Characterisation of the gill mucosal bacterial communities of four butterflyfish species: a reservoir of bacterial diversity in coral reef ecosystems.

PubMed

Reverter, Miriam; Sasal, Pierre; Tapissier-Bontemps, N; Lecchini, D; Suzuki, M

2017-06-01

While recent studies have suggested that fish mucus microbiota play an important role in homeostasis and prevention of infections, very few studies have investigated the bacterial communities of gill mucus. We characterised the gill mucus bacterial communities of four butterflyfish species and although the bacterial diversity of gill mucus varied significantly between species, Shannon diversities were high (H = 3.7-5.7) in all species. Microbiota composition differed between butterflyfishes, with Chaetodon lunulatus and C. ornatissimus having the most similar bacterial communities, which differed significantly from C. vagabundus and C. reticulatus. The core bacterial community of all species consisted of mainly Proteobacteria followed by Actinobacteria and Firmicutes. Chaetodonlunulatus and C. ornatissimus bacterial communities were mostly dominated by Gammaproteobacteria with Vibrio as the most abundant genus. Chaetodonvagabundus and C. reticulatus presented similar abundances of Gammaproteobacteria and Alphaproteobacteria, which were well represented by Acinetobacter and Paracoccus, respectively. In conclusion, our results indicate that different fish species present specific bacterial assemblages. Finally, as mucus layers are nutrient hotspots for heterotrophic bacteria living in oligotrophic environments, such as coral reef waters, the high bacterial diversity found in butterflyfish gill mucus might indicate external fish mucus surfaces act as a reservoir of coral reef bacterial diversity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar.

PubMed

Štornik, Aleksandra; Skok, Barbara; Trček, Janja

2016-03-01

Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different Hae III and five different Hpa II restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different Hae III and two different Hpa II restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica , Pichia membranifaciens and Saccharomycodes ludwigii . This study has shown for the first time that the bacterial microbiota for the industrial production of

Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

PubMed Central

Štornik, Aleksandra; Skok, Barbara

2016-01-01

Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial

Studies on Batch Production of Bacterial Concentrates from Mixed Species Lactic Starters

PubMed Central

Pettersson, H. E.

1975-01-01

Optimum growth conditions for mixed species starter FDs 0172 at constant pH in skim milk, whey, and tryptone medium were investigated. Growth rate and maximum population were optimal at 30 C. pH values between 5.5 and 7.0 did not influence the growth rate and maximum population obtainable. Lactic acid-producing activity declined rapidly after reaching the end of the exponential growth phase. The bacterial balance was found to be influenced by the growth parameters: media, pH, temperature, and neutralizer. Skim milk or whey medium at 25 C, pH 6.5, and neutralized with 20% (vol/vol) NH4OH kept the bacterial balance almost constant throughout the cultivation. Grown in tryptone medium at constant pH, the changes in bacterial balance and other metabolic activities were striking compared to the other two media tested. The effect of lactate as an inhibitor was found to be complex, changing with the growth conditions. Concentrates made from mixed species starters FDs 0172, FD 0570, CH 0170, CHs 0170, and T 27 were comparable to controls when cultivated at the optimum conditions found and thereafter centrifuged. Aroma production, proteolytic activity, and CO2 production did not change significantly compared to controls when cultivated at optimum conditions in skim milk or whey medium. PMID:16350009

D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.

PubMed

Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang

2015-04-01

Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.

D-lactic acid measurements in the diagnosis of bacterial infections.

PubMed Central

Smith, S M; Eng, R H; Campos, J M; Chmel, H

1989-01-01

Body fluids suspected of bacterial infection were cultured and examined for the presence of D-lactic acid, a specific bacterial metabolite. We examined 206 patients and 264 specimens. D-Lactic acid was found in concentrations of greater than or equal to 0.15 mM in 11 of 11 infected and 6 of 40 noninfected ascitic fluids, 6 of 6 infected and 4 of 33 noninfected pleural fluids, 4 of 4 infected and 0 of 13 noninfected synovial fluids, and 26 of 27 infected and 2 of 130 noninfected cerebrospinal fluids. The overall sensitivity was 79.7%, and the specificity was 99.5% when the D-lactic acid concentration was at least 0.15 mM. The most important clinical utility of the D-lactic acid measurement appears to be for patients with bacterial infection in various body compartments and in patients who have already received antimicrobial therapy. An elevation in D-lactic acid may indicate the presence of bacterial infection even when cultures are negative. PMID:2715313

Estimation of lactic acid bacterial cell number by DNA quantification.

PubMed

Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa

2018-01-01

Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.

Panamanian frog species host unique skin bacterial communities

PubMed Central

Belden, Lisa K.; Hughey, Myra C.; Rebollar, Eria A.; Umile, Thomas P.; Loftus, Stephen C.; Burzynski, Elizabeth A.; Minbiole, Kevin P. C.; House, Leanna L.; Jensen, Roderick V.; Becker, Matthew H.; Walke, Jenifer B.; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N.

2015-01-01

Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin.

PubMed

Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad

2016-08-01

Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3-7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Lactobacilli were recognized as the major group of lactic acid bacteria in Sayur Asin

Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

PubMed Central

McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

2016-01-01

ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

Distinctive bacterial communities in the rhizoplane of four tropical tree species.

PubMed

Oh, Yoon Myung; Kim, Mincheol; Lee-Cruz, Larisa; Lai-Hoe, Ang; Go, Rusea; Ainuddin, N; Rahim, Raha Abdul; Shukor, Noraini; Adams, Jonathan M

2012-11-01

It is known that the microbial community of the rhizosphere is not only influenced by factors such as root exudates, phenology, and nutrient uptake but also by the plant species. However, studies of bacterial communities associated with tropical rainforest tree root surfaces, or rhizoplane, are lacking. Here, we analyzed the bacterial community of root surfaces of four species of native trees, Agathis borneensis, Dipterocarpus kerrii, Dyera costulata, and Gnetum gnemon, and nearby bulk soils, in a rainforest arboretum in Malaysia, using 454 pyrosequencing of the 16S rRNA gene. The rhizoplane bacterial communities for each of the four tree species sampled clustered separately from one another on an ordination, suggesting that these assemblages are linked to chemical and biological characteristics of the host or possibly to the mycorrhizal fungi present. Bacterial communities of the rhizoplane had various similarities to surrounding bulk soils. Acidobacteria, Alphaproteobacteria, and Betaproteobacteria were dominant in rhizoplane communities and in bulk soils from the same depth (0-10 cm). In contrast, the relative abundance of certain bacterial lineages on the rhizoplane was different from that in bulk soils: Bacteroidetes and Betaproteobacteria, which are known as copiotrophs, were much more abundant in the rhizoplane in comparison to bulk soil. At the genus level, Burkholderia, Acidobacterium, Dyella, and Edaphobacter were more abundant in the rhizoplane. Burkholderia, which are known as both pathogens and mutualists of plants, were especially abundant on the rhizoplane of all tree species sampled. The Burkholderia species present included known mutualists of tropical crops and also known N fixers. The host-specific character of tropical tree rhizoplane bacterial communities may have implications for understanding nutrient cycling, recruitment, and structuring of tree species diversity in tropical forests. Such understanding may prove to be useful in both

Species differences in unlocking B-side electron transfer in bacterial reaction centers

DOE PAGES

Dylla, Nicholas P.; Faries, Kaitlyn M.; Wyllie, Ryan M.; ...

2016-06-21

The structure of the bacterial photosynthetic reaction center (RC) reveals symmetry-related electron transfer (ET) pathways, but only one path is used in native RCs. Analogous mutations have been made in two Rhodobacter (R.) species. A glutamic acid at position 133 in the M subunit increases transmembrane charge separation via the naturally inactive (B-side) path through impacts on primary ET in mutant R. sphaeroidesRCs. Prior work showed that the analogous substitution in the R. capsulatusRC also increases B-side activity, but mainly affects secondary ET. Finally, the overall yields of transmembrane ET are similar, but enabled in fundamentally different ways.

Species differences in unlocking B-side electron transfer in bacterial reaction centers

DOE Office of Scientific and Technical Information (OSTI.GOV)

Dylla, Nicholas P.; Faries, Kaitlyn M.; Wyllie, Ryan M.

The structure of the bacterial photosynthetic reaction center (RC) reveals symmetry-related electron transfer (ET) pathways, but only one path is used in native RCs. Analogous mutations have been made in two Rhodobacter (R.) species. A glutamic acid at position 133 in the M subunit increases transmembrane charge separation via the naturally inactive (B-side) path through impacts on primary ET in mutant R. sphaeroidesRCs. Prior work showed that the analogous substitution in the R. capsulatusRC also increases B-side activity, but mainly affects secondary ET. Finally, the overall yields of transmembrane ET are similar, but enabled in fundamentally different ways.

What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira

PubMed Central

Fouts, Derrick E.; Matthias, Michael A.; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E.; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L.; Haake, David A.; Haft, Daniel H.; Hartskeerl, Rudy; Ko, Albert I.; Levett, Paul N.; Matsunaga, James; Mechaly, Ariel E.; Monk, Jonathan M.; Nascimento, Ana L. T.; Nelson, Karen E.; Palsson, Bernhard; Peacock, Sharon J.; Picardeau, Mathieu; Ricaldi, Jessica N.; Thaipandungpanit, Janjira; Wunder, Elsio A.; Yang, X. Frank; Zhang, Jun-Jie; Vinetz, Joseph M.

2016-01-01

Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.

PubMed

Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M

2016-02-01

Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic

Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

PubMed

Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

2016-05-01

Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

Distribution of 10 periodontal bacterial species in children and adolescents over a 7-year period.

PubMed

Nakano, K; Miyamoto, E; Tamura, K; Nemoto, H; Fujita, K; Nomura, R; Ooshima, T

2008-10-01

There is scant information available regarding the distribution of periodontal bacterial species in children and adolescents over an extended period. The purpose of this study was to compare bacterial profiles in the same individuals over a period of 7 years. Twenty-six children and adolescents from whom dental plaque and saliva specimens were obtained during both the first (1999-2000) and second (2006-2007) periods, were analyzed. Bacterial DNA was extracted from each specimen and the presence of 10 periodontal bacterial species was determined using a PCR method, with a focus on the red complex species of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia. Subjects with red complex species in saliva specimens obtained during the second collection possessed a significantly higher number of total bacterial species than those without. The detection rate of the red complex species in the second collection period samples was significantly greater in subjects who had two or more species detected in samples taken during the first collection compared with the other subjects. Subjects possessing red complex species may be at possible risk for infection with a high number of periodontal bacterial species during adolescent and younger adult years.

Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin

PubMed Central

Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad

2016-01-01

Background and Objectives: Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Materials and Methods: Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3–7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Results: Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Conclusion: Lactobacilli were

Characterization of the spoilage potential of pure and mixed cultures of bacterial species isolated from tropical yellowfin tuna (Thunnus albacares).

PubMed

Silbande, A; Cornet, J; Cardinal, M; Chevalier, F; Rochefort, K; Smith-Ravin, J; Adenet, S; Leroi, F

2018-02-01

The spoilage potential of 28 bacterial strains isolated from spoiled raw yellowfin tuna was evaluated. Bacterial species were inoculated in irradiated tuna matrix. Chemical changes, bacterial growth and sensory quality were monitored during aerobic storage at 8°C. Pseudomonas spp., Enterobacter spp. and Escherichia hermanii had no spoiling effect. Brochothrix thermosphacta and Carnobacterium divergens/maltaromaticum developed moderate unpleasant odours. Hafnia paralvei and Serratia spp. released strong off-odours (pyrrolidine, sulphur/cabbage). No bacterial group (except H. paralvei) combined with Pseudomonas spp. deteriorated the sensory quality of tuna. When C. divergens/maltaromaticum was associated with H. paralvei or B. thermosphacta, the odour is close to the naturally contaminated tuna stored on the same conditions. The pH, total volatile basic nitrogen (TVBN) and trimethylamine (TMA) were not correlated with the spoilage. The bacterial species had a different impact on the sensory quality of the fish. The bacterial interactions lead to an enhancement or an inhibition of the spoilage potential and the bacterial growth. The specific spoilage organism (SSO) appears to be an association of lactic acid bacteria (LAB) with Enterobacteriaceae or B. thermosphacta. Pseudomonas, often dominant at the sensory rejection time, is not a good quality indicator. © 2017 The Society for Applied Microbiology.

In vitro bacterial cytotoxicity of CNTs: reactive oxygen species mediate cell damage edges over direct physical puncturing.

PubMed

Rajavel, Krishnamoorthy; Gomathi, Rajkumar; Manian, Sellamuthu; Rajendra Kumar, Ramasamy Thangavelu

2014-01-21

Understanding the bacterial cytotoxicity of CNTs is important for a wide variety of applications in the biomedical, environmental, and health sectors. A majority of the earlier reports attributed the bactericidal cytotoxicity of CNTs to bacterial cell membrane damage by direct physical puncturing. Our results reveal that bacterial cell death via bacterial cell membrane damage is induced by reactive oxygen species (ROS) produced from CNTs and is not due to direct physical puncturing by CNTs. To understand the actual mechanism of bacterial killing, we elucidated the bacterial cytotoxicity of SWCNTs and MWCNTs against Gram-negative human pathogenic bacterial species Escherichia coli, Shigella sonnei, Klebsiella pneumoniae, and Pseudomonas aeruginosa and its amelioration upon functionalizing the CNTs with antioxidant tannic acid (TA). Interestingly, the bacterial cells treated with CNTs exhibited severe cell damage under laboratory (ambient) and sunlight irradiation conditions. However, CNTs showed no cytotoxicity to the bacterial cells when incubated in the dark. The quantitative assessments carried out by us made it explicit that CNTs are effective generators of ROS such as (1)O2, O2(•-), and (•)OH in an aqueous medium under both ambient and sunlight-irradiated conditions. Both naked and TA-functionalized CNTs showed negligible ROS production in the dark. Furthermore, strong correlations were obtained between ROS produced by CNTs and the bacterial cell mortality (with the correlation coefficient varying between 0.7618 and 0.9891) for all four tested pathogens. The absence of bactericidal cytotoxicity in both naked and functionalized CNTs in the dark reveals that the presence of ROS is the major factor responsible for the bactericidal action compared to direct physical puncturing. This understanding of the bactericidal activity of the irradiated CNTs, mediated through the generation of ROS, could be interesting for novel applications such as regulated ROS delivery

New bacterial species associated with chronic periodontitis.

PubMed

Kumar, P S; Griffen, A L; Barton, J A; Paster, B J; Moeschberger, M L; Leys, E J

2003-05-01

Recent investigations of the human subgingival oral flora based on ribosomal 16S cloning and sequencing have shown many of the bacterial species present to be novel species or phylotypes. The purpose of the present investigation was to identify potential periodontal pathogens among these newly identified species and phylotypes. Species-specific ribosomal 16S primers for PCR amplification were developed for detection of new species. Associations with chronic periodontitis were observed for several new species or phylotypes, including uncultivated clones D084 and BH017 from the Deferribacteres phylum, AU126 from the Bacteroidetes phylum, Megasphaera clone BB166, clone X112 from the OP11 phylum, and clone I025 from the TM7 phylum, and the named species Eubacterium saphenum, Porphyromonas endodontalis, Prevotella denticola, and Cryptobacterium curtum. Species or phylotypes more prevalent in periodontal health included two uncultivated phylotypes, clone W090 from the Deferribacteres phylum and clone BU063 from the Bacteroidetes, and named species Atopobium rimae and Atopobium parvulum.

Bacterial-biota dynamics of eight bryophyte species from different ecosystems

PubMed Central

Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio

2014-01-01

Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subsequent phylogenetic analyses to investigate the bacterial community of eight bryophyte species collected from three distinct ecosystems from western Japan. Forty-two bacterial species belonging to γ-proteobacteria and Firmicutes with 71.4% and 28.6%, respectively, were identified among 90 DGGE gel band population. These DGGE-bands were assigned to 13 different genera with obvious predomination the genus Clostridium with 21.4% from the total bacterial community. These analyses provide new insights into bryophyte-associated bacteria and their relations to the ecosystems. PMID:25737654

Obeticholic acid reduces bacterial translocation and inhibits intestinal inflammation in cirrhotic rats.

PubMed

Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín

2016-05-01

In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Effect of organic acids production and bacterial community on the possible mechanism of phosphorus solubilization during composting with enriched phosphate-solubilizing bacteria inoculation.

PubMed

Wei, Yuquan; Zhao, Yue; Shi, Mingzi; Cao, Zhenyu; Lu, Qian; Yang, Tianxue; Fan, Yuying; Wei, Zimin

2018-01-01

Enriched phosphate-solubilizing bacteria (PSB) agent were acquired by domesticated cultivation, and inoculated into kitchen waste composting in different stages. The effect of different treatments on organic acids production, tricalcium phosphate (TCP) solubilization and their relationship with bacterial community were investigated during composting. Our results pointed out that inoculation affected pH, total acidity and the production of oxalic, lactic, citric, succinic, acetic and formic acids. We also found a strong advantage in the solubilization of TCP and phosphorus (P) availability for PSB inoculation especially in the cooling stage. Redundancy analysis and structural equation models demonstrated inoculation by different methods changed the correlation of the bacterial community composition with P fractions as well as organic acids, and strengthened the cooperative function related to P transformation among species during composting. Finally, we proposed a possible mechanism of P solubilization with enriched PSB inoculation, which was induced by bacterial community and organic acids production. Copyright © 2017 Elsevier Ltd. All rights reserved.

Plant-associated bacterial populations on native and invasive plant species: comparisons between 2 freshwater environments.

PubMed

Olapade, Ola A; Pung, Kayleigh

2012-06-01

Plant-microbial interactions have been well studied because of the ecological importance of such relationships in aquatic systems. However, general knowledge regarding the composition of these biofilm communities is still evolving, partly as a result of several confounding factors that are attributable to plant host properties and to hydrodynamic conditions in aquatic environments. In this study, the occurrences of various bacterial phylogenetic taxa on 2 native plants, i.e., mayapple (Podophyllum peltatum L.) and cow parsnip (Heracleum maximum Bartram), and on an invasive species, i.e., garlic mustard (Alliaria petiolata (M. Bieb.) Cavara & Grande), were quantitatively examined using nucleic acid staining and fluorescence in situ hybridization. The plants were incubated in triplicates for about a week within the Kalamazoo River and Pierce Cedar Creek as well as in microcosms. The bacterial groups targeted for enumeration are known to globally occur in relatively high abundance and are also ubiquitously distributed in freshwater environments. Fluorescence in situ hybridization analyses of the bacterioplankton assemblages revealed that the majority of bacterial cells that hybridized with the different probes were similar between the 2 sites. In contrast, the plant-associated populations while similar on the 3 plants incubated in Kalamazoo River, their representations were highest on the 2 native plants relative to the invasive species in Pierce Cedar Creek. Overall, our results further suggested that epiphytic bacterial assemblages are probably under the influences of and probably subsequently respond to multiple variables and conditions in aquatic milieus.

An uncooked vegan diet shifts the profile of human fecal microflora: computerized analysis of direct stool sample gas-liquid chromatography profiles of bacterial cellular fatty acids.

PubMed Central

Peltonen, R; Ling, W H; Hänninen, O; Eerola, E

1992-01-01

The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187

A new mathematical model of bacterial interactions in two-species oral biofilms

PubMed Central

Martin, Bénédicte; Tamanai-Shacoori, Zohreh; Bronsard, Julie; Ginguené, Franck; Meuric, Vincent

2017-01-01

Periodontitis are bacterial inflammatory diseases, where the bacterial biofilms present on the tooth-supporting tissues switch from a healthy state towards a pathogenic state. Among bacterial species involved in the disease, Porphyromonas gingivalis has been shown to induce dysbiosis, and to induce virulence of otherwise healthy bacteria like Streptococcus gordonii. During biofilm development, primary colonizers such as S. gordonii first attach to the surface and allow the subsequent adhesion of periodontal pathogens such as P. gingivalis. Interactions between those two bacteria have been extensively studied during the adhesion step of the biofilm. The aim of the study was to understand interactions of both species during the growing phase of the biofilm, for which little knowledge is available, using a mathematical model. This two-species biofilm model was based on a substrate-dependent growth, implemented with damage parameters, and validated thanks to data obtained on experimental biofilms. Three different hypothesis of interactions were proposed and assayed using this model: independence, competition between both bacteria species, or induction of toxicity by one species for the other species. Adequacy between experimental and simulated biofilms were found with the last hypothetic mathematical model. This new mathematical model of two species bacteria biofilms, dependent on different substrates for growing, can be applied to any bacteria species, environmental conditions, or steps of biofilm development. It will be of great interest for exploring bacterial interactions in biofilm conditions. PMID:28253369

Prevalent bacterial species and novel phylotypes in advanced noma lesions.

PubMed

Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E

2002-06-01

The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease.

Diversity of the dominant bacterial species on sliced cooked pork products at expiration date in the Belgian retail.

PubMed

Geeraerts, Wim; Pothakos, Vasileios; De Vuyst, Luc; Leroy, Frédéric

2017-08-01

Pork-based cooked products, such as cooked hams, are economically valuable foods that are vulnerable to bacterial spoilage, even when applying cooling and modified atmosphere packaging (MAP). Besides a common presence of Brochothrix thermosphacta, their microbiota are usually dominated by lactic acid bacteria (LAB). Yet, the exact LAB species diversity can differ considerably among products. In this study, 42 sliced cooked pork samples were acquired from three different Belgian supermarkets to map their bacterial heterogeneity. The community compositions of the dominant bacterial species were established by analysing a total of 702 isolates from selective agar media by (GTG) 5 -PCR fingerprinting followed by gene sequencing. Most of the isolates belonged to the genera Carnobacterium, Lactobacillus, and Leuconostoc, with Leuconostoc carnosum and Leuconostoc gelidum subsp. gelidum being the most dominant members. The diversity of the dominant bacterial species varied when comparing samples from different production facilities and, in some cases, even within the same product types. Although LAB consistently dominated the microbiota of sliced cooked pork products in the Belgian market, results indicated that bacterial diversity needs to be addressed on the level of product composition and batch variation. Dedicated studies will be needed to substantiate potential links between such variability and microbial composition. For instance, the fact that higher levels of lactobacilli were associated with the presence of potassium lactate (E326) may be suggestive of selective pressure but needs to be validated, as this finding referred to a single product only. Copyright © 2017 Elsevier Ltd. All rights reserved.

Glyphosate has limited short-term effects on commensal bacterial community composition in the gut environment due to sufficient aromatic amino acid levels.

PubMed

Nielsen, Lene Nørby; Roager, Henrik M; Casas, Mònica Escolà; Frandsen, Henrik L; Gosewinkel, Ulrich; Bester, Kai; Licht, Tine Rask; Hendriksen, Niels Bohse; Bahl, Martin Iain

2018-02-01

Recently, concerns have been raised that residues of glyphosate-based herbicides may interfere with the homeostasis of the intestinal bacterial community and thereby affect the health of humans or animals. The biochemical pathway for aromatic amino acid synthesis (Shikimate pathway), which is specifically inhibited by glyphosate, is shared by plants and numerous bacterial species. Several in vitro studies have shown that various groups of intestinal bacteria may be differently affected by glyphosate. Here, we present results from an animal exposure trial combining deep 16S rRNA gene sequencing of the bacterial community with liquid chromatography mass spectrometry (LC-MS) based metabolic profiling of aromatic amino acids and their downstream metabolites. We found that glyphosate as well as the commercial formulation Glyfonova ® 450 PLUS administered at up to fifty times the established European Acceptable Daily Intake (ADI = 0.5 mg/kg body weight) had very limited effects on bacterial community composition in Sprague Dawley rats during a two-week exposure trial. The effect of glyphosate on prototrophic bacterial growth was highly dependent on the availability of aromatic amino acids, suggesting that the observed limited effect on bacterial composition was due to the presence of sufficient amounts of aromatic amino acids in the intestinal environment. A strong correlation was observed between intestinal concentrations of glyphosate and intestinal pH, which may partly be explained by an observed reduction in acetic acid produced by the gut bacteria. We conclude that sufficient intestinal levels of aromatic amino acids provided by the diet alleviates the need for bacterial synthesis of aromatic amino acids and thus prevents an antimicrobial effect of glyphosate in vivo. It is however possible that the situation is different in cases of human malnutrition or in production animals. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Investigation of bacterial resistance to the immune system response: cepacian depolymerisation by reactive oxygen species.

PubMed

Cuzzi, Bruno; Cescutti, Paola; Furlanis, Linda; Lagatolla, Cristina; Sturiale, Luisa; Garozzo, Domenico; Rizzo, Roberto

2012-08-01

Reactive oxygen species (ROS) are part of the weapons used by the immune system to kill and degrade infecting microorganisms. Bacteria can produce macromolecules, such as polysaccharides, that are able to scavenge ROS. Species belonging to the Burkholderia cepacia complex are involved in serious lung infection in cystic fibrosis patients and produce a characteristic polysaccharide, cepacian. The interaction between ROS and bacterial polysaccharides was first investigated by killing experiments, where bacteria cells were incubated with sodium hypochlorite (NaClO) with and without prior incubation with cepacian. The results showed that the polysaccharide had a protective effect towards bacterial cells. Cepacian was then treated with different concentrations of NaClO and the course of reactions was followed by means of capillary viscometry. The degradation products were characterised by size-exclusion chromatography, NMR and mass spectrometry. The results showed that hypochlorite depolymerised cepacian, removed side chains and O-acetyl groups, but did not cleave the glycosidic bond between glucuronic acid and rhamnose. The structure of some oligomers produced by NaClO oxidation is reported.

The bacterial species definition in the genomic era

PubMed Central

Konstantinidis, Konstantinos T; Ramette, Alban; Tiedje, James M

2006-01-01

The bacterial species definition, despite its eminent practical significance for identification, diagnosis, quarantine and diversity surveys, remains a very difficult issue to advance. Genomics now offers novel insights into intra-species diversity and the potential for emergence of a more soundly based system. Although we share the excitement, we argue that it is premature for a universal change to the definition because current knowledge is based on too few phylogenetic groups and too few samples of natural populations. Our analysis of five important bacterial groups suggests, however, that more stringent standards for species may be justifiable when a solid understanding of gene content and ecological distinctiveness becomes available. Our analysis also reveals what is actually encompassed in a species according to the current standards, in terms of whole-genome sequence and gene-content diversity, and shows that this does not correspond to coherent clusters for the environmental Burkholderia and Shewanella genera examined. In contrast, the obligatory pathogens, which have a very restricted ecological niche, do exhibit clusters. Therefore, the idea of biologically meaningful clusters of diversity that applies to most eukaryotes may not be universally applicable in the microbial world, or if such clusters exist, they may be found at different levels of distinction. PMID:17062412

Predominant bacterial species in subgingival plaque in dogs.

PubMed

Dahlén, G; Charalampakis, G; Abrahamsson, I; Bengtsson, L; Falsen, E

2012-06-01

The dog has been used extensively for experimental and microbiological studies on periodontitis and peri-implantitis without detailed knowledge about the predominant flora of the subgingival plaque. This study was designed to evaluate the predominant cultivable bacterial species in dogs and compare them phenotypically and genotypically with corresponding human species. Four subgingival samples were taken from two upper premolars in each of six Labrador retrievers. The samples from each dog were processed for anaerobic culture. From the samples of each dog, the five or six predominating bacteria based on colony morphology were selected and pure cultured. Each of the strains was characterized by Gram stain, anaerobic/aerobic growth and API-ZYM test. Eighteen strains showing clear-cut phenotypic differences were further classified based on DNA sequencing technology. Cross-reactions of DNA probes from human and dog strains were also tested against a panel of both human and dog bacterial species. Thirty-one strains in the dogs were isolated and characterized. They represented 21 different species, of which six belonged to the genus Porphyromonas. No species was found consistently in the predominant flora of all six dogs. Porphyromonas crevioricanis and Fusobacterium canifelinum were the two most prevalent species in predominant flora in dogs. DNA probes from human and dog species cross-reacted to some extent with related strains from humans and dogs; however, distinct exceptions were found. The predominant cultural subgingival flora in dogs shows great similarities with the subgingival bacteria from humans at the genus level, but distinct differences at the species level; however, a genetic relatedness could be disclosed for most strains investigated. © 2011 John Wiley & Sons A/S.

Recombination-Driven Genome Evolution and Stability of Bacterial Species.

PubMed

Dixit, Purushottam D; Pang, Tin Yau; Maslov, Sergei

2017-09-01

While bacteria divide clonally, horizontal gene transfer followed by homologous recombination is now recognized as an important contributor to their evolution. However, the details of how the competition between clonality and recombination shapes genome diversity remains poorly understood. Using a computational model, we find two principal regimes in bacterial evolution and identify two composite parameters that dictate the evolutionary fate of bacterial species. In the divergent regime, characterized by either a low recombination frequency or strict barriers to recombination, cohesion due to recombination is not sufficient to overcome the mutational drift. As a consequence, the divergence between pairs of genomes in the population steadily increases in the course of their evolution. The species lacks genetic coherence with sexually isolated clonal subpopulations continuously formed and dissolved. In contrast, in the metastable regime, characterized by a high recombination frequency combined with low barriers to recombination, genomes continuously recombine with the rest of the population. The population remains genetically cohesive and temporally stable. Notably, the transition between these two regimes can be affected by relatively small changes in evolutionary parameters. Using the Multi Locus Sequence Typing (MLST) data, we classify a number of bacterial species to be either the divergent or the metastable type. Generalizations of our framework to include selection, ecologically structured populations, and horizontal gene transfer of nonhomologous regions are discussed as well. Copyright © 2017 by the Genetics Society of America.

Bacterial Communities of Diverse Drosophila Species: Ecological Context of a Host–Microbe Model System

PubMed Central

Bhatnagar, Srijak; Eisen, Jonathan A.; Kopp, Artyom

2011-01-01

Drosophila melanogaster is emerging as an important model of non-pathogenic host–microbe interactions. The genetic and experimental tractability of Drosophila has led to significant gains in our understanding of animal–microbial symbiosis. However, the full implications of these results cannot be appreciated without the knowledge of the microbial communities associated with natural Drosophila populations. In particular, it is not clear whether laboratory cultures can serve as an accurate model of host–microbe interactions that occur in the wild, or those that have occurred over evolutionary time. To fill this gap, we characterized natural bacterial communities associated with 14 species of Drosophila and related genera collected from distant geographic locations. To represent the ecological diversity of Drosophilids, examined species included fruit-, flower-, mushroom-, and cactus-feeders. In parallel, wild host populations were compared to laboratory strains, and controlled experiments were performed to assess the importance of host species and diet in shaping bacterial microbiome composition. We find that Drosophilid flies have taxonomically restricted bacterial communities, with 85% of the natural bacterial microbiome composed of only four bacterial families. The dominant bacterial taxa are widespread and found in many different host species despite the taxonomic, ecological, and geographic diversity of their hosts. Both natural surveys and laboratory experiments indicate that host diet plays a major role in shaping the Drosophila bacterial microbiome. Despite this, the internal bacterial microbiome represents only a highly reduced subset of the external bacterial communities, suggesting that the host exercises some level of control over the bacteria that inhabit its digestive tract. Finally, we show that laboratory strains provide only a limited model of natural host–microbe interactions. Bacterial taxa used in experimental studies are rare or absent in

The effects of micronutrient deficiencies on bacterial species from the human gut microbiota

PubMed Central

Hibberd, Matthew C.; Wu, Meng; Rodionov, Dmitry A.; Li, Xiaoqing; Cheng, Jiye; Griffin, Nicholas W.; Barratt, Michael J.; Giannone, Richard J.; Hettich, Robert L.; Osterman, Andrei L.; Gordon, Jeffrey I.

2017-01-01

Vitamin and mineral (micronutrient) deficiencies afflict two billion people. While the impact of these imbalances on host biology has been studied extensively, much less is known about their effects on the gut microbiota of developing or adult humans. Therefore, we established a community of cultured, sequenced human gut-derived bacterial species in gnotobiotic mice and fed the animals a defined micronutrient-sufficient diet, followed by a derivative diet devoid of vitamin A, folate, iron or zinc, followed by return to the sufficient diet. Acute vitamin A deficiency had the largest effect on bacterial community structure and meta-transcriptome, with Bacteroides vulgatus, a prominent responder, increasing its abundance in the absence of vitamin A. Applying retinol selection to a library of 30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Genetic complementation studies, microbial RNA-Seq, and transcription factor binding assays disclosed that AcrR is a repressor of an adjacent AcrAB-TolC efflux system. Retinol efflux measurements in wildtype and acrR-mutant strains plus treatment with a pharmacologic inhibitor of the efflux system, revealed that AcrAB-TolC is a determinant of retinol and bile acid sensitivity in B. vulgatus. Acute vitamin A deficiency was associated with altered bile acid metabolism in vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness of B. vulgatus and perhaps other microbiota members. This type of preclinical model can help to develop mechanistic insights about and more effective treatment strategies for micronutrient deficiencies. PMID:28515336

Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco

PubMed Central

Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Jürgen

2013-01-01

Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance. PMID:24025239

Association between Lactobacillus species and bacterial vaginosis-related bacteria, and bacterial vaginosis scores in pregnant Japanese women

PubMed Central

Tamrakar, Renuka; Yamada, Takashi; Furuta, Itsuko; Cho, Kazutoshi; Morikawa, Mamoru; Yamada, Hideto; Sakuragi, Noriaki; Minakami, Hisanori

2007-01-01

Background Bacterial vaginosis (BV), the etiology of which is still uncertain, increases the risk of preterm birth. Recent PCR-based studies suggested that BV is associated with complex vaginal bacterial communities, including many newly recognized bacterial species in non-pregnant women. Methods To examine whether these bacteria are also involved in BV in pregnant Japanese women, vaginal fluid samples were taken from 132 women, classified as normal (n = 98), intermediate (n = 21), or BV (n = 13) using the Nugent gram stain criteria, and studied. DNA extracted from these samples was analyzed for bacterial sequences of any Lactobacillus, four Lactobacillus species, and four BV-related bacteria by PCR with primers for 16S ribosomal DNA including a universal Lactobacillus primer, Lactobacillus species-specific primers for L. crispatus, L. jensenii, L. gasseri, and L. iners, and BV-related bacterium-specific primers for BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Results The prevalences of L. crispatus, L. jensenii, and L. gasseri were significantly higher, while those of BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium were significantly lower in the normal group than in the BV group. Unlike other Lactobacillus species, the prevalence of L. iners did not differ between the three groups and women with L. iners were significantly more likely to have BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Linear regression analysis revealed associations of BVAB2 and Megasphaera with Nugent score, and multivariate regression analyses suggested a close relationship between Eggerthella-like bacterium and BV. Conclusion The BV-related bacteria, including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, are common in the vagina of pregnant Japanese women with BV. The presence of L. iners may be correlated with vaginal colonization by these BV-related bacteria. PMID:17986357

Coral-associated bacterial diversity is conserved across two deep-sea Anthothela species

USGS Publications Warehouse

Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C; Clostio, Rachel W; Brooke, Sandra D.; Ross, Steve W.

2016-01-01

Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.

Plants of the fynbos biome harbour host species-specific bacterial communities.

PubMed

Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel

2016-08-01

The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Development of a Single Locus Sequence Typing (SLST) Scheme for Typing Bacterial Species Directly from Complex Communities.

PubMed

Scholz, Christian F P; Jensen, Anders

2017-01-01

The protocol describes a computational method to develop a Single Locus Sequence Typing (SLST) scheme for typing bacterial species. The resulting scheme can be used to type bacterial isolates as well as bacterial species directly from complex communities using next-generation sequencing technologies.

Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China.

PubMed

Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda

2016-01-01

The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments.

Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China

PubMed Central

Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda

2016-01-01

The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments. PMID:27695084

A quasi-universal medium to break the aerobic/anaerobic bacterial culture dichotomy in clinical microbiology.

PubMed

Dione, N; Khelaifia, S; La Scola, B; Lagier, J C; Raoult, D

2016-01-01

In the mid-19th century, the dichotomy between aerobic and anaerobic bacteria was introduced. Nevertheless, the aerobic growth of strictly anaerobic bacterial species such as Ruminococcus gnavus and Fusobacterium necrophorum, in a culture medium containing antioxidants, was recently demonstrated. We tested aerobically the culture of 623 bacterial strains from 276 bacterial species including 82 strictly anaerobic, 154 facultative anaerobic, 31 aerobic and nine microaerophilic bacterial species as well as ten fungi. The basic culture medium was based on Schaedler agar supplemented with 1 g/L ascorbic acid and 0.1 g/L glutathione (R-medium). We successively optimized this media, adding 0.4 g/L uric acid, using separate autoclaving of the component, or adding haemin 0.1 g/L or α-ketoglutarate 2 g/L. In the basic medium, 237 bacterial species and ten fungal species grew but with no growth of 36 bacterial species, including 22 strict anaerobes. Adding uric acid allowed the growth of 14 further species including eight strict anaerobes, while separate autoclaving allowed the growth of all tested bacterial strains. To extend its potential use for fastidious bacteria, we added haemin for Haemophilus influenzae, Haemophilus parainfluenzae and Eikenella corrodens and α-ketoglutarate for Legionella pneumophila. This medium allowed the growth of all tested strains with the exception of Mycobacterium tuberculosis and Mycobacterium bovis. Testing primoculture and more fastidious species will constitute the main work to be done, but R-medium coupled with a rapid identification method (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) will facilitate the anaerobic culture in clinical microbiology laboratories. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Amylolytic bacterial lactic acid fermentation - a review.

PubMed

Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay

2008-01-01

Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.

The effects of micronutrient deficiencies on bacterial species from the human gut microbiota.

PubMed

Hibberd, Matthew C; Wu, Meng; Rodionov, Dmitry A; Li, Xiaoqing; Cheng, Jiye; Griffin, Nicholas W; Barratt, Michael J; Giannone, Richard J; Hettich, Robert L; Osterman, Andrei L; Gordon, Jeffrey I

2017-05-17

Vitamin and mineral (micronutrient) deficiencies afflict 2 billion people. Although the impact of these imbalances on host biology has been studied extensively, much less is known about their effects on the gut microbiota of developing or adult humans. Therefore, we established a community of cultured, sequenced human gut-derived bacterial species in gnotobiotic mice and fed the animals a defined micronutrient-sufficient diet, followed by a derivative diet devoid of vitamin A, folate, iron, or zinc, followed by return to the sufficient diet. Acute vitamin A deficiency had the largest effect on bacterial community structure and metatranscriptome, with Bacteroides vulgatus, a prominent responder, increasing its abundance in the absence of vitamin A. Applying retinol selection to a library of 30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Genetic complementation studies, microbial RNA sequencing, and transcription factor-binding assays disclosed that AcrR is a repressor of an adjacent AcrAB-TolC efflux system. Retinol efflux measurements in wild-type and acrR -mutant strains plus treatment with a pharmacologic inhibitor of the efflux system revealed that AcrAB-TolC is a determinant of retinol and bile acid sensitivity in B. vulgatus Acute vitamin A deficiency was associated with altered bile acid metabolism in vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness of B. vulgatus and perhaps other microbiota members. This type of preclinical model can help to develop mechanistic insights about the effects of, and more effective treatment strategies for micronutrient deficiencies. Copyright © 2017, American Association for the Advancement of Science.

Diazotrophic potential among bacterial communities associated with wild and cultivated Agave species.

PubMed

Desgarennes, Damaris; Garrido, Etzel; Torres-Gomez, Miryam J; Peña-Cabriales, Juan J; Partida-Martinez, Laila P

2014-12-01

Agaves are major biotic resources in arid and semi-arid ecosystems. Despite their ecological, economical and cultural relevance, many aspects of the microbial communities associated with agaves are still unknown. Here, we investigated the bacterial communities associated with two Agave species by 16S rRNA- Denaturing gradient gel electrophoresis fingerprinting and sequencing. We also evaluated the effects of biotic and abiotic factors in the structure of the bacterial communities. In parallel, we isolated and characterized diazotrophic bacteria associated with agaves, as Agave soils are characterized by their low nitrogen content. Our results demonstrate that in Agave, the structure of prokaryotic assemblages was mostly influenced by the community group, where the soil, episphere, and endosphere were clearly distinct. Proteobacteria (γ and α), Actinobacteria, and Acidobacteria were the dominant phyla. Bacterial communities in the episphere of agaves were mainly influenced by the host species, whereas in the endosphere were affected by the season. Fifteen bacterial taxa were common and abundant in the endosphere of both Agave species during the dry season. Notably, some of the confirmed diazotrophic strains belonged to this group, suggesting a possible beneficial role in planta. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo.

PubMed

McDonald, Nathan D; Lubin, Jean-Bernard; Chowdhury, Nityananda; Boyd, E Fidelma

2016-04-12

A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota.Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. Sialic acids are nine carbon amino sugars that are abundant on all mucous surfaces. The deadly human pathogen Vibrio cholerae contains

Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species

PubMed Central

Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C.; Clostio, Rachel W.; Brooke, Sandra D.; Ross, Steve W.

2016-01-01

Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4–V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120

Bacterial endophyte communities of three agricultural important grass species differ in their response towards management regimes

NASA Astrophysics Data System (ADS)

Wemheuer, Franziska; Kaiser, Kristin; Karlovsky, Petr; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd

2017-01-01

Endophytic bacteria are critical for plant growth and health. However, compositional and functional responses of bacterial endophyte communities towards agricultural practices are still poorly understood. Hence, we analyzed the influence of fertilizer application and mowing frequency on bacterial endophytes in three agriculturally important grass species. For this purpose, we examined bacterial endophytic communities in aerial plant parts of Dactylis glomerata L., Festuca rubra L., and Lolium perenne L. by pyrotag sequencing of bacterial 16S rRNA genes over two consecutive years. Although management regimes influenced endophyte communities, observed responses were grass species-specific. This might be attributed to several bacteria specifically associated with a single grass species. We further predicted functional profiles from obtained 16S rRNA data. These profiles revealed that predicted abundances of genes involved in plant growth promotion or nitrogen metabolism differed between grass species and between management regimes. Moreover, structural and functional community patterns showed no correlation to each other indicating that plant species-specific selection of endophytes is driven by functional rather than phylogenetic traits. The unique combination of 16S rRNA data and functional profiles provided a holistic picture of compositional and functional responses of bacterial endophytes in agricultural relevant grass species towards management practices.

Waste Workers’ Exposure to Airborne Fungal and Bacterial Species in the Truck Cab and During Waste Collection

PubMed Central

Madsen, Anne Mette; Alwan, Taif; Ørberg, Anders; Uhrbrand, Katrine; Jørgensen, Marie Birk

2016-01-01

A large number of people work with garbage collection, and exposure to microorganisms is considered an occupational health problem. However, knowledge on microbial exposure at species level is limited. The aim of the study was to achieve knowledge on waste collectors’ exposure to airborne inhalable fungal and bacterial species during waste collection with focus on the transport of airborne microorganisms into the truck cab. Airborne microorganisms were collected with samplers mounted in the truck cab, on the workers’ clothes, and outdoors. Fungal and bacterial species were quantified and identified. The study showed that the workers were exposed to between 112 and 4.8×104 bacteria m−3 air and 326 and 4.6×104 fungi m−3 air. The personal exposures to bacteria and fungi were significantly higher than the concentrations measured in the truck cabs and in the outdoor references. On average, the fungal and bacterial concentrations in truck cabs were 111 and 7.7 times higher than outdoor reference measurements. In total, 23 fungal and 38 bacterial species were found and identified. Most fungal species belonged to the genus Penicillium and in total 11 Penicillium species were found. Identical fungal species were often found both in a personal sample and in the same person’s truck cab, but concentrations were on average 27 times higher in personal samples. Concentrations of fungal and bacterial species found only in the personal samples were lower than concentrations of species also found in truck cabs. Skin-related bacteria constituted a large fraction of bacterial isolates found in personal and truck cab samples. In total, six Staphylococcus species were found. In outdoor samples, no skin-related bacteria were found. On average, concentrations of bacterial species found both in the truck cab and personal samples were 77 times higher in personal samples than in truck cab samples. In conclusion, high concentrations of fungi were found in truck cabs, but the

Measurement of the incorporation rates of four amino acids into proteins for estimating bacterial production.

PubMed

Servais, P

1995-03-01

In aquatic ecosystems, [(3)H]thymidine incorporation into bacterial DNA and [(3)H]leucine incorporation into proteins are usually used to estimate bacterial production. The incorporation rates of four amino acids (leucine, tyrosine, lysine, alanine) into proteins of bacteria were measured in parallel on natural freshwater samples from the basin of the river Meuse (Belgium). Comparison of the incorporation into proteins and into the total macromolecular fraction showed that these different amino acids were incorporated at more than 90% into proteins. From incorporation measurements at four subsaturated concentrations (range, 2-77 nm), the maximum incorporation rates were determined. Strong correlations (r > 0.91 for all the calculated correlations) were found between the maximum incorporation rates of the different tested amino acids over a range of two orders of magnitude of bacterial activity. Bacterial production estimates were calculated using theoretical and experimental conversion factors. The productions calculated from the incorporation rates of the four amino acids were in good concordance, especially when the experimental conversion factors were used (slope range, 0.91-1.11, and r > 0.91). This study suggests that the incorporation of various amino acids into proteins can be used to estimate bacterial production.

Temporal changes in species interactions in simple aquatic bacterial communities

PubMed Central

2012-01-01

Background Organisms modify their environment and in doing so change the quantity and possibly the quality of available resources. Due to the two-way relationship between organisms and their resource environment, and the complexity it brings to biological communities, measuring species interactions reliably in any biological system is a challenging task. As the resource environment changes, the intensity and even the sign of interactions may vary in time. We used Serratia marcescens and Novosphingobium capsulatum bacteria to study how the interaction between resource environment and organisms influence the growth of the bacterial species during circa 200 generations. We used a sterile-filtering method to measure how changes in resource environment are reflected in growth rates of the two species. Results Changes in the resource environment caused complex time and species composition-dependent effects on bacterial growth performance. Variation in the quality of the growth medium indicated existence of temporally fluctuating within-species facilitation and inhibition, and between-species asymmetric facilitation. Conclusions The interactions between the community members could not be fully predicted based only on the knowledge of the growth performance of each member in isolation. Growth dynamics in sterile-filtered samples of the conditioned growth medium can reveal both biologically meaningful changes in resource availability and temporally changing facilitative resource-mediated interactions between study species. This is the first study we are aware of where the filter-sterilization – growth assay method is applied to study the effect of long-term changes in the environment on species interactions. PMID:22984961

RNA-oligonucleotide quantification technique (ROQT) for the enumeration of uncultivated bacterial species in subgingival biofilms

PubMed Central

Teles, F.R.F.; Teles, R.P.; Siegelin, Y.; Paster, B.; Haffajee, A.D.; Socransky, S.S.

