Bacterial Responses to Reactive Chlorine Species
Gray, Michael J.; Wholey, Wei-Yun; Jakob, Ursula
2013-01-01
Hypochlorous acid (HOCl), the active ingredient of household bleach, is the most common disinfectant in medical, industrial, and domestic use and plays an important role in microbial killing in the innate immune system. Given the critical importance of the antimicrobial properties of chlorine to public health, it is surprising how little is known about the ways in which bacteria sense and respond to reactive chlorine species (RCS). Although the literature on bacterial responses to reactive oxygen species (ROS) is enormous, work addressing bacterial responses to RCS has begun only recently. Transcriptomic and proteomic studies now provide new insights into how bacteria mount defenses against this important class of antimicrobial compounds. In this review, we summarize the current knowledge, emphasizing the overlaps between RCS stress responses and other more well-characterized bacterial defense systems, and identify outstanding questions that represent productive avenues for future research. PMID:23768204
Ardizzoni, Andrea; Neglia, Rachele G; Baschieri, Maria C; Cermelli, Claudio; Caratozzolo, Manuela; Righi, Elena; Palmieri, Beniamino; Blasi, Elisabetta
2011-10-01
Hyaluronic acid (HA) has several clinical applications (aesthetic surgery, dermatology, orthopaedics and ophtalmology). Following recent evidence, suggesting antimicrobial and antiviral properties for HA, we investigated its effects on 15 ATCC strains, representative of clinically relevant bacterial and fungal species. The in vitro system employed allowed to assess optical density of broth cultures as a measure of microbial load in a time-dependent manner. The results showed that different microbial species and, sometimes, different strains belonging to the same species, are differently affected by HA. In particular, staphylococci, enterococci, Streptococcus mutans, two Escherichia coli strains, Pseudomonas aeruginosa, Candida glabrata and C. parapsilosis displayed a HA dose-dependent growth inhibition; no HA effects were detected in E. coli ATCC 13768 and C. albicans; S. sanguinis was favoured by the highest HA dose. Therefore, the influence of HA on bacteria and fungi warrants further studies aimed at better establishing its relevance in clinical applications.
Reduction in bacterial load using hypochlorous acid hygiene solution on ocular skin
Stroman, David W; Mintun, Keri; Epstein, Arthur B; Brimer, Crystal M; Patel, Chirag R; Branch, James D; Najafi-Tagol, Kathryn
2017-01-01
Purpose To examine the magnitude of bacterial load reduction on the surface of the periocular skin 20 minutes after application of a saline hygiene solution containing 0.01% pure hypochlorous acid (HOCl). Methods Microbiological specimens were collected immediately prior to applying the hygiene solution and again 20 minutes later. Total microbial colonies were counted and each unique colony morphology was processed to identify the bacterial species and to determine the susceptibility profile to 15 selected antibiotics. Results Specimens were analyzed from the skin samples of 71 eyes from 36 patients. Prior to treatment, 194 unique bacterial isolates belonging to 33 different species were recovered. Twenty minutes after treatment, 138 unique bacterial isolates belonging to 26 different species were identified. Staphylococci accounted for 61% of all strains recovered and Staphylococcus epidermidis strains comprised 60% of the staphylococcal strains. No substantial differences in the distribution of Gram-positive, Gram-negative, or anaerobic species were noted before and after treatment. The quantitative data demonstrated a >99% reduction in the staphylococcal load on the surface of the skin 20 minutes following application of the hygiene solution. The total S. epidermidis colony-forming units were reduced by 99.5%. The HOCl hygiene solution removed staphylococcal isolates that were resistant to multiple antibiotics equally well as those isolates that were susceptible to antibiotics. Conclusion The application of a saline hygiene solution preserved with pure HOCl acid reduced the bacterial load significantly without altering the diversity of bacterial species remaining on the skin under the lower eyelid. PMID:28458509
Towards large-scale FAME-based bacterial species identification using machine learning techniques.
Slabbinck, Bram; De Baets, Bernard; Dawyndt, Peter; De Vos, Paul
2009-05-01
In the last decade, bacterial taxonomy witnessed a huge expansion. The swift pace of bacterial species (re-)definitions has a serious impact on the accuracy and completeness of first-line identification methods. Consequently, back-end identification libraries need to be synchronized with the List of Prokaryotic names with Standing in Nomenclature. In this study, we focus on bacterial fatty acid methyl ester (FAME) profiling as a broadly used first-line identification method. From the BAME@LMG database, we have selected FAME profiles of individual strains belonging to the genera Bacillus, Paenibacillus and Pseudomonas. Only those profiles resulting from standard growth conditions have been retained. The corresponding data set covers 74, 44 and 95 validly published bacterial species, respectively, represented by 961, 378 and 1673 standard FAME profiles. Through the application of machine learning techniques in a supervised strategy, different computational models have been built for genus and species identification. Three techniques have been considered: artificial neural networks, random forests and support vector machines. Nearly perfect identification has been achieved at genus level. Notwithstanding the known limited discriminative power of FAME analysis for species identification, the computational models have resulted in good species identification results for the three genera. For Bacillus, Paenibacillus and Pseudomonas, random forests have resulted in sensitivity values, respectively, 0.847, 0.901 and 0.708. The random forests models outperform those of the other machine learning techniques. Moreover, our machine learning approach also outperformed the Sherlock MIS (MIDI Inc., Newark, DE, USA). These results show that machine learning proves very useful for FAME-based bacterial species identification. Besides good bacterial identification at species level, speed and ease of taxonomic synchronization are major advantages of this computational species
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Bacterial communities in the phylloplane of Prunus species.
Jo, Yeonhwa; Cho, Jin Kyong; Choi, Hoseong; Chu, Hyosub; Lian, Sen; Cho, Won Kyong
2015-04-01
Bacterial populations in the phylloplane of four different Prunus species were investigated by 16 S rRNA pyrosequencing. Bioinformatic analysis identified an average of 510 operational taxonomic units belonging to 159 genera in 76 families. The two genera, Sphingomonas and Methylobacterium, were dominant in the phylloplane of four Prunus species. Twenty three genera were commonly identified in the four Prunus species, indicating a high level of bacterial diversity dependent on the plant species. Our study based on 16 S rRNA sequencing reveals the complexity of bacterial diversity in the phylloplane of Prunus species in detail. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Distinct antimicrobial peptide expression determines host species-specific bacterial associations
Franzenburg, Sören; Walter, Jonas; Künzel, Sven; Wang, Jun; Baines, John F.; Bosch, Thomas C. G.; Fraune, Sebastian
2013-01-01
Animals are colonized by coevolved bacterial communities, which contribute to the host’s health. This commensal microbiota is often highly specific to its host-species, inferring strong selective pressures on the associated microbes. Several factors, including diet, mucus composition, and the immune system have been proposed as putative determinants of host-associated bacterial communities. Here we report that species-specific antimicrobial peptides account for different bacterial communities associated with closely related species of the cnidarian Hydra. Gene family extensions for potent antimicrobial peptides, the arminins, were detected in four Hydra species, with each species possessing a unique composition and expression profile of arminins. For functional analysis, we inoculated arminin-deficient and control polyps with bacterial consortia characteristic for different Hydra species and compared their selective preferences by 454 pyrosequencing of the bacterial microbiota. In contrast to control polyps, arminin-deficient polyps displayed decreased potential to select for bacterial communities resembling their native microbiota. This finding indicates that species-specific antimicrobial peptides shape species-specific bacterial associations. PMID:24003149
Papalexandratou, Zoi; Vrancken, Gino; De Bruyne, Katrien; Vandamme, Peter; De Vuyst, Luc
2011-10-01
Spontaneous organic cocoa bean box fermentations were carried out on two different farms in Brazil. Physical parameters, microbial growth, bacterial species diversity [mainly lactic acid bacteria (LAB) and acetic acid bacteria (AAB)], and metabolite kinetics were monitored, and chocolates were produced from the fermented dry cocoa beans. The main end-products of the catabolism of the pulp substrates (glucose, fructose, and citric acid) by yeasts, LAB, and AAB were ethanol, lactic acid, mannitol, and/or acetic acid. Lactobacillus fermentum and Acetobacter pasteurianus were the predominating bacterial species of the fermentations as revealed through (GTG)(5)-PCR fingerprinting of isolates and PCR-DGGE of 16S rRNA gene PCR amplicons of DNA directly extracted from fermentation samples. Fructobacillus pseudoficulneus, Lactobacillus plantarum, and Acetobacter senegalensis were among the prevailing species during the initial phase of the fermentations. Also, three novel LAB species were found. This study emphasized the possible participation of Enterobacteriaceae in the cocoa bean fermentation process. Tatumella ptyseos and Tatumella citrea were the prevailing enterobacterial species in the beginning of the fermentations as revealed by 16S rRNA gene-PCR-DGGE. Finally, it turned out that control over a restricted bacterial species diversity during fermentation through an ideal post-harvest handling of the cocoa beans will allow the production of high-quality cocoa and chocolates produced thereof, independent of the fermentation method or farm. Copyright © 2011 Elsevier Ltd. All rights reserved.
Voon, W W Y; Rukayadi, Y; Meor Hussin, A S
2016-05-01
Biocellulose (BC) is pure extracellular cellulose produced by several species of micro-organisms that has numerous applications in the food, biomedical and paper industries. However, the existing biocellulose-producing bacterial strain with high yield was limited. The aim of this study was to isolate and identify the potential biocellulose-producing bacterial isolates from Malaysian acidic fruits. One hundred and ninety-three bacterial isolates were obtained from 19 local acidic fruits collected in Malaysia and screened for their ability to produce BC. A total of 15 potential bacterial isolates were then cultured in standard Hestrin-Schramm (HS) medium statically at 30°C for 2 weeks to determine the BC production. The most potent bacterial isolates were identified using 16S rRNA gene sequence analysis, morphological and biochemical characteristics. Three new and potent biocellulose-producing bacterial strains were isolated from soursop fruit and identified as Stenotrophomonas maltophilia WAUPM42, Pantoea vagans WAUPM45 and Beijerinckia fluminensis WAUPM53. Stenotrophomonas maltophilia WAUPM42 was the most potent biocellulose-producing bacterial strain that produced the highest amount of BC 0·58 g l(-1) in standard HS medium. Whereas, the isolates P. vagans WAUPM45 and B. fluminensis WAUPM53 showed 0·50 and 0·52 g l(-1) of BC production, respectively. Biocellulose (BC) is pure extracellular cellulose that is formed by many micro-organisms in the presence of carbon source and acidic condition. It can replace plant-based cellulose in multifarious applications due to its unique characteristics. In this study, three potential biocellulose-producing bacterial strains were obtained from Malaysian acidic fruits and identified as Stenotrophomonas maltophilia WAUPM42, Pantoea vagans WAUPM45 and Beijerinckia fluminensis WAUPM53. This study reports for the first time the new biocellulose-producing bacterial strains isolated from Malaysian acidic fruits. © 2016 The
Moravec, Anna R.; Siv, Andrew W.; Hobby, Chelsea R.; Lindsay, Emily N.; Norbash, Layla V.; Shults, Daniel J.; Symes, Steven J. K.
2017-01-01
ABSTRACT The pathogenic Vibrio species (V. cholerae, V. parahaemolyticus, and V. vulnificus) represent a constant threat to human health, causing foodborne and skin wound infections as a result of ingestion of or exposure to contaminated water and seafood. Recent studies have highlighted Vibrio's ability to acquire fatty acids from environmental sources and assimilate them into cell membranes. The possession and conservation of such machinery provokes consideration of fatty acids as important factors in the pathogenic lifestyle of Vibrio species. The findings here link exogenous fatty acid exposure to changes in bacterial membrane phospholipid structure, permeability, phenotypes associated with virulence, and consequent stress responses that may impact survival and persistence of pathogenic Vibrio species. Polyunsaturated fatty acids (PUFAs) (ranging in carbon length and unsaturation) supplied in growth medium were assimilated into bacterial phospholipids, as determined by thin-layer chromatography and liquid chromatography-mass spectrometry. The incorporation of fatty acids variably affected membrane permeability, as judged by uptake of the hydrophobic compound crystal violet. For each species, certain fatty acids were identified as affecting resistance to antimicrobial peptide treatment. Significant fluctuations were observed with regard to both motility and biofilm formation following growth in the presence of individual PUFAs. Our results illustrate the important and complex roles of exogenous fatty acids in the membrane physiology and virulence of a bacterial genus that inhabits aquatic and host environments containing an abundance of diverse fatty acids. IMPORTANCE Bacterial responses to fatty acids include, but are not limited to, degradation for metabolic gain, modification of membrane lipids, alteration of protein function, and regulation of gene expression. Vibrio species exhibit significant diversity with regard to the machinery known to participate in
Khan, S Sudheer; Mukherjee, Amitava; Chandrasekaran, N
2011-10-01
Silver nanoparticles (SNPs) are being increasingly used in many consumer products like textile fabrics, cosmetics, washing machines, food and drug products owing to its excellent antimicrobial properties. Here we have studied the adsorption and toxicity of SNPs on bacterial species such as Pseudomonas aeruginosa, Micrococcus luteus, Bacillus subtilis, Bacillus barbaricus and Klebsiella pneumoniae. The influence of zeta potential on the adsorption of SNPs on bacterial cell surface was investigated at acidic, neutral and alkaline pH and with varying salt (NaCl) concentrations (0.05, 0.1, 0.5, 1 and 1.5 M). The survival rate of bacterial species decreased with increase in adsorption of SNPs. Maximum adsorption and toxicity was observed at pH 5, and NaCl concentration of <0.5 M. A very less adsorption was observed at pH 9 and NaCl concentration >0.5 M, there by resulting in less toxicity. The zeta potential study suggests that, the adsorption of SNPs on the cell surface was related to electrostatic force of attraction. The equilibrium and kinetics of the adsorption process were also studied. The adsorption equilibrium isotherms fitted well to the Langmuir model. The kinetics of adsorption fitted best to pseudo-first-order. These findings form a basis for interpreting the interaction of nanoparticles with environmental bacterial species. Copyright © 2011 Elsevier B.V. All rights reserved.
Baude, Jessica; Vial, Ludovic; Villard, Camille; Campillo, Tony; Lavire, Céline; Nesme, Xavier
2016-01-01
ABSTRACT The rhizosphere-inhabiting species Agrobacterium fabrum (genomospecies G8 of the Agrobacterium tumefaciens species complex) is known to degrade hydroxycinnamic acids (HCAs), especially ferulic acid and p-coumaric acid, via the novel A. fabrum HCA degradation pathway. Gene expression profiles of A. fabrum strain C58 were investigated in the presence of HCAs, using a C58 whole-genome oligoarray. Both ferulic acid and p-coumaric acid caused variations in the expression of more than 10% of the C58 genes. Genes of the A. fabrum HCA degradation pathway, together with the genes involved in iron acquisition, were among the most highly induced in the presence of HCAs. Two operons coding for the biosynthesis of a particular siderophore, as well as genes of the A. fabrum HCA degradation pathway, have been described as being specific to the species. We demonstrate here their coordinated expression, emphasizing the interdependence between the iron concentration in the growth medium and the rate at which ferulic acid is degraded by cells. The coordinated expression of these functions may be advantageous in HCA-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. The present results confirm that there is cooperation between the A. fabrum-specific genes, defining a particular ecological niche. IMPORTANCE We previously identified seven genomic regions in Agrobacterium fabrum that were specifically present in all of the members of this species only. Here we demonstrated that two of these regions, encoding the hydroxycinnamic acid degradation pathway and the iron acquisition pathway, were regulated in a coordinated manner. The coexpression of these functions may be advantageous in hydroxycinnamic acid-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. These data support the view that bacterial genomic species
Alonzo, Francis
2016-01-01
To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental
Zorzoli, Azul; Grayczyk, James P; Alonzo, Francis
2016-10-01
To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental
Eradication of bacterial species via photosensitization
NASA Astrophysics Data System (ADS)
Golding, Paul S.; Maddocks, L.; King, Terence A.; Drucker, D. B.
1999-02-01
Photosensitization and inactivation efficacy of three bacterial species: Prevotella nigrescens, Staphylococcus aureus and Escherichia coli have been investigated. Samples of Staphylococcus aureus and Escherichia coli were treated with the triphenylmethane dye malachite green isothiocyanate and exposed to light from a variety of continuous and pulsed light sauces at a wavelength of approximately 630 nm. Inactivation of the Gram-positive species Staphylococcus aureus was found to increase with radiation dose, whilst Gram-negative Escherichia coli was resistant to such treatment. Samples of the pigmented species Prevotella nigrescens were found to be inactivated by exposure to light alone. The mechanism of photosensitization and inactivation of Staphylococcus aureus with malachite green isothiocyanate is addressed. The possible roles of the excited triplet state of the photosensitizer, the involvement of molecular oxygen, and the bacterial cell wall are discussed. Photosensitization may provide a way of eliminating naturally pigmented species responsible for a variety of infections, including oral diseases such as gingivitis and periodontitis.
Method for construction of bacterial strains with increased succinic acid production
Donnelly, Mark I.; Sanville-Millard, Cynthia; Chatterjee, Ranjini
2000-01-01
A fermentation process for producing succinic acid is provided comprising selecting a bacterial strain that does not produce succinic acid in high yield, disrupting the normal regulation of sugar metabolism of said bacterial strain, and combining the mutant bacterial strain and selected sugar in anaerobic conditions to facilitate production of succinic acid. Also provided is a method for changing low yield succinic acid producing bacteria to high yield succinic acid producing bacteria comprising selecting a bacterial strain having a phosphotransferase system and altering the phosphotransferase system so as to allow the bacterial strain to simultaneously metabolize different sugars.
Eigemann, Falk; Hilt, Sabine; Salka, Ivette; Grossart, Hans-Peter
2013-03-01
We studied bacterial associations with the green alga Desmodesmus armatus and the diatom Stephanodiscus minutulus under changing environmental conditions and bacterial source communities, to evaluate whether bacteria-algae associations are species-specific or more generalized and determined by external factors. Axenic and xenic algae were incubated in situ with and without allelopathically active macrophytes, and in the laboratory with sterile and nonsterile lake water and an allelochemical, tannic acid (TA). Bacterial community composition (BCC) of algae-associated bacteria was analyzed by denaturing gradient gel electrophoresis (DGGE), nonmetric multidimensional scaling, cluster analyses, and sequencing of DGGE bands. BCC of xenic algal cultures of both species were not significantly affected by changes in their environment or bacterial source community, except in the case of TA additions. Species-specific interactions therefore appear to overrule the effects of environmental conditions and source communities. The BCC of xenic and axenic D. armatus cultures subjected to in situ bacterial colonization, however, had lower similarities (ca. 55%), indicating that bacterial precolonization is a strong factor for bacteria-algae associations irrespective of environmental conditions and source community. Our findings emphasize the ecological importance of species-specific bacteria-algae associations with important repercussions for other processes, such as the remineralization of nutrients, and organic matter dynamics. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.
De Filippis, Francesca; Troise, Antonio Dario; Vitaglione, Paola; Ercolini, Danilo
2018-08-01
Kombucha is a traditional beverage produced by tea fermentation, carried out by a symbiotic consortium of bacteria and yeasts. Acetic Acid Bacteria (AAB) usually dominate the bacterial community of Kombucha, driving the fermentative process. The consumption of this beverage was often associated to beneficial effects for the health, due to its antioxidant and detoxifying properties. We characterized bacterial populations of Kombucha tea fermented at 20 or 30 °C by using culture-dependent and -independent methods and monitored the concentration of gluconic and glucuronic acids, as well as of total polyphenols. We found significant differences in the microbiota at the two temperatures. Moreover, different species of Gluconacetobacter were selected, leading to a differential abundance of gluconic and glucuronic acids. Copyright © 2018 Elsevier Ltd. All rights reserved.
Structural differences in the bacterial flagellar motor among bacterial species.
Terashima, Hiroyuki; Kawamoto, Akihiro; Morimoto, Yusuke V; Imada, Katsumi; Minamino, Tohru
2017-01-01
The bacterial flagellum is a supramolecular motility machine consisting of the basal body as a rotary motor, the hook as a universal joint, and the filament as a helical propeller. Intact structures of the bacterial flagella have been observed for different bacterial species by electron cryotomography and subtomogram averaging. The core structures of the basal body consisting of the C ring, the MS ring, the rod and the protein export apparatus, and their organization are well conserved, but novel and divergent structures have also been visualized to surround the conserved structure of the basal body. This suggests that the flagellar motors have adapted to function in various environments where bacteria live and survive. In this review, we will summarize our current findings on the divergent structures of the bacterial flagellar motor.
Extraction of Total Nucleic Acids From Ticks for the Detection of Bacterial and Viral Pathogens
Crowder, Chris D.; Rounds, Megan A.; Phillipson, Curtis A.; Picuri, John M.; Matthews, Heather E.; Halverson, Justina; Schutzer, Steven E.; Ecker, David J.; Eshoo, Mark W.
2010-01-01
Ticks harbor numerous bacterial, protozoal, and viral pathogens that can cause serious infections in humans and domestic animals. Active surveillance of the tick vector can provide insight into the frequency and distribution of important pathogens in the environment. Nucleic-acid based detection of tick-borne bacterial, protozoan, and viral pathogens requires the extraction of both DNA and RNA (total nucleic acids) from ticks. Traditional methods for nucleic acid extraction are limited to extraction of either DNA or the RNA from a sample. Here we present a simple bead-beating based protocol for extraction of DNA and RNA from a single tick and show detection of Borrelia burgdorferi and Powassan virus from individual, infected Ixodes scapularis ticks. We determined expected yields for total nucleic acids by this protocol for a variety of adult tick species. The method is applicable to a variety of arthropod vectors, including fleas and mosquitoes, and was partially automated on a liquid handling robot. PMID:20180313
Reverter, Miriam; Sasal, Pierre; Tapissier-Bontemps, N; Lecchini, D; Suzuki, M
2017-06-01
While recent studies have suggested that fish mucus microbiota play an important role in homeostasis and prevention of infections, very few studies have investigated the bacterial communities of gill mucus. We characterised the gill mucus bacterial communities of four butterflyfish species and although the bacterial diversity of gill mucus varied significantly between species, Shannon diversities were high (H = 3.7-5.7) in all species. Microbiota composition differed between butterflyfishes, with Chaetodon lunulatus and C. ornatissimus having the most similar bacterial communities, which differed significantly from C. vagabundus and C. reticulatus. The core bacterial community of all species consisted of mainly Proteobacteria followed by Actinobacteria and Firmicutes. Chaetodonlunulatus and C. ornatissimus bacterial communities were mostly dominated by Gammaproteobacteria with Vibrio as the most abundant genus. Chaetodonvagabundus and C. reticulatus presented similar abundances of Gammaproteobacteria and Alphaproteobacteria, which were well represented by Acinetobacter and Paracoccus, respectively. In conclusion, our results indicate that different fish species present specific bacterial assemblages. Finally, as mucus layers are nutrient hotspots for heterotrophic bacteria living in oligotrophic environments, such as coral reef waters, the high bacterial diversity found in butterflyfish gill mucus might indicate external fish mucus surfaces act as a reservoir of coral reef bacterial diversity. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Štornik, Aleksandra; Skok, Barbara; Trček, Janja
2016-03-01
Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different Hae III and five different Hpa II restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different Hae III and two different Hpa II restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica , Pichia membranifaciens and Saccharomycodes ludwigii . This study has shown for the first time that the bacterial microbiota for the industrial production of
Štornik, Aleksandra; Skok, Barbara
2016-01-01
Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial
Studies on Batch Production of Bacterial Concentrates from Mixed Species Lactic Starters
Pettersson, H. E.
1975-01-01
Optimum growth conditions for mixed species starter FDs 0172 at constant pH in skim milk, whey, and tryptone medium were investigated. Growth rate and maximum population were optimal at 30 C. pH values between 5.5 and 7.0 did not influence the growth rate and maximum population obtainable. Lactic acid-producing activity declined rapidly after reaching the end of the exponential growth phase. The bacterial balance was found to be influenced by the growth parameters: media, pH, temperature, and neutralizer. Skim milk or whey medium at 25 C, pH 6.5, and neutralized with 20% (vol/vol) NH4OH kept the bacterial balance almost constant throughout the cultivation. Grown in tryptone medium at constant pH, the changes in bacterial balance and other metabolic activities were striking compared to the other two media tested. The effect of lactate as an inhibitor was found to be complex, changing with the growth conditions. Concentrates made from mixed species starters FDs 0172, FD 0570, CH 0170, CHs 0170, and T 27 were comparable to controls when cultivated at the optimum conditions found and thereafter centrifuged. Aroma production, proteolytic activity, and CO2 production did not change significantly compared to controls when cultivated at optimum conditions in skim milk or whey medium. PMID:16350009
D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.
Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang
2015-04-01
Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.
D-lactic acid measurements in the diagnosis of bacterial infections.
Smith, S M; Eng, R H; Campos, J M; Chmel, H
1989-01-01
Body fluids suspected of bacterial infection were cultured and examined for the presence of D-lactic acid, a specific bacterial metabolite. We examined 206 patients and 264 specimens. D-Lactic acid was found in concentrations of greater than or equal to 0.15 mM in 11 of 11 infected and 6 of 40 noninfected ascitic fluids, 6 of 6 infected and 4 of 33 noninfected pleural fluids, 4 of 4 infected and 0 of 13 noninfected synovial fluids, and 26 of 27 infected and 2 of 130 noninfected cerebrospinal fluids. The overall sensitivity was 79.7%, and the specificity was 99.5% when the D-lactic acid concentration was at least 0.15 mM. The most important clinical utility of the D-lactic acid measurement appears to be for patients with bacterial infection in various body compartments and in patients who have already received antimicrobial therapy. An elevation in D-lactic acid may indicate the presence of bacterial infection even when cultures are negative. PMID:2715313
Estimation of lactic acid bacterial cell number by DNA quantification.
Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa
2018-01-01
Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.
Panamanian frog species host unique skin bacterial communities
Belden, Lisa K.; Hughey, Myra C.; Rebollar, Eria A.; Umile, Thomas P.; Loftus, Stephen C.; Burzynski, Elizabeth A.; Minbiole, Kevin P. C.; House, Leanna L.; Jensen, Roderick V.; Becker, Matthew H.; Walke, Jenifer B.; Medina, Daniel; Ibáñez, Roberto; Harris, Reid N.
2015-01-01
Vertebrates, including amphibians, host diverse symbiotic microbes that contribute to host disease resistance. Globally, and especially in montane tropical systems, many amphibian species are threatened by a chytrid fungus, Batrachochytrium dendrobatidis (Bd), that causes a lethal skin disease. Bd therefore may be a strong selective agent on the diversity and function of the microbial communities inhabiting amphibian skin. In Panamá, amphibian population declines and the spread of Bd have been tracked. In 2012, we completed a field survey in Panamá to examine frog skin microbiota in the context of Bd infection. We focused on three frog species and collected two skin swabs per frog from a total of 136 frogs across four sites that varied from west to east in the time since Bd arrival. One swab was used to assess bacterial community structure using 16S rRNA amplicon sequencing and to determine Bd infection status, and one was used to assess metabolite diversity, as the bacterial production of anti-fungal metabolites is an important disease resistance function. The skin microbiota of the three Panamanian frog species differed in OTU (operational taxonomic unit, ~bacterial species) community composition and metabolite profiles, although the pattern was less strong for the metabolites. Comparisons between frog skin bacterial communities from Panamá and the US suggest broad similarities at the phylum level, but key differences at lower taxonomic levels. In our field survey in Panamá, across all four sites, only 35 individuals (~26%) were Bd infected. There was no clustering of OTUs or metabolite profiles based on Bd infection status and no clear pattern of west-east changes in OTUs or metabolite profiles across the four sites. Overall, our field survey data suggest that different bacterial communities might be producing broadly similar sets of metabolites across frog hosts and sites. Community structure and function may not be as tightly coupled in these skin symbiont
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin.
Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad
2016-08-01
Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3-7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Lactobacilli were recognized as the major group of lactic acid bacteria in Sayur Asin
McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda
2016-01-01
ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099
Distinctive bacterial communities in the rhizoplane of four tropical tree species.
Oh, Yoon Myung; Kim, Mincheol; Lee-Cruz, Larisa; Lai-Hoe, Ang; Go, Rusea; Ainuddin, N; Rahim, Raha Abdul; Shukor, Noraini; Adams, Jonathan M
2012-11-01
It is known that the microbial community of the rhizosphere is not only influenced by factors such as root exudates, phenology, and nutrient uptake but also by the plant species. However, studies of bacterial communities associated with tropical rainforest tree root surfaces, or rhizoplane, are lacking. Here, we analyzed the bacterial community of root surfaces of four species of native trees, Agathis borneensis, Dipterocarpus kerrii, Dyera costulata, and Gnetum gnemon, and nearby bulk soils, in a rainforest arboretum in Malaysia, using 454 pyrosequencing of the 16S rRNA gene. The rhizoplane bacterial communities for each of the four tree species sampled clustered separately from one another on an ordination, suggesting that these assemblages are linked to chemical and biological characteristics of the host or possibly to the mycorrhizal fungi present. Bacterial communities of the rhizoplane had various similarities to surrounding bulk soils. Acidobacteria, Alphaproteobacteria, and Betaproteobacteria were dominant in rhizoplane communities and in bulk soils from the same depth (0-10 cm). In contrast, the relative abundance of certain bacterial lineages on the rhizoplane was different from that in bulk soils: Bacteroidetes and Betaproteobacteria, which are known as copiotrophs, were much more abundant in the rhizoplane in comparison to bulk soil. At the genus level, Burkholderia, Acidobacterium, Dyella, and Edaphobacter were more abundant in the rhizoplane. Burkholderia, which are known as both pathogens and mutualists of plants, were especially abundant on the rhizoplane of all tree species sampled. The Burkholderia species present included known mutualists of tropical crops and also known N fixers. The host-specific character of tropical tree rhizoplane bacterial communities may have implications for understanding nutrient cycling, recruitment, and structuring of tree species diversity in tropical forests. Such understanding may prove to be useful in both
Species differences in unlocking B-side electron transfer in bacterial reaction centers
Dylla, Nicholas P.; Faries, Kaitlyn M.; Wyllie, Ryan M.; ...
2016-06-21
The structure of the bacterial photosynthetic reaction center (RC) reveals symmetry-related electron transfer (ET) pathways, but only one path is used in native RCs. Analogous mutations have been made in two Rhodobacter (R.) species. A glutamic acid at position 133 in the M subunit increases transmembrane charge separation via the naturally inactive (B-side) path through impacts on primary ET in mutant R. sphaeroidesRCs. Prior work showed that the analogous substitution in the R. capsulatusRC also increases B-side activity, but mainly affects secondary ET. Finally, the overall yields of transmembrane ET are similar, but enabled in fundamentally different ways.
Species differences in unlocking B-side electron transfer in bacterial reaction centers
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dylla, Nicholas P.; Faries, Kaitlyn M.; Wyllie, Ryan M.
The structure of the bacterial photosynthetic reaction center (RC) reveals symmetry-related electron transfer (ET) pathways, but only one path is used in native RCs. Analogous mutations have been made in two Rhodobacter (R.) species. A glutamic acid at position 133 in the M subunit increases transmembrane charge separation via the naturally inactive (B-side) path through impacts on primary ET in mutant R. sphaeroidesRCs. Prior work showed that the analogous substitution in the R. capsulatusRC also increases B-side activity, but mainly affects secondary ET. Finally, the overall yields of transmembrane ET are similar, but enabled in fundamentally different ways.
What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira
Fouts, Derrick E.; Matthias, Michael A.; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E.; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L.; Haake, David A.; Haft, Daniel H.; Hartskeerl, Rudy; Ko, Albert I.; Levett, Paul N.; Matsunaga, James; Mechaly, Ariel E.; Monk, Jonathan M.; Nascimento, Ana L. T.; Nelson, Karen E.; Palsson, Bernhard; Peacock, Sharon J.; Picardeau, Mathieu; Ricaldi, Jessica N.; Thaipandungpanit, Janjira; Wunder, Elsio A.; Yang, X. Frank; Zhang, Jun-Jie; Vinetz, Joseph M.
2016-01-01
Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade’s refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic
What Makes a Bacterial Species Pathogenic?:Comparative Genomic Analysis of the Genus Leptospira.
Fouts, Derrick E; Matthias, Michael A; Adhikarla, Haritha; Adler, Ben; Amorim-Santos, Luciane; Berg, Douglas E; Bulach, Dieter; Buschiazzo, Alejandro; Chang, Yung-Fu; Galloway, Renee L; Haake, David A; Haft, Daniel H; Hartskeerl, Rudy; Ko, Albert I; Levett, Paul N; Matsunaga, James; Mechaly, Ariel E; Monk, Jonathan M; Nascimento, Ana L T; Nelson, Karen E; Palsson, Bernhard; Peacock, Sharon J; Picardeau, Mathieu; Ricaldi, Jessica N; Thaipandungpanit, Janjira; Wunder, Elsio A; Yang, X Frank; Zhang, Jun-Jie; Vinetz, Joseph M
2016-02-01
Leptospirosis, caused by spirochetes of the genus Leptospira, is a globally widespread, neglected and emerging zoonotic disease. While whole genome analysis of individual pathogenic, intermediately pathogenic and saprophytic Leptospira species has been reported, comprehensive cross-species genomic comparison of all known species of infectious and non-infectious Leptospira, with the goal of identifying genes related to pathogenesis and mammalian host adaptation, remains a key gap in the field. Infectious Leptospira, comprised of pathogenic and intermediately pathogenic Leptospira, evolutionarily diverged from non-infectious, saprophytic Leptospira, as demonstrated by the following computational biology analyses: 1) the definitive taxonomy and evolutionary relatedness among all known Leptospira species; 2) genomically-predicted metabolic reconstructions that indicate novel adaptation of infectious Leptospira to mammals, including sialic acid biosynthesis, pathogen-specific porphyrin metabolism and the first-time demonstration of cobalamin (B12) autotrophy as a bacterial virulence factor; 3) CRISPR/Cas systems demonstrated only to be present in pathogenic Leptospira, suggesting a potential mechanism for this clade's refractoriness to gene targeting; 4) finding Leptospira pathogen-specific specialized protein secretion systems; 5) novel virulence-related genes/gene families such as the Virulence Modifying (VM) (PF07598 paralogs) proteins and pathogen-specific adhesins; 6) discovery of novel, pathogen-specific protein modification and secretion mechanisms including unique lipoprotein signal peptide motifs, Sec-independent twin arginine protein secretion motifs, and the absence of certain canonical signal recognition particle proteins from all Leptospira; and 7) and demonstration of infectious Leptospira-specific signal-responsive gene expression, motility and chemotaxis systems. By identifying large scale changes in infectious (pathogenic and intermediately pathogenic
Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng
2016-05-01
Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.
Distribution of 10 periodontal bacterial species in children and adolescents over a 7-year period.
Nakano, K; Miyamoto, E; Tamura, K; Nemoto, H; Fujita, K; Nomura, R; Ooshima, T
2008-10-01
There is scant information available regarding the distribution of periodontal bacterial species in children and adolescents over an extended period. The purpose of this study was to compare bacterial profiles in the same individuals over a period of 7 years. Twenty-six children and adolescents from whom dental plaque and saliva specimens were obtained during both the first (1999-2000) and second (2006-2007) periods, were analyzed. Bacterial DNA was extracted from each specimen and the presence of 10 periodontal bacterial species was determined using a PCR method, with a focus on the red complex species of Porphyromonas gingivalis, Treponema denticola, and Tannerella forsythia. Subjects with red complex species in saliva specimens obtained during the second collection possessed a significantly higher number of total bacterial species than those without. The detection rate of the red complex species in the second collection period samples was significantly greater in subjects who had two or more species detected in samples taken during the first collection compared with the other subjects. Subjects possessing red complex species may be at possible risk for infection with a high number of periodontal bacterial species during adolescent and younger adult years.
Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin
Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad
2016-01-01
Background and Objectives: Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Materials and Methods: Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3–7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Results: Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Conclusion: Lactobacilli were
Silbande, A; Cornet, J; Cardinal, M; Chevalier, F; Rochefort, K; Smith-Ravin, J; Adenet, S; Leroi, F
2018-02-01
The spoilage potential of 28 bacterial strains isolated from spoiled raw yellowfin tuna was evaluated. Bacterial species were inoculated in irradiated tuna matrix. Chemical changes, bacterial growth and sensory quality were monitored during aerobic storage at 8°C. Pseudomonas spp., Enterobacter spp. and Escherichia hermanii had no spoiling effect. Brochothrix thermosphacta and Carnobacterium divergens/maltaromaticum developed moderate unpleasant odours. Hafnia paralvei and Serratia spp. released strong off-odours (pyrrolidine, sulphur/cabbage). No bacterial group (except H. paralvei) combined with Pseudomonas spp. deteriorated the sensory quality of tuna. When C. divergens/maltaromaticum was associated with H. paralvei or B. thermosphacta, the odour is close to the naturally contaminated tuna stored on the same conditions. The pH, total volatile basic nitrogen (TVBN) and trimethylamine (TMA) were not correlated with the spoilage. The bacterial species had a different impact on the sensory quality of the fish. The bacterial interactions lead to an enhancement or an inhibition of the spoilage potential and the bacterial growth. The specific spoilage organism (SSO) appears to be an association of lactic acid bacteria (LAB) with Enterobacteriaceae or B. thermosphacta. Pseudomonas, often dominant at the sensory rejection time, is not a good quality indicator. © 2017 The Society for Applied Microbiology.
Rajavel, Krishnamoorthy; Gomathi, Rajkumar; Manian, Sellamuthu; Rajendra Kumar, Ramasamy Thangavelu
2014-01-21
Understanding the bacterial cytotoxicity of CNTs is important for a wide variety of applications in the biomedical, environmental, and health sectors. A majority of the earlier reports attributed the bactericidal cytotoxicity of CNTs to bacterial cell membrane damage by direct physical puncturing. Our results reveal that bacterial cell death via bacterial cell membrane damage is induced by reactive oxygen species (ROS) produced from CNTs and is not due to direct physical puncturing by CNTs. To understand the actual mechanism of bacterial killing, we elucidated the bacterial cytotoxicity of SWCNTs and MWCNTs against Gram-negative human pathogenic bacterial species Escherichia coli, Shigella sonnei, Klebsiella pneumoniae, and Pseudomonas aeruginosa and its amelioration upon functionalizing the CNTs with antioxidant tannic acid (TA). Interestingly, the bacterial cells treated with CNTs exhibited severe cell damage under laboratory (ambient) and sunlight irradiation conditions. However, CNTs showed no cytotoxicity to the bacterial cells when incubated in the dark. The quantitative assessments carried out by us made it explicit that CNTs are effective generators of ROS such as (1)O2, O2(•-), and (•)OH in an aqueous medium under both ambient and sunlight-irradiated conditions. Both naked and TA-functionalized CNTs showed negligible ROS production in the dark. Furthermore, strong correlations were obtained between ROS produced by CNTs and the bacterial cell mortality (with the correlation coefficient varying between 0.7618 and 0.9891) for all four tested pathogens. The absence of bactericidal cytotoxicity in both naked and functionalized CNTs in the dark reveals that the presence of ROS is the major factor responsible for the bactericidal action compared to direct physical puncturing. This understanding of the bactericidal activity of the irradiated CNTs, mediated through the generation of ROS, could be interesting for novel applications such as regulated ROS delivery
New bacterial species associated with chronic periodontitis.
Kumar, P S; Griffen, A L; Barton, J A; Paster, B J; Moeschberger, M L; Leys, E J
2003-05-01
Recent investigations of the human subgingival oral flora based on ribosomal 16S cloning and sequencing have shown many of the bacterial species present to be novel species or phylotypes. The purpose of the present investigation was to identify potential periodontal pathogens among these newly identified species and phylotypes. Species-specific ribosomal 16S primers for PCR amplification were developed for detection of new species. Associations with chronic periodontitis were observed for several new species or phylotypes, including uncultivated clones D084 and BH017 from the Deferribacteres phylum, AU126 from the Bacteroidetes phylum, Megasphaera clone BB166, clone X112 from the OP11 phylum, and clone I025 from the TM7 phylum, and the named species Eubacterium saphenum, Porphyromonas endodontalis, Prevotella denticola, and Cryptobacterium curtum. Species or phylotypes more prevalent in periodontal health included two uncultivated phylotypes, clone W090 from the Deferribacteres phylum and clone BU063 from the Bacteroidetes, and named species Atopobium rimae and Atopobium parvulum.
Bacterial-biota dynamics of eight bryophyte species from different ecosystems
Koua, Faisal Hammad Mekky; Kimbara, Kazuhide; Tani, Akio
2014-01-01
Despite the importance of bryophyte-associated microorganisms in various ecological aspects including their crucial roles in the soil-enrichment of organic mass and N2 fixation, nonetheless, little is known about the microbial diversity of the bryophyte phyllospheres (epi-/endophytes). To get insights into bacterial community structures and their dynamics on the bryophyte habitats in different ecosystems and their potential biological roles, we utilized the 16S rRNA gene PCR-DGGE and subsequent phylogenetic analyses to investigate the bacterial community of eight bryophyte species collected from three distinct ecosystems from western Japan. Forty-two bacterial species belonging to γ-proteobacteria and Firmicutes with 71.4% and 28.6%, respectively, were identified among 90 DGGE gel band population. These DGGE-bands were assigned to 13 different genera with obvious predomination the genus Clostridium with 21.4% from the total bacterial community. These analyses provide new insights into bryophyte-associated bacteria and their relations to the ecosystems. PMID:25737654
Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín
2016-05-01
In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.
Wei, Yuquan; Zhao, Yue; Shi, Mingzi; Cao, Zhenyu; Lu, Qian; Yang, Tianxue; Fan, Yuying; Wei, Zimin
2018-01-01
Enriched phosphate-solubilizing bacteria (PSB) agent were acquired by domesticated cultivation, and inoculated into kitchen waste composting in different stages. The effect of different treatments on organic acids production, tricalcium phosphate (TCP) solubilization and their relationship with bacterial community were investigated during composting. Our results pointed out that inoculation affected pH, total acidity and the production of oxalic, lactic, citric, succinic, acetic and formic acids. We also found a strong advantage in the solubilization of TCP and phosphorus (P) availability for PSB inoculation especially in the cooling stage. Redundancy analysis and structural equation models demonstrated inoculation by different methods changed the correlation of the bacterial community composition with P fractions as well as organic acids, and strengthened the cooperative function related to P transformation among species during composting. Finally, we proposed a possible mechanism of P solubilization with enriched PSB inoculation, which was induced by bacterial community and organic acids production. Copyright © 2017 Elsevier Ltd. All rights reserved.
Olapade, Ola A; Pung, Kayleigh
2012-06-01
Plant-microbial interactions have been well studied because of the ecological importance of such relationships in aquatic systems. However, general knowledge regarding the composition of these biofilm communities is still evolving, partly as a result of several confounding factors that are attributable to plant host properties and to hydrodynamic conditions in aquatic environments. In this study, the occurrences of various bacterial phylogenetic taxa on 2 native plants, i.e., mayapple (Podophyllum peltatum L.) and cow parsnip (Heracleum maximum Bartram), and on an invasive species, i.e., garlic mustard (Alliaria petiolata (M. Bieb.) Cavara & Grande), were quantitatively examined using nucleic acid staining and fluorescence in situ hybridization. The plants were incubated in triplicates for about a week within the Kalamazoo River and Pierce Cedar Creek as well as in microcosms. The bacterial groups targeted for enumeration are known to globally occur in relatively high abundance and are also ubiquitously distributed in freshwater environments. Fluorescence in situ hybridization analyses of the bacterioplankton assemblages revealed that the majority of bacterial cells that hybridized with the different probes were similar between the 2 sites. In contrast, the plant-associated populations while similar on the 3 plants incubated in Kalamazoo River, their representations were highest on the 2 native plants relative to the invasive species in Pierce Cedar Creek. Overall, our results further suggested that epiphytic bacterial assemblages are probably under the influences of and probably subsequently respond to multiple variables and conditions in aquatic milieus.
Peltonen, R; Ling, W H; Hänninen, O; Eerola, E
1992-01-01
The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187
A new mathematical model of bacterial interactions in two-species oral biofilms
Martin, Bénédicte; Tamanai-Shacoori, Zohreh; Bronsard, Julie; Ginguené, Franck; Meuric, Vincent
2017-01-01
Periodontitis are bacterial inflammatory diseases, where the bacterial biofilms present on the tooth-supporting tissues switch from a healthy state towards a pathogenic state. Among bacterial species involved in the disease, Porphyromonas gingivalis has been shown to induce dysbiosis, and to induce virulence of otherwise healthy bacteria like Streptococcus gordonii. During biofilm development, primary colonizers such as S. gordonii first attach to the surface and allow the subsequent adhesion of periodontal pathogens such as P. gingivalis. Interactions between those two bacteria have been extensively studied during the adhesion step of the biofilm. The aim of the study was to understand interactions of both species during the growing phase of the biofilm, for which little knowledge is available, using a mathematical model. This two-species biofilm model was based on a substrate-dependent growth, implemented with damage parameters, and validated thanks to data obtained on experimental biofilms. Three different hypothesis of interactions were proposed and assayed using this model: independence, competition between both bacteria species, or induction of toxicity by one species for the other species. Adequacy between experimental and simulated biofilms were found with the last hypothetic mathematical model. This new mathematical model of two species bacteria biofilms, dependent on different substrates for growing, can be applied to any bacteria species, environmental conditions, or steps of biofilm development. It will be of great interest for exploring bacterial interactions in biofilm conditions. PMID:28253369
Prevalent bacterial species and novel phylotypes in advanced noma lesions.
Paster, B J; Falkler Jr, W A; Enwonwu, C O; Idigbe, E O; Savage, K O; Levanos, V A; Tamer, M A; Ericson, R L; Lau, C N; Dewhirst, F E
2002-06-01
The purpose of this study was to determine the bacterial diversity in advanced noma lesions using culture-independent molecular methods. 16S ribosomal DNA bacterial genes from DNA isolated from advanced noma lesions of four Nigerian children were PCR amplified with universally conserved primers and spirochetal selective primers and cloned into Escherichia coli. Partial 16S rRNA sequences of approximately 500 bases from 212 cloned inserts were used initially to determine species identity or closest relatives by comparison with sequences of known species or phylotypes. Nearly complete sequences of approximately 1,500 bases were obtained for most of the potentially novel species. A total of 67 bacterial species or phylotypes were detected, 25 of which have not yet been grown in vitro. Nineteen of the species or phylotypes, including Propionibacterium acnes, Staphylococcus spp., and the opportunistic pathogens Stenotrophomonas maltophilia and Ochrobactrum anthropi were detected in more than one subject. Other known species that were detected included Achromobacter spp., Afipia spp., Brevundimonas diminuta, Capnocytophaga spp., Cardiobacterium sp., Eikenella corrodens, Fusobacterium spp., Gemella haemoylsans, and Neisseria spp. Phylotypes that were unique to noma infections included those in the genera Eubacterium, Flavobacterium, Kocuria, Microbacterium, and Porphyromonas and the related Streptococcus salivarius and genera Sphingomonas and TREPONEMA: Since advanced noma lesions are infections open to the environment, it was not surprising to detect species not commonly associated with the oral cavity, e.g., from soil. Several species previously implicated as putative pathogens of noma, such as spirochetes and Fusobacterium spp., were detected in at least one subject. However, due to the limited number of available noma subjects, it was not possible at this time to associate specific species with the disease.
Geeraerts, Wim; Pothakos, Vasileios; De Vuyst, Luc; Leroy, Frédéric
2017-08-01
Pork-based cooked products, such as cooked hams, are economically valuable foods that are vulnerable to bacterial spoilage, even when applying cooling and modified atmosphere packaging (MAP). Besides a common presence of Brochothrix thermosphacta, their microbiota are usually dominated by lactic acid bacteria (LAB). Yet, the exact LAB species diversity can differ considerably among products. In this study, 42 sliced cooked pork samples were acquired from three different Belgian supermarkets to map their bacterial heterogeneity. The community compositions of the dominant bacterial species were established by analysing a total of 702 isolates from selective agar media by (GTG) 5 -PCR fingerprinting followed by gene sequencing. Most of the isolates belonged to the genera Carnobacterium, Lactobacillus, and Leuconostoc, with Leuconostoc carnosum and Leuconostoc gelidum subsp. gelidum being the most dominant members. The diversity of the dominant bacterial species varied when comparing samples from different production facilities and, in some cases, even within the same product types. Although LAB consistently dominated the microbiota of sliced cooked pork products in the Belgian market, results indicated that bacterial diversity needs to be addressed on the level of product composition and batch variation. Dedicated studies will be needed to substantiate potential links between such variability and microbial composition. For instance, the fact that higher levels of lactobacilli were associated with the presence of potassium lactate (E326) may be suggestive of selective pressure but needs to be validated, as this finding referred to a single product only. Copyright © 2017 Elsevier Ltd. All rights reserved.
Nielsen, Lene Nørby; Roager, Henrik M; Casas, Mònica Escolà; Frandsen, Henrik L; Gosewinkel, Ulrich; Bester, Kai; Licht, Tine Rask; Hendriksen, Niels Bohse; Bahl, Martin Iain
2018-02-01
Recently, concerns have been raised that residues of glyphosate-based herbicides may interfere with the homeostasis of the intestinal bacterial community and thereby affect the health of humans or animals. The biochemical pathway for aromatic amino acid synthesis (Shikimate pathway), which is specifically inhibited by glyphosate, is shared by plants and numerous bacterial species. Several in vitro studies have shown that various groups of intestinal bacteria may be differently affected by glyphosate. Here, we present results from an animal exposure trial combining deep 16S rRNA gene sequencing of the bacterial community with liquid chromatography mass spectrometry (LC-MS) based metabolic profiling of aromatic amino acids and their downstream metabolites. We found that glyphosate as well as the commercial formulation Glyfonova ® 450 PLUS administered at up to fifty times the established European Acceptable Daily Intake (ADI = 0.5 mg/kg body weight) had very limited effects on bacterial community composition in Sprague Dawley rats during a two-week exposure trial. The effect of glyphosate on prototrophic bacterial growth was highly dependent on the availability of aromatic amino acids, suggesting that the observed limited effect on bacterial composition was due to the presence of sufficient amounts of aromatic amino acids in the intestinal environment. A strong correlation was observed between intestinal concentrations of glyphosate and intestinal pH, which may partly be explained by an observed reduction in acetic acid produced by the gut bacteria. We conclude that sufficient intestinal levels of aromatic amino acids provided by the diet alleviates the need for bacterial synthesis of aromatic amino acids and thus prevents an antimicrobial effect of glyphosate in vivo. It is however possible that the situation is different in cases of human malnutrition or in production animals. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Cuzzi, Bruno; Cescutti, Paola; Furlanis, Linda; Lagatolla, Cristina; Sturiale, Luisa; Garozzo, Domenico; Rizzo, Roberto
2012-08-01
Reactive oxygen species (ROS) are part of the weapons used by the immune system to kill and degrade infecting microorganisms. Bacteria can produce macromolecules, such as polysaccharides, that are able to scavenge ROS. Species belonging to the Burkholderia cepacia complex are involved in serious lung infection in cystic fibrosis patients and produce a characteristic polysaccharide, cepacian. The interaction between ROS and bacterial polysaccharides was first investigated by killing experiments, where bacteria cells were incubated with sodium hypochlorite (NaClO) with and without prior incubation with cepacian. The results showed that the polysaccharide had a protective effect towards bacterial cells. Cepacian was then treated with different concentrations of NaClO and the course of reactions was followed by means of capillary viscometry. The degradation products were characterised by size-exclusion chromatography, NMR and mass spectrometry. The results showed that hypochlorite depolymerised cepacian, removed side chains and O-acetyl groups, but did not cleave the glycosidic bond between glucuronic acid and rhamnose. The structure of some oligomers produced by NaClO oxidation is reported.
The bacterial species definition in the genomic era
Konstantinidis, Konstantinos T; Ramette, Alban; Tiedje, James M
2006-01-01
The bacterial species definition, despite its eminent practical significance for identification, diagnosis, quarantine and diversity surveys, remains a very difficult issue to advance. Genomics now offers novel insights into intra-species diversity and the potential for emergence of a more soundly based system. Although we share the excitement, we argue that it is premature for a universal change to the definition because current knowledge is based on too few phylogenetic groups and too few samples of natural populations. Our analysis of five important bacterial groups suggests, however, that more stringent standards for species may be justifiable when a solid understanding of gene content and ecological distinctiveness becomes available. Our analysis also reveals what is actually encompassed in a species according to the current standards, in terms of whole-genome sequence and gene-content diversity, and shows that this does not correspond to coherent clusters for the environmental Burkholderia and Shewanella genera examined. In contrast, the obligatory pathogens, which have a very restricted ecological niche, do exhibit clusters. Therefore, the idea of biologically meaningful clusters of diversity that applies to most eukaryotes may not be universally applicable in the microbial world, or if such clusters exist, they may be found at different levels of distinction. PMID:17062412
Predominant bacterial species in subgingival plaque in dogs.
Dahlén, G; Charalampakis, G; Abrahamsson, I; Bengtsson, L; Falsen, E
2012-06-01
The dog has been used extensively for experimental and microbiological studies on periodontitis and peri-implantitis without detailed knowledge about the predominant flora of the subgingival plaque. This study was designed to evaluate the predominant cultivable bacterial species in dogs and compare them phenotypically and genotypically with corresponding human species. Four subgingival samples were taken from two upper premolars in each of six Labrador retrievers. The samples from each dog were processed for anaerobic culture. From the samples of each dog, the five or six predominating bacteria based on colony morphology were selected and pure cultured. Each of the strains was characterized by Gram stain, anaerobic/aerobic growth and API-ZYM test. Eighteen strains showing clear-cut phenotypic differences were further classified based on DNA sequencing technology. Cross-reactions of DNA probes from human and dog strains were also tested against a panel of both human and dog bacterial species. Thirty-one strains in the dogs were isolated and characterized. They represented 21 different species, of which six belonged to the genus Porphyromonas. No species was found consistently in the predominant flora of all six dogs. Porphyromonas crevioricanis and Fusobacterium canifelinum were the two most prevalent species in predominant flora in dogs. DNA probes from human and dog species cross-reacted to some extent with related strains from humans and dogs; however, distinct exceptions were found. The predominant cultural subgingival flora in dogs shows great similarities with the subgingival bacteria from humans at the genus level, but distinct differences at the species level; however, a genetic relatedness could be disclosed for most strains investigated. © 2011 John Wiley & Sons A/S.
Recombination-Driven Genome Evolution and Stability of Bacterial Species.
Dixit, Purushottam D; Pang, Tin Yau; Maslov, Sergei
2017-09-01
While bacteria divide clonally, horizontal gene transfer followed by homologous recombination is now recognized as an important contributor to their evolution. However, the details of how the competition between clonality and recombination shapes genome diversity remains poorly understood. Using a computational model, we find two principal regimes in bacterial evolution and identify two composite parameters that dictate the evolutionary fate of bacterial species. In the divergent regime, characterized by either a low recombination frequency or strict barriers to recombination, cohesion due to recombination is not sufficient to overcome the mutational drift. As a consequence, the divergence between pairs of genomes in the population steadily increases in the course of their evolution. The species lacks genetic coherence with sexually isolated clonal subpopulations continuously formed and dissolved. In contrast, in the metastable regime, characterized by a high recombination frequency combined with low barriers to recombination, genomes continuously recombine with the rest of the population. The population remains genetically cohesive and temporally stable. Notably, the transition between these two regimes can be affected by relatively small changes in evolutionary parameters. Using the Multi Locus Sequence Typing (MLST) data, we classify a number of bacterial species to be either the divergent or the metastable type. Generalizations of our framework to include selection, ecologically structured populations, and horizontal gene transfer of nonhomologous regions are discussed as well. Copyright © 2017 by the Genetics Society of America.
Bhatnagar, Srijak; Eisen, Jonathan A.; Kopp, Artyom
2011-01-01
Drosophila melanogaster is emerging as an important model of non-pathogenic host–microbe interactions. The genetic and experimental tractability of Drosophila has led to significant gains in our understanding of animal–microbial symbiosis. However, the full implications of these results cannot be appreciated without the knowledge of the microbial communities associated with natural Drosophila populations. In particular, it is not clear whether laboratory cultures can serve as an accurate model of host–microbe interactions that occur in the wild, or those that have occurred over evolutionary time. To fill this gap, we characterized natural bacterial communities associated with 14 species of Drosophila and related genera collected from distant geographic locations. To represent the ecological diversity of Drosophilids, examined species included fruit-, flower-, mushroom-, and cactus-feeders. In parallel, wild host populations were compared to laboratory strains, and controlled experiments were performed to assess the importance of host species and diet in shaping bacterial microbiome composition. We find that Drosophilid flies have taxonomically restricted bacterial communities, with 85% of the natural bacterial microbiome composed of only four bacterial families. The dominant bacterial taxa are widespread and found in many different host species despite the taxonomic, ecological, and geographic diversity of their hosts. Both natural surveys and laboratory experiments indicate that host diet plays a major role in shaping the Drosophila bacterial microbiome. Despite this, the internal bacterial microbiome represents only a highly reduced subset of the external bacterial communities, suggesting that the host exercises some level of control over the bacteria that inhabit its digestive tract. Finally, we show that laboratory strains provide only a limited model of natural host–microbe interactions. Bacterial taxa used in experimental studies are rare or absent in
The effects of micronutrient deficiencies on bacterial species from the human gut microbiota
Hibberd, Matthew C.; Wu, Meng; Rodionov, Dmitry A.; Li, Xiaoqing; Cheng, Jiye; Griffin, Nicholas W.; Barratt, Michael J.; Giannone, Richard J.; Hettich, Robert L.; Osterman, Andrei L.; Gordon, Jeffrey I.
2017-01-01
Vitamin and mineral (micronutrient) deficiencies afflict two billion people. While the impact of these imbalances on host biology has been studied extensively, much less is known about their effects on the gut microbiota of developing or adult humans. Therefore, we established a community of cultured, sequenced human gut-derived bacterial species in gnotobiotic mice and fed the animals a defined micronutrient-sufficient diet, followed by a derivative diet devoid of vitamin A, folate, iron or zinc, followed by return to the sufficient diet. Acute vitamin A deficiency had the largest effect on bacterial community structure and meta-transcriptome, with Bacteroides vulgatus, a prominent responder, increasing its abundance in the absence of vitamin A. Applying retinol selection to a library of 30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Genetic complementation studies, microbial RNA-Seq, and transcription factor binding assays disclosed that AcrR is a repressor of an adjacent AcrAB-TolC efflux system. Retinol efflux measurements in wildtype and acrR-mutant strains plus treatment with a pharmacologic inhibitor of the efflux system, revealed that AcrAB-TolC is a determinant of retinol and bile acid sensitivity in B. vulgatus. Acute vitamin A deficiency was associated with altered bile acid metabolism in vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness of B. vulgatus and perhaps other microbiota members. This type of preclinical model can help to develop mechanistic insights about and more effective treatment strategies for micronutrient deficiencies. PMID:28515336
Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Jürgen
2013-01-01
Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance. PMID:24025239
Tamrakar, Renuka; Yamada, Takashi; Furuta, Itsuko; Cho, Kazutoshi; Morikawa, Mamoru; Yamada, Hideto; Sakuragi, Noriaki; Minakami, Hisanori
2007-01-01
Background Bacterial vaginosis (BV), the etiology of which is still uncertain, increases the risk of preterm birth. Recent PCR-based studies suggested that BV is associated with complex vaginal bacterial communities, including many newly recognized bacterial species in non-pregnant women. Methods To examine whether these bacteria are also involved in BV in pregnant Japanese women, vaginal fluid samples were taken from 132 women, classified as normal (n = 98), intermediate (n = 21), or BV (n = 13) using the Nugent gram stain criteria, and studied. DNA extracted from these samples was analyzed for bacterial sequences of any Lactobacillus, four Lactobacillus species, and four BV-related bacteria by PCR with primers for 16S ribosomal DNA including a universal Lactobacillus primer, Lactobacillus species-specific primers for L. crispatus, L. jensenii, L. gasseri, and L. iners, and BV-related bacterium-specific primers for BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Results The prevalences of L. crispatus, L. jensenii, and L. gasseri were significantly higher, while those of BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium were significantly lower in the normal group than in the BV group. Unlike other Lactobacillus species, the prevalence of L. iners did not differ between the three groups and women with L. iners were significantly more likely to have BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium. Linear regression analysis revealed associations of BVAB2 and Megasphaera with Nugent score, and multivariate regression analyses suggested a close relationship between Eggerthella-like bacterium and BV. Conclusion The BV-related bacteria, including BVAB2, Megasphaera, Leptotrichia, and Eggerthella-like bacterium, are common in the vagina of pregnant Japanese women with BV. The presence of L. iners may be correlated with vaginal colonization by these BV-related bacteria. PMID:17986357
Coral-associated bacterial diversity is conserved across two deep-sea Anthothela species
Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C; Clostio, Rachel W; Brooke, Sandra D.; Ross, Steve W.
2016-01-01
Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4-V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont.
Plants of the fynbos biome harbour host species-specific bacterial communities.
Miyambo, Tsakani; Makhalanyane, Thulani P; Cowan, Don A; Valverde, Angel
2016-08-01
The fynbos biome in South Africa is globally recognised as a plant biodiversity hotspot. However, very little is known about the bacterial communities associated with fynbos plants, despite interactions between primary producers and bacteria having an impact on the physiology of both partners and shaping ecosystem diversity. This study reports on the structure, phylogenetic composition and potential roles of the endophytic bacterial communities located in the stems of three fynbos plants (Erepsia anceps, Phaenocoma prolifera and Leucadendron laureolum). Using Illumina MiSeq 16S rRNA sequencing we found that different subpopulations of Deinococcus-Thermus, Alphaproteobacteria, Acidobacteria and Firmicutes dominated the endophytic bacterial communities. Alphaproteobacteria and Actinobacteria were prevalent in P. prolifera, whereas Deinococcus-Thermus dominated in L. laureolum, revealing species-specific host-bacteria associations. Although a high degree of variability in the endophytic bacterial communities within hosts was observed, we also detected a core microbiome across the stems of the three plant species, which accounted for 72% of the sequences. Altogether, it seems that both deterministic and stochastic processes shaped microbial communities. Endophytic bacterial communities harboured putative plant growth-promoting bacteria, thus having the potential to influence host health and growth. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Scholz, Christian F P; Jensen, Anders
2017-01-01
The protocol describes a computational method to develop a Single Locus Sequence Typing (SLST) scheme for typing bacterial species. The resulting scheme can be used to type bacterial isolates as well as bacterial species directly from complex communities using next-generation sequencing technologies.
Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China.
Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda
2016-01-01
The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments.
Bacterial Communities in the Rhizospheres of Three Mangrove Tree Species from Beilun Estuary, China
Wu, Peng; Xiong, Xiaofei; Xu, Zhanzhou; Lu, Chuqian; Cheng, Hao; Lyu, Xiangli; Zhang, Jinghuai; He, Wei; Deng, Wei; Lyu, Yihua; Lou, Quansheng; Hong, Yiguo; Fang, Hongda
2016-01-01
The bacterial communities played important roles in the high productivity mangrove ecosystem. In this study, we investigated the vertical distributions of rhizosphere bacteria from three mangrove species (Bruguiera gymnorrhiza, Kandelia candel and Aegiceras corniculatum) in Beilun Estuary, China using high throughput DNA pyrosequencing of the 16S rRNA gene. Phylogenetic analysis showed that bacterial communities from mangrove rhizosphere sediments were dominated by Proteobacteria (mostly Deltaproteobacteria and Gammaproteobacteria), followed by Chloroflexi, Bacteroidetes, Planctomycetes and Acidobacteria. However, the ANOVA analysis on Shannon and Chao1 indices indicated that bacterial communities among sediments of the three mangrove species varied more strongly than the sampling depths. In addition, the PCA result demonstrated that the bacterial communities could be separated into three groups according to the mangrove species. Moreover, the dominated orders Rhodospirillales, GCA004 and envOPS12 were significantly different among sediments of the three mangrove species. The results of this study provided valuable information about the distribution feature of rhizosphere bacteria from Chinese mangrove plants and shed insights into biogeochemical transformations driven by bacteria in rhizosphere sediments. PMID:27695084
Dione, N; Khelaifia, S; La Scola, B; Lagier, J C; Raoult, D
2016-01-01
In the mid-19th century, the dichotomy between aerobic and anaerobic bacteria was introduced. Nevertheless, the aerobic growth of strictly anaerobic bacterial species such as Ruminococcus gnavus and Fusobacterium necrophorum, in a culture medium containing antioxidants, was recently demonstrated. We tested aerobically the culture of 623 bacterial strains from 276 bacterial species including 82 strictly anaerobic, 154 facultative anaerobic, 31 aerobic and nine microaerophilic bacterial species as well as ten fungi. The basic culture medium was based on Schaedler agar supplemented with 1 g/L ascorbic acid and 0.1 g/L glutathione (R-medium). We successively optimized this media, adding 0.4 g/L uric acid, using separate autoclaving of the component, or adding haemin 0.1 g/L or α-ketoglutarate 2 g/L. In the basic medium, 237 bacterial species and ten fungal species grew but with no growth of 36 bacterial species, including 22 strict anaerobes. Adding uric acid allowed the growth of 14 further species including eight strict anaerobes, while separate autoclaving allowed the growth of all tested bacterial strains. To extend its potential use for fastidious bacteria, we added haemin for Haemophilus influenzae, Haemophilus parainfluenzae and Eikenella corrodens and α-ketoglutarate for Legionella pneumophila. This medium allowed the growth of all tested strains with the exception of Mycobacterium tuberculosis and Mycobacterium bovis. Testing primoculture and more fastidious species will constitute the main work to be done, but R-medium coupled with a rapid identification method (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) will facilitate the anaerobic culture in clinical microbiology laboratories. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.
Amylolytic bacterial lactic acid fermentation - a review.
Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay
2008-01-01
Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.
The effects of micronutrient deficiencies on bacterial species from the human gut microbiota.
Hibberd, Matthew C; Wu, Meng; Rodionov, Dmitry A; Li, Xiaoqing; Cheng, Jiye; Griffin, Nicholas W; Barratt, Michael J; Giannone, Richard J; Hettich, Robert L; Osterman, Andrei L; Gordon, Jeffrey I
2017-05-17
Vitamin and mineral (micronutrient) deficiencies afflict 2 billion people. Although the impact of these imbalances on host biology has been studied extensively, much less is known about their effects on the gut microbiota of developing or adult humans. Therefore, we established a community of cultured, sequenced human gut-derived bacterial species in gnotobiotic mice and fed the animals a defined micronutrient-sufficient diet, followed by a derivative diet devoid of vitamin A, folate, iron, or zinc, followed by return to the sufficient diet. Acute vitamin A deficiency had the largest effect on bacterial community structure and metatranscriptome, with Bacteroides vulgatus, a prominent responder, increasing its abundance in the absence of vitamin A. Applying retinol selection to a library of 30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Genetic complementation studies, microbial RNA sequencing, and transcription factor-binding assays disclosed that AcrR is a repressor of an adjacent AcrAB-TolC efflux system. Retinol efflux measurements in wild-type and acrR -mutant strains plus treatment with a pharmacologic inhibitor of the efflux system revealed that AcrAB-TolC is a determinant of retinol and bile acid sensitivity in B. vulgatus Acute vitamin A deficiency was associated with altered bile acid metabolism in vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness of B. vulgatus and perhaps other microbiota members. This type of preclinical model can help to develop mechanistic insights about the effects of, and more effective treatment strategies for micronutrient deficiencies. Copyright © 2017, American Association for the Advancement of Science.