2010-01-01

SUMMARY Approximately 35% of the species present in subgingival biofilms are as yet uncultivated, so their role in periodontal pathogenesis is unknown. The aim of the present study was to develop a high throughput method to quantify a wide range of cultivated and uncultivated taxa in subgingival biofilm samples associated with periodontal disease or health. Oligonucleotides targeting the 16S ribosomal DNA gene were designed, synthesized and labeled with digoxigenin. These probes were hybridized with the total nucleic acids of pure cultures or subgingival biofilm samples. Target species included cultivated taxa associated with periodontal health and disease, as well as uncultivated species, such as TM7 sp OT 346, Mitsuokella sp. OT 131 and Desulfobulbus sp. OT 041. Sensitivity and specificity of the probes were determined. A Universal probe was used to assess total bacterial load. Sequences complementary to the probes were used as standards for quantification. Chemiluminescent signals were visualized after film exposure or using a CCD camera. In a pilot clinical study, 266 subgingival plaque samples from eight periodontally healthy people and 11 patients with periodontitis were examined. Probes were specific and sensitivity reached 104 cells. Fusobacterium nucleatum ss polymorphum and Actinomyces gerencseriae were the most abundant cultivated taxa in clinical samples. Among uncultivated/unrecognized species, Mitsuokella sp. OT 131 and Prevotella sp. OT 306 were the most numerous. Porphyromonas gingivalis and Desulfobulbus sp. OT 041 were only detected in patients with periodontitis. Direct hybridization of total nucleic acids using oligonucleotide probes permitted the quantification of multiple cultivated and uncultivated taxa in mixed species biofilm samples. PMID:21375703

Bacterial, Archaeal, and Eukaryotic Diversity across Distinct Microhabitats in an Acid Mine Drainage

PubMed Central

Mesa, Victoria; Gallego, Jose L. R.; González-Gil, Ricardo; Lauga, Béatrice; Sánchez, Jesús; Méndez-García, Celia; Peláez, Ana I.

2017-01-01

Acid mine drainages are characterized by their low pH and the presence of dissolved toxic metallic species. Microorganisms survive in different microhabitats within the ecosystem, namely water, sediments, and biofilms. In this report, we surveyed the microbial diversity within all domains of life in the different microhabitats at Los Rueldos abandoned mercury underground mine (NW Spain), and predicted bacterial function based on community composition. Sediment samples contained higher proportions of soil bacteria (AD3, Acidobacteria), as well as Crenarchaeota and Methanomassiliicoccaceae archaea. Oxic and hypoxic biofilm samples were enriched in bacterial iron oxidizers from the genus Leptospirillum, order Acidithiobacillales, class Betaproteobacteria, and archaea from the class Thermoplasmata. Water samples were enriched in Cyanobacteria and Thermoplasmata archaea at a 3–98% of the sunlight influence, whilst Betaproteobacteria, Thermoplasmata archaea, and Micrarchaea dominated in acid water collected in total darkness. Stalactites hanging from the Fe-rich mine ceiling were dominated by the neutrophilic iron oxidizer Gallionella and other lineages that were absent in the rest of the microhabitats (e.g., Chlorobi, Chloroflexi). Eukaryotes were detected in biofilms and open-air water samples, and belonged mainly to clades SAR (Alveolata and Stramenopiles), and Opisthokonta (Fungi). Oxic and hypoxic biofilms displayed higher proportions of ciliates (Gonostomum, Oxytricha), whereas water samples were enriched in fungi (Paramicrosporidium and unknown microbial Helotiales). Predicted function through bacterial community composition suggested adaptive evolutive convergence of function in heterogeneous communities. Our study showcases a broad description of the microbial diversity across different microhabitats in the same environment and expands the knowledge on the diversity of microbial eukaryotes in AMD habitats. PMID:28955322

Acidic pH sensing in the bacterial cytoplasm is required for Salmonella virulence.

PubMed

Choi, Jeongjoon; Groisman, Eduardo A

2016-09-01

pH regulates gene expression, biochemical activities and cellular behaviors. A mildly acidic pH activates the master virulence regulatory system PhoP/PhoQ in the facultative intracellular pathogen Salmonella enterica serovar Typhimurium. The sensor PhoQ harbors an extracytoplasmic domain implicated in signal sensing, and a cytoplasmic domain controlling activation of the regulator PhoP. We now report that, surprisingly, a decrease in Salmonella's own cytoplasmic pH induces transcription of PhoP-activated genes even when the extracytoplasmic pH remains neutral. Amino acid substitutions in PhoQ's cytoplasmic domain hindered activation by acidic pH and attenuated virulence in mice, but did not abolish activation by low Mg(2+) or the antimicrobial peptide C18G. Conversely, removal of PhoQ's extracytoplasmic domains prevented the response to the latter PhoQ-activating signals but not to acidic pH. PhoP-dependent genes were minimally induced by acidic pH in the non-pathogenic species Salmonella bongori but were activated by low Mg(2+) and C18G as in pathogenic S. enterica. Our findings indicate that the sensor PhoQ enables S. enterica to respond to both host- and bacterial-derived signals that alter its cytoplasmic pH. © 2016 John Wiley & Sons Ltd.

Positive and negative associations between bacterial species in dental root canals.

PubMed

Gomes, B P; Drucker, D B; Lilley, J D

1994-01-01

Significant associations have been previously reported between certain pairs of bacterial species isolated from human dental root canals. The aim of this study was to examine microbiologically a more extensive series of cases, with particular reference to obligate anaerobes which accounted for 64% of total isolations. A total of 65 different species was isolated and individual root canals yielded a maximum of eleven bacterial species. Highly significant positive associations (p < 0.001) were found between Peptostreptococcus spp. and Prevotella spp., between Peptostreptococcus spp. and P. melaninogenica, between P. micros and Prevotella spp., P. micros and P. melaninogenica and between Prevotella spp. and Eubacterium spp., all with an ODDS ratio of > 9.0. In contrast, negative and highly significant associations (p < 0.01) were found only between the four species pairs: B. vulgatus/F. necrophorum, P. magnus/Bifidobacterium spp., B. gracilis/F. nucleatum and between B. gracilis/Fusobacterium spp.; all with an ODDS ratio of < 0.5. Some previously published associations were confirmed and some new associations were found, while some negative associations became apparent.

Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.

PubMed

Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won

2010-11-01

Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.

Validation of hierarchical cluster analysis for identification of bacterial species using 42 bacterial isolates

NASA Astrophysics Data System (ADS)

Ghebremedhin, Meron; Yesupriya, Shubha; Luka, Janos; Crane, Nicole J.

2015-03-01

Recent studies have demonstrated the potential advantages of the use of Raman spectroscopy in the biomedical field due to its rapidity and noninvasive nature. In this study, Raman spectroscopy is applied as a method for differentiating between bacteria isolates for Gram status and Genus species. We created models for identifying 28 bacterial isolates using spectra collected with a 785 nm laser excitation Raman spectroscopic system. In order to investigate the groupings of these samples, partial least squares discriminant analysis (PLSDA) and hierarchical cluster analysis (HCA) was implemented. In addition, cluster analyses of the isolates were performed using various data types consisting of, biochemical tests, gene sequence alignment, high resolution melt (HRM) analysis and antimicrobial susceptibility tests of minimum inhibitory concentration (MIC) and degree of antimicrobial resistance (SIR). In order to evaluate the ability of these models to correctly classify bacterial isolates using solely Raman spectroscopic data, a set of 14 validation samples were tested using the PLSDA models and consequently the HCA models. External cluster evaluation criteria of purity and Rand index were calculated at different taxonomic levels to compare the performance of clustering using Raman spectra as well as the other datasets. Results showed that Raman spectra performed comparably, and in some cases better than, the other data types with Rand index and purity values up to 0.933 and 0.947, respectively. This study clearly demonstrates that the discrimination of bacterial species using Raman spectroscopic data and hierarchical cluster analysis is possible and has the potential to be a powerful point-of-care tool in clinical settings.

Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.

PubMed

Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia

2011-06-01

The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves. Copyright © 2011 Elsevier Ltd. All rights reserved.

Engineering Escherichia coli for Biodiesel Production Utilizing a Bacterial Fatty Acid Methyltransferase▿†

PubMed Central

Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

2011-01-01

The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis. PMID:21926202

Host species shapes the co-occurrence patterns rather than diversity of stomach bacterial communities in pikas.

PubMed

Li, Huan; Li, Tongtong; Tu, Bo; Kou, Yongping; Li, Xiangzhen

2017-07-01

The mammalian stomach acts as an important barrier against ingested pathogens into the entire gastrointestinal tract, thereby playing a key role in host health. However, little is known regarding to the stomach microbial compositions in wild mammals and the factors that may influence the community compositions. Using high-throughput sequencing of the 16S rRNA gene, we characterized the stomach bacterial community compositions, diversity, and interactions in two common pika (Ochotona sp.) species in China, including Plateau pikas (Ochotona curzoniae) and Daurian pikas (Ochotona daurica) living in the Qinghai-Tibet Plateau and the Inner Mongolia Grassland, respectively. The bacterial communities can be divided into two distinct phylogenetic clusters. The most dominant bacteria in cluster I were unclassified bacteria. Cluster II was more diverse, predominantly consisting of Bacteroidetes, followed by unclassified bacteria, Firmicutes and Proteobacteria. Three dominant genera (Prevotella, Oscillospira, and Ruminococcus) in pika stomachs were significantly enriched in cluster II. In addition, seasons, host species, and sampling sites as well as body weight and sex had no significant impacts on the composition and diversity of pika stomach communities. Interestingly, Plateau pikas harbored a more complex bacterial network than Daurian pikas, and these two pika species showed different co-occurrence patterns. These results suggested that the pika stomach harbors a diverse but relatively stable and unique bacterial community, which is independent on host (host species, body weight, and sex) and measured environmental factors (sampling sites and seasons). Interestingly, host species shapes the microbial interactions rather than diversity of stomach bacterial communities in pikas, reflecting specific niche adaptation of stomach bacterial communities through species interactions.

Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

NASA Astrophysics Data System (ADS)

Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

2016-02-01

Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

Massive Infection of Seabird Ticks with Bacterial Species Related to Coxiella burnetii

PubMed Central

Dietrich, Muriel; Lebarbenchon, Camille; Jaeger, Audrey; Le Rouzic, Céline; Bastien, Matthieu; Lagadec, Erwan; McCoy, Karen D.; Pascalis, Hervé; Le Corre, Matthieu; Dellagi, Koussay; Tortosa, Pablo

2014-01-01

Seabird ticks are known reservoirs of bacterial pathogens of medical importance; however, ticks parasitizing tropical seabirds have received less attention than their counterparts from temperate and subpolar regions. Recently, Rickettsia africae was described to infect seabird ticks of the western Indian Ocean and New Caledonia, constituting the only available data on bacterial pathogens associated with tropical seabird tick species. Here, we combined a pyrosequencing-based approach with a classical molecular analysis targeting bacteria of potential medical importance in order to describe the bacterial community in two tropical seabird ticks, Amblyomma loculosum and Carios (Ornithodoros) capensis. We also investigated the patterns of prevalence and host specificity within the biogeographical context of the western Indian Ocean islands. The bacterial community of the two tick species was characterized by a strong dominance of Coxiella and Rickettsia. Our data support a strict Coxiella-host tick specificity, a pattern resembling the one found for Rickettsia spp. in the same two seabird tick species. Both the high prevalence and stringent host tick specificity suggest that these bacteria may be tick symbionts with probable vertical transmission. Detailed studies of the pathogenicity of these bacteria will now be required to determine whether horizontal transmission can occur and to clarify their status as potential human pathogens. More generally, our results show that the combination of next generation sequencing with targeted detection/genotyping approaches proves to be efficient in poorly investigated fields where research can be considered to be starting from scratch. PMID:24657860

Yeast and bacterial diversity along a transect in an acidic, As-Fe rich environment revealed by cultural approaches.

PubMed

Delavat, François; Lett, Marie-Claire; Lièvremont, Didier

2013-10-01

Acid mine drainages (AMDs) are often thought to harbour low biodiversity, yet little is known about the diversity distribution along the drainages. Using culture-dependent approaches, the microbial diversity from the Carnoulès AMD sediment was investigated for the first time along a transect showing progressive environmental stringency decrease. In total, 20 bacterial genera were detected, highlighting a higher bacterial diversity than previously thought. Moreover, this approach led to the discovery of 16 yeast species, demonstrating for the first time the presence of this important phylogenetic group in this AMD. All in all, the location of the microbes along the transect helps to better understand their distribution in a pollution gradient. Copyright © 2013 Elsevier B.V. All rights reserved.

The group B streptococcal sialic acid O-acetyltransferase is encoded by neuD, a conserved component of bacterial sialic acid biosynthetic gene clusters.

PubMed

Lewis, Amanda L; Hensler, Mary E; Varki, Ajit; Nizet, Victor

2006-04-21

Nearly two dozen microbial pathogens have surface polysaccharides or lipo-oligosaccharides that contain sialic acid (Sia), and several Sia-dependent virulence mechanisms are known to enhance bacterial survival or result in host tissue injury. Some pathogens are also known to O-acetylate their Sias, although the role of this modification in pathogenesis remains unclear. We report that neuD, a gene located within the Group B Streptococcus (GBS) Sia biosynthetic gene cluster, encodes a Sia O-acetyltransferase that is itself required for capsular polysaccharide (CPS) sialylation. Homology modeling and site-directed mutagenesis identified Lys-123 as a critical residue for Sia O-acetyltransferase activity. Moreover, a single nucleotide polymorphism in neuD can determine whether GBS displays a "high" or "low" Sia O-acetylation phenotype. Complementation analysis revealed that Escherichia coli K1 NeuD also functions as a Sia O-acetyltransferase in GBS. In fact, NeuD homologs are commonly found within Sia biosynthetic gene clusters. A bioinformatic approach identified 18 bacterial species with a Sia biosynthetic gene cluster that included neuD. Included in this list are the sialylated human pathogens Legionella pneumophila, Vibrio parahemeolyticus, Pseudomonas aeruginosa, and Campylobacter jejuni, as well as an additional 12 bacterial species never before analyzed for Sia expression. Phylogenetic analysis shows that NeuD homologs of sialylated pathogens share a common evolutionary lineage distinct from the poly-Sia O-acetyltransferase of E. coli K1. These studies define a molecular genetic approach for the selective elimination of GBS Sia O-acetylation without concurrent loss of sialylation, a key to further studies addressing the role(s) of this modification in bacterial virulence.

Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants

PubMed Central

Ding, Tao; Melcher, Ulrich

2016-01-01

Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant’s growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species. PMID:26974817

Influences of Plant Species, Season and Location on Leaf Endophytic Bacterial Communities of Non-Cultivated Plants.

PubMed

Ding, Tao; Melcher, Ulrich

2016-01-01

Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant's growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species.

Catecholamines and in vitro growth of pathogenic bacteria: enhancement of growth varies greatly among bacterial species

NASA Technical Reports Server (NTRS)

Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald

2003-01-01

The purpose of this study was to examine the effects of catecholamines on in vitro growth of a range of bacterial species, including anaerobes. Bacteria tested included: Porphyromonas gingivalis, Bacteriodes fragilis, Shigella boydii, Shigella sonnie, Enterobacter Sp, and Salmonella choleraesuis. The results of the current study indicated that supplementation of bacterial cultures in minimal medium with norepinephrine or epinephrine did not result in increased growth of bacteria. Positive controls involving treatment of Escherichia coli with catecholamines did result in increased growth of that bacterial species. The results of the present study extend previous observations that showed differential capability of catecholamines to enhance bacterial growth in vitro.

Bacterial communities associated with the pitcher fluids of three Nepenthes (Nepenthaceae) pitcher plant species growing in the wild.

PubMed

Chou, Lee Yiung; Clarke, Charles M; Dykes, Gary A

2014-10-01

Nepenthes pitcher plants produce modified jug-shaped leaves to attract, trap and digest insect prey. We used 16S rDNA cloning and sequencing to compare bacterial communities in pitcher fluids of each of three species, namely Nepenthes ampullaria, Nepenthes gracilis and Nepenthes mirabilis, growing in the wild. In contrast to previous greenhouse-based studies, we found that both opened and unopened pitchers harbored bacterial DNA. Pitchers of N. mirabilis had higher bacterial diversity as compared to other Nepenthes species. The composition of the bacterial communities could be different between pitcher types for N. mirabilis (ANOSIM: R = 0.340, p < 0.05). Other Nepenthes species had similar bacterial composition between pitcher types. SIMPER showed that more than 50 % of the bacterial taxa identified from the open pitchers of N. mirabilis were not found in other groups. Our study suggests that bacteria in N. mirabilis are divided into native and nonnative groups.

Spatial and species variations in bacterial communities associated with corals from the Red Sea as revealed by pyrosequencing.

PubMed

Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan

2012-10-01

Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals.

Spatial and Species Variations in Bacterial Communities Associated with Corals from the Red Sea as Revealed by Pyrosequencing

PubMed Central

Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz

2012-01-01

Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals. PMID:22865078

Cellulose-ethylenediaminetetraacetic acid conjugates protect mammalian cells from bacterial cells.

PubMed

Luo, Jie; Lv, Wei; Deng, Ying; Sun, Yuyu

2013-04-08

Cellulose-ethylenediaminetetraacetic acid (EDTA) conjugates were synthesized by the esterification of cellulose with ethylenediaminetetraacetic dianhydride (EDTAD). The new materials provided potent antimicrobial activities against Staphylococcus aureus (S. aureus, Gram-positive bacteria) and Pseudomonas aeruginosa (P. aeruginosa, Gram-negative bacteria), and inhibited the formation of bacterial biofilms. The biocompatibility of the new cellulose-EDTA conjugates was evaluated with mouse skin fibroblasts for up to 14 days. SEM observation and DNA content analysis suggested that the new materials sustained the viability of fibroblast cells. Moreover, in mouse skin fibroblast-bacteria co-culture systems, the new cellulose-EDTA conjugates prevented bacterial biofilm formation and protected the mammalian cells from the bacterial cells for at least one day.

Impact of grassland management regimes on bacterial endophyte diversity differs with grass species.

PubMed

Wemheuer, F; Wemheuer, B; Kretzschmar, D; Pfeiffer, B; Herzog, S; Daniel, R; Vidal, S

2016-04-01

Most plant species are colonized by endophytic bacteria. Despite their importance for plant health and growth, the response of these bacteria to grassland management regimes is still not understood. Hence, we investigated the bacterial community structure in three agricultural important grass species Dactylis glomerata L., Festuca rubra L. and Lolium perenne L. with regard to fertilizer application and different mowing frequencies. For this purpose, above-ground plant material was collected from the Grassland Management Experiment (GrassMan) in Germany in September 2010 and 2011. DNA was extracted from surface-sterilized plant tissue and subjected to 16S rRNA gene PCRs. Endophytic community structures were assessed by denaturing gradient gel electrophoresis (DGGE)-based analysis of obtained PCR products. DGGE fingerprints revealed that fertilizer application significantly altered the endophytic communities in L. perenne and F. rubra but not in D. glomerata. Although no direct effect of mowing was observed, mowing frequencies in combination with fertilizer application had a significant impact on endophyte bacterial community structures. However, this effect was not observed for all three grass species in both years. Therefore, our results showed that management regimes changed the bacterial endophyte communities, but this effect was plant-specific and varied over time. Endophytic bacteria play an important role in plant health and growth. However, studies addressing the influence of grassland management regimes on these bacteria in above-ground plant parts are still missing. In this study, we present first evidence that fertilizer application significantly impacted bacterial community structures in three agricultural important grass species, whereas mowing had only a minor effect. Moreover, this effect was plant-specific and thus not visible for all grass species in each year. Consequently, this study sheds new light into the complex interaction of microbes and

Bacterial species colonizing the vagina of healthy women are not associated with race.

PubMed

Beamer, May A; Austin, Michele N; Avolia, Hilary A; Meyn, Leslie A; Bunge, Katherine E; Hillier, Sharon L

2017-06-01

The vaginal microbiota of 36 white versus 25 black asymptomatic women were compared using both cultivation-dependent and -independent identification. Significant differences by race were found in colonization and density of bacterial species. However, exclusion of 12 women with bacterial vaginosis by Nugent criteria resulted in no significant differences by race. Copyright © 2017 Elsevier Ltd. All rights reserved.

Phylogenetic analysis of bacterial and archaeal species in symptomatic and asymptomatic endodontic infections.

PubMed

Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R

2007-01-01

Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.

A 2,4-dichlorophenoxyacetic acid degradation plasmid pM7012 discloses distribution of an unclassified megaplasmid group across bacterial species.

PubMed

Sakai, Yoriko; Ogawa, Naoto; Shimomura, Yumi; Fujii, Takeshi

2014-03-01

Analysis of the complete nucleotide sequence of plasmid pM7012 from 2,4-dichlorophenoxyacetic-acid (2,4-D)-degrading bacterium Burkholderia sp. M701 revealed that the plasmid had 582 142 bp, with 541 putative protein-coding sequences and 39 putative tRNA genes for the transport of the standard 20 aa. pM7012 contains sequences homologous to the regions involved in conjugal transfer and plasmid maintenance found in plasmids byi_2p from Burkholderia sp. YI23 and pBVIE01 from Burkholderia sp. G4. No relaxase gene was found in any of these plasmids, although genes for a type IV secretion system and type IV coupling proteins were identified. Plasmids with no relaxase gene have been classified as non-mobile plasmids. However, nucleotide sequences with a high level of similarity to the genes for plasmid transfer, plasmid maintenance, 2,4-D degradation and arsenic resistance contained on pM7012 were also detected in eight other megaplasmids (~600 or 900 kb) found in seven Burkholderia strains and a strain of Cupriavidus, which were isolated as 2,4-D-degrading bacteria in Japan and the United States. These results suggested that the 2,4-D degradation megaplasmids related to pM7012 are mobile and distributed across various bacterial species worldwide, and that the plasmid group could be distinguished from known mobile plasmid groups.

The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species

PubMed Central

McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.

2015-01-01

Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452

Effect of species, breed, and age on bacterial load in bovine and bubaline semen

PubMed Central

Sannat, Chandrahas; Nair, Ajit; Sahu, S. B.; Sahasrabudhe, S. A.; Kumar, Ashish; Gupta, Amit Kumar; Shende, R. K.

2015-01-01

Aim: The present study was conducted to investigate the effect of species, breed and age on bacterial load in fresh and frozen semen of Cattle and Buffalo bull. Materials and Methods: Present study covered 56 cow and 10 buffalo bulls stationed at Central Semen Station Anjora, Durg (Chhattisgarh). Impact of breeds on bacterial load in semen was assessed using six breeds of cattle viz. Sahiwal, Gir, Red Sindhi, Tharparkar, Jersey and Holstein Friesian (HF) cross. Cow bulls were categorized into four different groups based on their age (<4 years, 4-5 years, 5-6 years and > 6 years) to study variation among age groups. Bacterial load was measured in fresh and frozen semen samples from these bulls using the standard plate count (SPC) method and count was expressed as colony forming unit (CFU) per ml of semen. Results: Higher bacterial load was reported in fresh (2.36 × 104 ± 1943 CFU/ml) and frozen (1.00 × 10 ± 90 CFU/ml) semen of cow bulls as compared to buffalo bulls (1.95 × 104 ± 2882 and 7.75 × 102 ± 160 CFU/ml in fresh and frozen semen, respectively). Jersey bull showed significantly higher bacterial count (p < 0.05) both in fresh (4.07 × 104 ± 13927 CFU/ml) and frozen (1.92 × 103 ± 178 CFU/ml) semen followed by HF cross, Sahiwal, Gir, Red Sindhi and Tharparkar bull. Bulls aged < 4 years and more than 6 years yielded increased bacterial load in their semen. Although a minor variation was reported between species and among age groups, no significant differences were measured. Conclusion: Bacterial load in semen did not differ significantly between species and age groups; however significant variation was reported among different breeds. Bulls of Jersey breed showed significantly higher bacterial load in semen as compared to the crossbred and indigenous bull. PMID:27047115

Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

PubMed Central

Parsons, Joshua B.; Rock, Charles O.

2011-01-01

The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

Design and Evaluation of PCR Primers for Analysis of Bacterial Populations in Wine by Denaturing Gradient Gel Electrophoresis

PubMed Central

Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.

2003-01-01

Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643

Life history correlates of fecal bacterial species richness in a wild population of the blue tit Cyanistes caeruleus

PubMed Central

Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R

2015-01-01

Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts. PMID:25750710

Cuticles of European and American lobsters harbor diverse bacterial species and differ in disease susceptibility

PubMed Central

Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F

2014-01-01

Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. ‘homaria’ (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. PMID:24817518

Cost-effective production of bacterial cellulose using acidic food industry by-products.

PubMed

Revin, Victor; Liyaskina, Elena; Nazarkina, Maria; Bogatyreva, Alena; Shchankin, Mikhail

2018-03-13

To reduce the cost of obtaining bacterial cellulose, acidic by-products of the alcohol and dairy industries were used without any pretreatment or addition of other nitrogen sources. Studies have shown that the greatest accumulation of bacterial cellulose (6.19g/L) occurs on wheat thin stillage for 3 days of cultivation under dynamic conditions, which is almost 3 times higher than on standard Hestrin and Schramm medium (2.14g/L). The use of whey as a nutrient medium makes it possible to obtain 5.45g/L bacterial cellulose under similar conditions of cultivation. It is established that the pH of the medium during the growth of Gluconacetobacter sucrofermentans B-11267 depends on the feedstock used and its initial value. By culturing the bacterium on thin stillage and whey, there is a decrease in the acidity of the waste. It is shown that the infrared spectra of bacterial cellulose obtained in a variety of environments have a similar character, but we found differences in the micromorphology and crystallinity of the resulting biopolymer. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

PubMed Central

Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

2012-01-01

Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

A duplex PCR-based assay for measuring the amount of bacterial contamination in a nucleic acid extract from a culture of free-living protists.

PubMed

Marron, Alan O; Akam, Michael; Walker, Giselle

2013-01-01

Cultures of heterotrophic protists often require co-culturing with bacteria to act as a source of nutrition. Such cultures will contain varying levels of intrinsic bacterial contamination that can interfere with molecular research and cause problems with the collection of sufficient material for sequencing. Measuring the levels of bacterial contamination for the purposes of molecular biology research is non-trivial, and can be complicated by the presence of a diverse bacterial flora, or by differences in the relative nucleic acid yield per bacterial or eukaryotic cell. Here we describe a duplex PCR-based assay that can be used to measure the levels of contamination from marine bacteria in a culture of loricate choanoflagellates. By comparison to a standard culture of known target sequence content, the assay can be used to quantify the relative proportions of bacterial and choanoflagellate material in DNA or RNA samples extracted from a culture. We apply the assay to compare methods of purifying choanoflagellate cultures prior to DNA extraction, to determine their effectiveness in reducing bacterial contamination. Together with measurements of the total nucleic acid concentration, the assay can then be used as the basis for determining the absolute amounts of choanoflagellate DNA or RNA present in a sample. The assay protocol we describe here is a simple and relatively inexpensive method of measuring contamination levels in nucleic acid samples. This provides a new way to establish quantification and purification protocols for molecular biology and genomics in novel heterotrophic protist species. Guidelines are provided to develop a similar protocol for use with any protistan culture. This assay method is recommended where qPCR equipment is unavailable, where qPCR is not viable because of the nature of the bacterial contamination or starting material, or where prior sequence information is insufficient to develop qPCR protocols.

Fatty Acid Compositions of Six Wild Edible Mushroom Species

PubMed Central

Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent

2013-01-01

The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377

RT-PCR-DGGE Analysis to Elucidate the Dominant Bacterial Species of Industrial Spanish-Style Green Table Olive Fermentations.

PubMed

Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N

2016-01-01

This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues.

Identification of different bacterial species in biofilms using confocal Raman microscopy

NASA Astrophysics Data System (ADS)

Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.

2010-11-01

Confocal Raman microspectroscopy is used to discriminate between different species of bacteria grown in biofilms. Tests are performed using two bacterial species, Streptococcus sanguinis and Streptococcus mutans, which are major components of oral plaque and of particular interest due to their association with healthy and cariogenic plaque, respectively. Dehydrated biofilms of these species are studied as a simplified model of dental plaque. A prediction model based on principal component analysis and logistic regression is calibrated using pure biofilms of each species and validated on pure biofilms grown months later, achieving 96% accuracy in prospective classification. When biofilms of the two species are partially mixed together, Raman-based identifications are achieved within ~2 μm of the boundaries between species with 97% accuracy. This combination of spatial resolution and predication accuracy should be suitable for forming images of species distributions within intact two-species biofilms.

Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

NASA Astrophysics Data System (ADS)

Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

2012-07-01

Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

The Microbiota of Freshwater Fish and Freshwater Niches Contain Omega-3 Fatty Acid-Producing Shewanella Species.

PubMed

Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B

2016-01-01

Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

Detection of Bacillus and Stenotrophomonas species growing in an organic acid and endocrine-disrupting chemical-rich environment of distillery spent wash and its phytotoxicity.

PubMed

Chandra, Ram; Kumar, Vineet

2017-01-01

Sugarcane molasses-based distillery spent wash (DSW) is well known for its toxicity and complex mixture of various recalcitrant organic pollutants with acidic pH, but the chemical nature of these pollutants is unknown. This study revealed the presence of toxic organic acids (butanedioic acid bis(TMS)ester; 2-hydroxysocaproic acid; benzenepropanoic acid, α-[(TMS)oxy], TMS ester; vanillylpropionic acid, bis(TMS)), and other recalcitrant organic pollutants (2-furancarboxylic acid, 5-[[(TMS)oxy] methyl], TMS ester; benzoic acid 3-methoxy-4-[(TMS)oxy], TMS ester; and tricarballylic acid 3TMS), which are listed as endocrine-disrupting chemicals. In addition, several major heavy metals were detected, including Fe (163.947), Mn (4.556), Zn (2.487), and Ni (1.175 mg l -1 ). Bacterial community analysis by restriction fragment length polymorphism revealed that Bacillus and Stenotrophomonas were dominant autochthonous bacterial communities belonging to the phylum Firmicutes and γ-Proteobacteria, respectively. The presence of Bacillus and Stenotrophomonas species in highly acidic environments indicated its broad range adaptation. These findings indicated that these autochthonous bacterial communities were pioneer taxa for in situ remediation of this hazardous waste during ecological succession. Further, phytotoxicity assay of DSW with Phaseolus mungo L. and Triticum aestivum revealed that T. aestivum was more sensitive than P. mungo L. in the seed germination test. The results of this study may be useful for monitoring and toxicity assessment of sugarcane molasses-based distillery waste at disposal sites.

Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe

PubMed Central

Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad

2017-01-01

Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633

Diversity and Phylogenetic Analyses of Bacterial Symbionts in Three Whitefly Species from Southeast Europe.

PubMed

Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Pleic, Ivana Lepen; Ghanim, Murad

2017-10-20

Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.

Cuticles of European and American lobsters harbor diverse bacterial species and differ in disease susceptibility.

PubMed

Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F

2014-06-01

Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. 'homaria' (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.

Improved fatty acid analysis of conjugated linoleic acid rich egg yolk triacylglycerols and phospholipid species.

PubMed

Shinn, Sara; Liyanage, Rohana; Lay, Jack; Proctor, Andrew

2014-07-16

Reports from chicken conjugated linoleic acid (CLA) feeding trials are limited to yolk total fatty acid composition, which consistently described increased saturated fatty acids and decreased monounsaturated fatty acids. However, information on CLA triacylglycerol (TAG) and phospholipid (PL) species is limited. This study determined the fatty acid composition of total lipids in CLA-rich egg yolk produced with CLA-rich soy oil, relative to control yolks using gas chromatography with flame ionization detection (GC-FID), determined TAG and PL fatty acid compositions by thin-layer chromatography-GC-FID (TLC-GC-FID), identified intact PL and TAG species by TLC-matrix-assisted laser desorption/ionization mass spectrometry (TLC-MALDI-MS), and determined the composition of TAG and PL species in CLA and control yolks by direct flow infusion electrospray ionization MS (DFI ESI-MS). In total, 2 lyso-phosphatidyl choline (LPC) species, 1 sphingomyelin species, 17 phosphatidyl choline species, 19 TAG species, and 9 phosphatidyl ethanolamine species were identified. Fifty percent of CLA was found in TAG, occurring predominantly in C52:5 and C52:4 TAG species. CLA-rich yolks contained significantly more LPC than did control eggs. Comprehensive lipid profiling may provide insight on relationships between lipid composition and the functional properties of CLA-rich eggs.

Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin

PubMed Central

Satapathy, N.; Purser, D. B.

1967-01-01

Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756

Effectiveness of acidic oxidative potential water in preventing bacterial infection in islet transplantation.

PubMed

Miyamoto, M; Inoue, K; Gu, Y; Hoki, M; Haji, S; Ohyanagi, H

1999-01-01

At a number of points in the current procedures of islet isolation and islet culture after the harvesting of donor pancreata, microorganisms could potentially infect the islet preparation. Furthermore, the use of islets from multiple donors can compound the risks of contamination of individual recipients. Acidic oxidative potential water (also termed electrolyzed strong acid solution, function water, or acqua oxidation water), which was developed in Japan, is a strong acid formed on the anode in the electrolysis of water containing a small amount of sodium chloride. It has these physical properties: pH, from 2.3 to 2.7; oxidative-reduction potential, from 1,000 to 1,100 mV; dissolved chlorine, from 30 to 40 ppm; and dissolved oxygen, from 10 to 30 ppm. Because of these properties, acidic oxidative potential water has strong bactericidal effects on all bacteria including methicillin-resistant Staphylococcus aureus (MRSA), viruses including HIV, HBV, HCV, CMV, and fungi as a result of the action of the active oxygen and active chlorine that it contains. We conducted this study to evaluate the effect of acidic oxidative potential water irrigation on bacterial contamination on the harvesting of porcine pancreata from slaughterhouses for islet xenotransplantation by counting the number of pancreatic surface bacteria using the Dip-slide method, and on the results of islet culture; and to evaluate the direct effect on isolated islets when it is used to prevent bacterial contamination by the static incubation test and by morphological examination. Direct irrigation of the pancreas by acidic oxidative potential water was found to be very effective in preventing bacterial contamination, but direct irrigation of isolated islets slightly decreased their viability and function.

Root and Rhizosphere Bacterial Phosphatase Activity Varies with Tree Species and Soil Phosphorus Availability in Puerto Rico Tropical Forest

PubMed Central

Cabugao, Kristine G.; Timm, Collin M.; Carrell, Alyssa A.; Childs, Joanne; Lu, Tse-Yuan S.; Pelletier, Dale A.; Weston, David J.; Norby, Richard J.

2017-01-01

Tropical forests generally occur on highly weathered soils that, in combination with the immobility of phosphorus (P), often result in soils lacking orthophosphate, the form of P most easily metabolized by plants and microbes. In these soils, mineralization of organic P can be the major source for orthophosphate. Both plants and microbes encode for phosphatases capable of mineralizing a range of organic P compounds. However, the activity of these enzymes depends on several edaphic factors including P availability, tree species, and microbial communities. Thus, phosphatase activity in both roots and the root microbial community constitute an important role in P mineralization and P nutrient dynamics that are not well studied in tropical forests. To relate phosphatase activity of roots and bacteria in tropical forests, we measured phosphatase activity in roots and bacterial isolates as well as bacterial community composition from the rhizosphere. Three forests in the Luquillo Mountains of Puerto Rico were selected to represent a range of soil P availability as measured using the resin P method. Within each site, a minimum of three tree species were chosen to sample. Root and bacterial phosphatase activity were both measured using a colorimetric assay with para-nitrophenyl phosphate as a substrate for the phosphomonoesterase enzyme. Both root and bacterial phosphatase were chiefly influenced by tree species. Though tree species was the only significant factor in root phosphatase activity, there was a negative trend between soil P availability and phosphatase activity in linear regressions of average root phosphatase and resin P. Permutational multivariate analysis of variance of bacterial community composition based on 16S amplicon sequencing indicated that bacterial composition was strongly controlled by soil P availability (p-value < 0.05). These results indicate that although root and bacterial phosphatase activity were influenced by tree species; bacterial

Root and Rhizosphere Bacterial Phosphatase Activity Varies with Tree Species and Soil Phosphorus Availability in Puerto Rico Tropical Forest.

PubMed

Cabugao, Kristine G; Timm, Collin M; Carrell, Alyssa A; Childs, Joanne; Lu, Tse-Yuan S; Pelletier, Dale A; Weston, David J; Norby, Richard J

2017-01-01

Tropical forests generally occur on highly weathered soils that, in combination with the immobility of phosphorus (P), often result in soils lacking orthophosphate, the form of P most easily metabolized by plants and microbes. In these soils, mineralization of organic P can be the major source for orthophosphate. Both plants and microbes encode for phosphatases capable of mineralizing a range of organic P compounds. However, the activity of these enzymes depends on several edaphic factors including P availability, tree species, and microbial communities. Thus, phosphatase activity in both roots and the root microbial community constitute an important role in P mineralization and P nutrient dynamics that are not well studied in tropical forests. To relate phosphatase activity of roots and bacteria in tropical forests, we measured phosphatase activity in roots and bacterial isolates as well as bacterial community composition from the rhizosphere. Three forests in the Luquillo Mountains of Puerto Rico were selected to represent a range of soil P availability as measured using the resin P method. Within each site, a minimum of three tree species were chosen to sample. Root and bacterial phosphatase activity were both measured using a colorimetric assay with para-nitrophenyl phosphate as a substrate for the phosphomonoesterase enzyme. Both root and bacterial phosphatase were chiefly influenced by tree species. Though tree species was the only significant factor in root phosphatase activity, there was a negative trend between soil P availability and phosphatase activity in linear regressions of average root phosphatase and resin P. Permutational multivariate analysis of variance of bacterial community composition based on 16S amplicon sequencing indicated that bacterial composition was strongly controlled by soil P availability ( p -value < 0.05). These results indicate that although root and bacterial phosphatase activity were influenced by tree species; bacterial

Phenotypic and genotypic characterization of lactic acid bacteria isolated from raw goat milk and effect of farming practices on the dominant species of lactic acid bacteria.

PubMed

Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C

2015-10-01

Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci). Copyright © 2015 Elsevier B.V. All rights reserved.

Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily

PubMed Central

Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.

2005-01-01

Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019

Pathogenic Leptospira species express surface-exposed proteins belonging to the bacterial immunoglobulin superfamily.

PubMed

Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I

2003-08-01

Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis.

Species Specific Bacterial Spore Detection Using Lateral-Flow Immunoassay with DPA-Triggered Tb Luminescence

NASA Technical Reports Server (NTRS)

Ponce, Adrian

2003-01-01

A method of detecting bacterial spores incorporates (1) A method of lateral-flow immunoassay in combination with (2) A method based on the luminescence of Tb3+ ions to which molecules of dipicolinic acid (DPA) released from the spores have become bound. The present combination of lateral-flow immunoassay and DPA-triggered Tb luminescence was developed as a superior alternative to a prior lateral-flow immunoassay method in which detection involves the visual observation and/or measurement of red light scattered from colloidal gold nanoparticles. The advantage of the present combination method is that it affords both (1) High selectivity for spores of the species of bacteria that one seeks to detect (a characteristic of lateral-flow immunoassay in general) and (2) Detection sensitivity much greater (by virtue of the use of DPA-triggered Tb luminescence instead of gold nanoparticles) than that of the prior lateral-flow immunoassay method

Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew

Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less

Comparative fatty acid composition of four Sargassum species (Fucales, Phaeophyta)

NASA Astrophysics Data System (ADS)

Wu, Xiang-Chun; Lu, Bao-Ren; Tseng, C. K.

1995-12-01

Fatty acid composition of four Sargassum species from Qingdao and Shidao, Shandong Province was investigated. 16:0 (palmitic acid) was the major saturated fatty acid. C18 and C20 were the main polyunsaturated fatty acids (PUFAs). Arachidonic acid and eicosapentaenoic acid predominated among polyenoic acids in all the algal species examined, except for Sargassum sp. which had low concentration of eicosapentaenoic acid.

An Acidic PATHOGENESIS-RELATED1 Gene of Oryza grandiglumis is Involved in Disease Resistance Response Against Bacterial Infection

PubMed Central

Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo

2014-01-01

Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005

Intra- and inter-species interactions within biofilms of important foodborne bacterial pathogens

PubMed Central

Giaouris, Efstathios; Heir, Even; Desvaux, Mickaël; Hébraud, Michel; Møretrø, Trond; Langsrud, Solveig; Doulgeraki, Agapi; Nychas, George-John; Kačániová, Miroslava; Czaczyk, Katarzyna; Ölmez, Hülya; Simões, Manuel

2015-01-01

A community-based sessile life style is the normal mode of growth and survival for many bacterial species. Under such conditions, cell-to-cell interactions are inevitable and ultimately lead to the establishment of dense, complex and highly structured biofilm populations encapsulated in a self-produced extracellular matrix and capable of coordinated and collective behavior. Remarkably, in food processing environments, a variety of different bacteria may attach to surfaces, survive, grow, and form biofilms. Salmonella enterica, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus are important bacterial pathogens commonly implicated in outbreaks of foodborne diseases, while all are known to be able to create biofilms on both abiotic and biotic surfaces. Particularly challenging is the attempt to understand the complexity of inter-bacterial interactions that can be encountered in such unwanted consortia, such as competitive and cooperative ones, together with their impact on the final outcome of these communities (e.g., maturation, physiology, antimicrobial resistance, virulence, dispersal). In this review, up-to-date data on both the intra- and inter-species interactions encountered in biofilms of these pathogens are presented. A better understanding of these interactions, both at molecular and biophysical levels, could lead to novel intervention strategies for controlling pathogenic biofilm formation in food processing environments and thus improve food safety. PMID:26347727

Use of Gifu Anaerobic Medium for culturing 32 dominant species of human gut microbes and its evaluation based on short-chain fatty acids fermentation profiles.

PubMed

Gotoh, Aina; Nara, Misaki; Sugiyama, Yuta; Sakanaka, Mikiyasu; Yachi, Hiroyuki; Kitakata, Aya; Nakagawa, Akira; Minami, Hiromichi; Okuda, Shujiro; Katoh, Toshihiko; Katayama, Takane; Kurihara, Shin

2017-10-01

Recently, a "human gut microbial gene catalogue," which ranks the dominance of microbe genus/species in human fecal samples, was published. Most of the bacteria ranked in the catalog are currently publicly available; however, the growth media recommended by the distributors vary among species, hampering physiological comparisons among the bacteria. To address this problem, we evaluated Gifu anaerobic medium (GAM) as a standard medium. Forty-four publicly available species of the top 56 species listed in the "human gut microbial gene catalogue" were cultured in GAM, and out of these, 32 (72%) were successfully cultured. Short-chain fatty acids from the bacterial culture supernatants were then quantified, and bacterial metabolic pathways were predicted based on in silico genomic sequence analysis. Our system provides a useful platform for assessing growth properties and analyzing metabolites of dominant human gut bacteria grown in GAM and supplemented with compounds of interest.

Bacterial and fungal endophthalmitis in upper Egypt: related species and risk factors.

PubMed

Gharamah, A A; Moharram, A M; Ismail, M A; Al-Hussaini, A K

2012-08-01

To study risk factors, contributing factors of bacterial and fungal endophthalmitis in Upper Egypt, test the isolated species sensitive to some therapeutic agents, and to investigate the air-borne bacteria and fungi in opthalmology operating rooms. Thirty one cases of endophthalmitis were clinically diagnosed and microbiologically studied. Indoor air-borne bacteria and fungi inside four air-conditioned operating rooms in the Ophthalmology Department at Assiut University Hospitals were also investigated. The isolated microbes from endophthalmitis cases were tested for their ability to produce some extracellular enzymes including protease, lipase, urease, phosphatase and catalase. Also the ability of 5 fungal isolates from endophthalmitis origin to produce mycotoxins and their sensitivity to some therapeutic agents were studied. Results showed that bacteria and fungi were responsihle for infection in 10 and 6 cases of endophthalmitis, respectively and only 2 cases produced a mixture of bacteria and fungi. Trauma was the most prevalent risk factor of endophthalmitis where 58.1% of the 31 cases were due to trauma. In ophthalmology operating rooms, different bacterial and fungal species were isolated. 8 bacterial and 5 fungal isolates showed their ability to produce enzymes while only 3 fungal isolates were able to produce mycotoxins. Terbinafine showed the highest effect against most isolates in vitro. The ability of bacterial and fungal isolates to produce extracellular enzymes and mycotoxins may be aid in the invasion and destruction of eye tissues. Microbial contamination of operating rooms with air-borne bacteria and fungi in the present work may be a source of postoperative endophthalmitis.

Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography.

PubMed

Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

2016-01-01

The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

Novel Perspectives on the Characterization of Species-Dependent Optical Signatures of Bacterial Colonies by Digital Holography

PubMed Central

Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina

2016-01-01

The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach

Dissolution and degradation of crude oil droplets by different bacterial species and consortia by microcosm microfluidics

NASA Astrophysics Data System (ADS)

Jalali, Maryam; Sheng, Jian

2017-11-01

Bacteria are involved in cleanup and degradation of crude oil in polluted marine and soil environments. A number of bacterial species have been identified for consuming petroleum hydrocarbons with diverse metabolic capabilities. We conducted laboratory experiments to investigate bacterial consumption by monitoring the volume change to oil droplets as well as effects of oil droplet size on this process. To conduct our study, we developed a micro-bioassay containing an enclosed chamber with bottom substrate printed with stationary oil microdroplets and a digital holographic interferometer (DHI). The morphology of microdroplets was monitored in real time over 100 hours and instantaneous flow field was also measured by digital holographic microscope. The substrates with printed oil droplets were further evaluated with atomic force microscopy (AFM) at the end of each experiment. Three different bacteria species, Pseudomonas sp, Alcanivorax borkumensis, and Marinobacter hydrocarbonoclasticus, as well as six bacterial consortia were used in this study. The results show that droplets smaller than 20µm in diameter are not subject to bacterial degradation and the volume of droplet did not change beyond dissolution. Substantial species-specific behaviors have been observed in isolates. The experiments of consortia and various flow shears on biodegradation and dissolution are ongoing and will be reported.

Usefulness of Fatty Acid Composition for Differentiation of Legionella Species

PubMed Central

Diogo, Alexandra; Veríssimo, António; Nobre, M. Fernanda; da Costa, Milton S.

1999-01-01

Numerical analysis of fatty acid methyl ester (FAME) profiles of 199 isolates and 76 reference strains, belonging to all validly described species of the genus Legionella that can be cultured in laboratory media, was used to differentiate between the species of this genus. With the exception of the strains that autofluoresced red, it was possible to differentiate all the other Legionella species. The strains of the species L. bozemanii, L. dumoffii, L. feeleii, L. gormanii, L. maceachernii, L. micdadei, and L. quinlivanii did not form single clusters, showing some degree of variability in the fatty acid compositions. The strains of the blue-white autofluorescent species had very similar fatty acid compositions and were difficult to distinguish from each other. Nine isolates had fatty acid profiles unlike those of any of the validly described species and may represent different FAME groups of known species or undescribed Legionella species. The method used in this study was useful for screening and discriminating large number of isolates of Legionella species. Moreover, the results obtained can be included in a database of fatty acid profiles, leading to a more accurate automatic identification of Legionella isolates. PMID:10364593

Extremophiles in Mineral Sulphide Heaps: Some Bacterial Responses to Variable Temperature, Acidity and Solution Composition

PubMed Central

Watling, Helen R.; Shiers, Denis W.; Collinson, David M.

2015-01-01

In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity. PMID:27682094

Assessing the viability of bacterial species in drinking water by combined cellular and molecular analyses.

PubMed

Kahlisch, Leila; Henne, Karsten; Gröbe, Lothar; Brettar, Ingrid; Höfle, Manfred G

2012-02-01

The question which bacterial species are present in water and if they are viable is essential for drinking water safety but also of general relevance in aquatic ecology. To approach this question we combined propidium iodide/SYTO9 staining ("live/dead staining" indicating membrane integrity), fluorescence-activated cell sorting (FACS) and community fingerprinting for the analysis of a set of tap water samples. Live/dead staining revealed that about half of the bacteria in the tap water had intact membranes. Molecular analysis using 16S rRNA and 16S rRNA gene-based single-strand conformation polymorphism (SSCP) fingerprints and sequencing of drinking water bacteria before and after FACS sorting revealed: (1) the DNA- and RNA-based overall community structure differed substantially, (2) the community retrieved from RNA and DNA reflected different bacterial species, classified as 53 phylotypes (with only two common phylotypes), (3) the percentage of phylotypes with intact membranes or damaged cells were comparable for RNA- and DNA-based analyses, and (4) the retrieved species were primarily of aquatic origin. The pronounced difference between phylotypes obtained from DNA extracts (dominated by Betaproteobacteria, Bacteroidetes, and Actinobacteria) and from RNA extracts (dominated by Alpha-, Beta-, Gammaproteobacteria, Bacteroidetes, and Cyanobacteria) demonstrate the relevance of concomitant RNA and DNA analyses for drinking water studies. Unexpected was that a comparable fraction (about 21%) of phylotypes with membrane-injured cells was observed for DNA- and RNA-based analyses, contradicting the current understanding that RNA-based analyses represent the actively growing fraction of the bacterial community. Overall, we think that this combined approach provides an interesting tool for a concomitant phylogenetic and viability analysis of bacterial species of drinking water.

Biodiversity of Bacterial Ecosystems in Traditional Egyptian Domiati Cheese▿

PubMed Central

El-Baradei, Gaber; Delacroix-Buchet, Agnès; Ogier, Jean-Claude

2007-01-01

Bacterial biodiversity occurring in traditional Egyptian soft Domiati cheese was studied by PCR-temporal temperature gel electrophoresis (TTGE) and PCR-denaturing gradient gel electrophoresis (DGGE). Bands were identified using a reference species database (J.-C. Ogier et al., Appl. Environ. Microbiol. 70:5628-5643, 2004); de novo bands having nonidentified migration patterns were identified by DNA sequencing. Results reveal a novel bacterial profile and extensive bacterial biodiversity in Domiati cheeses, as reflected by the numerous bands present in TTGE and DGGE patterns. The dominant lactic acid bacteria (LAB) identified were as follows: Leuconostoc mesenteroides, Lactococcus garvieae, Aerococcus viridans, Lactobacillus versmoldensis, Pediococcus inopinatus, and Lactococcus lactis. Frequent non-LAB species included numerous coagulase-negative staphylococci, Vibrio spp., Kocuria rhizophila, Kocuria kristinae, Kocuria halotolerans, Arthrobacter spp./Brachybacterium tyrofermentans. This is the first time that the majority of these species has been identified in Domiati cheese. Nearly all the dominant and frequent bacterial species are salt tolerant, and several correspond to known marine bacteria. As Domiati cheese contains 5.4 to 9.5% NaCl, we suggest that these bacteria are likely to have an important role in the ripening process. This first systematic study of the microbial composition of Domiati cheeses reveals great biodiversity and evokes a role for marine bacteria in determining cheese type. PMID:17189434

Biodiversity of bacterial ecosystems in traditional Egyptian Domiati cheese.

PubMed

El-Baradei, Gaber; Delacroix-Buchet, Agnès; Ogier, Jean-Claude

2007-02-01

Bacterial biodiversity occurring in traditional Egyptian soft Domiati cheese was studied by PCR-temporal temperature gel electrophoresis (TTGE) and PCR-denaturing gradient gel electrophoresis (DGGE). Bands were identified using a reference species database (J.-C. Ogier et al., Appl. Environ. Microbiol. 70:5628-5643, 2004); de novo bands having nonidentified migration patterns were identified by DNA sequencing. Results reveal a novel bacterial profile and extensive bacterial biodiversity in Domiati cheeses, as reflected by the numerous bands present in TTGE and DGGE patterns. The dominant lactic acid bacteria (LAB) identified were as follows: Leuconostoc mesenteroides, Lactococcus garvieae, Aerococcus viridans, Lactobacillus versmoldensis, Pediococcus inopinatus, and Lactococcus lactis. Frequent non-LAB species included numerous coagulase-negative staphylococci, Vibrio spp., Kocuria rhizophila, Kocuria kristinae, Kocuria halotolerans, Arthrobacter spp./Brachybacterium tyrofermentans. This is the first time that the majority of these species has been identified in Domiati cheese. Nearly all the dominant and frequent bacterial species are salt tolerant, and several correspond to known marine bacteria. As Domiati cheese contains 5.4 to 9.5% NaCl, we suggest that these bacteria are likely to have an important role in the ripening process. This first systematic study of the microbial composition of Domiati cheeses reveals great biodiversity and evokes a role for marine bacteria in determining cheese type.

Production and characterization of bacterial cellulose membranes with hyaluronic acid from chicken comb.

PubMed

de Oliveira, Sabrina Alves; da Silva, Bruno Campos; Riegel-Vidotti, Izabel Cristina; Urbano, Alexandre; de Sousa Faria-Tischer, Paula Cristina; Tischer, Cesar Augusto

2017-04-01

The bacterial cellulose (BC), from Gluconacetobacter hansenii, is a biofilm with a high degree of crystallinity that can be used for therapeutic purposes and as a candidate for healing wounds. Hyaluronic acid (HA) is a constitutive polysaccharide found in the extracellular matrix and is a material used in tissue engineering and scaffolding for tissue regeneration. In this study, polymeric composites were produced in presence of hyaluronic acid isolated from chicken comb on different days of fermentation, specifically on the first (BCHA-SABT0) and third day (BCHA-SABT3) of fermentation. The structural characteristics, thermal stability and molar mass of hyaluronic acid from chicken comb were evaluated. Native membrane and polymeric composites were characterized with respect to their morphology and crystallinity. The optimized process of extraction and purification of hyaluronic acid resulted in low molar mass hyaluronic acid with structural characteristics similar to the standard commercial hyaluronic acid. The results demonstrate that the polymeric composites (BC/HA-SAB) can be produced in situ. The membranes produced on the third day presented better incorporation of HA-SAB between cellulose microfiber, resulting in membranes with higher thermal stability, higher roughness and lower crystallinity. The biocompatiblily of bacterial cellulose and the importance of hyaluronic acid as a component of extracellular matrix qualify the polymeric composites as promising biomaterials for tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.

Host species and developmental stage, but not host social structure, affects bacterial community structure in socially polymorphic bees.

PubMed

McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G

2014-05-01

Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Effect of simulated acid rain on fluorine mobility and the bacterial community of phosphogypsum.

PubMed

Wang, Mei; Tang, Ya; Anderson, Christopher W N; Jeyakumar, Paramsothy; Yang, Jinyan

2018-06-01

Contamination of soil and water with fluorine (F) leached from phosphogypsum (PG) stacks is a global environmental issue. Millions of tons of PG is produced each year as a by-product of fertilizer manufacture, and in China, weathering is exacerbated by acid rain. In this work, column leaching experiments using simulated acid rain were run to evaluate the mobility of F and the impact of weathering on native bacterial community composition in PG. After a simulated summer rainfall, 2.42-3.05 wt% of the total F content of PG was leached and the F concentration in leachate was above the quality standard for surface water and groundwater in China. Acid rain had no significant effect on the movement of F in PG. A higher concentration of F was observed at the bottom than the top section of PG columns suggesting mobility and reprecipitation of F. Throughout the simulation, the PG was environmentally safe according the TCLP testing. The dominant bacteria in PG were from the Enterococcus and Bacillus genus. Bacterial community composition in PG leached by simulated acid rain (pH 3.03) was more abundant than at pH 6.88. Information on F mobility and bacterial community in PG under conditions of simulated rain is relevant to management of environmental risk in stockpiled PG waste.

In vaginal fluid, bacteria associated with bacterial vaginosis can be suppressed with lactic acid but not hydrogen peroxide

PubMed Central

2011-01-01

Background Hydrogen peroxide (H2O2) produced by vaginal lactobacilli is generally believed to protect against bacteria associated with bacterial vaginosis (BV), and strains of lactobacilli that can produce H2O2 are being developed as vaginal probiotics. However, evidence that led to this belief was based in part on non-physiological conditions, antioxidant-free aerobic conditions selected to maximize both production and microbicidal activity of H2O2. Here we used conditions more like those in vivo to compare the effects of physiologically plausible concentrations of H2O2 and lactic acid on a broad range of BV-associated bacteria and vaginal lactobacilli. Methods Anaerobic cultures of seventeen species of BV-associated bacteria and four species of vaginal lactobacilli were exposed to H2O2, lactic acid, or acetic acid at pH 7.0 and pH 4.5. After two hours, the remaining viable bacteria were enumerated by growth on agar media plates. The effect of vaginal fluid (VF) on the microbicidal activities of H2O2 and lactic acid was also measured. Results Physiological concentrations of H2O2 (< 100 μM) failed to inactivate any of the BV-associated bacteria tested, even in the presence of human myeloperoxidase (MPO) that increases the microbicidal activity of H2O2. At 10 mM, H2O2 inactivated all four species of vaginal lactobacilli but only one of seventeen species of BV-associated bacteria. Moreover, the addition of just 1% vaginal fluid (VF) blocked the microbicidal activity of 1 M H2O2. In contrast, lactic acid at physiological concentrations (55-111 mM) and pH (4.5) inactivated all the BV-associated bacteria tested, and had no detectable effect on the vaginal lactobacilli. Also, the addition of 10% VF did not block the microbicidal activity of lactic acid. Conclusions Under optimal, anaerobic growth conditions, physiological concentrations of lactic acid inactivated BV-associated bacteria without affecting vaginal lactobacilli, whereas physiological concentrations of H2O2

Microplastics as a vector for the transport of the bacterial fish pathogen species Aeromonas salmonicida.

PubMed

Viršek, Manca Kovač; Lovšin, Marija Nika; Koren, Špela; Kržan, Andrej; Peterlin, Monika

2017-12-15

Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.

Use of antibody to membrane adenosine triphosphatase in the study of bacterial relatioships.

PubMed

Whiteside, T L; De Siervo, A J; Salton, M R

1971-03-01

An antiserum to Ca(2+)-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy.

Diverse bacterial PKS sequences derived from okadaic acid-producing dinoflagellates.

PubMed

Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S

2008-05-22

Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum.

Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates

PubMed Central

Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.

2008-01-01

Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765

Bacterial diversity of bacteriomes and organs of reproductive, digestive and excretory systems in two cicada species (Hemiptera: Cicadidae)

PubMed Central

Zheng, Zhou; Wang, Dandan; He, Hong

2017-01-01

Cicadas form intimate symbioses with bacteria to obtain nutrients that are scarce in the xylem fluid they feed on. The obligate symbionts in cicadas are purportedly confined to specialized bacteriomes, but knowledge of bacterial communities associated with cicadas is limited. Bacterial communities in the bacteriomes and organs of reproductive, digestive and excretory systems of two cicada species (Platypleura kaempferi and Meimuna mongolica) were investigated using different methods, and the bacterial diversity and distribution patterns of dominant bacteria in different tissues were compared. Within each species, the bacterial communities of testes are significantly different from those of bacteriomes and ovaries. The dominant endosymbiont Candidatus Sulcia muelleri is found not only in the bacteriomes and reproductive organs, but also in the “filter chamber + conical segment” of both species. The transmission mode of this endosymbiont in the alimentary canal and its effect on physiological processes merits further study. A novel bacterium of Rhizobiales, showing ~80% similarity to Candidatus Hodgkinia cicadicola, is dominant in the bacteriomes and ovaries of P. kaempferi. Given that the genome of H. cicadicola exhibits rapid sequence evolution, it is possible that this novel bacterium is a related endosymbiont with beneficial trophic functions similar to that of H. cicadicola in some other cicadas. Failure to detect H. cicadicola in M. mongolica suggests that it has been subsequently replaced by another bacterium, a yeast or gut microbiota which compensates for the loss of H. cicadicola. The distribution of this novel Rhizobiales species in other cicadas and its identification require further investigation to help establish the definition of the bacterial genus Candidatus Hodgkinia and to provide more information on sequence divergence of related endosymbionts of cicadas. Our results highlight the complex bacterial communities of cicadas, and are informative

Bacterial diversity of bacteriomes and organs of reproductive, digestive and excretory systems in two cicada species (Hemiptera: Cicadidae).

PubMed

Zheng, Zhou; Wang, Dandan; He, Hong; Wei, Cong

2017-01-01

Cicadas form intimate symbioses with bacteria to obtain nutrients that are scarce in the xylem fluid they feed on. The obligate symbionts in cicadas are purportedly confined to specialized bacteriomes, but knowledge of bacterial communities associated with cicadas is limited. Bacterial communities in the bacteriomes and organs of reproductive, digestive and excretory systems of two cicada species (Platypleura kaempferi and Meimuna mongolica) were investigated using different methods, and the bacterial diversity and distribution patterns of dominant bacteria in different tissues were compared. Within each species, the bacterial communities of testes are significantly different from those of bacteriomes and ovaries. The dominant endosymbiont Candidatus Sulcia muelleri is found not only in the bacteriomes and reproductive organs, but also in the "filter chamber + conical segment" of both species. The transmission mode of this endosymbiont in the alimentary canal and its effect on physiological processes merits further study. A novel bacterium of Rhizobiales, showing ~80% similarity to Candidatus Hodgkinia cicadicola, is dominant in the bacteriomes and ovaries of P. kaempferi. Given that the genome of H. cicadicola exhibits rapid sequence evolution, it is possible that this novel bacterium is a related endosymbiont with beneficial trophic functions similar to that of H. cicadicola in some other cicadas. Failure to detect H. cicadicola in M. mongolica suggests that it has been subsequently replaced by another bacterium, a yeast or gut microbiota which compensates for the loss of H. cicadicola. The distribution of this novel Rhizobiales species in other cicadas and its identification require further investigation to help establish the definition of the bacterial genus Candidatus Hodgkinia and to provide more information on sequence divergence of related endosymbionts of cicadas. Our results highlight the complex bacterial communities of cicadas, and are informative for

Quantitative thermodynamic predication of interactions between nucleic acid and non-nucleic acid species using Microsoft excel.

PubMed

Zou, Jiaqi; Li, Na

2013-09-01

Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

Comparative Inter-Species Pharmacokinetics of Phenoxyacetic Acid Herbicides and Related Organic Acids. Evidence that the Dog is Not a Relevant Species for Evaluation of Human Health Risk.

DOE Office of Scientific and Technical Information (OSTI.GOV)

Timchalk, Chuck

Phenoxyacetic acids including 2,4-dichlorophenoxyacetic acid (2,4-D) and 4-chloro-2-methylphenoxyacetic acid (MCPA) are widely utilized organic acid herbicides that have undergone extensive toxicity and pharmacokinetic analyses. The dog is particularly susceptible to the toxicity of phenoxyacetic acids and related organic acids relative to other species. Active renal clearance mechanisms for organic acids are ubiquitous in mammalian species, and thus a likely mechanism responsible for the increased sensitivity of the dog to these agents is linked to a lower capacity to secrete organic acids from the kidney. Using published data describing the pharmacokinetics of phenoxyacetic and structurally related organic acids in a varietymore » of species including humans, inter-species comparative pharmacokinetics were evaluated using allometic parameter scaling. For both 2,4-D and MCPA the dog plasma half-life (t1/2) and renal clearance (Clr; ml hr-1) rates did not scale as a function of body weight across species; whereas for all other species evaluated, including humans, these pharmacokinetic parameters reasonably scaled. This exceptional response in the dog is clearly illustrated by comparing the plasma t1/2 at comparable doses of 2,4-D and MCPA, across several species. At a dosage of 5 mg/kg, in dogs the plasma t1/2 for 2,4-D and MCPA were {approx}92 - 106 hr and 63 hr, respectively, which is substantially longer than in the rat ({approx}1 and 6 hr, respectively) or in humans (12 and 11 hr, respectively). This longer t1/2, and slower elimination in the dog, results in substantially higher body burdens of these organic acids, at comparable doses, relative to other species. Although these results indicate the important role of renal transport clearance mechanisms as determinants of the clearance and potential toxicity outcomes of phenoxyacetic acid herbicides across several species, other contributing mechanisms such as reabsorption from the renal tubules is highly

Combinations of bacterial species associated with symptomatic endodontic infections in a Chinese population.

PubMed

Qi, Z; Cao, H; Jiang, H; Zhao, J; Tang, Z

2016-01-01

To use microarrays to detect 11 selected bacteria in infected root canals, revealing bacterial combinations that are associated with clinical symptoms and signs of primary endodontic infections in a Chinese population. DNA was extracted from 90 samples collected from the root canals of teeth with primary endodontic infections in a Chinese population, and the 16S rRNA gene was amplified by polymerase chain reaction (PCR). The PCR products were hybridized to microarrays containing specific oligonucleotide probes targeting 11 species, and the arrays were screened with a confocal laser scanner. Pearson's chi-squared test and cluster analysis were performed to investigate the associations between the bacterial combinations and clinical symptoms and signs using SAS 8.02. Seventy-seven samples (86%) yielded at least one of the 11 target species. Parvimonas micra (56%), Porphyromonas endodontalis (51%), Tannerella forsythia (48%), Prevotella intermedia (44%) and Porphyromonas gingivalis (37%) were the most prevalent taxa and were often concomitant. The following positive associations were found between the bacterial combinations and clinical features: P. endodontalis and T. forsythia with abscess; P. gingivalis and P. micra with sinus tract; P. gingivalis and P. endodontalis or P. micra and P. endodontalis with abscess and sinus tract; and the combination of P. endodontalis, P. micra, T. forsythia and P. gingivalis with sinus tract (P < 0.05). Various combinations of P. micra, P. endodontalis, T. forsythia and P. gingivalis may contribute to abscesses or sinus tracts of endodontic origin with bacterial synergism in a Chinese population. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.

Phytoplankton-Associated Bacterial Community Composition and Succession during Toxic Diatom Bloom and Non-Bloom Events

PubMed Central

Sison-Mangus, Marilou P.; Jiang, Sunny; Kudela, Raphael M.; Mehic, Sanjin

2016-01-01

Pseudo-nitzschia blooms often occur in coastal and open ocean environments, sometimes leading to the production of the neurotoxin domoic acid that can cause severe negative impacts to higher trophic levels. Increasing evidence suggests a close relationship between phytoplankton bloom and bacterial assemblages, however, the microbial composition and succession during a bloom process is unknown. Here, we investigate the bacterial assemblages before, during and after toxic and non-toxic Pseudo-nitzschia blooms to determine the patterns of bacterial succession in a natural bloom setting. Opportunistic sampling of bacterial community profiles were determined weekly at Santa Cruz Municipal Wharf by 454 pyrosequencing and analyzed together with domoic acid levels, phytoplankton community and biomass, nutrients and temperature. We asked if the bacterial communities are similar between bloom and non-bloom events and if domoic acid or the presence of toxic algal species acts as a driving force that can significantly structure phytoplankton-associated bacterial communities. We found that bacterial diversity generally increases when Pseudo-nitzschia numbers decline. Furthermore, bacterial diversity is higher when the low-DA producing P. fraudulenta dominates the algal bloom while bacterial diversity is lower when high-DA producing P. australis dominates the algal bloom, suggesting that the presence of algal toxin can structure bacterial community. We also found bloom-related succession patterns among associated bacterial groups; Gamma-proteobacteria, were dominant during low toxic P. fraudulenta blooms comprising mostly of Vibrio spp., which increased in relative abundance (6–65%) as the bloom progresses. On the other hand, Firmicutes bacteria comprising mostly of Planococcus spp. (12–86%) dominate during high toxic P. australis blooms, with the bacterial assemblage showing the same bloom-related successional patterns in three independent bloom events. Other environmental

Periodic Colony Formation by Bacterial Species Bacillus subtilis

NASA Astrophysics Data System (ADS)

Wakita, Jun-ichi; Shimada, Hirotoshi; Itoh, Hiroto; Matsuyama, Tohey; Matsushita, Mitsugu

2001-03-01

We have investigated the periodic colony growth of bacterial species Bacillus subtilis. A colony grows cyclically with the interface repeating an advance (migration phase) and a rest (consolidation phase) alternately on a surface of semi-solid agar plate under appropriate environmental conditions, resulting in a concentric ring-like colony. It was found from macroscopic observations that the characteristic quantities for the periodic growth such as the migration time, the consolidation time and the terrace spacing do not depend so much on nutrient concentration Cn, but do on agar concentration Ca. The consolidation time was a weakly increasing function of Ca, while the migration time and the terrace spacing were, respectively, weakly and strongly decreasing function of Ca. Overall, the cycle (migration-plus-consolidation) time seems to be constant, and does not depend so much on both Cn and Ca. Microscopically, bacterial cells inside the growing front of a colony keep increasing their population during both migration and consolidation phases. It was also confirmed that their secreting surfactant called surfactin does not affect their periodic growth qualitatively, i.e., mutant cells which cannot secrete surfactin produce a concentric ring-like colony. All these results suggest that the diffusion of the nutrient and the surfactin are irrelevant to their periodic growth.

Effects of jasmonic acid, ethylene, and salicylic acid signaling on the rhizosphere bacterial community of Arabidopsis thaliana.

PubMed

Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M

2011-04-01

Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora.

The in situ bacterial production of fluorescent organic matter; an investigation at a species level.

PubMed

Fox, B G; Thorn, R M S; Anesio, A M; Reynolds, D M

2017-11-15

Aquatic dissolved organic matter (DOM) plays an essential role in biogeochemical cycling and transport of organic matter throughout the hydrological continuum. To characterise microbially-derived organic matter (OM) from common environmental microorganisms (Escherichia coli, Bacillus subtilis and Pseudomonas aeruginosa), excitation-emission matrix (EEM) fluorescence spectroscopy was employed. This work shows that bacterial organisms can produce fluorescent organic matter (FOM) in situ and, furthermore, that the production of FOM differs at a bacterial species level. This production can be attributed to structural biological compounds, specific functional proteins (e.g. pyoverdine production by P. aeruginosa), and/or metabolic by-products. Bacterial growth curve data demonstrates that the production of FOM is fundamentally related to microbial metabolism. For example, the majority of Peak T fluorescence (> 75%) is shown to be intracellular in origin, as a result of the building of proteins for growth and metabolism. This underpins the use of Peak T as a measure of microbial activity, as opposed to bacterial enumeration as has been previously suggested. This study shows that different bacterial species produce a range of FOM that has historically been attributed to high molecular weight allochthonous material or the degradation of terrestrial FOM. We provide definitive evidence that, in fact, it can be produced by microbes within a model system (autochthonous), providing new insights into the possible origin of allochthonous and autochthonous organic material present in aquatic systems. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

The effects of micronutrient deficiencies on bacterial species from the human gut microbiota

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hibberd, Matthew C.; Wu, Meng; Rodionov, Dmitry A.

Micronutrient deficiencies afflict two billion people. And while the impact of these imbalances on host biology has been studied extensively, much less is known about their effects on the developing or adult gut microbiota. Thus, we established a community of 44 cultured, sequenced human gut-derived bacterial species in gnotobiotic mice and fed the animals a defined, micronutrient-sufficient diet, followed by a derivative diet devoid of vitamin A, folate, iron or zinc, followed by return to the sufficient diet. Acute vitamin A deficiency had the largest effect on community structure and meta-transcriptome, with Bacteroides vulgatus, a prominent responder, increasing its abundancemore » in the absence of vitamin A, and manifesting transcriptional changes involving various metabolic pathways. Applying retinol selection to a library of 30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Genetic complementation studies, microbial RNA-Seq, and transcription factor binding assays disclosed that AcrR functions as a repressor of an adjacent AcrAB-TolC efflux system plus other members of its regulon. Retinol efflux measurements in wild-type, acrR-mutant, and complemented acrR mutant strains, plus treatment with a pharmacologic inhibitor of the efflux system, revealed that AcrAB-TolC is a determinant of retinol and bile acid sensitivity. We associated acute vitamin A deficiency with altered bile acid metabolism in vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness of B. vulgatus and perhaps other microbiota members. This type of preclinical model can help develop mechanistic insights about and more effective treatment strategies for micronutrient deficiencies.« less

Identification and characterization of bacterial symbionts in three species of filth fly parasitoids.

PubMed

Betelman, Kfir; Caspi-Fluger, Ayelet; Shamir, Maayan; Chiel, Elad

2017-09-01

Facultative bacterial symbionts are widespread among insects and have diverse effects on their biology. Here, we focused on bacterial symbionts of three ecologically and economically important filth flies parasitoid species-Spalangia cameroni, Spalangia endius and Muscidifurax raptor. Both Spalangia species harbored a Sodalis bacterium that is closely related to Spalangia praecaptivus (a free-living bacterium) and to Sodalis symbionts of weevils. This is the only case of Sodalis infection in the important order Hymenoptera. We also found, for the first time in this parasitoid guild, a Rickettsia infecting the two Spalangia spp., albeit in much higher prevalence in S. cameroni. Molecular and phylogenetic analyses revealed that it is closely related to Rickettsia felis and other Rickettsia species from the 'transitional' group. All three parasitoid species harbored Wolbachia. Using multi-locus sequence typing, we found that M. raptor harbors a single Wolbachia strain whereas the Spalangia spp. have multiple strains. By controlled crossings, we found that Wolbachia infection in S. endius causes incomplete cytoplasmic incompatibility and increased longevity, thereby promoting Wolbachia's spread. In contrast, no effects of Wolbachia on the reproduction and longevity of M. raptor were found. This study underscores the diversity and nature of symbiotic interactions between microbes and insects. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Bacterial Species and Biochemical Characteristic Investigations of Nostoc flagelliforme Concentrates during its Storage.

PubMed

Yue, Lifang; Lv, Hexin; Zhen, Jing; Jiang, Shengping; Jia, Shiru; Shen, Shigang; Gao, Lu; Dai, Yujie

2016-04-28

Preservation of fresh algae plays an important role in algae seed subculture and aquaculture. The determination and examination of the changes of cell viability, composition, and bacterial species during storage would help to take suitable preservation methods to prolong the preservation time of fresh algae. Nostoc flagelliforme is a kind of edible cyanobacterium with important herbal and dietary values. This article investigated the changes of bacterial species and biochemical characteristics of fresh N. flagelliforme concentrate during natural storage. It was found that the viability of cells decreased along with the storage time. Fourteen bacteria strains in the algae concentrate were identified by PCR-DGGE and were grouped into four phyla, including Cyanobacteria, Firmicutes, Proteobacteria, and Bacteroidetes. Among them, Enterococcus viikkiensis may be a concern in the preservation. Eleven volatile organic compounds were identified from N. flagelliforme cells, in which geosmin could be treated as an indicator of the freshness of N. flagelliforme. The occurrence of indole compound may be an indicator of the degradation of cells.

Rosacea, reactive oxygen species, and azelaic Acid.

PubMed

Jones, David A

2009-01-01

Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea.

Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

PubMed

Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

2015-08-01

The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

BASIC study: is intravaginal boric acid non-inferior to metronidazole in symptomatic bacterial vaginosis? Study protocol for a randomized controlled trial.

PubMed

Zeron Mullins, Melinda; Trouton, Konia M

2015-07-26

Bacterial vaginosis is associated with increased transmission of sexually transmitted infections, preterm labor, post-surgical infections, and endometritis. Current treatment for symptomatic bacterial vaginosis includes antibiotics, such as metronidazole, which are 70-80 % effective at one month after treatment and result in high recurrence rates and secondary candida infections. Intravaginal boric acid has been used for over a hundred years to treat vaginal infections, such as bacterial vaginosis. Boric acid is inexpensive, accessible, and has shown to be an effective treatment for other infections, such as vaginal candidiasis. To date, there has been no clinical trial evaluation of boric acid effectiveness to treat bacterial vaginosis. The BASIC (Boric Acid, Alternate Solution for Intravaginal Colonization) trial is a randomized, double-blinded, multicenter study. The study will enroll a minimum of 240 women of 16-50 years of age who are symptomatic with bacterial vaginosis. Eligible participants will have Amsel and Nugent scores confirming bacterial vaginosis. Women who are pregnant or menopausal or have other active co-infections will be excluded. Consenting participants who meet exclusion and inclusion criteria will be randomly assigned to one of three treatment groups: boric acid, metronidazole, or an inert placebo. Self-administration of treatment intravaginally for 10 days will be followed by clinical assessment at 7 and 30 days (days 17 and 40, respectively) after the end of the treatment phase. Primary outcome is a non-inferiority, per-protocol comparison of the effectiveness of boric acid with that of metronidazole at day 17, as measured by the Nugent score in 16-50 year olds. Secondary outcomes include: non-inferiority, intention-to-treat comparison of effectiveness of boric acid with that of metronidazole at day 17, analysis for both per-protocol and intention-to-treat at day 40, and safety considerations, including adverse effects requiring patient

Mutations in y-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence

USDA-ARS?s Scientific Manuscript database

Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...

The Unculturables: targeted isolation of bacterial species associated with canine periodontal health or disease from dental plaque.

PubMed

Davis, Ian J; Bull, Christopher; Horsfall, Alexander; Morley, Ian; Harris, Stephen

2014-08-01

The current inability to culture the entirety of observed bacteria is well known and with the advent of ever more powerful molecular tools, that can survey bacterial communities at previously unattainable depth, the gap in our capacity to culture and define all of these species increases exponentially. This gap has essentially become the rate limiting step in determining how the knowledge of which species are present in a sample can be applied to understand the role of these species in an ecosystem or disease process. A case in point is periodontal disease, which is the most widespread oral disease in dogs. If untreated the disease results in significant pain, eventual loss of the dentition and potentially an increased risk of systemic diseases. Previous molecular based studies have identified the bacterial species associated with periodontal disease in dogs; however without cultured strains from many of these species it has not been possible to study whether they play a role in the disease process. Using a quantitative polymerase chain reaction (qPCR) directed approach a range of microbiological media were screened and optimized to enrich for previously uncultivated target species. A systematic screening methodology was then employed to isolate the species of interest. In cases where the target species were not cultivable in isolation, helper strains grown underneath a nitrocellulose membrane were used to provide the necessary growth factors. This guided media optimization approach enabled the purification of 14 species, 8 of which we had previously been unable to cultivate in isolation. It is also applicable to the targeted isolation of isolates from species that have previously been cultured (for example to study intra-species variation) as demonstrated by the successful isolation of 6 targeted isolates of already cultured species. To our knowledge this is the first time this combination of qPCR guided media optimization, strategic screening and helper strain

Use of Antibody to Membrane Adenosine Triphosphatase in the Study of Bacterial Relationships1

PubMed Central

Whiteside, Theresa L.; De Siervo, August J.; Salton, Milton R. J.

1971-01-01

An antiserum to Ca2+-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy. Images PMID:4323299

Characterization of a novel sialic acid transporter of the sodium solute symporter (SSS) family and in vivo comparison with known bacterial sialic acid transporters.

PubMed

Severi, Emmanuele; Hosie, Arthur H F; Hawkhead, Judith A; Thomas, Gavin H

2010-03-01

The function of sialic acids in the biology of bacterial pathogens is reflected by the diverse range of solute transporters that can recognize these sugar acids. Here, we use an Escherichia coliDeltananT strain to characterize the function of known and proposed bacterial sialic acid transporters. We discover that the STM1128 gene from Salmonella enterica serovar Typhimurium, which encodes a member of the sodium solute symporter family, is able to restore growth on sialic acid to the DeltananT strain and is able to transport [(14)C]-sialic acid. Using the DeltananT genetic background, we performed a direct in vivo comparison of the transport properties of the STM1128 protein with those of sialic acid transporters of the major facilitator superfamily and tripartite ATP-independent periplasmic families, E. coli NanT and Haemophilus influenzae SiaPQM, respectively. This revealed that both STM1128 and SiaPQM are sodium-dependent and, unlike SiaPQM, both STM1128 and NanT are reversible secondary carriers, demonstrating qualitative functional differences in the properties of sialic acid transporters used by bacteria that colonize humans.

Molecular and Ecological Evidence for Species Specificity and Coevolution in a Group of Marine Algal-Bacterial Symbioses

PubMed Central

Ashen, Jon B.; Goff, Lynda J.

2000-01-01

The phylogenetic relationships of bacterial symbionts from three gall-bearing species in the marine red algal genus Prionitis (Rhodophyta) were inferred from 16S rDNA sequence analysis and compared to host phylogeny also inferred from sequence comparisons (nuclear ribosomal internal-transcribed-spacer region). Gall formation has been described previously on two species of Prionitis, P. lanceolata (from central California) and P. decipiens (from Peru). This investigation reports gall formation on a third related host, Prionitis filiformis. Phylogenetic analyses based on sequence comparisons place the bacteria as a single lineage within the Roseobacter grouping of the α subclass of the division Proteobacteria (99.4 to 98.25% sequence identity among phylotypes). Comparison of symbiont and host molecular phylogenies confirms the presence of three gall-bearing algal lineages and is consistent with the hypothesis that these red seaweeds and their bacterial symbionts are coevolving. The species specificity of these associations was investigated in nature by whole-cell hybridization of gall bacteria and in the laboratory by using cross-inoculation trials. Whole-cell in situ hybridization confirmed that a single bacterial symbiont phylotype is present in galls on each host. In laboratory trials, bacterial symbionts were incapable of inducing galls on alternate hosts (including two non-gall-bearing species). Symbiont-host specificity in Prionitis gall formation indicates an effective ecological separation between these closely related symbiont phylotypes and provides an example of a biological context in which to consider the organismic significance of 16S rDNA sequence variation. PMID:10877801

Assessing quality of Medicago sativa silage by monitoring bacterial composition with single molecule, real-time sequencing technology and various physiological parameters

PubMed Central

Bao, Weichen; Mi, Zhihui; Xu, Haiyan; Zheng, Yi; Kwok, Lai Yu; Zhang, Heping; Zhang, Wenyi

2016-01-01

The present study applied the PacBio single molecule, real-time sequencing technology (SMRT) in evaluating the quality of silage production. Specifically, we produced four types of Medicago sativa silages by using four different lactic acid bacteria-based additives (AD-I, AD-II, AD-III and AD-IV). We monitored the changes in pH, organic acids (including butyric acid, the ratio of acetic acid/lactic acid, γ-aminobutyric acid, 4-hyroxy benzoic acid and phenyl lactic acid), mycotoxins, and bacterial microbiota during silage fermentation. Our results showed that the use of the additives was beneficial to the silage fermentation by enhancing a general pH and mycotoxin reduction, while increasing the organic acids content. By SMRT analysis of the microbial composition in eight silage samples, we found that the bacterial species number and relative abundances shifted apparently after fermentation. Such changes were specific to the LAB species in the additives. Particularly, Bacillus megaterium was the initial dominant species in the raw materials; and after the fermentation process, Pediococcus acidilactici and Lactobacillus plantarum became the most prevalent species, both of which were intrinsically present in the LAB additives. Our data have demonstrated that the SMRT sequencing platform is applicable in assessing the quality of silage. PMID:27340760

Assessing quality of Medicago sativa silage by monitoring bacterial composition with single molecule, real-time sequencing technology and various physiological parameters.

PubMed

Bao, Weichen; Mi, Zhihui; Xu, Haiyan; Zheng, Yi; Kwok, Lai Yu; Zhang, Heping; Zhang, Wenyi

2016-06-24

The present study applied the PacBio single molecule, real-time sequencing technology (SMRT) in evaluating the quality of silage production. Specifically, we produced four types of Medicago sativa silages by using four different lactic acid bacteria-based additives (AD-I, AD-II, AD-III and AD-IV). We monitored the changes in pH, organic acids (including butyric acid, the ratio of acetic acid/lactic acid, γ-aminobutyric acid, 4-hyroxy benzoic acid and phenyl lactic acid), mycotoxins, and bacterial microbiota during silage fermentation. Our results showed that the use of the additives was beneficial to the silage fermentation by enhancing a general pH and mycotoxin reduction, while increasing the organic acids content. By SMRT analysis of the microbial composition in eight silage samples, we found that the bacterial species number and relative abundances shifted apparently after fermentation. Such changes were specific to the LAB species in the additives. Particularly, Bacillus megaterium was the initial dominant species in the raw materials; and after the fermentation process, Pediococcus acidilactici and Lactobacillus plantarum became the most prevalent species, both of which were intrinsically present in the LAB additives. Our data have demonstrated that the SMRT sequencing platform is applicable in assessing the quality of silage.

Characteristics of organic acids in the fruit of different pumpkin species.

PubMed

Nawirska-Olszańska, Agnieszka; Biesiada, Anita; Sokół-Łętowska, Anna; Kucharska, Alicja Z

2014-04-01

The aim of the research was to determine the composition of organic acids in fruit of different cultivars of three pumpkin species. The amount of acids immediately after fruit harvest and after 3 months of storage was compared. The content of organic acids in the examined pumpkin cultivars was assayed using the method of high performance liquid chromatography (HPLC). Three organic acids (citric acid, malic acid, and fumaric acid) were identified in the cultivars, whose content considerably varied depending on a cultivar. Three-month storage resulted in decreased content of the acids in the case of cultivars belonging to Cucurbita maxima and Cucurbita pepo species, while a slight increase was recorded for Cucurbita moschata species. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.

Lactic acid bacterial extract as a biogenic mineral growth modifier

NASA Astrophysics Data System (ADS)

Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

2009-04-01

The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

Cheating fosters species co-existence in well-mixed bacterial communities

PubMed Central

Leinweber, Anne; Fredrik Inglis, R; Kümmerli, Rolf

2017-01-01

Explaining the enormous biodiversity observed in bacterial communities is challenging because ecological theory predicts that competition between species occupying the same niche should lead to the exclusion of less competitive community members. Competitive exclusion should be particularly strong when species compete for a single limiting resource or live in unstructured habitats that offer no refuge for weaker competitors. Here, we describe the ‘cheating effect’, a form of intra-specific competition that can counterbalance between-species competition, thereby fostering biodiversity in unstructured habitats. Using experimental communities consisting of the strong competitor Pseudomonas aeruginosa (PA) and its weaker counterpart Burkholderia cenocepacia (BC), we show that co-existence is impossible when the two species compete for a single limiting resource, iron. However, when introducing a PA cheating mutant, which specifically exploits the iron-scavenging siderophores produced by the PA wild type, we found that biodiversity was preserved under well-mixed conditions where PA cheats could outcompete the PA wild type. Cheating fosters biodiversity in our system because it creates strong intra-specific competition, which equalizes fitness differences between PA and BC. Our study identifies cheating – typically considered a destructive element – as a constructive force in shaping biodiversity. PMID:28060362

New insights on the baker's yeast-mediated hydration of oleic acid: the bacterial contaminants of yeast are responsible for the stereoselective formation of (R)-10-hydroxystearic acid.

PubMed

Serra, S; De Simeis, D

2018-03-01

The preparation of the high-value flavour γ-dodecalactone is based on the biotransformation of natural 10-HSA, which is in turn obtained by microbial hydration of oleic acid. We want to establish a reliable baker's yeast-mediated procedure for 10-HSA preparation. The previously reported yeast-mediated hydration procedures are unreliable because bacteria-free baker's yeast is not able to hydrate oleic acid. The actual responsible for performing this reaction are the bacterial contaminants present in baker's yeast. Moreover, we demonstrated that the enantioselectivity in the production of (R)-10-HSA is affected mainly by the temperature used in the biotransformation. We demonstrated that Saccharomyces cerevisiae is not able to hydrate oleic acid, whereas different bacterial strains present in baker's yeast transform oleic acid into (R)-10-HSA. We reported a general procedure for the preparation of (R)-10-HSA starting from oleic acid and using commercially available baker's yeast. This study holds both scientific and industrial interest. It unambiguously establishes that the eukaryote micro-organisms present in baker's yeast are not able to hydrate oleic acid. The isolation of oleic acid hydrating bacterial strains from commercial baker's yeast points to their prospective use for the industrial synthesis of 10-HSA. © 2017 The Society for Applied Microbiology.

Rosacea, Reactive Oxygen Species, and Azelaic Acid

PubMed Central

2009-01-01

Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea. PMID:20967185

Characterization and purification of a bacterial chlorogenic acid esterase detected during the extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots.

PubMed

Negrel, Jonathan; Javelle, Francine; Morandi, Dominique; Lucchi, Géraldine

2016-12-01

A Gram-negative bacterium able to grow using chlorogenic acid (5-caffeoylquinic acid) as sole carbon source has been isolated from the roots of tomato plants inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. An intracellular esterase exhibiting very high affinity (K m  = 2 μM) for chlorogenic acid has been extracted and purified by FPLC from the chlorogenate-grown cultures of this bacterium. The molecular mass of the purified esterase determined by SDS-PAGE was 61 kDa and its isoelectric point determined by chromatofocusing was 7.75. The esterase hydrolysed chlorogenic acid analogues (caffeoylshikimate, and the 4- and 3-caffeoylquinic acid isomers), feruloyl esterases substrates (methyl caffeate and methyl ferulate), and even caffeoyl-CoA in vitro but all of them were less active than chlorogenic acid, demonstrating that the esterase is a genuine chlorogenic acid esterase. It was also induced when the bacterial strain was cultured in the presence of hydroxycinnamic acids (caffeic, p-coumaric or ferulic acid) as sole carbon source, but not in the presence of simple phenolics such as catechol or protocatechuic acid, nor in the presence of organic acids such as succinic or quinic acids. The purified esterase was remarkably stable in the presence of methanol, rapid formation of methyl caffeate occurring when its activity was measured in aqueous solutions containing 10-60% methanol. Our results therefore show that this bacterial chlorogenase can catalyse the transesterification reaction previously detected during the methanolic extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots. Data are presented suggesting that colonisation by Rhizophagus irregularis could increase chlorogenic acid exudation from tomato roots, especially in nutrient-deprived plants, and thus favour the growth of chlorogenate-metabolizing bacteria on the root surface or in the mycorhizosphere. Copyright © 2016 Elsevier Masson SAS. All rights

Beyond Streptococcus mutans: Dental Caries Onset Linked to Multiple Species by 16S rRNA Community Analysis

PubMed Central

Gross, Erin L.; Beall, Clifford J.; Kutsch, Stacey R.; Firestone, Noah D.; Leys, Eugene J.; Griffen, Ann L.

2012-01-01

Dental caries in very young children may be severe, result in serious infection, and require general anesthesia for treatment. Dental caries results from a shift within the biofilm community specific to the tooth surface, and acidogenic species are responsible for caries. Streptococcus mutans, the most common acid producer in caries, is not always present and occurs as part of a complex microbial community. Understanding the degree to which multiple acidogenic species provide functional redundancy and resilience to caries-associated communities will be important for developing biologic interventions. In addition, microbial community interactions in health and caries pathogenesis are not well understood. The purpose of this study was to investigate bacterial community profiles associated with the onset of caries in the primary dentition. In a combination cross-sectional and longitudinal design, bacterial community profiles at progressive stages of caries and over time were examined and compared to those of health. 16S rRNA gene sequencing was used for bacterial community analysis. Streptococcus mutans was the dominant species in many, but not all, subjects with caries. Elevated levels of S. salivarius, S. sobrinus, and S. parasanguinis were also associated with caries, especially in subjects with no or low levels of S. mutans, suggesting these species are alternative pathogens, and that multiple species may need to be targeted for interventions. Veillonella, which metabolizes lactate, was associated with caries and was highly correlated with total acid producing species. Among children without previous history of caries, Veillonella, but not S. mutans or other acid-producing species, predicted future caries. Bacterial community diversity was reduced in caries as compared to health, as many species appeared to occur at lower levels or be lost as caries advanced, including the Streptococcus mitis group, Neisseria, and Streptococcus sanguinis. This may have

Getting to PTI of bacterial RNAs: Triggering plant innate immunity by extracellular RNAs from bacteria.

PubMed

Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min

2016-07-02

Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions.

N-METHYL GROUPS IN BACTERIAL LIPIDS

PubMed Central

Goldfine, Howard; Ellis, Martha E.

1964-01-01

Goldfine, Howard (Harvard Medical School, Boston, Mass.), and Martha E. Ellis. N-methyl groups in bacterial lipids. J. Bacteriol. 87:8–15. 1964.—The ability of bacteria to synthesize lecithin was examined by measuring the incorporation of the methyl group of methionine into the water-soluble moieties obtained on acid hydrolysis of bacterial lipids. Of 21 species examined, mostly of the order Eubacteriales, only 2, Agrobacterium radiobacter and A. rhizogenes, incorporated the methyl group of methionine into lipid-bound choline. Evidence was also obtained for the formation of lipid-bound N-methylethanolamine and N,N′-dimethylethanolamine in these two organisms. Two other species, Clostridium butyricum and Proteus vulgaris, incorporated the methyl group of methionine into lipid-bound N-methylethanolamine, but did not appear to be able to further methylate these lipids to form lecithin. The results of this study lend further strength to the generalization that bacteria, with the exception of the genus Agrobacterium, are unable to synthesize lecithin. PMID:14102879

Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*

PubMed Central

Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.

2016-01-01

Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

MOSAIC: an online database dedicated to the comparative genomics of bacterial strains at the intra-species level.

PubMed

Chiapello, Hélène; Gendrault, Annie; Caron, Christophe; Blum, Jérome; Petit, Marie-Agnès; El Karoui, Meriem

2008-11-27

The recent availability of complete sequences for numerous closely related bacterial genomes opens up new challenges in comparative genomics. Several methods have been developed to align complete genomes at the nucleotide level but their use and the biological interpretation of results are not straightforward. It is therefore necessary to develop new resources to access, analyze, and visualize genome comparisons. Here we present recent developments on MOSAIC, a generalist comparative bacterial genome database. This database provides the bacteriologist community with easy access to comparisons of complete bacterial genomes at the intra-species level. The strategy we developed for comparison allows us to define two types of regions in bacterial genomes: backbone segments (i.e., regions conserved in all compared strains) and variable segments (i.e., regions that are either specific to or variable in one of the aligned genomes). Definition of these segments at the nucleotide level allows precise comparative and evolutionary analyses of both coding and non-coding regions of bacterial genomes. Such work is easily performed using the MOSAIC Web interface, which allows browsing and graphical visualization of genome comparisons. The MOSAIC database now includes 493 pairwise comparisons and 35 multiple maximal comparisons representing 78 bacterial species. Genome conserved regions (backbones) and variable segments are presented in various formats for further analysis. A graphical interface allows visualization of aligned genomes and functional annotations. The MOSAIC database is available online at http://genome.jouy.inra.fr/mosaic.

Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

PubMed

Nanson, Jeffrey D; Forwood, Jade K

2015-01-01

Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.

An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Song, Zhen; Kenney, Janice P.L.; Fein, Jeremy B.

2015-02-09

Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has beenmore » observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.« less

An X-ray Absorption Fine Structure study of Au adsorbed onto the non-metabolizing cells of two soil bacterial species

NASA Astrophysics Data System (ADS)

Song, Zhen; Kenney, Janice P. L.; Fein, Jeremy B.; Bunker, Bruce A.