Desgarennes, Damaris; Garrido, Etzel; Torres-Gomez, Miryam J; Peña-Cabriales, Juan J; Partida-Martinez, Laila P
2014-12-01
Agaves are major biotic resources in arid and semi-arid ecosystems. Despite their ecological, economical and cultural relevance, many aspects of the microbial communities associated with agaves are still unknown. Here, we investigated the bacterial communities associated with two Agave species by 16S rRNA- Denaturing gradient gel electrophoresis fingerprinting and sequencing. We also evaluated the effects of biotic and abiotic factors in the structure of the bacterial communities. In parallel, we isolated and characterized diazotrophic bacteria associated with agaves, as Agave soils are characterized by their low nitrogen content. Our results demonstrate that in Agave, the structure of prokaryotic assemblages was mostly influenced by the community group, where the soil, episphere, and endosphere were clearly distinct. Proteobacteria (γ and α), Actinobacteria, and Acidobacteria were the dominant phyla. Bacterial communities in the episphere of agaves were mainly influenced by the host species, whereas in the endosphere were affected by the season. Fifteen bacterial taxa were common and abundant in the endosphere of both Agave species during the dry season. Notably, some of the confirmed diazotrophic strains belonged to this group, suggesting a possible beneficial role in planta. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
McDonald, Nathan D; Lubin, Jean-Bernard; Chowdhury, Nityananda; Boyd, E Fidelma
2016-04-12
A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota.Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. Sialic acids are nine carbon amino sugars that are abundant on all mucous surfaces. The deadly human pathogen Vibrio cholerae contains
Coral-Associated Bacterial Diversity Is Conserved across Two Deep-Sea Anthothela Species
Lawler, Stephanie N.; Kellogg, Christina A.; France, Scott C.; Clostio, Rachel W.; Brooke, Sandra D.; Ross, Steve W.
2016-01-01
Cold-water corals, similar to tropical corals, contain diverse and complex microbial assemblages. These bacteria provide essential biological functions within coral holobionts, facilitating increased nutrient utilization and production of antimicrobial compounds. To date, few cold-water octocoral species have been analyzed to explore the diversity and abundance of their microbial associates. For this study, 23 samples of the family Anthothelidae were collected from Norfolk (n = 12) and Baltimore Canyons (n = 11) from the western Atlantic in August 2012 and May 2013. Genetic testing found that these samples comprised two Anthothela species (Anthothela grandiflora and Anthothela sp.) and Alcyonium grandiflorum. DNA was extracted and sequenced with primers targeting the V4–V5 variable region of the 16S rRNA gene using 454 pyrosequencing with GS FLX Titanium chemistry. Results demonstrated that the coral host was the primary driver of bacterial community composition. Al. grandiflorum, dominated by Alteromonadales and Pirellulales had much higher species richness, and a distinct bacterial community compared to Anthothela samples. Anthothela species (A. grandiflora and Anthothela sp.) had very similar bacterial communities, dominated by Oceanospirillales and Spirochaetes. Additional analysis of core-conserved bacteria at 90% sample coverage revealed genus level conservation across Anthothela samples. This core included unclassified Oceanospirillales, Kiloniellales, Campylobacterales, and genus Spirochaeta. Members of this core were previously recognized for their functional capabilities in nitrogen cycling and suggest the possibility of a nearly complete nitrogen cycle within Anthothela species. Overall, many of the bacterial associates identified in this study have the potential to contribute to the acquisition and cycling of nutrients within the coral holobiont. PMID:27092120
NASA Astrophysics Data System (ADS)
Wemheuer, Franziska; Kaiser, Kristin; Karlovsky, Petr; Daniel, Rolf; Vidal, Stefan; Wemheuer, Bernd
2017-01-01
Endophytic bacteria are critical for plant growth and health. However, compositional and functional responses of bacterial endophyte communities towards agricultural practices are still poorly understood. Hence, we analyzed the influence of fertilizer application and mowing frequency on bacterial endophytes in three agriculturally important grass species. For this purpose, we examined bacterial endophytic communities in aerial plant parts of Dactylis glomerata L., Festuca rubra L., and Lolium perenne L. by pyrotag sequencing of bacterial 16S rRNA genes over two consecutive years. Although management regimes influenced endophyte communities, observed responses were grass species-specific. This might be attributed to several bacteria specifically associated with a single grass species. We further predicted functional profiles from obtained 16S rRNA data. These profiles revealed that predicted abundances of genes involved in plant growth promotion or nitrogen metabolism differed between grass species and between management regimes. Moreover, structural and functional community patterns showed no correlation to each other indicating that plant species-specific selection of endophytes is driven by functional rather than phylogenetic traits. The unique combination of 16S rRNA data and functional profiles provided a holistic picture of compositional and functional responses of bacterial endophytes in agricultural relevant grass species towards management practices.
Madsen, Anne Mette; Alwan, Taif; Ørberg, Anders; Uhrbrand, Katrine; Jørgensen, Marie Birk
2016-01-01
A large number of people work with garbage collection, and exposure to microorganisms is considered an occupational health problem. However, knowledge on microbial exposure at species level is limited. The aim of the study was to achieve knowledge on waste collectors’ exposure to airborne inhalable fungal and bacterial species during waste collection with focus on the transport of airborne microorganisms into the truck cab. Airborne microorganisms were collected with samplers mounted in the truck cab, on the workers’ clothes, and outdoors. Fungal and bacterial species were quantified and identified. The study showed that the workers were exposed to between 112 and 4.8×104 bacteria m−3 air and 326 and 4.6×104 fungi m−3 air. The personal exposures to bacteria and fungi were significantly higher than the concentrations measured in the truck cabs and in the outdoor references. On average, the fungal and bacterial concentrations in truck cabs were 111 and 7.7 times higher than outdoor reference measurements. In total, 23 fungal and 38 bacterial species were found and identified. Most fungal species belonged to the genus Penicillium and in total 11 Penicillium species were found. Identical fungal species were often found both in a personal sample and in the same person’s truck cab, but concentrations were on average 27 times higher in personal samples. Concentrations of fungal and bacterial species found only in the personal samples were lower than concentrations of species also found in truck cabs. Skin-related bacteria constituted a large fraction of bacterial isolates found in personal and truck cab samples. In total, six Staphylococcus species were found. In outdoor samples, no skin-related bacteria were found. On average, concentrations of bacterial species found both in the truck cab and personal samples were 77 times higher in personal samples than in truck cab samples. In conclusion, high concentrations of fungi were found in truck cabs, but the
Servais, P
1995-03-01
In aquatic ecosystems, [(3)H]thymidine incorporation into bacterial DNA and [(3)H]leucine incorporation into proteins are usually used to estimate bacterial production. The incorporation rates of four amino acids (leucine, tyrosine, lysine, alanine) into proteins of bacteria were measured in parallel on natural freshwater samples from the basin of the river Meuse (Belgium). Comparison of the incorporation into proteins and into the total macromolecular fraction showed that these different amino acids were incorporated at more than 90% into proteins. From incorporation measurements at four subsaturated concentrations (range, 2-77 nm), the maximum incorporation rates were determined. Strong correlations (r > 0.91 for all the calculated correlations) were found between the maximum incorporation rates of the different tested amino acids over a range of two orders of magnitude of bacterial activity. Bacterial production estimates were calculated using theoretical and experimental conversion factors. The productions calculated from the incorporation rates of the four amino acids were in good concordance, especially when the experimental conversion factors were used (slope range, 0.91-1.11, and r > 0.91). This study suggests that the incorporation of various amino acids into proteins can be used to estimate bacterial production.
Temporal changes in species interactions in simple aquatic bacterial communities
2012-01-01
Background Organisms modify their environment and in doing so change the quantity and possibly the quality of available resources. Due to the two-way relationship between organisms and their resource environment, and the complexity it brings to biological communities, measuring species interactions reliably in any biological system is a challenging task. As the resource environment changes, the intensity and even the sign of interactions may vary in time. We used Serratia marcescens and Novosphingobium capsulatum bacteria to study how the interaction between resource environment and organisms influence the growth of the bacterial species during circa 200 generations. We used a sterile-filtering method to measure how changes in resource environment are reflected in growth rates of the two species. Results Changes in the resource environment caused complex time and species composition-dependent effects on bacterial growth performance. Variation in the quality of the growth medium indicated existence of temporally fluctuating within-species facilitation and inhibition, and between-species asymmetric facilitation. Conclusions The interactions between the community members could not be fully predicted based only on the knowledge of the growth performance of each member in isolation. Growth dynamics in sterile-filtered samples of the conditioned growth medium can reveal both biologically meaningful changes in resource availability and temporally changing facilitative resource-mediated interactions between study species. This is the first study we are aware of where the filter-sterilization – growth assay method is applied to study the effect of long-term changes in the environment on species interactions. PMID:22984961
Teles, F.R.F.; Teles, R.P.; Siegelin, Y.; Paster, B.; Haffajee, A.D.; Socransky, S.S.
2010-01-01
SUMMARY Approximately 35% of the species present in subgingival biofilms are as yet uncultivated, so their role in periodontal pathogenesis is unknown. The aim of the present study was to develop a high throughput method to quantify a wide range of cultivated and uncultivated taxa in subgingival biofilm samples associated with periodontal disease or health. Oligonucleotides targeting the 16S ribosomal DNA gene were designed, synthesized and labeled with digoxigenin. These probes were hybridized with the total nucleic acids of pure cultures or subgingival biofilm samples. Target species included cultivated taxa associated with periodontal health and disease, as well as uncultivated species, such as TM7 sp OT 346, Mitsuokella sp. OT 131 and Desulfobulbus sp. OT 041. Sensitivity and specificity of the probes were determined. A Universal probe was used to assess total bacterial load. Sequences complementary to the probes were used as standards for quantification. Chemiluminescent signals were visualized after film exposure or using a CCD camera. In a pilot clinical study, 266 subgingival plaque samples from eight periodontally healthy people and 11 patients with periodontitis were examined. Probes were specific and sensitivity reached 104 cells. Fusobacterium nucleatum ss polymorphum and Actinomyces gerencseriae were the most abundant cultivated taxa in clinical samples. Among uncultivated/unrecognized species, Mitsuokella sp. OT 131 and Prevotella sp. OT 306 were the most numerous. Porphyromonas gingivalis and Desulfobulbus sp. OT 041 were only detected in patients with periodontitis. Direct hybridization of total nucleic acids using oligonucleotide probes permitted the quantification of multiple cultivated and uncultivated taxa in mixed species biofilm samples. PMID:21375703
Bacterial, Archaeal, and Eukaryotic Diversity across Distinct Microhabitats in an Acid Mine Drainage
Mesa, Victoria; Gallego, Jose L. R.; González-Gil, Ricardo; Lauga, Béatrice; Sánchez, Jesús; Méndez-García, Celia; Peláez, Ana I.
2017-01-01
Acid mine drainages are characterized by their low pH and the presence of dissolved toxic metallic species. Microorganisms survive in different microhabitats within the ecosystem, namely water, sediments, and biofilms. In this report, we surveyed the microbial diversity within all domains of life in the different microhabitats at Los Rueldos abandoned mercury underground mine (NW Spain), and predicted bacterial function based on community composition. Sediment samples contained higher proportions of soil bacteria (AD3, Acidobacteria), as well as Crenarchaeota and Methanomassiliicoccaceae archaea. Oxic and hypoxic biofilm samples were enriched in bacterial iron oxidizers from the genus Leptospirillum, order Acidithiobacillales, class Betaproteobacteria, and archaea from the class Thermoplasmata. Water samples were enriched in Cyanobacteria and Thermoplasmata archaea at a 3–98% of the sunlight influence, whilst Betaproteobacteria, Thermoplasmata archaea, and Micrarchaea dominated in acid water collected in total darkness. Stalactites hanging from the Fe-rich mine ceiling were dominated by the neutrophilic iron oxidizer Gallionella and other lineages that were absent in the rest of the microhabitats (e.g., Chlorobi, Chloroflexi). Eukaryotes were detected in biofilms and open-air water samples, and belonged mainly to clades SAR (Alveolata and Stramenopiles), and Opisthokonta (Fungi). Oxic and hypoxic biofilms displayed higher proportions of ciliates (Gonostomum, Oxytricha), whereas water samples were enriched in fungi (Paramicrosporidium and unknown microbial Helotiales). Predicted function through bacterial community composition suggested adaptive evolutive convergence of function in heterogeneous communities. Our study showcases a broad description of the microbial diversity across different microhabitats in the same environment and expands the knowledge on the diversity of microbial eukaryotes in AMD habitats. PMID:28955322
Acidic pH sensing in the bacterial cytoplasm is required for Salmonella virulence.
Choi, Jeongjoon; Groisman, Eduardo A
2016-09-01
pH regulates gene expression, biochemical activities and cellular behaviors. A mildly acidic pH activates the master virulence regulatory system PhoP/PhoQ in the facultative intracellular pathogen Salmonella enterica serovar Typhimurium. The sensor PhoQ harbors an extracytoplasmic domain implicated in signal sensing, and a cytoplasmic domain controlling activation of the regulator PhoP. We now report that, surprisingly, a decrease in Salmonella's own cytoplasmic pH induces transcription of PhoP-activated genes even when the extracytoplasmic pH remains neutral. Amino acid substitutions in PhoQ's cytoplasmic domain hindered activation by acidic pH and attenuated virulence in mice, but did not abolish activation by low Mg(2+) or the antimicrobial peptide C18G. Conversely, removal of PhoQ's extracytoplasmic domains prevented the response to the latter PhoQ-activating signals but not to acidic pH. PhoP-dependent genes were minimally induced by acidic pH in the non-pathogenic species Salmonella bongori but were activated by low Mg(2+) and C18G as in pathogenic S. enterica. Our findings indicate that the sensor PhoQ enables S. enterica to respond to both host- and bacterial-derived signals that alter its cytoplasmic pH. © 2016 John Wiley & Sons Ltd.
Positive and negative associations between bacterial species in dental root canals.
Gomes, B P; Drucker, D B; Lilley, J D
1994-01-01
Significant associations have been previously reported between certain pairs of bacterial species isolated from human dental root canals. The aim of this study was to examine microbiologically a more extensive series of cases, with particular reference to obligate anaerobes which accounted for 64% of total isolations. A total of 65 different species was isolated and individual root canals yielded a maximum of eleven bacterial species. Highly significant positive associations (p < 0.001) were found between Peptostreptococcus spp. and Prevotella spp., between Peptostreptococcus spp. and P. melaninogenica, between P. micros and Prevotella spp., P. micros and P. melaninogenica and between Prevotella spp. and Eubacterium spp., all with an ODDS ratio of > 9.0. In contrast, negative and highly significant associations (p < 0.01) were found only between the four species pairs: B. vulgatus/F. necrophorum, P. magnus/Bifidobacterium spp., B. gracilis/F. nucleatum and between B. gracilis/Fusobacterium spp.; all with an ODDS ratio of < 0.5. Some previously published associations were confirmed and some new associations were found, while some negative associations became apparent.
Proteome analysis of Arabidopsis seedlings exposed to bacterial volatiles.
Kwon, Young Sang; Ryu, Choong-Min; Lee, Soohyun; Park, Hyo Bee; Han, Ki Soo; Lee, Jung Han; Lee, Kyunghee; Chung, Woo Sik; Jeong, Mi-Jeong; Kim, Hee Kyu; Bae, Dong-Won
2010-11-01
Plant root-associated bacteria (rhizobacteria) elicit plant basal immunity referred to as induced systemic resistance (ISR) against multiple pathogens. Among multi-bacterial determinants involving such ISR, the induction of ISR and promotion of growth by bacterial volatile compounds was previously reported. To exploit global de novo expression of plant proteins by bacterial volatiles, proteomic analysis was performed after exposure of Arabidopsis plants to the rhizobacterium Bacillus subtilis GB03. Ethylene biosynthesis enzymes were significantly up-regulated. Analysis by quantitative reverse transcriptase polymerase chain reaction confirmed that ethylene biosynthesis-related genes SAM-2, ACS4, ACS12, and ACO2 as well as ethylene response genes, ERF1, GST2, and CHIB were up-regulated by the exposure to bacterial volatiles. More interestingly, the emission of bacterial volatiles significantly up-regulated both key defense mechanisms mediated by jasmonic acid and salicylic acid signaling pathways. In addition, high accumulation of antioxidant proteins also provided evidence of decreased sensitivity to reactive oxygen species during the elicitation of ISR by bacterial volatiles. The present results suggest that the proteomic analysis of plant defense responses in bacterial volatile-mediated ISR can reveal the mechanisms of plant basal defenses orchestrated by endogenous ethylene production pathways and the generation of reactive oxygen species.
NASA Astrophysics Data System (ADS)
Ghebremedhin, Meron; Yesupriya, Shubha; Luka, Janos; Crane, Nicole J.
2015-03-01
Recent studies have demonstrated the potential advantages of the use of Raman spectroscopy in the biomedical field due to its rapidity and noninvasive nature. In this study, Raman spectroscopy is applied as a method for differentiating between bacteria isolates for Gram status and Genus species. We created models for identifying 28 bacterial isolates using spectra collected with a 785 nm laser excitation Raman spectroscopic system. In order to investigate the groupings of these samples, partial least squares discriminant analysis (PLSDA) and hierarchical cluster analysis (HCA) was implemented. In addition, cluster analyses of the isolates were performed using various data types consisting of, biochemical tests, gene sequence alignment, high resolution melt (HRM) analysis and antimicrobial susceptibility tests of minimum inhibitory concentration (MIC) and degree of antimicrobial resistance (SIR). In order to evaluate the ability of these models to correctly classify bacterial isolates using solely Raman spectroscopic data, a set of 14 validation samples were tested using the PLSDA models and consequently the HCA models. External cluster evaluation criteria of purity and Rand index were calculated at different taxonomic levels to compare the performance of clustering using Raman spectra as well as the other datasets. Results showed that Raman spectra performed comparably, and in some cases better than, the other data types with Rand index and purity values up to 0.933 and 0.947, respectively. This study clearly demonstrates that the discrimination of bacterial species using Raman spectroscopic data and hierarchical cluster analysis is possible and has the potential to be a powerful point-of-care tool in clinical settings.
Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.
Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia
2011-06-01
The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves. Copyright © 2011 Elsevier Ltd. All rights reserved.
Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios
2011-01-01
The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis. PMID:21926202
Li, Huan; Li, Tongtong; Tu, Bo; Kou, Yongping; Li, Xiangzhen
2017-07-01
The mammalian stomach acts as an important barrier against ingested pathogens into the entire gastrointestinal tract, thereby playing a key role in host health. However, little is known regarding to the stomach microbial compositions in wild mammals and the factors that may influence the community compositions. Using high-throughput sequencing of the 16S rRNA gene, we characterized the stomach bacterial community compositions, diversity, and interactions in two common pika (Ochotona sp.) species in China, including Plateau pikas (Ochotona curzoniae) and Daurian pikas (Ochotona daurica) living in the Qinghai-Tibet Plateau and the Inner Mongolia Grassland, respectively. The bacterial communities can be divided into two distinct phylogenetic clusters. The most dominant bacteria in cluster I were unclassified bacteria. Cluster II was more diverse, predominantly consisting of Bacteroidetes, followed by unclassified bacteria, Firmicutes and Proteobacteria. Three dominant genera (Prevotella, Oscillospira, and Ruminococcus) in pika stomachs were significantly enriched in cluster II. In addition, seasons, host species, and sampling sites as well as body weight and sex had no significant impacts on the composition and diversity of pika stomach communities. Interestingly, Plateau pikas harbored a more complex bacterial network than Daurian pikas, and these two pika species showed different co-occurrence patterns. These results suggested that the pika stomach harbors a diverse but relatively stable and unique bacterial community, which is independent on host (host species, body weight, and sex) and measured environmental factors (sampling sites and seasons). Interestingly, host species shapes the microbial interactions rather than diversity of stomach bacterial communities in pikas, reflecting specific niche adaptation of stomach bacterial communities through species interactions.
NASA Astrophysics Data System (ADS)
Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik
2016-02-01
Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.
Massive Infection of Seabird Ticks with Bacterial Species Related to Coxiella burnetii
Dietrich, Muriel; Lebarbenchon, Camille; Jaeger, Audrey; Le Rouzic, Céline; Bastien, Matthieu; Lagadec, Erwan; McCoy, Karen D.; Pascalis, Hervé; Le Corre, Matthieu; Dellagi, Koussay; Tortosa, Pablo
2014-01-01
Seabird ticks are known reservoirs of bacterial pathogens of medical importance; however, ticks parasitizing tropical seabirds have received less attention than their counterparts from temperate and subpolar regions. Recently, Rickettsia africae was described to infect seabird ticks of the western Indian Ocean and New Caledonia, constituting the only available data on bacterial pathogens associated with tropical seabird tick species. Here, we combined a pyrosequencing-based approach with a classical molecular analysis targeting bacteria of potential medical importance in order to describe the bacterial community in two tropical seabird ticks, Amblyomma loculosum and Carios (Ornithodoros) capensis. We also investigated the patterns of prevalence and host specificity within the biogeographical context of the western Indian Ocean islands. The bacterial community of the two tick species was characterized by a strong dominance of Coxiella and Rickettsia. Our data support a strict Coxiella-host tick specificity, a pattern resembling the one found for Rickettsia spp. in the same two seabird tick species. Both the high prevalence and stringent host tick specificity suggest that these bacteria may be tick symbionts with probable vertical transmission. Detailed studies of the pathogenicity of these bacteria will now be required to determine whether horizontal transmission can occur and to clarify their status as potential human pathogens. More generally, our results show that the combination of next generation sequencing with targeted detection/genotyping approaches proves to be efficient in poorly investigated fields where research can be considered to be starting from scratch. PMID:24657860
Delavat, François; Lett, Marie-Claire; Lièvremont, Didier
2013-10-01
Acid mine drainages (AMDs) are often thought to harbour low biodiversity, yet little is known about the diversity distribution along the drainages. Using culture-dependent approaches, the microbial diversity from the Carnoulès AMD sediment was investigated for the first time along a transect showing progressive environmental stringency decrease. In total, 20 bacterial genera were detected, highlighting a higher bacterial diversity than previously thought. Moreover, this approach led to the discovery of 16 yeast species, demonstrating for the first time the presence of this important phylogenetic group in this AMD. All in all, the location of the microbes along the transect helps to better understand their distribution in a pollution gradient. Copyright © 2013 Elsevier B.V. All rights reserved.
Lewis, Amanda L; Hensler, Mary E; Varki, Ajit; Nizet, Victor
2006-04-21
Nearly two dozen microbial pathogens have surface polysaccharides or lipo-oligosaccharides that contain sialic acid (Sia), and several Sia-dependent virulence mechanisms are known to enhance bacterial survival or result in host tissue injury. Some pathogens are also known to O-acetylate their Sias, although the role of this modification in pathogenesis remains unclear. We report that neuD, a gene located within the Group B Streptococcus (GBS) Sia biosynthetic gene cluster, encodes a Sia O-acetyltransferase that is itself required for capsular polysaccharide (CPS) sialylation. Homology modeling and site-directed mutagenesis identified Lys-123 as a critical residue for Sia O-acetyltransferase activity. Moreover, a single nucleotide polymorphism in neuD can determine whether GBS displays a "high" or "low" Sia O-acetylation phenotype. Complementation analysis revealed that Escherichia coli K1 NeuD also functions as a Sia O-acetyltransferase in GBS. In fact, NeuD homologs are commonly found within Sia biosynthetic gene clusters. A bioinformatic approach identified 18 bacterial species with a Sia biosynthetic gene cluster that included neuD. Included in this list are the sialylated human pathogens Legionella pneumophila, Vibrio parahemeolyticus, Pseudomonas aeruginosa, and Campylobacter jejuni, as well as an additional 12 bacterial species never before analyzed for Sia expression. Phylogenetic analysis shows that NeuD homologs of sialylated pathogens share a common evolutionary lineage distinct from the poly-Sia O-acetyltransferase of E. coli K1. These studies define a molecular genetic approach for the selective elimination of GBS Sia O-acetylation without concurrent loss of sialylation, a key to further studies addressing the role(s) of this modification in bacterial virulence.
Ding, Tao; Melcher, Ulrich
2016-01-01
Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant’s growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species. PMID:26974817
Ding, Tao; Melcher, Ulrich
2016-01-01
Bacteria are known to be associated endophytically with plants. Research on endophytic bacteria has identified their importance in food safety, agricultural production and phytoremediation. However, the diversity of endophytic bacterial communities and the forces that shape their compositions in non-cultivated plants are largely uncharacterized. In this study, we explored the diversity, community structure, and dynamics of endophytic bacteria in different plant species in the Tallgrass Prairie Preserve of northern Oklahoma, USA. High throughput sequencing of amplified segments of bacterial rDNA from 81 samples collected at four sampling times from five plant species at four locations identified 335 distinct OTUs at 97% sequence similarity, representing 16 phyla. Proteobacteria was the dominant phylum in the communities, followed by the phyla Bacteriodetes and Actinobacteria. Bacteria from four classes of Proteobacteria were detected with Alphaproteobacteria as the dominant class. Analysis of molecular variance revealed that host plant species and collecting date had significant influences on the compositions of the leaf endophytic bacterial communities. The proportion of Alphaproteobacteria was much higher in the communities from Asclepias viridis than from other plant species and differed from month to month. The most dominant bacterial groups identified in LDA Effect Size analysis showed host-specific patterns, indicating mutual selection between host plants and endophytic bacteria and that leaf endophytic bacterial compositions were dynamic, varying with the host plant's growing season in three distinct patterns. In summary, next generation sequencing has revealed variations in the taxonomic compositions of leaf endophytic bacterial communities dependent primarily on the nature of the plant host species.
NASA Technical Reports Server (NTRS)
Belay, Tesfaye; Aviles, Hernan; Vance, Monique; Fountain, Kimberly; Sonnenfeld, Gerald
2003-01-01
The purpose of this study was to examine the effects of catecholamines on in vitro growth of a range of bacterial species, including anaerobes. Bacteria tested included: Porphyromonas gingivalis, Bacteriodes fragilis, Shigella boydii, Shigella sonnie, Enterobacter Sp, and Salmonella choleraesuis. The results of the current study indicated that supplementation of bacterial cultures in minimal medium with norepinephrine or epinephrine did not result in increased growth of bacteria. Positive controls involving treatment of Escherichia coli with catecholamines did result in increased growth of that bacterial species. The results of the present study extend previous observations that showed differential capability of catecholamines to enhance bacterial growth in vitro.
Chou, Lee Yiung; Clarke, Charles M; Dykes, Gary A
2014-10-01
Nepenthes pitcher plants produce modified jug-shaped leaves to attract, trap and digest insect prey. We used 16S rDNA cloning and sequencing to compare bacterial communities in pitcher fluids of each of three species, namely Nepenthes ampullaria, Nepenthes gracilis and Nepenthes mirabilis, growing in the wild. In contrast to previous greenhouse-based studies, we found that both opened and unopened pitchers harbored bacterial DNA. Pitchers of N. mirabilis had higher bacterial diversity as compared to other Nepenthes species. The composition of the bacterial communities could be different between pitcher types for N. mirabilis (ANOSIM: R = 0.340, p < 0.05). Other Nepenthes species had similar bacterial composition between pitcher types. SIMPER showed that more than 50 % of the bacterial taxa identified from the open pitchers of N. mirabilis were not found in other groups. Our study suggests that bacteria in N. mirabilis are divided into native and nonnative groups.
Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz; Qian, Pei-Yuan
2012-10-01
Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals.
Lee, On On; Yang, Jiangke; Bougouffa, Salim; Wang, Yong; Batang, Zenon; Tian, Renmao; Al-Suwailem, Abdulaziz
2012-01-01
Microbial associations with corals are common and are most likely symbiotic, although their diversity and relationships with environmental factors and host species remain unclear. In this study, we adopted a 16S rRNA gene tag-pyrosequencing technique to investigate the bacterial communities associated with three stony Scleractinea and two soft Octocorallia corals from three locations in the Red Sea. Our results revealed highly diverse bacterial communities in the Red Sea corals, with more than 600 ribotypes detected and up to 1,000 species estimated from a single coral species. Altogether, 21 bacterial phyla were recovered from the corals, of which Gammaproteobacteria was the most dominant group, and Chloroflexi, Chlamydiae, and the candidate phylum WS3 were reported in corals for the first time. The associated bacterial communities varied greatly with location, where environmental conditions differed significantly. Corals from disturbed areas appeared to share more similar bacterial communities, but larger variations in community structures were observed between different coral species from pristine waters. Ordination methods identified salinity and depth as the most influential parameters affecting the abundance of Vibrio, Pseudoalteromonas, Serratia, Stenotrophomonas, Pseudomonas, and Achromobacter in the corals. On the other hand, bacteria such as Chloracidobacterium and Endozoicomonas were more sensitive to the coral species, suggesting that the host species type may be influential in the associated bacterial community, as well. The combined influences of the coral host and environmental factors on the associated microbial communities are discussed. This study represents the first comparative study using tag-pyrosequencing technology to investigate the bacterial communities in Red Sea corals. PMID:22865078
Cellulose-ethylenediaminetetraacetic acid conjugates protect mammalian cells from bacterial cells.
Luo, Jie; Lv, Wei; Deng, Ying; Sun, Yuyu
2013-04-08
Cellulose-ethylenediaminetetraacetic acid (EDTA) conjugates were synthesized by the esterification of cellulose with ethylenediaminetetraacetic dianhydride (EDTAD). The new materials provided potent antimicrobial activities against Staphylococcus aureus (S. aureus, Gram-positive bacteria) and Pseudomonas aeruginosa (P. aeruginosa, Gram-negative bacteria), and inhibited the formation of bacterial biofilms. The biocompatibility of the new cellulose-EDTA conjugates was evaluated with mouse skin fibroblasts for up to 14 days. SEM observation and DNA content analysis suggested that the new materials sustained the viability of fibroblast cells. Moreover, in mouse skin fibroblast-bacteria co-culture systems, the new cellulose-EDTA conjugates prevented bacterial biofilm formation and protected the mammalian cells from the bacterial cells for at least one day.
Impact of grassland management regimes on bacterial endophyte diversity differs with grass species.
Wemheuer, F; Wemheuer, B; Kretzschmar, D; Pfeiffer, B; Herzog, S; Daniel, R; Vidal, S
2016-04-01
Most plant species are colonized by endophytic bacteria. Despite their importance for plant health and growth, the response of these bacteria to grassland management regimes is still not understood. Hence, we investigated the bacterial community structure in three agricultural important grass species Dactylis glomerata L., Festuca rubra L. and Lolium perenne L. with regard to fertilizer application and different mowing frequencies. For this purpose, above-ground plant material was collected from the Grassland Management Experiment (GrassMan) in Germany in September 2010 and 2011. DNA was extracted from surface-sterilized plant tissue and subjected to 16S rRNA gene PCRs. Endophytic community structures were assessed by denaturing gradient gel electrophoresis (DGGE)-based analysis of obtained PCR products. DGGE fingerprints revealed that fertilizer application significantly altered the endophytic communities in L. perenne and F. rubra but not in D. glomerata. Although no direct effect of mowing was observed, mowing frequencies in combination with fertilizer application had a significant impact on endophyte bacterial community structures. However, this effect was not observed for all three grass species in both years. Therefore, our results showed that management regimes changed the bacterial endophyte communities, but this effect was plant-specific and varied over time. Endophytic bacteria play an important role in plant health and growth. However, studies addressing the influence of grassland management regimes on these bacteria in above-ground plant parts are still missing. In this study, we present first evidence that fertilizer application significantly impacted bacterial community structures in three agricultural important grass species, whereas mowing had only a minor effect. Moreover, this effect was plant-specific and thus not visible for all grass species in each year. Consequently, this study sheds new light into the complex interaction of microbes and
Bacterial species colonizing the vagina of healthy women are not associated with race.
Beamer, May A; Austin, Michele N; Avolia, Hilary A; Meyn, Leslie A; Bunge, Katherine E; Hillier, Sharon L
2017-06-01
The vaginal microbiota of 36 white versus 25 black asymptomatic women were compared using both cultivation-dependent and -independent identification. Significant differences by race were found in colonization and density of bacterial species. However, exclusion of 12 women with bacterial vaginosis by Nugent criteria resulted in no significant differences by race. Copyright © 2017 Elsevier Ltd. All rights reserved.
Vickerman, M M; Brossard, K A; Funk, D B; Jesionowski, A M; Gill, S R
2007-01-01
Phylogenetic analysis of bacterial and archaeal 16S rRNA was used to examine polymicrobial communities within infected root canals of 20 symptomatic and 14 asymptomatic patients. Nucleotide sequences from approximately 750 clones amplified from each patient group with universal bacterial primers were matched to the Ribosomal Database Project II database. Phylotypes from 37 genera representing Actinobacteria, Bacteroidetes, Firmicutes, Fusobacteria and Proteobacteria were identified. Results were compared to those obtained with species-specific primers designed to detect Prevotella intermedia, Porphyromonas gingivalis, Porphyromonas endodontalis, Peptostreptococcus micros, Enterococcus sp., Streptococcus sp., Fusobacterium nucleatum, Tannerella forsythensis and Treponema denticola. Since members of the domain Archaea have been implicated in the severity of periodontal disease, and a recent report confirms that archaea are present in endodontic infections, 16S archaeal primers were also used to detect which patients carried these prokaryotes, to determine if their presence correlated with severity of the clinical symptoms. A Methanobrevibacter oralis-like species was detected in one asymptomatic and one symptomatic patient. DNA from root canals of these two patients was further analysed using species-specific primers to determine bacterial cohabitants. Trep. denticola was detected in the asymptomatic but not the symptomatic patient. Conversely, Porph. endodontalis was found in the symptomatic but not the asymptomatic patient. All other species except enterococci were detected with the species-specific primers in both patients. These results confirm the presence of archaea in root canals and provide additional insights into the polymicrobial communities in endodontic infections associated with clinical symptoms.
Sakai, Yoriko; Ogawa, Naoto; Shimomura, Yumi; Fujii, Takeshi
2014-03-01
Analysis of the complete nucleotide sequence of plasmid pM7012 from 2,4-dichlorophenoxyacetic-acid (2,4-D)-degrading bacterium Burkholderia sp. M701 revealed that the plasmid had 582 142 bp, with 541 putative protein-coding sequences and 39 putative tRNA genes for the transport of the standard 20 aa. pM7012 contains sequences homologous to the regions involved in conjugal transfer and plasmid maintenance found in plasmids byi_2p from Burkholderia sp. YI23 and pBVIE01 from Burkholderia sp. G4. No relaxase gene was found in any of these plasmids, although genes for a type IV secretion system and type IV coupling proteins were identified. Plasmids with no relaxase gene have been classified as non-mobile plasmids. However, nucleotide sequences with a high level of similarity to the genes for plasmid transfer, plasmid maintenance, 2,4-D degradation and arsenic resistance contained on pM7012 were also detected in eight other megaplasmids (~600 or 900 kb) found in seven Burkholderia strains and a strain of Cupriavidus, which were isolated as 2,4-D-degrading bacteria in Japan and the United States. These results suggested that the 2,4-D degradation megaplasmids related to pM7012 are mobile and distributed across various bacterial species worldwide, and that the plasmid group could be distinguished from known mobile plasmid groups.
McGraw, Joseph E.; Jensen, Brittany J.; Bishop, Sydney S.; Lokken, James P.; Dorff, Kellen J.; Ripley, Michael P.; Munro, James B.
2015-01-01
Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. PMID:26497452
Effect of species, breed, and age on bacterial load in bovine and bubaline semen
Sannat, Chandrahas; Nair, Ajit; Sahu, S. B.; Sahasrabudhe, S. A.; Kumar, Ashish; Gupta, Amit Kumar; Shende, R. K.
2015-01-01
Aim: The present study was conducted to investigate the effect of species, breed and age on bacterial load in fresh and frozen semen of Cattle and Buffalo bull. Materials and Methods: Present study covered 56 cow and 10 buffalo bulls stationed at Central Semen Station Anjora, Durg (Chhattisgarh). Impact of breeds on bacterial load in semen was assessed using six breeds of cattle viz. Sahiwal, Gir, Red Sindhi, Tharparkar, Jersey and Holstein Friesian (HF) cross. Cow bulls were categorized into four different groups based on their age (<4 years, 4-5 years, 5-6 years and > 6 years) to study variation among age groups. Bacterial load was measured in fresh and frozen semen samples from these bulls using the standard plate count (SPC) method and count was expressed as colony forming unit (CFU) per ml of semen. Results: Higher bacterial load was reported in fresh (2.36 × 104 ± 1943 CFU/ml) and frozen (1.00 × 10 ± 90 CFU/ml) semen of cow bulls as compared to buffalo bulls (1.95 × 104 ± 2882 and 7.75 × 102 ± 160 CFU/ml in fresh and frozen semen, respectively). Jersey bull showed significantly higher bacterial count (p < 0.05) both in fresh (4.07 × 104 ± 13927 CFU/ml) and frozen (1.92 × 103 ± 178 CFU/ml) semen followed by HF cross, Sahiwal, Gir, Red Sindhi and Tharparkar bull. Bulls aged < 4 years and more than 6 years yielded increased bacterial load in their semen. Although a minor variation was reported between species and among age groups, no significant differences were measured. Conclusion: Bacterial load in semen did not differ significantly between species and age groups; however significant variation was reported among different breeds. Bulls of Jersey breed showed significantly higher bacterial load in semen as compared to the crossbred and indigenous bull. PMID:27047115
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Lopez, Isabel; Ruiz-Larrea, Fernanda; Cocolin, Luca; Orr, Erica; Phister, Trevor; Marshall, Megan; VanderGheynst, Jean; Mills, David A.
2003-01-01
Denaturing gradient gel electrophoresis (DGGE) of PCR-amplified ribosomal DNA (rDNA) is routinely used to compare levels of diversity of microbial communities and to monitor population dynamics. While using PCR-DGGE to examine the bacteria in wine fermentations, we noted that several commonly used PCR primers for amplifying bacterial 16S rDNA also coamplified yeast, fungal, or plant DNA present in samples. Unfortunately, amplification of nonbacterial DNA can result in a masking of bacterial populations in DGGE profiles. To surmount this problem, we developed two new primer sets for specific amplification of bacterial 16S rDNA in wine fermentation samples without amplification of eukaryotic DNA. One primer set, termed WLAB1 and WLAB2, amplified lactic acid bacteria, while another, termed WBAC1 and WBAC2, amplified both lactic acid bacterial and acetic acid bacterial populations found in wine. Primer specificity and efficacy were examined with DNA isolated from numerous bacterial, yeast, and fungal species commonly found in wine and must samples. Importantly, both primer sets effectively distinguished bacterial species in wine containing mixtures of yeast and bacteria. PMID:14602643
Benskin, Clare McW H; Rhodes, Glenn; Pickup, Roger W; Mainwaring, Mark C; Wilson, Kenneth; Hartley, Ian R
2015-01-01
Very little is known about the normal gastrointestinal flora of wild birds, or how it might affect or reflect the host's life-history traits. The aim of this study was to survey the species richness of bacteria in the feces of a wild population of blue tits Cyanistes caeruleus and to explore the relationships between bacterial species richness and various life-history traits, such as age, sex, and reproductive success. Using PCR-TGGE, 55 operational taxonomic units (OTUs) were identified in blue tit feces. DNA sequencing revealed that the 16S rRNA gene was amplified from a diverse range of bacteria, including those that shared closest homology with Bacillus licheniformis, Campylobacter lari, Pseudomonas spp., and Salmonella spp. For adults, there was a significant negative relationship between bacterial species richness and the likelihood of being detected alive the following breeding season; bacterial richness was consistent across years but declined through the breeding season; and breeding pairs had significantly more similar bacterial richness than expected by chance alone. Reduced adult survival was correlated with the presence of an OTU most closely resembling C. lari; enhanced adult survival was associated with an OTU most similar to Arthrobacter spp. For nestlings, there was no significant change in bacterial species richness between the first and second week after hatching, and nestlings sharing the same nest had significantly more similar bacterial richness. Collectively, these results provide compelling evidence that bacterial species richness was associated with several aspects of the life history of their hosts. PMID:25750710
Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F
2014-01-01
Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. ‘homaria’ (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. PMID:24817518
Cost-effective production of bacterial cellulose using acidic food industry by-products.
Revin, Victor; Liyaskina, Elena; Nazarkina, Maria; Bogatyreva, Alena; Shchankin, Mikhail
2018-03-13
To reduce the cost of obtaining bacterial cellulose, acidic by-products of the alcohol and dairy industries were used without any pretreatment or addition of other nitrogen sources. Studies have shown that the greatest accumulation of bacterial cellulose (6.19g/L) occurs on wheat thin stillage for 3 days of cultivation under dynamic conditions, which is almost 3 times higher than on standard Hestrin and Schramm medium (2.14g/L). The use of whey as a nutrient medium makes it possible to obtain 5.45g/L bacterial cellulose under similar conditions of cultivation. It is established that the pH of the medium during the growth of Gluconacetobacter sucrofermentans B-11267 depends on the feedstock used and its initial value. By culturing the bacterium on thin stillage and whey, there is a decrease in the acidity of the waste. It is shown that the infrared spectra of bacterial cellulose obtained in a variety of environments have a similar character, but we found differences in the micromorphology and crystallinity of the resulting biopolymer. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.
RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids
Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A
2012-01-01
Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150
Marron, Alan O; Akam, Michael; Walker, Giselle
2013-01-01
Cultures of heterotrophic protists often require co-culturing with bacteria to act as a source of nutrition. Such cultures will contain varying levels of intrinsic bacterial contamination that can interfere with molecular research and cause problems with the collection of sufficient material for sequencing. Measuring the levels of bacterial contamination for the purposes of molecular biology research is non-trivial, and can be complicated by the presence of a diverse bacterial flora, or by differences in the relative nucleic acid yield per bacterial or eukaryotic cell. Here we describe a duplex PCR-based assay that can be used to measure the levels of contamination from marine bacteria in a culture of loricate choanoflagellates. By comparison to a standard culture of known target sequence content, the assay can be used to quantify the relative proportions of bacterial and choanoflagellate material in DNA or RNA samples extracted from a culture. We apply the assay to compare methods of purifying choanoflagellate cultures prior to DNA extraction, to determine their effectiveness in reducing bacterial contamination. Together with measurements of the total nucleic acid concentration, the assay can then be used as the basis for determining the absolute amounts of choanoflagellate DNA or RNA present in a sample. The assay protocol we describe here is a simple and relatively inexpensive method of measuring contamination levels in nucleic acid samples. This provides a new way to establish quantification and purification protocols for molecular biology and genomics in novel heterotrophic protist species. Guidelines are provided to develop a similar protocol for use with any protistan culture. This assay method is recommended where qPCR equipment is unavailable, where qPCR is not viable because of the nature of the bacterial contamination or starting material, or where prior sequence information is insufficient to develop qPCR protocols.
Fatty Acid Compositions of Six Wild Edible Mushroom Species
Günç Ergönül, Pelin; Akata, Ilgaz; Kalyoncu, Fatih; Ergönül, Bülent
2013-01-01
The fatty acids of six wild edible mushroom species (Boletus reticulatus, Flammulina velutipes var. velutipes, Lactarius salmonicolor, Pleurotus ostreatus, Polyporus squamosus, and Russula anthracina) collected from different regions from Anatolia were determined. The fatty acids were identified and quantified by gas chromatography and studied using fruit bodies. Fatty acid composition varied among species. The dominant fatty acid in fruit bodies of all mushrooms was cis-linoleic acid (18 : 2). Percentage of cis-linoleic acid in species varied from 22.39% to 65.29%. The other major fatty acids were, respectively, cis-oleic, palmitic, and stearic acids. Fatty acids analysis of the mushrooms showed that the unsaturated fatty acids were at higher concentrations than saturated fatty acids. PMID:23844377
Benítez-Cabello, Antonio; Bautista-Gallego, Joaquín; Garrido-Fernández, Antonio; Rantsiou, Kalliopi; Cocolin, Luca; Jiménez-Díaz, Rufino; Arroyo-López, Francisco N
2016-01-01
This paper describes the dominant bacterial species metabolically active through the industrial production of Spanish-style Manzanilla and Gordal olives. For this purpose, samples (brines and fruits) obtained at 0, 15, and 90 fermentation days were analyzed by a culture-independent approach to determine viable cells by reverse transcription of RNA and further PCR-DGGE analysis, detecting at least 7 different species. Vibrio vulnificus, Lactobacillus plantarum group, and Lactobacillus parafarraginis were present in samples from both cultivars; Lactobacillus sanfranciscensis and Halolactobacillus halophilus were detected only in Gordal samples, while Staphylococcus sp. was exclusively found at the onset of Manzanilla fermentations. Physicochemical data showed a typical fermentation profile while scanning electron microscopy confirmed the in situ biofilm formation on the olive epidermis. Different Bacillus, Staphylococcus, and Enterococcus species, not detected during the fermentation process, were also found in the solid marine salt used by the industry for preparation of brines. Elucidation of these non-lactic acid bacteria species role during fermentation is then an appealingly challenge, particularly regarding safety issues.
Identification of different bacterial species in biofilms using confocal Raman microscopy
NASA Astrophysics Data System (ADS)
Beier, Brooke D.; Quivey, Robert G.; Berger, Andrew J.
2010-11-01
Confocal Raman microspectroscopy is used to discriminate between different species of bacteria grown in biofilms. Tests are performed using two bacterial species, Streptococcus sanguinis and Streptococcus mutans, which are major components of oral plaque and of particular interest due to their association with healthy and cariogenic plaque, respectively. Dehydrated biofilms of these species are studied as a simplified model of dental plaque. A prediction model based on principal component analysis and logistic regression is calibrated using pure biofilms of each species and validated on pure biofilms grown months later, achieving 96% accuracy in prospective classification. When biofilms of the two species are partially mixed together, Raman-based identifications are achieved within ~2 μm of the boundaries between species with 97% accuracy. This combination of spatial resolution and predication accuracy should be suitable for forming images of species distributions within intact two-species biofilms.
Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids
NASA Astrophysics Data System (ADS)
Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.
2012-07-01
Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.
Dailey, Frank E; McGraw, Joseph E; Jensen, Brittany J; Bishop, Sydney S; Lokken, James P; Dorff, Kellen J; Ripley, Michael P; Munro, James B
2016-01-01
Approximately 30 years ago, it was discovered that free-living bacteria isolated from cold ocean depths could produce polyunsaturated fatty acids (PUFA) such as eicosapentaenoic acid (EPA) (20:5n-3) or docosahexaenoic acid (DHA) (22:6n-3), two PUFA essential for human health. Numerous laboratories have also discovered that EPA- and/or DHA-producing bacteria, many of them members of the Shewanella genus, could be isolated from the intestinal tracts of omega-3 fatty acid-rich marine fish. If bacteria contribute omega-3 fatty acids to the host fish in general or if they assist some bacterial species in adaptation to cold, then cold freshwater fish or habitats should also harbor these producers. Thus, we undertook a study to see if these niches also contained omega-3 fatty acid producers. We were successful in isolating and characterizing unique EPA-producing strains of Shewanella from three strictly freshwater native fish species, i.e., lake whitefish (Coregonus clupeaformis), lean lake trout (Salvelinus namaycush), and walleye (Sander vitreus), and from two other freshwater nonnative fish, i.e., coho salmon (Oncorhynchus kisutch) and seeforellen brown trout (Salmo trutta). We were also able to isolate four unique free-living strains of EPA-producing Shewanella from freshwater habitats. Phylogenetic and phenotypic analyses suggest that one producer is clearly a member of the Shewanella morhuae species and another is sister to members of the marine PUFA-producing Shewanella baltica species. However, the remaining isolates have more ambiguous relationships, sharing a common ancestor with non-PUFA-producing Shewanella putrefaciens isolates rather than marine S. baltica isolates despite having a phenotype more consistent with S. baltica strains. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Chandra, Ram; Kumar, Vineet
2017-01-01
Sugarcane molasses-based distillery spent wash (DSW) is well known for its toxicity and complex mixture of various recalcitrant organic pollutants with acidic pH, but the chemical nature of these pollutants is unknown. This study revealed the presence of toxic organic acids (butanedioic acid bis(TMS)ester; 2-hydroxysocaproic acid; benzenepropanoic acid, α-[(TMS)oxy], TMS ester; vanillylpropionic acid, bis(TMS)), and other recalcitrant organic pollutants (2-furancarboxylic acid, 5-[[(TMS)oxy] methyl], TMS ester; benzoic acid 3-methoxy-4-[(TMS)oxy], TMS ester; and tricarballylic acid 3TMS), which are listed as endocrine-disrupting chemicals. In addition, several major heavy metals were detected, including Fe (163.947), Mn (4.556), Zn (2.487), and Ni (1.175 mg l -1 ). Bacterial community analysis by restriction fragment length polymorphism revealed that Bacillus and Stenotrophomonas were dominant autochthonous bacterial communities belonging to the phylum Firmicutes and γ-Proteobacteria, respectively. The presence of Bacillus and Stenotrophomonas species in highly acidic environments indicated its broad range adaptation. These findings indicated that these autochthonous bacterial communities were pioneer taxa for in situ remediation of this hazardous waste during ecological succession. Further, phytotoxicity assay of DSW with Phaseolus mungo L. and Triticum aestivum revealed that T. aestivum was more sensitive than P. mungo L. in the seed germination test. The results of this study may be useful for monitoring and toxicity assessment of sugarcane molasses-based distillery waste at disposal sites.
Skaljac, Marisa; Zanic, Katja; Puizina, Jasna; Lepen Pleic, Ivana; Ghanim, Murad
2017-01-01
Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies. PMID:29053633
Skaljac, Marisa; Kanakala, Surapathrudu; Zanic, Katja; Puizina, Jasna; Pleic, Ivana Lepen; Ghanim, Murad
2017-10-20
Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood), and Siphoninus phillyreae (Haliday) are whitefly species that harm agricultural crops in many regions of the world. These insects live in close association with bacterial symbionts that affect host fitness and adaptation to the environment. In the current study, we surveyed the infection of whitefly populations in Southeast Europe by various bacterial symbionts and performed phylogenetic analyses on the different symbionts detected. Arsenophonus and Hamiltonella were the most prevalent symbionts in all three whitefly species. Rickettsia was found to infect mainly B. tabaci, while Wolbachia mainly infected both B. tabaci and S. phillyreae. Furthermore, Cardinium was rarely found in the investigated whitefly populations, while Fritschea was never found in any of the whitefly species tested. Phylogenetic analyses revealed a diversity of several symbionts (e.g., Hamiltonella, Arsenophonus, Rickettsia), which appeared in several clades. Reproductively isolated B. tabaci and T. vaporariorum shared the same (or highly similar) Hamiltonella and Arsenophonus, while these symbionts were distinctive in S. phillyreae. Interestingly, Arsenophonus from S. phillyreae did not cluster with any of the reported sequences, which could indicate the presence of Arsenophonus, not previously associated with whiteflies. In this study, symbionts (Wolbachia, Rickettsia, and Cardinium) known to infect a wide range of insects each clustered in the same clades independently of the whitefly species. These results indicate horizontal transmission of bacterial symbionts between reproductively isolated whitefly species, a mechanism that can establish new infections that did not previously exist in whiteflies.
Whitten, Miranda M A; Davies, Charlotte E; Kim, Anita; Tlusty, Michael; Wootton, Emma C; Chistoserdov, Andrei; Rowley, Andrew F
2014-06-01
Diseases of lobster shells have a significant impact on fishing industries but the risk of disease transmission between different lobster species has yet to be properly investigated. This study compared bacterial biofilm communities from American (Homarus americanus) and European lobsters (H. gammarus), to assess both healthy cuticle and diseased cuticle during lesion formation. Culture-independent molecular techniques revealed diversity in the bacterial communities of cuticle biofilms both within and between the two lobster species, and identified three bacterial genera associated with shell lesions plus two putative beneficial bacterial species (detected exclusively in healthy cuticle or healing damaged cuticle). In an experimental aquarium shared between American and European lobsters, heterospecific transmission of potentially pathogenic bacteria appeared to be very limited; however, the claws of European lobsters were more likely to develop lesions when reared in the presence of American lobsters. Aquarium biofilms were also examined but revealed no candidate pathogens for environmental transmission. Aquimarina sp. 'homaria' (a potential pathogen associated with a severe epizootic form of shell disease) was detected at a much higher prevalence among American than European lobsters, but its presence correlated more with exacerbation of existing lesions rather than with lesion initiation. © 2014 The Authors. MicrobiologyOpen published by John Wiley & Sons Ltd.
Shinn, Sara; Liyanage, Rohana; Lay, Jack; Proctor, Andrew
2014-07-16
Reports from chicken conjugated linoleic acid (CLA) feeding trials are limited to yolk total fatty acid composition, which consistently described increased saturated fatty acids and decreased monounsaturated fatty acids. However, information on CLA triacylglycerol (TAG) and phospholipid (PL) species is limited. This study determined the fatty acid composition of total lipids in CLA-rich egg yolk produced with CLA-rich soy oil, relative to control yolks using gas chromatography with flame ionization detection (GC-FID), determined TAG and PL fatty acid compositions by thin-layer chromatography-GC-FID (TLC-GC-FID), identified intact PL and TAG species by TLC-matrix-assisted laser desorption/ionization mass spectrometry (TLC-MALDI-MS), and determined the composition of TAG and PL species in CLA and control yolks by direct flow infusion electrospray ionization MS (DFI ESI-MS). In total, 2 lyso-phosphatidyl choline (LPC) species, 1 sphingomyelin species, 17 phosphatidyl choline species, 19 TAG species, and 9 phosphatidyl ethanolamine species were identified. Fifty percent of CLA was found in TAG, occurring predominantly in C52:5 and C52:4 TAG species. CLA-rich yolks contained significantly more LPC than did control eggs. Comprehensive lipid profiling may provide insight on relationships between lipid composition and the functional properties of CLA-rich eggs.
Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin
Satapathy, N.; Purser, D. B.
1967-01-01
Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756
Miyamoto, M; Inoue, K; Gu, Y; Hoki, M; Haji, S; Ohyanagi, H
1999-01-01
At a number of points in the current procedures of islet isolation and islet culture after the harvesting of donor pancreata, microorganisms could potentially infect the islet preparation. Furthermore, the use of islets from multiple donors can compound the risks of contamination of individual recipients. Acidic oxidative potential water (also termed electrolyzed strong acid solution, function water, or acqua oxidation water), which was developed in Japan, is a strong acid formed on the anode in the electrolysis of water containing a small amount of sodium chloride. It has these physical properties: pH, from 2.3 to 2.7; oxidative-reduction potential, from 1,000 to 1,100 mV; dissolved chlorine, from 30 to 40 ppm; and dissolved oxygen, from 10 to 30 ppm. Because of these properties, acidic oxidative potential water has strong bactericidal effects on all bacteria including methicillin-resistant Staphylococcus aureus (MRSA), viruses including HIV, HBV, HCV, CMV, and fungi as a result of the action of the active oxygen and active chlorine that it contains. We conducted this study to evaluate the effect of acidic oxidative potential water irrigation on bacterial contamination on the harvesting of porcine pancreata from slaughterhouses for islet xenotransplantation by counting the number of pancreatic surface bacteria using the Dip-slide method, and on the results of islet culture; and to evaluate the direct effect on isolated islets when it is used to prevent bacterial contamination by the static incubation test and by morphological examination. Direct irrigation of the pancreas by acidic oxidative potential water was found to be very effective in preventing bacterial contamination, but direct irrigation of isolated islets slightly decreased their viability and function.
Cabugao, Kristine G.; Timm, Collin M.; Carrell, Alyssa A.; Childs, Joanne; Lu, Tse-Yuan S.; Pelletier, Dale A.; Weston, David J.; Norby, Richard J.
2017-01-01
Tropical forests generally occur on highly weathered soils that, in combination with the immobility of phosphorus (P), often result in soils lacking orthophosphate, the form of P most easily metabolized by plants and microbes. In these soils, mineralization of organic P can be the major source for orthophosphate. Both plants and microbes encode for phosphatases capable of mineralizing a range of organic P compounds. However, the activity of these enzymes depends on several edaphic factors including P availability, tree species, and microbial communities. Thus, phosphatase activity in both roots and the root microbial community constitute an important role in P mineralization and P nutrient dynamics that are not well studied in tropical forests. To relate phosphatase activity of roots and bacteria in tropical forests, we measured phosphatase activity in roots and bacterial isolates as well as bacterial community composition from the rhizosphere. Three forests in the Luquillo Mountains of Puerto Rico were selected to represent a range of soil P availability as measured using the resin P method. Within each site, a minimum of three tree species were chosen to sample. Root and bacterial phosphatase activity were both measured using a colorimetric assay with para-nitrophenyl phosphate as a substrate for the phosphomonoesterase enzyme. Both root and bacterial phosphatase were chiefly influenced by tree species. Though tree species was the only significant factor in root phosphatase activity, there was a negative trend between soil P availability and phosphatase activity in linear regressions of average root phosphatase and resin P. Permutational multivariate analysis of variance of bacterial community composition based on 16S amplicon sequencing indicated that bacterial composition was strongly controlled by soil P availability (p-value < 0.05). These results indicate that although root and bacterial phosphatase activity were influenced by tree species; bacterial
Cabugao, Kristine G; Timm, Collin M; Carrell, Alyssa A; Childs, Joanne; Lu, Tse-Yuan S; Pelletier, Dale A; Weston, David J; Norby, Richard J
2017-01-01
Tropical forests generally occur on highly weathered soils that, in combination with the immobility of phosphorus (P), often result in soils lacking orthophosphate, the form of P most easily metabolized by plants and microbes. In these soils, mineralization of organic P can be the major source for orthophosphate. Both plants and microbes encode for phosphatases capable of mineralizing a range of organic P compounds. However, the activity of these enzymes depends on several edaphic factors including P availability, tree species, and microbial communities. Thus, phosphatase activity in both roots and the root microbial community constitute an important role in P mineralization and P nutrient dynamics that are not well studied in tropical forests. To relate phosphatase activity of roots and bacteria in tropical forests, we measured phosphatase activity in roots and bacterial isolates as well as bacterial community composition from the rhizosphere. Three forests in the Luquillo Mountains of Puerto Rico were selected to represent a range of soil P availability as measured using the resin P method. Within each site, a minimum of three tree species were chosen to sample. Root and bacterial phosphatase activity were both measured using a colorimetric assay with para-nitrophenyl phosphate as a substrate for the phosphomonoesterase enzyme. Both root and bacterial phosphatase were chiefly influenced by tree species. Though tree species was the only significant factor in root phosphatase activity, there was a negative trend between soil P availability and phosphatase activity in linear regressions of average root phosphatase and resin P. Permutational multivariate analysis of variance of bacterial community composition based on 16S amplicon sequencing indicated that bacterial composition was strongly controlled by soil P availability ( p -value < 0.05). These results indicate that although root and bacterial phosphatase activity were influenced by tree species; bacterial
Tormo, Hélène; Ali Haimoud Lekhal, Djamila; Roques, C
2015-10-01
Lactic acid bacteria, in particular Lactococcus lactis, play a decisive role in the cheese making process and more particularly in lactic cheeses which are primarily produced on goat dairy farms. The objective of this study was therefore to identify the main lactic acid bacteria found in raw goats' milk from three different regions in France and evaluate if certain farming practices have an effect on the distribution of species of lactic acid bacteria in the various milk samples. Identification at genus or species level was carried out using phenotypic tests and genotypic methods including repetitive element REP-PCR, species-specific PCR and 16S rRNA gene sequencing. The distribution of the main bacterial species in the milk samples varied depending on farms and their characteristics. Out of the 146 strains identified, L. lactis was the dominant species (60% of strains), followed by Enterococcus (38%) of which Enterococcus faecalis and Enterococcus faecium. Within the species L. lactis, L. lactis subsp lactis was detected more frequently than L. lactis subsp cremoris (74% vs. 26%). The predominance of L. lactis subsp cremoris was linked to geographical area studied. It appears that the animals' environment plays a role in the balance between the dominance of L. lactis and enterococci in raw goats' milk. The separation between the milking parlor and the goat shed (vs no separation) and only straw in the bedding (vs straw and hay) seems to promote L. lactis in the milk (vs enterococci). Copyright © 2015 Elsevier B.V. All rights reserved.
Matsunaga, James; Barocchi, Michele A.; Croda, Julio; Young, Tracy A.; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A.; Reis, Mitermayer G.; Riley, Lee W.; Haake, David A.; Ko, Albert I.
2005-01-01
Summary Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudo-gene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis. PMID:12890019
Matsunaga, James; Barocchi, Michele A; Croda, Julio; Young, Tracy A; Sanchez, Yolanda; Siqueira, Isadora; Bolin, Carole A; Reis, Mitermayer G; Riley, Lee W; Haake, David A; Ko, Albert I
2003-08-01
Proteins with bacterial immunoglobulin-like (Big) domains, such as the Yersinia pseudotuberculosis invasin and Escherichia coli intimin, are surface-expressed proteins that mediate host mammalian cell invasion or attachment. Here, we report the identification and characterization of a new family of Big domain proteins, referred to as Lig (leptospiral Ig-like) proteins, in pathogenic Leptospira. Screening of L. interrogans and L. kirschneri expression libraries with sera from leptospirosis patients identified 13 lambda phage clones that encode tandem repeats of the 90 amino acid Big domain. Two lig genes, designated ligA and ligB, and one pseudogene, ligC, were identified. The ligA and ligB genes encode amino-terminal lipoprotein signal peptides followed by 10 or 11 Big domain repeats and, in the case of ligB, a unique carboxy-terminal non-repeat domain. The organization of ligC is similar to that of ligB but contains mutations that disrupt the reading frame. The lig sequences are present in pathogenic but not saprophytic Leptospira species. LigA and LigB are expressed by a variety of virulent leptospiral strains. Loss of Lig protein and RNA transcript expression is correlated with the observed loss of virulence during culture attenuation of pathogenic strains. High-pressure freeze substitution followed by immunocytochemical electron microscopy confirmed that the Lig proteins were localized to the bacterial surface. Immunoblot studies with patient sera found that the Lig proteins are a major antigen recognized during the acute host infection. These observations demonstrate that the Lig proteins are a newly identified surface protein of pathogenic Leptospira, which by analogy to other bacterial immunoglobulin superfamily virulence factors, may play a role in host cell attachment and invasion during leptospiral pathogenesis.
NASA Technical Reports Server (NTRS)
Ponce, Adrian
2003-01-01
A method of detecting bacterial spores incorporates (1) A method of lateral-flow immunoassay in combination with (2) A method based on the luminescence of Tb3+ ions to which molecules of dipicolinic acid (DPA) released from the spores have become bound. The present combination of lateral-flow immunoassay and DPA-triggered Tb luminescence was developed as a superior alternative to a prior lateral-flow immunoassay method in which detection involves the visual observation and/or measurement of red light scattered from colloidal gold nanoparticles. The advantage of the present combination method is that it affords both (1) High selectivity for spores of the species of bacteria that one seeks to detect (a characteristic of lateral-flow immunoassay in general) and (2) Detection sensitivity much greater (by virtue of the use of DPA-triggered Tb luminescence instead of gold nanoparticles) than that of the prior lateral-flow immunoassay method
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less
Comparative fatty acid composition of four Sargassum species (Fucales, Phaeophyta)
NASA Astrophysics Data System (ADS)
Wu, Xiang-Chun; Lu, Bao-Ren; Tseng, C. K.
1995-12-01
Fatty acid composition of four Sargassum species from Qingdao and Shidao, Shandong Province was investigated. 16:0 (palmitic acid) was the major saturated fatty acid. C18 and C20 were the main polyunsaturated fatty acids (PUFAs). Arachidonic acid and eicosapentaenoic acid predominated among polyenoic acids in all the algal species examined, except for Sargassum sp. which had low concentration of eicosapentaenoic acid.
Shin, Sang Hyun; Pak, Jung-Hun; Kim, Mi Jin; Kim, Hye Jeong; Oh, Ju Sung; Choi, Hong Kyu; Jung, Ho Won; Chung, Young Soo
2014-01-01
Wild rice, Oryza grandiglumis shows hyper-resistance response to pathogen infection. In order to identify genes necessary for defense response in plants, we have carried out a subtractive hybridization coupled with a cDNA macroarray. An acidic PATHOGENESIS-RELATED1 (PR1) gene of the wild rice is highly identical to the acidic PR1 genes of different plant species. The OgPR1a cDNA has an apparent single open reading frame with a predicted molecular mass 40,621 Da and an isoelectic point of 5.14. Both in silico analysis and a transient expression assay in onion epidermal cells revealed that the OgPR1a protein could be localized in intercellular space in plants. The OgPR1a mRNA was strongly transcribed by the exogenous treatment with ethylene and jasmonic acid as well as protein phosphatase inhibitors. Additionally, ectopic expression of the OgPR1a conferred disease resistance on Arabidopsis to the bacterial and fungal infections. PMID:25289005
Intra- and inter-species interactions within biofilms of important foodborne bacterial pathogens
Giaouris, Efstathios; Heir, Even; Desvaux, Mickaël; Hébraud, Michel; Møretrø, Trond; Langsrud, Solveig; Doulgeraki, Agapi; Nychas, George-John; Kačániová, Miroslava; Czaczyk, Katarzyna; Ölmez, Hülya; Simões, Manuel
2015-01-01
A community-based sessile life style is the normal mode of growth and survival for many bacterial species. Under such conditions, cell-to-cell interactions are inevitable and ultimately lead to the establishment of dense, complex and highly structured biofilm populations encapsulated in a self-produced extracellular matrix and capable of coordinated and collective behavior. Remarkably, in food processing environments, a variety of different bacteria may attach to surfaces, survive, grow, and form biofilms. Salmonella enterica, Listeria monocytogenes, Escherichia coli, and Staphylococcus aureus are important bacterial pathogens commonly implicated in outbreaks of foodborne diseases, while all are known to be able to create biofilms on both abiotic and biotic surfaces. Particularly challenging is the attempt to understand the complexity of inter-bacterial interactions that can be encountered in such unwanted consortia, such as competitive and cooperative ones, together with their impact on the final outcome of these communities (e.g., maturation, physiology, antimicrobial resistance, virulence, dispersal). In this review, up-to-date data on both the intra- and inter-species interactions encountered in biofilms of these pathogens are presented. A better understanding of these interactions, both at molecular and biophysical levels, could lead to novel intervention strategies for controlling pathogenic biofilm formation in food processing environments and thus improve food safety. PMID:26347727
Gotoh, Aina; Nara, Misaki; Sugiyama, Yuta; Sakanaka, Mikiyasu; Yachi, Hiroyuki; Kitakata, Aya; Nakagawa, Akira; Minami, Hiromichi; Okuda, Shujiro; Katoh, Toshihiko; Katayama, Takane; Kurihara, Shin
2017-10-01
Recently, a "human gut microbial gene catalogue," which ranks the dominance of microbe genus/species in human fecal samples, was published. Most of the bacteria ranked in the catalog are currently publicly available; however, the growth media recommended by the distributors vary among species, hampering physiological comparisons among the bacteria. To address this problem, we evaluated Gifu anaerobic medium (GAM) as a standard medium. Forty-four publicly available species of the top 56 species listed in the "human gut microbial gene catalogue" were cultured in GAM, and out of these, 32 (72%) were successfully cultured. Short-chain fatty acids from the bacterial culture supernatants were then quantified, and bacterial metabolic pathways were predicted based on in silico genomic sequence analysis. Our system provides a useful platform for assessing growth properties and analyzing metabolites of dominant human gut bacteria grown in GAM and supplemented with compounds of interest.