2012-06-01

Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.

EXPLOSIVE RADIATION OF A BACTERIAL SPECIES GROUP

PubMed Central

Morlon, Hélène; Kemps, Brian D.; Plotkin, Joshua B.; Brisson, Dustin

2013-01-01

The current diversity of life on earth is the product of macroevolutionary processes that have shaped the dynamics of diversification. Although the tempo of diversification has been studied extensively in macroorganisms, much less is known about the rates of diversification in the exceedingly diverse and species-rich microbiota. Decreases in diversification rates over time, a signature of explosive radiations, are commonly observed in plant and animal lineages. However, the few existing analyses of microbial lineages suggest that the tempo of diversification in prokaryotes may be fundamentally different. Here, we use multilocus and genomic sequence data to test hypotheses about the rate of diversification in a well-studied pathogenic bacterial lineage, Borrelia burgdorferi sensu lato (sl). Our analyses support the hypothesis that an explosive radiation of lineages occurred near the origin of the clade, followed by a sharp decay in diversification rates. These results suggest that explosive radiations may be a general feature of evolutionary history across the tree of life. PMID:22834754

Diversity of bacterial species in the nasal cavity of sheep in the highlands of Ethiopia and first report of Histophilus somni in the country.

PubMed

Tesfaye, Biruk; Sisay Tessema, Tesfaye; Tefera, Genene

2013-06-01

A study was conducted to isolate bacterial species/pathogens from the nasal cavity of apparently healthy and pneumonic sheep. Nasal swabs were collected aseptically, transported in tryptose soya broth and incubated for 24 h. Then, each swab was streaked onto chocolate and blood agar for culture. Bacterial species were identified following standard bacteriological procedures. Accordingly, a total of 1,556 bacteria were isolated from 960 nasal swabs collected from three different highland areas of Ethiopia, namely Debre Berhan, Asella, and Gimba. In Debre Berhan, 140 Mannheimia haemolytica, 81 Histophilus somni, 57 Staphylococcus species, and 52 Bibersteinia trehalosi were isolated. While from Gimba M. haemolytica, Staphylococcus, Streptococcus, and H. somni were isolated at rates of 25.2, 15.9, 11.4, and 5.9 %, respectively, of the total 647 bacterial species. In Asella from 352 bacterial species isolated, 93 (26.4 %) were M. haemolytica, 48 (13.6 %) were Staphylococcus species, 26 (7.4 %) were B. trehalosi, and 17 (4.8 %) H. somni were recognized. Further identification and characterization using BIOLOG identification system Enterococcus avium and Sphingomonas sanguinis were identified at 100 % probability, while, H. somni and Actinobacillus lignerisii were suggested by the system. The study showed that a variety of bacterial species colonize the nasal cavity of the Ethiopian highland sheep with variable proportion between healthy and pneumonic ones. To our knowledge, this is the first report on isolation of H. somni, an important pathogen in cattle, from the respiratory tract of a ruminant species in the country.

Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

PubMed

Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

2014-02-01

There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

PubMed

Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

2012-11-01

Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.

The fate of benzoic acid in various species

PubMed Central

Bridges, J. W.; French, M. R.; Smith, R. L.; Williams, R. T.

1970-01-01

1. The urinary excretion of orally administered [14C]benzoic acid in man and 20 other species of animal was examined. 2. At a dose of 50mg/kg, benzoic acid was excreted by the rodents (rat, mouse, guinea pig, golden hamster, steppe lemming and gerbil), the rabbit, the cat and the capuchin monkey almost entirely as hippuric acid (95–100% of 24h excretion). 3. In man at a dose of 1mg/kg and the rhesus monkey at 20mg/kg benzoic acid was excreted entirely as hippuric acid. 4. At 50mg/kg benzoic acid was excreted as hippuric acid to the extent of about 80% of the 24h excretion in the squirrel monkey, pig, dog, ferret, hedgehog and pigeon, the other 20% being found as benzoyl glucuronide and benzoic acid, the latter possibly arising by decomposition of the former. 5. On increasing the dose of benzoic acid to 200mg/kg in the ferret, the proportion of benzoyl glucuronide excreted increased and that of hippuric acid decreased. This did not occur in the rabbit, which excreted 200mg/kg almost entirely as hippuric acid. It appears that the hedgehog and ferret are like the dog in respect to their metabolism of benzoic acid. 6. The Indian fruit bat produced only traces of hippuric acid and possibly has a defect in the glycine conjugation of benzoic acid. The main metabolite in this animal (dose 50mg/kg) was benzoyl glucuronide. 7. The chicken, side-necked turtle and gecko converted benzoic acid mainly into ornithuric acid, but all three species also excreted smaller amounts of hippuric acid. PMID:4990586

Skin bacterial flora as a potential risk factor predisposing to late bacterial infection after cross-linked hyaluronic acid gel augmentation.

PubMed

Netsvyetayeva, Irina; Marusza, Wojciech; Olszanski, Romuald; Szyller, Kamila; Krolak-Ulinska, Aneta; Swoboda-Kopec, Ewa; Sierdzinski, Janusz; Szymonski, Zachary; Mlynarczyk, Grazyna

2018-01-01

Cross-linked hyaluronic acid (HA) gel is widely used in esthetic medicine. Late bacterial infection (LBI) is a rare, but severe complication after HA augmentation. The aim of this study was to determine whether patients who underwent the HA injection procedure and developed LBI had qualitatively different bacterial flora on the skin compared to patients who underwent the procedure without any complications. The study group comprised 10 previously healthy women with recently diagnosed, untreated LBI after HA augmentation. The control group comprised 17 healthy women who had a similar amount of HA injected with no complications. To assess the difference between the two groups, their skin flora was cultured from nasal swabs, both before and after antibiotic treatment in the study group. A significant increase in the incidence of Staphylococcus epidermidis was detected in the control group ( P =0.000) compared to the study group. The study group showed a significantly higher incidence of Staphylococcus aureus ( P =0.005), Klebsiella pneumoniae ( P =0.006), Klebsiella oxytoca ( P =0.048), and Staphylococcus haemolyticus ( P =0.048) compared to the control group. The bacterial flora on the skin differed in patients with LBI from the control group. The control group's bacterial skin flora was dominated by S. epidermidis . Patients with LBI had a bacterial skin flora dominated by potentially pathogenic bacteria.

N-Acetyl-L-cysteine Effects on Multi-species Oral Biofilm Formation and Bacterial Ecology

PubMed Central

Rasmussen, Karin; Nikrad, Julia; Reilly, Cavan; Li, Yuping; Jones, Robert S.

2015-01-01

Future therapies for the treatment of dental decay have to consider the importance of preserving bacterial ecology while reducing biofilm adherence to teeth. A multi-species plaque derived (MSPD) biofilm model was used to assess how concentrations of N-acetyl-L-cysteine (0, 0.1%, 1%, 10%) affected the growth of complex oral biofilms. Biofilms were grown (n=96) for 24 hours on hydroxyapatite disks in BMM media with 0.5% sucrose. Bacterial viability and biomass formation was examined on each disk using a microtiter plate reader. In addition, fluorescence microscopy and Scanning Electron Microscopy was used to qualitatively examine the effect of NAC on bacterial biofilm aggregation, extracellular components, and bacterial morphology. The total biomass was significantly decreased after exposure of both 1% (from 0.48, with a 95% confidence interval of (0.44, 0.57) to 0.35, with confidence interval (0.31, 0.38)) and 10% NAC (0.14 with confidence interval (0.11, 0.17)). 16S rRNA amplicon sequencing analysis indicated that 1% NAC reduced biofilm adherence while preserving biofilm ecology. PMID:26518358

How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

PubMed Central

Yao, Jiangwei; Rock, Charles O.

2015-01-01

Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

Efficiencies of Recovery of Bdellovibrios from Brackish- Water Environments by Using Various Bacterial Species as Prey

PubMed Central

Schoeffield, A. J.; Williams, H. N.

1990-01-01

A total of 44 bacterial species subdivided into 10 trial experiments have been used as prey for the recovery of bdellovibrios from samples of water from a brackish tidal pond and an aquarium saltwater tank. In an initial investigation, the recovery efficiency of each of the test bacterial species was compared with that of a designated standard prey, Vibrio parahaemolyticus P-5. The results revealed that in each case strain P-5 yielded an equal or significantly greater number of plaques of bdellovibrios than the test prey with but a single exception, strain CS5. In repeat experiments, CS5 yielded fewer plaques than P-5. To determine whether the use of multiple bacterial species compared with a single species as prey would increase the number of PFU of bdellovibrios recovered, material from plaques appearing on each of the test prey in the respective trials was sequentially subcultured onto two respective agar plates, the first containing as prey V. parahaemolyticus P-5 and the second containing the initial test organism. In nearly every case, subculture of plaques from lawns of the test prey to P-5 resulted in plaque formation. On the basis of the results, the use of several test prey and P-5 did not result in the recovery of any more bdellovibrio PFU than the use of P-5 alone. In this study, V. parahaemolyticus P-5 was observed to be the most efficient prey for the recovery of bdellovibrios from moderate salt water. PMID:16348096

Microbiological and molecular identification of bacterial species isolated from nasal and oropharyngeal mucosa of fuel workers in Riyadh, Saudi Arabia.

PubMed

AlWakeel, Suaad S

2017-09-01

This study aimed to determine the bacterial species colonizing the nasal and oropharyngeal mucosa of fuel workers in Central Riyadh, Saudi Arabia on a microbiological and molecular level. Throat and nasal swab samples were obtained from 29 fuel station attendants in the period of time extending from March to May 2014 in Riyadh, Saudi Arabia. Microbiological identification techniques were utilized to identify the bacterial species isolated. Antibiotic sensitivity was assessed for each of the bacterial isolates. Molecular identification techniques based on PCR analysis of specific genomic sequences was conducted and was the basis on which phylogeny representation was done for 10 randomly selected samples of the isolates. Blood was drawn and a complete blood count was conducted to note the hematological indices for each of the study participants. Nineteen bacterial species were isolated from both the nasal cavity and the oropharynx including Streptococcus thoraltensis , alpha-hemolytic streptococci, Staphylococcus hominis , coagulase-negative staphylococci, Leuconostoc mesenteroides , Erysipelothrix rhusiopathiae and several others. We found 100% sensitivity of the isolates to ciprofloxacin, cefuroxime and gentamicin. Whereas cefotaxime and azithromycin posted sensitivities of 85.7% and 91.4%, respectively. Low sensitivities (<60% sensitivity) to the antibiotics ampicillin, erythromycin, clarithromycin and norfloxacin were observed. Ninety-seven percent similarity to the microbial bank species was noted when the isolates were compared to it. Most hematological indices recorded were within the normal range. In conclusion, exposure to toxic fumes and compounds within fuel products may be a contributing factor to bacterial colonization of the respiratory tract in fuel workers.

[Effect of Gram-negative bacteria on fatty acids].

PubMed

Vuillemin, N; Dupeyron, C; Leluan, G; Bory, J

1981-01-01

The gram-negative bacteria investigated exert various effects on fatty acids. P. aeruginosa and A. calcoaceticus catabolize any of the fatty acids tested. S. marcescens is effective upon all fatty acids excepting butyric acid. The long chain fatty acids only are degraded by E. coli, meanwhile the other fatty acids present a bacteriostatic or bactericidal activity on it. The authors propose a simple and original method for testing the capability of degradation of fatty acids by some bacterial species.

Novel consortium of Klebsiella variicola and Lactobacillus species enhances the functional potential of fermented dairy products by increasing the availability of branched-chain amino acids and the amount of distinctive volatiles.

PubMed

Rosales-Bravo, H; Morales-Torres, H C; Vázquez-Martínez, J; Molina-Torres, J; Olalde-Portugal, V; Partida-Martínez, L P

2017-11-01

Identify novel bacterial taxa that could increase the availability of branched-chain amino acids and the amount of distinctive volatiles during skim milk fermentation. We recovered 344 bacterial isolates from stool samples of healthy and breastfed infants. Five were selected based on their ability to produce branched-chain amino acids. Three strains were identified as Escherichia coli, one as Klebsiella pneumoniae and other as Klebsiella variicola by molecular and biochemical methods. HPLC and solid-phase microextraction with GC-MS were used for the determination of free amino acids and volatile compounds respectively. The consortium formed by K. variicola and four Lactobacillus species showed the highest production of Leu and Ile in skim milk fermentation. In addition, the production of volatile compounds, such as acetoin, ethanol, 2-nonanone, and acetic, hexanoic and octanoic acids, increased in comparison to commercial yogurt, Emmental and Gouda cheese. Also, distinctive volatiles, such as 2,3-butanediol, 4-methyl-2- hexanone and octanol, were identified. The use of K. variicola in combination with probiotic Lactobacillus species enhances the availability of Leu and Ile and the amount of distinctive volatiles during skim milk fermentation. The identified consortium increases the functional potential of fermented dairy products. © 2017 The Society for Applied Microbiology.

Epithelial cell pro-inflammatory cytokine response differs across dental plaque bacterial species.

PubMed

Stathopoulou, Panagiota G; Benakanakere, Manjunatha R; Galicia, Johnah C; Kinane, Denis F

2010-01-01

The dental plaque is comprised of numerous bacterial species, which may or may not be pathogenic. Human gingival epithelial cells (HGECs) respond to perturbation by various bacteria of the dental plaque by production of different levels of inflammatory cytokines, which is a putative reflection of their virulence. The aim of the current study was to determine responses in terms of interleukin (IL)-1beta, IL-6, IL-8 and IL-10 secretion induced by Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum and Streptococcus gordonii in order to gauge their virulence potential. HGECs were challenged with the four bacterial species, live or heat killed, at various multiplicity of infections and the elicited IL-1beta, IL-6, IL-8 and IL-10 responses were assayed by enzyme-linked immunosorbent assay. Primary HGECs challenged with live P. gingivalis produced high levels of IL-1beta, while challenge with live A. actinomycetemcomitans gave high levels of IL-8. The opportunistic pathogen F. nucleatum induces the highest levels of pro-inflammatory cytokines, while the commensal S. gordonii is the least stimulatory. We conclude that various dental plaque biofilm bacteria induce different cytokine response profiles in primary HGECs that may reflect their individual virulence or commensal status.

Limitations to estimating bacterial cross-species transmission using genetic and genomic markers: inferences from simulation modeling

PubMed Central

Benavides, Julio A; Cross, Paul C; Luikart, Gordon; Creel, Scott

2014-01-01

Cross-species transmission (CST) of bacterial pathogens has major implications for human health, livestock, and wildlife management because it determines whether control actions in one species may have subsequent effects on other potential host species. The study of bacterial transmission has benefitted from methods measuring two types of genetic variation: variable number of tandem repeats (VNTRs) and single nucleotide polymorphisms (SNPs). However, it is unclear whether these data can distinguish between different epidemiological scenarios. We used a simulation model with two host species and known transmission rates (within and between species) to evaluate the utility of these markers for inferring CST. We found that CST estimates are biased for a wide range of parameters when based on VNTRs and a most parsimonious reconstructed phylogeny. However, estimations of CST rates lower than 5% can be achieved with relatively low bias using as low as 250 SNPs. CST estimates are sensitive to several parameters, including the number of mutations accumulated since introduction, stochasticity, the genetic difference of strains introduced, and the sampling effort. Our results suggest that, even with whole-genome sequences, unbiased estimates of CST will be difficult when sampling is limited, mutation rates are low, or for pathogens that were recently introduced. PMID:25469159

Species and Scale Dependence of Bacterial Motion Dynamics

NASA Astrophysics Data System (ADS)

Sund, N. L.; Yang, X.; Parashar, R.; Plymale, A.; Hu, D.; Kelly, R.; Scheibe, T. D.

2017-12-01

Many metal reducing bacteria are motile with their motion characteristics described by run-and-tumble behavior exhibiting series of flights (jumps) and waiting (residence) time spanning a wide range of values. Accurate models of motility allow for improved design and evaluation of in-situ bioremediation in the subsurface. While many bioremediation models neglect the motion of the bacteria, others treat motility using an advection dispersion equation, which assumes that the motion of the bacteria is Brownian.The assumption of Brownian motion to describe motility has enormous implications on predictive capabilities of bioremediation models, yet experimental evidence of this assumption is mixed [1][2][3]. We hypothesize that this is due to the species and scale dependence of the motion dynamics. We test our hypothesis by analyzing videos of motile bacteria of five different species in open domains. Trajectories of individual cells ranging from several seconds to few minutes in duration are extracted in neutral conditions (in the absence of any chemical gradient). The density of the bacteria is kept low so that the interaction between the bacteria is minimal. Preliminary results show a transition from Fickian (Brownian) to non-Fickian behavior for one species of bacteria (Pelosinus) and persistent Fickian behavior of another species (Geobacter).Figure: Video frames of motile bacteria with the last 10 seconds of their trajectories drawn in red. (left) Pelosinus and (right) Geobacter.[1] Ariel, Gil, et al. "Swarming bacteria migrate by Lévy Walk." Nature Communications 6 (2015).[2] Saragosti, Jonathan, Pascal Silberzan, and Axel Buguin. "Modeling E. coli tumbles by rotational diffusion. Implications for chemotaxis." PloS one 7.4 (2012): e35412.[3] Wu, Mingming, et al. "Collective bacterial dynamics revealed using a three-dimensional population-scale defocused particle tracking technique." Applied and Environmental Microbiology 72.7 (2006): 4987-4994.

Ursodeoxycholic Acid and Its Taurine- or Glycine-Conjugated Species Reduce Colitogenic Dysbiosis and Equally Suppress Experimental Colitis in Mice

PubMed Central

Van den Bossche, Lien; Hindryckx, Pieter; Devisscher, Lindsey; Devriese, Sarah; Van Welden, Sophie; Holvoet, Tom; Vilchez-Vargas, Ramiro; Vital, Marius; Pieper, Dietmar H.; Vanden Bussche, Julie; Vanhaecke, Lynn; Van de Wiele, Tom; De Vos, Martine

2017-01-01

ABSTRACT The promising results seen in studies of secondary bile acids in experimental colitis suggest that they may represent an attractive and safe class of drugs for the treatment of inflammatory bowel diseases (IBD). However, the exact mechanism by which bile acid therapy confers protection from colitogenesis is currently unknown. Since the gut microbiota plays a crucial role in the pathogenesis of IBD, and exogenous bile acid administration may affect the community structure of the microbiota, we examined the impact of the secondary bile acid ursodeoxycholic acid (UDCA) and its taurine or glycine conjugates on the fecal microbial community structure during experimental colitis. Daily oral administration of UDCA, tauroursodeoxycholic acid (TUDCA), or glycoursodeoxycholic acid (GUDCA) equally lowered the severity of dextran sodium sulfate-induced colitis in mice, as evidenced by reduced body weight loss, colonic shortening, and expression of inflammatory cytokines. Illumina sequencing demonstrated that bile acid therapy during colitis did not restore fecal bacterial richness and diversity. However, bile acid therapy normalized the colitis-associated increased ratio of Firmicutes to Bacteroidetes. Interestingly, administration of bile acids prevented the loss of Clostridium cluster XIVa and increased the abundance of Akkermansia muciniphila, bacterial species known to be particularly decreased in IBD patients. We conclude that UDCA, which is an FDA-approved drug for cholestatic liver disorders, could be an attractive treatment option to reduce dysbiosis and ameliorate inflammation in human IBD. IMPORTANCE Secondary bile acids are emerging as attractive candidates for the treatment of inflammatory bowel disease. Although bile acids may affect the intestinal microbial community structure, which significantly contributes to the course of these inflammatory disorders, the impact of bile acid therapy on the fecal microbiota during colitis has not yet been considered

Ursodeoxycholic Acid and Its Taurine- or Glycine-Conjugated Species Reduce Colitogenic Dysbiosis and Equally Suppress Experimental Colitis in Mice.

PubMed

Van den Bossche, Lien; Hindryckx, Pieter; Devisscher, Lindsey; Devriese, Sarah; Van Welden, Sophie; Holvoet, Tom; Vilchez-Vargas, Ramiro; Vital, Marius; Pieper, Dietmar H; Vanden Bussche, Julie; Vanhaecke, Lynn; Van de Wiele, Tom; De Vos, Martine; Laukens, Debby

2017-04-01

The promising results seen in studies of secondary bile acids in experimental colitis suggest that they may represent an attractive and safe class of drugs for the treatment of inflammatory bowel diseases (IBD). However, the exact mechanism by which bile acid therapy confers protection from colitogenesis is currently unknown. Since the gut microbiota plays a crucial role in the pathogenesis of IBD, and exogenous bile acid administration may affect the community structure of the microbiota, we examined the impact of the secondary bile acid ursodeoxycholic acid (UDCA) and its taurine or glycine conjugates on the fecal microbial community structure during experimental colitis. Daily oral administration of UDCA, tauroursodeoxycholic acid (TUDCA), or glycoursodeoxycholic acid (GUDCA) equally lowered the severity of dextran sodium sulfate-induced colitis in mice, as evidenced by reduced body weight loss, colonic shortening, and expression of inflammatory cytokines. Illumina sequencing demonstrated that bile acid therapy during colitis did not restore fecal bacterial richness and diversity. However, bile acid therapy normalized the colitis-associated increased ratio of Firmicutes to Bacteroidetes Interestingly, administration of bile acids prevented the loss of Clostridium cluster XIVa and increased the abundance of Akkermansia muciniphila , bacterial species known to be particularly decreased in IBD patients. We conclude that UDCA, which is an FDA-approved drug for cholestatic liver disorders, could be an attractive treatment option to reduce dysbiosis and ameliorate inflammation in human IBD. IMPORTANCE Secondary bile acids are emerging as attractive candidates for the treatment of inflammatory bowel disease. Although bile acids may affect the intestinal microbial community structure, which significantly contributes to the course of these inflammatory disorders, the impact of bile acid therapy on the fecal microbiota during colitis has not yet been considered. Here, we

A novel production process for optically pure L-lactic acid from kitchen refuse using a bacterial consortium at high temperatures.

PubMed

Tashiro, Yukihiro; Matsumoto, Hiroko; Miyamoto, Hirokuni; Okugawa, Yuki; Pramod, Poudel; Miyamoto, Hisashi; Sakai, Kenji

2013-10-01

We investigated L-lactic acid production in static batch fermentation of kitchen refuse using a bacterial consortium from marine-animal-resource (MAR) composts at temperatures ranging from 30 to 65 °C. At relatively low temperatures butyric acid accumulated, whereas at higher temperatures L-lactic acid was produced. In particular, fermentation at 50 °C produced 34.5 g L(-1) L-lactic acid with 90% lactic acid selectivity and 100% optical purity. Denaturing gradient gel electrophoresis indicated that dominant bacteria present in the original MAR composts diminished rapidly and Bacillus coagulans strains became the dominant contributors to L-lactic acid production at 45, 50 and 55 °C. This is the first report of the achievement of 100% optical purity of L-lactic acid using a bacterial consortium. Copyright © 2013 Elsevier Ltd. All rights reserved.

Metal adsorption onto bacterial surfaces: development of a predictive approach

NASA Astrophysics Data System (ADS)

Fein, Jeremy B.; Martin, Aaron M.; Wightman, Peter G.

2001-12-01

Aqueous metal cation adsorption onto bacterial surfaces can be successfully modeled by means of a surface complexation approach. However, relatively few stability constants for metal-bacterial surface complexes have been measured. In order to determine the bacterial adsorption behavior of cations that have not been studied in the laboratory, predictive techniques are required that enable estimation of the stability constants of bacterial surface complexes. In this study, we use a linear free-energy approach to compare previously measured stability constants for Bacillus subtilis metal-carboxyl surface complexes with aqueous metal-organic acid anion stability constants. The organic acids that we consider are acetic, oxalic, citric, and tiron. We add to this limited data set by conducting metal adsorption experiments onto Bacillus subtilis, determining bacterial surface stability constants for Co, Nd, Ni, Sr, and Zn. The adsorption behavior of each of the metals studied here was described well by considering metal-carboxyl bacterial surface complexation only, except for the Zn adsorption behavior, which required carboxyl and phosphoryl complexation to obtain a suitable fit to the data. The best correlation between bacterial carboxyl surface complexes and aqueous organic acid anion stability constants was obtained by means of metal-acetate aqueous complexes, with a linear correlation coefficient of 0.97. This correlation applies only to unhydrolyzed aqueous cations and only to carboxyl binding of those cations, and it does not predict the binding behavior under conditions where metal binding to other bacterial surface site types occurs. However, the relationship derived in this study permits estimation of the carboxyl site adsorption behavior of a wide range of aqueous metal cations for which there is an absence of experimental data. This technique, coupled with the observation of similar adsorption behaviors across bacterial species (Yee and Fein, 2001), enables

Bacterial community dynamics and product distribution during pH-adjusted fermentation of vegetable wastes.

PubMed

Ye, N-F; Lü, F; Shao, L-M; Godon, J-J; He, P-J

2007-10-01

To estimate the effect of pH on the structures of bacterial community during fermentation of vegetable wastes and to investigate the relationship between bacterial community dynamics and product distribution. The bacterial communities in five batch tests controlled at different pH values [uncontrolled (about pH 4), 5, 6, 7 and 8] were monitored by denaturing gradient gel electrophoresis (DGGE) and single-strand conformation polymorphism (SSCP). The two fingerprinting methods provided consistent results and principal component analysis indicated a close similarity of bacterial community at pH 7 and 8 in addition to those at pH 4-6. This clustering also corresponded to dominant metabolic pathway. Thus, pH 7-8 shifted from alcohol-forming to acid-forming, especially butyric acid, whereas both alcohol-forming and acid-forming dominated at pH 5-6, and at pH 4, fermentation was inhibited. Shannon-weaver index was calculated to analyse the DGGE profiles, which revealed that the bacterial diversities at pH 7 and 8 were the highest while those at pH 5 and 4 (uncontrolled) were the lowest. According to sequencing results of the bands excised from DGGE gels, lactic acid bacteria and Clostridium sp. were predominant at all pH values, but varieties in species were observed as pH changed and time prolonged. The bacterial community during fermentation was materially influenced by pH and the diverse product distribution was related to the shift of different bacterial population. The study reveals that the impact of pH on fermentation product distribution is implemented primarily by changes of bacterial community. It also provides information about the comparison of two fingerprinting methods, DGGE and SSCP.

Lactobacillus and Pediococcus species richness and relative abundance in the vagina of rhesus monkeys (Macaca mulatta)

PubMed Central

Gravett, Michael G.; Jin, Ling; Pavlova, Sylvia I.; Tao, Lin

2012-01-01

Background The rhesus monkey is an important animal model to study human vaginal health to which lactic acid bacteria play a significant role. However, the vaginal lactic acid bacterial species richness and relative abundance in rhesus monkeys is largely unknown. Methods Vaginal swab samples were aseptically obtained from 200 reproductive aged female rhesus monkeys. Following Rogosa agar plating, single bacterial colonies representing different morphotypes were isolated and analyzed for whole-cell protein profile, species-specifc PCR, and 16S rRNA gene sequence. Results A total of 510 Lactobacillus strains of 17 species and one Pediococcus acidilactici were identified. The most abundant species was L. reuteri, which colonized the vaginas of 86% monkeys. L. johnsonii was the second most abundant species, which colonized 36% of monkeys. The majority of monkeys were colonized by multiple Lactobacillus species. Conclusions The vaginas of rhesus monkeys are frequently colonized by multiple Lactobacillus species, dominated by L. reuteri. PMID:22429090

Bacterial species and mycotoxin contamination associated with locust bean, melon and their fermented products in south-western Nigeria.

PubMed

Adedeji, Bamidele S; Ezeokoli, Obinna T; Ezekiel, Chibundu N; Obadina, Adewale O; Somorin, Yinka M; Sulyok, Michael; Adeleke, Rasheed A; Warth, Benedikt; Nwangburuka, Cyril C; Omemu, Adebukola M; Oyewole, Olusola B; Krska, Rudolf

2017-10-03

The microbiological safety of spontaneously fermented foods is not always guaranteed due to the undefined fermenting microbial consortium and processing materials. In this study, two commonly consumed traditional condiments (iru and ogiri) and their respective raw seeds (locust bean and melon) purchased from markets in south-western Nigeria were assessed for bacterial diversity and mycotoxin contamination using 16S rRNA gene sequencing and liquid chromatography tandem mass spectrometry (LC-MS/MS), respectively. Two hundred isolates obtained from the raw seeds and condiments clustered into 10 operational taxonomic units (OTUs) and spanned 3 phyla, 10 genera, 14 species and 2 sub-species. Bacillus (25%) and Staphylococcus (23.5%) dominated other genera. Potentially pathogenic species such as Alcaligenes faecalis, Bacillus anthracis, Proteus mirabilis and Staphylococcus sciuri subsp. sciuri occurred in the samples, suggesting poor hygienic practice during production and/or handling of the condiments. A total of 48 microbial metabolites including 7 mycotoxins [3-nitropropionic acid, aflatoxin B 1 (AFB 1 ), AFB 2 , beauvericin, citrinin, ochratoxin A and sterigmatocystin] were quantified in the food samples. Melon and ogiri had detectable aflatoxin levels whereas locust bean and iru did not; the overall mycotoxin levels in the food samples were low. There is a need to educate processors/vendors of these condiments on good hygienic and processing practices. Copyright © 2017 Elsevier B.V. All rights reserved.

Loofah sponges as reservoirs and vehicles in the transmission of potentially pathogenic bacterial species to human skin.

PubMed Central

Bottone, E J; Perez, A A; Oeser, J L

1994-01-01

Loofah sponges are natural products used as exfoliative beauty aids. As a consequence of tracing a case of Pseudomonas aeruginosa folliculitis to a contaminated loofah sponge, we assessed the role of loofah sponges in supporting the growth of a wide variety of bacterial species. Our data show growth enhancement of sterile loofah fragments for numerous gram-negative (Pseudomonas, Xanthomonas, and Klebsiella) and gram-positive (Enterococcus and group B Streptococcus) species of human and environmental origin. Furthermore, hydrated new, unused loofah sponges undergo a shift in bacterial flora from sparse colonies of Bacillus spp. and Staphylococcus epidermidis to a predominantly gram-negative flora. The growth-promoting potential of loofah sponges (and other exfoliatives) can be further augmented by desquamated epithelial cells entrapped in the loofah fibrous matrix. Therefore, as loofah sponges (and other exfoliatives) can serve as a reservoir and a vehicle for the transmission of potentially pathogenic species to the human skin, we recommend their decontamination with hypochlorite (10%) bleach at regular intervals. Images PMID:8150959

Loofah sponges as reservoirs and vehicles in the transmission of potentially pathogenic bacterial species to human skin.

PubMed

Bottone, E J; Perez, A A; Oeser, J L

1994-02-01

Loofah sponges are natural products used as exfoliative beauty aids. As a consequence of tracing a case of Pseudomonas aeruginosa folliculitis to a contaminated loofah sponge, we assessed the role of loofah sponges in supporting the growth of a wide variety of bacterial species. Our data show growth enhancement of sterile loofah fragments for numerous gram-negative (Pseudomonas, Xanthomonas, and Klebsiella) and gram-positive (Enterococcus and group B Streptococcus) species of human and environmental origin. Furthermore, hydrated new, unused loofah sponges undergo a shift in bacterial flora from sparse colonies of Bacillus spp. and Staphylococcus epidermidis to a predominantly gram-negative flora. The growth-promoting potential of loofah sponges (and other exfoliatives) can be further augmented by desquamated epithelial cells entrapped in the loofah fibrous matrix. Therefore, as loofah sponges (and other exfoliatives) can serve as a reservoir and a vehicle for the transmission of potentially pathogenic species to the human skin, we recommend their decontamination with hypochlorite (10%) bleach at regular intervals.

Carbon nanomaterials alter plant physiology and soil bacterial community composition in a rice-soil-bacterial ecosystem.

PubMed

Hao, Yi; Ma, Chuanxin; Zhang, Zetian; Song, Youhong; Cao, Weidong; Guo, Jing; Zhou, Guopeng; Rui, Yukui; Liu, Liming; Xing, Baoshan

2018-01-01

The aim of this study was to compare the toxicity effects of carbon nanomaterials (CNMs), namely fullerene (C 60 ), reduced graphene oxide (rGO) and multi-walled carbon nanotubes (MWCNTs), on a mini-ecosystem of rice grown in a loamy potted soil. We measured plant physiological and biochemical parameters and examined bacterial community composition in the CNMs-treated plant-soil system. After 30 days of exposure, all the three CNMs negatively affected the shoot height and root length of rice, significantly decreased root cortical cells diameter and resulted in shrinkage and deformation of cells, regardless of exposure doses (50 or 500 mg/kg). Additionally, at the high exposure dose of CNM, the concentrations of four phytohormones, including auxin, indoleacetic acid, brassinosteroid and gibberellin acid 4 in rice roots significantly increased as compared to the control. At the high exposure dose of MWCNTs and C 60 , activities of the antioxidant enzymes superoxide dismutase (SOD) and peroxidase (POD) in roots increased significantly. High-throughput sequencing showed that three typical CNMs had little effect on shifting the predominant soil bacterial species, but the presence of CNMs significantly altered the composition of the bacterial community. Our results indicate that different CNMs indeed resulted in environmental toxicity to rice and soil bacterial community in the rhizosphere and suggest that CNMs themselves and their incorporated products should be reasonably used to control their release/discharge into the environment to prevent their toxic effects on living organisms and the potential risks to food safety. Copyright © 2017 Elsevier Ltd. All rights reserved.

Combined chemical and physical transformation method with RbCl and sepiolite for the transformation of various bacterial species.

PubMed

Ren, Jun; Lee, Haram; Yoo, Seung Min; Yu, Myeong-Sang; Park, Hansoo; Na, Dokyun

2017-04-01

DNA transformation that delivers plasmid DNAs into bacterial cells is fundamental in genetic manipulation to engineer and study bacteria. Developed transformation methods to date are optimized to specific bacterial species for high efficiency. Thus, there is always a demand for simple and species-independent transformation methods. We herein describe the development of a chemico-physical transformation method that combines a rubidium chloride (RbCl)-based chemical method and sepiolite-based physical method, and report its use for the simple and efficient delivery of DNA into various bacterial species. Using this method, the best transformation efficiency for Escherichia coli DH5α was 4.3×10 6 CFU/μg of pUC19 plasmid, which is higher than or comparable to the reported transformation efficiencies to date. This method also allowed the introduction of plasmid DNAs into Bacillus subtilis (5.7×10 3 CFU/μg of pSEVA3b67Rb), Bacillus megaterium (2.5×10 3 CFU/μg of pSPAsp-hp), Lactococcus lactis subsp. lactis (1.0×10 2 CFU/μg of pTRKH3-ermGFP), and Lactococcus lactis subsp. cremoris (2.2×10 2 CFU/μg of pMSP3535VA). Remarkably, even when the conventional chemical and physical methods failed to generate transformed cells in Bacillus sp. and Enterococcus faecalis, E. malodoratus and E. mundtii, our combined method showed a significant transformation efficiency (2.4×10 4 , 4.5×10 2 , 2×10 1 , and 0.5×10 1 CFU/μg of plasmid DNA). Based on our results, we anticipate that our simple and efficient transformation method should prove usefulness for introducing DNA into various bacterial species without complicated optimization of parameters affecting DNA entry into the cell. Copyright © 2017. Published by Elsevier B.V.

Species identification of corynebacteria by cellular fatty acid analysis.

PubMed

Van den Velde, Sandra; Lagrou, Katrien; Desmet, Koen; Wauters, Georges; Verhaegen, Jan

2006-02-01

We evaluated the usefulness of cellular fatty acid analysis for the identification of corynebacteria. Therefore, 219 well-characterized strains belonging to 21 Corynebacterium species were analyzed with the Sherlock System of MIDI (Newark, DE). Most Corynebacterium species have a qualitative different fatty acid profile. Corynebacterium coyleae (subgroup 1), Corynebacterium riegelii, Corynebacterium simulans, and Corynebacterium imitans differ only quantitatively. Corynebacterium afermentans afermentans and C. coyleae (subgroup 2) have both a similar qualitative and quantitative profile. The commercially available database (CLIN 40, MIDI) identified only one third of the 219 strains correctly at the species level. We created a new database with these 219 strains. This new database was tested with 34 clinical isolates and could identify 29 strains correctly. Strains that remained unidentified were 2 Corynebacterium aurimucosum (not included in our database), 1 C. afermentans afermentans, and 2 Corynebacterium pseudodiphtheriticum. Cellular fatty acid analysis with a self-created database can be used for the identification and differentiation of corynebacteria.

Peracetic Acid Treatment Generates Potent Inactivated Oral Vaccines from a Broad Range of Culturable Bacterial Species

PubMed Central

Moor, Kathrin; Wotzka, Sandra Y.; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma

2016-01-01

Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 1010 peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024

Amino acid uptake by temperate tree species characteristic of low- and high-fertility habitats.

PubMed

Scott, Emily E; Rothstein, David E

2011-10-01

The relationship between inorganic nitrogen (N) cycling and plant productivity is well established. However, recent research has demonstrated the ability of plants to take up low molecular weight organic N compounds (i.e., amino acids) at rates that often rival those of inorganic N forms. In this study, we hypothesize that temperate forest tree species characteristic of low-fertility habitats will prefer amino acids over species characteristic of high-fertility habitats. We measured the uptake of (15)N-labeled amino acids (glycine, glutamine, arginine, serine), ammonium (NH(4)(+)), and nitrate (NO(3)(-)) by four tree species that commonly occur in eastern North America, where their abundances have been correlated with inorganic N availability. Specific uptake rates of amino acids were largely similar for all tree species; however, high-fertility species took up NH(4)(+) at rates more than double those of low-fertility species, rendering amino acid N relatively more important to the N nutrition of low-fertility species. Low-fertility species acquired over four times more total N from arginine compared to NH(4)(+) and NO(3)(-); high-fertility species acquired the most N from NH(4)(+). Arginine had the highest uptake rates of any amino acid by all species; there were no significant differences in uptake rates of the remaining amino acids. Our results support the idea that the dominant species in a particular habitat are those best able to utilize the most available N resources.

Diversity and localization of bacterial symbionts in three whitefly species (Hemiptera: Aleyrodidae) from the east coast of the Adriatic Sea.

PubMed

Skaljac, M; Zanić, K; Hrnčić, S; Radonjić, S; Perović, T; Ghanim, M

2013-02-01

Several whitefly species (Hemiptera: Aleyrodidae) are cosmopolitan phloem-feeders that cause serious damage in numerous agricultural crops. All whitefly species harbor a primary bacterial symbiont and a diverse array of secondary symbionts which may influence several aspects of the insect's biology. We surveyed infections by secondary symbionts in Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood) and Siphoninus phillyreae (Haliday) from areas in the east cost of the Adriatic Sea. Both the Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) B. tabaci genetic groups were detected in Montenegro, whereas only the MED was confirmed in Croatia. Trialeurodes vaporariorum and S. phillyreae were found in all areas surveyed. MEAM1 and MED exhibited similarity to previously reported infections, while populations of T. vaporariorum from Montenegro harbored Rickettsia, Wolbachia and Cardinium in addition to previously reported Hamiltonella and Arsenopnohus. Siphoninus phillyreae harbored Hamiltonella, Wolbachia, Cardinium and Arsenophonus, with the latter appearing in two alleles. Multiple infections of all symbionts were common in the three insect species tested, with some reaching near fixation. Florescent in situ hybridization showed new localization patterns for Hamiltonella in S. phillyreae, and the morphology of the bacteriosome differed from that observed in other whitefly species. Our results show new infections with bacterial symbionts in the whitefly species studied. Infections with the same symbionts in reproductively isolated whitefly species confirm complex relationships between whiteflies and bacterial symbionts, and suggest possible horizontal transfer of some of these bacteria.

The Immediate and Delayed Post-Debridement Effects on Tissue Bacterial Wound Counts of Hypochlorous Acid Versus Saline Irrigation in Chronic Wounds.

PubMed

Hiebert, John M; Robson, Martin C

2016-01-01

Introduction: Wound debridement is considered essential in chronic wound management. Hypochlorous acid has been shown to be an effective agent in reducing wound bacterial counts in open wounds. Ultrasound-enabled wound debridement is an effective and efficient method of debridement. This study compared ultrasound irrigation with hypochlorous acid versus saline irrigation for wound debridement on pre- and postoperative wounds and determined regrowth of bacteria over 1 week period of time. Finally, the outcome of definitive wound closure of the clinically clean-appearing wounds was recorded. Methods: Seventeen consenting adult patients with chronic open wounds were randomly selected for study. The patients were randomly divided into the hypochlorous acid irrigation or saline irrigation group. All patients provided pre- and postoperative tissue samples for qualitative and quantitative bacteriology. For the time (7 days) between the debridement procedure and the definitive closure procedure, the wounds were dressed with a silver-impregnated dressing and a hydroconductive dressing. Results : Both types of irrigation in the ultrasonic system initially lowered the bacterial counts by 4 to 6 logs. However, by the time of definitive closure, the saline-irrigated wounds had bacterial counts back up to 10 5 whereas the hypochlorous acid-irrigated wounds remained at 10 2 or fewer. More than 80% of patients in the saline group had postoperative closure failure compared with 25% of patients in the hypochlorous acid group. Conclusions: Hypochlorous acid irrigation with ultrasound debridement reduced bacterial growth in chronic open wounds more efficiently than saline alone. Postoperative wound closure outcomes suggest a remarkable reduction in wound complications after wound debridement using hypochlorous acid irrigation with ultrasound versus saline alone.

Amoeba host-Legionella synchronization of amino acid auxotrophy and its role in bacterial adaptation and pathogenic evolution

PubMed Central

Price, Christopher T. D.; Richards, Ashley M.; Von Dwingelo, Juanita E.; Samara, Hala A.; Kwaik, Yousef Abu

2013-01-01

Summary Legionella pneumophila, the causative agent of Legionnaires’ disease, invades and proliferates within a diverse range of free-living amoeba in the environment but upon transmission to humans the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. L. pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. PMID:24112119

Biomimetic/Optical Sensors for Detecting Bacterial Species

NASA Technical Reports Server (NTRS)

Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth

2006-01-01

Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites

Vaginal lactobacilli inhibiting growth of Gardnerella vaginalis, Mobiluncus and other bacterial species cultured from vaginal content of women with bacterial vaginosis.

PubMed

Skarin, A; Sylwan, J

1986-12-01

On a solid agar medium the growth-inhibitory effect of 9 Lactobacillus strains cultured from vaginal content was tested on bacteria cultured from vaginal content of women with bacterial vaginosis: Mobiluncus, Gardnerella vaginalis, Bacteroides and anaerobic cocci. Inhibition zones were observed in the growth of all of the strains isolated from women with bacterial vaginosis around all lactobacilli. The inhibitory effect of the lactobacilli was further tested on various anaerobic and facultatively anaerobic species, both type strains and fresh extragenitally cultured strains. Four Bacteroides fragilis strains as well as 2 out of 4 Staphylococcus aureus strains were clearly inhibited by the lactobacilli. The inhibition zones were generally wider at pH 5.5 than at 6.0. For all inhibited strains, (the S. aureus excepted) a low pH on the agar around the lactobacilli correlated to wider growth-inhibition zones.

Light-Stimulated Bacterial Production and Amino Acid Assimilation by Cyanobacteria and Other Microbes in the North Atlantic Ocean▿

PubMed Central

Michelou, Vanessa K.; Cottrell, Matthew T.; Kirchman, David L.

2007-01-01

We examined the contribution of photoheterotrophic microbes—those capable of light-mediated assimilation of organic compounds—to bacterial production and amino acid assimilation along a transect from Florida to Iceland from 28 May to 9 July 2005. Bacterial production (leucine incorporation at a 20 nM final concentration) was on average 30% higher in light than in dark-incubated samples, but the effect varied greatly (3% to 60%). To further characterize this light effect, we examined the abundance of potential photoheterotrophs and measured their contribution to bacterial production and amino acid assimilation (0.5 nM addition) using flow cytometry. Prochlorococcus and Synechococcus were abundant in surface waters where light-dependent leucine incorporation was observed, whereas aerobic anoxygenic phototrophic bacteria were abundant but did not correlate with the light effect. The per-cell assimilation rates of Prochlorococcus and Synechococcus were comparable to or higher than those of other prokaryotes, especially in the light. Picoeukaryotes also took up leucine (20 nM) and other amino acids (0.5 nM), but rates normalized to biovolume were much lower than those of prokaryotes. Prochlorococcus was responsible for 80% of light-stimulated bacterial production and amino acid assimilation in surface waters south of the Azores, while Synechococcus accounted for on average 12% of total assimilation. However, nearly 40% of the light-stimulated leucine assimilation was not accounted for by these groups, suggesting that assimilation by other microbes is also affected by light. Our results clarify the contribution of cyanobacteria to photoheterotrophy and highlight the potential role of other photoheterotrophs in biomass production and dissolved-organic-matter assimilation. PMID:17630296

Bacterial growth rates are influenced by cellular characteristics of individual species when immersed in electromagnetic fields.

PubMed

Tessaro, Lucas W E; Murugan, Nirosha J; Persinger, Michael A

2015-03-01

Previous studies have shown that exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) have negative effects on the rate of growth of bacteria. In the present study, two Gram-positive and two Gram-negative species were exposed to six magnetic field conditions in broth cultures. Three variations of the 'Thomas' pulsed frequency-modulated pattern; a strong-static "puck" magnet upwards of 5000G in intensity; a pair of these magnets rotating opposite one another at ∼30rpm; and finally a strong dynamic magnetic field generator termed the 'Resonator' with an average intensity of 250μT were used. Growth rate was discerned by optical density (OD) measurements every hour at 600nm. ELF-EMF conditions significantly affected the rates of growth of the bacterial cultures, while the two static magnetic field conditions were not statistically significant. Most interestingly, the 'Resonator' dynamic magnetic field increased the rates of growth of three species (Staphylococcus epidermidis, Staphylococcus aureus, and Escherichia coli), while slowing the growth of one (Serratia marcescens). We suggest that these effects are due to individual biophysical characteristics of the bacterial species. Copyright © 2015 Elsevier GmbH. All rights reserved.

Antarctic ice core samples: culturable bacterial diversity.

PubMed

Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R

2013-01-01

Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Role of lauric acid-potassium hydroxide concentration on bacterial contamination of spray washed broiler carcasses

USDA-ARS?s Scientific Manuscript database

A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...

Ohr plays a central role in bacterial responses against fatty acid hydroperoxides and peroxynitrite

PubMed Central

Alegria, Thiago G. P.; Hugo, Martín; Trujillo, Madia; de Oliveira, Marcos Antonio; Miyamoto, Sayuri; Queiroz, Raphael F.; Valadares, Napoleão Fonseca; Garratt, Richard C.; Radi, Rafael; Di Mascio, Paolo; Augusto, Ohara

2017-01-01

Organic hydroperoxide resistance (Ohr) enzymes are unique Cys-based, lipoyl-dependent peroxidases. Here, we investigated the involvement of Ohr in bacterial responses toward distinct hydroperoxides. In silico results indicated that fatty acid (but not cholesterol) hydroperoxides docked well into the active site of Ohr from Xylella fastidiosa and were efficiently reduced by the recombinant enzyme as assessed by a lipoamide-lipoamide dehydrogenase–coupled assay. Indeed, the rate constants between Ohr and several fatty acid hydroperoxides were in the 107–108 M−1⋅s−1 range as determined by a competition assay developed here. Reduction of peroxynitrite by Ohr was also determined to be in the order of 107 M−1⋅s−1 at pH 7.4 through two independent competition assays. A similar trend was observed when studying the sensitivities of a ∆ohr mutant of Pseudomonas aeruginosa toward different hydroperoxides. Fatty acid hydroperoxides, which are readily solubilized by bacterial surfactants, killed the ∆ohr strain most efficiently. In contrast, both wild-type and mutant strains deficient for peroxiredoxins and glutathione peroxidases were equally sensitive to fatty acid hydroperoxides. Ohr also appeared to play a central role in the peroxynitrite response, because the ∆ohr mutant was more sensitive than wild type to 3-morpholinosydnonimine hydrochloride (SIN-1 , a peroxynitrite generator). In the case of H2O2 insult, cells treated with 3-amino-1,2,4-triazole (a catalase inhibitor) were the most sensitive. Furthermore, fatty acid hydroperoxide and SIN-1 both induced Ohr expression in the wild-type strain. In conclusion, Ohr plays a central role in modulating the levels of fatty acid hydroperoxides and peroxynitrite, both of which are involved in host–pathogen interactions. PMID:28028230

Bacterial populations associated with the dirty area of a South African poultry abattoir.

PubMed

Geornaras, I; de Jesus, A E; von Holy, A

1998-06-01

Bacterial populations associated with three sample types from the neck region of poultry carcasses in the dirty area of an abattoir were characterized. Sample types before and after scalding were skin only, feathers only, and a skin and feather combination. The neck skin of carcasses after the defeathering processing stage was also sampled. Bacterial populations associated with water from the scald tank, rubber fingers at the exit of the defeathering machine, and air in the dirty area were also characterized. Bacterial colonies (751) were randomly isolated from yeast extract-supplemented tryptone soya agar plates exhibiting 30 to 300 colonies. Micrococcus spp. were isolated in the highest proportion from pre-and postscalded carcass samples (63.5 to 86.1% of isolates), regardless of the sample type. Conversely, Enterobacteriaceae (40.3%), Acinetobacter (19.4%), and Aeromonas/Vibrio (12.5%) species predominated on neck skin samples taken from mechanically defeathered carcasses. Isolates from the rubber fingers were, however, predominantly Micrococcus spp. (94.4%). Bacterial groups isolated in the highest proportion from scald tank water samples were Micrococcus spp. (38.3%), species of Enterobacteriaceae (29.1%), and lactic acid bacteria (17.0%). Corynebacterium spp., species of Enterobacteriaceae, and Micrococcus spp. were dominant on air settle plates.

A Cross-Sectional Survey of Bacterial Species in Plaque from Client Owned Dogs with Healthy Gingiva, Gingivitis or Mild Periodontitis

PubMed Central

Davis, Ian J.; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen

2013-01-01

Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease. PMID:24349448

A cross-sectional survey of bacterial species in plaque from client owned dogs with healthy gingiva, gingivitis or mild periodontitis.

PubMed

Davis, Ian J; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen

2013-01-01

Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease.

Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species

PubMed Central

Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao

2016-01-01

Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804

Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer

USGS Publications Warehouse

Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.

2009-01-01

Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an

Bacterial D-Amino Acids Suppress Sinonasal Innate Immunity Through Sweet Taste Receptors in Solitary Chemosensory Cells

PubMed Central

Lee, Robert J.; Hariri, Benjamin M.; McMahon, Derek B.; Chen, Bei; Doghramjii, Laurel; Adappa, Nithin D.; Palmer, James N.; Kennedy, David W.; Jiang, Peihua; Margolskee, Robert F.; Cohen, Noam A.

2017-01-01

In the upper respiratory epithelium, bitter and sweet taste receptors present in solitary chemosensory cells influence antimicrobial innate immune defense responses. Whereas activation of the bitter taste receptor (T2R) stimulates surrounding epithelial cells to release antimicrobial peptides, activation of the sweet taste receptor (T1R) in the same cells inhibits this response. It is thought that this mechanism exists to control the magnitude of antimicrobial peptide release based upon the sugar content of airway surface liquid. We hypothesized that D-amino acids, which are produced by various bacteria and activate T1R in taste receptor cells in the mouth, may also activate T1R in the airway. Here, we show that both the T1R2 and T1R3 subunits of the sweet taste receptor (T1R2/3) are present in the same chemosensory cells of primary human sinonasal epithelial cultures. Respiratory isolates of Staphylococcus species, but not Pseudomonas aeruginosa, produced at least two D-amino acids that activate the sweet taste receptor. In addition to inhibiting P. aeruginosa biofilm formation, D-amino acids derived from Staphylococcus inhibited T2R-mediated signaling and defensin secretion in sinonasal cells by activating T1R2/3. D-amino acid–mediated activation of T1R2/3 also enhanced epithelial cell death during challenge with Staphylococcus aureus in the presence of the bitter-receptor–activating compound denatonium benzoate. These data establish a potential mechanism for interkingdom signaling in the airway mediated by bacterial D-amino acids and the mammalian sweet taste receptor in airway chemosensory cells. PMID:28874606

Phospholipid-derived fatty acids and quinones as markers for bacterial biomass and community structure in marine sediments.

PubMed

Kunihiro, Tadao; Veuger, Bart; Vasquez-Cardenas, Diana; Pozzato, Lara; Le Guitton, Marie; Moriya, Kazuyoshi; Kuwae, Michinobu; Omori, Koji; Boschker, Henricus T S; van Oevelen, Dick

2014-01-01

Phospholipid-derived fatty acids (PLFA) and respiratory quinones (RQ) are microbial compounds that have been utilized as biomarkers to quantify bacterial biomass and to characterize microbial community structure in sediments, waters, and soils. While PLFAs have been widely used as quantitative bacterial biomarkers in marine sediments, applications of quinone analysis in marine sediments are very limited. In this study, we investigated the relation between both groups of bacterial biomarkers in a broad range of marine sediments from the intertidal zone to the deep sea. We found a good log-log correlation between concentrations of bacterial PLFA and RQ over several orders of magnitude. This relationship is probably due to metabolic variation in quinone concentrations in bacterial cells in different environments, whereas PLFA concentrations are relatively stable under different conditions. We also found a good agreement in the community structure classifications based on the bacterial PLFAs and RQs. These results strengthen the application of both compounds as quantitative bacterial biomarkers. Moreover, the bacterial PLFA- and RQ profiles revealed a comparable dissimilarity pattern of the sampled sediments, but with a higher level of dissimilarity for the RQs. This means that the quinone method has a higher resolution for resolving differences in bacterial community composition. Combining PLFA and quinone analysis as a complementary method is a good strategy to yield higher resolving power in bacterial community structure.

Antimicrobial and immune modulatory effects of lactic acid and short chain fatty acids produced by vaginal microbiota associated with eubiosis and bacterial vaginosis

PubMed Central

Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda

2015-01-01

Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720

Korean indigenous bacterial species with valid names belonging to the phylum Actinobacteria.

PubMed

Bae, Kyung Sook; Kim, Mi Sun; Lee, Ji Hee; Kang, Joo Won; Kim, Dae In; Lee, Ji Hee; Seong, Chi Nam

2016-12-01

, Gyeonggi, Jeonnam, Daejeon, and Chungnam. A large number of novel actinobacterial species continue to be discovered since the Korean government is encouraging the search for new bacterial species and researchers are endeavoring to find out novel strains from extreme or untapped environments.

Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.

PubMed

Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S

2014-01-01

The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit.

Amoeba host-Legionella synchronization of amino acid auxotrophy and its role in bacterial adaptation and pathogenic evolution.

PubMed

Price, Christopher T D; Richards, Ashley M; Von Dwingelo, Juanita E; Samara, Hala A; Abu Kwaik, Yousef

2014-02-01

Legionella pneumophila, the causative agent of Legionnaires' disease, invades and proliferates within a diverse range of free-living amoeba in the environment, but upon transmission to humans, the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host, but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. Legionella pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.

Sphagnum mosses harbour highly specific bacterial diversity during their whole lifecycle.

PubMed

Bragina, Anastasia; Berg, Christian; Cardinale, Massimiliano; Shcherbakov, Andrey; Chebotar, Vladimir; Berg, Gabriele

2012-04-01

Knowledge about Sphagnum-associated microbial communities, their structure and their origin is important to understand and maintain climate-relevant Sphagnum-dominated bog ecosystems. We studied bacterial communities of two cosmopolitan Sphagnum species, which are well adapted to different abiotic parameters (Sphagnum magellanicum, which are strongly acidic and ombrotrophic, and Sphagnum fallax, which are weakly acidic and mesotrophic), in three Alpine bogs in Austria by a multifaceted approach. Great differences between bacterial fingerprints of both Sphagna were found independently from the site. This remarkable specificity was confirmed by a cloning and a deep sequencing approach. Besides the common Alphaproteobacteria, we found a discriminative spectrum of bacteria; although Gammaproteobacteria dominated S. magellanicum, S. fallax was mainly colonised by Verrucomicrobia and Planctomycetes. Using this information for fluorescent in situ hybridisation analyses, corresponding colonisation patterns for Alphaproteobacteria and Planctomycetes were detected. Bacterial colonies were found in high abundances inside the dead big hyalocytes, but they were always connected with the living chlorocytes. Using multivariate statistical analysis, the abiotic factors nutrient richness and pH were identified to modulate the composition of Sphagnum-specific bacterial communities. Interestingly, we found that the immense bacterial diversity was transferred via the sporophyte to the gametophyte, which can explain the high specificity of Sphagnum-associated bacteria over long distances. In contrast to higher plants, which acquire their bacteria mainly from the environment, mosses as the phylogenetically oldest land plants maintain their bacterial diversity within the whole lifecycle.

Sphagnum mosses harbour highly specific bacterial diversity during their whole lifecycle

PubMed Central

Bragina, Anastasia; Berg, Christian; Cardinale, Massimiliano; Shcherbakov, Andrey; Chebotar, Vladimir; Berg, Gabriele

2012-01-01

Knowledge about Sphagnum-associated microbial communities, their structure and their origin is important to understand and maintain climate-relevant Sphagnum-dominated bog ecosystems. We studied bacterial communities of two cosmopolitan Sphagnum species, which are well adapted to different abiotic parameters (Sphagnum magellanicum, which are strongly acidic and ombrotrophic, and Sphagnum fallax, which are weakly acidic and mesotrophic), in three Alpine bogs in Austria by a multifaceted approach. Great differences between bacterial fingerprints of both Sphagna were found independently from the site. This remarkable specificity was confirmed by a cloning and a deep sequencing approach. Besides the common Alphaproteobacteria, we found a discriminative spectrum of bacteria; although Gammaproteobacteria dominated S. magellanicum, S. fallax was mainly colonised by Verrucomicrobia and Planctomycetes. Using this information for fluorescent in situ hybridisation analyses, corresponding colonisation patterns for Alphaproteobacteria and Planctomycetes were detected. Bacterial colonies were found in high abundances inside the dead big hyalocytes, but they were always connected with the living chlorocytes. Using multivariate statistical analysis, the abiotic factors nutrient richness and pH were identified to modulate the composition of Sphagnum-specific bacterial communities. Interestingly, we found that the immense bacterial diversity was transferred via the sporophyte to the gametophyte, which can explain the high specificity of Sphagnum-associated bacteria over long distances. In contrast to higher plants, which acquire their bacteria mainly from the environment, mosses as the phylogenetically oldest land plants maintain their bacterial diversity within the whole lifecycle. PMID:22094342

Differentiation of some species of Neisseriaceae and other bacterial groups by DNA-DNA hybridization.

PubMed

Tønjum, T; Bukholm, G; Bøvre, K

1989-05-01

DNA-DNA hybridization using total genomic DNA probes may represent a way of differentiating between miscellaneous bacterial species. This was studied with type and reference strains of 20 species in Moraxella, Kingella, and other selected Gram-negative groups. Both radioactive and biotin labelling were employed. Most of the species examined were easily distinguished, such as Moraxella (Branhamella) catarrhalis, M.(B.) ovis, M. atlantae, M. phenylpyruvica, M. osloensis, Neisseria elongata, N. meningitidis, Kingella kingae, K. indologenes, K. dentrificans, Oligella urethralis, Eikenella corrodens, Cardiobacterium hominis, Haemophilus aphrophilus, Actinobacillus actinomycetemcomitans, Gardnerella vaginalis, and DF-2. This reflected the extent of the genetic distances between them as a basis for identification by hybridization. There was some clustering in the Moraxella group. Especially the closely related Moraxella nonliquefaciens, M. lacunata and M. bovis showed strong hybridization affinities. This leads to potential problems in distinguishing these three species from each other by DNA-DNA hybridization with total genomic probes alone.

Time series analysis of aerobic bacterial flora during Miso fermentation.

PubMed

Onda, T; Yanagida, F; Tsuji, M; Shinohara, T; Yokotsuka, K

2003-01-01

This article reports a microbiological study of aerobic mesophilic bacteria that are present during the fermentation process of Miso. Aerobic bacteria were enumerated and isolated from Miso during fermentation and divided into nine groups using traditional phenotypic tests. The strains were identified by biochemical analysis and 16S rRNA sequence analysis. They were identified as Bacillus subtilis, B. amyloliquefaciens, Kocuria kristinae, Staphylococcus gallinarum and S. kloosii. All strains were sensitive to the bacteriocins produced by the lactic acid bacteria isolated from Miso. The dominant species among the undesirable species throughout the fermentation process were B. subtilis and B. amyloliquefaciens. It is suggested that bacteriocin-producing lactic acid bacteria are effective in the growth prevention of aerobic bacteria in Miso. This study has provided useful information for controlling of bacterial flora during Miso fermentation.

Bacterial community dynamics in a biodenitrification reactor packed with polylactic acid/poly (3-hydroxybutyrate-co-3-hydroxyvalerate) blend as the carbon source and biofilm carrier.

PubMed

Qiu, Tianlei; Xu, Ying; Gao, Min; Han, Meilin; Wang, Xuming

2017-05-01

While heterotrophic denitrification has been widely used for treating such nitrogen-rich wastewater, it requires the use of additional carbon sources. With fluctuations in the nitrate concentration in the influent, controlling the C/N ratio to avoid carbon breakthrough becomes difficult. To overcome this obstacle, solid-phase denitrification (SPD) using biodegradable polymers has been used, where denitrification and carbon source biodegradation depend on microorganisms growing within the reactor. However, the microbial community dynamics in continuous-flow SPD reactors have not been fully elucidated yet. Here, we aimed to study bacterial community dynamics in a biodenitrification reactor packed with a polylactic acid/poly (3-hydroxybutyrate-co-3-hydroxyvalerate) (PLA/PHBV) blend as the carbon source and biofilm carrier. A lab-scale denitrifying reactor filled with a PLA/PHBV blend was used. With 85 mg/L of influent NO 3 -N concentration and a hydraulic retention time (HRT) of 2.5 h, more than 92% of the nitrate was removed. The bacterial community of inoculated activated sludge had the highest species richness in all samples. Bacterial species diversity in the reactor first decreased and then increased to a stable level. Diaphorobacter species were predominant in the reactor after day 24. In total, 178 clones were retrieved from the 16S rRNA gene clone library constructed from the biofilm samples in the reactor at 62 days of operation, and 80.9% of the clones were affiliated with Betaproteobacteria. Of these, 97.2% were classified into phylotypes corresponding to Diaphorobacter nitroreducens strain NA10B with 99% sequence similarity. Diaphorobacter, Rhizobium, Acidovorax, Rubrivivax, Azospira, Thermomonas, and Acidaminobacter constituted the biofilm microflora in the stably running reactor. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Interaction of Atmospheric-Pressure Air Microplasmas with Amino Acids as Fundamental Processes in Aqueous Solution

PubMed Central

Zhou, Renwu; Zhou, Rusen; Zhuang, Jinxing; Zong, Zichao; Zhang, Xianhui; Liu, Dongping; Bazaka, Kateryna; Ostrikov, Kostya

2016-01-01

Plasma medicine is a relatively new field that investigates potential applications of cold atmospheric-pressure plasmas in bioengineering, such as for bacterial inactivation and degradation of organic molecules in water. In order to enunciate mechanisms of bacterial inactivation at molecular or atomic levels, we investigated the interaction of atmospheric-pressure air microplasmas with amino acids in aqueous solution by using high-resolution mass spectrometry (HRMS). Results show that the oxidation effect of plasma-induced species on the side chains of the amino acids can be categorized into four types, namely hydroxylation, nitration, dehydrogenation and dimerization. In addition, relative activities of amino acids resulting from plasma treatment come in descending order as follows: sulfur-containing carbon-chain amino acids > aromatic amino acids > five-membered ring amino acids > basic carbon-chain amino acids. Since amino acids are building blocks of proteins vital to the growth and reproduction of bacteria, these results provide an insight into the mechanism of bacterial inactivation by plasma. PMID:27183129

Bacterial utilization of L-sugars and D-amino acids

NASA Astrophysics Data System (ADS)

Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

2006-08-01

The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

Bacterial communities in floral nectar.

PubMed

Fridman, Svetlana; Izhaki, Ido; Gerchman, Yoram; Halpern, Malka

2012-02-01

Floral nectar is regarded as the most important reward available to animal-pollinated plants to attract pollinators. Despite the vast amount of publications on nectar properties, the role of nectar as a natural bacterial habitat is yet unexplored. To gain a better understanding of bacterial communities inhabiting floral nectar, culture-dependent and -independent (454-pyrosequencing) methods were used. Our findings demonstrate that bacterial communities in nectar are abundant and diverse. Using culture-dependent method we showed that bacterial communities of nectar displayed significant variation among three plant species: Amygdalus communis, Citrus paradisi and Nicotiana glauca. The dominant class in the nectar bacterial communities was Gammaproteobacteria. About half of the isolates were novel species (< 97% similarities of the 16S rRNA gene with known species). Using 454-pyrosequencing we demonstrated that nectar microbial community are distinct for each of the plant species while there are no significant differences between nectar microbial communities within nectars taken from different plants of the same species. Primary selection of the nectar bacteria is unclear; it may be affected by variations in the chemical composition of the nectar in each plant. The role of the rich and diverse nectar microflora in the attraction-repulsion relationships between the plant and its nectar consumers has yet to be explored. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.

Efficient aquatic bacterial metabolism of dissolved low-molecular-weight compounds from terrestrial sources.

PubMed

Berggren, Martin; Laudon, Hjalmar; Haei, Mahsa; Ström, Lena; Jansson, Mats

2010-03-01

Carboxylic acids (CAs), amino acids (AAs) and carbohydrates (CHs) in dissolved free forms can be readily assimilated by aquatic bacteria and metabolized at high growth efficiencies. Previous studies have shown that these low-molecular-weight (LMW) substrates are released by phytoplankton but also that unidentified LMW compounds of terrestrial origin is a subsidy for bacterial metabolism in unproductive freshwater systems. We tested the hypothesis that different terrestrially derived CA, AA and CH compounds can offer substantial support for aquatic bacterial metabolism in fresh waters that are dominated by allochthonous dissolved organic matter (DOM). Drainage water from three catchments of different characters in the Krycklan experimental area in Northern Sweden were studied at the rising and falling limb of the spring flood, using a 2-week bioassay approach. A variety of CA, AA and CH compounds were significantly assimilated by bacteria, meeting 15-100% of the bacterial carbon demand and explaining most of the observed variation in bacterial growth efficiency (BGE; R(2)=0.66). Of the 29 chemical species that was detected, acetate was the most important, representing 45% of the total bacterial consumption of all LMW compounds. We suggest that LMW organic compounds in boreal spring flood drainage could potentially support all in situ bacterial production in receiving lake waters during periods of weeks to months after the spring flood.

Spatial and temporal features of the growth of a bacterial species colonizing the zebrafish gut.

PubMed

Jemielita, Matthew; Taormina, Michael J; Burns, Adam R; Hampton, Jennifer S; Rolig, Annah S; Guillemin, Karen; Parthasarathy, Raghuveer

2014-12-16

The vertebrate intestine is home to microbial ecosystems that play key roles in host development and health. Little is known about the spatial and temporal dynamics of these microbial communities, limiting our understanding of fundamental properties, such as their mechanisms of growth, propagation, and persistence. To address this, we inoculated initially germ-free zebrafish larvae with fluorescently labeled strains of an Aeromonas species, representing an abundant genus in the zebrafish gut. Using light sheet fluorescence microscopy to obtain three-dimensional images spanning the gut, we quantified the entire bacterial load, as founding populations grew from tens to tens of thousands of cells over several hours. The data yield the first ever measurements of the growth kinetics of a microbial species inside a live vertebrate intestine and show dynamics that robustly fit a logistic growth model. Intriguingly, bacteria were nonuniformly distributed throughout the gut, and bacterial aggregates showed considerably higher growth rates than did discrete individuals. The form of aggregate growth indicates intrinsically higher division rates for clustered bacteria, rather than surface-mediated agglomeration onto clusters. Thus, the spatial organization of gut bacteria both relative to the host and to each other impacts overall growth kinetics, suggesting that spatial characterizations will be an important input to predictive models of host-associated microbial community assembly. Our intestines are home to vast numbers of microbes that influence many aspects of health and disease. Though we now know a great deal about the constituents of the gut microbiota, we understand very little about their spatial structure and temporal dynamics in humans or in any animal: how microbial populations establish themselves, grow, fluctuate, and persist. To address this, we made use of a model organism, the zebrafish, and a new optical imaging technique, light sheet fluorescence microscopy

Influence of fluoride on the bacterial composition of a dual-species biofilm composed of Streptococcus mutans and Streptococcus oralis.

PubMed

Jung, Ji-Eun; Cai, Jian-Na; Cho, Sung-Dae; Song, Kwang-Yeob; Jeon, Jae-Gyu

2016-10-01

Despite the widespread use of fluoride for the prevention of dental caries, few studies have demonstrated the effects of fluoride on the bacterial composition of dental biofilms. This study investigated whether fluoride affects the proportion of Streptococcus mutans and S. oralis in mono- and dual-species biofilm models, via microbiological, biochemical, and confocal fluorescence microscope studies. Fluoride did not affect the bacterial count and bio-volume of S. mutans and S. oralis in mono-species biofilms, except for the 24-h-old S. mutans biofilms. However, fluoride reduced the proportion and bio-volume of S. mutans but did not decrease those of S. oralis during both S. oralis and S. mutans dual-species biofilm formation, which may be related to the decrease in extracellular polysaccharide formation by fluoride. These results suggest that fluoride may prevent the shift in the microbial proportion to cariogenic bacteria in dental biofilms, subsequently inhibiting the cariogenic bacteria dominant biofilm formation.

Comparative analysis of the intestinal bacterial communities in different species of carp by pyrosequencing.

PubMed

Li, Tongtong; Long, Meng; Gatesoupe, François-Joël; Zhang, Qianqian; Li, Aihua; Gong, Xiaoning

2015-01-01

Gut microbiota is increasingly regarded as an integral component of the host, due to important roles in the modulation of the immune system, the proliferation of the intestinal epithelium and the regulation of the dietary energy intake. Understanding the factors that influence the composition of these microbial communities is essential to health management, and the application to aquatic animals still requires basic investigation. In this study, we compared the bacterial communities harboured in the intestines and in the rearing water of grass carp (Ctenopharyngodon idellus), crucian carp (Carassius cuvieri), and bighead carp (Hypophthalmichthys nobilis), by using 454-pyrosequencing with barcoded primers targeting the V4 to V5 regions of the bacterial 16S rRNA gene. The specimens of the three species were cohabiting in the same pond. Between 6,218 and 10,220 effective sequences were read from each sample, resulting in a total of 110,398 sequences for 13 samples from gut microbiota and pond water. In general, the microbial communities of the three carps were dominated by Fusobacteria, Firmicutes, Proteobacteria and Bacteroidetes, but the abundance of each phylum was significantly different between species. At the genus level, the overwhelming group was Cetobacterium (97.29 ± 0.46 %) in crucian carp, while its abundance averaged c. 40 and 60 % of the sequences read in the other two species. There was higher microbial diversity in the gut of filter-feeding bighead carp than the gut of the two other species, with grazing feeding habits. The composition of intestine microbiota of grass carp and crucian carp shared higher similarity when compared with bighead carp. The principal coordinates analysis (PCoA) with the weighted UniFrac distance and the heatmap analysis suggested that gut microbiota was not a simple reflection of the microbial community in the local habitat but resulted from species-specific selective pressures, possibly dependent on behavioural, immune

Species richness in soil bacterial communities: a proposed approach to overcome sample size bias.

PubMed

Youssef, Noha H; Elshahed, Mostafa S

2008-09-01

Estimates of species richness based on 16S rRNA gene clone libraries are increasingly utilized to gauge the level of bacterial diversity within various ecosystems. However, previous studies have indicated that regardless of the utilized approach, species richness estimates obtained are dependent on the size of the analyzed clone libraries. We here propose an approach to overcome sample size bias in species richness estimates in complex microbial communities. Parametric (Maximum likelihood-based and rarefaction curve-based) and non-parametric approaches were used to estimate species richness in a library of 13,001 near full-length 16S rRNA clones derived from soil, as well as in multiple subsets of the original library. Species richness estimates obtained increased with the increase in library size. To obtain a sample size-unbiased estimate of species richness, we calculated the theoretical clone library sizes required to encounter the estimated species richness at various clone library sizes, used curve fitting to determine the theoretical clone library size required to encounter the "true" species richness, and subsequently determined the corresponding sample size-unbiased species richness value. Using this approach, sample size-unbiased estimates of 17,230, 15,571, and 33,912 were obtained for the ML-based, rarefaction curve-based, and ACE-1 estimators, respectively, compared to bias-uncorrected values of 15,009, 11,913, and 20,909.

A role for bacterial urease in gut dysbiosis and Crohn’s disease

PubMed Central

Ni, Josephine; Shen, Ting-Chin David; Chen, Eric Z.; Bittinger, Kyle; Bailey, Aubrey; Roggiani, Manuela; Sirota-Madi, Alexandra; Friedman, Elliot S.; Chau, Lillian; Lin, Andrew; Nissim, Ilana; Scott, Justin; Lauder, Abigail; Hoffmann, Christian; Rivas, Gloriany; Albenberg, Lindsey; Baldassano, Robert N.; Braun, Jonathan; Xavier, Ramnik J.; Clish, Clary B.; Yudkoff, Marc; Li, Hongzhe; Goulian, Mark; Bushman, Frederic D.; Lewis, James D.; Wu, Gary D.

2018-01-01

Gut dysbiosis during inflammatory bowel disease involves alterations in the gut microbiota associated with inflammation of the host gut. We used a combination of shotgun metagenomic sequencing and metabolomics to analyze fecal samples from pediatric patients with Crohn’s disease and found an association between disease severity, gut dysbiosis, and bacterial production of free amino acids. Nitrogen flux studies using 15N in mice showed that activity of bacterial urease, an enzyme that releases ammonia by hydrolysis of host urea, led to the transfer of murine host-derived nitrogen to the gutmicrobiota where it was used for amino acid synthesis. Inoculation of a conventional murine host (pretreated with antibiotics and polyethylene glycol) with commensal Escherichia coli engineered to express urease led to dysbiosis of the gut microbiota, resulting in a predominance of Proteobacteria species. This was associated with a worsening of immune-mediated colitis in these animals. A potential role for altered urease expression and nitrogen flux in the development of gut dysbiosis suggests that bacterial urease may be a potential therapeutic target for inflammatory bowel diseases. PMID:29141885

In vitro pollen responses of two birch species to acidity and temperature

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, R.N.; Cox, R.M.

Paper birch (Betula papyrifera Marsh.) and mountain paper birch (Betula cordifolia Regel) near the Bay of Fundy coast frequently intercept acidic advection marine fogs. Chemical deposition by these fogs is thought to be a factor contributing to the observed foliar browning symptoms associated with a marked deterioration of these trees in the area. In vitro experiments were performed to test whether pollen germination in these two birch species would be affected by acidity at levels routinely found in the fog. The combined effect of temperature with acidity was also examined. Pollen germination in both species was inhibited below pH 5.6more » (P < 0.0001) and the effect of incubation temperature was also significant (P < 0.01) in both species. There was no difference in in vitro pollen germination between species (P > 0.05) in response to acidity, based on combined data from 12 trees of each; the optimum germination temperature was 22{degrees}C for B. papyrifera and 21{degrees}C for B. cordifolia.« less

Bacterial adhesion to orthopedic implant polymers.

PubMed

Barton, A J; Sagers, R D; Pitt, W G

1996-03-01

The degradable polymers poly(orthoester) (POE), poly(L-lactic acid) (PLA), and the nondegradable polymers polysulfone (PSF), polyethylene (PE), and poly(ether ether ketone) (PEEK) were exposed to cultures of Staphylococcus epidermidis, Pseudomonas aeruginosa, or Escherichia coli. Bacteria washed and resuspended in phosphate buffered saline (PBS) adhered to polymers in amounts nearly twice those of bacteria that were left in their growth medium, tryptic soy broth (TSB). In TSB, there was variation in adhesion from species to species, but no significant variation from polymer to polymer within one species. In PBS there were significant differences in the amounts of bacteria adhering to the various polymers with the exception, of S. epidermidis, which had similar adhesion to all polymers. As a whole, P. aeruginosa was the most adherent while S. epidermidis was the least adherent. The estimated values of the free energy of adhesion (delta Fadh) correlated with the amount of adherent P. aeruginosa. When POE, PLA, and PSF were exposed to hyaluronic acid (HA) before exposure to the bacteria, there was 50% more adhesion of E. coli and P. aeruginosa on POE and PLA. With respect to bacterial adhesion, the biodegradable polymers (POE and PLA) in general were not significantly different from the nondegradable polymers.

Culture-independent bacterial community analysis of the salty-fermented fish paste products of Thailand and Laos.

PubMed

Marui, Junichiro; Boulom, Sayvisene; Panthavee, Wanchai; Momma, Mari; Kusumoto, Ken-Ichi; Nakahara, Kazuhiko; Saito, Masayoshi

2015-01-01

A bacterial community analysis, using a culture-independent method (polymerase chain reaction-denaturing gradient gel electrophoresis), detected 17 species of bacteria including species of the genera Tetragenococcus, Lactobacillus, Pediococcus, Weissella Halanaerobium, Clostridium, and Sphingomonas in a traditional salty-fermented fish paste known as pla-ra or pa-daek in Thailand and Laos, which is used as a storage-stable multi-purpose seasoning. The representative genus of lactic acid bacteria seemed to vary in the 10 products collected from Thailand and Laos. Tetragenococci were common in products from central Thailand and Vientiane in Laos which had salinities of not less than 11% and pH values ranging from 5.6 to 6.1. However, lactobacilli were common in products from northern Thailand which had the lowest salinities (8.3-8.6%) and pH values (4.5-4.8) of all the samples examined. Two Lactobacillus and one Tetragenococcus species were detected in one product from northeastern Thailand containing 10% salt. These results suggest that salinity in pla-ra/pa-daek is an important determinant of the representative genus of lactic acid bacteria such as, Tetragenococcus or Lactobacillus. Additionally, differences in the acidity between these two groups seemed to be related to the production of d-/l-lactic acid in the lactic acid bacteria in each product. This is the first study to report a correlation between bacterial community structure and taste components in pla-ra/pa-daek products from various regions. This scientific work on a traditional fermented food will be useful in helping local producers meet differing consumer preferences in various regions.

Magnetic resonance tells microbiology where to go; bacterial teichoic acid protects liquid water at sub-zero temperatures

NASA Astrophysics Data System (ADS)

Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.

2008-08-01

Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.

Impact of Cropping Systems, Soil Inoculum, and Plant Species Identity on Soil Bacterial Community Structure.

PubMed

Ishaq, Suzanne L; Johnson, Stephen P; Miller, Zach J; Lehnhoff, Erik A; Olivo, Sarah; Yeoman, Carl J; Menalled, Fabian D

2017-02-01

Farming practices affect the soil microbial community, which in turn impacts crop growth and crop-weed interactions. This study assessed the modification of soil bacterial community structure by organic or conventional cropping systems, weed species identity [Amaranthus retroflexus L. (redroot pigweed) or Avena fatua L. (wild oat)], and living or sterilized inoculum. Soil from eight paired USDA-certified organic and conventional farms in north-central Montana was used as living or autoclave-sterilized inoculant into steam-pasteurized potting soil, planted with Am. retroflexus or Av. fatua and grown for two consecutive 8-week periods to condition soil nutrients and biota. Subsequently, the V3-V4 regions of the microbial 16S rRNA gene were sequenced by Illumina MiSeq. Treatments clustered significantly, with living or sterilized inoculum being the strongest delineating factor, followed by organic or conventional cropping system, then individual farm. Living inoculum-treated soil had greater species richness and was more diverse than sterile inoculum-treated soil (observed OTUs, Chao, inverse Simpson, Shannon, P < 0.001) and had more discriminant taxa delineating groups (linear discriminant analysis). Living inoculum soil contained more Chloroflexi and Acidobacteria, while the sterile inoculum soil had more Bacteroidetes, Firmicutes, Gemmatimonadetes, and Verrucomicrobia. Organically farmed inoculum-treated soil had greater species richness, more diversity (observed OTUs, Chao, Shannon, P < 0.05), and more discriminant taxa than conventionally farmed inoculum-treated soil. Cyanobacteria were higher in pots growing Am. retroflexus, regardless of inoculum type, for three of the four organic farms. Results highlight the potential of cropping systems and species identity to modify soil bacterial communities, subsequently modifying plant growth and crop-weed competition.

Broad-range real-time PCR assay for the rapid identification of cell-line contaminants and clinically important mollicute species.

PubMed

Störmer, Melanie; Vollmer, Tanja; Henrich, Birgit; Kleesiek, Knut; Dreier, Jens

2009-04-01

Polymerase chain reaction assays have become widely used methods of confirming the presence of Mollicutes species in clinical samples and cell cultures. We have developed a broad-range real-time PCR assay using the locked nucleic acid technology to detect mollicute species causing human infection and cell line contamination. Primers and probes specifically for the conserved regions of the mycoplasmal tuf gene (encoding elongation factor Tu) were designed. Cell culture supernatants, clinical specimens (vaginal swabs, sputum, cryopreserved heart valve tissues), and reference strains were tested for mollicute contamination as well as to exclude cross-reaction to human nucleic acids and other bacterial species. Nucleic acids were extracted using magnetic separation technology. The coamplification of the human beta2-microglobulin DNA served as an internal control. The PCR assay was highly specific and obtained an analytical sensitivity of one copy per microl sample. The 95% detection limit was calculated to 10 copies per microl sample for Mycoplasma pneumoniae and M. orale. No false-positive results were observed due to cross-reaction of walled bacterial, fungal, and human nucleic acids. To evaluate the PCR, we compared the results to two commercialized test systems. Moreover, in combination with a previously developed broad-range RT-PCR assay for the detection of bacteria in blood products, both mollicute and walled bacterial contamination can be detected simultaneously using multiplex real-time RT-PCR.

Bacterial Cellular Materials as Precursors of Chloroform

NASA Astrophysics Data System (ADS)

Wang, J.; Ng, T.; Zhang, Q.; Chow, A. T.; Wong, P.

2011-12-01

The environmental sources of chloroform and other halocarbons have been intensively investigated because their effects of stratospheric ozone destruction and environmental toxicity. It has been demonstrated that microorganisms could facilitate the biotic generation of chloroform from natural organic matters in soil, but whether the cellular materials itself also serves as an important precursor due to photo-disinfection is poorly known. Herein, seven common pure bacterial cultures (Acinetobacter junii, Aeromonas hydrophila, Bacillus cereus, Bacillus substilis, Escherichia coli, Shigella sonnei, Staphylococcus sciuri) were chlorinated to evaluate the yields of chloroform, dibromochloromethane, dichlorobromomethane, and bromoform. The effects of bromide on these chemical productions and speciations were also investigated. Results showed that, on average, 5.64-36.42 μg-chloroform /mg-C were generated during the bacterial chlorination, in similar order of magnitude to that generated by humic acid (previously reported as 78 μg-chloroform/mg-C). However, unlike humic acid in water chlorination, chloroform concentration did not simply increase with the total organic carbon in water mixture. In the presence of bromide, the yield of brominated species responded linearly to the bromide concentration. This study provides useful information to understand the contributions of chloroform from photodisinfection processes in coastal environments.

Impact of cultivation on characterisation of species composition of soil bacterial communities.

PubMed

McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.

2001-03-01

The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated

Teratogenicity of isotretinoin revisited: species variation and the role of all-trans-retinoic acid.

PubMed

Nau, H

2001-11-01

This paper reviews the teratogenicity of isotretinoin in regard to aspects of species variation, toxicokinetics, and metabolism. Particular emphasis is given to the hypothesis that most effects of isotretinoin (13-cis-retinoic acid) are mediated by isomerization to the all-trans-retinoic acid. This mechanism of action would provide a basis for the understanding of species differences and the extrapolation of experimental results to the human situation and thus improve drug development. The insensitive species (rat, mouse) eliminate the drug rapidly through detoxification to the beta-glucuronide; also, placental transfer is limited in these species. On the other hand, in sensitive species (primates), the drug is predominantly metabolized to the active 13-cis-4-oxo-retinoic acid; placental transfer is more extensive here. The beta-glucuronides showed limited placental transfer in all species examined; these metabolites exhibited very low, if any, measurable concentrations in the human. The 13-cis-retinoic acid is not appreciably bound to cellular retinoid-binding proteins or nuclear receptors and exhibits low tissue distribution and placental transfer. Its access to the nucleus may be extensive. Because of the long half life of 13-cis-retinoic acid, continuous isomerization results in significant area under the concentration-time curve levels of all-trans-retinoic acid in the mouse, monkey and the human; the all-trans-retinoic acid formed is extensively distributed across the placenta and may be an important factor that contributes to the teratogenic potency of 13-cis-retinoic acid. Isomerization cannot explain the teratogenic effects of 13-cis-retinoic acid in the rat and rabbit. It is concluded that the high teratogenic activity of isotretinoin in sensitive species (human, monkey) is related to slow elimination of the 13-cis-isomer, to metabolism to the 4-oxo-derivative, to increased placental transfer, to continuous isomerization and significant exposure of the

Genomic and phenotypic characterization of Xanthomonas cynarae sp. nov., a new species that causes bacterial bract spot of artichoke (Cynara scolymus L.).

PubMed

Trébaol, G; Gardan, L; Manceau, C; Tanguy, J L; Tirilly, Y; Boury, S

2000-07-01

A bacterial disease of artichoke (Cynara scolymus L.) was first observed in 1954 in Brittany and the Loire Valley, France. This disease causes water-soaked spots on bracts and depreciates marketability of the harvest. Ten strains of the pathogen causing bacterial spot of artichoke, previously identified as a member of the genus Xanthomonas, were characterized and compared with type and pathotype strains of the 20 Xanthomonas species using a polyphasic study including both phenotypic and genomic methods. The ten strains presented general morphological, biochemical and physiological traits and G+C content characteristic of the genus Xanthomonas. Sequencing of the 165 rRNA gene confirmed that this bacterium belongs to the genus Xanthomonas, and more precisely to the Xanthomonas campestris core. DNA-DNA hybridization results showed that the strains that cause bacterial spot of artichoke were 92-100% related to the proposed type strain CFBP 4188T and constituted a discrete DNA homology group that was distinct from the 20 previously described Xanthomonas species. The results of numerical analysis were in accordance with DNA-DNA hybridization data. Strains causing the bacterial bract spot of artichoke exhibited consistent determinative biochemical characteristics, which distinguished them from the 20 other Xanthomonas species previously described. Furthermore, pathogenicity tests allowed specific identification of this new phytopathogenic bacterium. Thus, it is concluded that this bacterium is a new species belonging to the genus Xanthomonas, for which the name Xanthomonas cynarae is proposed. The type strain, CFBP 4188T, has been deposited in the Collection Française des Bactéries Phytopathogènes (CFBP).

Assessment of oil content and fatty acid composition variability in two economically important Hibiscus species.

PubMed

Wang, Ming Li; Morris, Brad; Tonnis, Brandon; Davis, Jerry; Pederson, Gary A

2012-07-04

The Hibiscus genus encompasses more than 300 species, but kenaf (Hibiscus cannabinus L.) and roselle (Hibiscus sabdariffa L.) are the two most economically important species within the genus. Seeds from these two Hibiscus species contain a relatively high amount of oil with two unusual fatty acids: dihydrosterculic and vernolic acids. The fatty acid composition in the oil can directly affect oil quality and its utilization. However, the variability in oil content and fatty acid composition for these two species is unclear. For these two species, 329 available accessions were acquired from the USDA germplasm collection. Their oil content and fatty acid composition were determined by nuclear magnetic resonance (NMR) and gas chromatography (GC), respectively. Using NMR and GC analyses, we found that Hibiscus seeds on average contained 18% oil and seed oil was composed of six major fatty acids (each >1%) and seven minor fatty acids (each <1%). Hibiscus cannabinus seeds contained significantly higher amounts of oil (18.14%), palmitic (20.75%), oleic (28.91%), vernolic acids (VA, 4.16%), and significantly lower amounts of stearic (3.96%), linoleic (39.49%), and dihydrosterculic acids (DHSA, 1.08%) than H. sabdariffa seeds (17.35%, 18.52%, 25.16%, 3.52%, 4.31%, 44.72%, and 1.57%, respectively). For edible oils, a higher oleic/linoleic (O/L) ratio and lower level of DHSA are preferred, and for industrial oils a high level of VA is preferred. Our results indicate that seeds from H. cannabinus may be of higher quality than H. sabdariffa seeds for these reasons. Significant variability in oil content and major fatty acids was also detected within both species. The variability in oil content and fatty acid composition revealed from this study will be useful for exploring seed utilization and developing new cultivars in these Hibiscus species.

Comparison of sterols and fatty acids in two species of Ganoderma

PubMed Central

2012-01-01

Background Two species of Ganoderma, G. sinense and G. lucidum, are used as Lingzhi in China. Howerver, the content of triterpenoids and polysaccharides, main actives compounds, are significant different, though the extracts of both G. lucidum and G. sinense have antitumoral proliferation effect. It is suspected that other compounds contribute to their antitumoral activity. Sterols and fatty acids have obvious bioactivity. Therefore, determination and comparison of sterols and fatty acids is helpful to elucidate the active components of Lingzhi. Results Ergosterol, a specific component of fungal cell membrane, was rich in G. lucidum and G. sinense. But its content in G. lucidum (median content 705.0 μg·g-1, range 189.1-1453.3 μg·g-1, n = 19) was much higher than that in G. sinense (median content 80.1 μg·g-1, range 16.0-409.8 μg·g-1, n = 13). Hierarchical clustering analysis based on the content of ergosterol showed that 32 tested samples of Ganoderma were grouped into two main clusters, G. lucidum and G. sinense. Hierarchical clustering analysis based on the contents of ten fatty acids showed that two species of Ganoderma had no significant difference though two groups were also obtained. The similarity of two species of Ganoderma in fatty acids may be related to their antitumoral proliferation effect. Conclusions The content of ergosterol is much higher in G. lucidum than in G. sinense. Palmitic acid, linoleic acid, oleic acid, stearic acid are main fatty acids in Ganoderma and their content had no significant difference between G. lucidum and G. sinense, which may contribute to their antitumoral proliferation effect. PMID:22293530

Enzyme structures of the bacterial peptidoglycan and wall teichoic acid biogenesis pathways.

PubMed

Caveney, Nathanael A; Li, Franco Kk; Strynadka, Natalie Cj

2018-06-06

The bacterial cell wall is a complex polymeric structure with essential roles in defence, survival and pathogenesis. Common to both Gram-positive and Gram-negative bacteria is the mesh-like peptidoglycan sacculus that surrounds the outer leaflet of the cytoplasmic membrane. Recent crystallographic studies of enzymes that comprise the peptidoglycan biosynthetic pathway have led to significant new understanding of all stages. These include initial multi-step cytosolic formation of sugar-pentapeptide precursors, transfer of the precursors to activated polyprenyl lipids at the membrane inner leaflet and flippase mediated relocalization of the resulting lipid II precursors to the outer leaflet where glycopolymerization and subsequent peptide crosslinking are finalized. Additional, species-specific enzymes allow customized peptidoglycan modifications and biosynthetic regulation that are important to bacterial virulence and survival. These studies have reinforced the unique and specific catalytic mechanisms at play in cell wall biogenesis and expanded the atomic foundation to develop novel, structure guided, antibacterial agents. Copyright © 2018 Elsevier Ltd. All rights reserved.

Analysis of bacterial fatty acids by flow modulated comprehensive two-dimensional gas chromatography with parallel flame ionization detector/mass spectrometry.

PubMed

Gu, Qun; David, Frank; Lynen, Frédéric; Rumpel, Klaus; Xu, Guowang; De Vos, Paul; Sandra, Pat

2010-06-25

Comprehensive two-dimensional gas chromatography (GCxGC) offers an interesting tool for profiling bacterial fatty acids. Flow modulated GCxGC using a commercially available system was evaluated, different parameters such as column flows and modulation time were optimized. The method was tested on bacterial fatty acid methyl esters (BAMEs) from Stenotrophomonas maltophilia LMG 958T by using parallel flame ionization detector (FID)/mass spectrometry (MS). The results are compared to data obtained using a thermal modulated GCxGC system. The data show that flow modulated GCxGC-FID/MS method can be applied in a routine environment and offers interesting perspectives for chemotaxonomy of bacteria.

Bacterial community dynamics in a cooling tower with emphasis on pathogenic bacteria and Legionella species using universal and genus-specific deep sequencing.

PubMed

Pereira, Rui P A; Peplies, Jörg; Höfle, Manfred G; Brettar, Ingrid

2017-10-01

Cooling towers are the major source of outbreaks of legionellosis in Europe and worldwide. These outbreaks are mostly associated with Legionella species, primarily L. pneumophila, and its surveillance in cooling tower environments is of high relevance to public health. In this study, a combined NGS-based approach was used to study the whole bacterial community, specific waterborne and water-based bacterial pathogens, especially Legionella species, targeting the 16S rRNA gene. This approach was applied to water from a cooling tower obtained by monthly sampling during two years. The studied cooling tower was an open circuit cooling tower with lamellar cooling situated in Braunschweig, Germany. A highly diverse bacterial community was observed with 808 genera including 25 potentially pathogenic taxa using universal 16S rRNA primers. Sphingomonas and Legionella were the most abundant pathogenic genera. By applying genus-specific primers for Legionella, a diverse community with 85 phylotypes, and a representative core community with substantial temporal heterogeneity was observed. A high percentage of sequences (65%) could not be affiliated to an acknowledged species. L. pneumophila was part of the core community and the most abundant Legionella species reinforcing the importance of cooling towers as its environmental reservoir. Major temperature shifts (>10 °C) were the key environmental factor triggering the reduction or dominance of the Legionella species in the Legionella community dynamics. In addition, interventions by chlorine dioxide had a strong impact on the Legionella community composition but not on the whole bacterial community. Overall, the presented results demonstrated the value of a combined NGS approach for the molecular monitoring and surveillance of health related pathogens in man-made freshwater systems. Copyright © 2017 Elsevier Ltd. All rights reserved.