Bacterial and fungal endophthalmitis in upper Egypt: related species and risk factors.
Gharamah, A A; Moharram, A M; Ismail, M A; Al-Hussaini, A K
2012-08-01
To study risk factors, contributing factors of bacterial and fungal endophthalmitis in Upper Egypt, test the isolated species sensitive to some therapeutic agents, and to investigate the air-borne bacteria and fungi in opthalmology operating rooms. Thirty one cases of endophthalmitis were clinically diagnosed and microbiologically studied. Indoor air-borne bacteria and fungi inside four air-conditioned operating rooms in the Ophthalmology Department at Assiut University Hospitals were also investigated. The isolated microbes from endophthalmitis cases were tested for their ability to produce some extracellular enzymes including protease, lipase, urease, phosphatase and catalase. Also the ability of 5 fungal isolates from endophthalmitis origin to produce mycotoxins and their sensitivity to some therapeutic agents were studied. Results showed that bacteria and fungi were responsihle for infection in 10 and 6 cases of endophthalmitis, respectively and only 2 cases produced a mixture of bacteria and fungi. Trauma was the most prevalent risk factor of endophthalmitis where 58.1% of the 31 cases were due to trauma. In ophthalmology operating rooms, different bacterial and fungal species were isolated. 8 bacterial and 5 fungal isolates showed their ability to produce enzymes while only 3 fungal isolates were able to produce mycotoxins. Terbinafine showed the highest effect against most isolates in vitro. The ability of bacterial and fungal isolates to produce extracellular enzymes and mycotoxins may be aid in the invasion and destruction of eye tissues. Microbial contamination of operating rooms with air-borne bacteria and fungi in the present work may be a source of postoperative endophthalmitis.
Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina
2016-01-01
The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach
Buzalewicz, Igor; Kujawińska, Małgorzata; Krauze, Wojciech; Podbielska, Halina
2016-01-01
The use of light diffraction for the microbiological diagnosis of bacterial colonies was a significant breakthrough with widespread implications for the food industry and clinical practice. We previously confirmed that optical sensors for bacterial colony light diffraction can be used for bacterial identification. This paper is focused on the novel perspectives of this method based on digital in-line holography (DIH), which is able to reconstruct the amplitude and phase properties of examined objects, as well as the amplitude and phase patterns of the optical field scattered/diffracted by the bacterial colony in any chosen observation plane behind the object from single digital hologram. Analysis of the amplitude and phase patterns inside a colony revealed its unique optical properties, which are associated with the internal structure and geometry of the bacterial colony. Moreover, on a computational level, it is possible to select the desired scattered/diffracted pattern within the entire observation volume that exhibits the largest amount of unique, differentiating bacterial features. These properties distinguish this method from the already proposed sensing techniques based on light diffraction/scattering of bacterial colonies. The reconstructed diffraction patterns have a similar spatial distribution as the recorded Fresnel patterns, previously applied for bacterial identification with over 98% accuracy, but they are characterized by both intensity and phase distributions. Our results using digital holography provide new optical discriminators of bacterial species revealed in one single step in form of new optical signatures of bacterial colonies: digital holograms, reconstructed amplitude and phase patterns, as well as diffraction patterns from all observation space, which exhibit species-dependent features. To the best of our knowledge, this is the first report on bacterial colony analysis via digital holography and our study represents an innovative approach
NASA Astrophysics Data System (ADS)
Jalali, Maryam; Sheng, Jian
2017-11-01
Bacteria are involved in cleanup and degradation of crude oil in polluted marine and soil environments. A number of bacterial species have been identified for consuming petroleum hydrocarbons with diverse metabolic capabilities. We conducted laboratory experiments to investigate bacterial consumption by monitoring the volume change to oil droplets as well as effects of oil droplet size on this process. To conduct our study, we developed a micro-bioassay containing an enclosed chamber with bottom substrate printed with stationary oil microdroplets and a digital holographic interferometer (DHI). The morphology of microdroplets was monitored in real time over 100 hours and instantaneous flow field was also measured by digital holographic microscope. The substrates with printed oil droplets were further evaluated with atomic force microscopy (AFM) at the end of each experiment. Three different bacteria species, Pseudomonas sp, Alcanivorax borkumensis, and Marinobacter hydrocarbonoclasticus, as well as six bacterial consortia were used in this study. The results show that droplets smaller than 20µm in diameter are not subject to bacterial degradation and the volume of droplet did not change beyond dissolution. Substantial species-specific behaviors have been observed in isolates. The experiments of consortia and various flow shears on biodegradation and dissolution are ongoing and will be reported.
Usefulness of Fatty Acid Composition for Differentiation of Legionella Species
Diogo, Alexandra; Veríssimo, António; Nobre, M. Fernanda; da Costa, Milton S.
1999-01-01
Numerical analysis of fatty acid methyl ester (FAME) profiles of 199 isolates and 76 reference strains, belonging to all validly described species of the genus Legionella that can be cultured in laboratory media, was used to differentiate between the species of this genus. With the exception of the strains that autofluoresced red, it was possible to differentiate all the other Legionella species. The strains of the species L. bozemanii, L. dumoffii, L. feeleii, L. gormanii, L. maceachernii, L. micdadei, and L. quinlivanii did not form single clusters, showing some degree of variability in the fatty acid compositions. The strains of the blue-white autofluorescent species had very similar fatty acid compositions and were difficult to distinguish from each other. Nine isolates had fatty acid profiles unlike those of any of the validly described species and may represent different FAME groups of known species or undescribed Legionella species. The method used in this study was useful for screening and discriminating large number of isolates of Legionella species. Moreover, the results obtained can be included in a database of fatty acid profiles, leading to a more accurate automatic identification of Legionella isolates. PMID:10364593
Watling, Helen R.; Shiers, Denis W.; Collinson, David M.
2015-01-01
In heap bioleaching, acidophilic extremophiles contribute to enhanced metal extraction from mineral sulphides through the oxidation of Fe(II) and/or reduced inorganic sulphur compounds (RISC), such as elemental sulphur or mineral sulphides, or the degradation of organic compounds derived from the ore, biota or reagents used during mineral processing. The impacts of variable solution acidity and composition, as well as temperature on the three microbiological functions have been examined for up to four bacterial species found in mineral sulphide heaps. The results indicate that bacteria adapt to sufficiently high metal concentrations (Cu, Ni, Co, Zn, As) to allow them to function in mineral sulphide heaps and, by engaging alternative metabolic pathways, to extend the solution pH range over which growth is sustained. Fluctuating temperatures during start up in sulphide heaps pose the greatest threat to efficient bacterial colonisation. The large masses of ores in bioleaching heaps mean that high temperatures arising from sulphide oxidation are hard to control initially, when the sulphide content of the ore is greatest. During that period, mesophilic and moderately thermophilic bacteria are markedly reduced in both numbers and activity. PMID:27682094
Kahlisch, Leila; Henne, Karsten; Gröbe, Lothar; Brettar, Ingrid; Höfle, Manfred G
2012-02-01
The question which bacterial species are present in water and if they are viable is essential for drinking water safety but also of general relevance in aquatic ecology. To approach this question we combined propidium iodide/SYTO9 staining ("live/dead staining" indicating membrane integrity), fluorescence-activated cell sorting (FACS) and community fingerprinting for the analysis of a set of tap water samples. Live/dead staining revealed that about half of the bacteria in the tap water had intact membranes. Molecular analysis using 16S rRNA and 16S rRNA gene-based single-strand conformation polymorphism (SSCP) fingerprints and sequencing of drinking water bacteria before and after FACS sorting revealed: (1) the DNA- and RNA-based overall community structure differed substantially, (2) the community retrieved from RNA and DNA reflected different bacterial species, classified as 53 phylotypes (with only two common phylotypes), (3) the percentage of phylotypes with intact membranes or damaged cells were comparable for RNA- and DNA-based analyses, and (4) the retrieved species were primarily of aquatic origin. The pronounced difference between phylotypes obtained from DNA extracts (dominated by Betaproteobacteria, Bacteroidetes, and Actinobacteria) and from RNA extracts (dominated by Alpha-, Beta-, Gammaproteobacteria, Bacteroidetes, and Cyanobacteria) demonstrate the relevance of concomitant RNA and DNA analyses for drinking water studies. Unexpected was that a comparable fraction (about 21%) of phylotypes with membrane-injured cells was observed for DNA- and RNA-based analyses, contradicting the current understanding that RNA-based analyses represent the actively growing fraction of the bacterial community. Overall, we think that this combined approach provides an interesting tool for a concomitant phylogenetic and viability analysis of bacterial species of drinking water.
Biodiversity of Bacterial Ecosystems in Traditional Egyptian Domiati Cheese▿
El-Baradei, Gaber; Delacroix-Buchet, Agnès; Ogier, Jean-Claude
2007-01-01
Bacterial biodiversity occurring in traditional Egyptian soft Domiati cheese was studied by PCR-temporal temperature gel electrophoresis (TTGE) and PCR-denaturing gradient gel electrophoresis (DGGE). Bands were identified using a reference species database (J.-C. Ogier et al., Appl. Environ. Microbiol. 70:5628-5643, 2004); de novo bands having nonidentified migration patterns were identified by DNA sequencing. Results reveal a novel bacterial profile and extensive bacterial biodiversity in Domiati cheeses, as reflected by the numerous bands present in TTGE and DGGE patterns. The dominant lactic acid bacteria (LAB) identified were as follows: Leuconostoc mesenteroides, Lactococcus garvieae, Aerococcus viridans, Lactobacillus versmoldensis, Pediococcus inopinatus, and Lactococcus lactis. Frequent non-LAB species included numerous coagulase-negative staphylococci, Vibrio spp., Kocuria rhizophila, Kocuria kristinae, Kocuria halotolerans, Arthrobacter spp./Brachybacterium tyrofermentans. This is the first time that the majority of these species has been identified in Domiati cheese. Nearly all the dominant and frequent bacterial species are salt tolerant, and several correspond to known marine bacteria. As Domiati cheese contains 5.4 to 9.5% NaCl, we suggest that these bacteria are likely to have an important role in the ripening process. This first systematic study of the microbial composition of Domiati cheeses reveals great biodiversity and evokes a role for marine bacteria in determining cheese type. PMID:17189434
Biodiversity of bacterial ecosystems in traditional Egyptian Domiati cheese.
El-Baradei, Gaber; Delacroix-Buchet, Agnès; Ogier, Jean-Claude
2007-02-01
Bacterial biodiversity occurring in traditional Egyptian soft Domiati cheese was studied by PCR-temporal temperature gel electrophoresis (TTGE) and PCR-denaturing gradient gel electrophoresis (DGGE). Bands were identified using a reference species database (J.-C. Ogier et al., Appl. Environ. Microbiol. 70:5628-5643, 2004); de novo bands having nonidentified migration patterns were identified by DNA sequencing. Results reveal a novel bacterial profile and extensive bacterial biodiversity in Domiati cheeses, as reflected by the numerous bands present in TTGE and DGGE patterns. The dominant lactic acid bacteria (LAB) identified were as follows: Leuconostoc mesenteroides, Lactococcus garvieae, Aerococcus viridans, Lactobacillus versmoldensis, Pediococcus inopinatus, and Lactococcus lactis. Frequent non-LAB species included numerous coagulase-negative staphylococci, Vibrio spp., Kocuria rhizophila, Kocuria kristinae, Kocuria halotolerans, Arthrobacter spp./Brachybacterium tyrofermentans. This is the first time that the majority of these species has been identified in Domiati cheese. Nearly all the dominant and frequent bacterial species are salt tolerant, and several correspond to known marine bacteria. As Domiati cheese contains 5.4 to 9.5% NaCl, we suggest that these bacteria are likely to have an important role in the ripening process. This first systematic study of the microbial composition of Domiati cheeses reveals great biodiversity and evokes a role for marine bacteria in determining cheese type.
de Oliveira, Sabrina Alves; da Silva, Bruno Campos; Riegel-Vidotti, Izabel Cristina; Urbano, Alexandre; de Sousa Faria-Tischer, Paula Cristina; Tischer, Cesar Augusto
2017-04-01
The bacterial cellulose (BC), from Gluconacetobacter hansenii, is a biofilm with a high degree of crystallinity that can be used for therapeutic purposes and as a candidate for healing wounds. Hyaluronic acid (HA) is a constitutive polysaccharide found in the extracellular matrix and is a material used in tissue engineering and scaffolding for tissue regeneration. In this study, polymeric composites were produced in presence of hyaluronic acid isolated from chicken comb on different days of fermentation, specifically on the first (BCHA-SABT0) and third day (BCHA-SABT3) of fermentation. The structural characteristics, thermal stability and molar mass of hyaluronic acid from chicken comb were evaluated. Native membrane and polymeric composites were characterized with respect to their morphology and crystallinity. The optimized process of extraction and purification of hyaluronic acid resulted in low molar mass hyaluronic acid with structural characteristics similar to the standard commercial hyaluronic acid. The results demonstrate that the polymeric composites (BC/HA-SAB) can be produced in situ. The membranes produced on the third day presented better incorporation of HA-SAB between cellulose microfiber, resulting in membranes with higher thermal stability, higher roughness and lower crystallinity. The biocompatiblily of bacterial cellulose and the importance of hyaluronic acid as a component of extracellular matrix qualify the polymeric composites as promising biomaterials for tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.
McFrederick, Quinn S; Wcislo, William T; Hout, Michael C; Mueller, Ulrich G
2014-05-01
Social transmission and host developmental stage are thought to profoundly affect the structure of bacterial communities associated with honey bees and bumble bees, but these ideas have not been explored in other bee species. The halictid bees Megalopta centralis and M. genalis exhibit intrapopulation social polymorphism, which we exploit to test whether bacterial communities differ by host social structure, developmental stage, or host species. We collected social and solitary Megalopta nests and sampled bees and nest contents from all stages of host development. To survey these bacterial communities, we used 16S rRNA gene 454 pyrosequencing. We found no effect of social structure, but found differences by host species and developmental stage. Wolbachia prevalence differed between the two host species. Bacterial communities associated with different developmental stages appeared to be driven by environmentally acquired bacteria. A Lactobacillus kunkeei clade bacterium that is consistently associated with other bee species was dominant in pollen provisions and larval samples, but less abundant in mature larvae and pupae. Foraging adults appeared to often reacquire L. kunkeei clade bacteria, likely while foraging at flowers. Environmental transmission appears to be more important than social transmission for Megalopta bees at the cusp between social and solitary behavior. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Effect of simulated acid rain on fluorine mobility and the bacterial community of phosphogypsum.
Wang, Mei; Tang, Ya; Anderson, Christopher W N; Jeyakumar, Paramsothy; Yang, Jinyan
2018-06-01
Contamination of soil and water with fluorine (F) leached from phosphogypsum (PG) stacks is a global environmental issue. Millions of tons of PG is produced each year as a by-product of fertilizer manufacture, and in China, weathering is exacerbated by acid rain. In this work, column leaching experiments using simulated acid rain were run to evaluate the mobility of F and the impact of weathering on native bacterial community composition in PG. After a simulated summer rainfall, 2.42-3.05 wt% of the total F content of PG was leached and the F concentration in leachate was above the quality standard for surface water and groundwater in China. Acid rain had no significant effect on the movement of F in PG. A higher concentration of F was observed at the bottom than the top section of PG columns suggesting mobility and reprecipitation of F. Throughout the simulation, the PG was environmentally safe according the TCLP testing. The dominant bacteria in PG were from the Enterococcus and Bacillus genus. Bacterial community composition in PG leached by simulated acid rain (pH 3.03) was more abundant than at pH 6.88. Information on F mobility and bacterial community in PG under conditions of simulated rain is relevant to management of environmental risk in stockpiled PG waste.
2011-01-01
Background Hydrogen peroxide (H2O2) produced by vaginal lactobacilli is generally believed to protect against bacteria associated with bacterial vaginosis (BV), and strains of lactobacilli that can produce H2O2 are being developed as vaginal probiotics. However, evidence that led to this belief was based in part on non-physiological conditions, antioxidant-free aerobic conditions selected to maximize both production and microbicidal activity of H2O2. Here we used conditions more like those in vivo to compare the effects of physiologically plausible concentrations of H2O2 and lactic acid on a broad range of BV-associated bacteria and vaginal lactobacilli. Methods Anaerobic cultures of seventeen species of BV-associated bacteria and four species of vaginal lactobacilli were exposed to H2O2, lactic acid, or acetic acid at pH 7.0 and pH 4.5. After two hours, the remaining viable bacteria were enumerated by growth on agar media plates. The effect of vaginal fluid (VF) on the microbicidal activities of H2O2 and lactic acid was also measured. Results Physiological concentrations of H2O2 (< 100 μM) failed to inactivate any of the BV-associated bacteria tested, even in the presence of human myeloperoxidase (MPO) that increases the microbicidal activity of H2O2. At 10 mM, H2O2 inactivated all four species of vaginal lactobacilli but only one of seventeen species of BV-associated bacteria. Moreover, the addition of just 1% vaginal fluid (VF) blocked the microbicidal activity of 1 M H2O2. In contrast, lactic acid at physiological concentrations (55-111 mM) and pH (4.5) inactivated all the BV-associated bacteria tested, and had no detectable effect on the vaginal lactobacilli. Also, the addition of 10% VF did not block the microbicidal activity of lactic acid. Conclusions Under optimal, anaerobic growth conditions, physiological concentrations of lactic acid inactivated BV-associated bacteria without affecting vaginal lactobacilli, whereas physiological concentrations of H2O2
Viršek, Manca Kovač; Lovšin, Marija Nika; Koren, Špela; Kržan, Andrej; Peterlin, Monika
2017-12-15
Microplastics is widespread in the marine environment where it can cause numerous negative effects. It can provide space for the growth of organisms and serves as a vector for the long distance transfer of marine microorganisms. In this study, we examined the sea surface concentrations of microplastics in the North Adriatic and characterized bacterial communities living on the microplastics. DNA from microplastics particles was isolated by three different methods, followed by PCR amplification of 16S rDNA, clone libraries preparation and phylogenetic analysis. 28 bacterial species were identified on the microplastics particles including Aeromonas spp. and hydrocarbon-degrading bacterial species. Based on the 16S rDNA sequences the pathogenic fish bacteria Aeromonas salmonicida was identified for the first time on microplastics. Because A. salmonicida is responsible for illnesses in fish, it is crucial to get answers if and how microplastics pollution is responsible for spreading of diseases. Copyright © 2017 Elsevier Ltd. All rights reserved.
Use of antibody to membrane adenosine triphosphatase in the study of bacterial relatioships.
Whiteside, T L; De Siervo, A J; Salton, M R
1971-03-01
An antiserum to Ca(2+)-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy.
Diverse bacterial PKS sequences derived from okadaic acid-producing dinoflagellates.
Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S
2008-05-22
Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum.
Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates
Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.
2008-01-01
Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765
Zheng, Zhou; Wang, Dandan; He, Hong
2017-01-01
Cicadas form intimate symbioses with bacteria to obtain nutrients that are scarce in the xylem fluid they feed on. The obligate symbionts in cicadas are purportedly confined to specialized bacteriomes, but knowledge of bacterial communities associated with cicadas is limited. Bacterial communities in the bacteriomes and organs of reproductive, digestive and excretory systems of two cicada species (Platypleura kaempferi and Meimuna mongolica) were investigated using different methods, and the bacterial diversity and distribution patterns of dominant bacteria in different tissues were compared. Within each species, the bacterial communities of testes are significantly different from those of bacteriomes and ovaries. The dominant endosymbiont Candidatus Sulcia muelleri is found not only in the bacteriomes and reproductive organs, but also in the “filter chamber + conical segment” of both species. The transmission mode of this endosymbiont in the alimentary canal and its effect on physiological processes merits further study. A novel bacterium of Rhizobiales, showing ~80% similarity to Candidatus Hodgkinia cicadicola, is dominant in the bacteriomes and ovaries of P. kaempferi. Given that the genome of H. cicadicola exhibits rapid sequence evolution, it is possible that this novel bacterium is a related endosymbiont with beneficial trophic functions similar to that of H. cicadicola in some other cicadas. Failure to detect H. cicadicola in M. mongolica suggests that it has been subsequently replaced by another bacterium, a yeast or gut microbiota which compensates for the loss of H. cicadicola. The distribution of this novel Rhizobiales species in other cicadas and its identification require further investigation to help establish the definition of the bacterial genus Candidatus Hodgkinia and to provide more information on sequence divergence of related endosymbionts of cicadas. Our results highlight the complex bacterial communities of cicadas, and are informative
Zheng, Zhou; Wang, Dandan; He, Hong; Wei, Cong
2017-01-01
Cicadas form intimate symbioses with bacteria to obtain nutrients that are scarce in the xylem fluid they feed on. The obligate symbionts in cicadas are purportedly confined to specialized bacteriomes, but knowledge of bacterial communities associated with cicadas is limited. Bacterial communities in the bacteriomes and organs of reproductive, digestive and excretory systems of two cicada species (Platypleura kaempferi and Meimuna mongolica) were investigated using different methods, and the bacterial diversity and distribution patterns of dominant bacteria in different tissues were compared. Within each species, the bacterial communities of testes are significantly different from those of bacteriomes and ovaries. The dominant endosymbiont Candidatus Sulcia muelleri is found not only in the bacteriomes and reproductive organs, but also in the "filter chamber + conical segment" of both species. The transmission mode of this endosymbiont in the alimentary canal and its effect on physiological processes merits further study. A novel bacterium of Rhizobiales, showing ~80% similarity to Candidatus Hodgkinia cicadicola, is dominant in the bacteriomes and ovaries of P. kaempferi. Given that the genome of H. cicadicola exhibits rapid sequence evolution, it is possible that this novel bacterium is a related endosymbiont with beneficial trophic functions similar to that of H. cicadicola in some other cicadas. Failure to detect H. cicadicola in M. mongolica suggests that it has been subsequently replaced by another bacterium, a yeast or gut microbiota which compensates for the loss of H. cicadicola. The distribution of this novel Rhizobiales species in other cicadas and its identification require further investigation to help establish the definition of the bacterial genus Candidatus Hodgkinia and to provide more information on sequence divergence of related endosymbionts of cicadas. Our results highlight the complex bacterial communities of cicadas, and are informative for
Zou, Jiaqi; Li, Na
2013-09-01
Proper design of nucleic acid sequences is crucial for many applications. We have previously established a thermodynamics-based quantitative model to help design aptamer-based nucleic acid probes by predicting equilibrium concentrations of all interacting species. To facilitate customization of this thermodynamic model for different applications, here we present a generic and easy-to-use platform to implement the algorithm of the model with Microsoft(®) Excel formulas and VBA (Visual Basic for Applications) macros. Two Excel spreadsheets have been developed: one for the applications involving only nucleic acid species, the other for the applications involving both nucleic acid and non-nucleic acid species. The spreadsheets take the nucleic acid sequences and the initial concentrations of all species as input, guide the user to retrieve the necessary thermodynamic constants, and finally calculate equilibrium concentrations for all species in various bound and unbound conformations. The validity of both spreadsheets has been verified by comparing the modeling results with the experimental results on nucleic acid sequences reported in the literature. This Excel-based platform described here will allow biomedical researchers to rationalize the sequence design of nucleic acid probes using the thermodynamics-based modeling even without relevant theoretical and computational skills. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Timchalk, Chuck
Phenoxyacetic acids including 2,4-dichlorophenoxyacetic acid (2,4-D) and 4-chloro-2-methylphenoxyacetic acid (MCPA) are widely utilized organic acid herbicides that have undergone extensive toxicity and pharmacokinetic analyses. The dog is particularly susceptible to the toxicity of phenoxyacetic acids and related organic acids relative to other species. Active renal clearance mechanisms for organic acids are ubiquitous in mammalian species, and thus a likely mechanism responsible for the increased sensitivity of the dog to these agents is linked to a lower capacity to secrete organic acids from the kidney. Using published data describing the pharmacokinetics of phenoxyacetic and structurally related organic acids in a varietymore » of species including humans, inter-species comparative pharmacokinetics were evaluated using allometic parameter scaling. For both 2,4-D and MCPA the dog plasma half-life (t1/2) and renal clearance (Clr; ml hr-1) rates did not scale as a function of body weight across species; whereas for all other species evaluated, including humans, these pharmacokinetic parameters reasonably scaled. This exceptional response in the dog is clearly illustrated by comparing the plasma t1/2 at comparable doses of 2,4-D and MCPA, across several species. At a dosage of 5 mg/kg, in dogs the plasma t1/2 for 2,4-D and MCPA were {approx}92 - 106 hr and 63 hr, respectively, which is substantially longer than in the rat ({approx}1 and 6 hr, respectively) or in humans (12 and 11 hr, respectively). This longer t1/2, and slower elimination in the dog, results in substantially higher body burdens of these organic acids, at comparable doses, relative to other species. Although these results indicate the important role of renal transport clearance mechanisms as determinants of the clearance and potential toxicity outcomes of phenoxyacetic acid herbicides across several species, other contributing mechanisms such as reabsorption from the renal tubules is highly
Qi, Z; Cao, H; Jiang, H; Zhao, J; Tang, Z
2016-01-01
To use microarrays to detect 11 selected bacteria in infected root canals, revealing bacterial combinations that are associated with clinical symptoms and signs of primary endodontic infections in a Chinese population. DNA was extracted from 90 samples collected from the root canals of teeth with primary endodontic infections in a Chinese population, and the 16S rRNA gene was amplified by polymerase chain reaction (PCR). The PCR products were hybridized to microarrays containing specific oligonucleotide probes targeting 11 species, and the arrays were screened with a confocal laser scanner. Pearson's chi-squared test and cluster analysis were performed to investigate the associations between the bacterial combinations and clinical symptoms and signs using SAS 8.02. Seventy-seven samples (86%) yielded at least one of the 11 target species. Parvimonas micra (56%), Porphyromonas endodontalis (51%), Tannerella forsythia (48%), Prevotella intermedia (44%) and Porphyromonas gingivalis (37%) were the most prevalent taxa and were often concomitant. The following positive associations were found between the bacterial combinations and clinical features: P. endodontalis and T. forsythia with abscess; P. gingivalis and P. micra with sinus tract; P. gingivalis and P. endodontalis or P. micra and P. endodontalis with abscess and sinus tract; and the combination of P. endodontalis, P. micra, T. forsythia and P. gingivalis with sinus tract (P < 0.05). Various combinations of P. micra, P. endodontalis, T. forsythia and P. gingivalis may contribute to abscesses or sinus tracts of endodontic origin with bacterial synergism in a Chinese population. © 2015 International Endodontic Journal. Published by John Wiley & Sons Ltd.
Sison-Mangus, Marilou P.; Jiang, Sunny; Kudela, Raphael M.; Mehic, Sanjin
2016-01-01
Pseudo-nitzschia blooms often occur in coastal and open ocean environments, sometimes leading to the production of the neurotoxin domoic acid that can cause severe negative impacts to higher trophic levels. Increasing evidence suggests a close relationship between phytoplankton bloom and bacterial assemblages, however, the microbial composition and succession during a bloom process is unknown. Here, we investigate the bacterial assemblages before, during and after toxic and non-toxic Pseudo-nitzschia blooms to determine the patterns of bacterial succession in a natural bloom setting. Opportunistic sampling of bacterial community profiles were determined weekly at Santa Cruz Municipal Wharf by 454 pyrosequencing and analyzed together with domoic acid levels, phytoplankton community and biomass, nutrients and temperature. We asked if the bacterial communities are similar between bloom and non-bloom events and if domoic acid or the presence of toxic algal species acts as a driving force that can significantly structure phytoplankton-associated bacterial communities. We found that bacterial diversity generally increases when Pseudo-nitzschia numbers decline. Furthermore, bacterial diversity is higher when the low-DA producing P. fraudulenta dominates the algal bloom while bacterial diversity is lower when high-DA producing P. australis dominates the algal bloom, suggesting that the presence of algal toxin can structure bacterial community. We also found bloom-related succession patterns among associated bacterial groups; Gamma-proteobacteria, were dominant during low toxic P. fraudulenta blooms comprising mostly of Vibrio spp., which increased in relative abundance (6–65%) as the bloom progresses. On the other hand, Firmicutes bacteria comprising mostly of Planococcus spp. (12–86%) dominate during high toxic P. australis blooms, with the bacterial assemblage showing the same bloom-related successional patterns in three independent bloom events. Other environmental
Periodic Colony Formation by Bacterial Species Bacillus subtilis
NASA Astrophysics Data System (ADS)
Wakita, Jun-ichi; Shimada, Hirotoshi; Itoh, Hiroto; Matsuyama, Tohey; Matsushita, Mitsugu
2001-03-01
We have investigated the periodic colony growth of bacterial species Bacillus subtilis. A colony grows cyclically with the interface repeating an advance (migration phase) and a rest (consolidation phase) alternately on a surface of semi-solid agar plate under appropriate environmental conditions, resulting in a concentric ring-like colony. It was found from macroscopic observations that the characteristic quantities for the periodic growth such as the migration time, the consolidation time and the terrace spacing do not depend so much on nutrient concentration Cn, but do on agar concentration Ca. The consolidation time was a weakly increasing function of Ca, while the migration time and the terrace spacing were, respectively, weakly and strongly decreasing function of Ca. Overall, the cycle (migration-plus-consolidation) time seems to be constant, and does not depend so much on both Cn and Ca. Microscopically, bacterial cells inside the growing front of a colony keep increasing their population during both migration and consolidation phases. It was also confirmed that their secreting surfactant called surfactin does not affect their periodic growth qualitatively, i.e., mutant cells which cannot secrete surfactin produce a concentric ring-like colony. All these results suggest that the diffusion of the nutrient and the surfactin are irrelevant to their periodic growth.
Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M
2011-04-01
Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora.
The in situ bacterial production of fluorescent organic matter; an investigation at a species level.
Fox, B G; Thorn, R M S; Anesio, A M; Reynolds, D M
2017-11-15
Aquatic dissolved organic matter (DOM) plays an essential role in biogeochemical cycling and transport of organic matter throughout the hydrological continuum. To characterise microbially-derived organic matter (OM) from common environmental microorganisms (Escherichia coli, Bacillus subtilis and Pseudomonas aeruginosa), excitation-emission matrix (EEM) fluorescence spectroscopy was employed. This work shows that bacterial organisms can produce fluorescent organic matter (FOM) in situ and, furthermore, that the production of FOM differs at a bacterial species level. This production can be attributed to structural biological compounds, specific functional proteins (e.g. pyoverdine production by P. aeruginosa), and/or metabolic by-products. Bacterial growth curve data demonstrates that the production of FOM is fundamentally related to microbial metabolism. For example, the majority of Peak T fluorescence (> 75%) is shown to be intracellular in origin, as a result of the building of proteins for growth and metabolism. This underpins the use of Peak T as a measure of microbial activity, as opposed to bacterial enumeration as has been previously suggested. This study shows that different bacterial species produce a range of FOM that has historically been attributed to high molecular weight allochthonous material or the degradation of terrestrial FOM. We provide definitive evidence that, in fact, it can be produced by microbes within a model system (autochthonous), providing new insights into the possible origin of allochthonous and autochthonous organic material present in aquatic systems. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
The effects of micronutrient deficiencies on bacterial species from the human gut microbiota
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hibberd, Matthew C.; Wu, Meng; Rodionov, Dmitry A.
Micronutrient deficiencies afflict two billion people. And while the impact of these imbalances on host biology has been studied extensively, much less is known about their effects on the developing or adult gut microbiota. Thus, we established a community of 44 cultured, sequenced human gut-derived bacterial species in gnotobiotic mice and fed the animals a defined, micronutrient-sufficient diet, followed by a derivative diet devoid of vitamin A, folate, iron or zinc, followed by return to the sufficient diet. Acute vitamin A deficiency had the largest effect on community structure and meta-transcriptome, with Bacteroides vulgatus, a prominent responder, increasing its abundancemore » in the absence of vitamin A, and manifesting transcriptional changes involving various metabolic pathways. Applying retinol selection to a library of 30,300 B. vulgatus transposon mutants revealed that disruption of acrR abrogated retinol sensitivity. Genetic complementation studies, microbial RNA-Seq, and transcription factor binding assays disclosed that AcrR functions as a repressor of an adjacent AcrAB-TolC efflux system plus other members of its regulon. Retinol efflux measurements in wild-type, acrR-mutant, and complemented acrR mutant strains, plus treatment with a pharmacologic inhibitor of the efflux system, revealed that AcrAB-TolC is a determinant of retinol and bile acid sensitivity. We associated acute vitamin A deficiency with altered bile acid metabolism in vivo, raising the possibility that retinol, bile acid metabolites, and AcrAB-TolC interact to influence the fitness of B. vulgatus and perhaps other microbiota members. This type of preclinical model can help develop mechanistic insights about and more effective treatment strategies for micronutrient deficiencies.« less
Betelman, Kfir; Caspi-Fluger, Ayelet; Shamir, Maayan; Chiel, Elad
2017-09-01
Facultative bacterial symbionts are widespread among insects and have diverse effects on their biology. Here, we focused on bacterial symbionts of three ecologically and economically important filth flies parasitoid species-Spalangia cameroni, Spalangia endius and Muscidifurax raptor. Both Spalangia species harbored a Sodalis bacterium that is closely related to Spalangia praecaptivus (a free-living bacterium) and to Sodalis symbionts of weevils. This is the only case of Sodalis infection in the important order Hymenoptera. We also found, for the first time in this parasitoid guild, a Rickettsia infecting the two Spalangia spp., albeit in much higher prevalence in S. cameroni. Molecular and phylogenetic analyses revealed that it is closely related to Rickettsia felis and other Rickettsia species from the 'transitional' group. All three parasitoid species harbored Wolbachia. Using multi-locus sequence typing, we found that M. raptor harbors a single Wolbachia strain whereas the Spalangia spp. have multiple strains. By controlled crossings, we found that Wolbachia infection in S. endius causes incomplete cytoplasmic incompatibility and increased longevity, thereby promoting Wolbachia's spread. In contrast, no effects of Wolbachia on the reproduction and longevity of M. raptor were found. This study underscores the diversity and nature of symbiotic interactions between microbes and insects. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Yue, Lifang; Lv, Hexin; Zhen, Jing; Jiang, Shengping; Jia, Shiru; Shen, Shigang; Gao, Lu; Dai, Yujie
2016-04-28
Preservation of fresh algae plays an important role in algae seed subculture and aquaculture. The determination and examination of the changes of cell viability, composition, and bacterial species during storage would help to take suitable preservation methods to prolong the preservation time of fresh algae. Nostoc flagelliforme is a kind of edible cyanobacterium with important herbal and dietary values. This article investigated the changes of bacterial species and biochemical characteristics of fresh N. flagelliforme concentrate during natural storage. It was found that the viability of cells decreased along with the storage time. Fourteen bacteria strains in the algae concentrate were identified by PCR-DGGE and were grouped into four phyla, including Cyanobacteria, Firmicutes, Proteobacteria, and Bacteroidetes. Among them, Enterococcus viikkiensis may be a concern in the preservation. Eleven volatile organic compounds were identified from N. flagelliforme cells, in which geosmin could be treated as an indicator of the freshness of N. flagelliforme. The occurrence of indole compound may be an indicator of the degradation of cells.
Rosacea, reactive oxygen species, and azelaic Acid.
Jones, David A
2009-01-01
Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea.
Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye
2015-08-01
The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.
Zeron Mullins, Melinda; Trouton, Konia M
2015-07-26
Bacterial vaginosis is associated with increased transmission of sexually transmitted infections, preterm labor, post-surgical infections, and endometritis. Current treatment for symptomatic bacterial vaginosis includes antibiotics, such as metronidazole, which are 70-80 % effective at one month after treatment and result in high recurrence rates and secondary candida infections. Intravaginal boric acid has been used for over a hundred years to treat vaginal infections, such as bacterial vaginosis. Boric acid is inexpensive, accessible, and has shown to be an effective treatment for other infections, such as vaginal candidiasis. To date, there has been no clinical trial evaluation of boric acid effectiveness to treat bacterial vaginosis. The BASIC (Boric Acid, Alternate Solution for Intravaginal Colonization) trial is a randomized, double-blinded, multicenter study. The study will enroll a minimum of 240 women of 16-50 years of age who are symptomatic with bacterial vaginosis. Eligible participants will have Amsel and Nugent scores confirming bacterial vaginosis. Women who are pregnant or menopausal or have other active co-infections will be excluded. Consenting participants who meet exclusion and inclusion criteria will be randomly assigned to one of three treatment groups: boric acid, metronidazole, or an inert placebo. Self-administration of treatment intravaginally for 10 days will be followed by clinical assessment at 7 and 30 days (days 17 and 40, respectively) after the end of the treatment phase. Primary outcome is a non-inferiority, per-protocol comparison of the effectiveness of boric acid with that of metronidazole at day 17, as measured by the Nugent score in 16-50 year olds. Secondary outcomes include: non-inferiority, intention-to-treat comparison of effectiveness of boric acid with that of metronidazole at day 17, analysis for both per-protocol and intention-to-treat at day 40, and safety considerations, including adverse effects requiring patient
USDA-ARS?s Scientific Manuscript database
Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...
Davis, Ian J; Bull, Christopher; Horsfall, Alexander; Morley, Ian; Harris, Stephen
2014-08-01
The current inability to culture the entirety of observed bacteria is well known and with the advent of ever more powerful molecular tools, that can survey bacterial communities at previously unattainable depth, the gap in our capacity to culture and define all of these species increases exponentially. This gap has essentially become the rate limiting step in determining how the knowledge of which species are present in a sample can be applied to understand the role of these species in an ecosystem or disease process. A case in point is periodontal disease, which is the most widespread oral disease in dogs. If untreated the disease results in significant pain, eventual loss of the dentition and potentially an increased risk of systemic diseases. Previous molecular based studies have identified the bacterial species associated with periodontal disease in dogs; however without cultured strains from many of these species it has not been possible to study whether they play a role in the disease process. Using a quantitative polymerase chain reaction (qPCR) directed approach a range of microbiological media were screened and optimized to enrich for previously uncultivated target species. A systematic screening methodology was then employed to isolate the species of interest. In cases where the target species were not cultivable in isolation, helper strains grown underneath a nitrocellulose membrane were used to provide the necessary growth factors. This guided media optimization approach enabled the purification of 14 species, 8 of which we had previously been unable to cultivate in isolation. It is also applicable to the targeted isolation of isolates from species that have previously been cultured (for example to study intra-species variation) as demonstrated by the successful isolation of 6 targeted isolates of already cultured species. To our knowledge this is the first time this combination of qPCR guided media optimization, strategic screening and helper strain
Use of Antibody to Membrane Adenosine Triphosphatase in the Study of Bacterial Relationships1
Whiteside, Theresa L.; De Siervo, August J.; Salton, Milton R. J.
1971-01-01
An antiserum to Ca2+-activated adenosine triphosphatase from membranes of Micrococcus lysodeikticus cross-reacted in agar gels with membrane adenosine triphosphatases from other pigmented micrococci and related species. Species of Micrococcus and Sarcina showed different levels of inhibition of adenosine triphosphatase activities in heterologous reactions with antiserum. Inter- and intraspecific relationships based on the inhibition reaction were compared with an independent parameter, namely the quantitative and qualitative composition of the bacterial membrane phospholipids and fatty acids. The guanine plus cytosine contents in the deoxyribonucleic acid of the species studied correlated well with the serological cross-reactivity of adenosine triphosphatases from their membranes. The types of cross-bridges found in the peptidoglycans of these cocci were also compared with the other properties. The results suggest that an antiserum specific for a major membrane protein may be a reliable and most useful adjunct in studying bacterial serotaxonomy. Images PMID:4323299
Severi, Emmanuele; Hosie, Arthur H F; Hawkhead, Judith A; Thomas, Gavin H
2010-03-01
The function of sialic acids in the biology of bacterial pathogens is reflected by the diverse range of solute transporters that can recognize these sugar acids. Here, we use an Escherichia coliDeltananT strain to characterize the function of known and proposed bacterial sialic acid transporters. We discover that the STM1128 gene from Salmonella enterica serovar Typhimurium, which encodes a member of the sodium solute symporter family, is able to restore growth on sialic acid to the DeltananT strain and is able to transport [(14)C]-sialic acid. Using the DeltananT genetic background, we performed a direct in vivo comparison of the transport properties of the STM1128 protein with those of sialic acid transporters of the major facilitator superfamily and tripartite ATP-independent periplasmic families, E. coli NanT and Haemophilus influenzae SiaPQM, respectively. This revealed that both STM1128 and SiaPQM are sodium-dependent and, unlike SiaPQM, both STM1128 and NanT are reversible secondary carriers, demonstrating qualitative functional differences in the properties of sialic acid transporters used by bacteria that colonize humans.
Ashen, Jon B.; Goff, Lynda J.
2000-01-01
The phylogenetic relationships of bacterial symbionts from three gall-bearing species in the marine red algal genus Prionitis (Rhodophyta) were inferred from 16S rDNA sequence analysis and compared to host phylogeny also inferred from sequence comparisons (nuclear ribosomal internal-transcribed-spacer region). Gall formation has been described previously on two species of Prionitis, P. lanceolata (from central California) and P. decipiens (from Peru). This investigation reports gall formation on a third related host, Prionitis filiformis. Phylogenetic analyses based on sequence comparisons place the bacteria as a single lineage within the Roseobacter grouping of the α subclass of the division Proteobacteria (99.4 to 98.25% sequence identity among phylotypes). Comparison of symbiont and host molecular phylogenies confirms the presence of three gall-bearing algal lineages and is consistent with the hypothesis that these red seaweeds and their bacterial symbionts are coevolving. The species specificity of these associations was investigated in nature by whole-cell hybridization of gall bacteria and in the laboratory by using cross-inoculation trials. Whole-cell in situ hybridization confirmed that a single bacterial symbiont phylotype is present in galls on each host. In laboratory trials, bacterial symbionts were incapable of inducing galls on alternate hosts (including two non-gall-bearing species). Symbiont-host specificity in Prionitis gall formation indicates an effective ecological separation between these closely related symbiont phylotypes and provides an example of a biological context in which to consider the organismic significance of 16S rDNA sequence variation. PMID:10877801
Bao, Weichen; Mi, Zhihui; Xu, Haiyan; Zheng, Yi; Kwok, Lai Yu; Zhang, Heping; Zhang, Wenyi
2016-01-01
The present study applied the PacBio single molecule, real-time sequencing technology (SMRT) in evaluating the quality of silage production. Specifically, we produced four types of Medicago sativa silages by using four different lactic acid bacteria-based additives (AD-I, AD-II, AD-III and AD-IV). We monitored the changes in pH, organic acids (including butyric acid, the ratio of acetic acid/lactic acid, γ-aminobutyric acid, 4-hyroxy benzoic acid and phenyl lactic acid), mycotoxins, and bacterial microbiota during silage fermentation. Our results showed that the use of the additives was beneficial to the silage fermentation by enhancing a general pH and mycotoxin reduction, while increasing the organic acids content. By SMRT analysis of the microbial composition in eight silage samples, we found that the bacterial species number and relative abundances shifted apparently after fermentation. Such changes were specific to the LAB species in the additives. Particularly, Bacillus megaterium was the initial dominant species in the raw materials; and after the fermentation process, Pediococcus acidilactici and Lactobacillus plantarum became the most prevalent species, both of which were intrinsically present in the LAB additives. Our data have demonstrated that the SMRT sequencing platform is applicable in assessing the quality of silage. PMID:27340760
Bao, Weichen; Mi, Zhihui; Xu, Haiyan; Zheng, Yi; Kwok, Lai Yu; Zhang, Heping; Zhang, Wenyi
2016-06-24
The present study applied the PacBio single molecule, real-time sequencing technology (SMRT) in evaluating the quality of silage production. Specifically, we produced four types of Medicago sativa silages by using four different lactic acid bacteria-based additives (AD-I, AD-II, AD-III and AD-IV). We monitored the changes in pH, organic acids (including butyric acid, the ratio of acetic acid/lactic acid, γ-aminobutyric acid, 4-hyroxy benzoic acid and phenyl lactic acid), mycotoxins, and bacterial microbiota during silage fermentation. Our results showed that the use of the additives was beneficial to the silage fermentation by enhancing a general pH and mycotoxin reduction, while increasing the organic acids content. By SMRT analysis of the microbial composition in eight silage samples, we found that the bacterial species number and relative abundances shifted apparently after fermentation. Such changes were specific to the LAB species in the additives. Particularly, Bacillus megaterium was the initial dominant species in the raw materials; and after the fermentation process, Pediococcus acidilactici and Lactobacillus plantarum became the most prevalent species, both of which were intrinsically present in the LAB additives. Our data have demonstrated that the SMRT sequencing platform is applicable in assessing the quality of silage.
Characteristics of organic acids in the fruit of different pumpkin species.
Nawirska-Olszańska, Agnieszka; Biesiada, Anita; Sokół-Łętowska, Anna; Kucharska, Alicja Z
2014-04-01
The aim of the research was to determine the composition of organic acids in fruit of different cultivars of three pumpkin species. The amount of acids immediately after fruit harvest and after 3 months of storage was compared. The content of organic acids in the examined pumpkin cultivars was assayed using the method of high performance liquid chromatography (HPLC). Three organic acids (citric acid, malic acid, and fumaric acid) were identified in the cultivars, whose content considerably varied depending on a cultivar. Three-month storage resulted in decreased content of the acids in the case of cultivars belonging to Cucurbita maxima and Cucurbita pepo species, while a slight increase was recorded for Cucurbita moschata species. Crown Copyright © 2013. Published by Elsevier Ltd. All rights reserved.
Lactic acid bacterial extract as a biogenic mineral growth modifier
NASA Astrophysics Data System (ADS)
Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal
2009-04-01
The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.
Cheating fosters species co-existence in well-mixed bacterial communities
Leinweber, Anne; Fredrik Inglis, R; Kümmerli, Rolf
2017-01-01
Explaining the enormous biodiversity observed in bacterial communities is challenging because ecological theory predicts that competition between species occupying the same niche should lead to the exclusion of less competitive community members. Competitive exclusion should be particularly strong when species compete for a single limiting resource or live in unstructured habitats that offer no refuge for weaker competitors. Here, we describe the ‘cheating effect’, a form of intra-specific competition that can counterbalance between-species competition, thereby fostering biodiversity in unstructured habitats. Using experimental communities consisting of the strong competitor Pseudomonas aeruginosa (PA) and its weaker counterpart Burkholderia cenocepacia (BC), we show that co-existence is impossible when the two species compete for a single limiting resource, iron. However, when introducing a PA cheating mutant, which specifically exploits the iron-scavenging siderophores produced by the PA wild type, we found that biodiversity was preserved under well-mixed conditions where PA cheats could outcompete the PA wild type. Cheating fosters biodiversity in our system because it creates strong intra-specific competition, which equalizes fitness differences between PA and BC. Our study identifies cheating – typically considered a destructive element – as a constructive force in shaping biodiversity. PMID:28060362
Serra, S; De Simeis, D
2018-03-01
The preparation of the high-value flavour γ-dodecalactone is based on the biotransformation of natural 10-HSA, which is in turn obtained by microbial hydration of oleic acid. We want to establish a reliable baker's yeast-mediated procedure for 10-HSA preparation. The previously reported yeast-mediated hydration procedures are unreliable because bacteria-free baker's yeast is not able to hydrate oleic acid. The actual responsible for performing this reaction are the bacterial contaminants present in baker's yeast. Moreover, we demonstrated that the enantioselectivity in the production of (R)-10-HSA is affected mainly by the temperature used in the biotransformation. We demonstrated that Saccharomyces cerevisiae is not able to hydrate oleic acid, whereas different bacterial strains present in baker's yeast transform oleic acid into (R)-10-HSA. We reported a general procedure for the preparation of (R)-10-HSA starting from oleic acid and using commercially available baker's yeast. This study holds both scientific and industrial interest. It unambiguously establishes that the eukaryote micro-organisms present in baker's yeast are not able to hydrate oleic acid. The isolation of oleic acid hydrating bacterial strains from commercial baker's yeast points to their prospective use for the industrial synthesis of 10-HSA. © 2017 The Society for Applied Microbiology.
Rosacea, Reactive Oxygen Species, and Azelaic Acid
2009-01-01
Rosacea is a common skin condition thought to be primarily an inflammatory disorder. Neutrophils, in particular, have been implicated in the inflammation associated with rosacea and mediate many of their effects through the release of reactive oxygen species. Recently, the role of reactive oxygen species in the pathophysiology of rosacea has been recognized. Many effective agents for rosacea, including topical azelaic acid and topical metronidazole, have anti-inflammatory properties. in-vitro models have demonstrated the potent antioxidant effects of azelaic acid, providing a potential mechanistic explanation for its efficacy in the treatment of rosacea. PMID:20967185
Negrel, Jonathan; Javelle, Francine; Morandi, Dominique; Lucchi, Géraldine
2016-12-01
A Gram-negative bacterium able to grow using chlorogenic acid (5-caffeoylquinic acid) as sole carbon source has been isolated from the roots of tomato plants inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. An intracellular esterase exhibiting very high affinity (K m = 2 μM) for chlorogenic acid has been extracted and purified by FPLC from the chlorogenate-grown cultures of this bacterium. The molecular mass of the purified esterase determined by SDS-PAGE was 61 kDa and its isoelectric point determined by chromatofocusing was 7.75. The esterase hydrolysed chlorogenic acid analogues (caffeoylshikimate, and the 4- and 3-caffeoylquinic acid isomers), feruloyl esterases substrates (methyl caffeate and methyl ferulate), and even caffeoyl-CoA in vitro but all of them were less active than chlorogenic acid, demonstrating that the esterase is a genuine chlorogenic acid esterase. It was also induced when the bacterial strain was cultured in the presence of hydroxycinnamic acids (caffeic, p-coumaric or ferulic acid) as sole carbon source, but not in the presence of simple phenolics such as catechol or protocatechuic acid, nor in the presence of organic acids such as succinic or quinic acids. The purified esterase was remarkably stable in the presence of methanol, rapid formation of methyl caffeate occurring when its activity was measured in aqueous solutions containing 10-60% methanol. Our results therefore show that this bacterial chlorogenase can catalyse the transesterification reaction previously detected during the methanolic extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots. Data are presented suggesting that colonisation by Rhizophagus irregularis could increase chlorogenic acid exudation from tomato roots, especially in nutrient-deprived plants, and thus favour the growth of chlorogenate-metabolizing bacteria on the root surface or in the mycorhizosphere. Copyright © 2016 Elsevier Masson SAS. All rights
Gross, Erin L.; Beall, Clifford J.; Kutsch, Stacey R.; Firestone, Noah D.; Leys, Eugene J.; Griffen, Ann L.
2012-01-01
Dental caries in very young children may be severe, result in serious infection, and require general anesthesia for treatment. Dental caries results from a shift within the biofilm community specific to the tooth surface, and acidogenic species are responsible for caries. Streptococcus mutans, the most common acid producer in caries, is not always present and occurs as part of a complex microbial community. Understanding the degree to which multiple acidogenic species provide functional redundancy and resilience to caries-associated communities will be important for developing biologic interventions. In addition, microbial community interactions in health and caries pathogenesis are not well understood. The purpose of this study was to investigate bacterial community profiles associated with the onset of caries in the primary dentition. In a combination cross-sectional and longitudinal design, bacterial community profiles at progressive stages of caries and over time were examined and compared to those of health. 16S rRNA gene sequencing was used for bacterial community analysis. Streptococcus mutans was the dominant species in many, but not all, subjects with caries. Elevated levels of S. salivarius, S. sobrinus, and S. parasanguinis were also associated with caries, especially in subjects with no or low levels of S. mutans, suggesting these species are alternative pathogens, and that multiple species may need to be targeted for interventions. Veillonella, which metabolizes lactate, was associated with caries and was highly correlated with total acid producing species. Among children without previous history of caries, Veillonella, but not S. mutans or other acid-producing species, predicted future caries. Bacterial community diversity was reduced in caries as compared to health, as many species appeared to occur at lower levels or be lost as caries advanced, including the Streptococcus mitis group, Neisseria, and Streptococcus sanguinis. This may have
Park, Yong-Soon; Lee, Boyoung; Ryu, Choong-Min
2016-07-02
Defense against diverse biotic and abiotic stresses requires the plant to distinguish between self and non-self signaling molecules. Pathogen/microbe-associated molecular patterns (PAMPs/MAMPs) are pivotal for triggering innate immunity in plants. Unlike in animals and humans, the precise roles of nucleic acids in plant innate immunity are unclear. We therefore investigated the effects of infiltration of total Pseudomonas syringae pv. tomato DC3000 (Pto DC3000) RNAs into Arabidopsis plants. The pathogen population was 10-fold lower in bacterial RNAs pre-treated Arabidopsis plants than in the control. Bacterial RNAs purity was confirmed by physical (sonication) and chemical (RNase A and proteinase K digestion) methods. The perception of bacterial RNAs, especially rRNAs, positively regulated mitogen-activated protein kinase (MAPK) and induced a reactive oxygen species burst, callose deposition, salicylic acid (SA) and jasmonic acid (JA) signaling, and defense-related genes. Therefore, bacterial RNAs function as a new MAMP that activates plant innate immunity, providing a new paradigm for plant-microbe interactions.
N-METHYL GROUPS IN BACTERIAL LIPIDS
Goldfine, Howard; Ellis, Martha E.
1964-01-01
Goldfine, Howard (Harvard Medical School, Boston, Mass.), and Martha E. Ellis. N-methyl groups in bacterial lipids. J. Bacteriol. 87:8–15. 1964.—The ability of bacteria to synthesize lecithin was examined by measuring the incorporation of the methyl group of methionine into the water-soluble moieties obtained on acid hydrolysis of bacterial lipids. Of 21 species examined, mostly of the order Eubacteriales, only 2, Agrobacterium radiobacter and A. rhizogenes, incorporated the methyl group of methionine into lipid-bound choline. Evidence was also obtained for the formation of lipid-bound N-methylethanolamine and N,N′-dimethylethanolamine in these two organisms. Two other species, Clostridium butyricum and Proteus vulgaris, incorporated the methyl group of methionine into lipid-bound N-methylethanolamine, but did not appear to be able to further methylate these lipids to form lecithin. The results of this study lend further strength to the generalization that bacteria, with the exception of the genus Agrobacterium, are unable to synthesize lecithin. PMID:14102879
Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*
Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.
2016-01-01
Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272
Chiapello, Hélène; Gendrault, Annie; Caron, Christophe; Blum, Jérome; Petit, Marie-Agnès; El Karoui, Meriem
2008-11-27
The recent availability of complete sequences for numerous closely related bacterial genomes opens up new challenges in comparative genomics. Several methods have been developed to align complete genomes at the nucleotide level but their use and the biological interpretation of results are not straightforward. It is therefore necessary to develop new resources to access, analyze, and visualize genome comparisons. Here we present recent developments on MOSAIC, a generalist comparative bacterial genome database. This database provides the bacteriologist community with easy access to comparisons of complete bacterial genomes at the intra-species level. The strategy we developed for comparison allows us to define two types of regions in bacterial genomes: backbone segments (i.e., regions conserved in all compared strains) and variable segments (i.e., regions that are either specific to or variable in one of the aligned genomes). Definition of these segments at the nucleotide level allows precise comparative and evolutionary analyses of both coding and non-coding regions of bacterial genomes. Such work is easily performed using the MOSAIC Web interface, which allows browsing and graphical visualization of genome comparisons. The MOSAIC database now includes 493 pairwise comparisons and 35 multiple maximal comparisons representing 78 bacterial species. Genome conserved regions (backbones) and variable segments are presented in various formats for further analysis. A graphical interface allows visualization of aligned genomes and functional annotations. The MOSAIC database is available online at http://genome.jouy.inra.fr/mosaic.
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Song, Zhen; Kenney, Janice P.L.; Fein, Jeremy B.
2015-02-09
Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has beenmore » observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.« less
NASA Astrophysics Data System (ADS)
Song, Zhen; Kenney, Janice P. L.; Fein, Jeremy B.; Bunker, Bruce A.
2012-06-01
Gram-positive and Gram-negative bacterial cells can remove Au from Au(III)-chloride solutions, and the extent of removal is strongly pH dependent. In order to determine the removal mechanisms, X-ray Absorption Fine Structure (XAFS) spectroscopy experiments were conducted on non-metabolizing biomass of Bacillus subtilis and Pseudomonas putida with fixed Au(III) concentrations over a range of bacterial concentrations and pH values. X-ray Absorption Near Edge Structure (XANES) and Extended X-ray Absorption Fine Structure (EXAFS) data on both bacterial species indicate that more than 90% of the Au atoms on the bacterial cell walls were reduced to Au(I). In contrast to what has been observed for Au(III) interaction with metabolizing bacterial cells, no Au(0) or Au-Au nearest neighbors were observed in our experimental systems. All of the removed Au was present as adsorbed bacterial surface complexes. For both species, the XAFS data suggest that although Au-chloride-hydroxide aqueous complexes dominate the speciation of Au in solution, Au on the bacterial cell wall is characterized predominantly by binding of Au atoms to sulfhydryl functional groups and amine and/or carboxyl functional groups, and the relative importance of the sulfhydryl groups increases with increasing pH and with decreasing Au loading. The XAFS data for both microorganism species suggest that adsorption is the first step in the formation of Au nanoparticles by bacteria, and the results enhance our ability to account for the behavior of Au in bacteria-bearing geologic systems.
EXPLOSIVE RADIATION OF A BACTERIAL SPECIES GROUP
Morlon, Hélène; Kemps, Brian D.; Plotkin, Joshua B.; Brisson, Dustin
2013-01-01
The current diversity of life on earth is the product of macroevolutionary processes that have shaped the dynamics of diversification. Although the tempo of diversification has been studied extensively in macroorganisms, much less is known about the rates of diversification in the exceedingly diverse and species-rich microbiota. Decreases in diversification rates over time, a signature of explosive radiations, are commonly observed in plant and animal lineages. However, the few existing analyses of microbial lineages suggest that the tempo of diversification in prokaryotes may be fundamentally different. Here, we use multilocus and genomic sequence data to test hypotheses about the rate of diversification in a well-studied pathogenic bacterial lineage, Borrelia burgdorferi sensu lato (sl). Our analyses support the hypothesis that an explosive radiation of lineages occurred near the origin of the clade, followed by a sharp decay in diversification rates. These results suggest that explosive radiations may be a general feature of evolutionary history across the tree of life. PMID:22834754
Tesfaye, Biruk; Sisay Tessema, Tesfaye; Tefera, Genene
2013-06-01
A study was conducted to isolate bacterial species/pathogens from the nasal cavity of apparently healthy and pneumonic sheep. Nasal swabs were collected aseptically, transported in tryptose soya broth and incubated for 24 h. Then, each swab was streaked onto chocolate and blood agar for culture. Bacterial species were identified following standard bacteriological procedures. Accordingly, a total of 1,556 bacteria were isolated from 960 nasal swabs collected from three different highland areas of Ethiopia, namely Debre Berhan, Asella, and Gimba. In Debre Berhan, 140 Mannheimia haemolytica, 81 Histophilus somni, 57 Staphylococcus species, and 52 Bibersteinia trehalosi were isolated. While from Gimba M. haemolytica, Staphylococcus, Streptococcus, and H. somni were isolated at rates of 25.2, 15.9, 11.4, and 5.9 %, respectively, of the total 647 bacterial species. In Asella from 352 bacterial species isolated, 93 (26.4 %) were M. haemolytica, 48 (13.6 %) were Staphylococcus species, 26 (7.4 %) were B. trehalosi, and 17 (4.8 %) H. somni were recognized. Further identification and characterization using BIOLOG identification system Enterococcus avium and Sphingomonas sanguinis were identified at 100 % probability, while, H. somni and Actinobacillus lignerisii were suggested by the system. The study showed that a variety of bacterial species colonize the nasal cavity of the Ethiopian highland sheep with variable proportion between healthy and pneumonic ones. To our knowledge, this is the first report on isolation of H. somni, an important pathogen in cattle, from the respiratory tract of a ruminant species in the country.
Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula
2014-02-01
There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t
Effects of remediation on the bacterial community of an acid mine drainage impacted stream.
Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G
2012-11-01
Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.
The fate of benzoic acid in various species
Bridges, J. W.; French, M. R.; Smith, R. L.; Williams, R. T.
1970-01-01
1. The urinary excretion of orally administered [14C]benzoic acid in man and 20 other species of animal was examined. 2. At a dose of 50mg/kg, benzoic acid was excreted by the rodents (rat, mouse, guinea pig, golden hamster, steppe lemming and gerbil), the rabbit, the cat and the capuchin monkey almost entirely as hippuric acid (95–100% of 24h excretion). 3. In man at a dose of 1mg/kg and the rhesus monkey at 20mg/kg benzoic acid was excreted entirely as hippuric acid. 4. At 50mg/kg benzoic acid was excreted as hippuric acid to the extent of about 80% of the 24h excretion in the squirrel monkey, pig, dog, ferret, hedgehog and pigeon, the other 20% being found as benzoyl glucuronide and benzoic acid, the latter possibly arising by decomposition of the former. 5. On increasing the dose of benzoic acid to 200mg/kg in the ferret, the proportion of benzoyl glucuronide excreted increased and that of hippuric acid decreased. This did not occur in the rabbit, which excreted 200mg/kg almost entirely as hippuric acid. It appears that the hedgehog and ferret are like the dog in respect to their metabolism of benzoic acid. 6. The Indian fruit bat produced only traces of hippuric acid and possibly has a defect in the glycine conjugation of benzoic acid. The main metabolite in this animal (dose 50mg/kg) was benzoyl glucuronide. 7. The chicken, side-necked turtle and gecko converted benzoic acid mainly into ornithuric acid, but all three species also excreted smaller amounts of hippuric acid. PMID:4990586
Netsvyetayeva, Irina; Marusza, Wojciech; Olszanski, Romuald; Szyller, Kamila; Krolak-Ulinska, Aneta; Swoboda-Kopec, Ewa; Sierdzinski, Janusz; Szymonski, Zachary; Mlynarczyk, Grazyna
2018-01-01
Cross-linked hyaluronic acid (HA) gel is widely used in esthetic medicine. Late bacterial infection (LBI) is a rare, but severe complication after HA augmentation. The aim of this study was to determine whether patients who underwent the HA injection procedure and developed LBI had qualitatively different bacterial flora on the skin compared to patients who underwent the procedure without any complications. The study group comprised 10 previously healthy women with recently diagnosed, untreated LBI after HA augmentation. The control group comprised 17 healthy women who had a similar amount of HA injected with no complications. To assess the difference between the two groups, their skin flora was cultured from nasal swabs, both before and after antibiotic treatment in the study group. A significant increase in the incidence of Staphylococcus epidermidis was detected in the control group ( P =0.000) compared to the study group. The study group showed a significantly higher incidence of Staphylococcus aureus ( P =0.005), Klebsiella pneumoniae ( P =0.006), Klebsiella oxytoca ( P =0.048), and Staphylococcus haemolyticus ( P =0.048) compared to the control group. The bacterial flora on the skin differed in patients with LBI from the control group. The control group's bacterial skin flora was dominated by S. epidermidis . Patients with LBI had a bacterial skin flora dominated by potentially pathogenic bacteria.
N-Acetyl-L-cysteine Effects on Multi-species Oral Biofilm Formation and Bacterial Ecology
Rasmussen, Karin; Nikrad, Julia; Reilly, Cavan; Li, Yuping; Jones, Robert S.
2015-01-01
Future therapies for the treatment of dental decay have to consider the importance of preserving bacterial ecology while reducing biofilm adherence to teeth. A multi-species plaque derived (MSPD) biofilm model was used to assess how concentrations of N-acetyl-L-cysteine (0, 0.1%, 1%, 10%) affected the growth of complex oral biofilms. Biofilms were grown (n=96) for 24 hours on hydroxyapatite disks in BMM media with 0.5% sucrose. Bacterial viability and biomass formation was examined on each disk using a microtiter plate reader. In addition, fluorescence microscopy and Scanning Electron Microscopy was used to qualitatively examine the effect of NAC on bacterial biofilm aggregation, extracellular components, and bacterial morphology. The total biomass was significantly decreased after exposure of both 1% (from 0.48, with a 95% confidence interval of (0.44, 0.57) to 0.35, with confidence interval (0.31, 0.38)) and 10% NAC (0.14 with confidence interval (0.11, 0.17)). 16S rRNA amplicon sequencing analysis indicated that 1% NAC reduced biofilm adherence while preserving biofilm ecology. PMID:26518358
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
Schoeffield, A. J.; Williams, H. N.
1990-01-01
A total of 44 bacterial species subdivided into 10 trial experiments have been used as prey for the recovery of bdellovibrios from samples of water from a brackish tidal pond and an aquarium saltwater tank. In an initial investigation, the recovery efficiency of each of the test bacterial species was compared with that of a designated standard prey, Vibrio parahaemolyticus P-5. The results revealed that in each case strain P-5 yielded an equal or significantly greater number of plaques of bdellovibrios than the test prey with but a single exception, strain CS5. In repeat experiments, CS5 yielded fewer plaques than P-5. To determine whether the use of multiple bacterial species compared with a single species as prey would increase the number of PFU of bdellovibrios recovered, material from plaques appearing on each of the test prey in the respective trials was sequentially subcultured onto two respective agar plates, the first containing as prey V. parahaemolyticus P-5 and the second containing the initial test organism. In nearly every case, subculture of plaques from lawns of the test prey to P-5 resulted in plaque formation. On the basis of the results, the use of several test prey and P-5 did not result in the recovery of any more bdellovibrio PFU than the use of P-5 alone. In this study, V. parahaemolyticus P-5 was observed to be the most efficient prey for the recovery of bdellovibrios from moderate salt water. PMID:16348096
AlWakeel, Suaad S
2017-09-01
This study aimed to determine the bacterial species colonizing the nasal and oropharyngeal mucosa of fuel workers in Central Riyadh, Saudi Arabia on a microbiological and molecular level. Throat and nasal swab samples were obtained from 29 fuel station attendants in the period of time extending from March to May 2014 in Riyadh, Saudi Arabia. Microbiological identification techniques were utilized to identify the bacterial species isolated. Antibiotic sensitivity was assessed for each of the bacterial isolates. Molecular identification techniques based on PCR analysis of specific genomic sequences was conducted and was the basis on which phylogeny representation was done for 10 randomly selected samples of the isolates. Blood was drawn and a complete blood count was conducted to note the hematological indices for each of the study participants. Nineteen bacterial species were isolated from both the nasal cavity and the oropharynx including Streptococcus thoraltensis , alpha-hemolytic streptococci, Staphylococcus hominis , coagulase-negative staphylococci, Leuconostoc mesenteroides , Erysipelothrix rhusiopathiae and several others. We found 100% sensitivity of the isolates to ciprofloxacin, cefuroxime and gentamicin. Whereas cefotaxime and azithromycin posted sensitivities of 85.7% and 91.4%, respectively. Low sensitivities (<60% sensitivity) to the antibiotics ampicillin, erythromycin, clarithromycin and norfloxacin were observed. Ninety-seven percent similarity to the microbial bank species was noted when the isolates were compared to it. Most hematological indices recorded were within the normal range. In conclusion, exposure to toxic fumes and compounds within fuel products may be a contributing factor to bacterial colonization of the respiratory tract in fuel workers.