THE OCCURRENCE OF POLYGLYCEROPHOSPHATE AS AN ANTIGENIC COMPONENT OF VARIOUS GRAM-POSITIVE BACTERIAL SPECIES

PubMed Central

McCarty, Maclyn

1959-01-01

A bacterial substance has been described which gives a precipitin reaction with certain antisera to Group A streptococci. The precipitating antigen is present in various Gram-positive bacteria, including most hemolytic streptococci, staphylococci, and aerobic sporulating bacilli. It is not present in any of the Gram-negative species examined or in pneumococci, clostridia, or corynebacteria. Analysis of purified preparations obtained from Group A streptococci indicates that the antigen is a simple polymer of glycerophosphate. The identification has been confirmed by immunochemical studies, including precipitin tests and specific inhibition with synthetic polyglycerophosphates. In addition, the infrared spectra of bacterial and synthetic polyglycerophosphate are shown to be closely similar. Immunochemical analysis suggests that the amount of polyglycerophosphate present in Group A streptococci and staphylococci is approximately 1 per cent of the dry weight of the cells. The cellular localization and function of the polyglycerophosphate have not been established. PMID:13641562

Bacterial Profile of Dentine Caries and the Impact of pH on Bacterial Population Diversity

PubMed Central

Kianoush, Nima; Adler, Christina J.; Nguyen, Ky-Anh T.; Browne, Gina V.; Simonian, Mary; Hunter, Neil

2014-01-01

Dental caries is caused by the release of organic acids from fermentative bacteria, which results in the dissolution of hydroxyapatite matrices of enamel and dentine. While low environmental pH is proposed to cause a shift in the consortium of oral bacteria, favouring the development of caries, the impact of this variable has been overlooked in microbial population studies. This study aimed to detail the zonal composition of the microbiota associated with carious dentine lesions with reference to pH. We used 454 sequencing of the 16S rRNA gene (V3–V4 region) to compare microbial communities in layers ranging in pH from 4.5–7.8 from 25 teeth with advanced dentine caries. Pyrosequencing of the amplicons yielded 449,762 sequences. Nine phyla, 97 genera and 409 species were identified from the quality-filtered, de-noised and chimera-free sequences. Among the microbiota associated with dentinal caries, the most abundant taxa included Lactobacillus sp., Prevotella sp., Atopobium sp., Olsenella sp. and Actinomyces sp. We found a disparity between microbial communities localised at acidic versus neutral pH strata. Acidic conditions were associated with low diversity microbial populations, with Lactobacillus species including L. fermentum, L. rhamnosus and L. crispatus, being prominent. In comparison, the distinctive species of a more diverse flora associated with neutral pH regions of carious lesions included Alloprevotella tanerrae, Leptothrix sp., Sphingomonas sp. and Streptococcus anginosus. While certain bacteria were affected by the pH gradient, we also found that ∼60% of the taxa associated with caries were present across the investigated pH range, representing a substantial core. We demonstrated that some bacterial species implicated in caries progression show selective clustering with respect to pH gradient, providing a basis for specific therapeutic strategies. PMID:24675997

Response of key soil parameters during compost-assisted phytostabilization in extremely acidic tailings: effect of plant species.

PubMed

Solís-Dominguez, Fernando A; White, Scott A; Hutter, Travis Borrillo; Amistadi, Mary Kay; Root, Robert A; Chorover, Jon; Maier, Raina M

2012-01-17

Phytostabilization of mine tailings acts to mitigate both eolian dispersion and water erosion events which can disseminate barren tailings over large distances. This technology uses plants to establish a vegetative cover to permanently immobilize contaminants in the rooting zone, often requiring addition of an amendment to assist plant growth. Here we report the results of a greenhouse study that evaluated the ability of six native plant species to grow in extremely acidic (pH ∼ 2.5) metalliferous (As, Pb, Zn: 2000-3000 mg kg(-1)) mine tailings from Iron King Mine Humboldt Smelter Superfund site when amended with a range of compost concentrations. Results revealed that three of the six plant species tested (buffalo grass, mesquite, and catclaw acacia) are good candidates for phytostabilization at an optimum level of 15% compost (w/w) amendment showing good growth and minimal shoot accumulation of metal(loid)s. A fourth candidate, quailbush, also met all criteria except for exceeding the domestic animal toxicity limit for shoot accumulation of zinc. A key finding of this study was that the plant species that grew most successfully on these tailings significantly influenced key tailings parameters; direct correlations between plant biomass and both increased tailings pH and neutrophilic heterotrophic bacterial counts were observed. We also observed decreased iron oxidizer counts and decreased bioavailability of metal(loid)s mainly as a result of compost amendment. Taken together, these results suggest that the phytostabilization process reduced tailings toxicity as well as the potential for metal(loid) mobilization. This study provides practical information on plant and tailings characteristics that is critically needed for successful implementation of assisted phytostabilization on acidic, metalliferous mine tailings sites.

Response of Key Soil Parameters During Compost-Assisted Phytostabilization in Extremely Acidic Tailings: Effect of Plant Species

PubMed Central

Solís-Dominguez, Fernando A.; White, Scott A.; Hutter, Travis Borrillo; Amistadi, Mary Kay; Root, Robert A.; Chorover, Jon; Maier, Raina M.

2012-01-01

Phytostabilization of mine tailings acts to mitigate both eolian dispersion and water erosion events which can disseminate barren tailings over large distances. This technology uses plants to establish a vegetative cover to permanently immobilize contaminants in the rooting zone, often requiring addition of an amendment to assist plant growth. Here we report the results of a greenhouse study that evaluated the ability of six native plant species to grow in extremely acidic (pH ~ 2.5) metalliferous (As, Pb, Zn: 2000–3000 mg kg−1) mine tailings from Iron King Mine Humboldt Smelter Superfund site when amended with a range of compost concentrations. Results revealed that three of the six plant species tested (buffalo grass, mesquite, and catclaw acacia) are good candidates for phytostabilization at an optimum level of 15% compost (w/w) amendment showing good growth and minimal shoot accumulation of metal(loid)s. A fourth candidate, quailbush, also met all criteria except for exceeding the domestic animal toxicity limit for shoot accumulation of zinc. A key finding of this study was that the plant species that grew most successfully on these tailings significantly influenced key tailings parameters; direct correlations between plant biomass and both increased tailings pH and neutrophilic heterotrophic bacterial counts were observed. We also observed decreased iron oxidizer counts and decreased bioavailability of metal(loid)s mainly as a result of compost amendment. Taken together, these results suggest that the phytostabilization process reduced tailings toxicity as well as the potential for metal(loid) mobilization. This study provides practical information on plant and tailings characteristics that is critically needed for successful implementation of assisted phytostabilization on acidic, metalliferous mine tailings sites. PMID:22191663

The Extent of Genome Flux and Its Role in the Differentiation of Bacterial Lineages

PubMed Central

Nowell, Reuben W.; Green, Sarah; Laue, Bridget E.; Sharp, Paul M.

2014-01-01

Horizontal gene transfer (HGT) and gene loss are key processes in bacterial evolution. However, the role of gene gain and loss in the emergence and maintenance of ecologically differentiated bacterial populations remains an open question. Here, we use whole-genome sequence data to quantify gene gain and loss for 27 lineages of the plant-associated bacterium Pseudomonas syringae. We apply an extensive error-control procedure that accounts for errors in draft genome data and greatly improves the accuracy of patterns of gene occurrence among these genomes. We demonstrate a history of extensive genome fluctuation for this species and show that individual lineages could have acquired thousands of genes in the same period in which a 1% amino acid divergence accrues in the core genome. Elucidating the dynamics of genome fluctuation reveals the rapid turnover of gained genes, such that the majority of recently gained genes are quickly lost. Despite high observed rates of fluctuation, a phylogeny inferred from patterns of gene occurrence is similar to a phylogeny based on amino acid replacements within the core genome. Furthermore, the core genome phylogeny suggests that P. syringae should be considered a number of distinct species, with levels of divergence at least equivalent to those between recognized bacterial species. Gained genes are transferred from a variety of sources, reflecting the depth and diversity of the potential gene pool available via HGT. Overall, our results provide further insights into the evolutionary dynamics of genome fluctuation and implicate HGT as a major factor contributing to the diversification of P. syringae lineages. PMID:24923323

Abundance of antibiotic resistance genes and bacterial community composition in wild freshwater fish species.

PubMed

Marti, Elisabet; Huerta, Belinda; Rodríguez-Mozaz, Sara; Barceló, Damià; Marcé, Rafael; Balcázar, Jose Luis

2018-04-01

This study was aimed to determine the abundance of four antibiotic resistance genes (bla TEM , ermB, qnrS and sulI), as well as bacterial community composition associated with the intestinal mucus of wild freshwater fish species collected from the Foix and La Llosa del Cavall reservoirs, which represent ecosystems with high and low anthropogenic disturbance, respectively. Water and sediments from these reservoirs were also collected and analyzed to determine the pollution level by antibiotics. The bla TEM gene was only detected in brown trout and Ebro barbel, which were collected from La Llosa del Cavall reservoir. In contrast, the sulI and qnrS genes were only detected in common carp, which were collected from the Foix reservoir. Although the ermB gene was also detected in common carp, the values were below the limit of quantification. Likewise, water and sediment samples from the Foix reservoir had higher concentrations and more classes of antibiotics than those from La Llosa del Cavall. Pyrosequencing analysis of 16S rRNA genes revealed significant differences in bacterial communities associated with the intestinal mucus of fish species. Therefore, these findings suggest that anthropogenic activities are not only increasing the pollution of aquatic environments, but also contributing to the emergence and spread of antibiotic resistance in organisms that inhabit such environments. Copyright © 2017 Elsevier Ltd. All rights reserved.

Interaction between common organic acids and trace nucleation species in the Earth's atmosphere.

PubMed

Xu, Yisheng; Nadykto, Alexey B; Yu, Fangqun; Herb, J; Wang, Wei

2010-01-14

Atmospheric aerosols formed via nucleation in the Earth's atmosphere play an important role in the aerosol radiative forcing associated directly with global climate changes and public health. Although it is well-known that atmospheric aerosol particles contain organic species, the chemical nature of and physicochemical processes behind atmospheric nucleation involving organic species remain unclear. In the present work, the interaction of common organic acids with molecular weights of 122, 116, 134, 88, 136, and 150 (benzoic, maleic, malic, pyruvic, phenylacetic, and tartaric acids) with nucleation precursors and charged trace species has been investigated. We found a moderate strong effect of the organic species on the stability of neutral and charged ionic species. In most cases, the free energies of the mixed H(2)SO(4)-organic acid dimer formation are within 1-1.5 kcal mol(-1) of the (H(2)SO(4))(NH(3)) formation energy. The interaction of the organic acids with trace ionic species is quite strong, and the corresponding free energies far exceed those of the (H(3)O(+))(H(2)SO(4)) and (H(3)O(+))(H(2)SO(4))(2) formation. These considerations lead us to conclude that the aforementioned organic acids may possess a substantial capability of stabilizing both neutral and positively charged prenucleation clusters, and thus, they should be studied further with regard to their involvement in the gas-to-particle conversion in the Earth's atmosphere.

Mixed-species biofilm formation by lactic acid bacteria and rice wine yeasts.

PubMed

Kawarai, Taketo; Furukawa, Soichi; Ogihara, Hirokazu; Yamasaki, Makari

2007-07-01

We found that species combinations such as Lactobacillus casei subsp. rhamnosus IFO3831 and Saccharomyces cerevisiae Kyokai-10 can form a mixed-species biofilm in coculture. Moreover, the Kyokai-10 yeast strain can form a biofilm in monoculture in the presence of conditioned medium (CM) from L. casei IFO3831. The active substance(s) in bacterial CM is heat sensitive and has a molecular mass of between 3 and 5 kDa. In biofilms from cocultures or CM monocultures, yeast cells had a distinct morphology, with many hill-like protrusions on the cell surface.

Composition of sugars, organic acids, and total phenolics in 25 wild or cultivated berry species.

PubMed

Mikulic-Petkovsek, Maja; Schmitzer, Valentina; Slatnar, Ana; Stampar, Franci; Veberic, Robert

2012-10-01

Sugars, organic acids, and total phenolic content in fruit of 25 wild and cultivated berry species were identified and quantified with high-performance liquid chromatograph. The composition of sugars, organic acids, and total phenolic compounds in various species of Vaccinium, Rubus, Ribes, and Fragaria genus was evaluated. Additonally, total phenolics of less known berry species of the Morus, Amelanchier, Sorbus, Sambucus, Rosa, Lycium, Actinidia, and Aronia genus were determined in wild growing as well as in cultivated fruits. Significant differences in the concentration of sugars and organic acids were detected among the berry species. Glucose and fructose were the most abundant sugars in berry fruits and the major organic acids were malic and citric acid. However, in kiwi fruit, sucrose represented as much as 71.9% of total sugars. Sorbitol has been detected and quantified in chokeberry, rowanberry, and eastern shadbush fruit. The highest content of total analyzed sugars was determined in rowanberry fruit, followed by dog rose, eastern shadbush, hardy kiwifruit, American cranberry, chokeberry, and jostaberry fruit. Rowanberry stands out as the fruit with the highest content of total analyzed organic acids, followed by jostaberry, lingonberry, red gooseberry, hardy kiwifruit, and black currant. The berries of white gooseberry, black currant, red currant, and white currant had the lowest sugar/organic acid ratio and were thus perceptively the sourest species analyzed. On the other hand, the species with highest sugar/organic acid ratio were goji berry, eastern shadbush, black mulberry, and wild grown blackberry. The highest amounts of total phenols were quantified in chokeberry fruit. Wild strawberry, raspberry, and blackberry had 2- to 5-fold more total phenolics compared to cultivated plants. The fruit of analyzed berry species contained different levels of sugars, organic acids, and total phenolics. Moreover, it has been demonstrated that wild grown species

Improvement of MALDI-TOF MS profiling for the differentiation of species within the Acinetobacter calcoaceticus-Acinetobacter baumannii complex.

PubMed

Šedo, Ondrej; Nemec, Alexandr; Křížová, Lenka; Kačalová, Magdaléna; Zdráhal, Zbyněk

2013-12-01

MALDI-TOF MS is currently becoming the method of choice for rapid identification of bacterial species in routine diagnostics. Yet, this method suffers from the inability to differentiate reliably between some closely related bacterial species including those of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex, namely A. baumannii and Acinetobacter nosocomialis. In the present study, we evaluated a protocol which was different from that used in the Bruker Daltonics identification system (MALDI BioTyper) to improve species identification using a taxonomically precisely defined set of 105 strains representing the four validly named species of the ACB complex. The novel protocol is based on the change in matrix composition from alpha-cyano-4-hydroxycinnamic acid (saturated solution in water:acetonitrile:trifluoroacetic acid, 47.5:50:2.5, v/v) to ferulic acid (12.5mgml(-1) solution in water:acetonitrile:formic acid 50:33:17, v/v), while the other steps of sample processing remain unchanged. Compared to the standard protocol, the novel one extended the range of detected compounds towards higher molecular weight, produced signals with better mass resolution, and allowed the detection of species-specific signals. As a result, differentiation of A. nosocomialis and A. baumannii strains by cluster analysis was improved and 13 A. nosocomialis strains, assigned erroneously or ambiguously by using the standard protocol, were correctly identified. Copyright © 2013 Elsevier GmbH. All rights reserved.

Effect of growth phase on the fatty acid compositions of four species of marine diatoms

NASA Astrophysics Data System (ADS)

Liang, Ying; Mai, Kangsen

2005-04-01

The fatty acid compositions of four species of marine diatoms ( Chaetoceros gracilis MACC/B13, Cylindrotheca fusiformis MACC/B211, Phaeodactylum tricornutum MACC/B221 and Nitzschia closterium MACC/B222), cultivated at 22°C±1°C with the salinity of 28 in f/2 medium and harvested in the exponential growth phase, the early stationary phase and the late stationary phase, were determined. The results showed that growth phase has significant effect on most fatty acid contents in the four species of marine diatoms. The proportions of 16:0 and 16:1n-7 fatty acids increased while those of 16:3n-4 and eicosapentaenoic acid (EPA) decreased with increasing culture age in all species studied. The subtotal of saturated fatty acids (SFA) increased with the increasing culture age in all species with the exception of B13. The subtotal of monounsaturated fatty acids (MUFA) increased while that of polyunsaturated fatty acids (PUFA) decreased with culture age in the four species of marine diatoms. MUFA reached their lowest value in the exponential growth phase, whereas PUFA reached their highest value in the same phase.

Goniothalamus Species: A Source of Drugs for the Treatment of Cancers and Bacterial Infections?

PubMed Central

2007-01-01

Irrespective of the presence of cytotoxic acetogenins and styryl-lactones in the genus Goniothalamus, only 22 species in the genus Goniothalamus, out of 160 species (13.7%) have so far been investigated. In an effort to promote further research on the genus Goniothalamus which could represent a source of drugs for the treatment of cancers and bacterial infections, this work offers a broad analysis of current knowledge on Goniothalamus species. Therefore, it includes (i) taxonomy (ii) botanical description (iii) traditional medicinal uses and (iv) phytochemical and pharmacological studies. We discuss the molecular mechanisms of actions of acetogenins and styryl-lactones, with some emphasis on the possible involvement of protein kinase, Bax and TRAIL receptors in the cytotoxic effects of styryl-lactones. We also report (v) the growth inhibition of several nosocomial bacteria by Goniothalamus. scortechinii. The crude methanol extract of G. scortechinii showed a good and broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria. PMID:17965760

Bacterial contaminants from frozen puff pastry production process and their growth inhibition by antimicrobial substances from lactic acid bacteria.

PubMed

Rumjuankiat, Kittaporn; Keawsompong, Suttipun; Nitisinprasert, Sunee

2017-05-01

Seventy-five bacterial contaminants which still persisted to cleaning system from three puff pastry production lines (dough forming, layer and filling forming, and shock freezing) were identified using 16S rDNA as seven genera of Bacillus , Corynebacterium , Dermacoccus , Enterobacter , Klebsiella, Pseudomonas , and Staphylococcus with detection frequencies of 24.00, 2.66, 1.33, 37.33, 1.33, 2.66, and 30.66, respectively. Seventeen species were discovered while only 11 species Bacillus cereus, B. subtilis, B. pumilus, Corynebacterium striatum , Dermacoccus barathri , Enterobacter asburiae, Staphylococcus kloosii, S. haemolyticus, S. hominis, S. warneri , and S. aureus were detected at the end of production. Based on their abundance, the highest abundance of E. asburiae could be used as a biomarker for product quality. While a low abundance of the mesophile pathogen C. striatum , which causes respiratory and nervous infection and appeared only at the shock freezing step was firstly reported for its detection in bakery product. Six antimicrobial substances (AMSs) from lactic acid bacteria, FF1-4, FF1-7, PFUR-242, PFUR-255, PP-174, and nisin A were tested for their inhibition activities against the contaminants. The three most effective were FF1-7, PP-174, and nisin A exhibiting wide inhibition spectra of 88.00%, 85.33%, and 86.66%, respectively. The potential of a disinfectant solution containing 800 AU/ml of PP-174 and nisin A against the most resistant strains of Enterobacter , Staphylococcus , Bacillus and Klebsiella was determined on artificially contaminated conveyor belt coupons at 0, 4, 8, 12, and 16 hr. The survival levels of the test strains were below 1 log CFU/coupon at 0 hr. The results suggested that a combined solution of PP-174 and nisin A may be beneficial as a sanitizer to inhibit bacterial contaminants in the frozen puff pastry industry.

Biofilm formation and ethanol inhibition by bacterial contaminants of biofuel fermentation.

PubMed

Rich, Joseph O; Leathers, Timothy D; Bischoff, Kenneth M; Anderson, Amber M; Nunnally, Melinda S

2015-11-01

Bacterial contaminants can inhibit ethanol production in biofuel fermentations, and even result in stuck fermentations. Contaminants may persist in production facilities by forming recalcitrant biofilms. A two-year longitudinal study was conducted of bacterial contaminants from a Midwestern dry grind corn fuel ethanol facility. Among eight sites sampled in the facility, the combined liquefaction stream and yeast propagation tank were consistently contaminated, leading to contamination of early fermentation tanks. Among 768 contaminants isolated, 92% were identified as Lactobacillus sp., with the most abundant species being Lactobacillus plantarum, Lactobacillus casei, Lactobacillus mucosae, and Lactobacillus fermentum. Seven percent of total isolates showed the ability to form biofilms in pure cultures, and 22% showed the capacity to significantly inhibit ethanol production. However, these traits were not correlated. Ethanol inhibition appeared to be related to acetic acid production by contaminants, particularly by obligately heterofermentative species such as L. fermentum and L. mucosae. Published by Elsevier Ltd.

A new approach in the first-line treatment of bacterial and mycotic vulvovaginitis with topical lipohydroperoxides and glycyrrhetic acid: a comparative study.

PubMed

Mainini, G; Rotondi, M; Scaffa, C

2011-01-01

PURPOSE OF INVESTIGATIONS: The aim of this randomized controlled trial was to evaluate efficacy and tolerability of a new association of lipohydroperoxides and glycyrrhetic acid on topical treatment of bacterial and mycotic vulvovaginitis. One hundred consecutive patients with bacterial or mycotic vulvovaginitis were randomly assigned to a study group treated with vaginal lipohydroperoxides and a derivative of glycyrrhetic acid for three days (n = 50), and a control group using vaginal antibacterial metronidazole (500 mg) or antimycotic econazole (150 mg) for six days (n = 50). A clinical and microbiological response was achieved in 80.4% and 88.9% in investigational and control group, respectively (p > 0.05). Compared to traditional antimicrobial drugs, the effect appears to be faster and safer, even if not significantly. The 6-month recurrence rate was 7.7% and 5.6% in the investigational and control group, respectively. Topical medication based on lipohydroperoxides and glycyrrhetic acid showed a clinical and microbiological efficacy in the first-line treatment of bacterial and mycotic vulvovaginitis, comparable to conventional drugs.

Dual Enzyme-Responsive Capsules of Hyaluronic Acid-block-Poly(Lactic Acid) for Sensing Bacterial Enzymes.

PubMed

Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger

2015-07-01

The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Culture-independent bacterial community analysis of the salty-fermented fish paste products of Thailand and Laos

PubMed Central

MARUI, Junichiro; BOULOM, Sayvisene; PANTHAVEE, Wanchai; MOMMA, Mari; KUSUMOTO, Ken-Ichi; NAKAHARA, Kazuhiko; SAITO, Masayoshi

2015-01-01

A bacterial community analysis, using a culture-independent method (polymerase chain reaction-denaturing gradient gel electrophoresis), detected 17 species of bacteria including species of the genera Tetragenococcus, Lactobacillus, Pediococcus, Weissella Halanaerobium, Clostridium, and Sphingomonas in a traditional salty-fermented fish paste known as pla-ra or pa-daek in Thailand and Laos, which is used as a storage-stable multi-purpose seasoning. The representative genus of lactic acid bacteria seemed to vary in the 10 products collected from Thailand and Laos. Tetragenococci were common in products from central Thailand and Vientiane in Laos which had salinities of not less than 11% and pH values ranging from 5.6 to 6.1. However, lactobacilli were common in products from northern Thailand which had the lowest salinities (8.3–8.6%) and pH values (4.5–4.8) of all the samples examined. Two Lactobacillus and one Tetragenococcus species were detected in one product from northeastern Thailand containing 10% salt. These results suggest that salinity in pla-ra/pa-daek is an important determinant of the representative genus of lactic acid bacteria such as, Tetragenococcus or Lactobacillus. Additionally, differences in the acidity between these two groups seemed to be related to the production of d-/l-lactic acid in the lactic acid bacteria in each product. This is the first study to report a correlation between bacterial community structure and taste components in pla-ra/pa-daek products from various regions. This scientific work on a traditional fermented food will be useful in helping local producers meet differing consumer preferences in various regions. PMID:25918672

Bacterial species involved in the conversion of dietary flavonoids in the human gut.

PubMed

Braune, Annett; Blaut, Michael

2016-05-03

The gut microbiota plays a crucial role in the conversion of dietary flavonoids and thereby affects their health-promoting effects in the human host. The identification of the bacteria involved in intestinal flavonoid conversion has gained increasing interest. This review summarizes available information on the so far identified human intestinal flavonoid-converting bacterial species and strains as well as their enzymes catalyzing the underlying reactions. The majority of described species involved in flavonoid transformation are capable of carrying out the O-deglycosylation of flavonoids. Other bacteria cleave the less common flavonoid-C-glucosides and/or further degrade the aglycones of flavonols, flavanonols, flavones, flavanones, dihydrochalcones, isoflavones and monomeric flavan-3-ols. To increase the currently limited knowledge in this field, identification of flavonoid-converting bacteria should be continued using culture-dependent screening or isolation procedures and molecular approaches based on sequence information of the involved enzymes.

Nucleic Acid Homologies Among Oxidase-Negative Moraxella Species

PubMed Central

Johnson, John L.; Anderson, Robert S.; Ordal, Erling J.

1970-01-01

The deoxyribonucleic acid (DNA) base composition and DNA homologies of more than 40 strains of oxidase-negative Moraxella species were determined. These bacteria have also been identified as belonging to the Mima-Herellea-Acinetobacter group and the Bacterium anitratum group, as well as to several other genera including Achromobacter and Alcaligenes. The DNA base content of these strains ranged from 40 to 46% guanine plus cytosine. DNA–DNA competition experiments distinguished five groups whose members were determined by showing 50% or more homology to one of the reference strains: B. anitratum type B5W, Achromobacter haemolyticus var. haemolyticus, Alcaligenes haemolysans, Achromobacter metalcaligenes, and Moraxella lwoffi. A sixth group comprised those strains showing less than 50% homology to any of the reference strains. Negligible homology was found between strains of oxidase-negative and oxidase-positive Moraxella species in DNA–DNA competition experiments. However, evidence of a distant relationship between the two groups was obtained in competition experiments by using ribosomal ribonucleic acid. PMID:5413826

Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species

PubMed Central

Tsang, Jennifer; Hoover, Timothy R.

2014-01-01

Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ 54 (also known as RpoN) to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni), Gammaproteobacteria (e.g., Vibrio and Pseudomonas species), and Alphaproteobacteria (e.g., Caulobacter crescentus). This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization. PMID:24672734

Nectar sugars and amino acids in day- and night-flowering Nicotiana species are more strongly shaped by pollinators' preferences than organic acids and inorganic ions.

PubMed

Tiedge, Kira; Lohaus, Gertrud

2017-01-01

Floral nectar contains mainly sugars but also amino acids, organic acids, inorganic ions and secondary compounds to attract pollinators. The genus Nicotiana exhibits great diversity among species in floral morphology, flowering time, nectar compositions, and predominant pollinators. We studied nectar samples of 20 Nicotiana species, composed equally of day- and night-flowering plants and attracting different groups of pollinators (e.g. hummingbirds, moths or bats) to investigate whether sugars, amino acids, organic acids and inorganic ions are influenced by pollinator preferences. Glucose, fructose and sucrose were the only sugars found in the nectar of all examined species. Sugar concentration of the nectar of day-flowering species was 20% higher and amino acid concentration was 2-3-fold higher compared to the nectar of night-flowering species. The sucrose-to-hexose ratio was significantly higher in night-flowering species and the relative share of sucrose based on the total sugar correlated with the flower tube length in the nocturnal species. Flowers of different tobacco species contained varying volumes of nectar which led to about 150-fold higher amounts of total sugar per flower in bat- or sunbird-pollinated species than in bee-pollinated or autogamous species. This difference was even higher for total amino acids per flower (up to 1000-fold). As a consequence, some Nicotiana species invest large amounts of organic nitrogen for certain pollinators. Higher concentrations of inorganic ions, predominantly anions, were found in nectar of night-flowering species. Therefore, higher anion concentrations were also associated with pollinator types active at night. Malate, the main organic acid, was present in all nectar samples but the concentration was not correlated with pollinator type. In conclusion, statistical analyses revealed that pollinator types have a stronger effect on nectar composition than phylogenetic relations. In this context, nectar sugars and amino

Nectar sugars and amino acids in day- and night-flowering Nicotiana species are more strongly shaped by pollinators’ preferences than organic acids and inorganic ions

PubMed Central

Tiedge, Kira; Lohaus, Gertrud

2017-01-01

Floral nectar contains mainly sugars but also amino acids, organic acids, inorganic ions and secondary compounds to attract pollinators. The genus Nicotiana exhibits great diversity among species in floral morphology, flowering time, nectar compositions, and predominant pollinators. We studied nectar samples of 20 Nicotiana species, composed equally of day- and night-flowering plants and attracting different groups of pollinators (e.g. hummingbirds, moths or bats) to investigate whether sugars, amino acids, organic acids and inorganic ions are influenced by pollinator preferences. Glucose, fructose and sucrose were the only sugars found in the nectar of all examined species. Sugar concentration of the nectar of day-flowering species was 20% higher and amino acid concentration was 2-3-fold higher compared to the nectar of night-flowering species. The sucrose-to-hexose ratio was significantly higher in night-flowering species and the relative share of sucrose based on the total sugar correlated with the flower tube length in the nocturnal species. Flowers of different tobacco species contained varying volumes of nectar which led to about 150-fold higher amounts of total sugar per flower in bat- or sunbird-pollinated species than in bee-pollinated or autogamous species. This difference was even higher for total amino acids per flower (up to 1000-fold). As a consequence, some Nicotiana species invest large amounts of organic nitrogen for certain pollinators. Higher concentrations of inorganic ions, predominantly anions, were found in nectar of night-flowering species. Therefore, higher anion concentrations were also associated with pollinator types active at night. Malate, the main organic acid, was present in all nectar samples but the concentration was not correlated with pollinator type. In conclusion, statistical analyses revealed that pollinator types have a stronger effect on nectar composition than phylogenetic relations. In this context, nectar sugars and amino

The changes of dominant lactic acid bacteria and their metabolites during corn stover ensiling.

PubMed

Xu, Zhenshang; Zhang, Susu; Zhang, Rongling; Li, Shixu; Kong, Jian

2018-05-15

Monitoring the succession of bacterial populations during corn stover ensiling are helpful for improving the silage quality. Fermentation characteristics were assessed and bacterial communities were described along with the ensiling process. The ensiled corn stover exhibited chemical traits as low pH value (3.92 ± 0.02) and high levels of lactic acid (66.75 ± 1.97 g kg -1 dry matter) which were associated with well ensiled forages, as well as moderate concentrations of acetic acid (19.69 ± 1.51 g kg -1 dry matter) and small amounts of 1, 2-propanediol (4.4 ± 0.11 g kg -1 dry matter). In the early stages of the ensiling process, a significant increase and then reduction of the abundance of species Lactococcus lactis, Leuconostoc pseudomesenteroides, Pediococcus pentosaceus and Weissella sp. were observed. The species Lactobacillus plantarum (Lb. plantarum) group and Lb. brevis grew vigorously, and the species Lb. farciminis and Lb. parafarraginis gradually increased along with the course of ensiling. High-throughput sequencing was successfully used to describe bacterial communities throughout the process of corn stover ensiling. The knowledge about the ecological succession of the dominant lactic acid bacteria could lead to improved ensiling practices and the selection of corn stover silage inoculants. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.

Growth condition and bacterial community for maximum hydrolysis of suspended organic materials in anaerobic digestion of food waste-recycling wastewater.

PubMed

Kim, Man Deok; Song, Minkyung; Jo, Minho; Shin, Seung Gu; Khim, Jee Hyeong; Hwang, Seokhwan

2010-02-01

This paper reports the effects of changing pH (5-7) and temperature (T, 40-60 degrees C) on the efficiencies of bacterial hydrolysis of suspended organic matter (SOM) in wastewater from food waste recycling (FWR) and the changes in the bacterial community responsible for this hydrolysis. Maximum hydrolysis efficiency (i.e., 50.5% reduction of volatile suspended solids) was predicted to occur at pH 5.7 and T = 44.5 degrees C. Changes in short-chain volatile organic acid profiles and in acidogenic bacterial communities were investigated under these conditions. Propionic and butyric acids concentrations increased rapidly during the first 2 days of incubation. Several band sequences consistent with Clostridium spp. were detected using denaturing gel gradient electrophoresis. Clostridium thermopalmarium and Clostridium novyi seemed to contribute to butyric acid production during the first 1.5 days of acidification of FWR wastewater, and C. thermopalmarium was a major butyric acid producer afterward. C. novyi was an important propionic acid producer. These two species appear to be important contributors to hydrolysis of SOM in the wastewater. Other acidogenic anaerobes, Aeromonas sharmana, Bacillus coagulans, and Pseudomonas plecoglossicida, were also indentified.

Raw Cow Milk Bacterial Population Shifts Attributable to Refrigeration

PubMed Central

Lafarge, Véronique; Ogier, Jean-Claude; Girard, Victoria; Maladen, Véronique; Leveau, Jean-Yves; Gruss, Alexandra; Delacroix-Buchet, Agnès

2004-01-01

We monitored the dynamic changes in the bacterial population in milk associated with refrigeration. Direct analyses of DNA by using temporal temperature gel electrophoresis (TTGE) and denaturing gradient gel electrophoresis (DGGE) allowed us to make accurate species assignments for bacteria with low-GC-content (low-GC%) (<55%) and medium- or high-GC% (>55%) genomes, respectively. We examined raw milk samples before and after 24-h conservation at 4°C. Bacterial identification was facilitated by comparison with an extensive bacterial reference database (∼150 species) that we established with DNA fragments of pure bacterial strains. Cloning and sequencing of fragments missing from the database were used to achieve complete species identification. Considerable evolution of bacterial populations occurred during conservation at 4°C. TTGE and DGGE are shown to be a powerful tool for identifying the main bacterial species of the raw milk samples and for monitoring changes in bacterial populations during conservation at 4°C. The emergence of psychrotrophic bacteria such as Listeria spp. or Aeromonas hydrophila is demonstrated. PMID:15345453

Dietary and developmental shifts in butterfly-associated bacterial communities

PubMed Central

2018-01-01

Bacterial communities associated with insects can substantially influence host ecology, evolution and behaviour. Host diet is a key factor that shapes bacterial communities, but the impact of dietary transitions across insect development is poorly understood. We analysed bacterial communities of 12 butterfly species across different developmental stages, using amplicon sequencing of the 16S rRNA gene. Butterfly larvae typically consume leaves of a single host plant, whereas adults are more generalist nectar feeders. Thus, we expected bacterial communities to vary substantially across butterfly development. Surprisingly, only few species showed significant dietary and developmental transitions in bacterial communities, suggesting weak impacts of dietary transitions across butterfly development. On the other hand, bacterial communities were strongly influenced by butterfly species and family identity, potentially due to dietary and physiological variation across the host phylogeny. Larvae of most butterfly species largely mirrored bacterial community composition of their diets, suggesting passive acquisition rather than active selection. Overall, our results suggest that although butterflies harbour distinct microbiomes across taxonomic groups and dietary guilds, the dramatic dietary shifts that occur during development do not impose strong selection to maintain distinct bacterial communities across all butterfly hosts. PMID:29892359

Changes in the fatty acid composition in bitter Lupinus species depend on the debittering process.

PubMed

Curti, Carolina A; Curti, Ramiro N; Bonini, Norberto; Ramón, Adriana N

2018-10-15

The evaluation of changes in the fatty acid composition in Lupinus species after the debittering process is crucial to determine their nutritional implications. The aim of this study was to evaluate changes in the fatty acid composition in Lupinus albus and L. mutabilis after the debittering process. Lupinus species showed different fatty acid compositions which changed depending on the debittering process applied. The debittering process changed the monounsaturated and polyunsaturated fatty acids in L. albus, whereas in L. mutabilis it changed the w-6/w-3 ratio. However, the total saturated fatty acid content remained stable in both species after the debittering process. The changes in L. albus were associated with the fatty acid desaturation and a conversion into unsaturated fatty acids, whereas in L. mutabilis with the lipid peroxidation by decreasing the linoleic acid content. Nutritional implications of these changes in the fatty acid composition are discussed. Copyright © 2018. Published by Elsevier Ltd.

[Effects of tree species transition on soil microbial community composition and functions in subtropical China].

PubMed

Ding, Guo Chang; Wang, Xiao Hua; Yang, Qi Fan; Lin, Qun Xing; Huang, Zhi Qun

2017-11-01

We employed a comparative study to examine the effects of tree species transition on soil microbial biomass, community composition and enzymes activities under Cunninghamia lanceolata (Lamb.) Hook, Eucalyptus grandis and a N-fixing species, Acacia melanoxylon in subtropical China. Results showed that the effect of tree species on soil microbial community and enzymes activities was significant only in the 0-10 cm soil layer. Reforestation with N-fixing species A. melanoxylon on the C. lanceolata harvest site significantly increased the total phospholipid fatty acid (PLFA), fungal PLFAs, Gram-positive bacterial PLFAs, Gram-negative bacterial PLFAs and actinomycetes biomasses in the 0-10 cm soil layer. The principal component analysis (PCA) showed that the soil microbial community composition in A. melanoxylon soil differed significantly from that in C. lanceolata and E. grandis soils. N-fixing species (A. melanoxylon) significantly enhanced the percent abundance of Gram-positive bacteria, Gram-negative bacteria and actinomycetes. Activities of cellobiohydrolase, N-acetyl-β-d-glucosaminidase and acid phosphatase were significantly higher under A. melanoxylon than under C. lanceolata and E. grandis plantations. Our results suggested that reforestation with N-fixing species, A. melanoxylon on C. lanceolata harvest site could increase soil microbial biomass, enzyme activities and soil organic matter content.

Determination of concentration and molar absorptivity of hypochlorous acid and hypobromous acid species by hydrogen peroxide titration

NASA Astrophysics Data System (ADS)

Uehara, H.; Arakaki, T.

2017-12-01

Hypochlorous acid and hypobromous acid (abbreviated as "HypoX acids") are the main ingredients of bleaching and bactericides. The HypoX acids change their chemical forms depending on environmental factors such as pH and various chemical reactions. For example, it has been reported that hypobromite ion in water changes to carcinogenic bromate by photochemical reaction with ultraviolet light. In this study, concentrations of HypoX acids were determined by UV-VIS absorbance measurement utilizing the fact that HypoX acids react with hydrogen peroxide and do not co-exist in the solution. The method for determining the concentration by titration with hydrogen peroxide can be carried out simpler and more efficiently than the DPD method or the current titration method generally used for chlorine concentration measurement. Molar absorptivity between 250 - 500 nm of HypoX acids, including their conjugate base species, was determined by solving theoretical acid-base formula including molar fraction of each chemical species at various pHs. Molar absorptivity of OCl- and OBr- between 250 - 500 nm was determined based on the concentrations obtained from titration with hydrogen peroxide and absorbance at pH > 10, where OCl- and OBr- dominate. Furthermore, the HypoX acids solutions were irradiated with a solar simulator, and the photolysis rate constants were obtained. Based on those values, the half-lives were calculated and the behavior of HypoX acids in the environment was elucidated.

Anti-Biofilm Performance of Three Natural Products against Initial Bacterial Attachment

PubMed Central

Salta, Maria; Wharton, Julian A.; Dennington, Simon P.; Stoodley, Paul; Stokes, Keith R.

2013-01-01

Marine bacteria contribute significantly towards the fouling consortium, both directly (modern foul release coatings fail to prevent “slime” attachment) and indirectly (biofilms often excrete chemical cues that attract macrofouling settlement). This study assessed the natural product anti-biofilm performance of an extract of the seaweed, Chondrus crispus, and two isolated compounds from terrestrial sources, (+)-usnic acid and juglone, against two marine biofilm forming bacteria, Cobetia marina and Marinobacter hydrocarbonoclasticus. Bioassays were developed using quantitative imaging and fluorescent labelling to test the natural products over a range of concentrations against initial bacterial attachment. All natural products affected bacterial attachment; however, juglone demonstrated the best anti-biofilm performance against both bacterial species at a concentration range between 5–20 ppm. In addition, for the first time, a dose-dependent inhibition (hormetic) response was observed for natural products against marine biofilm forming bacteria. PMID:24192819

Evolution of bacterial consortia in spontaneously started rye sourdoughs during two months of daily propagation.

PubMed

Bessmeltseva, Marianna; Viiard, Ene; Simm, Jaak; Paalme, Toomas; Sarand, Inga

2014-01-01

The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200), propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius) were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus) was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata) were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping.

Amino acids in eight species of Monogenea.

PubMed

Arme, C

1977-04-15

The ethanol-extractable amino acids of several species of Monogenea were analysed. In the Monopisthocotylea levels were high ( greater than 1,200 micronmoles/g/ethanol extracted dry wt); in the Polyopisthocotylea lower amounts were present (196-562 micronmoles). High proline levels were present in parasites of hosts from a marine environment but low in freshwater forms. No correlation between diet and proline content was observed.

Spatial distribution of bacterial communities and related biochemical properties in Luzhou-flavor liquor-fermented grains.

PubMed

Zheng, Jia; Wu, Chongde; Huang, Jun; Zhou, Rongqing; Liao, Xuepin

2014-12-01

Grain fermenting with separate layers in a fermentation pit is the typical and experiential brewing technology for Chinese Luzhou-flavor liquor. However, it is still unclear to what extent the bacterial communities in the different layers of fermented grains (FG) effects the liquor's quality. In this study, the spatial distributions of bacterial communities in Luzhou-flavor liquor FG (top, middle, and bottom layers) from 2 distinctive factories (Jiannanchun and Fenggu) were investigated using culture-independent approaches (phospholipid fatty acid [PLFA] and polymerase chain reaction-denaturing gel electrophoresis [DGGE]). The relationship between bacterial community and biochemical properties was also assessed by Canonical correspondence analysis (CCA). No significant variation in moisture was observed in spatial samples, and the highest content of acidity and total ester was detected in the bottom layer (P < 0.05). A high level of ethanol was observed in the top and middle layers of Fenggu and Jiannanchun, respectively. Significant spatial distribution of the total PLFA was only shown in the 50-y-old pits (P < 0.05), and Gram negative bacteria was the prominent community. Bacterial 16S rDNA DGGE analysis revealed that the most abundant bacterial community was in the top layers of the FG both from Fenggu and Jiannanchun, with Lactobacillaceae accounting for 30% of the total DGGE bands and Lactobacillus acetotolerans was the dominant species. FG samples from the same pit had a highly similar bacterial community structure according to the hierarchal cluster tree. CCA suggested that the moisture, acidity, ethanol, and reducing sugar were the main factors affecting the distribution of L. acetotolerans. Our results will facilitate the knowledge about the spatial distribution of bacterial communities and the relationship with their living environment. © 2014 Institute of Food Technologists®

Peracetic acid in the disinfection of a hospital water system contaminated with Legionella species.

PubMed

Ditommaso, Savina; Biasin, Cinzia; Giacomuzzi, Monica; Zotti, Carla Maria; Cavanna, Alberto; Ruggenini Moiraghi, Angela

2005-05-01

To assess the efficacy of an alternative disinfection method for hospital water distribution systems contaminated with Legionella. Disinfection with peracetic acid was performed in a small hospital contaminated with L. pneumophila serotype 1. The disinfectant was used at concentrations of 50 ppm (first three surveillance phases) and 1,000 ppm (fourth surveillance phase) for 30 minutes. Environmental monitoring revealed that disinfection was maintained 1 week after treatment; however, levels of recontamination surpassing baseline values were detected after approximately 1 month. Comparison of water temperatures measured at the distal outlets showed a statistically significant association between temperature and bacterial load. The circulating water temperature was found to be lower in the two wards farthest away from the hot water production plant than in other wards. It was thought that the lower water temperature in the two wards promoted the bacterial growth even after disinfection. Peracetic acid may be useful in emergency situations, but does not provide definitive protection even if used monthly.

Oligotyping reveals differences between gut microbiomes of free-ranging sympatric Namibian carnivores (Acinonyx jubatus, Canis mesomelas) on a bacterial species-like level

PubMed Central

Menke, Sebastian; Wasimuddin; Meier, Matthias; Melzheimer, Jörg; Mfune, John K. E.; Heinrich, Sonja; Thalwitzer, Susanne; Wachter, Bettina; Sommer, Simone

2014-01-01

Recent gut microbiome studies in model organisms emphasize the effects of intrinsic and extrinsic factors on the variation of the bacterial composition and its impact on the overall health status of the host. Species occurring in the same habitat might share a similar microbiome, especially if they overlap in ecological and behavioral traits. So far, the natural variation in microbiomes of free-ranging wildlife species has not been thoroughly investigated. The few existing studies exploring microbiomes through 16S rRNA gene reads clustered sequencing reads into operational taxonomic units (OTUs) based on a similarity threshold (e.g., 97%). This approach, in combination with the low resolution of target databases, generally limits the level of taxonomic assignments to the genus level. However, distinguishing natural variation of microbiomes in healthy individuals from “abnormal” microbial compositions that affect host health requires knowledge of the “normal” microbial flora at a high taxonomic resolution. This gap can now be addressed using the recently published oligotyping approach, which can resolve closely related organisms into distinct oligotypes by utilizing subtle nucleotide variation. Here, we used Illumina MiSeq to sequence amplicons generated from the V4 region of the 16S rRNA gene to investigate the gut microbiome of two free-ranging sympatric Namibian carnivore species, the cheetah (Acinonyx jubatus) and the black-backed jackal (Canis mesomelas). Bacterial phyla with proportions >0.2% were identical for both species and included Firmicutes, Fusobacteria, Bacteroidetes, Proteobacteria and Actinobacteria. At a finer taxonomic resolution, black-backed jackals exhibited 69 bacterial taxa with proportions ≥0.1%, whereas cheetahs had only 42. Finally, oligotyping revealed that shared bacterial taxa consisted of distinct oligotype profiles. Thus, in contrast to 3% OTUs, oligotyping can detect fine-scale taxonomic differences between microbiomes

Fusarium Species from Nepalese Rice and Production of Mycotoxins and Gibberellic Acid by Selected Species

PubMed Central

Desjardins, A. E.; Manandhar, H. K.; Plattner, R. D.; Manandhar, G. G.; Poling, S. M.; Maragos, C. M.

2000-01-01

Infection of cereal grains with Fusarium species can cause contamination with mycotoxins that affect human and animal health. To determine the potential for mycotoxin contamination, we isolated Fusarium species from samples of rice seeds that were collected in 1997 on farms in the foothills of the Nepal Himalaya. The predominant Fusarium species in surface-disinfested seeds with husks were species of the Gibberella fujikuroi complex, including G. fujikuroi mating population A (anamorph, Fusarium verticillioides), G. fujikuroi mating population C (anamorph, Fusarium fujikuroi), and G. fujikuroi mating population D (anamorph, Fusarium proliferatum). The widespread occurrence of mating population D suggests that its role in the complex symptoms of bakanae disease of rice may be significant. Other common species were Gibberella zeae (anamorph, Fusarium graminearum) and Fusarium semitectum, with Fusarium acuminatum, Fusarium anguioides, Fusarium avenaceum, Fusarium chlamydosporum, Fusarium equiseti, and Fusarium oxysporum occasionally present. Strains of mating population C produced beauvericin, moniliformin, and gibberellic acid, but little or no fumonisin, whereas strains of mating population D produced beauvericin, fumonisin, and, usually, moniliformin, but no gibberellic acid. Some strains of G. zeae produced the 8-ketotrichothecene nivalenol, whereas others produced deoxynivalenol. Despite the occurrence of fumonisin-producing strains of mating population D, and of 8-ketotrichothecene-producing strains of G. zeae, Nepalese rice showed no detectable contamination with these mycotoxins. Effective traditional practices for grain drying and storage may prevent contamination of Nepalese rice with Fusarium mycotoxins. PMID:10698766

Isolation of a lead tolerant novel bacterial species, Achromobacter sp. TL-3: assessment of bioflocculant activity.