[Effect of Gram-negative bacteria on fatty acids].
Vuillemin, N; Dupeyron, C; Leluan, G; Bory, J
1981-01-01
The gram-negative bacteria investigated exert various effects on fatty acids. P. aeruginosa and A. calcoaceticus catabolize any of the fatty acids tested. S. marcescens is effective upon all fatty acids excepting butyric acid. The long chain fatty acids only are degraded by E. coli, meanwhile the other fatty acids present a bacteriostatic or bactericidal activity on it. The authors propose a simple and original method for testing the capability of degradation of fatty acids by some bacterial species.
Rosales-Bravo, H; Morales-Torres, H C; Vázquez-Martínez, J; Molina-Torres, J; Olalde-Portugal, V; Partida-Martínez, L P
2017-11-01
Identify novel bacterial taxa that could increase the availability of branched-chain amino acids and the amount of distinctive volatiles during skim milk fermentation. We recovered 344 bacterial isolates from stool samples of healthy and breastfed infants. Five were selected based on their ability to produce branched-chain amino acids. Three strains were identified as Escherichia coli, one as Klebsiella pneumoniae and other as Klebsiella variicola by molecular and biochemical methods. HPLC and solid-phase microextraction with GC-MS were used for the determination of free amino acids and volatile compounds respectively. The consortium formed by K. variicola and four Lactobacillus species showed the highest production of Leu and Ile in skim milk fermentation. In addition, the production of volatile compounds, such as acetoin, ethanol, 2-nonanone, and acetic, hexanoic and octanoic acids, increased in comparison to commercial yogurt, Emmental and Gouda cheese. Also, distinctive volatiles, such as 2,3-butanediol, 4-methyl-2- hexanone and octanol, were identified. The use of K. variicola in combination with probiotic Lactobacillus species enhances the availability of Leu and Ile and the amount of distinctive volatiles during skim milk fermentation. The identified consortium increases the functional potential of fermented dairy products. © 2017 The Society for Applied Microbiology.
Epithelial cell pro-inflammatory cytokine response differs across dental plaque bacterial species.
Stathopoulou, Panagiota G; Benakanakere, Manjunatha R; Galicia, Johnah C; Kinane, Denis F
2010-01-01
The dental plaque is comprised of numerous bacterial species, which may or may not be pathogenic. Human gingival epithelial cells (HGECs) respond to perturbation by various bacteria of the dental plaque by production of different levels of inflammatory cytokines, which is a putative reflection of their virulence. The aim of the current study was to determine responses in terms of interleukin (IL)-1beta, IL-6, IL-8 and IL-10 secretion induced by Porphyromonas gingivalis, Aggregatibacter actinomycetemcomitans, Fusobacterium nucleatum and Streptococcus gordonii in order to gauge their virulence potential. HGECs were challenged with the four bacterial species, live or heat killed, at various multiplicity of infections and the elicited IL-1beta, IL-6, IL-8 and IL-10 responses were assayed by enzyme-linked immunosorbent assay. Primary HGECs challenged with live P. gingivalis produced high levels of IL-1beta, while challenge with live A. actinomycetemcomitans gave high levels of IL-8. The opportunistic pathogen F. nucleatum induces the highest levels of pro-inflammatory cytokines, while the commensal S. gordonii is the least stimulatory. We conclude that various dental plaque biofilm bacteria induce different cytokine response profiles in primary HGECs that may reflect their individual virulence or commensal status.
Benavides, Julio A; Cross, Paul C; Luikart, Gordon; Creel, Scott
2014-01-01
Cross-species transmission (CST) of bacterial pathogens has major implications for human health, livestock, and wildlife management because it determines whether control actions in one species may have subsequent effects on other potential host species. The study of bacterial transmission has benefitted from methods measuring two types of genetic variation: variable number of tandem repeats (VNTRs) and single nucleotide polymorphisms (SNPs). However, it is unclear whether these data can distinguish between different epidemiological scenarios. We used a simulation model with two host species and known transmission rates (within and between species) to evaluate the utility of these markers for inferring CST. We found that CST estimates are biased for a wide range of parameters when based on VNTRs and a most parsimonious reconstructed phylogeny. However, estimations of CST rates lower than 5% can be achieved with relatively low bias using as low as 250 SNPs. CST estimates are sensitive to several parameters, including the number of mutations accumulated since introduction, stochasticity, the genetic difference of strains introduced, and the sampling effort. Our results suggest that, even with whole-genome sequences, unbiased estimates of CST will be difficult when sampling is limited, mutation rates are low, or for pathogens that were recently introduced. PMID:25469159
Species and Scale Dependence of Bacterial Motion Dynamics
NASA Astrophysics Data System (ADS)
Sund, N. L.; Yang, X.; Parashar, R.; Plymale, A.; Hu, D.; Kelly, R.; Scheibe, T. D.
2017-12-01
Many metal reducing bacteria are motile with their motion characteristics described by run-and-tumble behavior exhibiting series of flights (jumps) and waiting (residence) time spanning a wide range of values. Accurate models of motility allow for improved design and evaluation of in-situ bioremediation in the subsurface. While many bioremediation models neglect the motion of the bacteria, others treat motility using an advection dispersion equation, which assumes that the motion of the bacteria is Brownian.The assumption of Brownian motion to describe motility has enormous implications on predictive capabilities of bioremediation models, yet experimental evidence of this assumption is mixed [1][2][3]. We hypothesize that this is due to the species and scale dependence of the motion dynamics. We test our hypothesis by analyzing videos of motile bacteria of five different species in open domains. Trajectories of individual cells ranging from several seconds to few minutes in duration are extracted in neutral conditions (in the absence of any chemical gradient). The density of the bacteria is kept low so that the interaction between the bacteria is minimal. Preliminary results show a transition from Fickian (Brownian) to non-Fickian behavior for one species of bacteria (Pelosinus) and persistent Fickian behavior of another species (Geobacter).Figure: Video frames of motile bacteria with the last 10 seconds of their trajectories drawn in red. (left) Pelosinus and (right) Geobacter.[1] Ariel, Gil, et al. "Swarming bacteria migrate by Lévy Walk." Nature Communications 6 (2015).[2] Saragosti, Jonathan, Pascal Silberzan, and Axel Buguin. "Modeling E. coli tumbles by rotational diffusion. Implications for chemotaxis." PloS one 7.4 (2012): e35412.[3] Wu, Mingming, et al. "Collective bacterial dynamics revealed using a three-dimensional population-scale defocused particle tracking technique." Applied and Environmental Microbiology 72.7 (2006): 4987-4994.
Van den Bossche, Lien; Hindryckx, Pieter; Devisscher, Lindsey; Devriese, Sarah; Van Welden, Sophie; Holvoet, Tom; Vilchez-Vargas, Ramiro; Vital, Marius; Pieper, Dietmar H.; Vanden Bussche, Julie; Vanhaecke, Lynn; Van de Wiele, Tom; De Vos, Martine
2017-01-01
ABSTRACT The promising results seen in studies of secondary bile acids in experimental colitis suggest that they may represent an attractive and safe class of drugs for the treatment of inflammatory bowel diseases (IBD). However, the exact mechanism by which bile acid therapy confers protection from colitogenesis is currently unknown. Since the gut microbiota plays a crucial role in the pathogenesis of IBD, and exogenous bile acid administration may affect the community structure of the microbiota, we examined the impact of the secondary bile acid ursodeoxycholic acid (UDCA) and its taurine or glycine conjugates on the fecal microbial community structure during experimental colitis. Daily oral administration of UDCA, tauroursodeoxycholic acid (TUDCA), or glycoursodeoxycholic acid (GUDCA) equally lowered the severity of dextran sodium sulfate-induced colitis in mice, as evidenced by reduced body weight loss, colonic shortening, and expression of inflammatory cytokines. Illumina sequencing demonstrated that bile acid therapy during colitis did not restore fecal bacterial richness and diversity. However, bile acid therapy normalized the colitis-associated increased ratio of Firmicutes to Bacteroidetes. Interestingly, administration of bile acids prevented the loss of Clostridium cluster XIVa and increased the abundance of Akkermansia muciniphila, bacterial species known to be particularly decreased in IBD patients. We conclude that UDCA, which is an FDA-approved drug for cholestatic liver disorders, could be an attractive treatment option to reduce dysbiosis and ameliorate inflammation in human IBD. IMPORTANCE Secondary bile acids are emerging as attractive candidates for the treatment of inflammatory bowel disease. Although bile acids may affect the intestinal microbial community structure, which significantly contributes to the course of these inflammatory disorders, the impact of bile acid therapy on the fecal microbiota during colitis has not yet been considered
Van den Bossche, Lien; Hindryckx, Pieter; Devisscher, Lindsey; Devriese, Sarah; Van Welden, Sophie; Holvoet, Tom; Vilchez-Vargas, Ramiro; Vital, Marius; Pieper, Dietmar H; Vanden Bussche, Julie; Vanhaecke, Lynn; Van de Wiele, Tom; De Vos, Martine; Laukens, Debby
2017-04-01
The promising results seen in studies of secondary bile acids in experimental colitis suggest that they may represent an attractive and safe class of drugs for the treatment of inflammatory bowel diseases (IBD). However, the exact mechanism by which bile acid therapy confers protection from colitogenesis is currently unknown. Since the gut microbiota plays a crucial role in the pathogenesis of IBD, and exogenous bile acid administration may affect the community structure of the microbiota, we examined the impact of the secondary bile acid ursodeoxycholic acid (UDCA) and its taurine or glycine conjugates on the fecal microbial community structure during experimental colitis. Daily oral administration of UDCA, tauroursodeoxycholic acid (TUDCA), or glycoursodeoxycholic acid (GUDCA) equally lowered the severity of dextran sodium sulfate-induced colitis in mice, as evidenced by reduced body weight loss, colonic shortening, and expression of inflammatory cytokines. Illumina sequencing demonstrated that bile acid therapy during colitis did not restore fecal bacterial richness and diversity. However, bile acid therapy normalized the colitis-associated increased ratio of Firmicutes to Bacteroidetes Interestingly, administration of bile acids prevented the loss of Clostridium cluster XIVa and increased the abundance of Akkermansia muciniphila , bacterial species known to be particularly decreased in IBD patients. We conclude that UDCA, which is an FDA-approved drug for cholestatic liver disorders, could be an attractive treatment option to reduce dysbiosis and ameliorate inflammation in human IBD. IMPORTANCE Secondary bile acids are emerging as attractive candidates for the treatment of inflammatory bowel disease. Although bile acids may affect the intestinal microbial community structure, which significantly contributes to the course of these inflammatory disorders, the impact of bile acid therapy on the fecal microbiota during colitis has not yet been considered. Here, we
Tashiro, Yukihiro; Matsumoto, Hiroko; Miyamoto, Hirokuni; Okugawa, Yuki; Pramod, Poudel; Miyamoto, Hisashi; Sakai, Kenji
2013-10-01
We investigated L-lactic acid production in static batch fermentation of kitchen refuse using a bacterial consortium from marine-animal-resource (MAR) composts at temperatures ranging from 30 to 65 °C. At relatively low temperatures butyric acid accumulated, whereas at higher temperatures L-lactic acid was produced. In particular, fermentation at 50 °C produced 34.5 g L(-1) L-lactic acid with 90% lactic acid selectivity and 100% optical purity. Denaturing gradient gel electrophoresis indicated that dominant bacteria present in the original MAR composts diminished rapidly and Bacillus coagulans strains became the dominant contributors to L-lactic acid production at 45, 50 and 55 °C. This is the first report of the achievement of 100% optical purity of L-lactic acid using a bacterial consortium. Copyright © 2013 Elsevier Ltd. All rights reserved.
Metal adsorption onto bacterial surfaces: development of a predictive approach
NASA Astrophysics Data System (ADS)
Fein, Jeremy B.; Martin, Aaron M.; Wightman, Peter G.
2001-12-01
Aqueous metal cation adsorption onto bacterial surfaces can be successfully modeled by means of a surface complexation approach. However, relatively few stability constants for metal-bacterial surface complexes have been measured. In order to determine the bacterial adsorption behavior of cations that have not been studied in the laboratory, predictive techniques are required that enable estimation of the stability constants of bacterial surface complexes. In this study, we use a linear free-energy approach to compare previously measured stability constants for Bacillus subtilis metal-carboxyl surface complexes with aqueous metal-organic acid anion stability constants. The organic acids that we consider are acetic, oxalic, citric, and tiron. We add to this limited data set by conducting metal adsorption experiments onto Bacillus subtilis, determining bacterial surface stability constants for Co, Nd, Ni, Sr, and Zn. The adsorption behavior of each of the metals studied here was described well by considering metal-carboxyl bacterial surface complexation only, except for the Zn adsorption behavior, which required carboxyl and phosphoryl complexation to obtain a suitable fit to the data. The best correlation between bacterial carboxyl surface complexes and aqueous organic acid anion stability constants was obtained by means of metal-acetate aqueous complexes, with a linear correlation coefficient of 0.97. This correlation applies only to unhydrolyzed aqueous cations and only to carboxyl binding of those cations, and it does not predict the binding behavior under conditions where metal binding to other bacterial surface site types occurs. However, the relationship derived in this study permits estimation of the carboxyl site adsorption behavior of a wide range of aqueous metal cations for which there is an absence of experimental data. This technique, coupled with the observation of similar adsorption behaviors across bacterial species (Yee and Fein, 2001), enables
Ye, N-F; Lü, F; Shao, L-M; Godon, J-J; He, P-J
2007-10-01
To estimate the effect of pH on the structures of bacterial community during fermentation of vegetable wastes and to investigate the relationship between bacterial community dynamics and product distribution. The bacterial communities in five batch tests controlled at different pH values [uncontrolled (about pH 4), 5, 6, 7 and 8] were monitored by denaturing gradient gel electrophoresis (DGGE) and single-strand conformation polymorphism (SSCP). The two fingerprinting methods provided consistent results and principal component analysis indicated a close similarity of bacterial community at pH 7 and 8 in addition to those at pH 4-6. This clustering also corresponded to dominant metabolic pathway. Thus, pH 7-8 shifted from alcohol-forming to acid-forming, especially butyric acid, whereas both alcohol-forming and acid-forming dominated at pH 5-6, and at pH 4, fermentation was inhibited. Shannon-weaver index was calculated to analyse the DGGE profiles, which revealed that the bacterial diversities at pH 7 and 8 were the highest while those at pH 5 and 4 (uncontrolled) were the lowest. According to sequencing results of the bands excised from DGGE gels, lactic acid bacteria and Clostridium sp. were predominant at all pH values, but varieties in species were observed as pH changed and time prolonged. The bacterial community during fermentation was materially influenced by pH and the diverse product distribution was related to the shift of different bacterial population. The study reveals that the impact of pH on fermentation product distribution is implemented primarily by changes of bacterial community. It also provides information about the comparison of two fingerprinting methods, DGGE and SSCP.
Gravett, Michael G.; Jin, Ling; Pavlova, Sylvia I.; Tao, Lin
2012-01-01
Background The rhesus monkey is an important animal model to study human vaginal health to which lactic acid bacteria play a significant role. However, the vaginal lactic acid bacterial species richness and relative abundance in rhesus monkeys is largely unknown. Methods Vaginal swab samples were aseptically obtained from 200 reproductive aged female rhesus monkeys. Following Rogosa agar plating, single bacterial colonies representing different morphotypes were isolated and analyzed for whole-cell protein profile, species-specifc PCR, and 16S rRNA gene sequence. Results A total of 510 Lactobacillus strains of 17 species and one Pediococcus acidilactici were identified. The most abundant species was L. reuteri, which colonized the vaginas of 86% monkeys. L. johnsonii was the second most abundant species, which colonized 36% of monkeys. The majority of monkeys were colonized by multiple Lactobacillus species. Conclusions The vaginas of rhesus monkeys are frequently colonized by multiple Lactobacillus species, dominated by L. reuteri. PMID:22429090
Adedeji, Bamidele S; Ezeokoli, Obinna T; Ezekiel, Chibundu N; Obadina, Adewale O; Somorin, Yinka M; Sulyok, Michael; Adeleke, Rasheed A; Warth, Benedikt; Nwangburuka, Cyril C; Omemu, Adebukola M; Oyewole, Olusola B; Krska, Rudolf
2017-10-03
The microbiological safety of spontaneously fermented foods is not always guaranteed due to the undefined fermenting microbial consortium and processing materials. In this study, two commonly consumed traditional condiments (iru and ogiri) and their respective raw seeds (locust bean and melon) purchased from markets in south-western Nigeria were assessed for bacterial diversity and mycotoxin contamination using 16S rRNA gene sequencing and liquid chromatography tandem mass spectrometry (LC-MS/MS), respectively. Two hundred isolates obtained from the raw seeds and condiments clustered into 10 operational taxonomic units (OTUs) and spanned 3 phyla, 10 genera, 14 species and 2 sub-species. Bacillus (25%) and Staphylococcus (23.5%) dominated other genera. Potentially pathogenic species such as Alcaligenes faecalis, Bacillus anthracis, Proteus mirabilis and Staphylococcus sciuri subsp. sciuri occurred in the samples, suggesting poor hygienic practice during production and/or handling of the condiments. A total of 48 microbial metabolites including 7 mycotoxins [3-nitropropionic acid, aflatoxin B 1 (AFB 1 ), AFB 2 , beauvericin, citrinin, ochratoxin A and sterigmatocystin] were quantified in the food samples. Melon and ogiri had detectable aflatoxin levels whereas locust bean and iru did not; the overall mycotoxin levels in the food samples were low. There is a need to educate processors/vendors of these condiments on good hygienic and processing practices. Copyright © 2017 Elsevier B.V. All rights reserved.
Bottone, E J; Perez, A A; Oeser, J L
1994-01-01
Loofah sponges are natural products used as exfoliative beauty aids. As a consequence of tracing a case of Pseudomonas aeruginosa folliculitis to a contaminated loofah sponge, we assessed the role of loofah sponges in supporting the growth of a wide variety of bacterial species. Our data show growth enhancement of sterile loofah fragments for numerous gram-negative (Pseudomonas, Xanthomonas, and Klebsiella) and gram-positive (Enterococcus and group B Streptococcus) species of human and environmental origin. Furthermore, hydrated new, unused loofah sponges undergo a shift in bacterial flora from sparse colonies of Bacillus spp. and Staphylococcus epidermidis to a predominantly gram-negative flora. The growth-promoting potential of loofah sponges (and other exfoliatives) can be further augmented by desquamated epithelial cells entrapped in the loofah fibrous matrix. Therefore, as loofah sponges (and other exfoliatives) can serve as a reservoir and a vehicle for the transmission of potentially pathogenic species to the human skin, we recommend their decontamination with hypochlorite (10%) bleach at regular intervals. Images PMID:8150959
Bottone, E J; Perez, A A; Oeser, J L
1994-02-01
Loofah sponges are natural products used as exfoliative beauty aids. As a consequence of tracing a case of Pseudomonas aeruginosa folliculitis to a contaminated loofah sponge, we assessed the role of loofah sponges in supporting the growth of a wide variety of bacterial species. Our data show growth enhancement of sterile loofah fragments for numerous gram-negative (Pseudomonas, Xanthomonas, and Klebsiella) and gram-positive (Enterococcus and group B Streptococcus) species of human and environmental origin. Furthermore, hydrated new, unused loofah sponges undergo a shift in bacterial flora from sparse colonies of Bacillus spp. and Staphylococcus epidermidis to a predominantly gram-negative flora. The growth-promoting potential of loofah sponges (and other exfoliatives) can be further augmented by desquamated epithelial cells entrapped in the loofah fibrous matrix. Therefore, as loofah sponges (and other exfoliatives) can serve as a reservoir and a vehicle for the transmission of potentially pathogenic species to the human skin, we recommend their decontamination with hypochlorite (10%) bleach at regular intervals.
Hao, Yi; Ma, Chuanxin; Zhang, Zetian; Song, Youhong; Cao, Weidong; Guo, Jing; Zhou, Guopeng; Rui, Yukui; Liu, Liming; Xing, Baoshan
2018-01-01
The aim of this study was to compare the toxicity effects of carbon nanomaterials (CNMs), namely fullerene (C 60 ), reduced graphene oxide (rGO) and multi-walled carbon nanotubes (MWCNTs), on a mini-ecosystem of rice grown in a loamy potted soil. We measured plant physiological and biochemical parameters and examined bacterial community composition in the CNMs-treated plant-soil system. After 30 days of exposure, all the three CNMs negatively affected the shoot height and root length of rice, significantly decreased root cortical cells diameter and resulted in shrinkage and deformation of cells, regardless of exposure doses (50 or 500 mg/kg). Additionally, at the high exposure dose of CNM, the concentrations of four phytohormones, including auxin, indoleacetic acid, brassinosteroid and gibberellin acid 4 in rice roots significantly increased as compared to the control. At the high exposure dose of MWCNTs and C 60 , activities of the antioxidant enzymes superoxide dismutase (SOD) and peroxidase (POD) in roots increased significantly. High-throughput sequencing showed that three typical CNMs had little effect on shifting the predominant soil bacterial species, but the presence of CNMs significantly altered the composition of the bacterial community. Our results indicate that different CNMs indeed resulted in environmental toxicity to rice and soil bacterial community in the rhizosphere and suggest that CNMs themselves and their incorporated products should be reasonably used to control their release/discharge into the environment to prevent their toxic effects on living organisms and the potential risks to food safety. Copyright © 2017 Elsevier Ltd. All rights reserved.
Ren, Jun; Lee, Haram; Yoo, Seung Min; Yu, Myeong-Sang; Park, Hansoo; Na, Dokyun
2017-04-01
DNA transformation that delivers plasmid DNAs into bacterial cells is fundamental in genetic manipulation to engineer and study bacteria. Developed transformation methods to date are optimized to specific bacterial species for high efficiency. Thus, there is always a demand for simple and species-independent transformation methods. We herein describe the development of a chemico-physical transformation method that combines a rubidium chloride (RbCl)-based chemical method and sepiolite-based physical method, and report its use for the simple and efficient delivery of DNA into various bacterial species. Using this method, the best transformation efficiency for Escherichia coli DH5α was 4.3×10 6 CFU/μg of pUC19 plasmid, which is higher than or comparable to the reported transformation efficiencies to date. This method also allowed the introduction of plasmid DNAs into Bacillus subtilis (5.7×10 3 CFU/μg of pSEVA3b67Rb), Bacillus megaterium (2.5×10 3 CFU/μg of pSPAsp-hp), Lactococcus lactis subsp. lactis (1.0×10 2 CFU/μg of pTRKH3-ermGFP), and Lactococcus lactis subsp. cremoris (2.2×10 2 CFU/μg of pMSP3535VA). Remarkably, even when the conventional chemical and physical methods failed to generate transformed cells in Bacillus sp. and Enterococcus faecalis, E. malodoratus and E. mundtii, our combined method showed a significant transformation efficiency (2.4×10 4 , 4.5×10 2 , 2×10 1 , and 0.5×10 1 CFU/μg of plasmid DNA). Based on our results, we anticipate that our simple and efficient transformation method should prove usefulness for introducing DNA into various bacterial species without complicated optimization of parameters affecting DNA entry into the cell. Copyright © 2017. Published by Elsevier B.V.
Species identification of corynebacteria by cellular fatty acid analysis.
Van den Velde, Sandra; Lagrou, Katrien; Desmet, Koen; Wauters, Georges; Verhaegen, Jan
2006-02-01
We evaluated the usefulness of cellular fatty acid analysis for the identification of corynebacteria. Therefore, 219 well-characterized strains belonging to 21 Corynebacterium species were analyzed with the Sherlock System of MIDI (Newark, DE). Most Corynebacterium species have a qualitative different fatty acid profile. Corynebacterium coyleae (subgroup 1), Corynebacterium riegelii, Corynebacterium simulans, and Corynebacterium imitans differ only quantitatively. Corynebacterium afermentans afermentans and C. coyleae (subgroup 2) have both a similar qualitative and quantitative profile. The commercially available database (CLIN 40, MIDI) identified only one third of the 219 strains correctly at the species level. We created a new database with these 219 strains. This new database was tested with 34 clinical isolates and could identify 29 strains correctly. Strains that remained unidentified were 2 Corynebacterium aurimucosum (not included in our database), 1 C. afermentans afermentans, and 2 Corynebacterium pseudodiphtheriticum. Cellular fatty acid analysis with a self-created database can be used for the identification and differentiation of corynebacteria.
Moor, Kathrin; Wotzka, Sandra Y.; Toska, Albulena; Diard, Médéric; Hapfelmeier, Siegfried; Slack, Emma
2016-01-01
Our mucosal surfaces are the main sites of non-vector-borne pathogen entry, as well as the main interface with our commensal microbiota. We are still only beginning to understand how mucosal adaptive immunity interacts with commensal and pathogenic microbes to influence factors such as infectivity, phenotypic diversity, and within-host evolution. This is in part due to difficulties in generating specific mucosal adaptive immune responses without disrupting the mucosal microbial ecosystem itself. Here, we present a very simple tool to generate inactivated mucosal vaccines from a broad range of culturable bacteria. Oral gavage of 1010 peracetic acid-inactivated bacteria induces high-titer-specific intestinal IgA in the absence of any measurable inflammation or species invasion. As a proof of principle, we demonstrate that this technique is sufficient to provide fully protective immunity in the murine model of invasive non-typhoidal Salmonellosis, even in the face of severe innate immune deficiency. PMID:26904024
Amino acid uptake by temperate tree species characteristic of low- and high-fertility habitats.
Scott, Emily E; Rothstein, David E
2011-10-01
The relationship between inorganic nitrogen (N) cycling and plant productivity is well established. However, recent research has demonstrated the ability of plants to take up low molecular weight organic N compounds (i.e., amino acids) at rates that often rival those of inorganic N forms. In this study, we hypothesize that temperate forest tree species characteristic of low-fertility habitats will prefer amino acids over species characteristic of high-fertility habitats. We measured the uptake of (15)N-labeled amino acids (glycine, glutamine, arginine, serine), ammonium (NH(4)(+)), and nitrate (NO(3)(-)) by four tree species that commonly occur in eastern North America, where their abundances have been correlated with inorganic N availability. Specific uptake rates of amino acids were largely similar for all tree species; however, high-fertility species took up NH(4)(+) at rates more than double those of low-fertility species, rendering amino acid N relatively more important to the N nutrition of low-fertility species. Low-fertility species acquired over four times more total N from arginine compared to NH(4)(+) and NO(3)(-); high-fertility species acquired the most N from NH(4)(+). Arginine had the highest uptake rates of any amino acid by all species; there were no significant differences in uptake rates of the remaining amino acids. Our results support the idea that the dominant species in a particular habitat are those best able to utilize the most available N resources.
Skaljac, M; Zanić, K; Hrnčić, S; Radonjić, S; Perović, T; Ghanim, M
2013-02-01
Several whitefly species (Hemiptera: Aleyrodidae) are cosmopolitan phloem-feeders that cause serious damage in numerous agricultural crops. All whitefly species harbor a primary bacterial symbiont and a diverse array of secondary symbionts which may influence several aspects of the insect's biology. We surveyed infections by secondary symbionts in Bemisia tabaci (Gennadius), Trialeurodes vaporariorum (Westwood) and Siphoninus phillyreae (Haliday) from areas in the east cost of the Adriatic Sea. Both the Middle East-Asia Minor 1 (MEAM1) and Mediterranean (MED) B. tabaci genetic groups were detected in Montenegro, whereas only the MED was confirmed in Croatia. Trialeurodes vaporariorum and S. phillyreae were found in all areas surveyed. MEAM1 and MED exhibited similarity to previously reported infections, while populations of T. vaporariorum from Montenegro harbored Rickettsia, Wolbachia and Cardinium in addition to previously reported Hamiltonella and Arsenopnohus. Siphoninus phillyreae harbored Hamiltonella, Wolbachia, Cardinium and Arsenophonus, with the latter appearing in two alleles. Multiple infections of all symbionts were common in the three insect species tested, with some reaching near fixation. Florescent in situ hybridization showed new localization patterns for Hamiltonella in S. phillyreae, and the morphology of the bacteriosome differed from that observed in other whitefly species. Our results show new infections with bacterial symbionts in the whitefly species studied. Infections with the same symbionts in reproductively isolated whitefly species confirm complex relationships between whiteflies and bacterial symbionts, and suggest possible horizontal transfer of some of these bacteria.
Hiebert, John M; Robson, Martin C
2016-01-01
Introduction: Wound debridement is considered essential in chronic wound management. Hypochlorous acid has been shown to be an effective agent in reducing wound bacterial counts in open wounds. Ultrasound-enabled wound debridement is an effective and efficient method of debridement. This study compared ultrasound irrigation with hypochlorous acid versus saline irrigation for wound debridement on pre- and postoperative wounds and determined regrowth of bacteria over 1 week period of time. Finally, the outcome of definitive wound closure of the clinically clean-appearing wounds was recorded. Methods: Seventeen consenting adult patients with chronic open wounds were randomly selected for study. The patients were randomly divided into the hypochlorous acid irrigation or saline irrigation group. All patients provided pre- and postoperative tissue samples for qualitative and quantitative bacteriology. For the time (7 days) between the debridement procedure and the definitive closure procedure, the wounds were dressed with a silver-impregnated dressing and a hydroconductive dressing. Results : Both types of irrigation in the ultrasonic system initially lowered the bacterial counts by 4 to 6 logs. However, by the time of definitive closure, the saline-irrigated wounds had bacterial counts back up to 10 5 whereas the hypochlorous acid-irrigated wounds remained at 10 2 or fewer. More than 80% of patients in the saline group had postoperative closure failure compared with 25% of patients in the hypochlorous acid group. Conclusions: Hypochlorous acid irrigation with ultrasound debridement reduced bacterial growth in chronic open wounds more efficiently than saline alone. Postoperative wound closure outcomes suggest a remarkable reduction in wound complications after wound debridement using hypochlorous acid irrigation with ultrasound versus saline alone.
Price, Christopher T. D.; Richards, Ashley M.; Von Dwingelo, Juanita E.; Samara, Hala A.; Kwaik, Yousef Abu
2013-01-01
Summary Legionella pneumophila, the causative agent of Legionnaires’ disease, invades and proliferates within a diverse range of free-living amoeba in the environment but upon transmission to humans the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. L. pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. PMID:24112119
Biomimetic/Optical Sensors for Detecting Bacterial Species
NASA Technical Reports Server (NTRS)
Homer, Margie; Ksendzov, Alexander; Yen, Shiao-Pin; Ryan, Margaret; Lazazzera, Beth
2006-01-01
Biomimetic/optical sensors have been proposed as means of real-time detection of bacteria in liquid samples through real-time detection of compounds secreted by the bacteria. Bacterial species of interest would be identified through detection of signaling compounds unique to those species. The best-characterized examples of quorum-signaling compounds are acyl-homoserine lactones and peptides. Each compound, secreted by each bacterium of an affected species, serves as a signal to other bacteria of the same species to engage in a collective behavior when the population density of that species reaches a threshold level analogous to a quorum. A sensor according to the proposal would include a specially formulated biomimetic film, made of a molecularly imprinted polymer (MIP), that would respond optically to the signaling compound of interest. The MIP film would be integrated directly onto an opticalwaveguide- based ring resonator for optical readout. Optically, the sensor would resemble the one described in Chemical Sensors Based on Optical Ring Resonators (NPO-40601), NASA Tech Briefs, Vol. 29, No. 10 (October 2005), page 32. MIPs have been used before as molecular- recognition compounds, though not in the manner of the present proposal. Molecular imprinting is an approach to making molecularly selective cavities in a polymer matrix. These cavities function much as enzyme receptor sites: the chemical functionality and shape of a cavity in the polymer matrix cause the cavity to bind to specific molecules. An MIP matrix is made by polymerizing monomers in the presence of the compound of interest (template molecule). The polymer forms around the template. After the polymer solidifies, the template molecules are removed from the polymer matrix by decomplexing them from their binding sites and then dissolving them, leaving cavities that are matched to the template molecules in size, shape, and chemical functionality. The cavities thus become molecular-recognition sites
Skarin, A; Sylwan, J
1986-12-01
On a solid agar medium the growth-inhibitory effect of 9 Lactobacillus strains cultured from vaginal content was tested on bacteria cultured from vaginal content of women with bacterial vaginosis: Mobiluncus, Gardnerella vaginalis, Bacteroides and anaerobic cocci. Inhibition zones were observed in the growth of all of the strains isolated from women with bacterial vaginosis around all lactobacilli. The inhibitory effect of the lactobacilli was further tested on various anaerobic and facultatively anaerobic species, both type strains and fresh extragenitally cultured strains. Four Bacteroides fragilis strains as well as 2 out of 4 Staphylococcus aureus strains were clearly inhibited by the lactobacilli. The inhibition zones were generally wider at pH 5.5 than at 6.0. For all inhibited strains, (the S. aureus excepted) a low pH on the agar around the lactobacilli correlated to wider growth-inhibition zones.
Michelou, Vanessa K.; Cottrell, Matthew T.; Kirchman, David L.
2007-01-01
We examined the contribution of photoheterotrophic microbes—those capable of light-mediated assimilation of organic compounds—to bacterial production and amino acid assimilation along a transect from Florida to Iceland from 28 May to 9 July 2005. Bacterial production (leucine incorporation at a 20 nM final concentration) was on average 30% higher in light than in dark-incubated samples, but the effect varied greatly (3% to 60%). To further characterize this light effect, we examined the abundance of potential photoheterotrophs and measured their contribution to bacterial production and amino acid assimilation (0.5 nM addition) using flow cytometry. Prochlorococcus and Synechococcus were abundant in surface waters where light-dependent leucine incorporation was observed, whereas aerobic anoxygenic phototrophic bacteria were abundant but did not correlate with the light effect. The per-cell assimilation rates of Prochlorococcus and Synechococcus were comparable to or higher than those of other prokaryotes, especially in the light. Picoeukaryotes also took up leucine (20 nM) and other amino acids (0.5 nM), but rates normalized to biovolume were much lower than those of prokaryotes. Prochlorococcus was responsible for 80% of light-stimulated bacterial production and amino acid assimilation in surface waters south of the Azores, while Synechococcus accounted for on average 12% of total assimilation. However, nearly 40% of the light-stimulated leucine assimilation was not accounted for by these groups, suggesting that assimilation by other microbes is also affected by light. Our results clarify the contribution of cyanobacteria to photoheterotrophy and highlight the potential role of other photoheterotrophs in biomass production and dissolved-organic-matter assimilation. PMID:17630296
Tessaro, Lucas W E; Murugan, Nirosha J; Persinger, Michael A
2015-03-01
Previous studies have shown that exposure to extremely low-frequency electromagnetic fields (ELF-EMFs) have negative effects on the rate of growth of bacteria. In the present study, two Gram-positive and two Gram-negative species were exposed to six magnetic field conditions in broth cultures. Three variations of the 'Thomas' pulsed frequency-modulated pattern; a strong-static "puck" magnet upwards of 5000G in intensity; a pair of these magnets rotating opposite one another at ∼30rpm; and finally a strong dynamic magnetic field generator termed the 'Resonator' with an average intensity of 250μT were used. Growth rate was discerned by optical density (OD) measurements every hour at 600nm. ELF-EMF conditions significantly affected the rates of growth of the bacterial cultures, while the two static magnetic field conditions were not statistically significant. Most interestingly, the 'Resonator' dynamic magnetic field increased the rates of growth of three species (Staphylococcus epidermidis, Staphylococcus aureus, and Escherichia coli), while slowing the growth of one (Serratia marcescens). We suggest that these effects are due to individual biophysical characteristics of the bacterial species. Copyright © 2015 Elsevier GmbH. All rights reserved.
Antarctic ice core samples: culturable bacterial diversity.
Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R
2013-01-01
Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
USDA-ARS?s Scientific Manuscript database
A series of experiments were conducted to examine reductions in bacterial contamination of broiler carcasses washed in a spray cabinet with various concentrations of lauric acid (LA)-potassium hydroxide (KOH) solutions. Fifty eviscerated carcasses and 5 ceca were obtained from the processing line of...
Ohr plays a central role in bacterial responses against fatty acid hydroperoxides and peroxynitrite
Alegria, Thiago G. P.; Hugo, Martín; Trujillo, Madia; de Oliveira, Marcos Antonio; Miyamoto, Sayuri; Queiroz, Raphael F.; Valadares, Napoleão Fonseca; Garratt, Richard C.; Radi, Rafael; Di Mascio, Paolo; Augusto, Ohara
2017-01-01
Organic hydroperoxide resistance (Ohr) enzymes are unique Cys-based, lipoyl-dependent peroxidases. Here, we investigated the involvement of Ohr in bacterial responses toward distinct hydroperoxides. In silico results indicated that fatty acid (but not cholesterol) hydroperoxides docked well into the active site of Ohr from Xylella fastidiosa and were efficiently reduced by the recombinant enzyme as assessed by a lipoamide-lipoamide dehydrogenase–coupled assay. Indeed, the rate constants between Ohr and several fatty acid hydroperoxides were in the 107–108 M−1⋅s−1 range as determined by a competition assay developed here. Reduction of peroxynitrite by Ohr was also determined to be in the order of 107 M−1⋅s−1 at pH 7.4 through two independent competition assays. A similar trend was observed when studying the sensitivities of a ∆ohr mutant of Pseudomonas aeruginosa toward different hydroperoxides. Fatty acid hydroperoxides, which are readily solubilized by bacterial surfactants, killed the ∆ohr strain most efficiently. In contrast, both wild-type and mutant strains deficient for peroxiredoxins and glutathione peroxidases were equally sensitive to fatty acid hydroperoxides. Ohr also appeared to play a central role in the peroxynitrite response, because the ∆ohr mutant was more sensitive than wild type to 3-morpholinosydnonimine hydrochloride (SIN-1 , a peroxynitrite generator). In the case of H2O2 insult, cells treated with 3-amino-1,2,4-triazole (a catalase inhibitor) were the most sensitive. Furthermore, fatty acid hydroperoxide and SIN-1 both induced Ohr expression in the wild-type strain. In conclusion, Ohr plays a central role in modulating the levels of fatty acid hydroperoxides and peroxynitrite, both of which are involved in host–pathogen interactions. PMID:28028230
Bacterial populations associated with the dirty area of a South African poultry abattoir.
Geornaras, I; de Jesus, A E; von Holy, A
1998-06-01
Bacterial populations associated with three sample types from the neck region of poultry carcasses in the dirty area of an abattoir were characterized. Sample types before and after scalding were skin only, feathers only, and a skin and feather combination. The neck skin of carcasses after the defeathering processing stage was also sampled. Bacterial populations associated with water from the scald tank, rubber fingers at the exit of the defeathering machine, and air in the dirty area were also characterized. Bacterial colonies (751) were randomly isolated from yeast extract-supplemented tryptone soya agar plates exhibiting 30 to 300 colonies. Micrococcus spp. were isolated in the highest proportion from pre-and postscalded carcass samples (63.5 to 86.1% of isolates), regardless of the sample type. Conversely, Enterobacteriaceae (40.3%), Acinetobacter (19.4%), and Aeromonas/Vibrio (12.5%) species predominated on neck skin samples taken from mechanically defeathered carcasses. Isolates from the rubber fingers were, however, predominantly Micrococcus spp. (94.4%). Bacterial groups isolated in the highest proportion from scald tank water samples were Micrococcus spp. (38.3%), species of Enterobacteriaceae (29.1%), and lactic acid bacteria (17.0%). Corynebacterium spp., species of Enterobacteriaceae, and Micrococcus spp. were dominant on air settle plates.
Davis, Ian J.; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen
2013-01-01
Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease. PMID:24349448
Davis, Ian J; Wallis, Corrin; Deusch, Oliver; Colyer, Alison; Milella, Lisa; Loman, Nick; Harris, Stephen
2013-01-01
Periodontal disease is the most widespread oral disease in dogs which if left untreated results in significant pain to the pet and loss of dentition. The objective of this study was to identify bacterial species in canine plaque that are significantly associated with health, gingivitis and mild periodontitis (<25% attachment loss). In this survey subgingival plaque samples were collected from 223 dogs with healthy gingiva, gingivitis and mild periodontitis with 72 to 77 samples per health status. DNA was extracted from the plaque samples and subjected to PCR amplification of the V1-V3 region of the 16S rDNA. Pyrosequencing of the PCR amplicons identified a total of 274 operational taxonomic units after bioinformatic and statistical analysis. Porphyromonas was the most abundant genus in all disease stages, particularly in health along with Moraxella and Bergeyella. Peptostreptococcus, Actinomyces, and Peptostreptococcaceae were the most abundant genera in mild periodontitis. Logistic regression analysis identified species from each of these genera that were significantly associated with health, gingivitis or mild periodontitis. Principal component analysis showed distinct community profiles in health and disease. The species identified show some similarities with health and periodontal disease in humans but also major differences. In contrast to human, healthy canine plaque was found to be dominated by Gram negative bacterial species whereas Gram positive anaerobic species predominate in disease. The scale of this study surpasses previously published research and enhances our understanding of the bacterial species present in canine subgingival plaque and their associations with health and early periodontal disease.
Emerging Bacterial Infection: Identification and Clinical Significance of Kocuria Species
Palange, Padmavali; Vaish, Ritu; Bhatti, Adnan Bashir; Kale, Vinod; Kandi, Maheshwar Reddy; Bhoomagiri, Mohan Rao
2016-01-01
Recently there have been reports of gram-positive cocci which are morphologically similar to both Staphylococci and the Micrococci. These bacteria have been identified as Kocuria species with the help of automated identification system and other molecular methods including 16S rRNA (ribosomal ribonucleic acid) evaluation. Kocuria belongs to the family Micrococcaceae which also includes Staphylococcus species and Micrococcus species. Isolation and clinical significance of these bacteria from human specimens warrant great caution as it does not necessarily confirm infection due to their ubiquitous presence, and as a normal flora of skin and mucous membranes in human and animals. Most clinical microbiology laboratories ignore such bacteria as laboratory and specimen contaminants. With increasing reports of infections associated with these bacteria, it is now important for clinical microbiologists to identify and enumerate the virulence and antibiotic susceptibility patterns of such bacteria and assist clinicians in improving the patient care and management. We review the occurrence and clinical significance of Kocuria species. PMID:27630804
Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer
Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.
2009-01-01
Background: Phylogeographic reconstruction of some bacterial populations is hindered by low diversity coupled with high levels of lateral gene transfer. A comparison of recombination levels and diversity at seven housekeeping genes for eleven bacterial species, most of which are commonly cited as having high levels of lateral gene transfer shows that the relative contributions of homologous recombination versus mutation for Burkholderia pseudomallei is over two times higher than for Streptococcus pneumoniae and is thus the highest value yet reported in bacteria. Despite the potential for homologous recombination to increase diversity, B. pseudomallei exhibits a relative lack of diversity at these loci. In these situations, whole genome genotyping of orthologous shared single nucleotide polymorphism loci, discovered using next generation sequencing technologies, can provide very large data sets capable of estimating core phylogenetic relationships. We compared and searched 43 whole genome sequences of B. pseudomallei and its closest relatives for single nucleotide polymorphisms in orthologous shared regions to use in phylogenetic reconstruction. Results: Bayesian phylogenetic analyses of >14,000 single nucleotide polymorphisms yielded completely resolved trees for these 43 strains with high levels of statistical support. These results enable a better understanding of a separate analysis of population differentiation among >1,700 B. pseudomallei isolates as defined by sequence data from seven housekeeping genes. We analyzed this larger data set for population structure and allele sharing that can be attributed to lateral gene transfer. Our results suggest that despite an almost panmictic population, we can detect two distinct populations of B. pseudomallei that conform to biogeographic patterns found in many plant and animal species. That is, separation along Wallace's Line, a biogeographic boundary between Southeast Asia and Australia. Conclusion: We describe an
Lee, Robert J.; Hariri, Benjamin M.; McMahon, Derek B.; Chen, Bei; Doghramjii, Laurel; Adappa, Nithin D.; Palmer, James N.; Kennedy, David W.; Jiang, Peihua; Margolskee, Robert F.; Cohen, Noam A.
2017-01-01
In the upper respiratory epithelium, bitter and sweet taste receptors present in solitary chemosensory cells influence antimicrobial innate immune defense responses. Whereas activation of the bitter taste receptor (T2R) stimulates surrounding epithelial cells to release antimicrobial peptides, activation of the sweet taste receptor (T1R) in the same cells inhibits this response. It is thought that this mechanism exists to control the magnitude of antimicrobial peptide release based upon the sugar content of airway surface liquid. We hypothesized that D-amino acids, which are produced by various bacteria and activate T1R in taste receptor cells in the mouth, may also activate T1R in the airway. Here, we show that both the T1R2 and T1R3 subunits of the sweet taste receptor (T1R2/3) are present in the same chemosensory cells of primary human sinonasal epithelial cultures. Respiratory isolates of Staphylococcus species, but not Pseudomonas aeruginosa, produced at least two D-amino acids that activate the sweet taste receptor. In addition to inhibiting P. aeruginosa biofilm formation, D-amino acids derived from Staphylococcus inhibited T2R-mediated signaling and defensin secretion in sinonasal cells by activating T1R2/3. D-amino acid–mediated activation of T1R2/3 also enhanced epithelial cell death during challenge with Staphylococcus aureus in the presence of the bitter-receptor–activating compound denatonium benzoate. These data establish a potential mechanism for interkingdom signaling in the airway mediated by bacterial D-amino acids and the mammalian sweet taste receptor in airway chemosensory cells. PMID:28874606
Kunihiro, Tadao; Veuger, Bart; Vasquez-Cardenas, Diana; Pozzato, Lara; Le Guitton, Marie; Moriya, Kazuyoshi; Kuwae, Michinobu; Omori, Koji; Boschker, Henricus T S; van Oevelen, Dick
2014-01-01
Phospholipid-derived fatty acids (PLFA) and respiratory quinones (RQ) are microbial compounds that have been utilized as biomarkers to quantify bacterial biomass and to characterize microbial community structure in sediments, waters, and soils. While PLFAs have been widely used as quantitative bacterial biomarkers in marine sediments, applications of quinone analysis in marine sediments are very limited. In this study, we investigated the relation between both groups of bacterial biomarkers in a broad range of marine sediments from the intertidal zone to the deep sea. We found a good log-log correlation between concentrations of bacterial PLFA and RQ over several orders of magnitude. This relationship is probably due to metabolic variation in quinone concentrations in bacterial cells in different environments, whereas PLFA concentrations are relatively stable under different conditions. We also found a good agreement in the community structure classifications based on the bacterial PLFAs and RQs. These results strengthen the application of both compounds as quantitative bacterial biomarkers. Moreover, the bacterial PLFA- and RQ profiles revealed a comparable dissimilarity pattern of the sampled sediments, but with a higher level of dissimilarity for the RQs. This means that the quinone method has a higher resolution for resolving differences in bacterial community composition. Combining PLFA and quinone analysis as a complementary method is a good strategy to yield higher resolving power in bacterial community structure.
Aldunate, Muriel; Srbinovski, Daniela; Hearps, Anna C.; Latham, Catherine F.; Ramsland, Paul A.; Gugasyan, Raffi; Cone, Richard A.; Tachedjian, Gilda
2015-01-01
Lactic acid and short chain fatty acids (SCFAs) produced by vaginal microbiota have reported antimicrobial and immune modulatory activities indicating their potential as biomarkers of disease and/or disease susceptibility. In asymptomatic women of reproductive-age the vaginal microbiota is comprised of lactic acid-producing bacteria that are primarily responsible for the production of lactic acid present at ~110 mM and acidifying the vaginal milieu to pH ~3.5. In contrast, bacterial vaginosis (BV), a dysbiosis of the vaginal microbiota, is characterized by decreased lactic acid-producing microbiota and increased diverse anaerobic bacteria accompanied by an elevated pH>4.5. BV is also characterized by a dramatic loss of lactic acid and greater concentrations of mixed SCFAs including acetate, propionate, butyrate, and succinate. Notably women with lactic acid-producing microbiota have more favorable reproductive and sexual health outcomes compared to women with BV. Regarding the latter, BV is associated with increased susceptibility to sexually transmitted infections (STIs) including HIV. In vitro studies demonstrate that lactic acid produced by vaginal microbiota has microbicidal and virucidal activities that may protect against STIs and endogenous opportunistic bacteria as well as immune modulatory properties that require further characterization with regard to their effects on the vaginal mucosa. In contrast, BV-associated SCFAs have far less antimicrobial activity with the potential to contribute to a pro-inflammatory vaginal environment. Here we review the composition of lactic acid and SCFAs in respective states of eubiosis (non-BV) or dysbiosis (BV), their effects on susceptibility to bacterial/viral STIs and whether they have inherent microbicidal/virucidal and immune modulatory properties. We also explore their potential as biomarkers for the presence and/or increased susceptibility to STIs. PMID:26082720
Korean indigenous bacterial species with valid names belonging to the phylum Actinobacteria.
Bae, Kyung Sook; Kim, Mi Sun; Lee, Ji Hee; Kang, Joo Won; Kim, Dae In; Lee, Ji Hee; Seong, Chi Nam
2016-12-01
, Gyeonggi, Jeonnam, Daejeon, and Chungnam. A large number of novel actinobacterial species continue to be discovered since the Korean government is encouraging the search for new bacterial species and researchers are endeavoring to find out novel strains from extreme or untapped environments.
Bacterial fatty acids enhance recovery from the dauer larva in Caenorhabditis elegans.
Kaul, Tiffany K; Reis Rodrigues, Pedro; Ogungbe, Ifedayo V; Kapahi, Pankaj; Gill, Matthew S
2014-01-01
The dauer larva is a specialized dispersal stage in the nematode Caenorhabditis elegans that allows the animal to survive starvation for an extended period of time. The dauer does not feed, but uses chemosensation to identify new food sources and to determine whether to resume reproductive growth. Bacteria produce food signals that promote recovery of the dauer larva, but the chemical identities of these signals remain poorly defined. We find that bacterial fatty acids in the environment augment recovery from the dauer stage under permissive conditions. The effect of increased fatty acids on different dauer constitutive mutants indicates a role for insulin peptide secretion in coordinating recovery from the dauer stage in response to fatty acids. These data suggest that worms can sense the presence of fatty acids in the environment and that elevated levels can promote recovery from dauer arrest. This may be important in the natural environment where the dauer larva needs to determine whether the environment is appropriate to support reproductive growth following dauer exit.
Price, Christopher T D; Richards, Ashley M; Von Dwingelo, Juanita E; Samara, Hala A; Abu Kwaik, Yousef
2014-02-01
Legionella pneumophila, the causative agent of Legionnaires' disease, invades and proliferates within a diverse range of free-living amoeba in the environment, but upon transmission to humans, the bacteria hijack alveolar macrophages. Intracellular proliferation of L. pneumophila in two evolutionarily distant hosts is facilitated by bacterial exploitation of conserved host processes that are targeted by bacterial protein effectors injected into the host cell. A key aspect of microbe-host interaction is microbial extraction of nutrients from the host, but understanding of this is still limited. AnkB functions as a nutritional virulence factor and promotes host proteasomal degradation of polyubiquitinated proteins generating gratuitous levels of limiting host cellular amino acids. Legionella pneumophila is auxotrophic for several amino acids including cysteine, which is a metabolically preferred source of carbon and energy during intracellular proliferation, but is limiting in both amoebae and humans. We propose that synchronization of bacterial amino acids auxotrophy with the host is a driving force in pathogenic evolution and nutritional adaptation of L. pneumophila and other intracellular bacteria to life within the host cell. Understanding microbial strategies of nutrient generation and acquisition in the host will provide novel antimicrobial strategies to disrupt pathogen access to essential sources of carbon and energy. © 2013 Society for Applied Microbiology and John Wiley & Sons Ltd.
Sphagnum mosses harbour highly specific bacterial diversity during their whole lifecycle.
Bragina, Anastasia; Berg, Christian; Cardinale, Massimiliano; Shcherbakov, Andrey; Chebotar, Vladimir; Berg, Gabriele
2012-04-01
Knowledge about Sphagnum-associated microbial communities, their structure and their origin is important to understand and maintain climate-relevant Sphagnum-dominated bog ecosystems. We studied bacterial communities of two cosmopolitan Sphagnum species, which are well adapted to different abiotic parameters (Sphagnum magellanicum, which are strongly acidic and ombrotrophic, and Sphagnum fallax, which are weakly acidic and mesotrophic), in three Alpine bogs in Austria by a multifaceted approach. Great differences between bacterial fingerprints of both Sphagna were found independently from the site. This remarkable specificity was confirmed by a cloning and a deep sequencing approach. Besides the common Alphaproteobacteria, we found a discriminative spectrum of bacteria; although Gammaproteobacteria dominated S. magellanicum, S. fallax was mainly colonised by Verrucomicrobia and Planctomycetes. Using this information for fluorescent in situ hybridisation analyses, corresponding colonisation patterns for Alphaproteobacteria and Planctomycetes were detected. Bacterial colonies were found in high abundances inside the dead big hyalocytes, but they were always connected with the living chlorocytes. Using multivariate statistical analysis, the abiotic factors nutrient richness and pH were identified to modulate the composition of Sphagnum-specific bacterial communities. Interestingly, we found that the immense bacterial diversity was transferred via the sporophyte to the gametophyte, which can explain the high specificity of Sphagnum-associated bacteria over long distances. In contrast to higher plants, which acquire their bacteria mainly from the environment, mosses as the phylogenetically oldest land plants maintain their bacterial diversity within the whole lifecycle.
Sphagnum mosses harbour highly specific bacterial diversity during their whole lifecycle
Bragina, Anastasia; Berg, Christian; Cardinale, Massimiliano; Shcherbakov, Andrey; Chebotar, Vladimir; Berg, Gabriele
2012-01-01
Knowledge about Sphagnum-associated microbial communities, their structure and their origin is important to understand and maintain climate-relevant Sphagnum-dominated bog ecosystems. We studied bacterial communities of two cosmopolitan Sphagnum species, which are well adapted to different abiotic parameters (Sphagnum magellanicum, which are strongly acidic and ombrotrophic, and Sphagnum fallax, which are weakly acidic and mesotrophic), in three Alpine bogs in Austria by a multifaceted approach. Great differences between bacterial fingerprints of both Sphagna were found independently from the site. This remarkable specificity was confirmed by a cloning and a deep sequencing approach. Besides the common Alphaproteobacteria, we found a discriminative spectrum of bacteria; although Gammaproteobacteria dominated S. magellanicum, S. fallax was mainly colonised by Verrucomicrobia and Planctomycetes. Using this information for fluorescent in situ hybridisation analyses, corresponding colonisation patterns for Alphaproteobacteria and Planctomycetes were detected. Bacterial colonies were found in high abundances inside the dead big hyalocytes, but they were always connected with the living chlorocytes. Using multivariate statistical analysis, the abiotic factors nutrient richness and pH were identified to modulate the composition of Sphagnum-specific bacterial communities. Interestingly, we found that the immense bacterial diversity was transferred via the sporophyte to the gametophyte, which can explain the high specificity of Sphagnum-associated bacteria over long distances. In contrast to higher plants, which acquire their bacteria mainly from the environment, mosses as the phylogenetically oldest land plants maintain their bacterial diversity within the whole lifecycle. PMID:22094342
Tønjum, T; Bukholm, G; Bøvre, K
1989-05-01
DNA-DNA hybridization using total genomic DNA probes may represent a way of differentiating between miscellaneous bacterial species. This was studied with type and reference strains of 20 species in Moraxella, Kingella, and other selected Gram-negative groups. Both radioactive and biotin labelling were employed. Most of the species examined were easily distinguished, such as Moraxella (Branhamella) catarrhalis, M.(B.) ovis, M. atlantae, M. phenylpyruvica, M. osloensis, Neisseria elongata, N. meningitidis, Kingella kingae, K. indologenes, K. dentrificans, Oligella urethralis, Eikenella corrodens, Cardiobacterium hominis, Haemophilus aphrophilus, Actinobacillus actinomycetemcomitans, Gardnerella vaginalis, and DF-2. This reflected the extent of the genetic distances between them as a basis for identification by hybridization. There was some clustering in the Moraxella group. Especially the closely related Moraxella nonliquefaciens, M. lacunata and M. bovis showed strong hybridization affinities. This leads to potential problems in distinguishing these three species from each other by DNA-DNA hybridization with total genomic probes alone.
Time series analysis of aerobic bacterial flora during Miso fermentation.
Onda, T; Yanagida, F; Tsuji, M; Shinohara, T; Yokotsuka, K
2003-01-01
This article reports a microbiological study of aerobic mesophilic bacteria that are present during the fermentation process of Miso. Aerobic bacteria were enumerated and isolated from Miso during fermentation and divided into nine groups using traditional phenotypic tests. The strains were identified by biochemical analysis and 16S rRNA sequence analysis. They were identified as Bacillus subtilis, B. amyloliquefaciens, Kocuria kristinae, Staphylococcus gallinarum and S. kloosii. All strains were sensitive to the bacteriocins produced by the lactic acid bacteria isolated from Miso. The dominant species among the undesirable species throughout the fermentation process were B. subtilis and B. amyloliquefaciens. It is suggested that bacteriocin-producing lactic acid bacteria are effective in the growth prevention of aerobic bacteria in Miso. This study has provided useful information for controlling of bacterial flora during Miso fermentation.
Qiu, Tianlei; Xu, Ying; Gao, Min; Han, Meilin; Wang, Xuming
2017-05-01
While heterotrophic denitrification has been widely used for treating such nitrogen-rich wastewater, it requires the use of additional carbon sources. With fluctuations in the nitrate concentration in the influent, controlling the C/N ratio to avoid carbon breakthrough becomes difficult. To overcome this obstacle, solid-phase denitrification (SPD) using biodegradable polymers has been used, where denitrification and carbon source biodegradation depend on microorganisms growing within the reactor. However, the microbial community dynamics in continuous-flow SPD reactors have not been fully elucidated yet. Here, we aimed to study bacterial community dynamics in a biodenitrification reactor packed with a polylactic acid/poly (3-hydroxybutyrate-co-3-hydroxyvalerate) (PLA/PHBV) blend as the carbon source and biofilm carrier. A lab-scale denitrifying reactor filled with a PLA/PHBV blend was used. With 85 mg/L of influent NO 3 -N concentration and a hydraulic retention time (HRT) of 2.5 h, more than 92% of the nitrate was removed. The bacterial community of inoculated activated sludge had the highest species richness in all samples. Bacterial species diversity in the reactor first decreased and then increased to a stable level. Diaphorobacter species were predominant in the reactor after day 24. In total, 178 clones were retrieved from the 16S rRNA gene clone library constructed from the biofilm samples in the reactor at 62 days of operation, and 80.9% of the clones were affiliated with Betaproteobacteria. Of these, 97.2% were classified into phylotypes corresponding to Diaphorobacter nitroreducens strain NA10B with 99% sequence similarity. Diaphorobacter, Rhizobium, Acidovorax, Rubrivivax, Azospira, Thermomonas, and Acidaminobacter constituted the biofilm microflora in the stably running reactor. Copyright © 2016 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Zhou, Renwu; Zhou, Rusen; Zhuang, Jinxing; Zong, Zichao; Zhang, Xianhui; Liu, Dongping; Bazaka, Kateryna; Ostrikov, Kostya
2016-01-01
Plasma medicine is a relatively new field that investigates potential applications of cold atmospheric-pressure plasmas in bioengineering, such as for bacterial inactivation and degradation of organic molecules in water. In order to enunciate mechanisms of bacterial inactivation at molecular or atomic levels, we investigated the interaction of atmospheric-pressure air microplasmas with amino acids in aqueous solution by using high-resolution mass spectrometry (HRMS). Results show that the oxidation effect of plasma-induced species on the side chains of the amino acids can be categorized into four types, namely hydroxylation, nitration, dehydrogenation and dimerization. In addition, relative activities of amino acids resulting from plasma treatment come in descending order as follows: sulfur-containing carbon-chain amino acids > aromatic amino acids > five-membered ring amino acids > basic carbon-chain amino acids. Since amino acids are building blocks of proteins vital to the growth and reproduction of bacteria, these results provide an insight into the mechanism of bacterial inactivation by plasma. PMID:27183129
Bacterial utilization of L-sugars and D-amino acids
NASA Astrophysics Data System (ADS)
Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline
2006-08-01
The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of
Bacterial communities in floral nectar.
Fridman, Svetlana; Izhaki, Ido; Gerchman, Yoram; Halpern, Malka
2012-02-01
Floral nectar is regarded as the most important reward available to animal-pollinated plants to attract pollinators. Despite the vast amount of publications on nectar properties, the role of nectar as a natural bacterial habitat is yet unexplored. To gain a better understanding of bacterial communities inhabiting floral nectar, culture-dependent and -independent (454-pyrosequencing) methods were used. Our findings demonstrate that bacterial communities in nectar are abundant and diverse. Using culture-dependent method we showed that bacterial communities of nectar displayed significant variation among three plant species: Amygdalus communis, Citrus paradisi and Nicotiana glauca. The dominant class in the nectar bacterial communities was Gammaproteobacteria. About half of the isolates were novel species (< 97% similarities of the 16S rRNA gene with known species). Using 454-pyrosequencing we demonstrated that nectar microbial community are distinct for each of the plant species while there are no significant differences between nectar microbial communities within nectars taken from different plants of the same species. Primary selection of the nectar bacteria is unclear; it may be affected by variations in the chemical composition of the nectar in each plant. The role of the rich and diverse nectar microflora in the attraction-repulsion relationships between the plant and its nectar consumers has yet to be explored. © 2011 Society for Applied Microbiology and Blackwell Publishing Ltd.
Berggren, Martin; Laudon, Hjalmar; Haei, Mahsa; Ström, Lena; Jansson, Mats
2010-03-01
Carboxylic acids (CAs), amino acids (AAs) and carbohydrates (CHs) in dissolved free forms can be readily assimilated by aquatic bacteria and metabolized at high growth efficiencies. Previous studies have shown that these low-molecular-weight (LMW) substrates are released by phytoplankton but also that unidentified LMW compounds of terrestrial origin is a subsidy for bacterial metabolism in unproductive freshwater systems. We tested the hypothesis that different terrestrially derived CA, AA and CH compounds can offer substantial support for aquatic bacterial metabolism in fresh waters that are dominated by allochthonous dissolved organic matter (DOM). Drainage water from three catchments of different characters in the Krycklan experimental area in Northern Sweden were studied at the rising and falling limb of the spring flood, using a 2-week bioassay approach. A variety of CA, AA and CH compounds were significantly assimilated by bacteria, meeting 15-100% of the bacterial carbon demand and explaining most of the observed variation in bacterial growth efficiency (BGE; R(2)=0.66). Of the 29 chemical species that was detected, acetate was the most important, representing 45% of the total bacterial consumption of all LMW compounds. We suggest that LMW organic compounds in boreal spring flood drainage could potentially support all in situ bacterial production in receiving lake waters during periods of weeks to months after the spring flood.
Spatial and temporal features of the growth of a bacterial species colonizing the zebrafish gut.
Jemielita, Matthew; Taormina, Michael J; Burns, Adam R; Hampton, Jennifer S; Rolig, Annah S; Guillemin, Karen; Parthasarathy, Raghuveer
2014-12-16
The vertebrate intestine is home to microbial ecosystems that play key roles in host development and health. Little is known about the spatial and temporal dynamics of these microbial communities, limiting our understanding of fundamental properties, such as their mechanisms of growth, propagation, and persistence. To address this, we inoculated initially germ-free zebrafish larvae with fluorescently labeled strains of an Aeromonas species, representing an abundant genus in the zebrafish gut. Using light sheet fluorescence microscopy to obtain three-dimensional images spanning the gut, we quantified the entire bacterial load, as founding populations grew from tens to tens of thousands of cells over several hours. The data yield the first ever measurements of the growth kinetics of a microbial species inside a live vertebrate intestine and show dynamics that robustly fit a logistic growth model. Intriguingly, bacteria were nonuniformly distributed throughout the gut, and bacterial aggregates showed considerably higher growth rates than did discrete individuals. The form of aggregate growth indicates intrinsically higher division rates for clustered bacteria, rather than surface-mediated agglomeration onto clusters. Thus, the spatial organization of gut bacteria both relative to the host and to each other impacts overall growth kinetics, suggesting that spatial characterizations will be an important input to predictive models of host-associated microbial community assembly. Our intestines are home to vast numbers of microbes that influence many aspects of health and disease. Though we now know a great deal about the constituents of the gut microbiota, we understand very little about their spatial structure and temporal dynamics in humans or in any animal: how microbial populations establish themselves, grow, fluctuate, and persist. To address this, we made use of a model organism, the zebrafish, and a new optical imaging technique, light sheet fluorescence microscopy
Jung, Ji-Eun; Cai, Jian-Na; Cho, Sung-Dae; Song, Kwang-Yeob; Jeon, Jae-Gyu
2016-10-01
Despite the widespread use of fluoride for the prevention of dental caries, few studies have demonstrated the effects of fluoride on the bacterial composition of dental biofilms. This study investigated whether fluoride affects the proportion of Streptococcus mutans and S. oralis in mono- and dual-species biofilm models, via microbiological, biochemical, and confocal fluorescence microscope studies. Fluoride did not affect the bacterial count and bio-volume of S. mutans and S. oralis in mono-species biofilms, except for the 24-h-old S. mutans biofilms. However, fluoride reduced the proportion and bio-volume of S. mutans but did not decrease those of S. oralis during both S. oralis and S. mutans dual-species biofilm formation, which may be related to the decrease in extracellular polysaccharide formation by fluoride. These results suggest that fluoride may prevent the shift in the microbial proportion to cariogenic bacteria in dental biofilms, subsequently inhibiting the cariogenic bacteria dominant biofilm formation.
Li, Tongtong; Long, Meng; Gatesoupe, François-Joël; Zhang, Qianqian; Li, Aihua; Gong, Xiaoning
2015-01-01
Gut microbiota is increasingly regarded as an integral component of the host, due to important roles in the modulation of the immune system, the proliferation of the intestinal epithelium and the regulation of the dietary energy intake. Understanding the factors that influence the composition of these microbial communities is essential to health management, and the application to aquatic animals still requires basic investigation. In this study, we compared the bacterial communities harboured in the intestines and in the rearing water of grass carp (Ctenopharyngodon idellus), crucian carp (Carassius cuvieri), and bighead carp (Hypophthalmichthys nobilis), by using 454-pyrosequencing with barcoded primers targeting the V4 to V5 regions of the bacterial 16S rRNA gene. The specimens of the three species were cohabiting in the same pond. Between 6,218 and 10,220 effective sequences were read from each sample, resulting in a total of 110,398 sequences for 13 samples from gut microbiota and pond water. In general, the microbial communities of the three carps were dominated by Fusobacteria, Firmicutes, Proteobacteria and Bacteroidetes, but the abundance of each phylum was significantly different between species. At the genus level, the overwhelming group was Cetobacterium (97.29 ± 0.46 %) in crucian carp, while its abundance averaged c. 40 and 60 % of the sequences read in the other two species. There was higher microbial diversity in the gut of filter-feeding bighead carp than the gut of the two other species, with grazing feeding habits. The composition of intestine microbiota of grass carp and crucian carp shared higher similarity when compared with bighead carp. The principal coordinates analysis (PCoA) with the weighted UniFrac distance and the heatmap analysis suggested that gut microbiota was not a simple reflection of the microbial community in the local habitat but resulted from species-specific selective pressures, possibly dependent on behavioural, immune
Species richness in soil bacterial communities: a proposed approach to overcome sample size bias.
Youssef, Noha H; Elshahed, Mostafa S
2008-09-01
Estimates of species richness based on 16S rRNA gene clone libraries are increasingly utilized to gauge the level of bacterial diversity within various ecosystems. However, previous studies have indicated that regardless of the utilized approach, species richness estimates obtained are dependent on the size of the analyzed clone libraries. We here propose an approach to overcome sample size bias in species richness estimates in complex microbial communities. Parametric (Maximum likelihood-based and rarefaction curve-based) and non-parametric approaches were used to estimate species richness in a library of 13,001 near full-length 16S rRNA clones derived from soil, as well as in multiple subsets of the original library. Species richness estimates obtained increased with the increase in library size. To obtain a sample size-unbiased estimate of species richness, we calculated the theoretical clone library sizes required to encounter the estimated species richness at various clone library sizes, used curve fitting to determine the theoretical clone library size required to encounter the "true" species richness, and subsequently determined the corresponding sample size-unbiased species richness value. Using this approach, sample size-unbiased estimates of 17,230, 15,571, and 33,912 were obtained for the ML-based, rarefaction curve-based, and ACE-1 estimators, respectively, compared to bias-uncorrected values of 15,009, 11,913, and 20,909.
A role for bacterial urease in gut dysbiosis and Crohn’s disease
Ni, Josephine; Shen, Ting-Chin David; Chen, Eric Z.; Bittinger, Kyle; Bailey, Aubrey; Roggiani, Manuela; Sirota-Madi, Alexandra; Friedman, Elliot S.; Chau, Lillian; Lin, Andrew; Nissim, Ilana; Scott, Justin; Lauder, Abigail; Hoffmann, Christian; Rivas, Gloriany; Albenberg, Lindsey; Baldassano, Robert N.; Braun, Jonathan; Xavier, Ramnik J.; Clish, Clary B.; Yudkoff, Marc; Li, Hongzhe; Goulian, Mark; Bushman, Frederic D.; Lewis, James D.; Wu, Gary D.
2018-01-01
Gut dysbiosis during inflammatory bowel disease involves alterations in the gut microbiota associated with inflammation of the host gut. We used a combination of shotgun metagenomic sequencing and metabolomics to analyze fecal samples from pediatric patients with Crohn’s disease and found an association between disease severity, gut dysbiosis, and bacterial production of free amino acids. Nitrogen flux studies using 15N in mice showed that activity of bacterial urease, an enzyme that releases ammonia by hydrolysis of host urea, led to the transfer of murine host-derived nitrogen to the gutmicrobiota where it was used for amino acid synthesis. Inoculation of a conventional murine host (pretreated with antibiotics and polyethylene glycol) with commensal Escherichia coli engineered to express urease led to dysbiosis of the gut microbiota, resulting in a predominance of Proteobacteria species. This was associated with a worsening of immune-mediated colitis in these animals. A potential role for altered urease expression and nitrogen flux in the development of gut dysbiosis suggests that bacterial urease may be a potential therapeutic target for inflammatory bowel diseases. PMID:29141885
In vitro pollen responses of two birch species to acidity and temperature
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hughes, R.N.; Cox, R.M.
Paper birch (Betula papyrifera Marsh.) and mountain paper birch (Betula cordifolia Regel) near the Bay of Fundy coast frequently intercept acidic advection marine fogs. Chemical deposition by these fogs is thought to be a factor contributing to the observed foliar browning symptoms associated with a marked deterioration of these trees in the area. In vitro experiments were performed to test whether pollen germination in these two birch species would be affected by acidity at levels routinely found in the fog. The combined effect of temperature with acidity was also examined. Pollen germination in both species was inhibited below pH 5.6more » (P < 0.0001) and the effect of incubation temperature was also significant (P < 0.01) in both species. There was no difference in in vitro pollen germination between species (P > 0.05) in response to acidity, based on combined data from 12 trees of each; the optimum germination temperature was 22{degrees}C for B. papyrifera and 21{degrees}C for B. cordifolia.« less
Bacterial adhesion to orthopedic implant polymers.
Barton, A J; Sagers, R D; Pitt, W G
1996-03-01
The degradable polymers poly(orthoester) (POE), poly(L-lactic acid) (PLA), and the nondegradable polymers polysulfone (PSF), polyethylene (PE), and poly(ether ether ketone) (PEEK) were exposed to cultures of Staphylococcus epidermidis, Pseudomonas aeruginosa, or Escherichia coli. Bacteria washed and resuspended in phosphate buffered saline (PBS) adhered to polymers in amounts nearly twice those of bacteria that were left in their growth medium, tryptic soy broth (TSB). In TSB, there was variation in adhesion from species to species, but no significant variation from polymer to polymer within one species. In PBS there were significant differences in the amounts of bacteria adhering to the various polymers with the exception, of S. epidermidis, which had similar adhesion to all polymers. As a whole, P. aeruginosa was the most adherent while S. epidermidis was the least adherent. The estimated values of the free energy of adhesion (delta Fadh) correlated with the amount of adherent P. aeruginosa. When POE, PLA, and PSF were exposed to hyaluronic acid (HA) before exposure to the bacteria, there was 50% more adhesion of E. coli and P. aeruginosa on POE and PLA. With respect to bacterial adhesion, the biodegradable polymers (POE and PLA) in general were not significantly different from the nondegradable polymers.
Marui, Junichiro; Boulom, Sayvisene; Panthavee, Wanchai; Momma, Mari; Kusumoto, Ken-Ichi; Nakahara, Kazuhiko; Saito, Masayoshi
2015-01-01
A bacterial community analysis, using a culture-independent method (polymerase chain reaction-denaturing gradient gel electrophoresis), detected 17 species of bacteria including species of the genera Tetragenococcus, Lactobacillus, Pediococcus, Weissella Halanaerobium, Clostridium, and Sphingomonas in a traditional salty-fermented fish paste known as pla-ra or pa-daek in Thailand and Laos, which is used as a storage-stable multi-purpose seasoning. The representative genus of lactic acid bacteria seemed to vary in the 10 products collected from Thailand and Laos. Tetragenococci were common in products from central Thailand and Vientiane in Laos which had salinities of not less than 11% and pH values ranging from 5.6 to 6.1. However, lactobacilli were common in products from northern Thailand which had the lowest salinities (8.3-8.6%) and pH values (4.5-4.8) of all the samples examined. Two Lactobacillus and one Tetragenococcus species were detected in one product from northeastern Thailand containing 10% salt. These results suggest that salinity in pla-ra/pa-daek is an important determinant of the representative genus of lactic acid bacteria such as, Tetragenococcus or Lactobacillus. Additionally, differences in the acidity between these two groups seemed to be related to the production of d-/l-lactic acid in the lactic acid bacteria in each product. This is the first study to report a correlation between bacterial community structure and taste components in pla-ra/pa-daek products from various regions. This scientific work on a traditional fermented food will be useful in helping local producers meet differing consumer preferences in various regions.
NASA Astrophysics Data System (ADS)
Rice, Charles V.; Wickham, Jason R.; Eastman, Margaret A.; Harrison, William; Pereira, Mark P.; Brown, Eric D.
2008-08-01
Numerous chemical additives lower the freezing point of water, but life at sub-zero temperatures is sustained by a limited number of biological cryoprotectants. Antifreeze proteins in fish, plants, and insects provide protection to a few degrees below freezing. Microbes have been found to survive at even lower temperatures, although, with a few exceptions, antifreeze proteins are missing. Survival has been attributed to external factors, such as high salt concentration (brine veins) and adhesion to particulates or ice crystal defects. Teichoic acid is a phosphodiester polymer ubiquitous in Gram positive bacteria, composing 50% of the mass of the bacterial cell wall and excreted into the extracellular space of biofilm communities. We have found that when bound to the peptidoglycan cell wall (wall teichoic acid) or as a free molecule (lipoteichoic acid), teichoic acid is surrounded by liquid water at temperatures significantly below freezing. Using solid-state NMR, we are unable to collect 31P CPMAS spectra for frozen solutions of lipoteichoic acid at temperatures above -60 °C. For wall teichoic acid in D2O, signals are not seen above -30 °C. These results can be explained by the presence of liquid water, which permits rapid molecular motion to remove 1H/31P dipolar coupling. 2H quadrupole echo NMR spectroscopy reveals that both liquid and solid water are present. We suggest that teichoic acids could provide a shell of liquid water around biofilms and planktonic bacteria, removing the need for brine veins to prevent bacterial freezing.
Ishaq, Suzanne L; Johnson, Stephen P; Miller, Zach J; Lehnhoff, Erik A; Olivo, Sarah; Yeoman, Carl J; Menalled, Fabian D
2017-02-01
Farming practices affect the soil microbial community, which in turn impacts crop growth and crop-weed interactions. This study assessed the modification of soil bacterial community structure by organic or conventional cropping systems, weed species identity [Amaranthus retroflexus L. (redroot pigweed) or Avena fatua L. (wild oat)], and living or sterilized inoculum. Soil from eight paired USDA-certified organic and conventional farms in north-central Montana was used as living or autoclave-sterilized inoculant into steam-pasteurized potting soil, planted with Am. retroflexus or Av. fatua and grown for two consecutive 8-week periods to condition soil nutrients and biota. Subsequently, the V3-V4 regions of the microbial 16S rRNA gene were sequenced by Illumina MiSeq. Treatments clustered significantly, with living or sterilized inoculum being the strongest delineating factor, followed by organic or conventional cropping system, then individual farm. Living inoculum-treated soil had greater species richness and was more diverse than sterile inoculum-treated soil (observed OTUs, Chao, inverse Simpson, Shannon, P < 0.001) and had more discriminant taxa delineating groups (linear discriminant analysis). Living inoculum soil contained more Chloroflexi and Acidobacteria, while the sterile inoculum soil had more Bacteroidetes, Firmicutes, Gemmatimonadetes, and Verrucomicrobia. Organically farmed inoculum-treated soil had greater species richness, more diversity (observed OTUs, Chao, Shannon, P < 0.05), and more discriminant taxa than conventionally farmed inoculum-treated soil. Cyanobacteria were higher in pots growing Am. retroflexus, regardless of inoculum type, for three of the four organic farms. Results highlight the potential of cropping systems and species identity to modify soil bacterial communities, subsequently modifying plant growth and crop-weed competition.
Störmer, Melanie; Vollmer, Tanja; Henrich, Birgit; Kleesiek, Knut; Dreier, Jens
2009-04-01
Polymerase chain reaction assays have become widely used methods of confirming the presence of Mollicutes species in clinical samples and cell cultures. We have developed a broad-range real-time PCR assay using the locked nucleic acid technology to detect mollicute species causing human infection and cell line contamination. Primers and probes specifically for the conserved regions of the mycoplasmal tuf gene (encoding elongation factor Tu) were designed. Cell culture supernatants, clinical specimens (vaginal swabs, sputum, cryopreserved heart valve tissues), and reference strains were tested for mollicute contamination as well as to exclude cross-reaction to human nucleic acids and other bacterial species. Nucleic acids were extracted using magnetic separation technology. The coamplification of the human beta2-microglobulin DNA served as an internal control. The PCR assay was highly specific and obtained an analytical sensitivity of one copy per microl sample. The 95% detection limit was calculated to 10 copies per microl sample for Mycoplasma pneumoniae and M. orale. No false-positive results were observed due to cross-reaction of walled bacterial, fungal, and human nucleic acids. To evaluate the PCR, we compared the results to two commercialized test systems. Moreover, in combination with a previously developed broad-range RT-PCR assay for the detection of bacteria in blood products, both mollicute and walled bacterial contamination can be detected simultaneously using multiplex real-time RT-PCR.
Bacterial Cellular Materials as Precursors of Chloroform
NASA Astrophysics Data System (ADS)
Wang, J.; Ng, T.; Zhang, Q.; Chow, A. T.; Wong, P.
2011-12-01
The environmental sources of chloroform and other halocarbons have been intensively investigated because their effects of stratospheric ozone destruction and environmental toxicity. It has been demonstrated that microorganisms could facilitate the biotic generation of chloroform from natural organic matters in soil, but whether the cellular materials itself also serves as an important precursor due to photo-disinfection is poorly known. Herein, seven common pure bacterial cultures (Acinetobacter junii, Aeromonas hydrophila, Bacillus cereus, Bacillus substilis, Escherichia coli, Shigella sonnei, Staphylococcus sciuri) were chlorinated to evaluate the yields of chloroform, dibromochloromethane, dichlorobromomethane, and bromoform. The effects of bromide on these chemical productions and speciations were also investigated. Results showed that, on average, 5.64-36.42 μg-chloroform /mg-C were generated during the bacterial chlorination, in similar order of magnitude to that generated by humic acid (previously reported as 78 μg-chloroform/mg-C). However, unlike humic acid in water chlorination, chloroform concentration did not simply increase with the total organic carbon in water mixture. In the presence of bromide, the yield of brominated species responded linearly to the bromide concentration. This study provides useful information to understand the contributions of chloroform from photodisinfection processes in coastal environments.
Impact of cultivation on characterisation of species composition of soil bacterial communities.
McCaig, A E.; Grayston, S J.; Prosser, J I.; Glover, L A.
2001-03-01
The species composition of culturable bacteria in Scottish grassland soils was investigated using a combination of Biolog and 16S rDNA analysis for characterisation of isolates. The inclusion of a molecular approach allowed direct comparison of sequences from culturable bacteria with sequences obtained during analysis of DNA extracted directly from the same soil samples. Bacterial strains were isolated on Pseudomonas isolation agar (PIA), a selective medium, and on tryptone soya agar (TSA), a general laboratory medium. In total, 12 and 21 morphologically different bacterial cultures were isolated on PIA and TSA, respectively. Biolog and sequencing placed PIA isolates in the same taxonomic groups, the majority of cultures belonging to the Pseudomonas (sensu stricto) group. However, analysis of 16S rDNA sequences proved more efficient than Biolog for characterising TSA isolates due to limitations of the Microlog database for identifying environmental bacteria. In general, 16S rDNA sequences from TSA isolates showed high similarities to cultured species represented in sequence databases, although TSA-8 showed only 92.5% similarity to the nearest relative, Bacillus insolitus. In general, there was very little overlap between the culturable and uncultured bacterial communities, although two sequences, PIA-2 and TSA-13, showed >99% similarity to soil clones. A cloning step was included prior to sequence analysis of two isolates, TSA-5 and TSA-14, and analysis of several clones confirmed that these cultures comprised at least four and three sequence types, respectively. All isolate clones were most closely related to uncultured bacteria, with clone TSA-5.1 showing 99.8% similarity to a sequence amplified directly from the same soil sample. Interestingly, one clone, TSA-5.4, clustered within a novel group comprising only uncultured sequences. This group, which is associated with the novel, deep-branching Acidobacterium capsulatum lineage, also included clones isolated
Teratogenicity of isotretinoin revisited: species variation and the role of all-trans-retinoic acid.
Nau, H
2001-11-01
This paper reviews the teratogenicity of isotretinoin in regard to aspects of species variation, toxicokinetics, and metabolism. Particular emphasis is given to the hypothesis that most effects of isotretinoin (13-cis-retinoic acid) are mediated by isomerization to the all-trans-retinoic acid. This mechanism of action would provide a basis for the understanding of species differences and the extrapolation of experimental results to the human situation and thus improve drug development. The insensitive species (rat, mouse) eliminate the drug rapidly through detoxification to the beta-glucuronide; also, placental transfer is limited in these species. On the other hand, in sensitive species (primates), the drug is predominantly metabolized to the active 13-cis-4-oxo-retinoic acid; placental transfer is more extensive here. The beta-glucuronides showed limited placental transfer in all species examined; these metabolites exhibited very low, if any, measurable concentrations in the human. The 13-cis-retinoic acid is not appreciably bound to cellular retinoid-binding proteins or nuclear receptors and exhibits low tissue distribution and placental transfer. Its access to the nucleus may be extensive. Because of the long half life of 13-cis-retinoic acid, continuous isomerization results in significant area under the concentration-time curve levels of all-trans-retinoic acid in the mouse, monkey and the human; the all-trans-retinoic acid formed is extensively distributed across the placenta and may be an important factor that contributes to the teratogenic potency of 13-cis-retinoic acid. Isomerization cannot explain the teratogenic effects of 13-cis-retinoic acid in the rat and rabbit. It is concluded that the high teratogenic activity of isotretinoin in sensitive species (human, monkey) is related to slow elimination of the 13-cis-isomer, to metabolism to the 4-oxo-derivative, to increased placental transfer, to continuous isomerization and significant exposure of the
Trébaol, G; Gardan, L; Manceau, C; Tanguy, J L; Tirilly, Y; Boury, S
2000-07-01
A bacterial disease of artichoke (Cynara scolymus L.) was first observed in 1954 in Brittany and the Loire Valley, France. This disease causes water-soaked spots on bracts and depreciates marketability of the harvest. Ten strains of the pathogen causing bacterial spot of artichoke, previously identified as a member of the genus Xanthomonas, were characterized and compared with type and pathotype strains of the 20 Xanthomonas species using a polyphasic study including both phenotypic and genomic methods. The ten strains presented general morphological, biochemical and physiological traits and G+C content characteristic of the genus Xanthomonas. Sequencing of the 165 rRNA gene confirmed that this bacterium belongs to the genus Xanthomonas, and more precisely to the Xanthomonas campestris core. DNA-DNA hybridization results showed that the strains that cause bacterial spot of artichoke were 92-100% related to the proposed type strain CFBP 4188T and constituted a discrete DNA homology group that was distinct from the 20 previously described Xanthomonas species. The results of numerical analysis were in accordance with DNA-DNA hybridization data. Strains causing the bacterial bract spot of artichoke exhibited consistent determinative biochemical characteristics, which distinguished them from the 20 other Xanthomonas species previously described. Furthermore, pathogenicity tests allowed specific identification of this new phytopathogenic bacterium. Thus, it is concluded that this bacterium is a new species belonging to the genus Xanthomonas, for which the name Xanthomonas cynarae is proposed. The type strain, CFBP 4188T, has been deposited in the Collection Française des Bactéries Phytopathogènes (CFBP).
Wang, Ming Li; Morris, Brad; Tonnis, Brandon; Davis, Jerry; Pederson, Gary A
2012-07-04
The Hibiscus genus encompasses more than 300 species, but kenaf (Hibiscus cannabinus L.) and roselle (Hibiscus sabdariffa L.) are the two most economically important species within the genus. Seeds from these two Hibiscus species contain a relatively high amount of oil with two unusual fatty acids: dihydrosterculic and vernolic acids. The fatty acid composition in the oil can directly affect oil quality and its utilization. However, the variability in oil content and fatty acid composition for these two species is unclear. For these two species, 329 available accessions were acquired from the USDA germplasm collection. Their oil content and fatty acid composition were determined by nuclear magnetic resonance (NMR) and gas chromatography (GC), respectively. Using NMR and GC analyses, we found that Hibiscus seeds on average contained 18% oil and seed oil was composed of six major fatty acids (each >1%) and seven minor fatty acids (each <1%). Hibiscus cannabinus seeds contained significantly higher amounts of oil (18.14%), palmitic (20.75%), oleic (28.91%), vernolic acids (VA, 4.16%), and significantly lower amounts of stearic (3.96%), linoleic (39.49%), and dihydrosterculic acids (DHSA, 1.08%) than H. sabdariffa seeds (17.35%, 18.52%, 25.16%, 3.52%, 4.31%, 44.72%, and 1.57%, respectively). For edible oils, a higher oleic/linoleic (O/L) ratio and lower level of DHSA are preferred, and for industrial oils a high level of VA is preferred. Our results indicate that seeds from H. cannabinus may be of higher quality than H. sabdariffa seeds for these reasons. Significant variability in oil content and major fatty acids was also detected within both species. The variability in oil content and fatty acid composition revealed from this study will be useful for exploring seed utilization and developing new cultivars in these Hibiscus species.
Comparison of sterols and fatty acids in two species of Ganoderma
2012-01-01
Background Two species of Ganoderma, G. sinense and G. lucidum, are used as Lingzhi in China. Howerver, the content of triterpenoids and polysaccharides, main actives compounds, are significant different, though the extracts of both G. lucidum and G. sinense have antitumoral proliferation effect. It is suspected that other compounds contribute to their antitumoral activity. Sterols and fatty acids have obvious bioactivity. Therefore, determination and comparison of sterols and fatty acids is helpful to elucidate the active components of Lingzhi. Results Ergosterol, a specific component of fungal cell membrane, was rich in G. lucidum and G. sinense. But its content in G. lucidum (median content 705.0 μg·g-1, range 189.1-1453.3 μg·g-1, n = 19) was much higher than that in G. sinense (median content 80.1 μg·g-1, range 16.0-409.8 μg·g-1, n = 13). Hierarchical clustering analysis based on the content of ergosterol showed that 32 tested samples of Ganoderma were grouped into two main clusters, G. lucidum and G. sinense. Hierarchical clustering analysis based on the contents of ten fatty acids showed that two species of Ganoderma had no significant difference though two groups were also obtained. The similarity of two species of Ganoderma in fatty acids may be related to their antitumoral proliferation effect. Conclusions The content of ergosterol is much higher in G. lucidum than in G. sinense. Palmitic acid, linoleic acid, oleic acid, stearic acid are main fatty acids in Ganoderma and their content had no significant difference between G. lucidum and G. sinense, which may contribute to their antitumoral proliferation effect. PMID:22293530
Enzyme structures of the bacterial peptidoglycan and wall teichoic acid biogenesis pathways.
Caveney, Nathanael A; Li, Franco Kk; Strynadka, Natalie Cj
2018-06-06
The bacterial cell wall is a complex polymeric structure with essential roles in defence, survival and pathogenesis. Common to both Gram-positive and Gram-negative bacteria is the mesh-like peptidoglycan sacculus that surrounds the outer leaflet of the cytoplasmic membrane. Recent crystallographic studies of enzymes that comprise the peptidoglycan biosynthetic pathway have led to significant new understanding of all stages. These include initial multi-step cytosolic formation of sugar-pentapeptide precursors, transfer of the precursors to activated polyprenyl lipids at the membrane inner leaflet and flippase mediated relocalization of the resulting lipid II precursors to the outer leaflet where glycopolymerization and subsequent peptide crosslinking are finalized. Additional, species-specific enzymes allow customized peptidoglycan modifications and biosynthetic regulation that are important to bacterial virulence and survival. These studies have reinforced the unique and specific catalytic mechanisms at play in cell wall biogenesis and expanded the atomic foundation to develop novel, structure guided, antibacterial agents. Copyright © 2018 Elsevier Ltd. All rights reserved.
Gu, Qun; David, Frank; Lynen, Frédéric; Rumpel, Klaus; Xu, Guowang; De Vos, Paul; Sandra, Pat
2010-06-25
Comprehensive two-dimensional gas chromatography (GCxGC) offers an interesting tool for profiling bacterial fatty acids. Flow modulated GCxGC using a commercially available system was evaluated, different parameters such as column flows and modulation time were optimized. The method was tested on bacterial fatty acid methyl esters (BAMEs) from Stenotrophomonas maltophilia LMG 958T by using parallel flame ionization detector (FID)/mass spectrometry (MS). The results are compared to data obtained using a thermal modulated GCxGC system. The data show that flow modulated GCxGC-FID/MS method can be applied in a routine environment and offers interesting perspectives for chemotaxonomy of bacteria.
Pereira, Rui P A; Peplies, Jörg; Höfle, Manfred G; Brettar, Ingrid
2017-10-01
Cooling towers are the major source of outbreaks of legionellosis in Europe and worldwide. These outbreaks are mostly associated with Legionella species, primarily L. pneumophila, and its surveillance in cooling tower environments is of high relevance to public health. In this study, a combined NGS-based approach was used to study the whole bacterial community, specific waterborne and water-based bacterial pathogens, especially Legionella species, targeting the 16S rRNA gene. This approach was applied to water from a cooling tower obtained by monthly sampling during two years. The studied cooling tower was an open circuit cooling tower with lamellar cooling situated in Braunschweig, Germany. A highly diverse bacterial community was observed with 808 genera including 25 potentially pathogenic taxa using universal 16S rRNA primers. Sphingomonas and Legionella were the most abundant pathogenic genera. By applying genus-specific primers for Legionella, a diverse community with 85 phylotypes, and a representative core community with substantial temporal heterogeneity was observed. A high percentage of sequences (65%) could not be affiliated to an acknowledged species. L. pneumophila was part of the core community and the most abundant Legionella species reinforcing the importance of cooling towers as its environmental reservoir. Major temperature shifts (>10 °C) were the key environmental factor triggering the reduction or dominance of the Legionella species in the Legionella community dynamics. In addition, interventions by chlorine dioxide had a strong impact on the Legionella community composition but not on the whole bacterial community. Overall, the presented results demonstrated the value of a combined NGS approach for the molecular monitoring and surveillance of health related pathogens in man-made freshwater systems. Copyright © 2017 Elsevier Ltd. All rights reserved.
McCarty, Maclyn
1959-01-01
A bacterial substance has been described which gives a precipitin reaction with certain antisera to Group A streptococci. The precipitating antigen is present in various Gram-positive bacteria, including most hemolytic streptococci, staphylococci, and aerobic sporulating bacilli. It is not present in any of the Gram-negative species examined or in pneumococci, clostridia, or corynebacteria. Analysis of purified preparations obtained from Group A streptococci indicates that the antigen is a simple polymer of glycerophosphate. The identification has been confirmed by immunochemical studies, including precipitin tests and specific inhibition with synthetic polyglycerophosphates. In addition, the infrared spectra of bacterial and synthetic polyglycerophosphate are shown to be closely similar. Immunochemical analysis suggests that the amount of polyglycerophosphate present in Group A streptococci and staphylococci is approximately 1 per cent of the dry weight of the cells. The cellular localization and function of the polyglycerophosphate have not been established. PMID:13641562
Bacterial Profile of Dentine Caries and the Impact of pH on Bacterial Population Diversity
Kianoush, Nima; Adler, Christina J.; Nguyen, Ky-Anh T.; Browne, Gina V.; Simonian, Mary; Hunter, Neil
2014-01-01
Dental caries is caused by the release of organic acids from fermentative bacteria, which results in the dissolution of hydroxyapatite matrices of enamel and dentine. While low environmental pH is proposed to cause a shift in the consortium of oral bacteria, favouring the development of caries, the impact of this variable has been overlooked in microbial population studies. This study aimed to detail the zonal composition of the microbiota associated with carious dentine lesions with reference to pH. We used 454 sequencing of the 16S rRNA gene (V3–V4 region) to compare microbial communities in layers ranging in pH from 4.5–7.8 from 25 teeth with advanced dentine caries. Pyrosequencing of the amplicons yielded 449,762 sequences. Nine phyla, 97 genera and 409 species were identified from the quality-filtered, de-noised and chimera-free sequences. Among the microbiota associated with dentinal caries, the most abundant taxa included Lactobacillus sp., Prevotella sp., Atopobium sp., Olsenella sp. and Actinomyces sp. We found a disparity between microbial communities localised at acidic versus neutral pH strata. Acidic conditions were associated with low diversity microbial populations, with Lactobacillus species including L. fermentum, L. rhamnosus and L. crispatus, being prominent. In comparison, the distinctive species of a more diverse flora associated with neutral pH regions of carious lesions included Alloprevotella tanerrae, Leptothrix sp., Sphingomonas sp. and Streptococcus anginosus. While certain bacteria were affected by the pH gradient, we also found that ∼60% of the taxa associated with caries were present across the investigated pH range, representing a substantial core. We demonstrated that some bacterial species implicated in caries progression show selective clustering with respect to pH gradient, providing a basis for specific therapeutic strategies. PMID:24675997
Solís-Dominguez, Fernando A; White, Scott A; Hutter, Travis Borrillo; Amistadi, Mary Kay; Root, Robert A; Chorover, Jon; Maier, Raina M
2012-01-17
Phytostabilization of mine tailings acts to mitigate both eolian dispersion and water erosion events which can disseminate barren tailings over large distances. This technology uses plants to establish a vegetative cover to permanently immobilize contaminants in the rooting zone, often requiring addition of an amendment to assist plant growth. Here we report the results of a greenhouse study that evaluated the ability of six native plant species to grow in extremely acidic (pH ∼ 2.5) metalliferous (As, Pb, Zn: 2000-3000 mg kg(-1)) mine tailings from Iron King Mine Humboldt Smelter Superfund site when amended with a range of compost concentrations. Results revealed that three of the six plant species tested (buffalo grass, mesquite, and catclaw acacia) are good candidates for phytostabilization at an optimum level of 15% compost (w/w) amendment showing good growth and minimal shoot accumulation of metal(loid)s. A fourth candidate, quailbush, also met all criteria except for exceeding the domestic animal toxicity limit for shoot accumulation of zinc. A key finding of this study was that the plant species that grew most successfully on these tailings significantly influenced key tailings parameters; direct correlations between plant biomass and both increased tailings pH and neutrophilic heterotrophic bacterial counts were observed. We also observed decreased iron oxidizer counts and decreased bioavailability of metal(loid)s mainly as a result of compost amendment. Taken together, these results suggest that the phytostabilization process reduced tailings toxicity as well as the potential for metal(loid) mobilization. This study provides practical information on plant and tailings characteristics that is critically needed for successful implementation of assisted phytostabilization on acidic, metalliferous mine tailings sites.
Solís-Dominguez, Fernando A.; White, Scott A.; Hutter, Travis Borrillo; Amistadi, Mary Kay; Root, Robert A.; Chorover, Jon; Maier, Raina M.
2012-01-01
Phytostabilization of mine tailings acts to mitigate both eolian dispersion and water erosion events which can disseminate barren tailings over large distances. This technology uses plants to establish a vegetative cover to permanently immobilize contaminants in the rooting zone, often requiring addition of an amendment to assist plant growth. Here we report the results of a greenhouse study that evaluated the ability of six native plant species to grow in extremely acidic (pH ~ 2.5) metalliferous (As, Pb, Zn: 2000–3000 mg kg−1) mine tailings from Iron King Mine Humboldt Smelter Superfund site when amended with a range of compost concentrations. Results revealed that three of the six plant species tested (buffalo grass, mesquite, and catclaw acacia) are good candidates for phytostabilization at an optimum level of 15% compost (w/w) amendment showing good growth and minimal shoot accumulation of metal(loid)s. A fourth candidate, quailbush, also met all criteria except for exceeding the domestic animal toxicity limit for shoot accumulation of zinc. A key finding of this study was that the plant species that grew most successfully on these tailings significantly influenced key tailings parameters; direct correlations between plant biomass and both increased tailings pH and neutrophilic heterotrophic bacterial counts were observed. We also observed decreased iron oxidizer counts and decreased bioavailability of metal(loid)s mainly as a result of compost amendment. Taken together, these results suggest that the phytostabilization process reduced tailings toxicity as well as the potential for metal(loid) mobilization. This study provides practical information on plant and tailings characteristics that is critically needed for successful implementation of assisted phytostabilization on acidic, metalliferous mine tailings sites. PMID:22191663
The Extent of Genome Flux and Its Role in the Differentiation of Bacterial Lineages
Nowell, Reuben W.; Green, Sarah; Laue, Bridget E.; Sharp, Paul M.
2014-01-01
Horizontal gene transfer (HGT) and gene loss are key processes in bacterial evolution. However, the role of gene gain and loss in the emergence and maintenance of ecologically differentiated bacterial populations remains an open question. Here, we use whole-genome sequence data to quantify gene gain and loss for 27 lineages of the plant-associated bacterium Pseudomonas syringae. We apply an extensive error-control procedure that accounts for errors in draft genome data and greatly improves the accuracy of patterns of gene occurrence among these genomes. We demonstrate a history of extensive genome fluctuation for this species and show that individual lineages could have acquired thousands of genes in the same period in which a 1% amino acid divergence accrues in the core genome. Elucidating the dynamics of genome fluctuation reveals the rapid turnover of gained genes, such that the majority of recently gained genes are quickly lost. Despite high observed rates of fluctuation, a phylogeny inferred from patterns of gene occurrence is similar to a phylogeny based on amino acid replacements within the core genome. Furthermore, the core genome phylogeny suggests that P. syringae should be considered a number of distinct species, with levels of divergence at least equivalent to those between recognized bacterial species. Gained genes are transferred from a variety of sources, reflecting the depth and diversity of the potential gene pool available via HGT. Overall, our results provide further insights into the evolutionary dynamics of genome fluctuation and implicate HGT as a major factor contributing to the diversification of P. syringae lineages. PMID:24923323
Marti, Elisabet; Huerta, Belinda; Rodríguez-Mozaz, Sara; Barceló, Damià; Marcé, Rafael; Balcázar, Jose Luis
2018-04-01
This study was aimed to determine the abundance of four antibiotic resistance genes (bla TEM , ermB, qnrS and sulI), as well as bacterial community composition associated with the intestinal mucus of wild freshwater fish species collected from the Foix and La Llosa del Cavall reservoirs, which represent ecosystems with high and low anthropogenic disturbance, respectively. Water and sediments from these reservoirs were also collected and analyzed to determine the pollution level by antibiotics. The bla TEM gene was only detected in brown trout and Ebro barbel, which were collected from La Llosa del Cavall reservoir. In contrast, the sulI and qnrS genes were only detected in common carp, which were collected from the Foix reservoir. Although the ermB gene was also detected in common carp, the values were below the limit of quantification. Likewise, water and sediment samples from the Foix reservoir had higher concentrations and more classes of antibiotics than those from La Llosa del Cavall. Pyrosequencing analysis of 16S rRNA genes revealed significant differences in bacterial communities associated with the intestinal mucus of fish species. Therefore, these findings suggest that anthropogenic activities are not only increasing the pollution of aquatic environments, but also contributing to the emergence and spread of antibiotic resistance in organisms that inhabit such environments. Copyright © 2017 Elsevier Ltd. All rights reserved.
Interaction between common organic acids and trace nucleation species in the Earth's atmosphere.
Xu, Yisheng; Nadykto, Alexey B; Yu, Fangqun; Herb, J; Wang, Wei
2010-01-14
Atmospheric aerosols formed via nucleation in the Earth's atmosphere play an important role in the aerosol radiative forcing associated directly with global climate changes and public health. Although it is well-known that atmospheric aerosol particles contain organic species, the chemical nature of and physicochemical processes behind atmospheric nucleation involving organic species remain unclear. In the present work, the interaction of common organic acids with molecular weights of 122, 116, 134, 88, 136, and 150 (benzoic, maleic, malic, pyruvic, phenylacetic, and tartaric acids) with nucleation precursors and charged trace species has been investigated. We found a moderate strong effect of the organic species on the stability of neutral and charged ionic species. In most cases, the free energies of the mixed H(2)SO(4)-organic acid dimer formation are within 1-1.5 kcal mol(-1) of the (H(2)SO(4))(NH(3)) formation energy. The interaction of the organic acids with trace ionic species is quite strong, and the corresponding free energies far exceed those of the (H(3)O(+))(H(2)SO(4)) and (H(3)O(+))(H(2)SO(4))(2) formation. These considerations lead us to conclude that the aforementioned organic acids may possess a substantial capability of stabilizing both neutral and positively charged prenucleation clusters, and thus, they should be studied further with regard to their involvement in the gas-to-particle conversion in the Earth's atmosphere.
Mixed-species biofilm formation by lactic acid bacteria and rice wine yeasts.
Kawarai, Taketo; Furukawa, Soichi; Ogihara, Hirokazu; Yamasaki, Makari
2007-07-01
We found that species combinations such as Lactobacillus casei subsp. rhamnosus IFO3831 and Saccharomyces cerevisiae Kyokai-10 can form a mixed-species biofilm in coculture. Moreover, the Kyokai-10 yeast strain can form a biofilm in monoculture in the presence of conditioned medium (CM) from L. casei IFO3831. The active substance(s) in bacterial CM is heat sensitive and has a molecular mass of between 3 and 5 kDa. In biofilms from cocultures or CM monocultures, yeast cells had a distinct morphology, with many hill-like protrusions on the cell surface.
Composition of sugars, organic acids, and total phenolics in 25 wild or cultivated berry species.
Mikulic-Petkovsek, Maja; Schmitzer, Valentina; Slatnar, Ana; Stampar, Franci; Veberic, Robert
2012-10-01
Sugars, organic acids, and total phenolic content in fruit of 25 wild and cultivated berry species were identified and quantified with high-performance liquid chromatograph. The composition of sugars, organic acids, and total phenolic compounds in various species of Vaccinium, Rubus, Ribes, and Fragaria genus was evaluated. Additonally, total phenolics of less known berry species of the Morus, Amelanchier, Sorbus, Sambucus, Rosa, Lycium, Actinidia, and Aronia genus were determined in wild growing as well as in cultivated fruits. Significant differences in the concentration of sugars and organic acids were detected among the berry species. Glucose and fructose were the most abundant sugars in berry fruits and the major organic acids were malic and citric acid. However, in kiwi fruit, sucrose represented as much as 71.9% of total sugars. Sorbitol has been detected and quantified in chokeberry, rowanberry, and eastern shadbush fruit. The highest content of total analyzed sugars was determined in rowanberry fruit, followed by dog rose, eastern shadbush, hardy kiwifruit, American cranberry, chokeberry, and jostaberry fruit. Rowanberry stands out as the fruit with the highest content of total analyzed organic acids, followed by jostaberry, lingonberry, red gooseberry, hardy kiwifruit, and black currant. The berries of white gooseberry, black currant, red currant, and white currant had the lowest sugar/organic acid ratio and were thus perceptively the sourest species analyzed. On the other hand, the species with highest sugar/organic acid ratio were goji berry, eastern shadbush, black mulberry, and wild grown blackberry. The highest amounts of total phenols were quantified in chokeberry fruit. Wild strawberry, raspberry, and blackberry had 2- to 5-fold more total phenolics compared to cultivated plants. The fruit of analyzed berry species contained different levels of sugars, organic acids, and total phenolics. Moreover, it has been demonstrated that wild grown species
Šedo, Ondrej; Nemec, Alexandr; Křížová, Lenka; Kačalová, Magdaléna; Zdráhal, Zbyněk
2013-12-01
MALDI-TOF MS is currently becoming the method of choice for rapid identification of bacterial species in routine diagnostics. Yet, this method suffers from the inability to differentiate reliably between some closely related bacterial species including those of the Acinetobacter calcoaceticus-Acinetobacter baumannii (ACB) complex, namely A. baumannii and Acinetobacter nosocomialis. In the present study, we evaluated a protocol which was different from that used in the Bruker Daltonics identification system (MALDI BioTyper) to improve species identification using a taxonomically precisely defined set of 105 strains representing the four validly named species of the ACB complex. The novel protocol is based on the change in matrix composition from alpha-cyano-4-hydroxycinnamic acid (saturated solution in water:acetonitrile:trifluoroacetic acid, 47.5:50:2.5, v/v) to ferulic acid (12.5mgml(-1) solution in water:acetonitrile:formic acid 50:33:17, v/v), while the other steps of sample processing remain unchanged. Compared to the standard protocol, the novel one extended the range of detected compounds towards higher molecular weight, produced signals with better mass resolution, and allowed the detection of species-specific signals. As a result, differentiation of A. nosocomialis and A. baumannii strains by cluster analysis was improved and 13 A. nosocomialis strains, assigned erroneously or ambiguously by using the standard protocol, were correctly identified. Copyright © 2013 Elsevier GmbH. All rights reserved.
Effect of growth phase on the fatty acid compositions of four species of marine diatoms
NASA Astrophysics Data System (ADS)
Liang, Ying; Mai, Kangsen
2005-04-01
The fatty acid compositions of four species of marine diatoms ( Chaetoceros gracilis MACC/B13, Cylindrotheca fusiformis MACC/B211, Phaeodactylum tricornutum MACC/B221 and Nitzschia closterium MACC/B222), cultivated at 22°C±1°C with the salinity of 28 in f/2 medium and harvested in the exponential growth phase, the early stationary phase and the late stationary phase, were determined. The results showed that growth phase has significant effect on most fatty acid contents in the four species of marine diatoms. The proportions of 16:0 and 16:1n-7 fatty acids increased while those of 16:3n-4 and eicosapentaenoic acid (EPA) decreased with increasing culture age in all species studied. The subtotal of saturated fatty acids (SFA) increased with the increasing culture age in all species with the exception of B13. The subtotal of monounsaturated fatty acids (MUFA) increased while that of polyunsaturated fatty acids (PUFA) decreased with culture age in the four species of marine diatoms. MUFA reached their lowest value in the exponential growth phase, whereas PUFA reached their highest value in the same phase.
Goniothalamus Species: A Source of Drugs for the Treatment of Cancers and Bacterial Infections?
2007-01-01
Irrespective of the presence of cytotoxic acetogenins and styryl-lactones in the genus Goniothalamus, only 22 species in the genus Goniothalamus, out of 160 species (13.7%) have so far been investigated. In an effort to promote further research on the genus Goniothalamus which could represent a source of drugs for the treatment of cancers and bacterial infections, this work offers a broad analysis of current knowledge on Goniothalamus species. Therefore, it includes (i) taxonomy (ii) botanical description (iii) traditional medicinal uses and (iv) phytochemical and pharmacological studies. We discuss the molecular mechanisms of actions of acetogenins and styryl-lactones, with some emphasis on the possible involvement of protein kinase, Bax and TRAIL receptors in the cytotoxic effects of styryl-lactones. We also report (v) the growth inhibition of several nosocomial bacteria by Goniothalamus. scortechinii. The crude methanol extract of G. scortechinii showed a good and broad spectrum of antibacterial activity against both Gram-negative and Gram-positive bacteria. PMID:17965760
Rumjuankiat, Kittaporn; Keawsompong, Suttipun; Nitisinprasert, Sunee
2017-05-01
Seventy-five bacterial contaminants which still persisted to cleaning system from three puff pastry production lines (dough forming, layer and filling forming, and shock freezing) were identified using 16S rDNA as seven genera of Bacillus , Corynebacterium , Dermacoccus , Enterobacter , Klebsiella, Pseudomonas , and Staphylococcus with detection frequencies of 24.00, 2.66, 1.33, 37.33, 1.33, 2.66, and 30.66, respectively. Seventeen species were discovered while only 11 species Bacillus cereus, B. subtilis, B. pumilus, Corynebacterium striatum , Dermacoccus barathri , Enterobacter asburiae, Staphylococcus kloosii, S. haemolyticus, S. hominis, S. warneri , and S. aureus were detected at the end of production. Based on their abundance, the highest abundance of E. asburiae could be used as a biomarker for product quality. While a low abundance of the mesophile pathogen C. striatum , which causes respiratory and nervous infection and appeared only at the shock freezing step was firstly reported for its detection in bakery product. Six antimicrobial substances (AMSs) from lactic acid bacteria, FF1-4, FF1-7, PFUR-242, PFUR-255, PP-174, and nisin A were tested for their inhibition activities against the contaminants. The three most effective were FF1-7, PP-174, and nisin A exhibiting wide inhibition spectra of 88.00%, 85.33%, and 86.66%, respectively. The potential of a disinfectant solution containing 800 AU/ml of PP-174 and nisin A against the most resistant strains of Enterobacter , Staphylococcus , Bacillus and Klebsiella was determined on artificially contaminated conveyor belt coupons at 0, 4, 8, 12, and 16 hr. The survival levels of the test strains were below 1 log CFU/coupon at 0 hr. The results suggested that a combined solution of PP-174 and nisin A may be beneficial as a sanitizer to inhibit bacterial contaminants in the frozen puff pastry industry.
Biofilm formation and ethanol inhibition by bacterial contaminants of biofuel fermentation.
Rich, Joseph O; Leathers, Timothy D; Bischoff, Kenneth M; Anderson, Amber M; Nunnally, Melinda S
2015-11-01
Bacterial contaminants can inhibit ethanol production in biofuel fermentations, and even result in stuck fermentations. Contaminants may persist in production facilities by forming recalcitrant biofilms. A two-year longitudinal study was conducted of bacterial contaminants from a Midwestern dry grind corn fuel ethanol facility. Among eight sites sampled in the facility, the combined liquefaction stream and yeast propagation tank were consistently contaminated, leading to contamination of early fermentation tanks. Among 768 contaminants isolated, 92% were identified as Lactobacillus sp., with the most abundant species being Lactobacillus plantarum, Lactobacillus casei, Lactobacillus mucosae, and Lactobacillus fermentum. Seven percent of total isolates showed the ability to form biofilms in pure cultures, and 22% showed the capacity to significantly inhibit ethanol production. However, these traits were not correlated. Ethanol inhibition appeared to be related to acetic acid production by contaminants, particularly by obligately heterofermentative species such as L. fermentum and L. mucosae. Published by Elsevier Ltd.
Mainini, G; Rotondi, M; Scaffa, C
2011-01-01
PURPOSE OF INVESTIGATIONS: The aim of this randomized controlled trial was to evaluate efficacy and tolerability of a new association of lipohydroperoxides and glycyrrhetic acid on topical treatment of bacterial and mycotic vulvovaginitis. One hundred consecutive patients with bacterial or mycotic vulvovaginitis were randomly assigned to a study group treated with vaginal lipohydroperoxides and a derivative of glycyrrhetic acid for three days (n = 50), and a control group using vaginal antibacterial metronidazole (500 mg) or antimycotic econazole (150 mg) for six days (n = 50). A clinical and microbiological response was achieved in 80.4% and 88.9% in investigational and control group, respectively (p > 0.05). Compared to traditional antimicrobial drugs, the effect appears to be faster and safer, even if not significantly. The 6-month recurrence rate was 7.7% and 5.6% in the investigational and control group, respectively. Topical medication based on lipohydroperoxides and glycyrrhetic acid showed a clinical and microbiological efficacy in the first-line treatment of bacterial and mycotic vulvovaginitis, comparable to conventional drugs.
Tücking, Katrin-Stephanie; Grützner, Verena; Unger, Ronald E; Schönherr, Holger
2015-07-01
The synthesis of novel amphiphilic hyaluronic acid (HYA) and poly(lactic acid) (PLA) block copolymers is reported as the key element of a strategy to detect the presence of pathogenic bacterial enzymes. In addition to the formation of defined HYA-block-PLA assemblies, the encapsulation of fluorescent reporter dyes and the selective enzymatic degradation of the capsules by hyaluronidase and proteinase K are studied. The synthesis of the dual enzyme-responsive HYA-b-PLA is carried out by copper-catalyzed Huisgen 1,3-dipolar cycloaddition. The resulting copolymers are assembled in water to form vesicular structures, which are characterized by scanning electron microscopy, transmission electron microscopy, dynamic light scattering (DLS), and fluorescence lifetime imaging microscopy (FLIM). DLS measurements show that both enzymes cause a rapid decrease in the hydrodynamic diameter of the nanocapsules. Fluorescence spectroscopy data confirm the liberation of encapsulated dye, which indicates the disintegration of the capsules and validates the concept of enzymatically triggered payload release. Finally, cytotoxicity assays confirm that the HYA-b-PLA nanocapsules are biocompatible with primary human dermal microvascular endothelial cells. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
MARUI, Junichiro; BOULOM, Sayvisene; PANTHAVEE, Wanchai; MOMMA, Mari; KUSUMOTO, Ken-Ichi; NAKAHARA, Kazuhiko; SAITO, Masayoshi
2015-01-01
A bacterial community analysis, using a culture-independent method (polymerase chain reaction-denaturing gradient gel electrophoresis), detected 17 species of bacteria including species of the genera Tetragenococcus, Lactobacillus, Pediococcus, Weissella Halanaerobium, Clostridium, and Sphingomonas in a traditional salty-fermented fish paste known as pla-ra or pa-daek in Thailand and Laos, which is used as a storage-stable multi-purpose seasoning. The representative genus of lactic acid bacteria seemed to vary in the 10 products collected from Thailand and Laos. Tetragenococci were common in products from central Thailand and Vientiane in Laos which had salinities of not less than 11% and pH values ranging from 5.6 to 6.1. However, lactobacilli were common in products from northern Thailand which had the lowest salinities (8.3–8.6%) and pH values (4.5–4.8) of all the samples examined. Two Lactobacillus and one Tetragenococcus species were detected in one product from northeastern Thailand containing 10% salt. These results suggest that salinity in pla-ra/pa-daek is an important determinant of the representative genus of lactic acid bacteria such as, Tetragenococcus or Lactobacillus. Additionally, differences in the acidity between these two groups seemed to be related to the production of d-/l-lactic acid in the lactic acid bacteria in each product. This is the first study to report a correlation between bacterial community structure and taste components in pla-ra/pa-daek products from various regions. This scientific work on a traditional fermented food will be useful in helping local producers meet differing consumer preferences in various regions. PMID:25918672
Bacterial species involved in the conversion of dietary flavonoids in the human gut.
Braune, Annett; Blaut, Michael
2016-05-03
The gut microbiota plays a crucial role in the conversion of dietary flavonoids and thereby affects their health-promoting effects in the human host. The identification of the bacteria involved in intestinal flavonoid conversion has gained increasing interest. This review summarizes available information on the so far identified human intestinal flavonoid-converting bacterial species and strains as well as their enzymes catalyzing the underlying reactions. The majority of described species involved in flavonoid transformation are capable of carrying out the O-deglycosylation of flavonoids. Other bacteria cleave the less common flavonoid-C-glucosides and/or further degrade the aglycones of flavonols, flavanonols, flavones, flavanones, dihydrochalcones, isoflavones and monomeric flavan-3-ols. To increase the currently limited knowledge in this field, identification of flavonoid-converting bacteria should be continued using culture-dependent screening or isolation procedures and molecular approaches based on sequence information of the involved enzymes.
Nucleic Acid Homologies Among Oxidase-Negative Moraxella Species
Johnson, John L.; Anderson, Robert S.; Ordal, Erling J.
1970-01-01
The deoxyribonucleic acid (DNA) base composition and DNA homologies of more than 40 strains of oxidase-negative Moraxella species were determined. These bacteria have also been identified as belonging to the Mima-Herellea-Acinetobacter group and the Bacterium anitratum group, as well as to several other genera including Achromobacter and Alcaligenes. The DNA base content of these strains ranged from 40 to 46% guanine plus cytosine. DNA–DNA competition experiments distinguished five groups whose members were determined by showing 50% or more homology to one of the reference strains: B. anitratum type B5W, Achromobacter haemolyticus var. haemolyticus, Alcaligenes haemolysans, Achromobacter metalcaligenes, and Moraxella lwoffi. A sixth group comprised those strains showing less than 50% homology to any of the reference strains. Negligible homology was found between strains of oxidase-negative and oxidase-positive Moraxella species in DNA–DNA competition experiments. However, evidence of a distant relationship between the two groups was obtained in competition experiments by using ribosomal ribonucleic acid. PMID:5413826
Themes and Variations: Regulation of RpoN-Dependent Flagellar Genes across Diverse Bacterial Species
Tsang, Jennifer; Hoover, Timothy R.
2014-01-01
Flagellar biogenesis in bacteria is a complex process in which the transcription of dozens of structural and regulatory genes is coordinated with the assembly of the flagellum. Although the overall process of flagellar biogenesis is conserved among bacteria, the mechanisms used to regulate flagellar gene expression vary greatly among different bacterial species. Many bacteria use the alternative sigma factor σ 54 (also known as RpoN) to transcribe specific sets of flagellar genes. These bacteria include members of the Epsilonproteobacteria (e.g., Helicobacter pylori and Campylobacter jejuni), Gammaproteobacteria (e.g., Vibrio and Pseudomonas species), and Alphaproteobacteria (e.g., Caulobacter crescentus). This review characterizes the flagellar transcriptional hierarchies in these bacteria and examines what is known about how flagellar gene regulation is linked with other processes including growth phase, quorum sensing, and host colonization. PMID:24672734
Tiedge, Kira; Lohaus, Gertrud
2017-01-01
Floral nectar contains mainly sugars but also amino acids, organic acids, inorganic ions and secondary compounds to attract pollinators. The genus Nicotiana exhibits great diversity among species in floral morphology, flowering time, nectar compositions, and predominant pollinators. We studied nectar samples of 20 Nicotiana species, composed equally of day- and night-flowering plants and attracting different groups of pollinators (e.g. hummingbirds, moths or bats) to investigate whether sugars, amino acids, organic acids and inorganic ions are influenced by pollinator preferences. Glucose, fructose and sucrose were the only sugars found in the nectar of all examined species. Sugar concentration of the nectar of day-flowering species was 20% higher and amino acid concentration was 2-3-fold higher compared to the nectar of night-flowering species. The sucrose-to-hexose ratio was significantly higher in night-flowering species and the relative share of sucrose based on the total sugar correlated with the flower tube length in the nocturnal species. Flowers of different tobacco species contained varying volumes of nectar which led to about 150-fold higher amounts of total sugar per flower in bat- or sunbird-pollinated species than in bee-pollinated or autogamous species. This difference was even higher for total amino acids per flower (up to 1000-fold). As a consequence, some Nicotiana species invest large amounts of organic nitrogen for certain pollinators. Higher concentrations of inorganic ions, predominantly anions, were found in nectar of night-flowering species. Therefore, higher anion concentrations were also associated with pollinator types active at night. Malate, the main organic acid, was present in all nectar samples but the concentration was not correlated with pollinator type. In conclusion, statistical analyses revealed that pollinator types have a stronger effect on nectar composition than phylogenetic relations. In this context, nectar sugars and amino
Tiedge, Kira; Lohaus, Gertrud
2017-01-01
Floral nectar contains mainly sugars but also amino acids, organic acids, inorganic ions and secondary compounds to attract pollinators. The genus Nicotiana exhibits great diversity among species in floral morphology, flowering time, nectar compositions, and predominant pollinators. We studied nectar samples of 20 Nicotiana species, composed equally of day- and night-flowering plants and attracting different groups of pollinators (e.g. hummingbirds, moths or bats) to investigate whether sugars, amino acids, organic acids and inorganic ions are influenced by pollinator preferences. Glucose, fructose and sucrose were the only sugars found in the nectar of all examined species. Sugar concentration of the nectar of day-flowering species was 20% higher and amino acid concentration was 2-3-fold higher compared to the nectar of night-flowering species. The sucrose-to-hexose ratio was significantly higher in night-flowering species and the relative share of sucrose based on the total sugar correlated with the flower tube length in the nocturnal species. Flowers of different tobacco species contained varying volumes of nectar which led to about 150-fold higher amounts of total sugar per flower in bat- or sunbird-pollinated species than in bee-pollinated or autogamous species. This difference was even higher for total amino acids per flower (up to 1000-fold). As a consequence, some Nicotiana species invest large amounts of organic nitrogen for certain pollinators. Higher concentrations of inorganic ions, predominantly anions, were found in nectar of night-flowering species. Therefore, higher anion concentrations were also associated with pollinator types active at night. Malate, the main organic acid, was present in all nectar samples but the concentration was not correlated with pollinator type. In conclusion, statistical analyses revealed that pollinator types have a stronger effect on nectar composition than phylogenetic relations. In this context, nectar sugars and amino
The changes of dominant lactic acid bacteria and their metabolites during corn stover ensiling.
Xu, Zhenshang; Zhang, Susu; Zhang, Rongling; Li, Shixu; Kong, Jian
2018-05-15
Monitoring the succession of bacterial populations during corn stover ensiling are helpful for improving the silage quality. Fermentation characteristics were assessed and bacterial communities were described along with the ensiling process. The ensiled corn stover exhibited chemical traits as low pH value (3.92 ± 0.02) and high levels of lactic acid (66.75 ± 1.97 g kg -1 dry matter) which were associated with well ensiled forages, as well as moderate concentrations of acetic acid (19.69 ± 1.51 g kg -1 dry matter) and small amounts of 1, 2-propanediol (4.4 ± 0.11 g kg -1 dry matter). In the early stages of the ensiling process, a significant increase and then reduction of the abundance of species Lactococcus lactis, Leuconostoc pseudomesenteroides, Pediococcus pentosaceus and Weissella sp. were observed. The species Lactobacillus plantarum (Lb. plantarum) group and Lb. brevis grew vigorously, and the species Lb. farciminis and Lb. parafarraginis gradually increased along with the course of ensiling. High-throughput sequencing was successfully used to describe bacterial communities throughout the process of corn stover ensiling. The knowledge about the ecological succession of the dominant lactic acid bacteria could lead to improved ensiling practices and the selection of corn stover silage inoculants. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Kim, Man Deok; Song, Minkyung; Jo, Minho; Shin, Seung Gu; Khim, Jee Hyeong; Hwang, Seokhwan
2010-02-01
This paper reports the effects of changing pH (5-7) and temperature (T, 40-60 degrees C) on the efficiencies of bacterial hydrolysis of suspended organic matter (SOM) in wastewater from food waste recycling (FWR) and the changes in the bacterial community responsible for this hydrolysis. Maximum hydrolysis efficiency (i.e., 50.5% reduction of volatile suspended solids) was predicted to occur at pH 5.7 and T = 44.5 degrees C. Changes in short-chain volatile organic acid profiles and in acidogenic bacterial communities were investigated under these conditions. Propionic and butyric acids concentrations increased rapidly during the first 2 days of incubation. Several band sequences consistent with Clostridium spp. were detected using denaturing gel gradient electrophoresis. Clostridium thermopalmarium and Clostridium novyi seemed to contribute to butyric acid production during the first 1.5 days of acidification of FWR wastewater, and C. thermopalmarium was a major butyric acid producer afterward. C. novyi was an important propionic acid producer. These two species appear to be important contributors to hydrolysis of SOM in the wastewater. Other acidogenic anaerobes, Aeromonas sharmana, Bacillus coagulans, and Pseudomonas plecoglossicida, were also indentified.
Raw Cow Milk Bacterial Population Shifts Attributable to Refrigeration
Lafarge, Véronique; Ogier, Jean-Claude; Girard, Victoria; Maladen, Véronique; Leveau, Jean-Yves; Gruss, Alexandra; Delacroix-Buchet, Agnès
2004-01-01
We monitored the dynamic changes in the bacterial population in milk associated with refrigeration. Direct analyses of DNA by using temporal temperature gel electrophoresis (TTGE) and denaturing gradient gel electrophoresis (DGGE) allowed us to make accurate species assignments for bacteria with low-GC-content (low-GC%) (<55%) and medium- or high-GC% (>55%) genomes, respectively. We examined raw milk samples before and after 24-h conservation at 4°C. Bacterial identification was facilitated by comparison with an extensive bacterial reference database (∼150 species) that we established with DNA fragments of pure bacterial strains. Cloning and sequencing of fragments missing from the database were used to achieve complete species identification. Considerable evolution of bacterial populations occurred during conservation at 4°C. TTGE and DGGE are shown to be a powerful tool for identifying the main bacterial species of the raw milk samples and for monitoring changes in bacterial populations during conservation at 4°C. The emergence of psychrotrophic bacteria such as Listeria spp. or Aeromonas hydrophila is demonstrated. PMID:15345453
Dietary and developmental shifts in butterfly-associated bacterial communities
2018-01-01
Bacterial communities associated with insects can substantially influence host ecology, evolution and behaviour. Host diet is a key factor that shapes bacterial communities, but the impact of dietary transitions across insect development is poorly understood. We analysed bacterial communities of 12 butterfly species across different developmental stages, using amplicon sequencing of the 16S rRNA gene. Butterfly larvae typically consume leaves of a single host plant, whereas adults are more generalist nectar feeders. Thus, we expected bacterial communities to vary substantially across butterfly development. Surprisingly, only few species showed significant dietary and developmental transitions in bacterial communities, suggesting weak impacts of dietary transitions across butterfly development. On the other hand, bacterial communities were strongly influenced by butterfly species and family identity, potentially due to dietary and physiological variation across the host phylogeny. Larvae of most butterfly species largely mirrored bacterial community composition of their diets, suggesting passive acquisition rather than active selection. Overall, our results suggest that although butterflies harbour distinct microbiomes across taxonomic groups and dietary guilds, the dramatic dietary shifts that occur during development do not impose strong selection to maintain distinct bacterial communities across all butterfly hosts. PMID:29892359
Changes in the fatty acid composition in bitter Lupinus species depend on the debittering process.
Curti, Carolina A; Curti, Ramiro N; Bonini, Norberto; Ramón, Adriana N
2018-10-15
The evaluation of changes in the fatty acid composition in Lupinus species after the debittering process is crucial to determine their nutritional implications. The aim of this study was to evaluate changes in the fatty acid composition in Lupinus albus and L. mutabilis after the debittering process. Lupinus species showed different fatty acid compositions which changed depending on the debittering process applied. The debittering process changed the monounsaturated and polyunsaturated fatty acids in L. albus, whereas in L. mutabilis it changed the w-6/w-3 ratio. However, the total saturated fatty acid content remained stable in both species after the debittering process. The changes in L. albus were associated with the fatty acid desaturation and a conversion into unsaturated fatty acids, whereas in L. mutabilis with the lipid peroxidation by decreasing the linoleic acid content. Nutritional implications of these changes in the fatty acid composition are discussed. Copyright © 2018. Published by Elsevier Ltd.
Ding, Guo Chang; Wang, Xiao Hua; Yang, Qi Fan; Lin, Qun Xing; Huang, Zhi Qun
2017-11-01
We employed a comparative study to examine the effects of tree species transition on soil microbial biomass, community composition and enzymes activities under Cunninghamia lanceolata (Lamb.) Hook, Eucalyptus grandis and a N-fixing species, Acacia melanoxylon in subtropical China. Results showed that the effect of tree species on soil microbial community and enzymes activities was significant only in the 0-10 cm soil layer. Reforestation with N-fixing species A. melanoxylon on the C. lanceolata harvest site significantly increased the total phospholipid fatty acid (PLFA), fungal PLFAs, Gram-positive bacterial PLFAs, Gram-negative bacterial PLFAs and actinomycetes biomasses in the 0-10 cm soil layer. The principal component analysis (PCA) showed that the soil microbial community composition in A. melanoxylon soil differed significantly from that in C. lanceolata and E. grandis soils. N-fixing species (A. melanoxylon) significantly enhanced the percent abundance of Gram-positive bacteria, Gram-negative bacteria and actinomycetes. Activities of cellobiohydrolase, N-acetyl-β-d-glucosaminidase and acid phosphatase were significantly higher under A. melanoxylon than under C. lanceolata and E. grandis plantations. Our results suggested that reforestation with N-fixing species, A. melanoxylon on C. lanceolata harvest site could increase soil microbial biomass, enzyme activities and soil organic matter content.
NASA Astrophysics Data System (ADS)
Uehara, H.; Arakaki, T.
2017-12-01
Hypochlorous acid and hypobromous acid (abbreviated as "HypoX acids") are the main ingredients of bleaching and bactericides. The HypoX acids change their chemical forms depending on environmental factors such as pH and various chemical reactions. For example, it has been reported that hypobromite ion in water changes to carcinogenic bromate by photochemical reaction with ultraviolet light. In this study, concentrations of HypoX acids were determined by UV-VIS absorbance measurement utilizing the fact that HypoX acids react with hydrogen peroxide and do not co-exist in the solution. The method for determining the concentration by titration with hydrogen peroxide can be carried out simpler and more efficiently than the DPD method or the current titration method generally used for chlorine concentration measurement. Molar absorptivity between 250 - 500 nm of HypoX acids, including their conjugate base species, was determined by solving theoretical acid-base formula including molar fraction of each chemical species at various pHs. Molar absorptivity of OCl- and OBr- between 250 - 500 nm was determined based on the concentrations obtained from titration with hydrogen peroxide and absorbance at pH > 10, where OCl- and OBr- dominate. Furthermore, the HypoX acids solutions were irradiated with a solar simulator, and the photolysis rate constants were obtained. Based on those values, the half-lives were calculated and the behavior of HypoX acids in the environment was elucidated.
Anti-Biofilm Performance of Three Natural Products against Initial Bacterial Attachment
Salta, Maria; Wharton, Julian A.; Dennington, Simon P.; Stoodley, Paul; Stokes, Keith R.
2013-01-01
Marine bacteria contribute significantly towards the fouling consortium, both directly (modern foul release coatings fail to prevent “slime” attachment) and indirectly (biofilms often excrete chemical cues that attract macrofouling settlement). This study assessed the natural product anti-biofilm performance of an extract of the seaweed, Chondrus crispus, and two isolated compounds from terrestrial sources, (+)-usnic acid and juglone, against two marine biofilm forming bacteria, Cobetia marina and Marinobacter hydrocarbonoclasticus. Bioassays were developed using quantitative imaging and fluorescent labelling to test the natural products over a range of concentrations against initial bacterial attachment. All natural products affected bacterial attachment; however, juglone demonstrated the best anti-biofilm performance against both bacterial species at a concentration range between 5–20 ppm. In addition, for the first time, a dose-dependent inhibition (hormetic) response was observed for natural products against marine biofilm forming bacteria. PMID:24192819
Bessmeltseva, Marianna; Viiard, Ene; Simm, Jaak; Paalme, Toomas; Sarand, Inga
2014-01-01
The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200), propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius) were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus) was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata) were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping.
Amino acids in eight species of Monogenea.
Arme, C
1977-04-15
The ethanol-extractable amino acids of several species of Monogenea were analysed. In the Monopisthocotylea levels were high ( greater than 1,200 micronmoles/g/ethanol extracted dry wt); in the Polyopisthocotylea lower amounts were present (196-562 micronmoles). High proline levels were present in parasites of hosts from a marine environment but low in freshwater forms. No correlation between diet and proline content was observed.
Zheng, Jia; Wu, Chongde; Huang, Jun; Zhou, Rongqing; Liao, Xuepin
2014-12-01
Grain fermenting with separate layers in a fermentation pit is the typical and experiential brewing technology for Chinese Luzhou-flavor liquor. However, it is still unclear to what extent the bacterial communities in the different layers of fermented grains (FG) effects the liquor's quality. In this study, the spatial distributions of bacterial communities in Luzhou-flavor liquor FG (top, middle, and bottom layers) from 2 distinctive factories (Jiannanchun and Fenggu) were investigated using culture-independent approaches (phospholipid fatty acid [PLFA] and polymerase chain reaction-denaturing gel electrophoresis [DGGE]). The relationship between bacterial community and biochemical properties was also assessed by Canonical correspondence analysis (CCA). No significant variation in moisture was observed in spatial samples, and the highest content of acidity and total ester was detected in the bottom layer (P < 0.05). A high level of ethanol was observed in the top and middle layers of Fenggu and Jiannanchun, respectively. Significant spatial distribution of the total PLFA was only shown in the 50-y-old pits (P < 0.05), and Gram negative bacteria was the prominent community. Bacterial 16S rDNA DGGE analysis revealed that the most abundant bacterial community was in the top layers of the FG both from Fenggu and Jiannanchun, with Lactobacillaceae accounting for 30% of the total DGGE bands and Lactobacillus acetotolerans was the dominant species. FG samples from the same pit had a highly similar bacterial community structure according to the hierarchal cluster tree. CCA suggested that the moisture, acidity, ethanol, and reducing sugar were the main factors affecting the distribution of L. acetotolerans. Our results will facilitate the knowledge about the spatial distribution of bacterial communities and the relationship with their living environment. © 2014 Institute of Food Technologists®
Peracetic acid in the disinfection of a hospital water system contaminated with Legionella species.