PubMed

Batta, Neha; Subudhi, Sanjukta; Lal, Banwari; Devi, Arundhuti

2013-11-01

Lead is one of the four heavy metals that has a profound damaging effects on human health. In the recent past there has been an increasing global concern for development of sustainable bioremediation technologies for detoxification of lead contaminant. Present investigation highlights for lead biosorption by a newly isolated novel bacterial species; Achromobacter sp. TL-3 strain, isolated from activated sludge samples contaminated with heavy metals (collected from oil refinery, Assam, North-East India). For isolation of lead tolerant bacteria, sludge samples were enriched into Luria Broth medium supplemented separately with a range of lead nitrate; 250, 500, 750, 1000, 1250 and 1500 ppm respectively. The bacterial consortium that could tolerate 1500 ppm of lead nitrate was selected further for purification of lead tolerant bacterial isolates. Purified lead tolerant bacterial isolates were then eventually inoculated into production medium supplemented with ethanol and glycerol as carbon and energy source to investigate for bioflocculant production. Bioflocculant production was estimated by monitoring the potential of lead tolerant bacterial isolate to flocculate Kaolin clay in presence of 1% CaCl2. Compared to other isolates, TL-3 isolate demonstrated for maximum bioflocculant activity of 95% and thus was identified based on 16S rRNA gene sequence analysis. TL3 isolate revealed maximum homology (98%) with Achromobacter sp. and thus designated as Achromobacter sp. TL-3. Bioflocculant activity of TL-3 isolate was correlated with the change in pH and growth. Achromobacter sp. TL-3 has significant potential for lead biosorption and can be effectively employed for detoxification of lead contaminated waste effluents/waste waters.

Macroscopic Streamer Growths in Acidic, Metal-Rich Mine Waters in North Wales Consist of Novel and Remarkably Simple Bacterial Communities

PubMed Central

Hallberg, Kevin B.; Coupland, Kris; Kimura, Sakurako; Johnson, D. Barrie

2006-01-01

The microbial composition of acid streamers (macroscopic biofilms) in acidic, metal-rich waters in two locations (an abandoned copper mine and a chalybeate spa) in north Wales was studied using cultivation-based and biomolecular techniques. Known chemolithotrophic and heterotrophic acidophiles were readily isolated from disrupted streamers, but they accounted for only <1 to 7% of the total microorganisms present. Fluorescent in situ hybridization (FISH) revealed that 80 to 90% of the microbes in both types of streamers were β-Proteobacteria. Terminal restriction fragment length polymorphism analysis of the streamers suggested that a single bacterial species was dominant in the copper mine streamers, while two distinct bacteria (one of which was identical to the bacterium found in the copper mine streamers) accounted for about 90% of the streamers in the spa water. 16S rRNA gene clone libraries showed that the β-proteobacterium found in both locations was closely related to a clone detected previously in acid mine drainage in California and that its closest characterized relatives were neutrophilic ammonium oxidizers. Using a modified isolation technique, this bacterium was isolated from the copper mine streamers and shown to be a novel acidophilic autotrophic iron oxidizer. The β-proteobacterium found only in the spa streamers was closely related to the neutrophilic iron oxidizer Gallionella ferruginea. FISH analysis using oligonucleotide probes that targeted the two β-proteobacteria confirmed that the biodiversity of the streamers in both locations was very limited. The microbial compositions of the acid streamers found at the two north Wales sites are very different from the microbial compositions of the previously described acid streamers found at Iron Mountain, California, and the Rio Tinto, Spain. PMID:16517651

Diacylglycerol kinase ζ generates dipalmitoyl-phosphatidic acid species during neuroblastoma cell differentiation.

PubMed

Mizuno, Satoru; Kado, Sayaka; Goto, Kaoru; Takahashi, Daisuke; Sakane, Fumio

2016-12-01

Phosphatidic acid (PA) is one of the phospholipids composing the plasma membrane and acts as a second messenger to regulate a wide variety of important cellular events, including mitogenesis, migration and differentiation. PA consists of various molecular species with different acyl chains at the sn- 1 and sn -2 positions. However, it has been poorly understood what PA molecular species are produced during such cellular events. Here we identified the PA molecular species generated during retinoic acid (RA)-induced neuroblastoma cell differentiation using a newly established liquid chromatography/mass spectrometry (LC/MS) method. Intriguingly, the amount of 32:0-PA species was dramatically and transiently increased in Neuro-2a neuroblastoma cells 24-48 h after RA-treatment. In addition, 30:0- and 34:0-PA species were also moderately increased. Moreover, similar results were obtained when Neuro-2a cells were differentiated for 24 h by serum starvation. MS/MS analysis revealed that 32:0-PA species contains two palmitic acids (16:0 s). RT-PCR analysis showed that diacylglycerol kinase (DGK) δ and DGKζ were highly expressed in Neuro-2a cells. The silencing of DGKζ expression significantly decreased the production of 32:0-PA species, whereas DGKδ-siRNA did not. Moreover, neurite outgrowth was also markedly attenuated by the deficiency of DGKζ. Taken together, these results indicate that DGKζ exclusively generates very restricted PA species, 16:0/16:0-PA, and up-regulates neurite outgrowth during the initial/early stage of neuroblastoma cell differentiation.

Rapid detection method for fusaric acid-producing species of Fusarium by PCR

USDA-ARS?s Scientific Manuscript database

Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...

Bacterial Utilization of L-sugars and D-amino Acids

NASA Technical Reports Server (NTRS)

Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

2006-01-01

The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

Acidic fog and temperature effects on stigmatic receptivity in two birch species

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hughes, R.N.; Cox, R.M.

Factorial assays were performed to determine the effects of simulated acid fog (SAF) and temperature on stigmatic receptivity in two birch species. Excised reproductive branches were sampled from representative individuals of mountain paper birch (Betula cordifolia Regel.) and paper birch (Betula papyrifera Marsh.) in populations adjacent to the Bay of Fundy, New Brunswick, Canada. Since 1979 these trees have exhibited branch dieback in association with abnormal foliar browning symptoms. This browning has been linked with acidity and nitrate deposited by fog, which is frequent in the area. In general, experimental results indicated that pollen germination increased with temperature, but pHmore » effects were less obvious. Similarly, pollen tube growth responded positively to temperature and was little affected by fog acidity. ANOVA tests indicated a significant difference (P < 0.05) between species in their pollen germination response only at 12{degrees}C, and not at the other three temperatures tested. For pollen tube growth, significant differences between species (P < 0.05) were demonstrated at 12 and 22{degrees}C. A significant pH effect was demonstrated at 27{degrees}C for germination, while pH effects on tube growth were significant at 27 and 12{degrees}C (P < 0.01). A response surface regression analysis indicated that acidity significantly affected pollen germination in mountain paper birch (P < 0.001) but not in paper birch. Temperature was not a significant factor for in vivo pollen germination in either species. For pollen tube growth, however, temperature was more important than pH and produced highly significant effects in both species (P < 0.001). Acidity was also a significant factor in pollen tube growth for paper birch. 39 refs., 4 figs., 3 tabs.« less

Fatty acid and sterol composition of three phytomonas species.

PubMed

Nakamura, C V; Waldow, L; Pelegrinello, S R; Ueda-Nakamura, T; Filho, B A; Filho, B P

1999-01-01

Fatty acid and sterol analysis were performed on Phytomonas serpens and Phytomonas sp. grown in chemically defined and complex medium, and P. françai cultivated in complex medium. The three species of the genus Phytomonas had qualitatively identical fatty acid patterns. Oleic, linoleic, and linolenic were the major unsaturated fatty acids. Miristic and stearic were the major saturated fatty acids. Ergosterol was the only sterol isolated from Phytmonas sp. and P. serpens grown in a sterol-free medium, indicating that it was synthesized de novo. When P. françai that does not grow in defined medium was cultivated in a complex medium, cholesterol was the only sterol detected. The fatty acids and sterol isolated from Phytomonas sp. and P. serpens grown in a chemically defined lipid-free medium indicated that they were able to biosynthesize fatty acids and ergosterol from acetate or from acetate precursors such as glucose or threonine.

Investigations of the structure and function of bacterial communities associated with Sphagnum mosses.

PubMed

Opelt, Katja; Chobot, Vladimir; Hadacek, Franz; Schönmann, Susan; Eberl, Leo; Berg, Gabriele

2007-11-01

High acidity, low temperature and extremely low concentration of nutrients form Sphagnum bogs into extreme habitats for organisms. Little is known about the bacteria associated with living Sphagnum plantlets, especially about their function for the host. Therefore, we analysed the endo- and ectophytic bacterial populations associated with two widely distributed Sphagnum species, Sphagnum magellanicum and Sphagnum fallax, by a multiphasic approach. The screening of 1222 isolates for antagonistic activity resulted in 326 active isolates. The bacterial communities harboured a high proportion of antifungal (26%) but a low proportion of antibacterial isolates (0.4%). Members of the genus Burkholderia (38%) were found to be the most dominant group of antagonistic bacteria. The finding that a large proportion (89%) of the antagonistic bacteria produced antifungal compounds may provide an explanation for the well-known antimicrobial activity of certain Sphagnum species. The secondary metabolites of the Sphagnum species themselves were analysed by HPLC-PDA. The different spectra of detected compounds may not only explain the antifungal activity but also the species specificity of the microbial communities. The latter was analysed using cultivation-independent single-stranded conformation polymorphism (SSCP) analysis. Using Burkholderia-specific primers we found a high diversity of Burkholderia isolates in the endophytic and ectophytic habitats of Sphagnum. Furthermore, a high diversity of nitrogen-fixing bacteria was detected by using nifH-specific primers, especially inside Sphagnum mosses. In conclusion, this study provides evidence that both Sphagnum species were colonized by characteristic bacterial populations, which appear to be important for pathogen defence and nitrogen fixation.

Comparative and bioinformatics analyses of pathogenic bacterial secretomes identified by mass spectrometry in Burkholderia species.

PubMed

Nguyen, Thao Thi; Chon, Tae-Soo; Kim, Jaehan; Seo, Young-Su; Heo, Muyoung

2017-07-01

Secreted proteins (secretomes) play crucial roles during bacterial pathogenesis in both plant and human hosts. The identification and characterization of secretomes in the two plant pathogens Burkholderia glumae BGR1 and B. gladioli BSR3, which cause diseases in rice such as seedling blight, panicle blight, and grain rot, are important steps to not only understand the disease-causing mechanisms but also find remedies for the diseases. Here, we identified two datasets of secretomes in B. glumae BGR1 and B. gladioli BSR3, which consist of 118 and 111 proteins, respectively, using mass spectrometry approach and literature curation. Next, we characterized the functional properties, potential secretion pathways and sequence information properties of secretomes of two plant pathogens in a comparative analysis by various computational approaches. The ratio of potential non-classically secreted proteins (NCSPs) to classically secreted proteins (CSPs) in B. glumae BGR1 was greater than that in B. gladioli BSR3. For CSPs, the putative hydrophobic regions (PHRs) which are essential for secretion process of CSPs were screened in detail at their N-terminal sequences using hidden Markov model (HMM)-based method. Total 31 pairs of homologous proteins in two bacterial secretomes were indicated based on the global alignment (identity ≥ 70%). Our results may facilitate the understanding of the species-specific features of secretomes in two plant pathogenic Burkholderia species.

[Fatty acids in different edible fish species from Mexico].

PubMed

Castro González, María Isabel; Rodríguez, Ana Gabriela Maafs; Galindo Gómez, Carlos

2013-12-01

Different biotic and abiotic factors determine the fatty acid (FA) composition of fish tissues and organs. This information is useful for humans due to the fact that fish consumption is associated with health benefits. The aim of the present study was to identify the variation in the concentration of fatty acids, according to different factors, among ten edible marine fish species in Mexico, collected from June to December 2009 in the largest fish market in Mexico City: Euthynnus alletteratus, Sciaenops ocellatus, Bairdiella chrysoura, Sphyraena guachancho, Symphurus elongatus, Istiophorus platypterus, Ophichthus rex, Eugerres plumieri, Eucinostomus entomelas and Oreochromrnis mossambicus. Lipid content was gravimetrically quantified, the fatty acids were determined using a gas chromatograph and the results were statistically analyzed. Total lipid content ranged from 0.93 to 1.95 g/100 g in E. entomelas and O. urolepis hornorum, respectively. E. alletteratus, B. chrysoura, S. elongatus, I. platypterus, O. rex and E. plumieri presented the following order in FA concentration: Polyunsaturated FA (PUFA)>Saturated FA (SFA)>Monounsaturated FA (MUFA). S. ocellatus, S. guachancho and E. entomelas presented SFA>PUFA>MUFA; and only O. mossambicus presented SFA>MUFA>PUFA. O. mossambicus had the highest concentration (mg/100 g) of SFA (559.40) and MUFA (442.60), while B. chrysoura presented the highest content (mg/100 g) of PUFA (663.03), n-3 PUFA (514.03), EPA+DHA (506.10) and n-6 PUFA (145.80). Biotic and abiotic factors of the analyzed fish significantly influenced their FA concentration. Subtropical species presented 42.1% more EPA+DHA than tropical specie. Values presented here will vary according to the changes in the ecosystem and characteristics of each fish species, however the information generated in the present study is useful for improving fish consumption recommendations.

Biotechnological production of caffeic acid derivatives from cell and organ cultures of Echinacea species.

PubMed

Murthy, Hosakatte Niranjana; Kim, Yun-Soo; Park, So-Young; Paek, Kee-Yoeup

2014-09-01

Caffeic acid derivatives (CADs) are a group of bioactive compounds which are produced in Echinacea species especially Echinacea purpurea, Echinacea angustifolia, and Echinacea pallida. Echinacea is a popular herbal medicine used in the treatment of common cold and it is also a prominent dietary supplement used throughout the world. Caffeic acid, chlorogenic acid (5-O-caffeoylquinic acid), caftaric acid (2-O-caffeoyltartaric acid), cichoric acid (2, 3-O-dicaffeoyltartaric acid), cynarin, and echinacoside are some of the important CADs which have varied pharmacological activities. The concentrations of these bioactive compounds are species specific and also they vary considerably with the cultivated Echinacea species due to geographical location, stage of development, time of harvest, and growth conditions. Due to these reasons, plant cell and organ cultures have become attractive alternative for the production of biomass and caffeic acid derivatives. Adventitious and hairy roots have been induced in E. pupurea and E. angustifolia, and suspension cultures have been established from flask to bioreactor scale for the production of biomass and CADs. Tremendous progress has been made in this area; various bioprocess methods and strategies have been developed for constant high-quality productivity of biomass and secondary products. This review is aimed to discuss biotechnological methods and approaches employed for the sustainable production of CADs.

Culturable endophytic bacterial communities associated with field-grown soybean.

PubMed

de Almeida Lopes, K B; Carpentieri-Pipolo, V; Oro, T H; Stefani Pagliosa, E; Degrassi, G

2016-03-01

Assess the diversity of the culturable endophytic bacterial population associated with transgenic and nontransgenic soybean grown in field trial sites in Brazil and characterize them phenotypically and genotypically focusing on characteristics related to plant growth promotion. Endophytic bacteria were isolated from roots, stems and leaves of soybean cultivars (nontransgenic (C) and glyphosate-resistant (GR) transgenic soybean), including the isogenic BRS133 and BRS245RR. Significant differences were observed in bacterial densities in relation to genotype and tissue from which the isolates were obtained. The highest number of bacteria was observed in roots and in GR soybean. Based on characteristics related to plant growth promotion, 54 strains were identified by partial 16S rRNA sequence analysis, with most of the isolates belonging to the species Enterobacter ludwigii and Variovorax paradoxus. Among the isolates, 44·4% were able to either produce indoleacetic acid (IAA) or solubilize phosphates, and 9·2% (all from GR soybean) presented both plant growth-promoting activities. The results from this study indicate that the abundance of endophytic bacterial communities of soybean differs between cultivars and in general it was higher in the transgenic cultivars than in nontransgenic cultivars. BRS 245 RR exhibited no significant difference in abundance compared to nontransgenic BRS133. This suggests that the impact of the management used in the GR soybean fields was comparable with the impacts of some enviromental factors. However, the bacterial endophytes associated to GR and nontransgenic soybean were different. The soybean-associated bacteria showing characteristics related to plant growth promotion were identified as belonging to the species Pantoea agglomerans and Variovorax paradoxus. Our study demonstrated differences concerning compostion of culturable endophytic bacterial population in nontransgenic and transgenic soybean. © 2016 The Society for Applied

Memory of Germinant Stimuli in Bacterial Spores

PubMed Central

Wang, Shiwei; Faeder, James R.; Setlow, Peter

2015-01-01

ABSTRACT Bacterial spores, despite being metabolically dormant, possess the remarkable capacity to detect nutrients and other molecules in their environment through a biochemical sensory apparatus that can trigger spore germination, allowing the return to vegetative growth within minutes of exposure of germinants. We demonstrate here that bacterial spores of multiple species retain memory of transient exposures to germinant stimuli that can result in altered responses to subsequent exposure. The magnitude and decay of these memory effects depend on the pulse duration as well as on the separation time, incubation temperature, and pH values between the pulses. Spores of Bacillus species germinate in response to nutrients that interact with germinant receptors (GRs) in the spore’s inner membrane, with different nutrient types acting on different receptors. In our experiments, B. subtilis spores display memory when the first and second germinant pulses target different receptors, suggesting that some components of spore memory are downstream of GRs. Furthermore, nonnutrient germinants, which do not require GRs, exhibit memory either alone or in combination with nutrient germinants, and memory of nonnutrient stimulation is found to be more persistent than that induced by GR-dependent stimuli. Spores of B. cereus and Clostridium difficile also exhibit germination memory, suggesting that memory may be a general property of bacterial spores. These observations along with experiments involving strains with mutations in various germination proteins suggest a model in which memory is stored primarily in the metastable states of SpoVA proteins, which comprise a channel for release of dipicolinic acid, a major early event in spore germination. PMID:26604257

The effect of boric acid on bacterial culture of canine and feline urine.

PubMed

Rowlands, M; Blackwood, L; Mas, A; Cripps, P; Crompton, C; Burrow, R

2011-10-01

To identify the optimal method of submission of canine and feline urine for bacterial culture. Cystocentesis samples from 250 animals (200 dogs, 50 cats) suspected of having urinary tract infections were collected. The reference aliquot, without preservative, was processed on site within 2 hours. Two further aliquots (one without preservative, one with boric acid) were stored at room temperature for up to 7 hours and then posted by guaranteed next day delivery to a commercial laboratory for analysis. Forty-seven of the samples were positive on culture in the reference test. There was no significant difference between reference test results and those of samples posted without preservative (P=0·39), but samples posted in boric acid were significantly less likely to give a positive result (P=0·01). Samples posted without preservative had a sensitivity of 82% and a specificity of 98%; for boric acid, sensitivity was 73% and specificity 99%. Postal urine samples should be submitted to the laboratory in a plain sterile tube. © 2011 British Small Animal Veterinary Association.

Modeling the acid-base properties of bacterial surfaces: A combined spectroscopic and potentiometric study of the gram-positive bacterium Bacillus subtilis.

PubMed

Leone, Laura; Ferri, Diego; Manfredi, Carla; Persson, Per; Shchukarev, Andrei; Sjöberg, Staffan; Loring, John

2007-09-15

In this study, macroscopic and spectroscopic data were combined to develop a surface complexation model that describes the acid-base properties of Bacillus subtilis. The bacteria were freeze-dried and then resuspended in 0.1 M NaCl ionic medium. Macroscopic measurements included potentiometric acid-base titrations and electrophoretic mobility measurements. In addition, ATR-FTIR spectra of wet pastes from suspensions of Bacillus subtilis at different pH values were collected. The least-squares program MAGPIE was used to generate a surface complexation model that takes into account the presence of three acid-base sites on the surface: tripple bond COOH, tripple bond NH+, and tripple bond PO-, which were identified previously by XPS measurements. Both potentiometric titration data and ATR-FTIR spectra were used quantitatively, and electrostatic effects at the charged bacterial surface were accounted for using the constant capacitance model. The model was calculated using two different approaches: in the first one XPS data were used to constrain the ratio of the total concentrations of all three surface sites. The capacitance of the double layer, the total buffer capacity, and the deprotonation constants of the tripple bond NH+, tripple bond POH, and tripple bond COOH species were determined in the fit. A second approach is presented in which the ratio determined by XPS of the total concentrations of tripple bond NH+ to tripple bond PO- sites is relaxed. The total concentration of tripple bond PO- sites was determined in the fit, while the deprotonation constant for tripple bond POH was manually varied until the minimization led to a model which predicted an isoelectric point that resulted in consistency with electrophoretic mobility data. The model explains well the buffering capacity of Bacillus subtilis suspensions in a wide pH range (between pH=3 and pH=9) which is of considerable environmental interest. In particular, a similar quantitative use of the IR data

Bacterial Communities in Women with Bacterial Vaginosis: High Resolution Phylogenetic Analyses Reveal Relationships of Microbiota to Clinical Criteria

PubMed Central

Srinivasan, Sujatha; Hoffman, Noah G.; Morgan, Martin T.; Matsen, Frederick A.; Fiedler, Tina L.; Hall, Robert W.; Ross, Frederick J.; McCoy, Connor O.; Bumgarner, Roger; Marrazzo, Jeanne M.; Fredricks, David N.

2012-01-01

Background Bacterial vaginosis (BV) is a common condition that is associated with numerous adverse health outcomes and is characterized by poorly understood changes in the vaginal microbiota. We sought to describe the composition and diversity of the vaginal bacterial biota in women with BV using deep sequencing of the 16S rRNA gene coupled with species-level taxonomic identification. We investigated the associations between the presence of individual bacterial species and clinical diagnostic characteristics of BV. Methodology/Principal Findings Broad-range 16S rRNA gene PCR and pyrosequencing were performed on vaginal swabs from 220 women with and without BV. BV was assessed by Amsel’s clinical criteria and confirmed by Gram stain. Taxonomic classification was performed using phylogenetic placement tools that assigned 99% of query sequence reads to the species level. Women with BV had heterogeneous vaginal bacterial communities that were usually not dominated by a single taxon. In the absence of BV, vaginal bacterial communities were dominated by either Lactobacillus crispatus or Lactobacillus iners. Leptotrichia amnionii and Eggerthella sp. were the only two BV-associated bacteria (BVABs) significantly associated with each of the four Amsel’s criteria. Co-occurrence analysis revealed the presence of several sub-groups of BVABs suggesting metabolic co-dependencies. Greater abundance of several BVABs was observed in Black women without BV. Conclusions/Significance The human vaginal bacterial biota is heterogeneous and marked by greater species richness and diversity in women with BV; no species is universally present. Different bacterial species have different associations with the four clinical criteria, which may account for discrepancies often observed between Amsel and Nugent (Gram stain) diagnostic criteria. Several BVABs exhibited race-dependent prevalence when analyzed in separate groups by BV status which may contribute to increased incidence of BV in

Estimates of Soil Bacterial Ribosome Content and Diversity Are Significantly Affected by the Nucleic Acid Extraction Method Employed

PubMed Central

Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf

2016-01-01

Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137

Effects of dietary n-3 fatty acids on the phospholipid molecular species of monkey brain.

PubMed

Lin, D S; Connor, W E; Anderson, G J; Neuringer, M

1990-10-01

We examined the changes in the molecular species of brain ethanolamine glycerophospholipids of monkeys fed diets containing widely ranging amounts of n-3 fatty acids. Two groups of rhesus monkeys were fed pre- and postnatally either a control diet (soy oil; containing 8% of fatty acids as 18:3n-3) or a deficient diet (safflower oil; containing less than 0.3% 18:3n-3). The brains of these animals were analyzed at 22 months of age. A third group of monkeys was fed the safflower oil diet to 22 months of age and then switched to a fish oil diet (28% long-chain n-3 fatty acids) for 1-2 years before autopsy. The molecular species of the diacyl, alkylacyl, and alkenylacyl ethanolamine glycerophospholipids from frontal cortex were separated by HPLC. A total of 24 molecular species were identified. Fatty acids in the sn-2 position differed markedly among the diet groups, but the sn-1 position always contained only 16:0, 18:0, or 18:1. In the diacyl subclass of the control brain, the n-3 molecular species represented 41% of total and the n-6 species 45%, whereas in the deficient brain the n-3 molecular species decreased to 9% and n-6 molecular species increased to 77%. The fatty acid 22:5n-6 did not replace 22:6n-3 in a symmetrical fashion in the molecular species of the deficient brain. In the brains of the fish oil-fed monkeys, the n-3 molecular species amounted to 61% and n-6 molecular species were reduced to 25%. The species 18:1-22:6, 16:0-22:6, and 18:0-22:6 generally changed proportionally in response to diet.(ABSTRACT TRUNCATED AT 250 WORDS)

From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

PubMed

Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

2010-01-30

Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

PubMed Central

2010-01-01

Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

The effect of natural organic matter on the adsorption of mercury to bacterial cells

NASA Astrophysics Data System (ADS)

Dunham-Cheatham, Sarrah; Mishra, Bhoopesh; Myneni, Satish; Fein, Jeremy B.

2015-02-01

We investigated the ability of non-metabolizing Bacillus subtilis, Shewanella oneidensis MR-1, and Geobacter sulfurreducens bacterial species to adsorb mercury in the absence and presence of Suwanee River fulvic acid (FA). Bulk adsorption and X-ray absorption spectroscopy (XAS) experiments were conducted at three pH conditions, and the results indicate that the presence of FA decreases the extent of Hg adsorption to biomass under all of the pH conditions studied. Hg XAS results show that the presence of FA does not alter the binding environment of Hg adsorbed onto the biomass regardless of pH or FA concentration, indicating that ternary bacteria-Hg-FA complexes do not form to an appreciable extent under the experimental conditions, and that Hg binding on the bacteria is dominated by sulfhydryl binding. We used the experimental results to calculate apparent partition coefficients, Kd, for Hg under each experimental condition. The calculations yield similar coefficients for Hg onto each of the bacterial species studies, suggesting there is no significant difference in Hg partitioning between the three bacterial species. The calculations also indicate similar coefficients for Hg-bacteria and Hg-FA complexes. S XAS measurements confirm the presence of sulfhydryl sites on both the FA and bacterial cells, and demonstrate the presence of a wide range of S moieties on the FA in contrast to the bacterial biomass, whose S sites are dominated by thiols. Our results suggest that although FA can compete with bacterial binding sites for aqueous Hg, because of the relatively similar partition coefficients for the types of sorbents, the competition is not dominated by either bacteria or FA unless the concentration of one type of site greatly exceeds that of the other.

Quantitation of phosphatidic acid and lysophosphatidic acid molecular species using hydrophilic interaction liquid chromatography coupled to electrospray ionization high resolution mass spectrometry.

PubMed

Triebl, Alexander; Trötzmüller, Martin; Eberl, Anita; Hanel, Pia; Hartler, Jürgen; Köfeler, Harald C

2014-06-20

A method for a highly selective and sensitive identification and quantitation of lysophosphatidic acid (LPA) and phosphatidic acid (PA) molecular species was developed using hydrophilic interaction liquid chromatography (HILIC) followed by negative-ion electrospray ionization high resolution mass spectrometry. Different extraction methods for the polar LPA and PA species were compared and a modified Bligh & Dyer extraction by addition of 0.1M hydrochloric acid resulted in a ≈1.2-fold increase of recovery for the 7 PA and a more than 15-fold increase for the 6 LPA molecular species of a commercially available natural mix compared to conventional Bligh & Dyer extraction. This modified Bligh & Dyer extraction did not show any artifacts resulting from hydrolysis of natural abundant phospholipids. The developed HILIC method is able to separate all PA and LPA species from major polar membrane lipid classes which might have suppressive effects on the minor abundant lipid classes of interest. The elemental compositions of intact lipid species are provided by the high mass resolution of 100,000 and high mass accuracy below 3ppm of the Orbitrap instrument. Additionally, tandem mass spectra were generated in a parallel data dependent acquisition mode in the linear ion trap to provide structural information at molecular level. Limits of quantitation were identified at 45fmol on column and the dynamic range reaches 20pmol on column, covering the range of natural abundance well. By applying the developed method to mouse brain it can be shown that phosphatidic acid contains less unsaturated fatty acids with PA 34:1 and PA 36:1 as the major species. In contrast, for LPA species a high content of polyunsaturated fatty acids (LPA 20:4 and LPA 22:6) was quantified. Copyright © 2014 Elsevier B.V. All rights reserved.

Autoxidated linolenic acid inhibits aflatoxin biosynthesis in Aspergillus flavus via oxylipin species.

PubMed

Yan, Shijuan; Liang, Yating; Zhang, Jindan; Chen, Zhuang; Liu, Chun-Ming

2015-08-01

Aflatoxins produced by Aspergillus species are among the most toxic and carcinogenic compounds in nature. Although it has been known for a long time that seeds with high oil content are more susceptible to aflatoxin contamination, the role of fatty acids in aflatoxin biosynthesis remains controversial. Here we demonstrate in A. flavus that both the saturated stearic acid (C18:0) and the polyunsaturated linolenic acid (C18:3) promoted aflatoxin production, while C18:3, but not C18:0, inhibited aflatoxin biosynthesis after exposure to air for several hours. Further experiments showed that autoxidated C18:3 promoted mycelial growth, sporulation, and kojic acid production, but inhibited the expression of genes in the AF biosynthetic gene cluster. Mass spectrometry analyses of autoxidated C18:3 fractions that were able to inhibit aflatoxin biosynthesis led to the identification of multiple oxylipin species. These results may help to clarify the role of fatty acids in aflatoxin biosynthesis, and may explain why controversial results have been obtained for fatty acids in the past. Copyright © 2014 Elsevier Inc. All rights reserved.

Fatty acids in six small pelagic fish species and their crustacean prey from the mindanao sea, southern Philippines.

PubMed

Metillo, Ephrime Bicoy; Aspiras-Eya, Anna Arlene

2014-08-01

Fatty acids are important in human health and useful in the analysis of the marine food web, however information on tropical pelagic organisms is scarce. Six zooplanktivorous small pelagic fish species (Decapterus kurroides, Decapterus macarellus, Selar crumenophthalmus, Sardinella lemuru, Spratilloides gracilis and Stolephorus insularis) and four of their zooplanktonic crustacean prey [three sergestoid species (Acetes erythraeus, Acetes intermedius and Lucifer penicillifer) and one calanoid copepod (Acartia erythraea)] were collected from the Mindanao Sea, and their fatty acids were profiled. The resulting profiles revealed 17 fatty acids that were specific to certain species and 9 {myristic acid [C14:0], palmitic acid [C16:0], stearic acid [C18:0]; palmitoleic acid [C16:1], oleic acid [C18:1n9c], linoleic acid [C18:2n6c], linolenic acid [C18:3n3], eicosapentaenoic acid (EPA) [C20:5n3] and docosahexaenoic acid (DHA) [C22:6n3]} that were common to all species. Cluster analysis and non-metric multidimensional scaling (NMDS) of fatty acids indicate a high similarity in profiles in all species, but separate fish and zooplankton clusters were obtained. Mackerel species (D. macarellus, D. kurroides and S. crumenophthalmus) had concentrations of total n-3 fatty acids that match those of their Acetes prey. The copepod A. erythraea and the sergestoid L. penicillifer exhibited the lowest values of the EPA:DHA ratio, which was most likely due to their phytoplanktivorous feeding habits, but the occurrence of the highest values of the ratio in Acetes suggests the inclusion of plant detritus in their diet. DHA values appear to affirm the trophic link among copepod, Lucifer, Acetes and mackerel species.

Response of citrus and other selected plant species to simulated HCL - acid rain

NASA Technical Reports Server (NTRS)

Knott, W. M.; Heagle, A. S.

1980-01-01

Mature valencia orange trees were sprayed with hydrochloric acid solutions (pH 7.8, 2.0, 1.0, and 0.5) in the field at the full bloom stage and at one month after fruit set. Potted valencia orange and dwarf citrus trees, four species of plants native to Merritt Island, and four agronomic species were exposed to various pH levels of simulated acid rain under controlled conditions. The acid rain was generated from dilutions of hydrochloric acid solutions or by passing water through an exhaust generated by burning solid rocket fuel. The plants were injured severely at pH levels below 1.0, but showed only slight injury at pH levels of 2.0 and above. Threshold injury levels were between 2.0 and 3.0 pH. The sensitivity of the different plant species to acid solutions was similar. Foliar injury symptoms were representative of acid rain including necrosis of young tissue, isolated necrotic spots or patches, and leaf abscission. Mature valencia orange trees sprayed with concentrations of 1.0 pH and 0.5 pH in the field had reduced fruit yields for two harvests after the treatment. All experimental trees were back to full productivity by the third harvest after treatment.

Study of the bacterial diversity of foods: PCR-DGGE versus LH-PCR.

PubMed

Garofalo, Cristiana; Bancalari, Elena; Milanović, Vesna; Cardinali, Federica; Osimani, Andrea; Sardaro, Maria Luisa Savo; Bottari, Benedetta; Bernini, Valentina; Aquilanti, Lucia; Clementi, Francesca; Neviani, Erasmo; Gatti, Monica

2017-02-02

The present study compared two culture-independent methods, polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) and length-heterogeneity polymerase chain reaction (LH-PCR), for their ability to reveal food bacterial microbiota. Total microbial DNA and RNA were extracted directly from fourteen fermented and unfermented foods, and domain A of the variable regions V1 and V2 of the 16S rRNA gene was analyzed through LH-PCR and PCR-DGGE. Finally, the outline of these analyses was compared with bacterial viable counts obtained after bacterial growth on suitable selective media. For the majority of the samples, RNA-based PCR-DGGE revealed species that the DNA-based PCR-DGGE was not able to highlight. When analyzing either DNA or RNA, LH-PCR identified several lactic acid bacteria (LAB) and coagulase negative cocci (CCN) species that were not identified by PCR-DGGE. This phenomenon was particularly evident in food samples with viable loads<5.0 Logcfug -1 . Furthermore, LH-PCR was able to detect a higher number of peaks in the analyzed food matrices relative to species identified by PCR-DGGE. In light of these findings, it may be suggested that LH-PCR shows greater sensitivity than PCR-DGGE. However, PCR-DGGE detected some other species (LAB included) that were not detected by LH-PCR. Therefore, certain LH-PCR peaks not attributed to known species within the LH-PCR database could be solved by comparing them with species identified by PCR-DGGE. Overall, this study also showed that LH-PCR is a promising method for use in the food microbiology field, indicating the necessity to expand the LH-PCR database, which is based, up to now, mainly on LAB isolates from dairy products. Copyright © 2016 Elsevier B.V. All rights reserved.

Pulmonary bioavailability of ascorbic acid in an ascorbate-synthesising species, the horse.

PubMed

Deaton, Christopher M; Marlin, David J; Smith, Nicola C; Roberts, Colin A; Harris, Pat A; Kelly, Frank J; Schroter, Robert C

2003-04-01

Vitamin C (ascorbic acid) is a non-enzymatic antioxidant important in protecting the lung against oxidative damage and is decreased in lung lining fluid of horses with airway inflammation. To examine possible therapeutic regimens in a species with ascorbate-synthesising capacity, we studied the effects of oral supplementation of two forms of ascorbic acid, (each equivalent to 20 mg ascorbic acid per kg body weight) on the pulmonary and systemic antioxidant status of six healthy ponies in a 3 x 3 Latin square design. Two weeks supplementation with ascorbyl palmitate significantly increased mean plasma ascorbic acid concentrations compared to control (29 +/- 5 and 18 +/- 7 micromol/l, respectively; p < 0.05). Calcium ascorbyl-2-monophosphate, a more stable form of ascorbic acid, also increased mean plasma ascorbic acid concentrations, but not significantly (23 +/- 1 micromol/l; p = 0.07). The concentration of ascorbic acid in bronchoalveolar lavage fluid increased in five out of six ponies following supplementation with either ascorbyl palmitate or calcium ascorbyl-2-monophosphate compared with control (30 +/- 10, 25 +/- 4 and 18 +/- 8 micromol/l, respectively; p < 0.01). Neither supplement altered the concentration of glutathione, uric acid or alpha-tocopherol in plasma or bronchoalveolar lavage fluid. In conclusion, the concentration of lung lining fluid ascorbic acid is increased following ascorbic acid supplementation (20 mg/kg body weight) in an ascorbate-synthesising species.

Bacterial Species and Antibiotic Sensitivity in Korean Patients Diagnosed with Acute Otitis Media and Otitis Media with Effusion.

PubMed

Kim, Sang Hoon; Jeon, Eun Ju; Hong, Seok Min; Bae, Chang Hoon; Lee, Ho Yun; Park, Moo Kyun; Byun, Jae Yong; Kim, Myung Gu; Yeo, Seung Geun

2017-04-01

Changes over time in pathogens and their antibiotic sensitivity resulting from the recent overuse and misuse of antibiotics in otitis media (OM) have complicated treatment. This study evaluated changes over 5 years in principal pathogens and their antibiotic sensitivity in patients in Korea diagnosed with acute OM (AOM) and OM with effusion (OME). The study population consisted of 683 patients who visited the outpatient department of otorhinolaryngology in 7 tertiary hospitals in Korea between January 2010 and May 2015 and were diagnosed with acute AOM or OME. Aural discharge or middle ear fluid were collected from patients in the operating room or outpatient department and subjected to tests of bacterial identification and antibiotic sensitivity. The overall bacteria detection rate of AOM was 62.3% and OME was 40.9%. The most frequently isolated Gram-positive bacterial species was coagulase negative Staphylococcus aureus (CNS) followed by methicillin-susceptible S. aureus (MSSA), methicillin-resistant S. aureus (MRSA), and Streptococcus pneumonia (SP), whereas the most frequently isolated Gram-negative bacterium was Pseudomonas aeruginosa (PA). Regardless of OM subtype, ≥ 80% of CNS and MRSA strains were resistant to penicillin (PC) and tetracycline (TC); isolated MRSA strains showed low sensitivity to other antibiotics, with 100% resistant to PC, TC, cefoxitin (CFT), and erythromycin (EM); and isolated PA showed low sensitivity to quinolone antibiotics, including ciprofloxacin (CIP) and levofloxacin (LFX), and to aminoglycosides. Bacterial species and antibiotic sensitivity did not change significantly over 5 years. The rate of detection of MRSA was higher in OME than in previous studies. As bacterial predominance and antibiotic sensitivity could change over time, continuous and periodic surveillance is necessary in guiding appropriate antibacterial therapy. © 2017 The Korean Academy of Medical Sciences.

Lactobacillus species isolated from vaginal secretions of healthy and bacterial vaginosis-intermediate Mexican women: a prospective study

PubMed Central

2013-01-01

Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of

Exposure of Bacterial Biofilms to Electrical Current Leads to Cell Death Mediated in Part by Reactive Oxygen Species

PubMed Central

Brinkman, Cassandra L.; Schmidt-Malan, Suzannah M.; Karau, Melissa J.; Greenwood-Quaintance, Kerryl; Hassett, Daniel J.; Mandrekar, Jayawant N.

2016-01-01

Bacterial biofilms may form on indwelling medical devices such as prosthetic joints, heart valves and catheters, causing challenging-to-treat infections. We have previously described the ‘electricidal effect’, in which bacterial biofilms are decreased following exposure to direct electrical current. Herein, we sought to determine if the decreased bacterial quantities are due to detachment of biofilms or cell death and to investigate the role that reactive oxygen species (ROS) play in the observed effect. Using confocal and electron microscopy and flow cytometry, we found that direct current (DC) leads to cell death and changes in the architecture of biofilms formed by Gram-positive and Gram-negative bacteria. Reactive oxygen species (ROS) appear to play a role in DC-associated cell death, as there was an increase in ROS-production by Staphylococcus aureus and Staphylococcus epidermidis biofilms following exposure to DC. An increase in the production of ROS response enzymes catalase and superoxide dismutase (SOD) was observed for S. aureus, S. epidermidis and Pseudomonas aeruginosa biofilms following exposure to DC. Additionally, biofilms were protected from cell death when supplemented with antioxidants and oxidant scavengers, including catalase, mannitol and Tempol. Knocking out SOD (sodAB) in P. aeruginosa led to an enhanced DC effect. Microarray analysis of P. aeruginosa PAO1 showed transcriptional changes in genes related to the stress response and cell death. In conclusion, the electricidal effect results in death of bacteria in biofilms, mediated, at least in part, by production of ROS. PMID:27992529

Exposure of Bacterial Biofilms to Electrical Current Leads to Cell Death Mediated in Part by Reactive Oxygen Species.

PubMed

Brinkman, Cassandra L; Schmidt-Malan, Suzannah M; Karau, Melissa J; Greenwood-Quaintance, Kerryl; Hassett, Daniel J; Mandrekar, Jayawant N; Patel, Robin

2016-01-01

Bacterial biofilms may form on indwelling medical devices such as prosthetic joints, heart valves and catheters, causing challenging-to-treat infections. We have previously described the 'electricidal effect', in which bacterial biofilms are decreased following exposure to direct electrical current. Herein, we sought to determine if the decreased bacterial quantities are due to detachment of biofilms or cell death and to investigate the role that reactive oxygen species (ROS) play in the observed effect. Using confocal and electron microscopy and flow cytometry, we found that direct current (DC) leads to cell death and changes in the architecture of biofilms formed by Gram-positive and Gram-negative bacteria. Reactive oxygen species (ROS) appear to play a role in DC-associated cell death, as there was an increase in ROS-production by Staphylococcus aureus and Staphylococcus epidermidis biofilms following exposure to DC. An increase in the production of ROS response enzymes catalase and superoxide dismutase (SOD) was observed for S. aureus, S. epidermidis and Pseudomonas aeruginosa biofilms following exposure to DC. Additionally, biofilms were protected from cell death when supplemented with antioxidants and oxidant scavengers, including catalase, mannitol and Tempol. Knocking out SOD (sodAB) in P. aeruginosa led to an enhanced DC effect. Microarray analysis of P. aeruginosa PAO1 showed transcriptional changes in genes related to the stress response and cell death. In conclusion, the electricidal effect results in death of bacteria in biofilms, mediated, at least in part, by production of ROS.

Eicosanoids mediate nodulation reactions to bacterial infections in adults of two 17-year periodical cicadas, Magicicada septendecim and M. cassini.

PubMed

Tunaz, H; Bedick, J C.; Miller, J S.; Hoback, W W.; Rana, R L.; Stanley, D W.

1999-10-01

Nodulation is the first and quantitatively most important cellular defense reaction to bacterial infections in insects. Treating adults of the 17-year periodical cicadas, Magicicada septendecim and M. cassini, with eicosanoid biosynthesis inhibitors immediately prior to intrahemocoelic injections of the bacterium, Serratia marcescens, sharply reduced the nodulation response to bacterial challenges. Separate treatments with specific inhibitors of phospholipase A(2), cyclooxygenase, and lipoxygenase reduced nodulation, supporting our view that nodule formation is a multi-step process in which individual steps are separately mediated by lipoxygenase and cyclooxygenase products. The inhibitory influence of dexamethasone was apparent by 2 h after injection, and nodulation was significantly reduced, relative to control insects, over the following 14 h. The dexamethasone effects were reversed by treating bacteria-challenged insects with the eicosanoid-precursor polyunsaturated fatty acid, arachidonic acid. Low levels of arachidonic acid were detected in fat body phospholipids. These findings in adults of an exopterygote insect species with an unusual life history pattern broaden our hypothesis that eicosanoids mediate cellular immune reactions to bacterial infections in most, if not all, insects.

Combined scanning transmission X-ray and electron microscopy for the characterization of bacterial endospores.

PubMed

Jamroskovic, Jan; Shao, Paul P; Suvorova, Elena; Barak, Imrich; Bernier-Latmani, Rizlan

2014-09-01

Endospores (also referred to as bacterial spores) are bacterial structures formed by several bacterial species of the phylum Firmicutes. Spores form as a response to environmental stress. These structures exhibit remarkable resistance to harsh environmental conditions such as exposure to heat, desiccation, and chemical oxidants. The spores include several layers of protein and peptidoglycan that surround a core harboring DNA as well as high concentrations of calcium and dipicolinic acid (DPA). A combination of scanning transmission X-ray microscopy, scanning transmission electron microscopy, and energy dispersive spectroscopy was used for the direct quantitative characterization of bacterial spores. The concentration and localization of DPA, Ca(2+) , and other elements were determined and compared for the core and cortex of spores from two distinct genera: Bacillus subtilis and Desulfotomaculum reducens. This micro-spectroscopic approach is uniquely suited for the direct study of individual bacterial spores, while classical molecular and biochemical methods access only bulk characteristics. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

Evolution of Bacterial Consortia in Spontaneously Started Rye Sourdoughs during Two Months of Daily Propagation

PubMed Central

Simm, Jaak; Paalme, Toomas; Sarand, Inga

2014-01-01

The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200), propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius) were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus) was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata) were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping. PMID:24748058

Surface-Selective Preferential Production of Reactive Oxygen Species on Piezoelectric Ceramics for Bacterial Killing.

PubMed

Tan, Guoxin; Wang, Shuangying; Zhu, Ye; Zhou, Lei; Yu, Peng; Wang, Xiaolan; He, Tianrui; Chen, Junqi; Mao, Chuanbin; Ning, Chengyun

2016-09-21

Reactive oxygen species (ROS) can be used to kill bacterial cells, and thus the selective generation of ROS from material surfaces is an emerging direction in antibacterial material discovery. We found the polarization of piezoelectric ceramic causes the two sides of the disk to become positively and negatively charged, which translate into cathode and anode surfaces in an aqueous solution. Because of the microelectrolysis of water, ROS are preferentially formed on the cathode surface. Consequently, the bacteria are selectively killed on the cathode surface. However, the cell experiment suggested that the level of ROS is safe for normal mammalian cells.

Light-Induced Changes in Fatty Acid Profiles of Specific Lipid Classes in Several Freshwater Phytoplankton Species

PubMed Central

Wacker, Alexander; Piepho, Maike; Harwood, John L.; Guschina, Irina A.; Arts, Michael T.