Ditommaso, Savina; Biasin, Cinzia; Giacomuzzi, Monica; Zotti, Carla Maria; Cavanna, Alberto; Ruggenini Moiraghi, Angela
2005-05-01
To assess the efficacy of an alternative disinfection method for hospital water distribution systems contaminated with Legionella. Disinfection with peracetic acid was performed in a small hospital contaminated with L. pneumophila serotype 1. The disinfectant was used at concentrations of 50 ppm (first three surveillance phases) and 1,000 ppm (fourth surveillance phase) for 30 minutes. Environmental monitoring revealed that disinfection was maintained 1 week after treatment; however, levels of recontamination surpassing baseline values were detected after approximately 1 month. Comparison of water temperatures measured at the distal outlets showed a statistically significant association between temperature and bacterial load. The circulating water temperature was found to be lower in the two wards farthest away from the hot water production plant than in other wards. It was thought that the lower water temperature in the two wards promoted the bacterial growth even after disinfection. Peracetic acid may be useful in emergency situations, but does not provide definitive protection even if used monthly.
Menke, Sebastian; Wasimuddin; Meier, Matthias; Melzheimer, Jörg; Mfune, John K. E.; Heinrich, Sonja; Thalwitzer, Susanne; Wachter, Bettina; Sommer, Simone
2014-01-01
Recent gut microbiome studies in model organisms emphasize the effects of intrinsic and extrinsic factors on the variation of the bacterial composition and its impact on the overall health status of the host. Species occurring in the same habitat might share a similar microbiome, especially if they overlap in ecological and behavioral traits. So far, the natural variation in microbiomes of free-ranging wildlife species has not been thoroughly investigated. The few existing studies exploring microbiomes through 16S rRNA gene reads clustered sequencing reads into operational taxonomic units (OTUs) based on a similarity threshold (e.g., 97%). This approach, in combination with the low resolution of target databases, generally limits the level of taxonomic assignments to the genus level. However, distinguishing natural variation of microbiomes in healthy individuals from “abnormal” microbial compositions that affect host health requires knowledge of the “normal” microbial flora at a high taxonomic resolution. This gap can now be addressed using the recently published oligotyping approach, which can resolve closely related organisms into distinct oligotypes by utilizing subtle nucleotide variation. Here, we used Illumina MiSeq to sequence amplicons generated from the V4 region of the 16S rRNA gene to investigate the gut microbiome of two free-ranging sympatric Namibian carnivore species, the cheetah (Acinonyx jubatus) and the black-backed jackal (Canis mesomelas). Bacterial phyla with proportions >0.2% were identical for both species and included Firmicutes, Fusobacteria, Bacteroidetes, Proteobacteria and Actinobacteria. At a finer taxonomic resolution, black-backed jackals exhibited 69 bacterial taxa with proportions ≥0.1%, whereas cheetahs had only 42. Finally, oligotyping revealed that shared bacterial taxa consisted of distinct oligotype profiles. Thus, in contrast to 3% OTUs, oligotyping can detect fine-scale taxonomic differences between microbiomes
Desjardins, A. E.; Manandhar, H. K.; Plattner, R. D.; Manandhar, G. G.; Poling, S. M.; Maragos, C. M.
2000-01-01
Infection of cereal grains with Fusarium species can cause contamination with mycotoxins that affect human and animal health. To determine the potential for mycotoxin contamination, we isolated Fusarium species from samples of rice seeds that were collected in 1997 on farms in the foothills of the Nepal Himalaya. The predominant Fusarium species in surface-disinfested seeds with husks were species of the Gibberella fujikuroi complex, including G. fujikuroi mating population A (anamorph, Fusarium verticillioides), G. fujikuroi mating population C (anamorph, Fusarium fujikuroi), and G. fujikuroi mating population D (anamorph, Fusarium proliferatum). The widespread occurrence of mating population D suggests that its role in the complex symptoms of bakanae disease of rice may be significant. Other common species were Gibberella zeae (anamorph, Fusarium graminearum) and Fusarium semitectum, with Fusarium acuminatum, Fusarium anguioides, Fusarium avenaceum, Fusarium chlamydosporum, Fusarium equiseti, and Fusarium oxysporum occasionally present. Strains of mating population C produced beauvericin, moniliformin, and gibberellic acid, but little or no fumonisin, whereas strains of mating population D produced beauvericin, fumonisin, and, usually, moniliformin, but no gibberellic acid. Some strains of G. zeae produced the 8-ketotrichothecene nivalenol, whereas others produced deoxynivalenol. Despite the occurrence of fumonisin-producing strains of mating population D, and of 8-ketotrichothecene-producing strains of G. zeae, Nepalese rice showed no detectable contamination with these mycotoxins. Effective traditional practices for grain drying and storage may prevent contamination of Nepalese rice with Fusarium mycotoxins. PMID:10698766
Batta, Neha; Subudhi, Sanjukta; Lal, Banwari; Devi, Arundhuti
2013-11-01
Lead is one of the four heavy metals that has a profound damaging effects on human health. In the recent past there has been an increasing global concern for development of sustainable bioremediation technologies for detoxification of lead contaminant. Present investigation highlights for lead biosorption by a newly isolated novel bacterial species; Achromobacter sp. TL-3 strain, isolated from activated sludge samples contaminated with heavy metals (collected from oil refinery, Assam, North-East India). For isolation of lead tolerant bacteria, sludge samples were enriched into Luria Broth medium supplemented separately with a range of lead nitrate; 250, 500, 750, 1000, 1250 and 1500 ppm respectively. The bacterial consortium that could tolerate 1500 ppm of lead nitrate was selected further for purification of lead tolerant bacterial isolates. Purified lead tolerant bacterial isolates were then eventually inoculated into production medium supplemented with ethanol and glycerol as carbon and energy source to investigate for bioflocculant production. Bioflocculant production was estimated by monitoring the potential of lead tolerant bacterial isolate to flocculate Kaolin clay in presence of 1% CaCl2. Compared to other isolates, TL-3 isolate demonstrated for maximum bioflocculant activity of 95% and thus was identified based on 16S rRNA gene sequence analysis. TL3 isolate revealed maximum homology (98%) with Achromobacter sp. and thus designated as Achromobacter sp. TL-3. Bioflocculant activity of TL-3 isolate was correlated with the change in pH and growth. Achromobacter sp. TL-3 has significant potential for lead biosorption and can be effectively employed for detoxification of lead contaminated waste effluents/waste waters.
Hallberg, Kevin B.; Coupland, Kris; Kimura, Sakurako; Johnson, D. Barrie
2006-01-01
The microbial composition of acid streamers (macroscopic biofilms) in acidic, metal-rich waters in two locations (an abandoned copper mine and a chalybeate spa) in north Wales was studied using cultivation-based and biomolecular techniques. Known chemolithotrophic and heterotrophic acidophiles were readily isolated from disrupted streamers, but they accounted for only <1 to 7% of the total microorganisms present. Fluorescent in situ hybridization (FISH) revealed that 80 to 90% of the microbes in both types of streamers were β-Proteobacteria. Terminal restriction fragment length polymorphism analysis of the streamers suggested that a single bacterial species was dominant in the copper mine streamers, while two distinct bacteria (one of which was identical to the bacterium found in the copper mine streamers) accounted for about 90% of the streamers in the spa water. 16S rRNA gene clone libraries showed that the β-proteobacterium found in both locations was closely related to a clone detected previously in acid mine drainage in California and that its closest characterized relatives were neutrophilic ammonium oxidizers. Using a modified isolation technique, this bacterium was isolated from the copper mine streamers and shown to be a novel acidophilic autotrophic iron oxidizer. The β-proteobacterium found only in the spa streamers was closely related to the neutrophilic iron oxidizer Gallionella ferruginea. FISH analysis using oligonucleotide probes that targeted the two β-proteobacteria confirmed that the biodiversity of the streamers in both locations was very limited. The microbial compositions of the acid streamers found at the two north Wales sites are very different from the microbial compositions of the previously described acid streamers found at Iron Mountain, California, and the Rio Tinto, Spain. PMID:16517651
Mizuno, Satoru; Kado, Sayaka; Goto, Kaoru; Takahashi, Daisuke; Sakane, Fumio
2016-12-01
Phosphatidic acid (PA) is one of the phospholipids composing the plasma membrane and acts as a second messenger to regulate a wide variety of important cellular events, including mitogenesis, migration and differentiation. PA consists of various molecular species with different acyl chains at the sn- 1 and sn -2 positions. However, it has been poorly understood what PA molecular species are produced during such cellular events. Here we identified the PA molecular species generated during retinoic acid (RA)-induced neuroblastoma cell differentiation using a newly established liquid chromatography/mass spectrometry (LC/MS) method. Intriguingly, the amount of 32:0-PA species was dramatically and transiently increased in Neuro-2a neuroblastoma cells 24-48 h after RA-treatment. In addition, 30:0- and 34:0-PA species were also moderately increased. Moreover, similar results were obtained when Neuro-2a cells were differentiated for 24 h by serum starvation. MS/MS analysis revealed that 32:0-PA species contains two palmitic acids (16:0 s). RT-PCR analysis showed that diacylglycerol kinase (DGK) δ and DGKζ were highly expressed in Neuro-2a cells. The silencing of DGKζ expression significantly decreased the production of 32:0-PA species, whereas DGKδ-siRNA did not. Moreover, neurite outgrowth was also markedly attenuated by the deficiency of DGKζ. Taken together, these results indicate that DGKζ exclusively generates very restricted PA species, 16:0/16:0-PA, and up-regulates neurite outgrowth during the initial/early stage of neuroblastoma cell differentiation.
Rapid detection method for fusaric acid-producing species of Fusarium by PCR
USDA-ARS?s Scientific Manuscript database
Fusaric acid is a mycotoxin produced by species of the fungus Fusarium and can act synergistically with other Fusarium toxins. In order to develop a specific detection method for fusaric acid-producing fungus, PCR prim¬ers were designed to amplify FUB10, a transcription factor gene in fusaric acid ...
Bacterial Utilization of L-sugars and D-amino Acids
NASA Technical Reports Server (NTRS)
Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline
2006-01-01
The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084
Acidic fog and temperature effects on stigmatic receptivity in two birch species
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hughes, R.N.; Cox, R.M.
Factorial assays were performed to determine the effects of simulated acid fog (SAF) and temperature on stigmatic receptivity in two birch species. Excised reproductive branches were sampled from representative individuals of mountain paper birch (Betula cordifolia Regel.) and paper birch (Betula papyrifera Marsh.) in populations adjacent to the Bay of Fundy, New Brunswick, Canada. Since 1979 these trees have exhibited branch dieback in association with abnormal foliar browning symptoms. This browning has been linked with acidity and nitrate deposited by fog, which is frequent in the area. In general, experimental results indicated that pollen germination increased with temperature, but pHmore » effects were less obvious. Similarly, pollen tube growth responded positively to temperature and was little affected by fog acidity. ANOVA tests indicated a significant difference (P < 0.05) between species in their pollen germination response only at 12{degrees}C, and not at the other three temperatures tested. For pollen tube growth, significant differences between species (P < 0.05) were demonstrated at 12 and 22{degrees}C. A significant pH effect was demonstrated at 27{degrees}C for germination, while pH effects on tube growth were significant at 27 and 12{degrees}C (P < 0.01). A response surface regression analysis indicated that acidity significantly affected pollen germination in mountain paper birch (P < 0.001) but not in paper birch. Temperature was not a significant factor for in vivo pollen germination in either species. For pollen tube growth, however, temperature was more important than pH and produced highly significant effects in both species (P < 0.001). Acidity was also a significant factor in pollen tube growth for paper birch. 39 refs., 4 figs., 3 tabs.« less
Fatty acid and sterol composition of three phytomonas species.
Nakamura, C V; Waldow, L; Pelegrinello, S R; Ueda-Nakamura, T; Filho, B A; Filho, B P
1999-01-01
Fatty acid and sterol analysis were performed on Phytomonas serpens and Phytomonas sp. grown in chemically defined and complex medium, and P. françai cultivated in complex medium. The three species of the genus Phytomonas had qualitatively identical fatty acid patterns. Oleic, linoleic, and linolenic were the major unsaturated fatty acids. Miristic and stearic were the major saturated fatty acids. Ergosterol was the only sterol isolated from Phytmonas sp. and P. serpens grown in a sterol-free medium, indicating that it was synthesized de novo. When P. françai that does not grow in defined medium was cultivated in a complex medium, cholesterol was the only sterol detected. The fatty acids and sterol isolated from Phytomonas sp. and P. serpens grown in a chemically defined lipid-free medium indicated that they were able to biosynthesize fatty acids and ergosterol from acetate or from acetate precursors such as glucose or threonine.
Opelt, Katja; Chobot, Vladimir; Hadacek, Franz; Schönmann, Susan; Eberl, Leo; Berg, Gabriele
2007-11-01
High acidity, low temperature and extremely low concentration of nutrients form Sphagnum bogs into extreme habitats for organisms. Little is known about the bacteria associated with living Sphagnum plantlets, especially about their function for the host. Therefore, we analysed the endo- and ectophytic bacterial populations associated with two widely distributed Sphagnum species, Sphagnum magellanicum and Sphagnum fallax, by a multiphasic approach. The screening of 1222 isolates for antagonistic activity resulted in 326 active isolates. The bacterial communities harboured a high proportion of antifungal (26%) but a low proportion of antibacterial isolates (0.4%). Members of the genus Burkholderia (38%) were found to be the most dominant group of antagonistic bacteria. The finding that a large proportion (89%) of the antagonistic bacteria produced antifungal compounds may provide an explanation for the well-known antimicrobial activity of certain Sphagnum species. The secondary metabolites of the Sphagnum species themselves were analysed by HPLC-PDA. The different spectra of detected compounds may not only explain the antifungal activity but also the species specificity of the microbial communities. The latter was analysed using cultivation-independent single-stranded conformation polymorphism (SSCP) analysis. Using Burkholderia-specific primers we found a high diversity of Burkholderia isolates in the endophytic and ectophytic habitats of Sphagnum. Furthermore, a high diversity of nitrogen-fixing bacteria was detected by using nifH-specific primers, especially inside Sphagnum mosses. In conclusion, this study provides evidence that both Sphagnum species were colonized by characteristic bacterial populations, which appear to be important for pathogen defence and nitrogen fixation.
Nguyen, Thao Thi; Chon, Tae-Soo; Kim, Jaehan; Seo, Young-Su; Heo, Muyoung
2017-07-01
Secreted proteins (secretomes) play crucial roles during bacterial pathogenesis in both plant and human hosts. The identification and characterization of secretomes in the two plant pathogens Burkholderia glumae BGR1 and B. gladioli BSR3, which cause diseases in rice such as seedling blight, panicle blight, and grain rot, are important steps to not only understand the disease-causing mechanisms but also find remedies for the diseases. Here, we identified two datasets of secretomes in B. glumae BGR1 and B. gladioli BSR3, which consist of 118 and 111 proteins, respectively, using mass spectrometry approach and literature curation. Next, we characterized the functional properties, potential secretion pathways and sequence information properties of secretomes of two plant pathogens in a comparative analysis by various computational approaches. The ratio of potential non-classically secreted proteins (NCSPs) to classically secreted proteins (CSPs) in B. glumae BGR1 was greater than that in B. gladioli BSR3. For CSPs, the putative hydrophobic regions (PHRs) which are essential for secretion process of CSPs were screened in detail at their N-terminal sequences using hidden Markov model (HMM)-based method. Total 31 pairs of homologous proteins in two bacterial secretomes were indicated based on the global alignment (identity ≥ 70%). Our results may facilitate the understanding of the species-specific features of secretomes in two plant pathogenic Burkholderia species.
[Fatty acids in different edible fish species from Mexico].
Castro González, María Isabel; Rodríguez, Ana Gabriela Maafs; Galindo Gómez, Carlos
2013-12-01
Different biotic and abiotic factors determine the fatty acid (FA) composition of fish tissues and organs. This information is useful for humans due to the fact that fish consumption is associated with health benefits. The aim of the present study was to identify the variation in the concentration of fatty acids, according to different factors, among ten edible marine fish species in Mexico, collected from June to December 2009 in the largest fish market in Mexico City: Euthynnus alletteratus, Sciaenops ocellatus, Bairdiella chrysoura, Sphyraena guachancho, Symphurus elongatus, Istiophorus platypterus, Ophichthus rex, Eugerres plumieri, Eucinostomus entomelas and Oreochromrnis mossambicus. Lipid content was gravimetrically quantified, the fatty acids were determined using a gas chromatograph and the results were statistically analyzed. Total lipid content ranged from 0.93 to 1.95 g/100 g in E. entomelas and O. urolepis hornorum, respectively. E. alletteratus, B. chrysoura, S. elongatus, I. platypterus, O. rex and E. plumieri presented the following order in FA concentration: Polyunsaturated FA (PUFA)>Saturated FA (SFA)>Monounsaturated FA (MUFA). S. ocellatus, S. guachancho and E. entomelas presented SFA>PUFA>MUFA; and only O. mossambicus presented SFA>MUFA>PUFA. O. mossambicus had the highest concentration (mg/100 g) of SFA (559.40) and MUFA (442.60), while B. chrysoura presented the highest content (mg/100 g) of PUFA (663.03), n-3 PUFA (514.03), EPA+DHA (506.10) and n-6 PUFA (145.80). Biotic and abiotic factors of the analyzed fish significantly influenced their FA concentration. Subtropical species presented 42.1% more EPA+DHA than tropical specie. Values presented here will vary according to the changes in the ecosystem and characteristics of each fish species, however the information generated in the present study is useful for improving fish consumption recommendations.
Murthy, Hosakatte Niranjana; Kim, Yun-Soo; Park, So-Young; Paek, Kee-Yoeup
2014-09-01
Caffeic acid derivatives (CADs) are a group of bioactive compounds which are produced in Echinacea species especially Echinacea purpurea, Echinacea angustifolia, and Echinacea pallida. Echinacea is a popular herbal medicine used in the treatment of common cold and it is also a prominent dietary supplement used throughout the world. Caffeic acid, chlorogenic acid (5-O-caffeoylquinic acid), caftaric acid (2-O-caffeoyltartaric acid), cichoric acid (2, 3-O-dicaffeoyltartaric acid), cynarin, and echinacoside are some of the important CADs which have varied pharmacological activities. The concentrations of these bioactive compounds are species specific and also they vary considerably with the cultivated Echinacea species due to geographical location, stage of development, time of harvest, and growth conditions. Due to these reasons, plant cell and organ cultures have become attractive alternative for the production of biomass and caffeic acid derivatives. Adventitious and hairy roots have been induced in E. pupurea and E. angustifolia, and suspension cultures have been established from flask to bioreactor scale for the production of biomass and CADs. Tremendous progress has been made in this area; various bioprocess methods and strategies have been developed for constant high-quality productivity of biomass and secondary products. This review is aimed to discuss biotechnological methods and approaches employed for the sustainable production of CADs.
Culturable endophytic bacterial communities associated with field-grown soybean.
de Almeida Lopes, K B; Carpentieri-Pipolo, V; Oro, T H; Stefani Pagliosa, E; Degrassi, G
2016-03-01
Assess the diversity of the culturable endophytic bacterial population associated with transgenic and nontransgenic soybean grown in field trial sites in Brazil and characterize them phenotypically and genotypically focusing on characteristics related to plant growth promotion. Endophytic bacteria were isolated from roots, stems and leaves of soybean cultivars (nontransgenic (C) and glyphosate-resistant (GR) transgenic soybean), including the isogenic BRS133 and BRS245RR. Significant differences were observed in bacterial densities in relation to genotype and tissue from which the isolates were obtained. The highest number of bacteria was observed in roots and in GR soybean. Based on characteristics related to plant growth promotion, 54 strains were identified by partial 16S rRNA sequence analysis, with most of the isolates belonging to the species Enterobacter ludwigii and Variovorax paradoxus. Among the isolates, 44·4% were able to either produce indoleacetic acid (IAA) or solubilize phosphates, and 9·2% (all from GR soybean) presented both plant growth-promoting activities. The results from this study indicate that the abundance of endophytic bacterial communities of soybean differs between cultivars and in general it was higher in the transgenic cultivars than in nontransgenic cultivars. BRS 245 RR exhibited no significant difference in abundance compared to nontransgenic BRS133. This suggests that the impact of the management used in the GR soybean fields was comparable with the impacts of some enviromental factors. However, the bacterial endophytes associated to GR and nontransgenic soybean were different. The soybean-associated bacteria showing characteristics related to plant growth promotion were identified as belonging to the species Pantoea agglomerans and Variovorax paradoxus. Our study demonstrated differences concerning compostion of culturable endophytic bacterial population in nontransgenic and transgenic soybean. © 2016 The Society for Applied
Memory of Germinant Stimuli in Bacterial Spores
Wang, Shiwei; Faeder, James R.; Setlow, Peter
2015-01-01
ABSTRACT Bacterial spores, despite being metabolically dormant, possess the remarkable capacity to detect nutrients and other molecules in their environment through a biochemical sensory apparatus that can trigger spore germination, allowing the return to vegetative growth within minutes of exposure of germinants. We demonstrate here that bacterial spores of multiple species retain memory of transient exposures to germinant stimuli that can result in altered responses to subsequent exposure. The magnitude and decay of these memory effects depend on the pulse duration as well as on the separation time, incubation temperature, and pH values between the pulses. Spores of Bacillus species germinate in response to nutrients that interact with germinant receptors (GRs) in the spore’s inner membrane, with different nutrient types acting on different receptors. In our experiments, B. subtilis spores display memory when the first and second germinant pulses target different receptors, suggesting that some components of spore memory are downstream of GRs. Furthermore, nonnutrient germinants, which do not require GRs, exhibit memory either alone or in combination with nutrient germinants, and memory of nonnutrient stimulation is found to be more persistent than that induced by GR-dependent stimuli. Spores of B. cereus and Clostridium difficile also exhibit germination memory, suggesting that memory may be a general property of bacterial spores. These observations along with experiments involving strains with mutations in various germination proteins suggest a model in which memory is stored primarily in the metastable states of SpoVA proteins, which comprise a channel for release of dipicolinic acid, a major early event in spore germination. PMID:26604257
The effect of boric acid on bacterial culture of canine and feline urine.
Rowlands, M; Blackwood, L; Mas, A; Cripps, P; Crompton, C; Burrow, R
2011-10-01
To identify the optimal method of submission of canine and feline urine for bacterial culture. Cystocentesis samples from 250 animals (200 dogs, 50 cats) suspected of having urinary tract infections were collected. The reference aliquot, without preservative, was processed on site within 2 hours. Two further aliquots (one without preservative, one with boric acid) were stored at room temperature for up to 7 hours and then posted by guaranteed next day delivery to a commercial laboratory for analysis. Forty-seven of the samples were positive on culture in the reference test. There was no significant difference between reference test results and those of samples posted without preservative (P=0·39), but samples posted in boric acid were significantly less likely to give a positive result (P=0·01). Samples posted without preservative had a sensitivity of 82% and a specificity of 98%; for boric acid, sensitivity was 73% and specificity 99%. Postal urine samples should be submitted to the laboratory in a plain sterile tube. © 2011 British Small Animal Veterinary Association.
Leone, Laura; Ferri, Diego; Manfredi, Carla; Persson, Per; Shchukarev, Andrei; Sjöberg, Staffan; Loring, John
2007-09-15
In this study, macroscopic and spectroscopic data were combined to develop a surface complexation model that describes the acid-base properties of Bacillus subtilis. The bacteria were freeze-dried and then resuspended in 0.1 M NaCl ionic medium. Macroscopic measurements included potentiometric acid-base titrations and electrophoretic mobility measurements. In addition, ATR-FTIR spectra of wet pastes from suspensions of Bacillus subtilis at different pH values were collected. The least-squares program MAGPIE was used to generate a surface complexation model that takes into account the presence of three acid-base sites on the surface: tripple bond COOH, tripple bond NH+, and tripple bond PO-, which were identified previously by XPS measurements. Both potentiometric titration data and ATR-FTIR spectra were used quantitatively, and electrostatic effects at the charged bacterial surface were accounted for using the constant capacitance model. The model was calculated using two different approaches: in the first one XPS data were used to constrain the ratio of the total concentrations of all three surface sites. The capacitance of the double layer, the total buffer capacity, and the deprotonation constants of the tripple bond NH+, tripple bond POH, and tripple bond COOH species were determined in the fit. A second approach is presented in which the ratio determined by XPS of the total concentrations of tripple bond NH+ to tripple bond PO- sites is relaxed. The total concentration of tripple bond PO- sites was determined in the fit, while the deprotonation constant for tripple bond POH was manually varied until the minimization led to a model which predicted an isoelectric point that resulted in consistency with electrophoretic mobility data. The model explains well the buffering capacity of Bacillus subtilis suspensions in a wide pH range (between pH=3 and pH=9) which is of considerable environmental interest. In particular, a similar quantitative use of the IR data
Srinivasan, Sujatha; Hoffman, Noah G.; Morgan, Martin T.; Matsen, Frederick A.; Fiedler, Tina L.; Hall, Robert W.; Ross, Frederick J.; McCoy, Connor O.; Bumgarner, Roger; Marrazzo, Jeanne M.; Fredricks, David N.
2012-01-01
Background Bacterial vaginosis (BV) is a common condition that is associated with numerous adverse health outcomes and is characterized by poorly understood changes in the vaginal microbiota. We sought to describe the composition and diversity of the vaginal bacterial biota in women with BV using deep sequencing of the 16S rRNA gene coupled with species-level taxonomic identification. We investigated the associations between the presence of individual bacterial species and clinical diagnostic characteristics of BV. Methodology/Principal Findings Broad-range 16S rRNA gene PCR and pyrosequencing were performed on vaginal swabs from 220 women with and without BV. BV was assessed by Amsel’s clinical criteria and confirmed by Gram stain. Taxonomic classification was performed using phylogenetic placement tools that assigned 99% of query sequence reads to the species level. Women with BV had heterogeneous vaginal bacterial communities that were usually not dominated by a single taxon. In the absence of BV, vaginal bacterial communities were dominated by either Lactobacillus crispatus or Lactobacillus iners. Leptotrichia amnionii and Eggerthella sp. were the only two BV-associated bacteria (BVABs) significantly associated with each of the four Amsel’s criteria. Co-occurrence analysis revealed the presence of several sub-groups of BVABs suggesting metabolic co-dependencies. Greater abundance of several BVABs was observed in Black women without BV. Conclusions/Significance The human vaginal bacterial biota is heterogeneous and marked by greater species richness and diversity in women with BV; no species is universally present. Different bacterial species have different associations with the four clinical criteria, which may account for discrepancies often observed between Amsel and Nugent (Gram stain) diagnostic criteria. Several BVABs exhibited race-dependent prevalence when analyzed in separate groups by BV status which may contribute to increased incidence of BV in
Wüst, Pia K.; Nacke, Heiko; Kaiser, Kristin; Marhan, Sven; Sikorski, Johannes; Kandeler, Ellen; Daniel, Rolf
2016-01-01
Modern sequencing technologies allow high-resolution analyses of total and potentially active soil microbial communities based on their DNA and RNA, respectively. In the present study, quantitative PCR and 454 pyrosequencing were used to evaluate the effects of different extraction methods on the abundance and diversity of 16S rRNA genes and transcripts recovered from three different types of soils (leptosol, stagnosol, and gleysol). The quality and yield of nucleic acids varied considerably with respect to both the applied extraction method and the analyzed type of soil. The bacterial ribosome content (calculated as the ratio of 16S rRNA transcripts to 16S rRNA genes) can serve as an indicator of the potential activity of bacterial cells and differed by 2 orders of magnitude between nucleic acid extracts obtained by the various extraction methods. Depending on the extraction method, the relative abundances of dominant soil taxa, in particular Actinobacteria and Proteobacteria, varied by a factor of up to 10. Through this systematic approach, the present study allows guidelines to be deduced for the selection of the appropriate extraction protocol according to the specific soil properties, the nucleic acid of interest, and the target organisms. PMID:26896137
Effects of dietary n-3 fatty acids on the phospholipid molecular species of monkey brain.
Lin, D S; Connor, W E; Anderson, G J; Neuringer, M
1990-10-01
We examined the changes in the molecular species of brain ethanolamine glycerophospholipids of monkeys fed diets containing widely ranging amounts of n-3 fatty acids. Two groups of rhesus monkeys were fed pre- and postnatally either a control diet (soy oil; containing 8% of fatty acids as 18:3n-3) or a deficient diet (safflower oil; containing less than 0.3% 18:3n-3). The brains of these animals were analyzed at 22 months of age. A third group of monkeys was fed the safflower oil diet to 22 months of age and then switched to a fish oil diet (28% long-chain n-3 fatty acids) for 1-2 years before autopsy. The molecular species of the diacyl, alkylacyl, and alkenylacyl ethanolamine glycerophospholipids from frontal cortex were separated by HPLC. A total of 24 molecular species were identified. Fatty acids in the sn-2 position differed markedly among the diet groups, but the sn-1 position always contained only 16:0, 18:0, or 18:1. In the diacyl subclass of the control brain, the n-3 molecular species represented 41% of total and the n-6 species 45%, whereas in the deficient brain the n-3 molecular species decreased to 9% and n-6 molecular species increased to 77%. The fatty acid 22:5n-6 did not replace 22:6n-3 in a symmetrical fashion in the molecular species of the deficient brain. In the brains of the fish oil-fed monkeys, the n-3 molecular species amounted to 61% and n-6 molecular species were reduced to 25%. The species 18:1-22:6, 16:0-22:6, and 18:0-22:6 generally changed proportionally in response to diet.(ABSTRACT TRUNCATED AT 250 WORDS)
Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard
2010-01-30
Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial
2010-01-01
Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for
The effect of natural organic matter on the adsorption of mercury to bacterial cells
NASA Astrophysics Data System (ADS)
Dunham-Cheatham, Sarrah; Mishra, Bhoopesh; Myneni, Satish; Fein, Jeremy B.
2015-02-01
We investigated the ability of non-metabolizing Bacillus subtilis, Shewanella oneidensis MR-1, and Geobacter sulfurreducens bacterial species to adsorb mercury in the absence and presence of Suwanee River fulvic acid (FA). Bulk adsorption and X-ray absorption spectroscopy (XAS) experiments were conducted at three pH conditions, and the results indicate that the presence of FA decreases the extent of Hg adsorption to biomass under all of the pH conditions studied. Hg XAS results show that the presence of FA does not alter the binding environment of Hg adsorbed onto the biomass regardless of pH or FA concentration, indicating that ternary bacteria-Hg-FA complexes do not form to an appreciable extent under the experimental conditions, and that Hg binding on the bacteria is dominated by sulfhydryl binding. We used the experimental results to calculate apparent partition coefficients, Kd, for Hg under each experimental condition. The calculations yield similar coefficients for Hg onto each of the bacterial species studies, suggesting there is no significant difference in Hg partitioning between the three bacterial species. The calculations also indicate similar coefficients for Hg-bacteria and Hg-FA complexes. S XAS measurements confirm the presence of sulfhydryl sites on both the FA and bacterial cells, and demonstrate the presence of a wide range of S moieties on the FA in contrast to the bacterial biomass, whose S sites are dominated by thiols. Our results suggest that although FA can compete with bacterial binding sites for aqueous Hg, because of the relatively similar partition coefficients for the types of sorbents, the competition is not dominated by either bacteria or FA unless the concentration of one type of site greatly exceeds that of the other.
Triebl, Alexander; Trötzmüller, Martin; Eberl, Anita; Hanel, Pia; Hartler, Jürgen; Köfeler, Harald C
2014-06-20
A method for a highly selective and sensitive identification and quantitation of lysophosphatidic acid (LPA) and phosphatidic acid (PA) molecular species was developed using hydrophilic interaction liquid chromatography (HILIC) followed by negative-ion electrospray ionization high resolution mass spectrometry. Different extraction methods for the polar LPA and PA species were compared and a modified Bligh & Dyer extraction by addition of 0.1M hydrochloric acid resulted in a ≈1.2-fold increase of recovery for the 7 PA and a more than 15-fold increase for the 6 LPA molecular species of a commercially available natural mix compared to conventional Bligh & Dyer extraction. This modified Bligh & Dyer extraction did not show any artifacts resulting from hydrolysis of natural abundant phospholipids. The developed HILIC method is able to separate all PA and LPA species from major polar membrane lipid classes which might have suppressive effects on the minor abundant lipid classes of interest. The elemental compositions of intact lipid species are provided by the high mass resolution of 100,000 and high mass accuracy below 3ppm of the Orbitrap instrument. Additionally, tandem mass spectra were generated in a parallel data dependent acquisition mode in the linear ion trap to provide structural information at molecular level. Limits of quantitation were identified at 45fmol on column and the dynamic range reaches 20pmol on column, covering the range of natural abundance well. By applying the developed method to mouse brain it can be shown that phosphatidic acid contains less unsaturated fatty acids with PA 34:1 and PA 36:1 as the major species. In contrast, for LPA species a high content of polyunsaturated fatty acids (LPA 20:4 and LPA 22:6) was quantified. Copyright © 2014 Elsevier B.V. All rights reserved.
Yan, Shijuan; Liang, Yating; Zhang, Jindan; Chen, Zhuang; Liu, Chun-Ming
2015-08-01
Aflatoxins produced by Aspergillus species are among the most toxic and carcinogenic compounds in nature. Although it has been known for a long time that seeds with high oil content are more susceptible to aflatoxin contamination, the role of fatty acids in aflatoxin biosynthesis remains controversial. Here we demonstrate in A. flavus that both the saturated stearic acid (C18:0) and the polyunsaturated linolenic acid (C18:3) promoted aflatoxin production, while C18:3, but not C18:0, inhibited aflatoxin biosynthesis after exposure to air for several hours. Further experiments showed that autoxidated C18:3 promoted mycelial growth, sporulation, and kojic acid production, but inhibited the expression of genes in the AF biosynthetic gene cluster. Mass spectrometry analyses of autoxidated C18:3 fractions that were able to inhibit aflatoxin biosynthesis led to the identification of multiple oxylipin species. These results may help to clarify the role of fatty acids in aflatoxin biosynthesis, and may explain why controversial results have been obtained for fatty acids in the past. Copyright © 2014 Elsevier Inc. All rights reserved.
Metillo, Ephrime Bicoy; Aspiras-Eya, Anna Arlene
2014-08-01
Fatty acids are important in human health and useful in the analysis of the marine food web, however information on tropical pelagic organisms is scarce. Six zooplanktivorous small pelagic fish species (Decapterus kurroides, Decapterus macarellus, Selar crumenophthalmus, Sardinella lemuru, Spratilloides gracilis and Stolephorus insularis) and four of their zooplanktonic crustacean prey [three sergestoid species (Acetes erythraeus, Acetes intermedius and Lucifer penicillifer) and one calanoid copepod (Acartia erythraea)] were collected from the Mindanao Sea, and their fatty acids were profiled. The resulting profiles revealed 17 fatty acids that were specific to certain species and 9 {myristic acid [C14:0], palmitic acid [C16:0], stearic acid [C18:0]; palmitoleic acid [C16:1], oleic acid [C18:1n9c], linoleic acid [C18:2n6c], linolenic acid [C18:3n3], eicosapentaenoic acid (EPA) [C20:5n3] and docosahexaenoic acid (DHA) [C22:6n3]} that were common to all species. Cluster analysis and non-metric multidimensional scaling (NMDS) of fatty acids indicate a high similarity in profiles in all species, but separate fish and zooplankton clusters were obtained. Mackerel species (D. macarellus, D. kurroides and S. crumenophthalmus) had concentrations of total n-3 fatty acids that match those of their Acetes prey. The copepod A. erythraea and the sergestoid L. penicillifer exhibited the lowest values of the EPA:DHA ratio, which was most likely due to their phytoplanktivorous feeding habits, but the occurrence of the highest values of the ratio in Acetes suggests the inclusion of plant detritus in their diet. DHA values appear to affirm the trophic link among copepod, Lucifer, Acetes and mackerel species.
Response of citrus and other selected plant species to simulated HCL - acid rain
NASA Technical Reports Server (NTRS)
Knott, W. M.; Heagle, A. S.
1980-01-01
Mature valencia orange trees were sprayed with hydrochloric acid solutions (pH 7.8, 2.0, 1.0, and 0.5) in the field at the full bloom stage and at one month after fruit set. Potted valencia orange and dwarf citrus trees, four species of plants native to Merritt Island, and four agronomic species were exposed to various pH levels of simulated acid rain under controlled conditions. The acid rain was generated from dilutions of hydrochloric acid solutions or by passing water through an exhaust generated by burning solid rocket fuel. The plants were injured severely at pH levels below 1.0, but showed only slight injury at pH levels of 2.0 and above. Threshold injury levels were between 2.0 and 3.0 pH. The sensitivity of the different plant species to acid solutions was similar. Foliar injury symptoms were representative of acid rain including necrosis of young tissue, isolated necrotic spots or patches, and leaf abscission. Mature valencia orange trees sprayed with concentrations of 1.0 pH and 0.5 pH in the field had reduced fruit yields for two harvests after the treatment. All experimental trees were back to full productivity by the third harvest after treatment.
Study of the bacterial diversity of foods: PCR-DGGE versus LH-PCR.
Garofalo, Cristiana; Bancalari, Elena; Milanović, Vesna; Cardinali, Federica; Osimani, Andrea; Sardaro, Maria Luisa Savo; Bottari, Benedetta; Bernini, Valentina; Aquilanti, Lucia; Clementi, Francesca; Neviani, Erasmo; Gatti, Monica
2017-02-02
The present study compared two culture-independent methods, polymerase chain reaction denaturing gradient gel electrophoresis (PCR-DGGE) and length-heterogeneity polymerase chain reaction (LH-PCR), for their ability to reveal food bacterial microbiota. Total microbial DNA and RNA were extracted directly from fourteen fermented and unfermented foods, and domain A of the variable regions V1 and V2 of the 16S rRNA gene was analyzed through LH-PCR and PCR-DGGE. Finally, the outline of these analyses was compared with bacterial viable counts obtained after bacterial growth on suitable selective media. For the majority of the samples, RNA-based PCR-DGGE revealed species that the DNA-based PCR-DGGE was not able to highlight. When analyzing either DNA or RNA, LH-PCR identified several lactic acid bacteria (LAB) and coagulase negative cocci (CCN) species that were not identified by PCR-DGGE. This phenomenon was particularly evident in food samples with viable loads<5.0 Logcfug -1 . Furthermore, LH-PCR was able to detect a higher number of peaks in the analyzed food matrices relative to species identified by PCR-DGGE. In light of these findings, it may be suggested that LH-PCR shows greater sensitivity than PCR-DGGE. However, PCR-DGGE detected some other species (LAB included) that were not detected by LH-PCR. Therefore, certain LH-PCR peaks not attributed to known species within the LH-PCR database could be solved by comparing them with species identified by PCR-DGGE. Overall, this study also showed that LH-PCR is a promising method for use in the food microbiology field, indicating the necessity to expand the LH-PCR database, which is based, up to now, mainly on LAB isolates from dairy products. Copyright © 2016 Elsevier B.V. All rights reserved.
Pulmonary bioavailability of ascorbic acid in an ascorbate-synthesising species, the horse.
Deaton, Christopher M; Marlin, David J; Smith, Nicola C; Roberts, Colin A; Harris, Pat A; Kelly, Frank J; Schroter, Robert C
2003-04-01
Vitamin C (ascorbic acid) is a non-enzymatic antioxidant important in protecting the lung against oxidative damage and is decreased in lung lining fluid of horses with airway inflammation. To examine possible therapeutic regimens in a species with ascorbate-synthesising capacity, we studied the effects of oral supplementation of two forms of ascorbic acid, (each equivalent to 20 mg ascorbic acid per kg body weight) on the pulmonary and systemic antioxidant status of six healthy ponies in a 3 x 3 Latin square design. Two weeks supplementation with ascorbyl palmitate significantly increased mean plasma ascorbic acid concentrations compared to control (29 +/- 5 and 18 +/- 7 micromol/l, respectively; p < 0.05). Calcium ascorbyl-2-monophosphate, a more stable form of ascorbic acid, also increased mean plasma ascorbic acid concentrations, but not significantly (23 +/- 1 micromol/l; p = 0.07). The concentration of ascorbic acid in bronchoalveolar lavage fluid increased in five out of six ponies following supplementation with either ascorbyl palmitate or calcium ascorbyl-2-monophosphate compared with control (30 +/- 10, 25 +/- 4 and 18 +/- 8 micromol/l, respectively; p < 0.01). Neither supplement altered the concentration of glutathione, uric acid or alpha-tocopherol in plasma or bronchoalveolar lavage fluid. In conclusion, the concentration of lung lining fluid ascorbic acid is increased following ascorbic acid supplementation (20 mg/kg body weight) in an ascorbate-synthesising species.
Kim, Sang Hoon; Jeon, Eun Ju; Hong, Seok Min; Bae, Chang Hoon; Lee, Ho Yun; Park, Moo Kyun; Byun, Jae Yong; Kim, Myung Gu; Yeo, Seung Geun
2017-04-01
Changes over time in pathogens and their antibiotic sensitivity resulting from the recent overuse and misuse of antibiotics in otitis media (OM) have complicated treatment. This study evaluated changes over 5 years in principal pathogens and their antibiotic sensitivity in patients in Korea diagnosed with acute OM (AOM) and OM with effusion (OME). The study population consisted of 683 patients who visited the outpatient department of otorhinolaryngology in 7 tertiary hospitals in Korea between January 2010 and May 2015 and were diagnosed with acute AOM or OME. Aural discharge or middle ear fluid were collected from patients in the operating room or outpatient department and subjected to tests of bacterial identification and antibiotic sensitivity. The overall bacteria detection rate of AOM was 62.3% and OME was 40.9%. The most frequently isolated Gram-positive bacterial species was coagulase negative Staphylococcus aureus (CNS) followed by methicillin-susceptible S. aureus (MSSA), methicillin-resistant S. aureus (MRSA), and Streptococcus pneumonia (SP), whereas the most frequently isolated Gram-negative bacterium was Pseudomonas aeruginosa (PA). Regardless of OM subtype, ≥ 80% of CNS and MRSA strains were resistant to penicillin (PC) and tetracycline (TC); isolated MRSA strains showed low sensitivity to other antibiotics, with 100% resistant to PC, TC, cefoxitin (CFT), and erythromycin (EM); and isolated PA showed low sensitivity to quinolone antibiotics, including ciprofloxacin (CIP) and levofloxacin (LFX), and to aminoglycosides. Bacterial species and antibiotic sensitivity did not change significantly over 5 years. The rate of detection of MRSA was higher in OME than in previous studies. As bacterial predominance and antibiotic sensitivity could change over time, continuous and periodic surveillance is necessary in guiding appropriate antibacterial therapy. © 2017 The Korean Academy of Medical Sciences.
2013-01-01
Background Lactobacillus jensenii, L. iners, L. crispatus and L. gasseri are the most frequently occurring lactobacilli in the vagina. However, the native species vary widely according to the studied population. The present study was performed to genetically determine the identity of Lactobacillus strains present in the vaginal discharge of healthy and bacterial vaginosis (BV) intermediate Mexican women. Methods In a prospective study, 31 strains preliminarily identified as Lactobacillus species were isolated from 21 samples collected from 105 non-pregnant Mexican women. The samples were classified into groups according to the Nugent score criteria proposed for detection of BV: normal (N), intermediate (I) and bacterial vaginosis (BV). We examined the isolates using culture-based methods as well as molecular analysis of the V1–V3 regions of the 16S rRNA gene. Enterobacterial repetitive intergenic consensus (ERIC) sequence analysis was performed to reject clones. Results Clinical isolates (25/31) were classified into four groups based on sequencing and analysis of the 16S rRNA gene: L. acidophilus (14/25), L. reuteri (6/25), L. casei (4/25) and L. buchneri (1/25). The remaining six isolates were presumptively identified as Enterococcus species. Within the L. acidophilus group, L. gasseri was the most frequently isolated species, followed by L. jensenii and L. crispatus. L. fermentum, L. rhamnosus and L. brevis were also isolated, and were placed in the L. reuteri, L. casei and L. buchneri groups, respectively. ERIC profile analysis showed intraspecific variability amongst the L. gasseri and L. fermentum species. Conclusions These findings agree with previous studies showing that L. crispatus, L. gasseri and L. jensenii are consistently present in the healthy vaginal ecosystem. Additional species or phylotypes were detected in the vaginal microbiota of the non-pregnant Mexican (Hispanic-mestizo) population, and thus, these results further our understanding of
Brinkman, Cassandra L.; Schmidt-Malan, Suzannah M.; Karau, Melissa J.; Greenwood-Quaintance, Kerryl; Hassett, Daniel J.; Mandrekar, Jayawant N.
2016-01-01
Bacterial biofilms may form on indwelling medical devices such as prosthetic joints, heart valves and catheters, causing challenging-to-treat infections. We have previously described the ‘electricidal effect’, in which bacterial biofilms are decreased following exposure to direct electrical current. Herein, we sought to determine if the decreased bacterial quantities are due to detachment of biofilms or cell death and to investigate the role that reactive oxygen species (ROS) play in the observed effect. Using confocal and electron microscopy and flow cytometry, we found that direct current (DC) leads to cell death and changes in the architecture of biofilms formed by Gram-positive and Gram-negative bacteria. Reactive oxygen species (ROS) appear to play a role in DC-associated cell death, as there was an increase in ROS-production by Staphylococcus aureus and Staphylococcus epidermidis biofilms following exposure to DC. An increase in the production of ROS response enzymes catalase and superoxide dismutase (SOD) was observed for S. aureus, S. epidermidis and Pseudomonas aeruginosa biofilms following exposure to DC. Additionally, biofilms were protected from cell death when supplemented with antioxidants and oxidant scavengers, including catalase, mannitol and Tempol. Knocking out SOD (sodAB) in P. aeruginosa led to an enhanced DC effect. Microarray analysis of P. aeruginosa PAO1 showed transcriptional changes in genes related to the stress response and cell death. In conclusion, the electricidal effect results in death of bacteria in biofilms, mediated, at least in part, by production of ROS. PMID:27992529
Brinkman, Cassandra L; Schmidt-Malan, Suzannah M; Karau, Melissa J; Greenwood-Quaintance, Kerryl; Hassett, Daniel J; Mandrekar, Jayawant N; Patel, Robin
2016-01-01
Bacterial biofilms may form on indwelling medical devices such as prosthetic joints, heart valves and catheters, causing challenging-to-treat infections. We have previously described the 'electricidal effect', in which bacterial biofilms are decreased following exposure to direct electrical current. Herein, we sought to determine if the decreased bacterial quantities are due to detachment of biofilms or cell death and to investigate the role that reactive oxygen species (ROS) play in the observed effect. Using confocal and electron microscopy and flow cytometry, we found that direct current (DC) leads to cell death and changes in the architecture of biofilms formed by Gram-positive and Gram-negative bacteria. Reactive oxygen species (ROS) appear to play a role in DC-associated cell death, as there was an increase in ROS-production by Staphylococcus aureus and Staphylococcus epidermidis biofilms following exposure to DC. An increase in the production of ROS response enzymes catalase and superoxide dismutase (SOD) was observed for S. aureus, S. epidermidis and Pseudomonas aeruginosa biofilms following exposure to DC. Additionally, biofilms were protected from cell death when supplemented with antioxidants and oxidant scavengers, including catalase, mannitol and Tempol. Knocking out SOD (sodAB) in P. aeruginosa led to an enhanced DC effect. Microarray analysis of P. aeruginosa PAO1 showed transcriptional changes in genes related to the stress response and cell death. In conclusion, the electricidal effect results in death of bacteria in biofilms, mediated, at least in part, by production of ROS.
Tunaz, H; Bedick, J C.; Miller, J S.; Hoback, W W.; Rana, R L.; Stanley, D W.
1999-10-01
Nodulation is the first and quantitatively most important cellular defense reaction to bacterial infections in insects. Treating adults of the 17-year periodical cicadas, Magicicada septendecim and M. cassini, with eicosanoid biosynthesis inhibitors immediately prior to intrahemocoelic injections of the bacterium, Serratia marcescens, sharply reduced the nodulation response to bacterial challenges. Separate treatments with specific inhibitors of phospholipase A(2), cyclooxygenase, and lipoxygenase reduced nodulation, supporting our view that nodule formation is a multi-step process in which individual steps are separately mediated by lipoxygenase and cyclooxygenase products. The inhibitory influence of dexamethasone was apparent by 2 h after injection, and nodulation was significantly reduced, relative to control insects, over the following 14 h. The dexamethasone effects were reversed by treating bacteria-challenged insects with the eicosanoid-precursor polyunsaturated fatty acid, arachidonic acid. Low levels of arachidonic acid were detected in fat body phospholipids. These findings in adults of an exopterygote insect species with an unusual life history pattern broaden our hypothesis that eicosanoids mediate cellular immune reactions to bacterial infections in most, if not all, insects.
Jamroskovic, Jan; Shao, Paul P; Suvorova, Elena; Barak, Imrich; Bernier-Latmani, Rizlan
2014-09-01
Endospores (also referred to as bacterial spores) are bacterial structures formed by several bacterial species of the phylum Firmicutes. Spores form as a response to environmental stress. These structures exhibit remarkable resistance to harsh environmental conditions such as exposure to heat, desiccation, and chemical oxidants. The spores include several layers of protein and peptidoglycan that surround a core harboring DNA as well as high concentrations of calcium and dipicolinic acid (DPA). A combination of scanning transmission X-ray microscopy, scanning transmission electron microscopy, and energy dispersive spectroscopy was used for the direct quantitative characterization of bacterial spores. The concentration and localization of DPA, Ca(2+) , and other elements were determined and compared for the core and cortex of spores from two distinct genera: Bacillus subtilis and Desulfotomaculum reducens. This micro-spectroscopic approach is uniquely suited for the direct study of individual bacterial spores, while classical molecular and biochemical methods access only bulk characteristics. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Simm, Jaak; Paalme, Toomas; Sarand, Inga
2014-01-01
The evolution of bacterial consortia was studied in six semi-solid rye sourdoughs during long-term backslopping at different temperatures. Each rye sourdough was started spontaneously in a laboratory (dough yield 200), propagated at either 20°C or 30°C, and renewed daily at an inoculation rate of 1∶10 for 56 days. The changes in bacterial diversity over time were followed by both DGGE coupled with partial 16S rRNA gene sequencing and pyrosequencing of bar-coded 16S rRNA gene amplicons. Four species from the genus Lactobacillus (brevis, crustorum, plantarum, and paralimentarius) were detected in different combinations in all sourdoughs after 56 propagation cycles. Facultative heterofermentative lactic acid bacteria dominated in sourdoughs fermented at 30°C, while both obligate and facultative heterofermentative LAB were found to dominate in sourdoughs fermented at 20°C. After 56 propagation cycles, Kazachstania unispora (formerly Saccharomyces unisporus) was identified as the only yeast species that dominated in sourdoughs fermented at 20°C, while different combinations of strains from four yeast species (Kazachstania unispora, Saccharomyces cerevisiae, Candida krusei and Candida glabrata) were detected in sourdoughs propagated at 30°C. The evolution of bacterial communities in sourdoughs fermented at the same temperature did not follow the same time course and changes in the composition of dominant and subdominant bacterial communities occurred even after six weeks of backslopping. PMID:24748058
Tan, Guoxin; Wang, Shuangying; Zhu, Ye; Zhou, Lei; Yu, Peng; Wang, Xiaolan; He, Tianrui; Chen, Junqi; Mao, Chuanbin; Ning, Chengyun
2016-09-21
Reactive oxygen species (ROS) can be used to kill bacterial cells, and thus the selective generation of ROS from material surfaces is an emerging direction in antibacterial material discovery. We found the polarization of piezoelectric ceramic causes the two sides of the disk to become positively and negatively charged, which translate into cathode and anode surfaces in an aqueous solution. Because of the microelectrolysis of water, ROS are preferentially formed on the cathode surface. Consequently, the bacteria are selectively killed on the cathode surface. However, the cell experiment suggested that the level of ROS is safe for normal mammalian cells.
Wacker, Alexander; Piepho, Maike; Harwood, John L.; Guschina, Irina A.; Arts, Michael T.
2016-01-01
We tested the influence of two light intensities [40 and 300 μmol PAR / (m2s)] on the fatty acid composition of three distinct lipid classes in four freshwater phytoplankton species. We chose species of different taxonomic classes in order to detect potentially similar reaction characteristics that might also be present in natural phytoplankton communities. From samples of the bacillariophyte Asterionella formosa, the chrysophyte Chromulina sp., the cryptophyte Cryptomonas ovata and the zygnematophyte Cosmarium botrytis we first separated glycolipids (monogalactosyldiacylglycerol, digalactosyldiacylglycerol, and sulfoquinovosyldiacylglycerol), phospholipids (phosphatidylcholine, phosphatidylethanolamine, phosphatidylglycerol, phosphatidylinositol, and phosphatidylserine) as well as non-polar lipids (triacylglycerols), before analyzing the fatty acid composition of each lipid class. High variation in the fatty acid composition existed among different species. Individual fatty acid compositions differed in their reaction to changing light intensities in the four species. Although no generalizations could be made for species across taxonomic classes, individual species showed clear but small responses in their ecologically-relevant omega-3 and omega-6 polyunsaturated fatty acids (PUFA) in terms of proportions and of per tissue carbon quotas. Knowledge on how lipids like fatty acids change with environmental or culture conditions is of great interest in ecological food web studies, aquaculture, and biotechnology, since algal lipids are the most important sources of omega-3 long-chain PUFA for aquatic and terrestrial consumers, including humans. PMID:27014290
Nielsen, D. S.; Møller, P. L.; Rosenfeldt, V.; Pærregaard, A.; Michaelsen, K. F.; Jakobsen, M.
2003-01-01
The distribution of mucosa-associated bacteria, bifidobacteria and lactobacilli and closely related lactic acid bacteria, in biopsy samples from the ascending, transverse, and descending parts of the colon from four individuals was investigated by denaturing gradient gel electrophoresis (DGGE). Bifidobacterial genus-specific, Lactobacillus group-specific, and universal bacterial primers were used in a nested PCR approach to amplify a fragment of the 16S rRNA gene. DGGE profiles of the bifidobacterial community were relatively simple, with one or two amplicons detected at most sampling sites in the colon. DGGE profiles obtained with Lactobacillus group-specific primers were complex and varied with host and sampling site in the colon. The overall bacterial community varied with host but not sampling site. PMID:14660412
NASA Astrophysics Data System (ADS)
Utada, Andrew
2014-03-01
Biofilms are structured multi-cellular communities that are fundamental to the biology and ecology of bacteria. Parasitic bacterial biofilms can cause lethal infections and biofouling, but commensal bacterial biofilms, such as those found in the gut, can break down otherwise indigestible plant polysaccharides and allow us to enjoy vegetables. The first step in biofilm formation, adaptation to life on a surface, requires a working knowledge of low Reynolds number fluid physics, and the coordination of biochemical signaling, polysaccharide production, and molecular motility motors. These crucial early stages of biofilm formation are at present poorly understood. By adapting methods from soft matter physics, we dissect bacterial social behavior at the single cell level for several prototypical bacterial species, including Pseudomonas aeruginosa and Vibrio cholerae.
Papalexandratou, Zoi; Falony, Gwen; Romanens, Edwina; Jimenez, Juan Carlos; Amores, Freddy; Daniel, Heide-Marie; De Vuyst, Luc
2011-01-01
Traditional fermentations of the local Ecuadorian cocoa type Nacional, with its fine flavor, are carried out in boxes and on platforms for a short time. A multiphasic approach, encompassing culture-dependent and -independent microbiological analyses of fermenting cocoa pulp-bean samples, metabolite target analyses of both cocoa pulp and beans, and sensory analysis of chocolates produced from the respective fermented dry beans, was applied for the investigation of the influence of these fermentation practices on the yeast and bacterial species diversity and community dynamics during cocoa bean fermentation. A wide microbial species diversity was found during the first 3 days of all fermentations carried out. The prevailing ethanol-producing yeast species were Pichia kudriavzevii and Pichia manshurica, followed by Saccharomyces cerevisiae. Leuconostoc pseudomesenteroides (glucose and fructose fermenting), Fructobacillus tropaeoli-like (fructose fermenting), and Lactobacillus fermentum (citrate converting, mannitol producing) represented the main lactic acid bacterial species in the fermentations studied, resulting in intensive heterolactate metabolism of the pulp substrates. Tatumella saanichensis and Tatumella punctata were among the members of the family Enterobacteriaceae present during the initial phase of the cocoa bean fermentations and could be responsible for the production of gluconic acid in some cases. Also, a potential new yeast species was isolated, namely, Candida sorbosivorans-like. Acetic acid bacteria, whose main representative was Acetobacter pasteurianus, generally appeared later during fermentation and oxidized ethanol to acetic acid. However, acetic acid bacteria were not always present during the main course of the platform fermentations. All of the data taken together indicated that short box and platform fermentation methods caused incomplete fermentation, which had a serious impact on the quality of the fermented dry cocoa beans. PMID
Stability of bound species during alkene reactions on solid acids
NASA Astrophysics Data System (ADS)
Sarazen, Michele L.; Iglesia, Enrique
2017-05-01
This study reports the thermodynamics of bound species derived from ethene, propene, n-butene, and isobutene on solid acids with diverse strength and confining voids. Density functional theory (DFT) and kinetic data indicate that covalently bound alkoxides form C-C bonds in the kinetically relevant step for dimerization turnovers on protons within TON (0.57 nm) and MOR (0.67 nm) zeolitic channels and on stronger acids HPW (polyoxometalate clusters on silica). Turnover rates for mixed alkenes give relative alkoxide stabilities; the respective adsorption constants are obtained from in situ infrared spectra. Tertiary alkoxides (from isobutene) within larger voids (MOR, HPW) are more stable than less substituted isomers but are destabilized within smaller concave environments (TON) because framework distortions are required to avoid steric repulsion. Adsorption constants are similar on MOR and HPW for each alkoxide, indicating that binding is insensitive to acid strength for covalently bound species. DFT-derived formation free energies for alkoxides with different framework attachments and backbone length/structure agree with measurements when dispersion forces, which mediate stabilization by confinement in host-guest systems, are considered. Theory reveals previously unrecognized framework distortions that balance the C-O bond lengths required for covalency with host-guest distances that maximize van der Waals contacts. These distortions, reported here as changes in O-atom locations and dihedral angles, become stronger for larger, more substituted alkoxides. The thermodynamic properties reported here for alkoxides and acid hosts differing in size and conjugate-anion stability are benchmarked against DFT-derived free energies; their details are essential to design host-guest pairs that direct alkoxide species toward specific products.
Kidd, Haack S.; Garchow, H.; Odelson, D.A.; Forney, L.J.; Klug, M.J.
1994-01-01
We determined the accuracy and reproducibility of whole-community fatty acid methyl ester (FAME) analysis with two model bacterial communities differing in composition by using the Microbial ID, Inc. (MIDI), system. The biomass, taxonomic structure, and expected MIDI-FAME profiles under a variety of environmental conditions were known for these model communities a priori. Not all members of each community could be detected in the composite profile because of lack of fatty acid 'signatures' in some isolates or because of variations (approximately fivefold) in fatty acid yield across taxa. MIDI- FAME profiles of replicate subsamples of a given community were similar in terms of fatty acid yield per unit of community dry weight and relative proportions of specific fatty acids. Principal-components analysis (PCA) of MIDI-FAME profiles resulted in a clear separation of the two different communities and a clustering of replicates of each community from two separate experiments on the first PCA axis. The first PCA axis accounted for 57.1% of the variance in the data and was correlated with fatty acids that varied significantly between communities and reflected the underlying community taxonomic structure. On the basis of our data, community fatty acid profiles can be used to assess the relative similarities and differences of microbial communities that differ in taxonomic composition. However, detailed interpretation of community fatty acid profiles in terms of biomass or community taxonomic composition must be viewed with caution until our knowledge of the quantitative and qualitative distribution of fatty acids over a wide variety of taxa and the effects of growth conditions on fatty acid profiles is more extensive.
Xu, Wenjing; Shi, Lingling; Chan, Onchim; Li, Jiao; Casper, Peter; Zou, Xiaoming
2013-01-01
Although bacteria and fungi are well-known to be decomposers of leaf litter, few studies have examined their compositions and diversities during the decomposition process in tropical stream water. Xishuangbanna is a tropical region preserving one of the highest floristic diversity areas in China. In this study, leaf litter of four dominant plant species in Xishuangbanna was incubated in stream water for 42 days during which samples were taken regularly. Following DNA extraction, PCR-DGGE (denaturing gradient gel electrophoresis) and clone-sequencing analyses were performed using bacterial and fungal specific primers. Leaf species have slightly influences on bacterial community rather than fungal community. The richness and diversity of bacteria was higher than that of fungi, which increased towards the end of the 42-day-incubation. The bacterial community was initially more specific upon the type of leaves and gradually became similar at the later stage of decomposition with alpha-proteobacteria as major component. Sequences affiliated to methanotrophs were obtained that indicates potentially occurrence of methane oxidation and methanogenesis. For the fungal community, sequences affiliated to Aspergillus were predominant at the beginning and then shifted to Pleosporales. Our results suggest that the microorganisms colonizing leaf biofilm in tropical stream water were mostly generalists that could exploit the resources of leaves of various species equally well. PMID:24367682
Comparative Genomic Analyses of the Bacterial Phosphotransferase System
Barabote, Ravi D.; Saier, Milton H.
2005-01-01
We report analyses of 202 fully sequenced genomes for homologues of known protein constituents of the bacterial phosphoenolpyruvate-dependent phosphotransferase system (PTS). These included 174 bacterial, 19 archaeal, and 9 eukaryotic genomes. Homologues of PTS proteins were not identified in archaea or eukaryotes, showing that the horizontal transfer of genes encoding PTS proteins has not occurred between the three domains of life. Of the 174 bacterial genomes (136 bacterial species) analyzed, 30 diverse species have no PTS homologues, and 29 species have cytoplasmic PTS phosphoryl transfer protein homologues but lack recognizable PTS permeases. These soluble homologues presumably function in regulation. The remaining 77 species possess all PTS proteins required for the transport and phosphorylation of at least one sugar via the PTS. Up to 3.2% of the genes in a bacterium encode PTS proteins. These homologues were analyzed for family association, range of protein types, domain organization, and organismal distribution. Different strains of a single bacterial species often possess strikingly different complements of PTS proteins. Types of PTS protein domain fusions were analyzed, showing that certain types of domain fusions are common, while others are rare or prohibited. Select PTS proteins were analyzed from different phylogenetic standpoints, showing that PTS protein phylogeny often differs from organismal phylogeny. The results document the frequent gain and loss of PTS protein-encoding genes and suggest that the lateral transfer of these genes within the bacterial domain has played an important role in bacterial evolution. Our studies provide insight into the development of complex multicomponent enzyme systems and lead to predictions regarding the types of protein-protein interactions that promote efficient PTS-mediated phosphoryl transfer. PMID:16339738
Viral-bacterial associations in acute apical abscesses.
Ferreira, Dennis C; Rôças, Isabela N; Paiva, Simone S M; Carmo, Flávia L; Cavalcante, Fernanda S; Rosado, Alexandre S; Santos, Kátia R N; Siqueira, José F
2011-08-01
Viral-bacterial and bacterial synergism have been suggested to contribute to the pathogenesis of several human diseases. This study sought to investigate the possible associations between 9 candidate endodontic bacterial pathogens and 9 human viruses in samples from acute apical abscesses. DNA extracts from purulent exudate aspirates of 33 cases of acute apical abscess were surveyed for the presence of 9 selected bacterial species using a 16S ribosomal RNA gene-based nested polymerase chain reaction (PCR) approach. Single or nested PCR assays were used for detection of the human papillomavirus (HPV) and herpesviruses types 1 to 8. Two-thirds of the abscess samples were positive for at least one of the target viruses. Specifically, the most frequently detected viruses were HHV-8 (54.5%); HPV (9%); and varicella zoster virus (VZV), Epstein-Barr virus (EBV), and HHV-6 (6%). Bacterial DNA was present in all cases and the most prevalent bacterial species were Treponema denticola (70%), Tannerella forsythia (67%), Porphyromonas endodontalis (67%), Dialister invisus (61%), and Dialister pneumosintes (57.5%). HHV-8 was positively associated with 7 of the target bacterial species and HPV with 4, but all these associations were weak. Several bacterial pairs showed a moderate positive association. Viral coinfection was found in 6 abscess cases, but no significant viral association could be determined. Findings demonstrated that bacterial and viral DNA occurred concomitantly in two-thirds of the samples from endodontic abscesses. Although this may suggest a role for viruses in the etiology of apical abscesses, the possibility also exists that the presence of viruses in abscess samples is merely a consequence of the bacterially induced disease process. Further studies are necessary to clarify the role of these viral-bacterial interactions, if any, in the pathogenesis of acute apical abscesses. Copyright © 2011 Mosby, Inc. All rights reserved.
Marekov, Ilko; Momchilova, Svetlana; Grung, Bjørn; Nikolova-Damyanova, Boryana
2012-12-01
Applying gas chromatography-mass spectrometry of 4,4-dimethyloxazoline fatty acid derivatives, the fatty acid composition of 15 mushroom species belonging to 9 genera and 5 families of order Agaricales growing in Bulgaria is determined. The structure of 31 fatty acids (not all present in each species) is unambiguously elucidated, with linoleic, oleic and palmitic acids being the main components (ranging between 70.9% (Marasmius oreades) and 91.2% (Endoptychum agaricoides)). A group of three hexadecenoic positionally isomeric fatty acids, 6-, 9- and 11-16:1, appeared to be characteristic components of the examined species. By applying chemometrics it was possible to show that the fatty acid composition closely reflects the classification of the species. Copyright © 2012 Elsevier B.V. All rights reserved.
Yadav, R K P; Karamanoli, K; Vokou, D
2005-08-01
In this study, we assessed various leaf structural and chemical features as possible predictors of the size of the phyllosphere bacterial population in the Mediterranean environment. We examined eight perennial species, naturally occurring and coexisting in the same area, in Halkidiki (northern Greece). They are Arbutus unedo, Quercus coccifera, Pistacia lentiscus, and Myrtus communis (evergreen sclerophyllous species), Lavandula stoechas and Cistus incanus (drought semi-deciduous species), and Calamintha nepeta and Melissa officinalis (non-woody perennial species). M. communis, L. stoechas, C. nepeta, and M. officinalis produce essential oil in substantial quantities. We sampled summer leaves from these species and (1) estimated the size of the bacterial population of their phyllosphere, (2) estimated the concentration of different leaf constituents, and (3) studied leaf morphological and anatomical features and expressed them in a quantitative way. The aromatic plants are on average more highly colonized than the other species, whereas the non-woody perennials are more highly colonized than the woody species. The population size of epiphytic bacteria is positively correlated with glandular and non-glandular trichome densities, and with water and phosphorus contents; it is negatively correlated with total phenolics content and the thickness of the leaf, of the mesophyll, and of the abaxial epidermis. No correlation was found with the density of stomata, the nitrogen, and the soluble sugar contents. By regression tree analysis, we found that the leaf-microbe system can be effectively described by three leaf attributes with leaf water content being the primary explanatory attribute. Leaves with water content >73% are the most highly colonized. For leaves with water content <73%, the phosphorus content, with a critical value of 1.34 mg g(-1) d.w., is the next explanatory leaf attribute, followed by the thickness of the adaxial epidermis. Leaves higher in phosphorus
Polyunsaturated fatty acids in various macroalgal species from North Atlantic and tropical seas.
van Ginneken, Vincent J T; Helsper, Johannes P F G; de Visser, Willem; van Keulen, Herman; Brandenburg, Willem A
2011-06-22
In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was detected.
Polyunsaturated fatty acids in various macroalgal species from north Atlantic and tropical seas
2011-01-01
Background In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. Methods The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Results Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Conclusion Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was
Di Gregorio, Simona; Siracusa, Giovanna; Becarelli, Simone; Mariotti, Lorenzo; Gentini, Alessandro; Lorenzi, Roberto
2016-06-01
Seven hydrocarbonoclastic new bacterial isolates were isolated from dredged sediments of a river estuary in Italy. The sediments were contaminated by shipyard activities since decades, mainly ascribable to the exploitation of diesel oil as the fuel for recreational and commercial navigation of watercrafts. The bacterial isolates were able to utilize diesel oil as sole carbon source. Their metabolic capacities were evaluated by GC-MS analysis, with reference to the depletion of both the normal and branched alkanes, the nC18 fatty acid methyl ester and the unresolved complex mixture of organic compounds. They were taxonomically identified as different species of Stenotrophomonas and Pseudomonas spp. by the combination of amplified ribosomal DNA restriction analysis (ARDRA) and repetitive sequence-based PCR (REP-PCR) analysis. The metabolic activities of interest were analyzed both in relation to the single bacterial strains and to the combination of the latter as a multibacterial species system. After 6 days of incubation in mineral medium with diesel oil as sole carbon source, the Stenotrophomonas sp. M1 strain depleted 43-46 % of Cn-alkane from C28 up to C30, 70 % of the nC18 fatty acid methyl ester and the 46 % of the unresolved complex mixture of organic compounds. On the other hand, the Pseudomonas sp. NM1 strain depleted the 76 % of the nC18 fatty acid methyl ester, the 50 % of the unresolved complex mixture of organic compounds. The bacterial multispecies system was able to completely deplete Cn-alkane from C28 up to C30 and to deplete the 95 % of the unresolved complex mixture of organic compounds. The isolates, either as single strains and as a bacterial multispecies system, were proposed as candidates for bioaugmentation in bio-based processes for the decontamination of dredged sediments.
Aires, Tânia; Serrão, Ester A.; Engelen, Aschwin H.
2016-01-01
As habitats change due to global and local pressures, population resilience, and adaptive processes depend not only on their gene pools but also on their associated bacteria communities. The hologenome can play a determinant role in adaptive evolution of higher organisms that rely on their bacterial associates for vital processes. In this study, we focus on the associated bacteria of the two most invasive seaweeds in southwest Iberia (coastal mainland) and nearby offshore Atlantic islands, Asparagopsis taxiformis and Asparagopsis armata. Bacterial communities were characterized using 16S rRNA barcoding through 454 next generation sequencing and exploratory shotgun metagenomics to provide functional insights and a backbone for future functional studies. The bacterial community composition was clearly different between the two species A. taxiformis and A. armata and between continental and island habitats. The latter was mainly due to higher abundances of Acidimicrobiales, Sphingomonadales, Xanthomonadales, Myxococcales, and Alteromonadales on the continent. Metabolic assignments for these groups contained a higher number of reads in functions related to oxidative stress and resistance to toxic compounds, more precisely heavy metals. These results are in agreement with their usual association with hydrocarbon degradation and heavy-metals detoxification. In contrast, A. taxiformis from islands contained more bacteria related to oligotrophic environments which might putatively play a role in mineralization of dissolved organic matter. The higher number of functional assignments found in the metagenomes of A. taxiformis collected from Cape Verde Islands suggest a higher contribution of bacteria to compensate nutrient limitation in oligotrophic environments. Our results show that Asparagopsis-associated bacterial communities have host-specificity and are modulated by environmental conditions. Whether this environmental effect reflects the host's selective requirements or
Bacterial species and their associations with acute and chronic mastitis in suckler ewes.
Smith, E M; Willis, Z N; Blakeley, M; Lovatt, F; Purdy, K J; Green, L E
2015-10-01
Acute mastitis in suckler ewes is often detected because of systemic signs such as anorexia or lameness, whereas chronic mastitis, characterized by intramammary abscesses with no systemic disease, is typically detected when ewes are inspected before mating. The aims of the current study were to identify the species and strains of culturable bacteria associated with acutely diseased, chronically diseased, and unaffected mammary glands to investigate whether species and strains vary by state. To investigate acute mastitis, 28 milk samples were obtained from both glands of 14 ewes with acute mastitis in one gland only. To investigate chronic mastitis, 16 ovine udders were obtained from 2 abattoirs; milk was aspirated from the 32 glands where possible, and the udders were sectioned to expose intramammary abscesses, which were swab sampled. All milk and swab samples were cultured aerobically. In total, 37 bacterial species were identified, 4 from acute mastitis, 26 from chronic mastitis, and 8 from apparently healthy glands. In chronic mastitis, the overall coincidence index of overlap of species detected in intramammary abscesses and milk was 0.60, reducing to 0.36 within individual glands, indicating a high degree of species overlap in milk and abscesses overall, but less overlap within specific glands. Staphylococcus aureus was detected frequently in all sample types; it was isolated from 10/14 glands with acute mastitis. In 5 ewes, closely related strains were present in both affected and unaffected glands. In chronic mastitis, closely related Staphylococcus aureus strains were detected in milk and abscesses from the same gland. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Kumar, Manoj; van Elsas, Jan Dirk; Nissinen, Riitta
2017-01-01
Arctic and alpine biomes are most often strongly nitrogen-limited, and hence biological nitrogen fixation is a strong driver of these ecosystems. Both biomes are characterized by low temperatures and short growing seasons, but they differ in seasonality of solar radiation and in soil water balance due to underlying permafrost in the Arctic. Arcto-alpine plant species are well-adapted to the low temperatures that prevail in their habitats, and plant growth is mainly limited by the availability of nutrients, in particular nitrogen, due to slow mineralization. Nitrogen fixing bacteria are likely important for plant growth in these habitats, but very little is known of these bacteria or forces shaping their communities. In this study, we characterized the potential nitrogen fixing bacterial (PNFB) communities associated with two arcto-alpine pioneer plant species, Oxyria digyna (mountain sorrel) and Saxifraga oppositifolia (blue saxifrage), in three climate regions. Both of these plants readily colonize low nutrient mineral soils. Our goal was to investigate how climate (region) and, on the other hand, host plant and plant species shape these communities. To our knowledge, this is the first comprehensive study describing PNFB communities associated with pioneer plants in different arcto-alpine biomes. Replicate samples were taken from two arctic regions, Kilpisjärvi and Ny-Ålesund, and one alpine region, Mayrhofen. In these, the PNFB communities in the bulk and rhizosphere soils and the plant endospheres were characterized by nifH -targeted PCR and massive parallel sequencing. The data revealed strong effects of climatic region on the dominating nitrogen fixers. Specifically, nifH sequences related to Geobacter (δ- Proteobacteria ) were present in high relative abundances in the nitrogen-fixing communities in the Mayrhofen and Kilpisjärvi regions, while members of the Clostridiales prevailed in the Kilpisjärvi and Ny-Ålesund regions. The bulk and rhizosphere soil
Sabree, Zakee L; Hansen, Allison K; Moran, Nancy A
2012-01-01
Starting in 2003, numerous studies using culture-independent methodologies to characterize the gut microbiota of honey bees have retrieved a consistent and distinctive set of eight bacterial species, based on near identity of the 16S rRNA gene sequences. A recent study [Mattila HR, Rios D, Walker-Sperling VE, Roeselers G, Newton ILG (2012) Characterization of the active microbiotas associated with honey bees reveals healthier and broader communities when colonies are genetically diverse. PLoS ONE 7(3): e32962], using pyrosequencing of the V1-V2 hypervariable region of the 16S rRNA gene, reported finding entirely novel bacterial species in honey bee guts, and used taxonomic assignments from these reads to predict metabolic activities based on known metabolisms of cultivable species. To better understand this discrepancy, we analyzed the Mattila et al. pyrotag dataset. In contrast to the conclusions of Mattila et al., we found that the large majority of pyrotag sequences belonged to clusters for which representative sequences were identical to sequences from previously identified core species of the bee microbiota. On average, they represent 95% of the bacteria in each worker bee in the Mattila et al. dataset, a slightly lower value than that found in other studies. Some colonies contain small proportions of other bacteria, mostly species of Enterobacteriaceae. Reanalysis of the Mattila et al. dataset also did not support a relationship between abundances of Bifidobacterium and of putative pathogens or a significant difference in gut communities between colonies from queens that were singly or multiply mated. Additionally, consistent with previous studies, the dataset supports the occurrence of considerable strain variation within core species, even within single colonies. The roles of these bacteria within bees, or the implications of the strain variation, are not yet clear.
Anderson, J. W.; Fowden, L.
1970-01-01
1. Phenylalanyl-tRNA synthetases have been partially purified from cotyledons of seeds of Aesculus californica, which contains 2-amino-4-methylhex-4-enoic acid, and from four other species of Aesculus that do not contain this amino acid. The A. californica preparation was free from other aminoacyl-tRNA synthetases, and the contaminating synthetase activity in preparations from A. hippocastanum was decreased to acceptable limits by conducting assays of pyrophosphate exchange activity in 0.5m-potassium chloride. 2. The phenylalanyl-tRNA synthetase from each species activated 2-amino-4-methylhex-4-enoic acid with Km 30–40 times that for phenylalanine. The maximum velocity for 2-amino-4-methylhex-4-enoic acid was only 30% of that for phenylalanine with the A. californica enzyme, but the maximum velocities for the two substrates were identical for the other four species. 3. 2-Amino-4-methylhex-4-enoic acid was not found in the protein of A. californica, so discrimination against this amino acid probably occurs in the step of transfer to tRNA, though subcellular localization, or subsequent steps of protein synthesis could be involved. 4. Crotylglycine, methallylglycine, ethallylglycine, 2-aminohex-4,5-dienoic acid, 2-amino-5-methylhex-4-enoic acid, 2-amino-4-methylhex-4-enoic acid, β-(thien-2-yl)alanine, β-(pyrazol-1-yl)alanine, phenylserine and m-fluorophenylalanine were substrates for pyrophosphate exchange catalysed by the phenylalanyl-tRNA synthetases of A. californica or A. hippocastanum. Allylglycine, phenylglycine and 2-amino-4-phenylbutyric acid were inactive. PMID:5493504
Next-Generation Sequencing Reveals Significant Bacterial Diversity of Botrytized Wine
Bokulich, Nicholas A.; Joseph, C. M. Lucy; Allen, Greg; Benson, Andrew K.; Mills, David A.
2012-01-01
While wine fermentation has long been known to involve complex microbial communities, the composition and role of bacteria other than a select set of lactic acid bacteria (LAB) has often been assumed either negligible or detrimental. This study served as a pilot study for using barcoded amplicon next-generation sequencing to profile bacterial community structure in wines and grape musts, comparing the taxonomic depth achieved by sequencing two different domains of prokaryotic 16S rDNA (V4 and V5). This study was designed to serve two goals: 1) to empirically determine the most taxonomically informative 16S rDNA target region for barcoded amplicon sequencing of wine, comparing V4 and V5 domains of bacterial 16S rDNA to terminal restriction fragment length polymorphism (TRFLP) of LAB communities; and 2) to explore the bacterial communities of wine fermentation to better understand the biodiversity of wine at a depth previously unattainable using other techniques. Analysis of amplicons from the V4 and V5 provided similar views of the bacterial communities of botrytized wine fermentations, revealing a broad diversity of low-abundance taxa not traditionally associated with wine, as well as atypical LAB communities initially detected by TRFLP. The V4 domain was determined as the more suitable read for wine ecology studies, as it provided greater taxonomic depth for profiling LAB communities. In addition, targeted enrichment was used to isolate two species of Alphaproteobacteria from a finished fermentation. Significant differences in diversity between inoculated and uninoculated samples suggest that Saccharomyces inoculation exerts selective pressure on bacterial diversity in these fermentations, most notably suppressing abundance of acetic acid bacteria. These results determine the bacterial diversity of botrytized wines to be far higher than previously realized, providing further insight into the fermentation dynamics of these wines, and demonstrate the utility of next
Yasunaga, Haruna; Takeshita, Toru; Shibata, Yukie; Furuta, Michiko; Shimazaki, Yoshihiro; Akifusa, Sumio; Ninomiya, Toshiharu; Kiyohara, Yutaka; Takahashi, Ichiro; Yamashita, Yoshihisa
2017-11-01
Dental caries is caused by acidogenic plaque microbiota formed on saliva-bathed tooth surfaces, in which multiple organisms act collectively to initiate and expand a cavity. We explored bacterial species associated with the salivary microbiome of individuals with low susceptibility to dental caries. The bacterial composition of saliva from 19 young adults was analyzed using barcoded pyrosequencing of the 16S rRNA gene; we compared 10 caries-experienced (CE) and nine caries-free (CF) individuals. A quantitative PCR assay of saliva from 139 orally healthy adults aged 40-59 years was carried out to confirm the result obtained by pyrosequencing analysis. The microbiomes of CF individuals showed more diverse communities with a significantly greater proportion of the genus Porphyromonas. Among operational taxonomic units (OTUs) corresponding to the genus Porphyromonas, the OTU corresponding to P. pasteri was the most predominant and its relative abundance in CF individuals was significantly greater than in CE individuals (P < 0.001, Wilcoxon rank sum test). A quantitative PCR assay of saliva confirmed that the amounts of P. pasteri were significantly higher in individuals with lower caries experience (filled teeth <15, n = 67) than in those with higher caries experience (filled teeth ≥15, n = 72) (P < 0.001, Student's t test). These results revealed an association between a greater abundance of P. pasteri and lower susceptibility to dental caries. P. pasteri may be a bacterial species that could potentially be used as a marker for maintaining a healthy oral microbiome against dental caries.
Raghuwanshi, Shailendra; Dutt, Kakoli; Gupta, Pritesh; Misra, Swati; Saxena, Rajendra Kumar
2011-06-01
An indigenously isolated strain of Bacillus sphaericus was found to produce 1.21 IU/ml of tannase under unoptimized conditions. Optimizing the process one variable at a time resulted in the production of 7.6 IU/ml of tannase in 48 h in the presence of 1.5% tannic acid. A 9.26-fold increase in tannase production was achieved upon further optimization using response surface methodology (RSM), a statistical approach. This increase led to a production level of 11.2I U/ml in medium containing 2.0% tannic acid, 2.5% galactose, 0.25% ammonium chloride, and 0.1% MgSO(4) pH 6.0 incubated at 37°C and 100 rpm for 48 h with a 2.0% inoculum level. Scaling up tannase production in a 30-l bioreactor resulted in the production of 16.54 IU/ml after 36 h. Thus far, this tannase production is the highest reported in this bacterial strain. Partially purified tannase exhibited an optimum pH of 5.0 with activity in the pH range of 3 to 8; 50°C was the optimal temperature for activity. Efficient conversion of tannic acid to purified gallic acid (90.80%) was achieved through crystallization. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.
Ceccato-Antonini, Sandra Regina
2018-05-25
Ethanol bio-production in Brazil has some unique characteristics that inevitably lead to bacterial contamination, which results in the production of organic acids and biofilms and flocculation that impair the fermentation yield by affecting yeast viability and diverting sugars to metabolites other than ethanol. The ethanol-producing units commonly give an acid treatment to the cells after each fermentative cycle to decrease the bacterial number, which is not always effective. An alternative strategy must be employed to avoid bacterial multiplication but must be compatible with economic, health and environmental aspects. This review analyzes the issue of bacterial contamination in sugarcane-based fuel ethanol fermentation, and the potential strategies that may be utilized to control bacterial growth besides acid treatment and antibiotics. We have emphasized the efficiency and suitability of chemical products other than acids and those derived from natural sources in industrial conditions. In addition, we have also presented bacteriocins, bacteriophages, and beneficial bacteria as non-conventional antimicrobial agents to mitigate bacterial contamination in the bioethanol industry.
Kurm, Viola; van der Putten, Wim H; Pineda, Ana; Hol, W H Gera
2018-02-12
Plant growth-promoting rhizobacteria (PGPR) strains can influence plant-insect interactions. However, little is known about the effect of changes in the soil bacterial community in general and especially the loss of rare soil microbes on these interactions. Here, the influence of rare soil microbe reduction on induced systemic resistance (ISR) in a wild ecotype of Arabidopsis thaliana against the aphid Myzus persicae was investigated. To create a gradient of microbial abundances, soil was inoculated with a serial dilution of a microbial community and responses of Arabidopsis plants that originated from the same site as the soil microbes were tested. Plant biomass, transcription of genes involved in plant defences, and insect performance were measured. In addition, the effects of the PGPR strain Pseudomonas fluorescens SS101 on plant and insect performance were tested under the influence of the various soil dilution treatments. Plant biomass showed a hump-shaped relationship with soil microbial community dilution, independent of aphid or Pseudomonas treatments. Both aphid infestation and inoculation with Pseudomonas reduced plant biomass, and led to downregulation of PR1 (salicylic acid-responsive gene) and CYP79B3 (involved in synthesis of glucosinolates). Aphid performance and gene transcription were unaffected by soil dilution. Neither the loss of rare microbial species, as caused by soil dilution, nor Pseudomonas affect the resistance of A. thaliana against M. persicae. However, both Pseudomonas survival and plant biomass respond to rare species loss. Thus, loss of rare soil microbial species can have a significant impact on both above- and below-ground organisms. © The Author(s) 2018. Published by Oxford University Press on behalf of the Annals of Botany Company. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Autoinducer-2 detection among commensal oral streptococci is dependent on pH and boric acid.
Cuadra, Giancarlo A; Frantellizzi, Ashley J; Gaesser, Kimberly M; Tammariello, Steven P; Ahmed, Anika
2016-07-01
Autoinducer-2, considered a universal signaling molecule, is produced by many species of bacteria; including oral strains. Structurally, autoinducer-2 can exist bound to boron (borated autoinducer-2). Functionally, autoinducer-2 has been linked to important bacterial processes such as virulence and biofilm formation. In order to test production of autoinducer-2 by a given bacterial strain, a bioassay using marine bioluminescent bacteria Vibrio harveyi as a reporter for autoinducer-2 has been designed. We hypothesize that pH adjustment and addition of boron are required for optimal bioluminescence and accurate autoinducer-2 detection. Using this reporter strain we tested autoinducer-2 activity from two oral commensal species, Streptococcus gordonii DL1 and Streptococcus oralis 34. Spent broth was collected and adjusted to pH 7.5 and supplemented with boric acid prior to measuring autoinducer- 2 activity. Results show that low pH inhibits bioluminescence of the reporter strain, but pH 7.5 allows for bioluminescence induction and proper readings of autoinducer-2 activity. Addition of boric acid also has a positive effect on bioluminescence allowing for a more sensitive detection of autoinducer-2 activity. Our data suggests that although autoinducer-2 is present in spent broth, low pH and/or low levels of boric acid become an obstacle for proper autoinducer-2 detection. For proper autoinducer-2 detection, we propose a protocol using this bioassay to include pH adjustment and boric acid addition to spent broth. Studies on autoinducer-2 activity in several bacteria species represent an important area of study as this universal signaling molecule is involved in critical bacterial phenotypes such as virulence and biofilm formation.
Biotechnological Production of Caffeic Acid by Bacterial Cytochrome P450 CYP199A2
Arai, Yuka; Kino, Kuniki
2012-01-01
Caffeic acid is a biologically active molecule that has various beneficial properties, including antioxidant, anticancer, and anti-inflammatory activities. In this study, we explored the catalytic potential of a bacterial cytochrome P450, CYP199A2, for the biotechnological production of caffeic acid. When the CYP199A2 enzyme was reacted with p-coumaric acid, it stoichiometrically produced caffeic acid. The crystal structure of CYP199A2 shows that Phe at position 185 is situated directly above, and only 6.35 Å from, the heme iron. This F185 residue was replaced with hydrophobic or hydroxylated amino acids using site-directed mutagenesis to create mutants with novel and improved catalytic properties. In whole-cell assays with the known substrate of CYP199A2, 2-naphthoic acid, only the wild-type enzyme hydroxylated 2-naphthoic acid at the C-7 and C-8 positions, whereas all of the active F185 mutants exhibited a preference for C-5 hydroxylation. Interestingly, several F185 mutants (F185V, F185L, F185I, F185G, and F185A mutants) also acquired the ability to hydroxylate cinnamic acid, which was not hydroxylated by the wild-type enzyme. These results demonstrate that F185 is an important residue that controls the regioselectivity and the substrate specificity of CYP199A2. Furthermore, Escherichia coli cells expressing the F185L mutant exhibited 5.5 times higher hydroxylation activity for p-coumaric acid than those expressing the wild-type enzyme. By using the F185L whole-cell catalyst, the production of caffeic acid reached 15 mM (2.8 g/liter), which is the highest level so far attained in biotechnological production of this compound. PMID:22729547
Sopina, V A
2000-01-01
Glucose-6-phosphate dehydrogenase (G6PD), acid phosphatase and esterases in free-living amoebae of 7 Amoeba species were investigated with the use of disc-electrophoresis in polyacrylamide gel. The evidence provided is suggestive that the electrophoretic isoenzyme patterns of acid phosphatase and esterases (and G6PD in some cases), in addition to a few morphological characters, can serve as a taxonomic criterion for species identification within this genus, as well as for revealing erroneously classified species and strains. It is suggested that A. indica is an independent species whose preliminary diagnosis has been given in this paper. It is concluded that A. discoides and A. lescherae are strains of A. proteus, rather than two independent species. A and As-102 amoebian strains, kept in the collection of protozoan strains and species of the Institute of Cytology RAS and referred to as strains of A. proteus, belong in reality to another Amoeba species and even to another genus within the family Amoebidae. This conclusion has been documented by results of our analysis of electrophoretic patterns of acid phosphatase and esterases in these strains.
Bacterial Diversity in Human Subgingival Plaque
Paster, Bruce J.; Boches, Susan K.; Galvin, Jamie L.; Ericson, Rebecca E.; Lau, Carol N.; Levanos, Valerie A.; Sahasrabudhe, Ashish; Dewhirst, Floyd E.
2001-01-01
The purpose of this study was to determine the bacterial diversity in the human subgingival plaque by using culture-independent molecular methods as part of an ongoing effort to obtain full 16S rRNA sequences for all cultivable and not-yet-cultivated species of human oral bacteria. Subgingival plaque was analyzed from healthy subjects and subjects with refractory periodontitis, adult periodontitis, human immunodeficiency virus periodontitis, and acute necrotizing ulcerative gingivitis. 16S ribosomal DNA (rDNA) bacterial genes from DNA isolated from subgingival plaque samples were PCR amplified with all-bacterial or selective primers and cloned into Escherichia coli. The sequences of cloned 16S rDNA inserts were used to determine species identity or closest relatives by comparison with sequences of known species. A total of 2,522 clones were analyzed. Nearly complete sequences of approximately 1,500 bases were obtained for putative new species. About 60% of the clones fell into 132 known species, 70 of which were identified from multiple subjects. About 40% of the clones were novel phylotypes. Of the 215 novel phylotypes, 75 were identified from multiple subjects. Known putative periodontal pathogens such as Porphyromonas gingivalis, Bacteroides forsythus, and Treponema denticola were identified from multiple subjects, but typically as a minor component of the plaque as seen in cultivable studies. Several phylotypes fell into two recently described phyla previously associated with extreme natural environments, for which there are no cultivable species. A number of species or phylotypes were found only in subjects with disease, and a few were found only in healthy subjects. The organisms identified only from diseased sites deserve further study as potential pathogens. Based on the sequence data in this study, the predominant subgingival microbial community consisted of 347 species or phylotypes that fall into 9 bacterial phyla. Based on the 347 species seen in our
Bacterial polyesters: biosynthesis, biodegradable plastics and biotechnology.
Lenz, Robert W; Marchessault, Robert H
2005-01-01
The discovery and chemical identification, in the 1920s, of the aliphatic polyester: poly(3-hydroxybutyrate), PHB, as a granular component in bacterial cells proceeded without any of the controversies which marked the recognition of macromolecules by Staudinger. Some thirty years after its discovery, PHB was recognized as the prototypical biodegradable thermoplastic to solve the waste disposal challenge. The development effort led by Imperial Chemical Industries Ltd., encouraged interdisciplinary research from genetic engineering and biotechnology to the study of enzymes involved in biosynthesis and biodegradation. From the simple PHB homopolyester discovered by Maurice Lemoigne in the mid-twenties, a family of over 100 different aliphatic polyesters of the same general structure has been discovered. Depending on bacterial species and substrates, these high molecular weight stereoregular polyesters have emerged as a new family of natural polymers ranking with nucleic acids, polyamides, polyisoprenoids, polyphenols, polyphosphates, and polysaccharides. In this historical review, the chemical, biochemical and microbial highlights are linked to personalities and locations involved with the events covering a discovery timespan of 75 years.
Gundogdu, Muttalip; Ozrenk, Koray; Ercisli, Sezai; Kan, Tuncay; Kodad, Ossama; Hegedus, Attila
2014-05-30
The Hawthorn (Crateagus sp.) mostly occurs around the temperate region of the world with a high number of species, producing a fruit with numerous beneficial effects for human health. The aim of the study was to determine organic acid and sugar contents in the fruit of a number of hawthorn species grown in Erzincan province of Turkey. Citric acid was the predominant organic acid in all hawthorn species and C. pseudoheterophylla had the highest citric acid content (23.688 g/100 g). There were not statistically significant differences among hawthorn species (except C. atrosanguinea Pojark) in terms of fumaric acid content. C.pontica C.Koch had a higher content of vitamin C (9.418 mg/100 g) compared to other species. Fructose was the predominant sugar component in all species and C. monogyna subsp. monogyna Joiq had the highest fructose content (18.378 g/100 g). The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source. The study revealed that there were differences in terms of fruit characteristics among hawthorn species and thus better quality hawthorn genotypes can be selected within the species. Hence, this study is considered to be a valuable reference for forthcoming studies. The high fruit quality of the studied species indicates the importance of this fruit in human nutrition as a natural source.
The feasibility of using probes directed towards ribosomal DNAs (rDNAs) as a quantitative approach to estimating cell numbers was examined and applied to study the structure of a bacterial community in humic acid-rich salt marsh sediments. Hybridizations were performed with membr...
Weber, Heike E; Gottardi, Manuela; Brückner, Christine; Oreb, Mislav; Boles, Eckhard; Tripp, Joanna
2017-05-15
Biotechnological production of cis , cis -muconic acid from renewable feedstocks is an environmentally sustainable alternative to conventional, petroleum-based methods. Even though a heterologous production pathway for cis , cis -muconic acid has already been established in the host organism Saccharomyces cerevisiae , the generation of industrially relevant amounts of cis , cis -muconic acid is hampered by the low activity of the bacterial protocatechuic acid (PCA) decarboxylase AroY isomeric subunit C iso (AroY-C iso ), leading to secretion of large amounts of the intermediate PCA into the medium. In the present study, we show that the activity of AroY-C iso in S. cerevisiae strongly depends on the strain background. We could demonstrate that the strain dependency is caused by the presence or absence of an intact genomic copy of PAD1 , which encodes a mitochondrial enzyme responsible for the biosynthesis of a prenylated form of the cofactor flavin mononucleotide (prFMN). The inactivity of AroY-C iso in strain CEN.PK2-1 could be overcome by plasmid-borne expression of Pad1 or its bacterial homologue AroY subunit B (AroY-B). Our data reveal that the two enzymes perform the same function in decarboxylation of PCA by AroY-C iso , although coexpression of Pad1 led to higher decarboxylase activity. Conversely, AroY-B can replace Pad1 in its function in decarboxylation of phenylacrylic acids by ferulic acid decarboxylase Fdc1. Targeting of the majority of AroY-B to mitochondria by fusion to a heterologous mitochondrial targeting signal did not improve decarboxylase activity of AroY-C iso , suggesting that mitochondrial localization has no major impact on cofactor biosynthesis. IMPORTANCE In Saccharomyces cerevisiae , the decarboxylation of protocatechuic acid (PCA) to catechol is the bottleneck reaction in the heterologous biosynthetic pathway for production of cis , cis -muconic acid, a valuable precursor for the production of bulk chemicals. In our work, we demonstrate
Fu, Liang; Chen, Siqian; Yi, Jiulong; Hou, Zongxia
2014-07-01
A strain of acidogenic bacterium was isolated from the fermentation liquid of Cantonese-style rice vinegar produced by traditional surface fermentation. 16S rDNA identification confirmed the bacterium as Gluconacetobacter xylinus, which synthesizes bacterial cellulose, and the acid productivity of the strain was investigated. In the study, the effects of the membrane integrity and the comparison of the air-liquid interface membrane with immerged membrane on total acidity, cellulose production, alcohol dehydrogenase (ADH) activity and number of bacteria were investigated. The cellulose membrane and the bacteria were observed under SEM for discussing their relationship. The correlations between oxygen consumption and total acid production rate were compared in surface and shake flask fermentation. The results showed the average acid productivity of the strain was 0.02g/(100mL/h), and the integrity of cellulose membrane in surface fermentation had an important effect on total acidity and cellulose production. With a higher membrane integrity, the total acidity after 144 h of fermentation was 3.75 g/100 mL, and the cellulose production was 1.71 g/100 mL after 360 h of fermentation. However, when the membrane was crushed by mechanical force, the total acidity and the cellulose production were as low as 0.36 g/100 mL and 0.14 g/100 mL, respectively. When the cellulose membrane was forced under the surface of fermentation liquid, the total acid production rate was extremely low, but the activity of ADH in the cellulose membrane was basically the same with the one above the liquid surface. The bacteria were mainly distributed in the cellulose membrane during the fermentation. The bacterial counts in surface fermentation were more than in the shake flask fermentation and G. xylinus consumed the substrate faster, in surface fermentation than in shake flask fermentation. The oxygen consumption rate and total acid production rate of surface fermentation were respectively 26
Barrios, Carlos A; Xu, Qingwei; Cutright, Teresa; Newby, Bi-min Zhang
2005-03-25
Biofouling has posed serious problems in maritime industry including increased fuel consumptions, economic loss from ship-hull maintenances, contamination of drinking water, and serious corrosion for mechanical instruments. Minimizing the attachment of bacteria and formation of biofilm could be advantageous in reducing the early stages of biofouling. Zosteric acid, a natural product present in eelgrass, was found to have ability for preventing the attachment of some bacteria and barnacles. In this study, the antifouling ability of zosteric acid during the early stages of fouling was evaluated using attachment studies of fresh water bacteria. Simultaneously, various methods were sought for incorporating zosteric acid into silicone to prolong the release of the compound. The main results from this study were that zosteric acid exhibited anti-bacterial attachment regardless of whether it dispersed in water or incorporated into a coating. In addition, the release rate of zosteric acid from the incorporated coatings, particularly those where zosteric acid was uniformly dispersed with aggregates size of 4 microm or less, was orders of magnitude slower than those of previous reports. The release results indicate that the service life of our coatings could be far extended even with a small amount of zosteric acid incorporated.
Philippeau, C; Lettat, A; Martin, C; Silberberg, M; Morgavi, D P; Ferlay, A; Berger, C; Nozière, P
2017-04-01
This study investigated the effects of bacterial direct-fed microbials (DFM) on ruminal fermentation and microbial characteristics, methane (CH 4 ) emission, diet digestibility, and milk fatty acid (FA) composition in dairy cows fed diets formulated to induce different ruminal volatile fatty acid (VFA) profiles. Eight ruminally cannulated dairy cows were divided into 2 groups based on parity, days in milk, milk production, and body weight. Cows in each group were fed either a high-starch (38%, HS) or a low-starch (2%, LS) diet in a 55:45 forage-to-concentrate ratio on a dry matter (DM) basis. For each diet, cows were randomly assigned to 1 of 4 treatments in a Latin square design of (1) control (CON); (2) Propionibacterium P63 (P63); (3) P63 plus Lactobacillus plantarum 115 (P63+Lp); (4) P63 plus Lactobacillus rhamnosus 32 (P63+Lr). Strains of DFM were administered at 10 10 cfu/d. Methane emission (using the sulfur hexafluoride tracer technique), total-tract digestibility, dry matter intake, and milk production and composition were quantified in wk 3. Ruminal fermentation and microbial characteristics were measured in wk 4. Data were analyzed using the mixed procedure of SAS (SAS Institute Inc., Cary, NC). The 2 diets induced different ruminal VFA profiles, with a greater proportion of propionate at the expense of acetate and butyrate for the HS diet. Greater concentrations of total bacteria and selected bacterial species of methanogenic Archaea were reported for the HS diet, whereas the protozoa concentration in HS decreased. For both diets, bacterial DFM supplementation raised ruminal pH (+0.18 pH units, on average) compared with CON. Irrespective of diet, P63+Lp and P63+Lr increased ruminal cellulase activity (3.8-fold, on average) compared with CON, but this effect was not associated with variations in ruminal microbial numbers. Irrespective of diet, no effect of bacterial DFM on ruminal VFA was observed. For the LS diet, supplementing cows with P63+Lr tended
Disease notes - Bacterial root rot
USDA-ARS?s Scientific Manuscript database
Bacterial root rot initiated by lactic acid bacteria, particularly Leuconostoc, occurs every year in Idaho sugarbeet fields. Hot fall weather seems to make the problem worse. Although Leuconostoc initiates the rot, other bacteria and yeast frequently invade the tissue as well. The acetic acid bac...
Mueller, R F; Characklis, W G; Jones, W L; Sears, J T
1992-05-01
The processes leading to bacterial colonization on solid-water interfaces are adsorption, desorption, growth, and erosion. These processes have been measured individually in situ in a flowing system in real time using image analysis. Four different substrata (copper, silicon, 316 stainless-steel and glass) and 2 different bacterial species (Pseudomonas aeruginosa and Pseudomonas fluorescens) were used in the experiments. The flow was laminar (Re = 1.4) and the shear stress was kept constant during all experiments at 0.75 N m(-2). The surface roughness varied among the substrata from 0.002 microm (for silicon) to 0.015 microm (for copper). Surface free energies varied from 25.1 dynes cm(-1) for silicon to 31.2 dynes cm(-1) for copper. Cell curface hydrophobicity, reported as hydrocarbon partitioning values, ranged from 0.67 for Ps. fluorescens to 0.97 for Ps. aeruginosa.The adsorption rate coefficient varied by as much as a factor of 10 among the combinations of bacterial strain and substratum material, and was positively correlated with surface free energy, the surface roughness of the substratum, and the hydrophobicity of the cells. The probability of desorption decreased with increasing surface free energy and surface roughness of the substratum. Cell growth was inhibited on copper, but replication of cells overlying an initial cell layer was observed with increased exposure time to the cell-containing bulk water. A mathematical model describing cell accumulation on a substratum is presented.
Bacterial diversity at different stages of the composting process
2010-01-01
Background Composting is an aerobic microbiological process that is facilitated by bacteria and fungi. Composting is also a method to produce fertilizer or soil conditioner. Tightened EU legislation now requires treatment of the continuously growing quantities of organic municipal waste before final disposal. However, some full-scale composting plants experience difficulties with the efficiency of biowaste degradation and with the emission of noxious odours. In this study we examine the bacterial species richness and community structure of an optimally working pilot-scale compost plant, as well as a full-scale composting plant experiencing typical problems. Bacterial species composition was determined by isolating total DNA followed by amplifying and sequencing the gene encoding the 16S ribosomal RNA. Results Over 1500 almost full-length 16S rRNA gene sequences were analysed and of these, over 500 were present only as singletons. Most of the sequences observed in either one or both of the composting processes studied here were similar to the bacterial species reported earlier in composts, including bacteria from the phyla Actinobacteria, Bacteroidetes, Firmicutes, Proteobacteria and Deinococcus-Thermus. In addition, a number of previously undetected bacterial phylotypes were observed. Statistical calculations estimated a total bacterial diversity of over 2000 different phylotypes in the studied composts. Conclusions Interestingly, locally enriched or evolved bacterial variants of familiar compost species were observed in both composts. A detailed comparison of the bacterial diversity revealed a large difference in composts at the species and strain level from the different composting plants. However, at the genus level, the difference was much smaller and illustrated a delay of the composting process in the full-scale, sub-optimally performing plants. PMID:20350306
Bacteriophage Amplification-Coupled Detection and Identification of Bacterial Pathogens
NASA Astrophysics Data System (ADS)
Cox, Christopher R.; Voorhees, Kent J.
Current methods of species-specific bacterial detection and identification are complex, time-consuming, and often require expensive specialized equipment and highly trained personnel. Numerous biochemical and genotypic identification methods have been applied to bacterial characterization, but all rely on tedious microbiological culturing practices and/or costly sequencing protocols which render them impractical for deployment as rapid, cost-effective point-of-care or field detection and identification methods. With a view towards addressing these shortcomings, we have exploited the evolutionarily conserved interactions between a bacteriophage (phage) and its bacterial host to develop species-specific detection methods. Phage amplification-coupled matrix assisted laser desorption time-of-flight mass spectrometry (MALDI-TOF-MS) was utilized to rapidly detect phage propagation resulting from species-specific in vitro bacterial infection. This novel signal amplification method allowed for bacterial detection and identification in as little as 2 h, and when combined with disulfide bond reduction methods developed in our laboratory to enhance MALDI-TOF-MS resolution, was observed to lower the limit of detection by several orders of magnitude over conventional spectroscopy and phage typing methods. Phage amplification has been combined with lateral flow immunochromatography (LFI) to develop rapid, easy-to-operate, portable, species-specific point-of-care (POC) detection devices. Prototype LFI detectors have been developed and characterized for Yersinia pestis and Bacillus anthracis, the etiologic agents of plague and anthrax, respectively. Comparable sensitivity and rapidity was observed when phage amplification was adapted to a species-specific handheld LFI detector, thus allowing for rapid, simple, POC bacterial detection and identification while eliminating the need for bacterial culturing or DNA isolation and amplification techniques.
USDA-ARS?s Scientific Manuscript database
We previously reported the apparent formation of matrix adducts of 3,5-dimethoxy-4-hydroxy-cinnamic acid (sinapinic acid or SA) via covalent attachment to disulfide bond-containing proteins (HdeA, HdeB and YbgS) from bacterial cell lysates ionized by matrix-assisted laser desorption/ionization (MALD...
Zakhia, Frédéric; de Lajudie, Philippe
2006-03-01
Taxonomy is the science that studies the relationships between organisms. It comprises classification, nomenclature, and identification. Modern bacterial taxonomy is polyphasic. This means that it is based on several molecular techniques, each one retrieving the information at different cellular levels (proteins, fatty acids, DNA...). The obtained results are combined and analysed to reach a "consensus taxonomy" of a microorganism. Until 1970, a small number of classification techniques were available for microbiologists (mainly phenotypic characterization was performed: a legume species nodulation ability for a Rhizobium, for example). With the development of techniques based on polymerase chain reaction for characterization, the bacterial taxonomy has undergone great changes. In particular, the classification of the legume nodulating bacteria has been repeatedly modified over the last 20 years. We present here a review of the currently used molecular techniques in bacterial characterization, with examples of application of these techniques for the study of the legume nodulating bacteria.
Wu, Jia Jia; Ma, Ying Kun; Zhang, Fen Fen; Chen, Fu Sheng
2012-05-01
Shanxi aged vinegar is a famous traditional Chinese vinegar made from several kinds of cereal by spontaneous solid-state fermentation techniques. In order to get a comprehensive understanding of culturable microorganism's diversity present in its fermentation, the indigenous microorganisms including 47 yeast isolates, 28 lactic acid bacteria isolates and 58 acetic acid bacteria isolates were recovered in different fermenting time and characterized based on a combination of phenotypic and genotypic approaches including inter-delta/PCR, PCR-RFLP, ERIC/PCR analysis, as well as 16S rRNA and 26S rRNA partial gene sequencing. In the alcoholic fermentation, the dominant yeast species Saccharomyces (S.) cerevisiae (96%) exhibited low phenotypic and genotypic diversity among the isolates, while Lactobacillus (Lb.) fermentum together with Lb. plantarum, Lb. buchneri, Lb. casei, Pediococcus (P.) acidilactici, P. pentosaceus and Weissella confusa were predominated in the bacterial population at the same stage. Acetobacter (A.) pasteurianus showing great variety both in genotypic and phenotypic tests was the dominant species (76%) in the acetic acid fermentation stage, while the other acetic acid bacteria species including A. senegalensis, A. indonesiensis, A. malorum and A. orientalis, as well as Gluconobacter (G.) oxydans were detected at initial point of alcoholic and acetic acid fermentation stage respectively. Copyright © 2011 Elsevier Ltd. All rights reserved.
Colin, Y; Nicolitch, O; Turpault, M-P; Uroz, S
2017-03-01
mineralogy influences the diversity, structure, and function of soil bacterial communities in relation to the soil conditions is crucial to better understanding the relative role of the soil bacterial communities in nutrient cycling and plant nutrition in nutrient-poor environments. The present study determined in detail the diversity and structure of bacterial communities associated with different mineral types incubated for 2.5 years in the soil under different tree species using cultivation-dependent and -independent analyses. Our data showed an enrichment of specific bacterial taxa on the minerals, specifically on the most weathered minerals, suggesting that they play key roles in mineral weathering and nutrient cycling in nutrient-poor forest ecosystems. Copyright © 2017 American Society for Microbiology.
Colin, Y.; Nicolitch, O.; Turpault, M.-P.
2016-01-01
how soil mineralogy influences the diversity, structure, and function of soil bacterial communities in relation to the soil conditions is crucial to better understanding the relative role of the soil bacterial communities in nutrient cycling and plant nutrition in nutrient-poor environments. The present study determined in detail the diversity and structure of bacterial communities associated with different mineral types incubated for 2.5 years in the soil under different tree species using cultivation-dependent and -independent analyses. Our data showed an enrichment of specific bacterial taxa on the minerals, specifically on the most weathered minerals, suggesting that they play key roles in mineral weathering and nutrient cycling in nutrient-poor forest ecosystems. PMID:28003192
Kocatepe, Demet; Turan, Hülya
2012-06-01
The proximate and fatty acid compositions of the commercially important fish species (Engraulis encrasicolus, Alosa alosa, Belone belone, Scorpaena porcus, Pomatomus saltatrix, Mullus barbatus) from the Sinop region of the Black Sea were examined. The fat contents ranged from 1.26% (for scorpion fish) to 18.12% (for shad). The protein contents were min 14.54% (for red mullet) and maximum 20.26% (for belone). The fatty acid compositions of the fish ranged from 27.83 to 35.91% for saturated fatty acids, 19.50-33.80% for monounsaturated fatty acids and 15.25-40.02% for polyunsaturated fatty acids. Among the saturated fatty acids, palmitic acid (16:0) (17.75-22.20%) was the dominant fatty acid for all the fish species. As a second saturated fatty acid, myristic acid (14:0) was observed in four of the fish species and its content ranged from 4.72 to 7.31%. Whereas, for the other two fish species, the second saturated fatty acid was stearic acid (18:0) ranging between 4.54 and 10.64%. Among the monounsaturated fatty acids, those occurring in the highest proportions were oleic acid (18:1n-9c) (11.67-22.45%) and palmitoleic acid (16:1) (4.50-9.40%). Docosahexaenoic acid (22:6n-3) (5.41-28.52%), eicosapentaenoic acid (20:5n-3) (4.68-11.06) and linoleic acid (18:2n-6) (1.38-3.49%) were dominant polyunsaturated fatty acids, respectively. All the species, in particular the belone, the anchovy and the shad had high levels of the n-3 series.
NASA Astrophysics Data System (ADS)
Fang, J.
2015-12-01
Marine sediments cover more than two-thirds of the Earth's surface and represent a major part of the deep biosphere. Microbial cells and microbial activity appear to be widespread in these sediments. Recently, we reported the isolation of gram-positive anaerobic spore-forming piezophilic bacteria and detection of bacterial endospores in marine subsurface sediment from the Shimokita coalbed, Japan. However, the modern molecular microbiological methods (e.g., DNA-based microbial detection techniques) cannot detect bacterial endospore, because endospores are impermeable and are not stained by fluorescence DNA dyes or by ribosomal RNA staining techniques such as catalysed reporter deposition fluorescence in situ hybridization. Thus, the total microbial cell abundance in the deep biosphere may has been globally underestimated. This emphasizes the need for a new cultivation independent approach for the quantification of bacterial endospores in the deep subsurface. Dipicolinic acid (DPA, pyridine-2,6-dicarboxylic acid) is a universal and specific component of bacterial endospores, representing 5-15wt% of the dry spore, and therefore is a useful indicator and quantifier of bacterial endospores and permits to estimate total spore numbers in the subsurface biosphere. We developed a sensitive analytical method to quantify DPA content in environmental samples using gas chromatography-mass spectrometry. The method is sensitive and more convenient in use than other traditional methods. We applied this method to analyzing sediment samples from the South China Sea (obtained from IODP Exp. 349) to determine the abundance of spore-forming bacteria in the deep marine subsurface sediment. Our results suggest that gram-positive, endospore-forming bacteria may be the "unseen majority" in the deep biosphere.
Toppe, Jogeir; Albrektsen, Sissel; Hope, Britt; Aksnes, Anders
2007-03-01
The chemical composition, content of minerals and the profiles of amino acids and fatty acids were analyzed in fish bones from eight different species of fish. Fish bones varied significantly in chemical composition. The main difference was lipid content ranging from 23 g/kg in cod (Gadus morhua) to 509 g/kg in mackerel (Scomber scombrus). In general fatty fish species showed higher lipid levels in the bones compared to lean fish species. Similarly, lower levels of protein and ash were observed in bones from fatty fish species. Protein levels differed from 363 g/kg lipid free dry matter (dm) to 568 g/kg lipid free dm with a concomitant inverse difference in ash content. Ash to protein ratio differed from 0.78 to 1.71 with the lowest level in fish that naturally have highest swimming and physical activity. Saithe (Pollachius virens) and salmon (Salmo salar) were found to be significantly different in the levels of lipid, protein and ash, and ash/protein ratio in the bones. Only small differences were observed in the level of amino acids although species specific differences were observed. The levels of Ca and P in lipid free fish bones were about the same in all species analyzed. Fatty acid profile differed in relation to total lipid levels in the fish bones, but some minor differences between fish species were observed.
Sun, Hongwei; Li, Guiying; Nie, Xin; Shi, Huixian; Wong, Po-Keung; Zhao, Huijun; An, Taicheng
2014-08-19
A systematic approach was developed to understand, in-depth, the mechanisms involved during the inactivation of bacterial cells using photoelectrocatalytic (PEC) processes with Escherichia coli K-12 as the model microorganism. The bacterial cells were found to be inactivated and decomposed primarily due to attack from photogenerated H2O2. Extracellular reactive oxygen species (ROSs), such as H2O2, may penetrate into the bacterial cell and cause dramatically elevated intracellular ROSs levels, which would overwhelm the antioxidative capacity of bacterial protective enzymes such as superoxide dismutase and catalase. The activities of these two enzymes were found to decrease due to the ROSs attacks during PEC inactivation. Bacterial cell wall damage was then observed, including loss of cell membrane integrity and increased permeability, followed by the decomposition of cell envelope (demonstrated by scanning electronic microscope images). One of the bacterial building blocks, protein, was found to be oxidatively damaged due to the ROSs attacks, as well. Leakage of cytoplasm and biomolecules (bacterial building blocks such as proteins and nucleic acids) were evident during prolonged PEC inactivation process. The leaked cytoplasmic substances and cell debris could be further degraded and, ultimately, mineralized with prolonged PEC treatment.
Fatty acid profiles of five farmed Brazilian freshwater fish species from different families
Canto, Anna Carolina Vilhena da Cruz Silva; da Costa, Marion Pereira; da Silva, Flávio Alves; Mársico, Eliane Teixeira; Conte-Junior, Carlos Adam
2017-01-01
The proximate composition and fatty acid (FA) profiles of five Brazilian freshwater fish species, namely Brycon cephalus (BC), Cichla ocellaris (CO), Prochilodus lineatus (PL), Leporinus friderici (LF) and Pseudoplatystoma corruscans (PCO), were investigated. CO and LF exhibited the highest (p < 0.05) moisture content, as well as one of the lowest (p < 0.05) lipid values, whereas BC presented the lowest (p < 0.05) moisture and, alongside PL, the highest (p < 0.05) lipid content. The predominant FAs in the evaluated fish species were palmitic, oleic, linoleic and docosahexaenoic acids. BC and CO presented high n-3 PUFA content, especially DHA, and demonstrated superior nutritional quality indices compared to the other evaluated fish species. Furthermore, a significant relationship was observed among these species, suggesting they possess similar nutritional lipid values. Thus, BC and CO were proven to be an excellent matrix with relevant lipid quality, desirable for human health. PMID:28614390
Differentiation of bacterial colonies and temporal growth patterns using hyperspectral imaging
NASA Astrophysics Data System (ADS)
Mehrübeoglu, Mehrube; Buck, Gregory W.; Livingston, Daniel W.
2014-09-01
Detection and identification of bacteria are important for health and safety. Hyperspectral imaging offers the potential to capture unique spectral patterns and spatial information from bacteria which can then be used to detect and differentiate bacterial species. Here, hyperspectral imaging has been used to characterize different bacterial colonies and investigate their growth over time. Six bacterial species (Pseudomonas fluorescens, Escherichia coli, Serratia marcescens, Salmonella enterica, Staphylococcus aureus, Enterobacter aerogenes) were grown on tryptic soy agar plates. Hyperspectral data were acquired immediately after, 24 hours after, and 96 hours after incubation. Spectral signatures from bacterial colonies demonstrated repeatable measurements for five out of six species. Spatial variations as well as changes in spectral signatures were observed across temporal measurements within and among species at multiple wavelengths due to strengthening or weakening reflectance signals from growing bacterial colonies based on their pigmentation. Between-class differences and within-class similarities were the most prominent in hyperspectral data collected 96 hours after incubation.
Hicks, R P; Abercrombie, J J; Wong, R K; Leung, K P
2013-01-01
A series of 36 synthetic antimicrobial peptides containing unnatural amino acids were screened to determine their effectiveness to treat Enterococcus faecium, Staphylococcus aureus, Klebsiella pnemoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, and Enterobacter species (ESKAPE) pathogens, which are known to commonly infect chronic wounds. The primary amino acid sequences of these peptides incorporate either three or six dipeptide units consisting of the unnatural amino acids Tetrahydroisoquinolinecarboxylic acid (Tic) and Octahydroindolecarboxylic acid (Oic). The Tic-Oic dipeptide units are separated by SPACER amino acids with specific physicochemical properties that control how these peptides interact with bacterial cell membranes of different chemical compositions. These peptides exhibited minimum inhibitory concentrations (MIC) against these pathogens in the range from >100 to 6.25 μg/mL. The observed diversity of MIC values for these peptides against the various bacterial strains are consistent with our hypothesis that the complementarity of the physicochemical properties of the peptide and the lipid of the bacteria's cell membrane determines the resulting antibacterial activity of the peptide. Published by Elsevier Ltd.
Crossroads between Bacterial and Mammalian Glycosyltransferases
Brockhausen, Inka
2014-01-01
Bacterial glycosyltransferases (GT) often synthesize the same glycan linkages as mammalian GT; yet, they usually have very little sequence identity. Nevertheless, enzymatic properties, folding, substrate specificities, and catalytic mechanisms of these enzyme proteins may have significant similarity. Thus, bacterial GT can be utilized for the enzymatic synthesis of both bacterial and mammalian types of complex glycan structures. A comparison is made here between mammalian and bacterial enzymes that synthesize epitopes found in mammalian glycoproteins, and those found in the O antigens of Gram-negative bacteria. These epitopes include Thomsen–Friedenreich (TF or T) antigen, blood group O, A, and B, type 1 and 2 chains, Lewis antigens, sialylated and fucosylated structures, and polysialic acids. Many different approaches can be taken to investigate the substrate binding and catalytic mechanisms of GT, including crystal structure analyses, mutations, comparison of amino acid sequences, NMR, and mass spectrometry. Knowledge of the protein structures and functions helps to design GT for specific glycan synthesis and to develop inhibitors. The goals are to develop new strategies to reduce bacterial virulence and to synthesize vaccines and other biologically active glycan structures. PMID:25368613
Ávila Ramírez, Jhon Alejandro; Gómez Hoyos, Catalina; Arroyo, Silvana; Cerrutti, Patricia; Foresti, María Laura
2016-11-20
Bacterial cellulose (BC) nanoribbons were partially acetylated by a simple direct solvent-free route catalyzed by citric acid. The assay of reaction conditions within chosen intervals (i.e. esterification time (0.5-7h), catalyst content (0.08-1.01mmol/mmol AGU), and temperature (90-140°C)), illustrated the flexibility of the methodology proposed, with reaction variables which can be conveniently manipulated to acetylate BC to the required degree of substitution (DS) within the 0.20-0.73 interval. Within this DS interval, characterization results indicated a surface-only process in which acetylated bacterial cellulose with tunable DS, preserved fibrous structure and increased hydrophobicity could be easily obtained. The feasibility of reusing the catalyst/excess acylant in view of potential scale-up was also illustrated. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bacterial keratitis: a prospective clinical and microbiological study
Schaefer, F.; Bruttin, O.; Zografos, L.; Guex-Crosier, Y.
2001-01-01
AIM—To define the clinical and microbiological profile of bacterial keratitis at the Jules Gonin Eye Hospital and to test the in vitro bacterial resistance. METHODS—Patients presenting with bacterial keratitis were prospectively followed; clinical features (age, risk factors, visual acuity) and response to therapy were analysed. Bacteriological profile was determined and the sensitivity/resistance of isolated strains were tested towards 12 ocular antibiotics (NCCLS disc diffusion test). RESULTS—85 consecutive patients (mean age 44.3 (SD 20.7) years) were prospectively enrolled from 1 March 1997 to 30 November 1998. The following risk factors were identified: contact lens wear, 36%; blepharitis, 21%; trauma, 20%; xerophthalmia, 15%; keratopathies, 8%; and eyelid abnormalities, 6%. The most commonly isolated bacteria were Staphylococcus epidermidis, 40%; Staphylococcus aureus, 22%; Streptococcus pneumoniae, 8%; others Streptococcus species, 5%; Pseudomonas, 9%; Moraxella and Serratia marcescens, 5% each; Bacillus, Corynebacterium, Alcaligenes xyloxidans, Morganella morganii, and Haemophilus influenza, 1% each. 1-15% of strains were resistant to fluoroquinolones, 13-22% to aminoglycosides, 37% to cefazolin, 18% to chloramphenicol, 54% to polymyxin B, 51% to fusidic acid, and 45% to bacitracin. Five of the 85 patients (5.8%) had a poor clinical outcome with a visual loss of one or more lines of visual acuity. CONCLUSION—Fluoroquinolones appear to be the therapy of choice for bacterial keratitis, but, based upon these in vitro studies, some strains may be resistant. PMID:11423460
PCR-DGGE analysis of bacterial community dynamics in kava beverages during refrigeration.
Dong, J; Kandukuru, P; Huang, A S; Li, Y
2011-07-01
Kava beverages are highly perishable even under refrigerated conditions. This study aimed to investigate the bacterial community dynamics in kava beverages during refrigeration. Four freshly made kava beverages were obtained from kava bars and stored at 4°C. On days 0, 3 and 6, the aerobic plate count (APC), lactic acid bacteria (LAB) count and yeast and mould count (YMC) of the samples were determined. Meanwhile, bacterial DNA was extracted from each sample and subjected to the polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE). Moreover, species-specific PCR assays were employed to identify predominant Pseudomonas spp. involved in kava spoilage. Over the storage period, the APC, LAB count and YMC of the four kava beverages all increased, whereas their pH values decreased. The DGGE profile revealed diverse bacterial populations in the samples. LAB, such as Weissella soli, Lactobacillus spp. and Lactococcus lactis, were found in the kava beverages. Species-specific PCR assays detected Pseudomonas putida and Pseudomonas fluorescens in the samples; Ps. fluorescens became dominant during refrigeration. LAB and Pseudomonas may play a significant role in the spoilage of kava beverages. This study provides important information that may be used to extend the shelf life of kava beverages. © 2011 The Authors. Letters in Applied Microbiology © 2011 The Society for Applied Microbiology.
Van Campenhout, Jelle; Vanreusel, Ann; Van Belleghem, Steven; Derycke, Sofie
2015-12-03
Bathyal cold seeps are isolated extreme deep-sea environments characterized by low species diversity while biomass can be high. The Håkon Mosby mud volcano (Barents Sea, 1,280 m) is a rather stable chemosynthetic driven habitat characterized by prominent surface bacterial mats with high sulfide concentrations and low oxygen levels. Here, the nematode Halomonhystera hermesi thrives in high abundances (11,000 individuals 10 cm(-2)). Halomonhystera hermesi is a member of the intertidal Halomonhystera disjuncta species complex that includes five cryptic species (GD1-5). GD1-5's common habitat is characterized by strong environmental fluctuations. Here, we compared the transcriptomes of H. hermesi and GD1, H. hermesi's closest relative. Genes encoding proteins involved in oxidative phosphorylation are more strongly expressed in H. hermesi than in GD1, and many genes were only observed in H. hermesi while being completely absent in GD1. Both observations could in part be attributed to high sulfide concentrations and low oxygen levels. Additionally, fatty acid elongation was also prominent in H. hermesi confirming the importance of highly unsaturated fatty acids in this species. Significant higher amounts of transcription factors and genes involved in signaling receptor activity were observed in GD1 (many of which were completely absent in H. hermesi), allowing fast signaling and transcriptional reprogramming which can mediate survival in dynamic intertidal environments. GC content was approximately 8% higher in H. hermesi coding unigenes resulting in differential codon usage between both species and a higher proportion of amino acids with GC-rich codons in H. hermesi. In general our results showed that most pathways were active in both environments and that only three genes are under natural selection. This indicates that also plasticity should be taken in consideration in the evolutionary history of Halomonhystera species. Such plasticity, as well as possible
Bacterial Identification Using Light Scattering Measurements: a Preliminary Report
NASA Technical Reports Server (NTRS)
Wilkins, J. R.
1971-01-01
The light scattering properties of single bacterial cells were examined as a possible means of identification. Three species were studied with streptococcus faecalis exhibiting a unique pattern; the light-scattering traces for staphylococcus aureus and escherichia coli were quite similar although differences existed. Based on preliminary investigations, the light scattering approach appeared promising with additional research needed to include a wide variety of bacterial species, computer capability to handle and analyze data, and expansion of light scattering theory to include bacterial cells.
Modeling bacterial contamination of fuel ethanol fermentation.
Bischoff, Kenneth M; Liu, Siqing; Leathers, Timothy D; Worthington, Ronald E; Rich, Joseph O
2009-05-01
The emergence of antibiotic-resistant bacteria may limit the effectiveness of antibiotics to treat bacterial contamination in fuel ethanol plants, and therefore, new antibacterial intervention methods and tools to test their application are needed. Using shake-flask cultures of Saccharomyces cerevisiae grown on saccharified corn mash and strains of lactic acid bacteria isolated from a dry-grind ethanol facility, a simple model to simulate bacterial contamination and infection was developed. Challenging the model with 10(8) CFU/mL Lactobacillus fermentum decreased ethanol yield by 27% and increased residual glucose from 6.2 to 45.5 g/L. The magnitude of the effect was proportional to the initial bacterial load, with 10(5) CFU/mL L. fermentum still producing an 8% decrease in ethanol and a 3.2-fold increase in residual glucose. Infection was also dependent on the bacterial species used to challenge the fermentation, as neither L. delbrueckii ATCC 4797 nor L. amylovorus 0315-7B produced a significant decrease in ethanol when inoculated at a density of 10(8) CFU/mL. In the shake-flask model, treatment with 2 microg/mL virginiamycin mitigated the infection when challenged with a susceptible strain of L. fermentum (MIC for virginiamycin < or =2 ppm), but treatment was ineffective at treating infection by a resistant strain of L. fermentum (MIC = 16 ppm). The model may find application in developing new antibacterial agents and management practices for use in controlling contamination in the fuel ethanol industry. Copyright 2008 Wiley Periodicals, Inc.
The hydroxyl species and acid sites on diatomite surface: a combined IR and Raman study
NASA Astrophysics Data System (ADS)
Yuan, P.; Wu, D. Q.; He, H. P.; Lin, Z. Y.
2004-04-01
Diffuse reflectance infrared Fourier transform spectroscopy (DRIFT), Raman spectroscopy of adsorbed pyridine molecules (Py-Raman) and in situ Py-IR have been used to investigate the hydroxyl species and acid sites on diatomite surfaces. The Lewis (L) and Brønsted (B) acid sites, and various hydroxyl species, including isolated hydroxyl groups, H-bonded hydroxyl groups and physically adsorbed water, are identified. The L acid sites in diatomite samples are resulted from the clay impurities, and the B acid sites are resulted from some moderate strength H-bonded hydroxyl groups. At room temperature, both of the isolated and H-bonded silanols associate with the physically adsorbed water by hydrogen bond. After calcination treatment, physically adsorbed water will be desorbed from the silanols, and the silanols will condense with the increase of temperature. Generally, the H-bonded silanols condense more easily than the isolated ones. The properties of surface hydroxyl species of diatomaceous silica are more similar to precipitated silica rather than fumed silica.
Sarker, Shafiqul A; Ahmed, Tahmeed; Brüssow, Harald
2017-09-01
Underproduction of hydrochloric acid into the stomach is frequently encountered in subjects from developing countries. We explore the hypothesis that hypochlorhydria compromises the gastric barrier and favours bacterial overgrowth in the proximal parts of the small intestine where nutrient absorption takes place. Food calories are thus deviated into bacterial metabolism. In addition to an adequate caloric supply, correcting hypochlorhydria might be needed to decrease childhood malnutrition. © 2017 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.
Periodic growth of bacterial colonies
NASA Astrophysics Data System (ADS)
Yamazaki, Yoshihiro; Ikeda, Takemasa; Shimada, Hirotoshi; Hiramatsu, Fumiko; Kobayashi, Naoki; Wakita, Jun-ichi; Itoh, Hiroto; Kurosu, Sayuri; Nakatsuchi, Michio; Matsuyama, Tohey; Matsushita, Mitsugu
2005-06-01
The formation of concentric ring colonies by bacterial species Bacillus subtilis and Proteus mirabilis has been investigated experimentally, focusing our attention on the dependence of local cell density upon the bacterial motility. It has been confirmed that these concentric ring colonies reflect the periodic change of the bacterial motility between motile cell state and immotile cell state. We conclude that this periodic change is macroscopically determined neither by biological factors (i.e., biological clock) nor by chemical factors (chemotaxis as inhibitor). And our experimental results strongly suggest that the essential factor for the change of the bacterial motility during concentric ring formation is the local cell density.
Effect of Weak Magnetic Field on Bacterial Growth
NASA Astrophysics Data System (ADS)
Masood, Samina
Effects of weak magnetic fields are observed on the growth of various bacterial strains. Different sources of a constant magnetic field are used to demonstrate that ion transport in the nutrient broth and bacterial cellular dynamics is perturbed in the presence of weak magnetic field which affects the mobility and absorption of nutrients in cells and hence their doubling rate. The change is obvious after a few hours of exposure and keeps on increasing with time for all the observed species. The growth rate depends on the field strength and the nature of the magnetic field. The field effect varies with the shape and the structure of the bacterial cell wall as well as the concentration of nutrient broth. We closely study the growth of three species Escherichia coli, Pseudomonas aeruginosa and Staphylococcus epidermidis with the same initial concentrations at the same temperature in the same laboratory environment. Our results indicate that the weak static field of a few gauss after a few hours gives a measurable change in the growth rates of all bacterial species. This shows that the same magnetic field has different effects on different species in the same environment.
The intrinsic resistome of bacterial pathogens
Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B. Sanchez, Maria; Martinez, Jose L.
2013-01-01
Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice. PMID:23641241
The intrinsic resistome of bacterial pathogens.
Olivares, Jorge; Bernardini, Alejandra; Garcia-Leon, Guillermo; Corona, Fernando; B Sanchez, Maria; Martinez, Jose L
2013-01-01
Intrinsically resistant bacteria have emerged as a relevant health problem in the last years. Those bacterial species, several of them with an environmental origin, present naturally low-level susceptibility to several drugs. It has been proposed that intrinsic resistance is mainly the consequence of the impermeability of cellular envelopes, the activity of multidrug efflux pumps or the lack of appropriate targets for a given family of drugs. However, recently published articles indicate that the characteristic phenotype of susceptibility to antibiotics of a given bacterial species depends on the concerted activity of several elements, what has been named as intrinsic resistome. These determinants comprise not just classical resistance genes. Other elements, several of them involved in basic bacterial metabolic processes, are of relevance for the intrinsic resistance of bacterial pathogens. In the present review we analyze recent publications on the intrinsic resistomes of Escherichia coli and Pseudomonas aeruginosa. We present as well information on the role that global regulators of bacterial metabolism, as Crc from P. aeruginosa, may have on modulating bacterial susceptibility to antibiotics. Finally, we discuss the possibility of searching inhibitors of the intrinsic resistome in the aim of improving the activity of drugs currently in use for clinical practice.
Relationship of periodontal clinical parameters with bacterial composition in human dental plaque.
Fujinaka, Hidetake; Takeshita, Toru; Sato, Hirayuki; Yamamoto, Tetsuji; Nakamura, Junji; Hase, Tadashi; Yamashita, Yoshihisa
2013-06-01
More than 600 bacterial species have been identified in the oral cavity, but only a limited number of species show a strong association with periodontitis. The purpose of the present study was to provide a comprehensive outline of the microbiota in dental plaque related to periodontal status. Dental plaque from 90 subjects was sampled, and the subjects were clustered based on bacterial composition using the terminal restriction fragment length polymorphism of 16S rRNA genes. Here, we evaluated (1) periodontal clinical parameters between clusters; (2) the correlation of subgingival bacterial composition with supragingival bacterial composition; and (3) the association between bacterial interspecies in dental plaque using a graphical Gaussian model. Cluster 1 (C1) having high prevalence of pathogenic bacteria in subgingival plaque showed increasing values of the parameters. The values of the parameters in Cluster 2a (C2a) having high prevalence of non-pathogenic bacteria were markedly lower than those in C1. A cluster having low prevalence of non-pathogenic bacteria in supragingival plaque showed increasing values of the parameters. The bacterial patterns between subgingival plaque and supragingival plaque were significantly correlated. Chief pathogens, such as Porphyromonas gingivalis, formed a network with other pathogenic species in C1, whereas a network of non-pathogenic species, such as Rothia sp. and Lautropia sp., tended to compete with a network of pathogenic species in C2a. Periodontal status relates to non-pathogenic species as well as to pathogenic species, suggesting that the bacterial interspecies connection affects dental plaque virulence.
Bacterial RecA Protein Promotes Adenoviral Recombination during In Vitro Infection
Lee, Jeong Yoon; Lee, Ji Sun; Materne, Emma C.; Rajala, Rahul; Ismail, Ashrafali M.; Seto, Donald; Dyer, David W.