2016-01-01

We tested the influence of two light intensities [40 and 300 μmol PAR / (m2s)] on the fatty acid composition of three distinct lipid classes in four freshwater phytoplankton species. We chose species of different taxonomic classes in order to detect potentially similar reaction characteristics that might also be present in natural phytoplankton communities. From samples of the bacillariophyte Asterionella formosa, the chrysophyte Chromulina sp., the cryptophyte Cryptomonas ovata and the zygnematophyte Cosmarium botrytis we first separated glycolipids (monogalactosyldiacylglycerol, digalactosyldiacylglycerol, and sulfoquinovosyldiacylglycerol), phospholipids (phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, and phosphatidylserine) as well as non-polar lipids (triacylglycerols), before analyzing the fatty acid composition of each lipid class. High variation in the fatty acid composition existed among different species. Individual fatty acid compositions differed in their reaction to changing light intensities in the four species. Although no generalizations could be made for species across taxonomic classes, individual species showed clear but small responses in their ecologically-relevant omega-3 and omega-6 polyunsaturated fatty acids (PUFA) in terms of proportions and of per tissue carbon quotas. Knowledge on how lipids like fatty acids change with environmental or culture conditions is of great interest in ecological food web studies, aquaculture, and biotechnology, since algal lipids are the most important sources of omega-3 long-chain PUFA for aquatic and terrestrial consumers, including humans. PMID:27014290

Case Study of the Distribution of Mucosa-Associated Bifidobacterium Species, Lactobacillus Species, and Other Lactic Acid Bacteria in the Human Colon

PubMed Central

Nielsen, D. S.; Møller, P. L.; Rosenfeldt, V.; Pærregaard, A.; Michaelsen, K. F.; Jakobsen, M.

2003-01-01

The distribution of mucosa-associated bacteria, bifidobacteria and lactobacilli and closely related lactic acid bacteria, in biopsy samples from the ascending, transverse, and descending parts of the colon from four individuals was investigated by denaturing gradient gel electrophoresis (DGGE). Bifidobacterial genus-specific, Lactobacillus group-specific, and universal bacterial primers were used in a nested PCR approach to amplify a fragment of the 16S rRNA gene. DGGE profiles of the bifidobacterial community were relatively simple, with one or two amplicons detected at most sampling sites in the colon. DGGE profiles obtained with Lactobacillus group-specific primers were complex and varied with host and sampling site in the colon. The overall bacterial community varied with host but not sampling site. PMID:14660412

Bacterial surface adaptation

NASA Astrophysics Data System (ADS)

Utada, Andrew

2014-03-01

Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.

Species Diversity, Community Dynamics, and Metabolite Kinetics of the Microbiota Associated with Traditional Ecuadorian Spontaneous Cocoa Bean Fermentations▿

PubMed Central

Papalexandratou, Zoi; Falony, Gwen; Romanens, Edwina; Jimenez, Juan Carlos; Amores, Freddy; Daniel, Heide-Marie; De Vuyst, Luc

2011-01-01

Traditional fermentations of the local Ecuadorian cocoa type Nacional, with its fine flavor, are carried out in boxes and on platforms for a short time. A multiphasic approach, encompassing culture-dependent and -independent microbiological analyses of fermenting cocoa pulp-bean samples, metabolite target analyses of both cocoa pulp and beans, and sensory analysis of chocolates produced from the respective fermented dry beans, was applied for the investigation of the influence of these fermentation practices on the yeast and bacterial species diversity and community dynamics during cocoa bean fermentation. A wide microbial species diversity was found during the first 3 days of all fermentations carried out. The prevailing ethanol-producing yeast species were Pichia kudriavzevii and Pichia manshurica, followed by Saccharomyces cerevisiae. Leuconostoc pseudomesenteroides (glucose and fructose fermenting), Fructobacillus tropaeoli-like (fructose fermenting), and Lactobacillus fermentum (citrate converting, mannitol producing) represented the main lactic acid bacterial species in the fermentations studied, resulting in intensive heterolactate metabolism of the pulp substrates. Tatumella saanichensis and Tatumella punctata were among the members of the family Enterobacteriaceae present during the initial phase of the cocoa bean fermentations and could be responsible for the production of gluconic acid in some cases. Also, a potential new yeast species was isolated, namely, Candida sorbosivorans-like. Acetic acid bacteria, whose main representative was Acetobacter pasteurianus, generally appeared later during fermentation and oxidized ethanol to acetic acid. However, acetic acid bacteria were not always present during the main course of the platform fermentations. All of the data taken together indicated that short box and platform fermentation methods caused incomplete fermentation, which had a serious impact on the quality of the fermented dry cocoa beans. PMID

Stability of bound species during alkene reactions on solid acids

NASA Astrophysics Data System (ADS)

Sarazen, Michele L.; Iglesia, Enrique

2017-05-01

This study reports the thermodynamics of bound species derived from ethene, propene, n-butene, and isobutene on solid acids with diverse strength and confining voids. Density functional theory (DFT) and kinetic data indicate that covalently bound alkoxides form C-C bonds in the kinetically relevant step for dimerization turnovers on protons within TON (0.57 nm) and MOR (0.67 nm) zeolitic channels and on stronger acids HPW (polyoxometalate clusters on silica). Turnover rates for mixed alkenes give relative alkoxide stabilities; the respective adsorption constants are obtained from in situ infrared spectra. Tertiary alkoxides (from isobutene) within larger voids (MOR, HPW) are more stable than less substituted isomers but are destabilized within smaller concave environments (TON) because framework distortions are required to avoid steric repulsion. Adsorption constants are similar on MOR and HPW for each alkoxide, indicating that binding is insensitive to acid strength for covalently bound species. DFT-derived formation free energies for alkoxides with different framework attachments and backbone length/structure agree with measurements when dispersion forces, which mediate stabilization by confinement in host-guest systems, are considered. Theory reveals previously unrecognized framework distortions that balance the C-O bond lengths required for covalency with host-guest distances that maximize van der Waals contacts. These distortions, reported here as changes in O-atom locations and dihedral angles, become stronger for larger, more substituted alkoxides. The thermodynamic properties reported here for alkoxides and acid hosts differing in size and conjugate-anion stability are benchmarked against DFT-derived free energies; their details are essential to design host-guest pairs that direct alkoxide species toward specific products.

Accuracy, reproducibility, and interpretation of fatty acid methyl ester profiles of model bacterial communities

USGS Publications Warehouse

Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.

1994-01-01

We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.

Assessing the Effect of Litter Species on the Dynamic of Bacterial and Fungal Communities during Leaf Decomposition in Microcosm by Molecular Techniques

PubMed Central

Xu, Wenjing; Shi, Lingling; Chan, Onchim; Li, Jiao; Casper, Peter; Zou, Xiaoming

2013-01-01

Although bacteria and fungi are well-known to be decomposers of leaf litter, few studies have examined their compositions and diversities during the decomposition process in tropical stream water. Xishuangbanna is a tropical region preserving one of the highest floristic diversity areas in China. In this study, leaf litter of four dominant plant species in Xishuangbanna was incubated in stream water for 42 days during which samples were taken regularly. Following DNA extraction, PCR-DGGE (denaturing gradient gel electrophoresis) and clone-sequencing analyses were performed using bacterial and fungal specific primers. Leaf species have slightly influences on bacterial community rather than fungal community. The richness and diversity of bacteria was higher than that of fungi, which increased towards the end of the 42-day-incubation. The bacterial community was initially more specific upon the type of leaves and gradually became similar at the later stage of decomposition with alpha-proteobacteria as major component. Sequences affiliated to methanotrophs were obtained that indicates potentially occurrence of methane oxidation and methanogenesis. For the fungal community, sequences affiliated to Aspergillus were predominant at the beginning and then shifted to Pleosporales. Our results suggest that the microorganisms colonizing leaf biofilm in tropical stream water were mostly generalists that could exploit the resources of leaves of various species equally well. PMID:24367682

Comparative Genomic Analyses of the Bacterial Phosphotransferase System

PubMed Central

Barabote, Ravi D.; Saier, Milton H.

2005-01-01

We report analyses of 202 fully sequenced genomes for homologues of known protein constituents of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS). These included 174 bacterial, 19 archaeal, and 9 eukaryotic genomes. Homologues of PTS proteins were not identified in archaea or eukaryotes, showing that the horizontal transfer of genes encoding PTS proteins has not occurred between the three domains of life. Of the 174 bacterial genomes (136 bacterial species) analyzed, 30 diverse species have no PTS homologues, and 29 species have cytoplasmic PTS phosphoryl transfer protein homologues but lack recognizable PTS permeases. These soluble homologues presumably function in regulation. The remaining 77 species possess all PTS proteins required for the transport and phosphorylation of at least one sugar via the PTS. Up to 3.2% of the genes in a bacterium encode PTS proteins. These homologues were analyzed for family association, range of protein types, domain organization, and organismal distribution. Different strains of a single bacterial species often possess strikingly different complements of PTS proteins. Types of PTS protein domain fusions were analyzed, showing that certain types of domain fusions are common, while others are rare or prohibited. Select PTS proteins were analyzed from different phylogenetic standpoints, showing that PTS protein phylogeny often differs from organismal phylogeny. The results document the frequent gain and loss of PTS protein-encoding genes and suggest that the lateral transfer of these genes within the bacterial domain has played an important role in bacterial evolution. Our studies provide insight into the development of complex multicomponent enzyme systems and lead to predictions regarding the types of protein-protein interactions that promote efficient PTS-mediated phosphoryl transfer. PMID:16339738

Viral-bacterial associations in acute apical abscesses.

PubMed

Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F

2011-08-01

Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.

Fatty acid composition of wild mushroom species of order Agaricales--examination by gas chromatography-mass spectrometry and chemometrics.

PubMed

Marekov, Ilko; Momchilova, Svetlana; Grung, Bjørn; Nikolova-Damyanova, Boryana

2012-12-01

Applying gas chromatography-mass spectrometry of 4,4-dimethyloxazoline fatty acid derivatives, the fatty acid composition of 15 mushroom species belonging to 9 genera and 5 families of order Agaricales growing in Bulgaria is determined. The structure of 31 fatty acids (not all present in each species) is unambiguously elucidated, with linoleic, oleic and palmitic acids being the main components (ranging between 70.9% (Marasmius oreades) and 91.2% (Endoptychum agaricoides)). A group of three hexadecenoic positionally isomeric fatty acids, 6-, 9- and 11-16:1, appeared to be characteristic components of the examined species. By applying chemometrics it was possible to show that the fatty acid composition closely reflects the classification of the species. Copyright © 2012 Elsevier B.V. All rights reserved.

Bacterial colonization of the phyllosphere of mediterranean perennial species as influenced by leaf structural and chemical features.

PubMed

Yadav, R K P; Karamanoli, K; Vokou, D

2005-08-01

In this study, we assessed various leaf structural and chemical features as possible predictors of the size of the phyllosphere bacterial population in the Mediterranean environment. We examined eight perennial species, naturally occurring and coexisting in the same area, in Halkidiki (northern Greece). They are Arbutus unedo, Quercus coccifera, Pistacia lentiscus, and Myrtus communis (evergreen sclerophyllous species), Lavandula stoechas and Cistus incanus (drought semi-deciduous species), and Calamintha nepeta and Melissa officinalis (non-woody perennial species). M. communis, L. stoechas, C. nepeta, and M. officinalis produce essential oil in substantial quantities. We sampled summer leaves from these species and (1) estimated the size of the bacterial population of their phyllosphere, (2) estimated the concentration of different leaf constituents, and (3) studied leaf morphological and anatomical features and expressed them in a quantitative way. The aromatic plants are on average more highly colonized than the other species, whereas the non-woody perennials are more highly colonized than the woody species. The population size of epiphytic bacteria is positively correlated with glandular and non-glandular trichome densities, and with water and phosphorus contents; it is negatively correlated with total phenolics content and the thickness of the leaf, of the mesophyll, and of the abaxial epidermis. No correlation was found with the density of stomata, the nitrogen, and the soluble sugar contents. By regression tree analysis, we found that the leaf-microbe system can be effectively described by three leaf attributes with leaf water content being the primary explanatory attribute. Leaves with water content >73% are the most highly colonized. For leaves with water content <73%, the phosphorus content, with a critical value of 1.34 mg g(-1) d.w., is the next explanatory leaf attribute, followed by the thickness of the adaxial epidermis. Leaves higher in phosphorus

Polyunsaturated fatty acids in various macroalgal species from North Atlantic and tropical seas.

PubMed

van Ginneken, Vincent J T; Helsper, Johannes P F G; de Visser, Willem; van Keulen, Herman; Brandenburg, Willem A

2011-06-22

In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was detected.

Polyunsaturated fatty acids in various macroalgal species from north Atlantic and tropical seas

PubMed Central

2011-01-01

Background In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. Methods The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Results Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Conclusion Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was

Isolation and characterization of a hydrocarbonoclastic bacterial enrichment from total petroleum hydrocarbon contaminated sediments: potential candidates for bioaugmentation in bio-based processes.

PubMed

Di Gregorio, Simona; Siracusa, Giovanna; Becarelli, Simone; Mariotti, Lorenzo; Gentini, Alessandro; Lorenzi, Roberto

2016-06-01

Seven hydrocarbonoclastic new bacterial isolates were isolated from dredged sediments of a river estuary in Italy. The sediments were contaminated by shipyard activities since decades, mainly ascribable to the exploitation of diesel oil as the fuel for recreational and commercial navigation of watercrafts. The bacterial isolates were able to utilize diesel oil as sole carbon source. Their metabolic capacities were evaluated by GC-MS analysis, with reference to the depletion of both the normal and branched alkanes, the nC18 fatty acid methyl ester and the unresolved complex mixture of organic compounds. They were taxonomically identified as different species of Stenotrophomonas and Pseudomonas spp. by the combination of amplified ribosomal DNA restriction analysis (ARDRA) and repetitive sequence-based PCR (REP-PCR) analysis. The metabolic activities of interest were analyzed both in relation to the single bacterial strains and to the combination of the latter as a multibacterial species system. After 6 days of incubation in mineral medium with diesel oil as sole carbon source, the Stenotrophomonas sp. M1 strain depleted 43-46 % of Cn-alkane from C28 up to C30, 70 % of the nC18 fatty acid methyl ester and the 46 % of the unresolved complex mixture of organic compounds. On the other hand, the Pseudomonas sp. NM1 strain depleted the 76 % of the nC18 fatty acid methyl ester, the 50 % of the unresolved complex mixture of organic compounds. The bacterial multispecies system was able to completely deplete Cn-alkane from C28 up to C30 and to deplete the 95 % of the unresolved complex mixture of organic compounds. The isolates, either as single strains and as a bacterial multispecies system, were proposed as candidates for bioaugmentation in bio-based processes for the decontamination of dredged sediments.

Host and Environmental Specificity in Bacterial Communities Associated to Two Highly Invasive Marine Species (Genus Asparagopsis)

PubMed Central

Aires, Tânia; Serrão, Ester A.; Engelen, Aschwin H.

2016-01-01

As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or

Bacterial species and their associations with acute and chronic mastitis in suckler ewes.

PubMed

Smith, E M; Willis, Z N; Blakeley, M; Lovatt, F; Purdy, K J; Green, L E

2015-10-01

Acute mastitis in suckler ewes is often detected because of systemic signs such as anorexia or lameness, whereas chronic mastitis, characterized by intramammary abscesses with no systemic disease, is typically detected when ewes are inspected before mating. The aims of the current study were to identify the species and strains of culturable bacteria associated with acutely diseased, chronically diseased, and unaffected mammary glands to investigate whether species and strains vary by state. To investigate acute mastitis, 28 milk samples were obtained from both glands of 14 ewes with acute mastitis in one gland only. To investigate chronic mastitis, 16 ovine udders were obtained from 2 abattoirs; milk was aspirated from the 32 glands where possible, and the udders were sectioned to expose intramammary abscesses, which were swab sampled. All milk and swab samples were cultured aerobically. In total, 37 bacterial species were identified, 4 from acute mastitis, 26 from chronic mastitis, and 8 from apparently healthy glands. In chronic mastitis, the overall coincidence index of overlap of species detected in intramammary abscesses and milk was 0.60, reducing to 0.36 within individual glands, indicating a high degree of species overlap in milk and abscesses overall, but less overlap within specific glands. Staphylococcus aureus was detected frequently in all sample types; it was isolated from 10/14 glands with acute mastitis. In 5 ewes, closely related strains were present in both affected and unaffected glands. In chronic mastitis, closely related Staphylococcus aureus strains were detected in milk and abscesses from the same gland. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Strong Regionality and Dominance of Anaerobic Bacterial Taxa Characterize Diazotrophic Bacterial Communities of the Arcto-Alpine Plant Species Oxyria digyna and Saxifraga oppositifolia.

PubMed

Kumar, Manoj; van Elsas, Jan Dirk; Nissinen, Riitta

2017-01-01

Arctic and alpine biomes are most often strongly nitrogen-limited, and hence biological nitrogen fixation is a strong driver of these ecosystems. Both biomes are characterized by low temperatures and short growing seasons, but they differ in seasonality of solar radiation and in soil water balance due to underlying permafrost in the Arctic. Arcto-alpine plant species are well-adapted to the low temperatures that prevail in their habitats, and plant growth is mainly limited by the availability of nutrients, in particular nitrogen, due to slow mineralization. Nitrogen fixing bacteria are likely important for plant growth in these habitats, but very little is known of these bacteria or forces shaping their communities. In this study, we characterized the potential nitrogen fixing bacterial (PNFB) communities associated with two arcto-alpine pioneer plant species, Oxyria digyna (mountain sorrel) and Saxifraga oppositifolia (blue saxifrage), in three climate regions. Both of these plants readily colonize low nutrient mineral soils. Our goal was to investigate how climate (region) and, on the other hand, host plant and plant species shape these communities. To our knowledge, this is the first comprehensive study describing PNFB communities associated with pioneer plants in different arcto-alpine biomes. Replicate samples were taken from two arctic regions, Kilpisjärvi and Ny-Ålesund, and one alpine region, Mayrhofen. In these, the PNFB communities in the bulk and rhizosphere soils and the plant endospheres were characterized by nifH -targeted PCR and massive parallel sequencing. The data revealed strong effects of climatic region on the dominating nitrogen fixers. Specifically, nifH sequences related to Geobacter (δ- Proteobacteria ) were present in high relative abundances in the nitrogen-fixing communities in the Mayrhofen and Kilpisjärvi regions, while members of the Clostridiales prevailed in the Kilpisjärvi and Ny-Ålesund regions. The bulk and rhizosphere soil

Independent studies using deep sequencing resolve the same set of core bacterial species dominating gut communities of honey bees.

PubMed

Sabree, Zakee L; Hansen, Allison K; Moran, Nancy A

2012-01-01

Starting in 2003, numerous studies using culture-independent methodologies to characterize the gut microbiota of honey bees have retrieved a consistent and distinctive set of eight bacterial species, based on near identity of the 16S rRNA gene sequences. A recent study [Mattila HR, Rios D, Walker-Sperling VE, Roeselers G, Newton ILG (2012) Characterization of the active microbiotas associated with honey bees reveals healthier and broader communities when colonies are genetically diverse. PLoS ONE 7(3): e32962], using pyrosequencing of the V1-V2 hypervariable region of the 16S rRNA gene, reported finding entirely novel bacterial species in honey bee guts, and used taxonomic assignments from these reads to predict metabolic activities based on known metabolisms of cultivable species. To better understand this discrepancy, we analyzed the Mattila et al. pyrotag dataset. In contrast to the conclusions of Mattila et al., we found that the large majority of pyrotag sequences belonged to clusters for which representative sequences were identical to sequences from previously identified core species of the bee microbiota. On average, they represent 95% of the bacteria in each worker bee in the Mattila et al. dataset, a slightly lower value than that found in other studies. Some colonies contain small proportions of other bacteria, mostly species of Enterobacteriaceae. Reanalysis of the Mattila et al. dataset also did not support a relationship between abundances of Bifidobacterium and of putative pathogens or a significant difference in gut communities between colonies from queens that were singly or multiply mated. Additionally, consistent with previous studies, the dataset supports the occurrence of considerable strain variation within core species, even within single colonies. The roles of these bacteria within bees, or the implications of the strain variation, are not yet clear.

Properties and substrate specificities of the phenylalanyl-transfer-ribonucleic acid synthetases of Aesculus species

PubMed Central

Anderson, J. W.; Fowden, L.

1970-01-01

1. Phenylalanyl-tRNA synthetases have been partially purified from cotyledons of seeds of Aesculus californica, which contains 2-amino-4-methylhex-4-enoic acid, and from four other species of Aesculus that do not contain this amino acid. The A. californica preparation was free from other aminoacyl-tRNA synthetases, and the contaminating synthetase activity in preparations from A. hippocastanum was decreased to acceptable limits by conducting assays of pyrophosphate exchange activity in 0.5m-potassium chloride. 2. The phenylalanyl-tRNA synthetase from each species activated 2-amino-4-methylhex-4-enoic acid with Km 30–40 times that for phenylalanine. The maximum velocity for 2-amino-4-methylhex-4-enoic acid was only 30% of that for phenylalanine with the A. californica enzyme, but the maximum velocities for the two substrates were identical for the other four species. 3. 2-Amino-4-methylhex-4-enoic acid was not found in the protein of A. californica, so discrimination against this amino acid probably occurs in the step of transfer to tRNA, though subcellular localization, or subsequent steps of protein synthesis could be involved. 4. Crotylglycine, methallylglycine, ethallylglycine, 2-aminohex-4,5-dienoic acid, 2-amino-5-methylhex-4-enoic acid, 2-amino-4-methylhex-4-enoic acid, β-(thien-2-yl)alanine, β-(pyrazol-1-yl)alanine, phenylserine and m-fluorophenylalanine were substrates for pyrophosphate exchange catalysed by the phenylalanyl-tRNA synthetases of A. californica or A. hippocastanum. Allylglycine, phenylglycine and 2-amino-4-phenylbutyric acid were inactive. PMID:5493504

Next-Generation Sequencing Reveals Significant Bacterial Diversity of Botrytized Wine

PubMed Central

Bokulich, Nicholas A.; Joseph, C. M. Lucy; Allen, Greg; Benson, Andrew K.; Mills, David A.

2012-01-01

While wine fermentation has long been known to involve complex microbial communities, the composition and role of bacteria other than a select set of lactic acid bacteria (LAB) has often been assumed either negligible or detrimental. This study served as a pilot study for using barcoded amplicon next-generation sequencing to profile bacterial community structure in wines and grape musts, comparing the taxonomic depth achieved by sequencing two different domains of prokaryotic 16S rDNA (V4 and V5). This study was designed to serve two goals: 1) to empirically determine the most taxonomically informative 16S rDNA target region for barcoded amplicon sequencing of wine, comparing V4 and V5 domains of bacterial 16S rDNA to terminal restriction fragment length polymorphism (TRFLP) of LAB communities; and 2) to explore the bacterial communities of wine fermentation to better understand the biodiversity of wine at a depth previously unattainable using other techniques. Analysis of amplicons from the V4 and V5 provided similar views of the bacterial communities of botrytized wine fermentations, revealing a broad diversity of low-abundance taxa not traditionally associated with wine, as well as atypical LAB communities initially detected by TRFLP. The V4 domain was determined as the more suitable read for wine ecology studies, as it provided greater taxonomic depth for profiling LAB communities. In addition, targeted enrichment was used to isolate two species of Alphaproteobacteria from a finished fermentation. Significant differences in diversity between inoculated and uninoculated samples suggest that Saccharomyces inoculation exerts selective pressure on bacterial diversity in these fermentations, most notably suppressing abundance of acetic acid bacteria. These results determine the bacterial diversity of botrytized wines to be far higher than previously realized, providing further insight into the fermentation dynamics of these wines, and demonstrate the utility of next

Exploration of bacterial species associated with the salivary microbiome of individuals with a low susceptibility to dental caries.

PubMed

Yasunaga, Haruna; Takeshita, Toru; Shibata, Yukie; Furuta, Michiko; Shimazaki, Yoshihiro; Akifusa, Sumio; Ninomiya, Toshiharu; Kiyohara, Yutaka; Takahashi, Ichiro; Yamashita, Yoshihisa

2017-11-01

Dental caries is caused by acidogenic plaque microbiota formed on saliva-bathed tooth surfaces, in which multiple organisms act collectively to initiate and expand a cavity. We explored bacterial species associated with the salivary microbiome of individuals with low susceptibility to dental caries. The bacterial composition of saliva from 19 young adults was analyzed using barcoded pyrosequencing of the 16S rRNA gene; we compared 10 caries-experienced (CE) and nine caries-free (CF) individuals. A quantitative PCR assay of saliva from 139 orally healthy adults aged 40-59 years was carried out to confirm the result obtained by pyrosequencing analysis. The microbiomes of CF individuals showed more diverse communities with a significantly greater proportion of the genus Porphyromonas. Among operational taxonomic units (OTUs) corresponding to the genus Porphyromonas, the OTU corresponding to P. pasteri was the most predominant and its relative abundance in CF individuals was significantly greater than in CE individuals (P < 0.001, Wilcoxon rank sum test). A quantitative PCR assay of saliva confirmed that the amounts of P. pasteri were significantly higher in individuals with lower caries experience (filled teeth <15, n = 67) than in those with higher caries experience (filled teeth ≥15, n = 72) (P < 0.001, Student's t test). These results revealed an association between a greater abundance of P. pasteri and lower susceptibility to dental caries. P. pasteri may be a bacterial species that could potentially be used as a marker for maintaining a healthy oral microbiome against dental caries.

Bacillus sphaericus: the highest bacterial tannase producer with potential for gallic acid synthesis.

PubMed

Raghuwanshi, Shailendra; Dutt, Kakoli; Gupta, Pritesh; Misra, Swati; Saxena, Rajendra Kumar

2011-06-01

An indigenously isolated strain of Bacillus sphaericus was found to produce 1.21 IU/ml of tannase under unoptimized conditions. Optimizing the process one variable at a time resulted in the production of 7.6 IU/ml of tannase in 48 h in the presence of 1.5% tannic acid. A 9.26-fold increase in tannase production was achieved upon further optimization using response surface methodology (RSM), a statistical approach. This increase led to a production level of 11.2I U/ml in medium containing 2.0% tannic acid, 2.5% galactose, 0.25% ammonium chloride, and 0.1% MgSO(4) pH 6.0 incubated at 37°C and 100 rpm for 48 h with a 2.0% inoculum level. Scaling up tannase production in a 30-l bioreactor resulted in the production of 16.54 IU/ml after 36 h. Thus far, this tannase production is the highest reported in this bacterial strain. Partially purified tannase exhibited an optimum pH of 5.0 with activity in the pH range of 3 to 8; 50°C was the optimal temperature for activity. Efficient conversion of tannic acid to purified gallic acid (90.80%) was achieved through crystallization. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Conventional and nonconventional strategies for controlling bacterial contamination in fuel ethanol fermentations.

PubMed

Ceccato-Antonini, Sandra Regina

2018-05-25

Ethanol bio-production in Brazil has some unique characteristics that inevitably lead to bacterial contamination, which results in the production of organic acids and biofilms and flocculation that impair the fermentation yield by affecting yeast viability and diverting sugars to metabolites other than ethanol. The ethanol-producing units commonly give an acid treatment to the cells after each fermentative cycle to decrease the bacterial number, which is not always effective. An alternative strategy must be employed to avoid bacterial multiplication but must be compatible with economic, health and environmental aspects. This review analyzes the issue of bacterial contamination in sugarcane-based fuel ethanol fermentation, and the potential strategies that may be utilized to control bacterial growth besides acid treatment and antibiotics. We have emphasized the efficiency and suitability of chemical products other than acids and those derived from natural sources in industrial conditions. In addition, we have also presented bacteriocins, bacteriophages, and beneficial bacteria as non-conventional antimicrobial agents to mitigate bacterial contamination in the bioethanol industry.

Soil microbial species loss affects plant biomass and survival of an introduced bacterial strain, but not inducible plant defences.

PubMed

Kurm, Viola; van der Putten, Wim H; Pineda, Ana; Hol, W H Gera

2018-02-12

Plant growth-promoting rhizobacteria (PGPR) strains can influence plant-insect interactions. However, little is known about the effect of changes in the soil bacterial community in general and especially the loss of rare soil microbes on these interactions. Here, the influence of rare soil microbe reduction on induced systemic resistance (ISR) in a wild ecotype of Arabidopsis thaliana against the aphid Myzus persicae was investigated. To create a gradient of microbial abundances, soil was inoculated with a serial dilution of a microbial community and responses of Arabidopsis plants that originated from the same site as the soil microbes were tested. Plant biomass, transcription of genes involved in plant defences, and insect performance were measured. In addition, the effects of the PGPR strain Pseudomonas fluorescens SS101 on plant and insect performance were tested under the influence of the various soil dilution treatments. Plant biomass showed a hump-shaped relationship with soil microbial community dilution, independent of aphid or Pseudomonas treatments. Both aphid infestation and inoculation with Pseudomonas reduced plant biomass, and led to downregulation of PR1 (salicylic acid-responsive gene) and CYP79B3 (involved in synthesis of glucosinolates). Aphid performance and gene transcription were unaffected by soil dilution. Neither the loss of rare microbial species, as caused by soil dilution, nor Pseudomonas affect the resistance of A. thaliana against M. persicae. However, both Pseudomonas survival and plant biomass respond to rare species loss. Thus, loss of rare soil microbial species can have a significant impact on both above- and below-ground organisms. © The Author(s) 2018. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Autoinducer-2 detection among commensal oral streptococci is dependent on pH and boric acid.

PubMed

Cuadra, Giancarlo A; Frantellizzi, Ashley J; Gaesser, Kimberly M; Tammariello, Steven P; Ahmed, Anika

2016-07-01

Autoinducer-2, considered a universal signaling molecule, is produced by many species of bacteria; including oral strains. Structurally, autoinducer-2 can exist bound to boron (borated autoinducer-2). Functionally, autoinducer-2 has been linked to important bacterial processes such as virulence and biofilm formation. In order to test production of autoinducer-2 by a given bacterial strain, a bioassay using marine bioluminescent bacteria Vibrio harveyi as a reporter for autoinducer-2 has been designed. We hypothesize that pH adjustment and addition of boron are required for optimal bioluminescence and accurate autoinducer-2 detection. Using this reporter strain we tested autoinducer-2 activity from two oral commensal species, Streptococcus gordonii DL1 and Streptococcus oralis 34. Spent broth was collected and adjusted to pH 7.5 and supplemented with boric acid prior to measuring autoinducer- 2 activity. Results show that low pH inhibits bioluminescence of the reporter strain, but pH 7.5 allows for bioluminescence induction and proper readings of autoinducer-2 activity. Addition of boric acid also has a positive effect on bioluminescence allowing for a more sensitive detection of autoinducer-2 activity. Our data suggests that although autoinducer-2 is present in spent broth, low pH and/or low levels of boric acid become an obstacle for proper autoinducer-2 detection. For proper autoinducer-2 detection, we propose a protocol using this bioassay to include pH adjustment and boric acid addition to spent broth. Studies on autoinducer-2 activity in several bacteria species represent an important area of study as this universal signaling molecule is involved in critical bacterial phenotypes such as virulence and biofilm formation.

Biotechnological Production of Caffeic Acid by Bacterial Cytochrome P450 CYP199A2

PubMed Central

Arai, Yuka; Kino, Kuniki

2012-01-01

Caffeic acid is a biologically active molecule that has various beneficial properties, including antioxidant, anticancer, and anti-inflammatory activities. In this study, we explored the catalytic potential of a bacterial cytochrome P450, CYP199A2, for the biotechnological production of caffeic acid. When the CYP199A2 enzyme was reacted with p-coumaric acid, it stoichiometrically produced caffeic acid. The crystal structure of CYP199A2 shows that Phe at position 185 is situated directly above, and only 6.35 Å from, the heme iron. This F185 residue was replaced with hydrophobic or hydroxylated amino acids using site-directed mutagenesis to create mutants with novel and improved catalytic properties. In whole-cell assays with the known substrate of CYP199A2, 2-naphthoic acid, only the wild-type enzyme hydroxylated 2-naphthoic acid at the C-7 and C-8 positions, whereas all of the active F185 mutants exhibited a preference for C-5 hydroxylation. Interestingly, several F185 mutants (F185V, F185L, F185I, F185G, and F185A mutants) also acquired the ability to hydroxylate cinnamic acid, which was not hydroxylated by the wild-type enzyme. These results demonstrate that F185 is an important residue that controls the regioselectivity and the substrate specificity of CYP199A2. Furthermore, Escherichia coli cells expressing the F185L mutant exhibited 5.5 times higher hydroxylation activity for p-coumaric acid than those expressing the wild-type enzyme. By using the F185L whole-cell catalyst, the production of caffeic acid reached 15 mM (2.8 g/liter), which is the highest level so far attained in biotechnological production of this compound. PMID:22729547

[Electrophoretic forms of glucose-6-phosphate dehydrogenase, acid phosphatase and esterase in Amoeba species amoebas].

PubMed

Sopina, V A

2000-01-01

Glucose-6-phosphate dehydrogenase (G6PD), acid phosphatase and esterases in free-living amoebae of 7 Amoeba species were investigated with the use of disc-electrophoresis in polyacrylamide gel. The evidence provided is suggestive that the electrophoretic isoenzyme patterns of acid phosphatase and esterases (and G6PD in some cases), in addition to a few morphological characters, can serve as a taxonomic criterion for species identification within this genus, as well as for revealing erroneously classified species and strains. It is suggested that A. indica is an independent species whose preliminary diagnosis has been given in this paper. It is concluded that A. discoides and A. lescherae are strains of A. proteus, rather than two independent species. A and As-102 amoebian strains, kept in the collection of protozoan strains and species of the Institute of Cytology RAS and referred to as strains of A. proteus, belong in reality to another Amoeba species and even to another genus within the family Amoebidae. This conclusion has been documented by results of our analysis of electrophoretic patterns of acid phosphatase and esterases in these strains.

Bacterial Diversity in Human Subgingival Plaque

PubMed Central

Paster, Bruce J.; Boches, Susan K.; Galvin, Jamie L.; Ericson, Rebecca E.; Lau, Carol N.; Levanos, Valerie A.; Sahasrabudhe, Ashish; Dewhirst, Floyd E.

2001-01-01

The purpose of this study was to determine the bacterial diversity in the human subgingival plaque by using culture-independent molecular methods as part of an ongoing effort to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species of human oral bacteria. Subgingival plaque was analyzed from healthy subjects and subjects with refractory periodontitis, adult periodontitis, human immunodeficiency virus periodontitis, and acute necrotizing ulcerative gingivitis. 16S ribosomal DNA (rDNA) bacterial genes from DNA isolated from subgingival plaque samples were PCR amplified with all-bacterial or selective primers and cloned into Escherichia coli. The sequences of cloned 16S rDNA inserts were used to determine species identity or closest relatives by comparison with sequences of known species. A total of 2,522 clones were analyzed. Nearly complete sequences of approximately 1,500 bases were obtained for putative new species. About 60% of the clones fell into 132 known species, 70 of which were identified from multiple subjects. About 40% of the clones were novel phylotypes. Of the 215 novel phylotypes, 75 were identified from multiple subjects. Known putative periodontal pathogens such as Porphyromonas gingivalis, Bacteroides forsythus, and Treponema denticola were identified from multiple subjects, but typically as a minor component of the plaque as seen in cultivable studies. Several phylotypes fell into two recently described phyla previously associated with extreme natural environments, for which there are no cultivable species. A number of species or phylotypes were found only in subjects with disease, and a few were found only in healthy subjects. The organisms identified only from diseased sites deserve further study as potential pathogens. Based on the sequence data in this study, the predominant subgingival microbial community consisted of 347 species or phylotypes that fall into 9 bacterial phyla. Based on the 347 species seen in our

Bacterial polyesters: biosynthesis, biodegradable plastics and biotechnology.

PubMed

Lenz, Robert W; Marchessault, Robert H

2005-01-01

The discovery and chemical identification, in the 1920s, of the aliphatic polyester: poly(3-hydroxybutyrate), PHB, as a granular component in bacterial cells proceeded without any of the controversies which marked the recognition of macromolecules by Staudinger. Some thirty years after its discovery, PHB was recognized as the prototypical biodegradable thermoplastic to solve the waste disposal challenge. The development effort led by Imperial Chemical Industries Ltd., encouraged interdisciplinary research from genetic engineering and biotechnology to the study of enzymes involved in biosynthesis and biodegradation. From the simple PHB homopolyester discovered by Maurice Lemoigne in the mid-twenties, a family of over 100 different aliphatic polyesters of the same general structure has been discovered. Depending on bacterial species and substrates, these high molecular weight stereoregular polyesters have emerged as a new family of natural polymers ranking with nucleic acids, polyamides, polyisoprenoids, polyphenols, polyphosphates, and polysaccharides. In this historical review, the chemical, biochemical and microbial highlights are linked to personalities and locations involved with the events covering a discovery timespan of 75 years.

Organic acids, sugars, vitamin C content and some pomological characteristics of eleven hawthorn species (Crataegus spp.) from Turkey.

PubMed

Gundogdu, Muttalip; Ozrenk, Koray; Ercisli, Sezai; Kan, Tuncay; Kodad, Ossama; Hegedus, Attila

2014-05-30

The Hawthorn (Crateagus sp.) mostly occurs around the temperate region of the world with a high number of species, producing a fruit with numerous beneficial effects for human health. The aim of the study was to determine organic acid and sugar contents in the fruit of a number of hawthorn species grown in Erzincan province of Turkey. Citric acid was the predominant organic acid in all hawthorn species and C. pseudoheterophylla had the highest citric acid content (23.688 g/100 g). There were not statistically significant differences among hawthorn species (except C. atrosanguinea Pojark) in terms of fumaric acid content. C.pontica C.Koch had a higher content of vitamin C (9.418 mg/100 g) compared to other species. Fructose was the predominant sugar component in all species and C. monogyna subsp. monogyna Joiq had the highest fructose content (18.378 g/100 g). The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source. The study revealed that there were differences in terms of fruit characteristics among hawthorn species and thus better quality hawthorn genotypes can be selected within the species. Hence, this study is considered to be a valuable reference for forthcoming studies. The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source.

ESTIMATION OF BACTERIAL CELL NUMBERS IN HUMIC ACID-RICH SALT MARSH SEDIMENTS WITH PROBES DIRECTED TO 16S RIBOSOMAL DNA

EPA Science Inventory

The feasibility of using probes directed towards ribosomal DNAs (rDNAs) as a quantitative approach to estimating cell numbers was examined and applied to study the structure of a bacterial community in humic acid-rich salt marsh sediments. Hybridizations were performed with membr...

Requirement of a Functional Flavin Mononucleotide Prenyltransferase for the Activity of a Bacterial Decarboxylase in a Heterologous Muconic Acid Pathway in Saccharomyces cerevisiae.

PubMed

Weber, Heike E; Gottardi, Manuela; Brückner, Christine; Oreb, Mislav; Boles, Eckhard; Tripp, Joanna

2017-05-15

Biotechnological production of cis , cis -muconic acid from renewable feedstocks is an environmentally sustainable alternative to conventional, petroleum-based methods. Even though a heterologous production pathway for cis , cis -muconic acid has already been established in the host organism Saccharomyces cerevisiae , the generation of industrially relevant amounts of cis , cis -muconic acid is hampered by the low activity of the bacterial protocatechuic acid (PCA) decarboxylase AroY isomeric subunit C iso (AroY-C iso ), leading to secretion of large amounts of the intermediate PCA into the medium. In the present study, we show that the activity of AroY-C iso in S. cerevisiae strongly depends on the strain background. We could demonstrate that the strain dependency is caused by the presence or absence of an intact genomic copy of PAD1 , which encodes a mitochondrial enzyme responsible for the biosynthesis of a prenylated form of the cofactor flavin mononucleotide (prFMN). The inactivity of AroY-C iso in strain CEN.PK2-1 could be overcome by plasmid-borne expression of Pad1 or its bacterial homologue AroY subunit B (AroY-B). Our data reveal that the two enzymes perform the same function in decarboxylation of PCA by AroY-C iso , although coexpression of Pad1 led to higher decarboxylase activity. Conversely, AroY-B can replace Pad1 in its function in decarboxylation of phenylacrylic acids by ferulic acid decarboxylase Fdc1. Targeting of the majority of AroY-B to mitochondria by fusion to a heterologous mitochondrial targeting signal did not improve decarboxylase activity of AroY-C iso , suggesting that mitochondrial localization has no major impact on cofactor biosynthesis. IMPORTANCE In Saccharomyces cerevisiae , the decarboxylation of protocatechuic acid (PCA) to catechol is the bottleneck reaction in the heterologous biosynthetic pathway for production of cis , cis -muconic acid, a valuable precursor for the production of bulk chemicals. In our work, we demonstrate

Effects of different fermentation methods on bacterial cellulose and acid production by Gluconacetobacter xylinus in Cantonese-style rice vinegar.

PubMed

Fu, Liang; Chen, Siqian; Yi, Jiulong; Hou, Zongxia

2014-07-01

A strain of acidogenic bacterium was isolated from the fermentation liquid of Cantonese-style rice vinegar produced by traditional surface fermentation. 16S rDNA identification confirmed the bacterium as Gluconacetobacter xylinus, which synthesizes bacterial cellulose, and the acid productivity of the strain was investigated. In the study, the effects of the membrane integrity and the comparison of the air-liquid interface membrane with immerged membrane on total acidity, cellulose production, alcohol dehydrogenase (ADH) activity and number of bacteria were investigated. The cellulose membrane and the bacteria were observed under SEM for discussing their relationship. The correlations between oxygen consumption and total acid production rate were compared in surface and shake flask fermentation. The results showed the average acid productivity of the strain was 0.02g/(100mL/h), and the integrity of cellulose membrane in surface fermentation had an important effect on total acidity and cellulose production. With a higher membrane integrity, the total acidity after 144 h of fermentation was 3.75 g/100 mL, and the cellulose production was 1.71 g/100 mL after 360 h of fermentation. However, when the membrane was crushed by mechanical force, the total acidity and the cellulose production were as low as 0.36 g/100 mL and 0.14 g/100 mL, respectively. When the cellulose membrane was forced under the surface of fermentation liquid, the total acid production rate was extremely low, but the activity of ADH in the cellulose membrane was basically the same with the one above the liquid surface. The bacteria were mainly distributed in the cellulose membrane during the fermentation. The bacterial counts in surface fermentation were more than in the shake flask fermentation and G. xylinus consumed the substrate faster, in surface fermentation than in shake flask fermentation. The oxygen consumption rate and total acid production rate of surface fermentation were respectively 26

Incorporating zosteric acid into silicone coatings to achieve its slow release while reducing fresh water bacterial attachment.

PubMed

Barrios, Carlos A; Xu, Qingwei; Cutright, Teresa; Newby, Bi-min Zhang

2005-03-25

Biofouling has posed serious problems in maritime industry including increased fuel consumptions, economic loss from ship-hull maintenances, contamination of drinking water, and serious corrosion for mechanical instruments. Minimizing the attachment of bacteria and formation of biofilm could be advantageous in reducing the early stages of biofouling. Zosteric acid, a natural product present in eelgrass, was found to have ability for preventing the attachment of some bacteria and barnacles. In this study, the antifouling ability of zosteric acid during the early stages of fouling was evaluated using attachment studies of fresh water bacteria. Simultaneously, various methods were sought for incorporating zosteric acid into silicone to prolong the release of the compound. The main results from this study were that zosteric acid exhibited anti-bacterial attachment regardless of whether it dispersed in water or incorporated into a coating. In addition, the release rate of zosteric acid from the incorporated coatings, particularly those where zosteric acid was uniformly dispersed with aggregates size of 4 microm or less, was orders of magnitude slower than those of previous reports. The release results indicate that the service life of our coatings could be far extended even with a small amount of zosteric acid incorporated.

Effects of bacterial direct-fed microbials on ruminal characteristics, methane emission, and milk fatty acid composition in cows fed high- or low-starch diets.

PubMed

Philippeau, C; Lettat, A; Martin, C; Silberberg, M; Morgavi, D P; Ferlay, A; Berger, C; Nozière, P

2017-04-01

This study investigated the effects of bacterial direct-fed microbials (DFM) on ruminal fermentation and microbial characteristics, methane (CH 4 ) emission, diet digestibility, and milk fatty acid (FA) composition in dairy cows fed diets formulated to induce different ruminal volatile fatty acid (VFA) profiles. Eight ruminally cannulated dairy cows were divided into 2 groups based on parity, days in milk, milk production, and body weight. Cows in each group were fed either a high-starch (38%, HS) or a low-starch (2%, LS) diet in a 55:45 forage-to-concentrate ratio on a dry matter (DM) basis. For each diet, cows were randomly assigned to 1 of 4 treatments in a Latin square design of (1) control (CON); (2) Propionibacterium P63 (P63); (3) P63 plus Lactobacillus plantarum 115 (P63+Lp); (4) P63 plus Lactobacillus rhamnosus 32 (P63+Lr). Strains of DFM were administered at 10 10 cfu/d. Methane emission (using the sulfur hexafluoride tracer technique), total-tract digestibility, dry matter intake, and milk production and composition were quantified in wk 3. Ruminal fermentation and microbial characteristics were measured in wk 4. Data were analyzed using the mixed procedure of SAS (SAS Institute Inc., Cary, NC). The 2 diets induced different ruminal VFA profiles, with a greater proportion of propionate at the expense of acetate and butyrate for the HS diet. Greater concentrations of total bacteria and selected bacterial species of methanogenic Archaea were reported for the HS diet, whereas the protozoa concentration in HS decreased. For both diets, bacterial DFM supplementation raised ruminal pH (+0.18 pH units, on average) compared with CON. Irrespective of diet, P63+Lp and P63+Lr increased ruminal cellulase activity (3.8-fold, on average) compared with CON, but this effect was not associated with variations in ruminal microbial numbers. Irrespective of diet, no effect of bacterial DFM on ruminal VFA was observed. For the LS diet, supplementing cows with P63+Lr tended

Disease notes - Bacterial root rot

USDA-ARS?s Scientific Manuscript database

Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...

Characterization of initial events in bacterial surface colonization by two Pseudomonas species using image analysis.

PubMed

Mueller, R F; Characklis, W G; Jones, W L; Sears, J T

1992-05-01

The processes leading to bacterial colonization on solid-water interfaces are adsorption, desorption, growth, and erosion. These processes have been measured individually in situ in a flowing system in real time using image analysis. Four different substrata (copper, silicon, 316 stainless-steel and glass) and 2 different bacterial species (Pseudomonas aeruginosa and Pseudomonas fluorescens) were used in the experiments. The flow was laminar (Re = 1.4) and the shear stress was kept constant during all experiments at 0.75 N m(-2). The surface roughness varied among the substrata from 0.002 microm (for silicon) to 0.015 microm (for copper). Surface free energies varied from 25.1 dynes cm(-1) for silicon to 31.2 dynes cm(-1) for copper. Cell curface hydrophobicity, reported as hydrocarbon partitioning values, ranged from 0.67 for Ps. fluorescens to 0.97 for Ps. aeruginosa.The adsorption rate coefficient varied by as much as a factor of 10 among the combinations of bacterial strain and substratum material, and was positively correlated with surface free energy, the surface roughness of the substratum, and the hydrophobicity of the cells. The probability of desorption decreased with increasing surface free energy and surface roughness of the substratum. Cell growth was inhibited on copper, but replication of cells overlying an initial cell layer was observed with increased exposure time to the cell-containing bulk water. A mathematical model describing cell accumulation on a substratum is presented.

Bacterial diversity at different stages of the composting process

PubMed Central

2010-01-01

Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants. PMID:20350306