2018-01-01
ABSTRACT Adenovirus infections in humans are common and sometimes lethal. Adenovirus-derived vectors are also commonly chosen for gene therapy in human clinical trials. We have shown in previous work that homologous recombination between adenoviral genomes of human adenovirus species D (HAdV-D), the largest and fastest growing HAdV species, is responsible for the rapid evolution of this species. Because adenovirus infection initiates in mucosal epithelia, particularly at the gastrointestinal, respiratory, genitourinary, and ocular surfaces, we sought to determine a possible role for mucosal microbiota in adenovirus genome diversity. By analysis of known recombination hot spots across 38 human adenovirus genomes in species D (HAdV-D), we identified nucleotide sequence motifs similar to bacterial Chi sequences, which facilitate homologous recombination in the presence of bacterial Rec enzymes. These motifs, referred to here as ChiAD, were identified immediately 5′ to the sequence encoding penton base hypervariable loop 2, which expresses the arginine-glycine-aspartate moiety critical to adenoviral cellular entry. Coinfection with two HAdV-Ds in the presence of an Escherichia coli lysate increased recombination; this was blocked in a RecA mutant strain, E. coli DH5α, or upon RecA depletion. Recombination increased in the presence of E. coli lysate despite a general reduction in viral replication. RecA colocalized with viral DNA in HAdV-D-infected cell nuclei and was shown to bind specifically to ChiAD sequences. These results indicate that adenoviruses may repurpose bacterial recombination machinery, a sharing of evolutionary mechanisms across a diverse microbiota, and unique example of viral commensalism. IMPORTANCE Adenoviruses are common human mucosal pathogens of the gastrointestinal, respiratory, and genitourinary tracts and ocular surface. Here, we report finding Chi-like sequences in adenovirus recombination hot spots. Adenovirus coinfection in the
Wang, Fan; Zhao, Hongwei; Xiang, Haiying; Wu, Lijun; Men, Xiao; Qi, Chang; Chen, Guoqiang; Zhang, Haibo; Wang, Yi; Xian, Mo
2018-06-05
Microbes on aging flue-cured tobaccos (ATFs) improve the aroma and other qualities desirable in products. Understanding the relevant organisms would picture microbial community diversity, metabolic potential, and their applications. However, limited efforts have been made on characterizing the microbial quality and functional profiling. Herein, we present our investigation of the bacterial diversity and predicted potential genetic capability of the bacteria from two AFTs using 16S rRNA gene sequences and phylogenetic investigation of communities by reconstruction of unobserved states (PICRUSt) software. The results show that dominant bacteria from AFT surfaces were classified into 48 genera, 36 families, and 7 phyla. In addition, Bacillus spp. was found prevalent on both ATFs. Furthermore, PICRUSt predictions of bacterial community functions revealed many attractive metabolic capacities in the AFT microbiota, including several involved in the biosynthesis of flavors and fragrances and the degradation of harmful compounds, such as nicotine and nitrite. These results provide insights into the importance of AFT bacteria in determining product qualities and indicate specific microbial species with predicted enzymatic capabilities for the production of high-efficiency flavors, the degradation of undesirable compounds, and the provision of nicotine and nitrite tolerance which suggest fruitful areas of investigation into the manipulation of AFT microbiota for AFT and other product improvements.
Culture-independent analysis of lactic acid bacteria diversity associated with mezcal fermentation.
Narváez-Zapata, J A; Rojas-Herrera, R A; Rodríguez-Luna, I C; Larralde-Corona, C P
2010-11-01
Mezcal is an alcoholic beverage obtained from the distillation of fermented juices of cooked Agave spp. plant stalks (agave must), and each region in Mexico with denomination of origin uses defined Agave species to prepare mezcal with unique organoleptic characteristics. During fermentation to produce mezcal in the state of Tamaulipas, not only alcohol-producing yeasts are involved, but also a lactic acid bacterial community that has not been characterized yet. In order to address this lack of knowledge on this traditional Mexican beverage, we performed a DGGE-16S rRNA analysis of the lactic acid bacterial diversity and metabolite accumulation during the fermentation of a typical agave must that is rustically produced in San Carlos County (Tamaulipas, Mexico). The analysis of metabolite production indicated a short but important malolactic fermentation stage not previously described for mezcal. The denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA genes showed a distinctive lactic acid bacterial community composed mainly of Pediococcus parvulus, Lactobacillus brevis, Lactobacillus composti, Lactobacillus parabuchneri, and Lactobacillus plantarum. Some atypical genera such as Weissella and Bacillus were also found in the residual must. Our results suggest that the lactic acid bacteria could strongly be implicated in the organoleptic attributes of this traditional Mexican distilled beverage.
Jellyfish modulate bacterial dynamic and community structure.
Tinta, Tinkara; Kogovšek, Tjaša; Malej, Alenka; Turk, Valentina
2012-01-01
Jellyfish blooms have increased in coastal areas around the world and the outbreaks have become longer and more frequent over the past few decades. The Mediterranean Sea is among the heavily affected regions and the common bloom-forming taxa are scyphozoans Aurelia aurita s.l., Pelagia noctiluca, and Rhizostoma pulmo. Jellyfish have few natural predators, therefore their carcasses at the termination of a bloom represent an organic-rich substrate that supports rapid bacterial growth, and may have a large impact on the surrounding environment. The focus of this study was to explore whether jellyfish substrate have an impact on bacterial community phylotype selection. We conducted in situ jellyfish-enrichment experiment with three different jellyfish species. Bacterial dynamic together with nutrients were monitored to assess decaying jellyfish-bacteria dynamics. Our results show that jellyfish biomass is characterized by protein rich organic matter, which is highly bioavailable to 'jellyfish-associated' and 'free-living' bacteria, and triggers rapid shifts in bacterial population dynamics and composition. Based on 16S rRNA clone libraries and denaturing gradient gel electrophoresis (DGGE) analysis, we observed a rapid shift in community composition from unculturable Alphaproteobacteria to culturable species of Gammaproteobacteria and Flavobacteria. The results of sequence analyses of bacterial isolates and of total bacterial community determined by culture independent genetic analysis showed the dominance of the Pseudoalteromonadaceae and the Vibrionaceae families. Elevated levels of dissolved proteins, dissolved organic and inorganic nutrient release, bacterial abundance and carbon production as well as ammonium concentrations characterized the degradation process. The biochemical composition of jellyfish species may influence changes in the amount of accumulated dissolved organic and inorganic nutrients. Our results can contribute insights into possible changes in
Key determinants of the fungal and bacterial microbiomes in homes.
Kettleson, Eric M; Adhikari, Atin; Vesper, Stephen; Coombs, Kanistha; Indugula, Reshmi; Reponen, Tiina
2015-04-01
The microbiome of the home is of great interest because of its possible impact on health. Our goal was to identify some of the factors that determine the richness, evenness and diversity of the home's fungal and bacterial microbiomes. Vacuumed settled dust from homes (n=35) in Cincinnati, OH, were analyzed by pyrosequencing to determine the fungal and bacterial relative sequence occurrence. The correlation coefficients between home environmental characteristics, including age of home, Environmental Relative Moldiness Index (ERMI) values, occupant number, relative humidity and temperature, as well as pets (dog and cat) were evaluated for their influence on fungal and bacterial communities. In addition, linear discriminant analysis (LDA) was used for identifying fungal and bacterial genera and species associated with those housing determinants found to be significant. The fungal richness was found to be positively correlated with age of home (p=0.002), ERMI value (p=0.003), and relative humidity (p=0.015) in the home. However, fungal evenness and diversity were only correlated with the age of home (p=0.001). Diversity and evenness (not richness) of the bacterial microbiome in the homes were associated with dog ownership. Linear discriminant analysis showed total of 39 putative fungal genera/species with significantly higher LDA scores in high ERMI homes and 47 genera/species with significantly higher LDA scores in homes with high relative humidity. When categorized according to the age of the home, a total of 67 fungal genera/species had LDA scores above the significance threshold. Dog ownership appeared to have the most influence on the bacterial microbiome, since a total of 130 bacterial genera/species had significantly higher LDA scores in homes with dogs. Some key determinants of the fungal and bacterial microbiome appear to be excess moisture, age of the home and dog ownership. Copyright © 2015 Elsevier Inc. All rights reserved.
Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung
2017-06-01
Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.
Ramond, Jean-Baptiste; Lako, Joseph D W; Stafford, William H L; Tuffin, Marla I; Cowan, Don A
2015-08-01
Ammonia-oxidizing bacteria (AOB) are essential in the biogeochemical cycling of nitrogen as they catalyze the rate-limiting oxidation of ammonia into nitrite. Since their first isolation in the late 19th century, chemolithoautotrophic AOBs have been identified in a wide range of natural (e.g., soils, sediments, estuarine, and freshwaters) and man created or impacted habitats (e.g., wastewater treatment plants and agricultural soils). However, little is known on the plant-species association of AOBs, particularly in the nutrient-starved fynbos terrestrial biome. In this study, we evaluated the diversity of AOBs in the plant canopy of three South African fynbos-specific plant species, namely Leucadendron xanthoconus, Leucospermum truncatulum and Leucadendron microcephalum, through the construction of amoA-gene clone libraries. Our results clearly demonstrate that plant-species specific and monophyletic AOB clades are present in fynbos canopy soils. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Novel Species of Non-Spore-Forming Bacteria
NASA Technical Reports Server (NTRS)
Briegel, Ariane; Osman, Shariff; Moissl, Christine; Hosoya,Naofumi; Venkateswaran, Kasthuri; Satomi, Masataka; Mayilraj, Shanmugam
2008-01-01
While cataloging cultivatable microbes from the airborne biological diversity of the atmosphere of the Regenerative Enclosed life-support Module Simulator (REMS) system at Marshall Space Flight Center, two strains that belong to one novel bacterial species were isolated. Based on 16S rRNA gene sequencing and the unique morphology and the taxonomic characteristics of these strains, it is shown that they belong to the family Intrasporangiaceae, related to the genus Tetrasphaera, with phylogenetic distances from any validly described species of the genus Tetrasphaera ranging from 96.71 to 97.76 percent. The fatty acid profile supported the affiliation of these novel strains to the genus Tetrasphaera except for the presence of higher concentrations of octadecenoic acid (C18:0) and cis-9-octadecenoic acid (C18:1), which discriminates these strains from other valid species. In addition, DNA-DNA hybridization studies indicate that these strains belong to a novel species that could be readily distinguished from its nearest neighbor, Tetrasphaera japonica AMC 5116T, with less than 20 percent DNA relatedness. Physiological and biochemical tests show few phenotypic dissimilarities, but genotypic analysis allowed the differentiation of these gelatin-liquefying strains from previously reported strains. The name Tetrasphaera remsis sp. Nov. is proposed with the type strain 3-M5-R-4(sup T) (=ATCC BAA-1496(sup T)=CIP 109413(sup T). The cells are Gram-positive, nonmotile, cocci, in tetrad arrangement and clusters. Spore formation is not observed. No species of Tetrashpaera has ever been isolated from airborne samples. Previous discoveries have come from soil and activated sludge samples. As other species of this genus have demonstrated enhanced biological phosphorus removal activity, further tests are required to determine if this newly discovered species would have bioremediation applications.
Henderson, R J; Millar, R M; Sargent, J R
1995-02-01
Phosphatidylethanolamine (PE) and phosphatidylglycerol (PG) were isolated from a Vibrio species of bacterium, known to produce eicosapentaenoic acid (20:5n-3) and trans-hexadecenoic acid (16:1n-7), and subjected to phospholipase A2 degradation to determine the positional distribution of component fatty acids. At the two growth temperatures studied (20 and 5 degrees C), both 20:5n-3 and trans 16:1 n-7 were located mainly at position sn-2 in PE. Increases in the proportions of 20:5n-3 and trans 16:1n-7 in position sn-2 with decreasing growth temperature were balanced mainly by decreases in the level of iso-15:0. In PG, trans 16:1n-7 was located predominantly in position sn-1, although the difference between the two positions was not as great as in PE. Eicosapentaenoic acid was preferentially located in position sn-2 of PG, particularly at 5 degrees C when it comprised 29.9% of the total fatty acids in this position. It is concluded that trans 16:1n-7/20:5n-3 is not a major molecular species of phospholipid in this species of Vibrio and that changes in the levels of molecular species of PE containing iso-15:0 may feature in thermal acclimation.
Broad spectrum microarray for fingerprint-based bacterial species identification
2010-01-01
Background Microarrays are powerful tools for DNA-based molecular diagnostics and identification of pathogens. Most target a limited range of organisms and are based on only one or a very few genes for specific identification. Such microarrays are limited to organisms for which specific probes are available, and often have difficulty discriminating closely related taxa. We have developed an alternative broad-spectrum microarray that employs hybridisation fingerprints generated by high-density anonymous markers distributed over the entire genome for identification based on comparison to a reference database. Results A high-density microarray carrying 95,000 unique 13-mer probes was designed. Optimized methods were developed to deliver reproducible hybridisation patterns that enabled confident discrimination of bacteria at the species, subspecies, and strain levels. High correlation coefficients were achieved between replicates. A sub-selection of 12,071 probes, determined by ANOVA and class prediction analysis, enabled the discrimination of all samples in our panel. Mismatch probe hybridisation was observed but was found to have no effect on the discriminatory capacity of our system. Conclusions These results indicate the potential of our genome chip for reliable identification of a wide range of bacterial taxa at the subspecies level without laborious prior sequencing and probe design. With its high resolution capacity, our proof-of-principle chip demonstrates great potential as a tool for molecular diagnostics of broad taxonomic groups. PMID:20163710
Lebaron, P; Servais, P; Agogué, H; Courties, C; Joux, F
2001-04-01
The nucleic acid contents of individual bacterial cells as determined with three different nucleic acid-specific fluorescent dyes (SYBR I, SYBR II, and SYTO 13) and flow cytometry were compared for different seawater samples. Similar fluorescence patterns were observed, and bacteria with high apparent nucleic acid contents (HNA) could be discriminated from bacteria with low nucleic acid contents (LNA). The best discrimination between HNA and LNA cells was found when cells were stained with SYBR II. Bacteria in different water samples collected from seven freshwater, brackish water, and seawater ecosystems were prelabeled with tritiated leucine and then stained with SYBR II. After labeling and staining, HNA, LNA, and total cells were sorted by flow cytometry, and the specific activity of each cellular category was determined from leucine incorporation rates. The HNA cells were responsible for most of the total bacterial production, and the specific activities of cells in the HNA population varied between samples by a factor of seven. We suggest that nucleic acid content alone can be a better indicator of the fraction of growing cells than total counts and that this approach should be combined with other fluorescent physiological probes to improve detection of the most active cells in aquatic systems.
Lebaron, Philippe; Servais, Pierre; Agogué, Helene; Courties, Claude; Joux, Fabien
2001-01-01
The nucleic acid contents of individual bacterial cells as determined with three different nucleic acid-specific fluorescent dyes (SYBR I, SYBR II, and SYTO 13) and flow cytometry were compared for different seawater samples. Similar fluorescence patterns were observed, and bacteria with high apparent nucleic acid contents (HNA) could be discriminated from bacteria with low nucleic acid contents (LNA). The best discrimination between HNA and LNA cells was found when cells were stained with SYBR II. Bacteria in different water samples collected from seven freshwater, brackish water, and seawater ecosystems were prelabeled with tritiated leucine and then stained with SYBR II. After labeling and staining, HNA, LNA, and total cells were sorted by flow cytometry, and the specific activity of each cellular category was determined from leucine incorporation rates. The HNA cells were responsible for most of the total bacterial production, and the specific activities of cells in the HNA population varied between samples by a factor of seven. We suggest that nucleic acid content alone can be a better indicator of the fraction of growing cells than total counts and that this approach should be combined with other fluorescent physiological probes to improve detection of the most active cells in aquatic systems. PMID:11282632
Gamma-irradiated bacterial preparation having anti-tumor activity
Vass, Arpad A.; Tyndall, Richard L.; Terzaghi-Howe, Peggy
1999-01-01
A bacterial preparation from Pseudomonas species isolated #15 ATCC 55638 that has been exposed to gamma radiation exhibits cytotoxicity that is specific for neoplastic carcinoma cells. A method for obtaining a bacterial preparation having antitumor activity consists of suspending a bacterial isolate in media and exposing the suspension to gamma radiation. A bacterial preparation of an aged culture of an amoeba-associated bacteria exhibits anti-reverse transcriptase activity. A method for obtaining a bacterial preparation having anti-reverse transcriptase activity from an amoeba-associated bacterial isolate grown to stationary phase is disclosed.
Long, M; Feng, W J; Li, P; Zhang, Y; He, R X; Yu, L H; He, J B; Jing, W Y; Li, Y M; Wang, Z; Liu, G W
2014-02-01
The aim of this study was to examine the effects of the acid-tolerant engineered bacterial strain Megasphaera elsdenii H6F32 (M. elsdenii H6F32) on ruminal pH and the lactic acid concentrations in simulated rumen acidosis conditions in vitro. A mixed culture of ruminal bacteria, buffer, and primarily degradable substrates was inoculated with equal numbers of M. elsdenii H6 or M. elsdenii H6F32. The pH and lactic acid concentrations in the mixed culture were determined at 0, 2, 4, 6, 8, 10, 12, 14, 16, and 18 h of incubation. Acid-tolerant M. elsdenii H6F32 reduced the accumulation of lactic acid and increased the pH value. These results indicate that acid-tolerant M. elsdenii H6F32 could be a potential candidate for preventing rumen acidosis. Copyright © 2013 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bisessar, S.; Palmer, K.T.; Kuja, A.L.
Ambient rain in southern Ontario has a volume-weighted average pH of approximately 4.2. Tomato (Lycopersicon esculentum Mill var. 'Chico III') seedlings were exposed to simulated acidic rain in specially designed chambers. The inoculum of Pseudomonas tomato (Okabe) Alstatt, causal agent of bacterial speck, was sprayed on plants before or after exposure to acidic rain of pH 2.5, 3.5, and 4.5, as well as on plants not exposed to the simulated acidic rain. Speck symptoms (small, dark, brown spots with yellow halos) were found on all inoculated plants. Exposure of plants to simulted acidic rain inhibited speck development, but the inhibitionmore » was greater on plants exposed to acidic rain after inoculation. Spot necrosis, a typical response to acid rain, occurred on up to 15 to 20% of the leaf area on all tomato plants treated with acidic rain at pH 2.5. Plants alos showed a decrease in growth (height and fresh and dry weights) with an increase in rain acidity. Leaves injured by simulated acidic rain and examined histopathologically displayed cellular malformations including hyperplasia and hypertrophy. Pseudomonas tomato failed to grow on acidified King B medium or Difco nutrient broth adjusted to pH 3.5 or lower.« less
Non-methylene-interrupted fatty acids with Δ5 unsaturation in Sargassum species.
Kim, Gwang-Woo; Itabashi, Yutaka
2012-01-01
Detailed fatty acid compositions of five species of the brown algae Sargassum (S. fulvellum, S. horneri, S. boreale, S. thunbergii, and S. yezoense) were determined using silver ion solid phase extraction, gas chromatography (GC), and GC-mass spectrometry (GC-MS) techniques. In addition to a high number of typical saturated and unsaturated fatty acids, the GC-MS spectra of the 4,4-dimethyloxazoline derivatives of fatty acids revealed the occurrence of small amounts of unusual non-methylene-interrupted (NMI) fatty acids with Δ5 unsaturation, namely, 5,9-eicosadienoic (5,9-20:2), 5,11,14-eicosatrienoic (5,11,14-20:3), and 5,11,14,17-eicosatetraenoic (5,11,14,17-20:4) acids. Of these three NMI acids, the 5,9-20:2 acid was found to be the most abundant (0.4%-2.3% of the total fatty acids) and was detected for the first time in algae.
Jiang, Tieshan; Mandal, Rabindra K.; Wideman, Robert F.; Khatiwara, Anita; Pevzner, Igal; Min Kwon, Young
2015-01-01
Bacterial chondronecrosis with osteomyelitis (BCO) is recognized as an important cause of lameness in commercial broiler chickens (meat-type chickens). Relatively little is known about the microbial communities associated with BCO. This study was conducted to increase our understanding of the microbial factors associated with BCO using a culture-independent approach. Using Illumina sequencing of the hyper-variable region V6 in the 16S rRNA gene, we characterized the bacterial communities in 97 femoral or tibial heads from normal and lame broilers carefully selected to represent diverse variations in age, line, lesion type, floor type, clinical status and bone type. Our in-depth survey based on 14 million assembled sequence reads revealed that complex bacterial communities exist in all samples, including macroscopically normal bones from clinically healthy birds. Overall, Proteobacteria (mean 90.9%) comprised the most common phylum, followed by Firmicutes (6.1%) and Actinobacteria (2.6%), accounting for more than 99% of all reads. Statistical analyses demonstrated that there are differences in bacterial communities in different types of bones (femur vs. tibia), lesion types (macroscopically normal femora or tibiae vs. those with pathognomonic BCO lesions), and among individual birds. This analysis also showed that BCO samples overrepresented genera Staphylococcus, whose species have been frequently isolated in BCO samples in previous studies. Rarefaction analysis demonstrated the general tendency that increased severities of BCO lesions were associated with reduced species diversity in both femoral and tibial samples when compared to macroscopically normal samples. These observations suggest that certain bacterial subgroups are preferentially selected in association with the development of BCO lesions. Understanding the microbial species associated with BCO will identify opportunities for understanding and modulating the pathogenesis of this form of lameness in
Fatty acid composition of Juniperus species (Juniperus section) native to Turkey.
Güvenç, Aysegül; Küçükboyaci, Nurgün; Gören, Ahmet Ceyhan
2012-07-01
Fatty acid compositions of seeds of five taxa of the Juniperus section of the genus Juniperus L. (Cupressaceae), i. e. J. drupacea Lab., J. communis L. var. communis, J. communis var. saxatilis Pall., J. oxycedrus L. subsp. oxycedrus, and J. oxycedrus subsp. macrocarpa (Sibth. & Sm.) Ball, were investigated. Methyl ester derivatized fatty acids of the lipophylic extracts of the five species were comparatively analyzed by capillary gas chromatography-mass spectrometry (GC-MS). Juniperus taxa showed uniform fatty acid patterns, among which linoleic (25.8 - 32.5%), pinolenic (11.9 - 24.1%) and oleic acids (12.4 - 17.2%) were determined to be the main fractions in the seed oils. Juniperonic acid was found to be remarkably high in J. communis var. saxatilis (11.4%), J. oxycedrus subsp. oxycedrus (10.4%), and J. communis var. communis (10.1%). To the best of our knowledge, the present work discloses the first report on the fatty acid compositions of seeds of this Juniperus section grown in Turkey.
Repairing oxidized proteins in the bacterial envelope using respiratory chain electrons.
Gennaris, Alexandra; Ezraty, Benjamin; Henry, Camille; Agrebi, Rym; Vergnes, Alexandra; Oheix, Emmanuel; Bos, Julia; Leverrier, Pauline; Espinosa, Leon; Szewczyk, Joanna; Vertommen, Didier; Iranzo, Olga; Collet, Jean-François; Barras, Frédéric
2015-12-17
The reactive species of oxygen and chlorine damage cellular components, potentially leading to cell death. In proteins, the sulfur-containing amino acid methionine is converted to methionine sulfoxide, which can cause a loss of biological activity. To rescue proteins with methionine sulfoxide residues, living cells express methionine sulfoxide reductases (Msrs) in most subcellular compartments, including the cytosol, mitochondria and chloroplasts. Here we report the identification of an enzymatic system, MsrPQ, repairing proteins containing methionine sulfoxide in the bacterial cell envelope, a compartment particularly exposed to the reactive species of oxygen and chlorine generated by the host defence mechanisms. MsrP, a molybdo-enzyme, and MsrQ, a haem-binding membrane protein, are widely conserved throughout Gram-negative bacteria, including major human pathogens. MsrPQ synthesis is induced by hypochlorous acid, a powerful antimicrobial released by neutrophils. Consistently, MsrPQ is essential for the maintenance of envelope integrity under bleach stress, rescuing a wide series of structurally unrelated periplasmic proteins from methionine oxidation, including the primary periplasmic chaperone SurA. For this activity, MsrPQ uses electrons from the respiratory chain, which represents a novel mechanism to import reducing equivalents into the bacterial cell envelope. A remarkable feature of MsrPQ is its capacity to reduce both rectus (R-) and sinister (S-) diastereoisomers of methionine sulfoxide, making this oxidoreductase complex functionally different from previously identified Msrs. The discovery that a large class of bacteria contain a single, non-stereospecific enzymatic complex fully protecting methionine residues from oxidation should prompt a search for similar systems in eukaryotic subcellular oxidizing compartments, including the endoplasmic reticulum.
Kalaycıoğlu, Zeynep; Uzaşçı, Sesil; Dirmenci, Tuncay; Erim, F Bedia
2018-06-05
During the last decade, ursolic and oleanolic acids have been of considerable interest because of their α-glucosidase inhibitory activities and potential effects for treatment of type 2 diabetes. A simple and sensitive reversed-phase HPLC method was developed for the simultaneous determination of ursolic acid and oleanolic acid. The optimal mobile phase was selected as 85% acetonitrile solution. The limit of detection of the method for ursolic acid and oleanolic acid were 14 ng mL -1 and 13 ng mL -1 , respectively. The method showed good precision and accuracy with intra-day and inter-day variations of 0.54% and 7.33% for ursolic acid, intra-day and inter-day variations of 0.51% and 5.26% for oleanolic acid, and overall recoveries of 97.8% and 98.5% for ursolic acid and oleanolic acid, respectively. Application of the method to determine the ursolic acid and oleanolic acid contents in the Salvia species revealed both compounds, with varying amounts between 0.21-9.76 mg g -1 ursolic acid and 0.20-12.7 mg g -1 oleanolic acid, respectively, among 14 Salvia species analyzed. Additionally, the plant extracts were analyzed for their inhibitory activities on α-glucosidase. According to the results of this assay, the extracts showed considerable activity on α-glucosidase with IC 50 values from 17.6 to 173 μg mL -1 . A strong negative correlation was detected between the amounts of both acids and IC 50 values of extracts. Anatolian Salvia species have great potential as functional plants in the management of diabetes. Copyright © 2018 Elsevier B.V. All rights reserved.
Papalexandratou, Zoi; Camu, Nicholas; Falony, Gwen; De Vuyst, Luc
2011-08-01
To compare the spontaneous cocoa bean fermentation process carried out in different cocoa-producing regions, heap and box (one Ivorian farm) and box (two Brazilian farms) fermentations were carried out. All fermentations were studied through a multiphasic approach. In general, the temperature inside the fermenting mass increased throughout all fermentations and reached end-values of 42-48 °C. The main end-products of pulp carbohydrate catabolism were ethanol, lactic acid, acetic acid, and/or mannitol. In the case of the fermentations on the selected Ivorian farm, the species diversity of lactic acid bacteria (LAB) and acetic acid bacteria (AAB) was restricted. Lactobacillus fermentum and Leuconostoc pseudomesenteroides were the predominant LAB species, due to their ethanol and acid tolerance and citrate consumption. The levels of mannitol, ascribed to growth of L. fermentum, were fermentation-dependent. Also, enterobacterial species, such as Erwinia soli and Pantoea sp., were among the predominating microbiota during the early stages of both heap and box fermentations in Ivory Coast, which could be responsible for gluconic acid production. Consumption of gluconic acid at the initial phases of the Ivorian fermentations could be due to yeast growth. A wider microbial species diversity throughout the fermentation process was seen in the case of the box fermentations on the selected Brazilian farms, which differed, amongst other factors, regarding pod/bean selection on these farms as compared to fermentations on the selected Ivorian farm. This microbiota included Lactobacillus plantarum, Lactobacillus durianis, L. fermentum, Lactobacillus mali, Lactobacillus nagelii, L. pseudomesenteroides, and Pediococcus acidilactici, as well as Bacillus subtilis that was present at late fermentation, when the temperature inside the fermenting mass reached values higher than 50 °C. Moreover, AAB seemed to dominate the Brazilian box fermentations studied, explaining higher acetic
Dancing for Food in the Deep Sea: Bacterial Farming by a New Species of Yeti Crab
Thurber, Andrew R.; Jones, William J.; Schnabel, Kareen
2011-01-01
Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3rd maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins. PMID:22140426
Dancing for food in the deep sea: bacterial farming by a new species of Yeti crab.
Thurber, Andrew R; Jones, William J; Schnabel, Kareen
2011-01-01
Vent and seep animals harness chemosynthetic energy to thrive far from the sun's energy. While symbiont-derived energy fuels many taxa, vent crustaceans have remained an enigma; these shrimps, crabs, and barnacles possess a phylogenetically distinct group of chemosynthetic bacterial epibionts, yet the role of these bacteria has remained unclear. We test whether a new species of Yeti crab, which we describe as Kiwa puravida n. sp, farms the epibiotic bacteria that it grows on its chelipeds (claws), chelipeds that the crab waves in fluid escaping from a deep-sea methane seep. Lipid and isotope analyses provide evidence that epibiotic bacteria are the crab's main food source and K. puravida n. sp. has highly-modified setae (hairs) on its 3(rd) maxilliped (a mouth appendage) which it uses to harvest these bacteria. The ε- and γ- proteobacteria that this methane-seep species farms are closely related to hydrothermal-vent decapod epibionts. We hypothesize that this species waves its arm in reducing fluid to increase the productivity of its epibionts by removing boundary layers which may otherwise limit carbon fixation. The discovery of this new species, only the second within a family described in 2005, stresses how much remains undiscovered on our continental margins.
Falynskova, I N; Leonova, E I; Fedyakina, I T; Makhmudova, N R; Lepekha, L N; Mikhailova, N A; Rasnetsov, L D; Zverev, V V; Leneva, I A
2015-01-01
Study the effectiveness of the substance and various drug formulations of fullerene-(tris-aminocapronic acid) hydrate (FTAAH onwards) in the model of experimental viral-bacterial pneumonia of mice. BALB/c mice were infected with influenza virus A/California/04/2009 and subsequently infected with Staphylococcus aureus. The animals were treated after viral infection with the substance and various drug forms of FTAAH, as well as comparative preparations--oseltamivir and arbidol. Therapy effectiveness was evaluated by clinical indicators (survival, lifespan, animal mass decrease reduction), virological (virus titer), microbiological (density of bacteria in lungs) parameters, confirmed by pathomorphological characteristics of lungs. FTAAH therapy in injectable form was effective in the model of a combined viral-bacterial pneumonia of mice by all the studied criteria: treatment increased mice survival, reduced the decrease of their body weight, resulted in a reduction of virus titers and density of bacteria in lungs, that correlated with the data from morphological study and signs of bronchopneumonia resolution in mice. FTAAH therapy in rectal form depended on animal infection schemes, as well as preparation dose, increasing with its increase. FTAAH substance is effective in the model of experimental viral-bacterial pneumonia of mice.
Bacterial collagen-like proteins that form triple-helical structures
Yu, Zhuoxin; An, Bo; Ramshaw, John A.M.; Brodsky, Barbara
2014-01-01
A large number of collagen-like proteins have been identified in bacteria during the past ten years, principally from analysis of genome databases. These bacterial collagens share the distinctive Gly-Xaa-Yaa repeating amino acid sequence of animal collagens which underlies their unique triple-helical structure. A number of the bacterial collagens have been expressed in E. coli, and they all adopt a triple-helix conformation. Unlike animal collagens, these bacterial proteins do not contain the post-translationally modified amino acid, hydroxyproline, which is known to stabilize the triple-helix structure and may promote self-assembly. Despite the absence of collagen hydroxylation, the triple-helix structures of the bacterial collagens studied exhibit a high thermal stability of 35–39 °C, close to that seen for mammalian collagens. These bacterial collagens are readily produced in large quantities by recombinant methods, either in the original amino acid sequence or in genetically manipulated sequences. This new family of recombinant, easy to modify collagens could provide a novel system for investigating structural and functional motifs in animal collagens and could also form the basis of new biomedical materials with designed structural properties and functions. PMID:24434612
Wang, Xueqin; Cui, Hongyang; Shi, Jianhong; Zhao, Xinyu; Zhao, Yue; Wei, Zimin
2015-12-01
The aim of this study was to compare the bacterial structure of seven different composts. The primary environmental factors affecting bacterial species were identified, and a strategy to enhance the abundance of uncultured bacteria through controlling relevant environmental parameters was proposed. The results showed that the physical-chemical parameters of each different pile changed in its own manner during composting, which affected the structure and succession of bacteria in different ways. DGGE profiles showed that there were 10 prominent species during composting. Among them, four species existed in all compost types, two species existed in several piles and four species were detected in a single material. Redundancy analysis results showed that bacterial species compositions were significantly influenced by C/N and moisture (p<0.05). The optimal range of C/N was 14-27. Based on these results, the primary environmental factors affecting a certain species were further identified as a potential control of bacterial diversity. Copyright © 2015 Elsevier Ltd. All rights reserved.
Closely related intertidal and deep-sea Halomonhystera species have distinct fatty acid compositions
NASA Astrophysics Data System (ADS)
Van Campenhout, Jelle; Vanreusel, Ann
2017-01-01
The deep-sea free-living nematode Halomonhystera hermesi, dominant in the sulphidic sediments of the Håkon Mosby mud volcano (1280 m, Barent sea slope), is part of the mainly estuarine Halomonhystera disjuncta species complex consisting of five cryptic species (GD1-GD5). Cryptic species have a very similar morphology raising questions on their specific environmental differences. This study analyzed total fatty acid (FA) compositions of H. hermesi and GD1, one of H. hermesi's closest relatives. Additionally, we experimentally investigated the effect of a temperature reduction, salinity increase and sulphide concentrations on GD1's FA composition. Because nematodes are expected to have low amounts of storage FA, total FA compositions most likely reflect FA contents of cellular membranes. The deep-sea nematode H. hermesi had significantly lower saturation levels and increased highly unsaturated fatty acid (HUFAs) proportions due to the presence of docosahexanoic acid (DHA—22:6ω3) and higher eicosapentaenoic acid (EPA—20:5ω3) proportions. HUFAs were absent in H. hermesi's food source indicating the ability and need for this nematode to synthesize HUFAs in a deep-sea environment. Our experimental data revealed that only a decrease in temperature resulted in lower saturated fatty acids proportions, indicating that the FA content of H. hermesi is most likely a response to temperature but not to sulphide concentrations or salinity differences. In experimental nematodes, EPA proportions were low and DHA was absent indicating that other factors than temperature, salinity and sulphides mediate the presence of these HUFAs in H. hermesi.
Durack, Juliana; Lynch, Susan V; Nariya, Snehal; Bhakta, Nirav R; Beigelman, Avraham; Castro, Mario; Dyer, Anne-Marie; Israel, Elliot; Kraft, Monica; Martin, Richard J; Mauger, David T; Rosenberg, Sharon R; Sharp-King, Tonya; White, Steven R; Woodruff, Prescott G; Avila, Pedro C; Denlinger, Loren C; Holguin, Fernando; Lazarus, Stephen C; Lugogo, Njira; Moore, Wendy C; Peters, Stephen P; Que, Loretta; Smith, Lewis J; Sorkness, Christine A; Wechsler, Michael E; Wenzel, Sally E; Boushey, Homer A; Huang, Yvonne J
2017-07-01
Compositional differences in the bronchial bacterial microbiota have been associated with asthma, but it remains unclear whether the findings are attributable to asthma, to aeroallergen sensitization, or to inhaled corticosteroid treatment. We sought to compare the bronchial bacterial microbiota in adults with steroid-naive atopic asthma, subjects with atopy but no asthma, and nonatopic healthy control subjects and to determine relationships of the bronchial microbiota to phenotypic features of asthma. Bacterial communities in protected bronchial brushings from 42 atopic asthmatic subjects, 21 subjects with atopy but no asthma, and 21 healthy control subjects were profiled by using 16S rRNA gene sequencing. Bacterial composition and community-level functions inferred from sequence profiles were analyzed for between-group differences. Associations with clinical and inflammatory variables were examined, including markers of type 2-related inflammation and change in airway hyperresponsiveness after 6 weeks of fluticasone treatment. The bronchial microbiome differed significantly among the 3 groups. Asthmatic subjects were uniquely enriched in members of the Haemophilus, Neisseria, Fusobacterium, and Porphyromonas species and the Sphingomonodaceae family and depleted in members of the Mogibacteriaceae family and Lactobacillales order. Asthma-associated differences in predicted bacterial functions included involvement of amino acid and short-chain fatty acid metabolism pathways. Subjects with type 2-high asthma harbored significantly lower bronchial bacterial burden. Distinct changes in specific microbiota members were seen after fluticasone treatment. Steroid responsiveness was linked to differences in baseline compositional and functional features of the bacterial microbiome. Even in subjects with mild steroid-naive asthma, differences in the bronchial microbiome are associated with immunologic and clinical features of the disease. The specific differences identified
Pieper, Robert; Janczyk, Pawel; Zeyner, Annette; Smidt, Hauke; Guiard, Volker; Souffrant, Wolfgang Bernhard
2008-10-01
Weaning of the pig is generally regarded as a stressful event which could lead to clinical implications because of the changes in the intestinal ecosystem. The functional properties of microbiota inhabiting the pig's small intestine (SI), including lactobacilli which are assumed to exert health-promoting properties, are yet poorly described. Thus, we determined the ecophysiology of bacterial groups and within genus Lactobacillus in the SI of weaning piglets and the impact of dietary changes. The SI contents of 20 piglets, 4 killed at weaning (only sow milk and no creep feed) and 4 killed at 1, 2, 5, and 11 days post weaning (pw; cereal-based diet) were examined for bacterial cell count and bacterial metabolites by fluorescence in situ hybridization (FISH). Lactobacilli were the predominant group in the SI except at 1 day pw because of a marked reduction in their number. On day 11 pw, bifidobacteria and E. coli were not detected, and Enterobacteriaceae and members of the Clostridium coccoides/Eubacterium rectale cluster were only found occasionally. L. sobrius/L. amylovorus became dominant species whereas the abundance of L. salivarius and L. gasseri/johnsonii declined. Concentration of lactic acid increased pw whereas pH, volatile fatty acids, and ammonia decreased. Carbohydrate utilization of 76 Lactobacillus spp. isolates was studied revealing a shift from lactose and galactose to starch, cellobiose, and xylose, suggesting that the bacteria colonizing the SI of piglets adapt to the newly introduced nutrients during the early weaning period. Identification of isolates based on partial 16S rRNA gene sequence data and comparison with fermentation data furthermore suggested adaptation processes below the species level. The results of our study will help to understand intestinal bacterial ecophysiology and to develop nutritional regimes to prevent or counteract complications during the weaning transition.
Abd El Razak, Ahmed; Ward, Alan C; Glassey, Jarka
2014-02-01
Water samples from three different environments including Mid Atlantic Ridge, Red Sea and Mediterranean Sea were screened in order to isolate new polyunsaturated fatty acids (PUFAs) bacterial producers especially eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA). Two hundred and fifty-one isolates were screened for PUFA production and among them the highest number of producers was isolated from the Mid-Atlantic Ridge followed by the Red Sea while no producers were found in the Mediterranean Sea samples. The screening strategy included a simple colourimetric method followed by a confirmation via GC/MS. Among the tested producers, an isolate named 66 was found to be a potentially high PUFA producer producing relatively high levels of EPA in particular. A Plackett-Burman statistical design of experiments was applied to screen a wide number of media components identifying glycerol and whey as components of a production medium. The potential low-cost production medium was optimised by applying a response surface methodology to obtain the highest productivity converting industrial by-products into value-added products. The maximum achieved productivity of EPA was 20 mg/g, 45 mg/l, representing 11% of the total fatty acids, which is approximately five times more than the amount produced prior to optimisation. The production medium composition was 10.79 g/l whey and 6.87 g/l glycerol. To our knowledge, this is the first investigation of potential bacteria PUFA producers from Mediterranean and Red Seas providing an evaluation of a colourimetric screening method as means of rapid screening of a large number of isolates.
Navarrete, Andres; Avula, Bharathi; Choi, Young-Whan; Khan, Ikhlas A
2006-01-01
The roots and rhizomes of various valeriana species are currently used as a sleeping aid or mild sedative. A liquid chromatography method has been developed that permits the analysis of chlorogenic acid, lignans, flavonoids, valerenic acids, and valpotrates in various valerian samples. The best results were obtained with a Phenomenex Luna C18(2) column using gradient elution with a mobile phase consisting of water and 0.05% phosphoric acid and 2-100% acetonitrile-methanol (1 + 1) with 0.05% phosphoric acid. The flow rate was 0.8 mL/min and ultraviolet detection was at 207, 225, 254, 280, and 325 nm. Different valerian species and commercial products showed remarkable quantitative variations. Chlorogenic acid (0.2-1.2%), 3 lignans, linarin (0.002-0.24%), and valepotriates were detected in all the valeriana species analyzed. Highest amounts of valerenic acids were detected in V. officinalis L., trace amounts in V. sitchensis, and none in the other species analyzed.
Brønsted acid sites based on penta-coordinated aluminum species
NASA Astrophysics Data System (ADS)
Wang, Zichun; Jiang, Yijiao; Lafon, Olivier; Trébosc, Julien; Duk Kim, Kyung; Stampfl, Catherine; Baiker, Alfons; Amoureux, Jean-Paul; Huang, Jun
2016-12-01
Zeolites and amorphous silica-alumina (ASA), which both provide Brønsted acid sites (BASs), are the most extensively used solid acid catalysts in the chemical industry. It is widely believed that BASs consist only of tetra-coordinated aluminum sites (AlIV) with bridging OH groups in zeolites or nearby silanols on ASA surfaces. Here we report the direct observation in ASA of a new type of BAS based on penta-coordinated aluminum species (AlV) by 27Al-{1H} dipolar-mediated correlation two-dimensional NMR experiments at high magnetic field under magic-angle spinning. Both BAS-AlIV and -AlV show a similar acidity to protonate probe molecular ammonia. The quantitative evaluation of 1H and 27Al sites demonstrates that BAS-AlV co-exists with BAS-AlIV rather than replaces it, which opens new avenues for strongly enhancing the acidity of these popular solid acids.
USDA-ARS?s Scientific Manuscript database
The Hibiscus genus encompasses more than 300 species, but kenaf (H. cannabinus L.) and roselle (H. sabdariffa L.) are the two most economically important species within the genus. Seeds from these two Hibiscus species contain a relatively high amount of oil with two unusual fatty acids: dihydrosterc...
Kullback Leibler divergence in complete bacterial and phage genomes
Akhter, Sajia; Kashef, Mona T.; Ibrahim, Eslam S.; Bailey, Barbara
2017-01-01
The amino acid content of the proteins encoded by a genome may predict the coding potential of that genome and may reflect lifestyle restrictions of the organism. Here, we calculated the Kullback–Leibler divergence from the mean amino acid content as a metric to compare the amino acid composition for a large set of bacterial and phage genome sequences. Using these data, we demonstrate that (i) there is a significant difference between amino acid utilization in different phylogenetic groups of bacteria and phages; (ii) many of the bacteria with the most skewed amino acid utilization profiles, or the bacteria that host phages with the most skewed profiles, are endosymbionts or parasites; (iii) the skews in the distribution are not restricted to certain metabolic processes but are common across all bacterial genomic subsystems; (iv) amino acid utilization profiles strongly correlate with GC content in bacterial genomes but very weakly correlate with the G+C percent in phage genomes. These findings might be exploited to distinguish coding from non-coding sequences in large data sets, such as metagenomic sequence libraries, to help in prioritizing subsequent analyses. PMID:29204318
Kullback Leibler divergence in complete bacterial and phage genomes.
Akhter, Sajia; Aziz, Ramy K; Kashef, Mona T; Ibrahim, Eslam S; Bailey, Barbara; Edwards, Robert A
2017-01-01
The amino acid content of the proteins encoded by a genome may predict the coding potential of that genome and may reflect lifestyle restrictions of the organism. Here, we calculated the Kullback-Leibler divergence from the mean amino acid content as a metric to compare the amino acid composition for a large set of bacterial and phage genome sequences. Using these data, we demonstrate that (i) there is a significant difference between amino acid utilization in different phylogenetic groups of bacteria and phages; (ii) many of the bacteria with the most skewed amino acid utilization profiles, or the bacteria that host phages with the most skewed profiles, are endosymbionts or parasites; (iii) the skews in the distribution are not restricted to certain metabolic processes but are common across all bacterial genomic subsystems; (iv) amino acid utilization profiles strongly correlate with GC content in bacterial genomes but very weakly correlate with the G+C percent in phage genomes. These findings might be exploited to distinguish coding from non-coding sequences in large data sets, such as metagenomic sequence libraries, to help in prioritizing subsequent analyses.
Promiscuity in mice is associated with increased vaginal bacterial diversity
NASA Astrophysics Data System (ADS)
Macmanes, Matthew David
2011-11-01
Differences in the number of sexual partners (i.e., mating system) have the potential to exert a strong influence on the bacterial communities present in reproductive structures like the vagina. Because this structure serves as a conduit for gametes, bacteria present there may have a pronounced, direct effect on host reproductive success. As a first step towards the identification of the relationship between sexual behavior and potentially pathogenic bacterial communities inhabiting vital reproductive structures, as well as their potential effects on fitness, I sought to quantify differences in bacterial diversity in a promiscuous and monogamous mammal species. To accomplish this, I used two sympatric species of Peromyscus rodents— Peromyscus californicus and Peromyscus maniculatus that differ with regard to the number of sexual partners per individual to test the hypothesis that bacterial diversity should be greater in the promiscuous P. maniculatus relative to the monogamous P. californicus. As predicted, phylogenetically controlled and operational taxonomic unit-based indices of bacterial diversity indicated that diversity is greater in the promiscuous species. These results provide important new insights into the effects of mating system on bacterial diversity in free-living vertebrates, and may suggest a potential cost of promiscuity.
Gamma-irradiated bacterial preparation having anti-tumor activity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vass, A.A.; Tyndall, R.L.; Terzaghi-Howe, P.
1999-11-16
This application describes a bacterial preparation from Pseudomonas species isolated {number{underscore}sign}15 ATCC 55638 that has been exposed to gamma radiation exhibits cytotoxicity that is specific for neoplastic carcinoma cells. A method for obtaining a bacterial preparation having antitumor activity consists of suspending a bacterial isolate in media and exposing the suspension to gamma radiation. A bacterial preparation of an aged culture of an amoeba-associated bacteria exhibits anti-reverse transcriptase activity. A method for obtaining a bacterial preparation having anti-reverse transcriptase activity from an amoeba-associated bacterial isolate grown to stationary phase is disclosed.
A glimpse of the endophytic bacterial diversity in roots of blackberry plants (Rubus fruticosus).
Contreras, M; Loeza, P D; Villegas, J; Farias, R; Santoyo, G
2016-09-16
The aim of this study was to explore the diversity of culturable bacterial communities residing in blackberry plants (Rubus fruticosus). Bacterial endophytes were isolated from plant roots, and their 16S rDNA sequences were amplified and sequenced. Our results show that the roots of R. fruticosus exhibit low colony forming units of bacterial endophytes per gram of fresh tissue (6 x 10 2 ± 0.5 x 10 2 ). We identified 41 endophytic bacterial species in R. fruticosus by BLAST homology search and a subsequent phylogenetic analysis, belonging to the classes Actinobacteria, Bacilli, Alfaproteobacteria, Betaproteobacteria, and Gammaproteobacteria. Predominantly, genera belonging the Proteobacteria (Burkholderia, 29.4%; Herbaspirillum, 10.7%; Pseudomonas, 4.9%; and Dyella, 3.9%), Firmicutes (Bacillus, 42.1%), and Actinobacteria (two isolates showing high identity with the Streptomyces genus, 1.9%) divisions were identified. Fifty percent of the bacterial endophytes produced the phytohormone indole-acetic acid (IAA), eleven of which exhibited higher IAA production (>5.8 mg/mL) compared to the plant growth-promoting strain, Pseudomonas fluorescens UM270. Additionally, the endophytic isolates exhibited protease activity (22%), produced siderophores (26.4%), and demonstrated antagonistic action (>50% inhibition of mycelial growth) against the grey mold phytopathogen Botrytis cinerea (3.9%). These results suggested that field-grown R. fruticosus plants contain bacterial endophytes within their tissues with the potential to promote plant growth and display antagonism towards plant pathogens.
Detection of bacterial pathogens including potential new species in human head lice from Mali.
Amanzougaghene, Nadia; Fenollar, Florence; Sangaré, Abdoul Karim; Sissoko, Mahamadou S; Doumbo, Ogobara K; Raoult, Didier; Mediannikov, Oleg
2017-01-01
In poor African countries, where no medical and biological facilities are available, the identification of potential emerging pathogens of concern at an early stage is challenging. Head lice, Pediculus humanus capitis, have a short life, feed only on human blood and do not transmit pathogens to their progeny. They are, therefore, a perfect tool for the xenodiagnosis of current or recent human infection. This study assessed the occurrence of bacterial pathogens from head lice collected in two rural villages from Mali, where a high frequency of head lice infestation had previously been reported, using molecular methods. Results show that all 600 head lice, collected from 117 individuals, belonged to clade E, specific to West Africa. Bartonella quintana, the causative agent of trench fever, was identified in three of the 600 (0.5%) head lice studied. Our study also shows, for the first time, the presence of the DNA of two pathogenic bacteria, namely Coxiella burnetii (5.1%) and Rickettsia aeschlimannii (0.6%), detected in human head lice, as well as the DNA of potential new species from the Anaplasma and Ehrlichia genera of unknown pathogenicity. The finding of several Malian head lice infected with B. quintana, C. burnetii, R. aeschlimannii, Anaplasma and Ehrlichia is alarming and highlights the need for active survey programs to define the public health consequences of the detection of these emerging bacterial pathogens in human head lice.
Boric acid ovicidal trap for the management of Aedes species.
Bhami, L Charlet; Das, S Sam Manohar
2015-06-01
The use of low concentrations of boric acid as a potential and effective control agent for the eggs and immature stages of Aedes aegypti L. and Aedes albopictus Skuse (Diptera: Culicidae) is found to be safe and effective as compared to synthetic chemical insecticides. The study aims to determine the ovicidal concentration of boric acid, its effective concentration for oviposition attraction and the larval mortality concentration for Ae. aegypti and Ae. albopictus. The ovicidal concentration of boric acid was determined by incubating the eggs in different concentrations of boric acid (0.1, 0.25, 0.5, 0.75 and 1%). Different dilutions of boric acid were taken in the oviposition cup and the ovicidal concentration, effective concentration for oviposition attraction and the mean survival/mortality rate of III and IV instar Ae. aegypti and Ae. albopictus larvae were determined. The ovicidal concentration of boric acid for 100% mortality in Aedes sp eggs is 1%. Effective concentration for the oviposition attraction is 0.5%. At 1% concentration, larvae of both the species died within 24 h. Boric acid is less toxic compared to different pesticides, and in low concentrations, it attracts the ovipositing female Aedes sp as well as fertile males. Dilute boric acid solution is an effective ovitrap since the eggs laid by mosquitoes either die or the larvae that hatch out from them do not survive in boric acid. Boric acid kills the males that come in contact with the solution, which are attracted to the trap by the females hovering around.
Giaouris, Efstathios; Briandet, Romain; Meyrand, Mickael; Courtin, Pascal; Chapot-Chartier, Marie-Pierre
2008-01-01
An increase of the degree of d-alanylation of teichoic acids in Lactococcus lactis resulted in a significant increase of bacterial resistance toward the cationic antimicrobials nisin and lysozyme, whereas the absence of d-alanylation led to a decreased resistance toward the same compounds. In contrast, the same variations of the d-alanylation degree did not modify bacterial cell surface charge and hydrophobicity. Bacterial adhesion to polystyrene and glass surfaces was not modified either. PMID:18539809
Chohan, Zahid H.; Praveen, M.; Ghaffar, A.
1997-01-01
Biologically active tridentate amino acid (Alanine, Glycine & Tyrosine) derived Schiff-bases and their Co(II), Cu(II) & Ni(II) complexes have been synthesised and characterised on the basis of their conductance and magnetic measurements, elemental analysis and 13C-NMR, 1H-NMR, IR and electronic spectral data. These Schiff-bases and their complexes have been evaluated for their antibacterial activity against bacterial species such as Staphylococcus aureus, Escherichia coli, Klebsiella pneumonae, Proteus vulgarus and Pseudomonas aeruginosa and this activity data show the metal complexes to be more antibacterial than the Schiff-bases against one or more bacterial species. PMID:18475798
Bednar, A.J.; Garbarino, J.R.; Ranville, J.F.; Wildeman, T.R.
2002-01-01
The distribution of inorganic arsenic species must be preserved in the field to eliminate changes caused by metal oxyhydroxide precipitation, photochemical oxidation, and redox reactions. Arsenic species sorb to iron and manganese oxyhydroxide precipitates, and arsenite can be oxidized to arsenate by photolytically produced free radicals in many sample matrices. Several preservatives were evaluated to minimize metal oxyhydroxide precipitation, such as inorganic acids and ethylenediaminetetraacetic acid (EDTA). EDTA was found to work best for all sample matrices tested. Storing samples in opaque polyethylene bottles eliminated the effects of photochemical reactions. The preservation technique was tested on 71 groundwater and six acid mine drainage samples. Concentrations in groundwater samples reached 720 ??g-As/L for arsenite and 1080 ??g-As/L for arsenate, and acid mine drainage samples reached 13 000 ??g-As/L for arsenite and 3700 ??g-As/L for arsenate. The arsenic species distribution in the samples ranged from 0 to 90% arsenite. The stability of the preservation technique was established by comparing laboratory arsenic speciation results for samples preserved in the field to results for subsamples speciated onsite. Statistical analyses indicated that the difference between arsenite and arsenate concentrations for samples preserved with EDTA in opaque bottles and field speciation results were analytically insignificant. The percentage change in arsenite:arsenate ratios for a preserved acid mine drainage sample and groundwater sample during a 3-month period was -5 and +3%, respectively.
Bacterial detection: from microscope to smartphone.
Gopinath, Subash C B; Tang, Thean-Hock; Chen, Yeng; Citartan, Marimuthu; Lakshmipriya, Thangavel
2014-10-15
The ubiquitous nature of bacteria enables them to survive in a wide variety of environments. Hence, the rise of various pathogenic species that are harmful to human health raises the need for the development of accurate sensing systems. Sensing systems are necessary for diagnosis and epidemiological control of pathogenic organism, especially in the food-borne pathogen and sanitary water treatment facility' bacterial populations. Bacterial sensing for the purpose of diagnosis can function in three ways: bacterial morphological visualization, specific detection of bacterial component and whole cell detection. This paper provides an overview of the currently available bacterial detection systems that ranges from microscopic observation to state-of-the-art smartphone-based detection. Copyright © 2014 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ingram, Jani Cheri; Lehman, Richard Michael; Bauer, William Francis
We report the use of a surface analysis approach, static secondary ion mass spectrometry (SIMS) equipped with a molecular (ReO4-) ion primary beam, to analyze the surface of intact microbial cells. SIMS spectra of 28 microorganisms were compared to fatty acid profiles determined by gas chromatographic analysis of transesterfied fatty acids extracted from the same organisms. The results indicate that surface bombardment using the molecular primary beam cleaved the ester linkage characteristic of bacteria at the glycerophosphate backbone of the phospholipid components of the cell membrane. This cleavage enables direct detection of the fatty acid conjugate base of intact microorganismsmore » by static SIMS. The limit of detection for this approach is approximately 107 bacterial cells/cm2. Multivariate statistical methods were applied in a graded approach to the SIMS microbial data. The results showed that the full data set could initially be statistically grouped based upon major differences in biochemical composition of the cell wall. The gram-positive bacteria were further statistically analyzed, followed by final analysis of a specific bacterial genus that was successfully grouped by species. Additionally, the use of SIMS to detect microbes on mineral surfaces is demonstrated by an analysis of Shewanella oneidensis on crushed hematite. The results of this study provide evidence for the potential of static SIMS to rapidly detect bacterial species based on ion fragments originating from cell membrane lipids directly from sample surfaces.« less
[Sharing bacterial microbiota between owners and their pets (dogs, cats)].
Wipler, Jan; Čermáková, Zuzana; Hanzálek, Tomáš; Horáková, Hana; Žemličková, Helena
2017-06-01
The microbiological aspect of a relationship between pets (dogs/cats) and their owners is mainly concerned with the incidence of shared bacterial species, in particular potential pathogens. Given the great popularity of sharing homes with pets (dogs/cats) in the Czech Republic, there is an increased possibility of communication between microbiota of the two macroorganisms (pet and owner). The aim of the study was to determine the biodiversity of shared bacteria and possibility of exchange of genes of resistance to antimicrobial agents between potential pathogens based on the close relationship between pets and humans. A total of 103 samples were collected from 20 pairs (20 owners, 16 dogs and 4 cats). All owners completed a questionnaire with their pets' veterinarians. In owners, swabs were collected from the nasal mucosa, armpit and interdigital spaces of the foot. In pets, swabs were obtained from the external auditory meatus and nasal mucosa. In individuals with skin lesions, samples were also collected from the affected areas. Bacterial species were identified by culture and matrix-assisted laser desorption/ionization - time of flight (MALDI-TOF) mass spectrometry. In shared species, susceptibility to antibiotics was tested by the disk diffusion method. Statistical methods were used to correlate the closeness of relationship with the number of shared bacterial species and to correlate previous antimicrobial therapy with shared resistance of the common bacteria. Analysis of the questionnaires showed that 65 % of owners who participated in the study kept more pets at home than only the tested one. In the previous year, 5 % of pets and 5 % of owners received antimicrobial therapy. As many as 45 % of dogs or cats slept in their owners' beds and 80 % rested on a sofa together with their owners. Also, 45 % owners had their faces licked by pets. Eighty percent of pets were fed with several types of food (dry food and cooked food). Further, 70 % of pets lived
New target for inhibition of bacterial RNA polymerase: 'switch region'.
Srivastava, Aashish; Talaue, Meliza; Liu, Shuang; Degen, David; Ebright, Richard Y; Sineva, Elena; Chakraborty, Anirban; Druzhinin, Sergey Y; Chatterjee, Sujoy; Mukhopadhyay, Jayanta; Ebright, Yon W; Zozula, Alex; Shen, Juan; Sengupta, Sonali; Niedfeldt, Rui Rong; Xin, Cai; Kaneko, Takushi; Irschik, Herbert; Jansen, Rolf; Donadio, Stefano; Connell, Nancy; Ebright, Richard H
2011-10-01
A new drug target - the 'switch region' - has been identified within bacterial RNA polymerase (RNAP), the enzyme that mediates bacterial RNA synthesis. The new target serves as the binding site for compounds that inhibit bacterial RNA synthesis and kill bacteria. Since the new target is present in most bacterial species, compounds that bind to the new target are active against a broad spectrum of bacterial species. Since the new target is different from targets of other antibacterial agents, compounds that bind to the new target are not cross-resistant with other antibacterial agents. Four antibiotics that function through the new target have been identified: myxopyronin, corallopyronin, ripostatin, and lipiarmycin. This review summarizes the switch region, switch-region inhibitors, and implications for antibacterial drug discovery. Copyright © 2011 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Di Donato, Paola; Romano, Ida; Mastascusa, Vincenza; Poli, Annarita; Orlando, Pierangelo; Pugliese, Mariagabriella; Nicolaus, Barbara
2018-03-01
Astrobiology studies the origin and evolution of life on Earth and in the universe. According to the panspermia theory, life on Earth could have emerged from bacterial species transported by meteorites, that were able to adapt and proliferate on our planet. Therefore, the study of extremophiles, i.e. bacterial species able to live in extreme terrestrial environments, can be relevant to Astrobiology studies. In this work we described the ability of the thermophilic species Geobacillus thermantarcticus to survive after exposition to simulated spatial conditions including temperature's variation, desiccation, X-rays and UVC irradiation. The response to the exposition to the space conditions was assessed at a molecular level by studying the changes in the morphology, the lipid and protein patterns, the nucleic acids. G. thermantarcticus survived to the exposition to all the stressing conditions examined, since it was able to restart cellular growth in comparable levels to control experiments carried out in the optimal growth conditions. Survival was elicited by changing proteins and lipids distribution, and by protecting the DNA's integrity.
Zhao, Yuan; Zhang, Shuncai; Jiang, Li; Jiang, Jie; Liu, Hongchun
2009-11-01
To evaluate the preventive effects of Schistosoma japonicum ova on trinitrobenzenesulfonic acid (TNBS)-induced colitis and bacterial translocation in mice. BALB/c mice were randomly divided into three groups: control group; TNBS(+)Ova(-) group; and TNBS(+)Ova(+) group. Mice of the TNBS(+)Ova(+) group were exposed to 10 000 freeze-killed S. japonicum ova by i.p. injection on day 1 and day 11. On day 15, mice were challenged with TNBS to induce colitis. The following variables were assessed: colon pathological changes; serum expression of tumor necrosis factor-alpha (TNF-alpha), gamma-interferon (IFN-gamma) and interleukin-10 (IL-10); expression of Toll-like receptor 4 (TLR4) in colon; IFN-gamma, IL-10 and TLR4 mRNA expression in colon; and the bacterial translocation rate. Compared to TNBS(+)Ova(-) group, the colonic inflammation in the TNBS(+)Ova(+) group were relieved. A highly significant elevation of IFN-gamma and TNF-alpha were observed in the TNBS-induced colitis group. After exposure to the eggs, IFN-gamma was significantly decreased, while TNF-alpha was similar to that of the TNBS(+)ova(-) group. No obvious variation was seen in IL-10 expression in TNBS-induced colitis, compared to the controls. Exposure to the eggs led to a significant upregulation of IL-10 expression. TLR4 expression was elevated after injected with TNBS and was downregulated in the eggs group. Less intestinal bacterial translocation frequency was observed when exposed to eggs. S. japonicum ova can prevent the TNBS-induced colitis and reduce the bacterial translocation frequency in mice. The mechanisms were supposed to be due to the regulation of T-helper cell 1/2 balance and TLR4 expression.
Gillespie, Joseph J.; Wattam, Alice R.; Cammer, Stephen A.; Gabbard, Joseph L.; Shukla, Maulik P.; Dalay, Oral; Driscoll, Timothy; Hix, Deborah; Mane, Shrinivasrao P.; Mao, Chunhong; Nordberg, Eric K.; Scott, Mark; Schulman, Julie R.; Snyder, Eric E.; Sullivan, Daniel E.; Wang, Chunxia; Warren, Andrew; Williams, Kelly P.; Xue, Tian; Seung Yoo, Hyun; Zhang, Chengdong; Zhang, Yan; Will, Rebecca; Kenyon, Ronald W.; Sobral, Bruno W.
2011-01-01
Funded by the National Institute of Allergy and Infectious Diseases, the Pathosystems Resource Integration Center (PATRIC) is a genomics-centric relational database and bioinformatics resource designed to assist scientists in infectious-disease research. Specifically, PATRIC provides scientists with (i) a comprehensive bacterial genomics database, (ii) a plethora of associated data relevant to genomic analysis, and (iii) an extensive suite of computational tools and platforms for bioinformatics analysis. While the primary aim of PATRIC is to advance the knowledge underlying the biology of human pathogens, all publicly available genome-scale data for bacteria are compiled and continually updated, thereby enabling comparative analyses to reveal the basis for differences between infectious free-living and commensal species. Herein we summarize the major features available at PATRIC, dividing the resources into two major categories: (i) organisms, genomes, and comparative genomics and (ii) recurrent integration of community-derived associated data. Additionally, we present two experimental designs typical of bacterial genomics research and report on the execution of both projects using only PATRIC data and tools. These applications encompass a broad range of the data and analysis tools available, illustrating practical uses of PATRIC for the biologist. Finally, a summary of PATRIC's outreach activities, collaborative endeavors, and future research directions is provided. PMID:21896772
Exploring the Bacterial Microbiota of Colombian Fermented Maize Dough "Masa Agria" (Maiz Añejo).
Chaves-Lopez, Clemencia; Serio, Annalisa; Delgado-Ospina, Johannes; Rossi, Chiara; Grande-Tovar, Carlos D; Paparella, Antonello
2016-01-01
Masa Agria is a naturally fermented maize dough produced in Colombia, very common in the traditional gastronomy. In this study we used culture-dependent and RNA-based pyrosequencing to investigate the bacterial community structure of Masa Agria samples produced in the south west of Colombia. The mean value of cell density was 7.6 log CFU/g of presumptive lactic acid bacteria, 5.4 log cfu/g for presumptive acetic bacteria and 5.6 og CFU/g for yeasts. The abundance of these microorganisms is also responsible for the low pH (3.1-3.7) registered. Although the 16S rRNA pyrosequencing revealed that the analyzed samples were different in bacteria richness and diversity, the genera Lactobacillus, Weissella, and Acetobacter were predominant. In particular, the most common species were Lactobacillus plantarum and Acetobacter fabarum, followed by L. fermentum, L. vaccinostercus, and Pediococcus argentinicus. Several microorganisms of environmental origin, such as Dechloromonas and most of all Sphingobium spp., revealed in each sample, were detected, and also bacteria related to maize, such as Phytoplasma. In conclusion, our results elucidated for the first time the structures of the bacterial communities of Masa Agria samples obtained from different producers, identifying the specific dominant species and revealing a complete picture of the bacterial consortium in this specific niche. The selective pressure of tropical environments may favor microbial biodiversity characterized by a useful technological potential.
Chemical sensing in mammalian host-bacterial commensal associations
USDA-ARS?s Scientific Manuscript database
The mammalian gastrointestinal (GI) tract is colonized by a complex consortium of bacterial species. Bacteria engage in chemical signaling to coordinate population-wide behavior. However, it is unclear if chemical sensing plays a role in establishing mammalian host–bacterial commensal relationships....
Reid, Gregor; Burton, Jeremy; Hammond, Jo-Anne; Bruce, Andrew W
2004-01-01
Bacterial vaginosis (BV) is a common condition in women that represents an imbalance of the vaginal microflora, lactobacilli depletion, and excess growth of mainly anaerobic Gram-negative pathogens. Diagnosis is made using a series of tests or a Gram stain of a vaginal smear. Treatment with antibiotics is quite effective, but recurrences are common. A study of 55 vaginal samples from 11 postmenopausal women showed the presence of BV by the Gram stain-based Nugent scoring system, and polymerase chain reaction-denaturing gradient gel electrophoresis showed that Bacteroides or Prevotella species were the most common isolates recovered (24 of 25), with Escherichia coli, Staphylococcus aureus, and Streptococcus agalactiae also found in some samples. In one case, only Gardnerella vaginalis was found. These findings illustrate that BV remains common even among otherwise healthy women, but it is not caused solely by either Gardnerella or Mobiluncus. Use of a FemExam system (Cooper Surgical, Shelton, CT), based upon elevated pH and trimethylamine levels, to screen vaginal smears from 59 healthy women showed poor correlation with the Gram stain method. A randomized, placebo-controlled trial of these subjects showed that the lactobacilli-dominant microbiota was restored in subjects with BV but not in controls, following 2 months of daily oral intake of Lactobacillus rhamnosus GR-1 and Lactobacillus fermentum RC-14. These studies show that nucleic acid-based methods are effective at identifying bacteria responsible for BV. If such methods could be used to develop a commercially available, self-use kit, women would be much better placed to take control of their own health, for example, using medicinal food or dietary supplement products such as the clinically proven probiotic strains L. rhamnosus GR-1 and L. fermentum RC-14.
Deng, Shihuai; Gou, Shuzhen; Sun, Baiye; Lv, Wenlin; Li, Yuanwei; Peng, Hong; Xiao, Hong; Yang, Gang; Wang, Yingjun
2012-08-01
This study investigated the sensitivity of plant species to acid rain based on the modeled dosage-response relationship on the net photosynthetic rate (P (N)) of 21 types of plant species, subjected to the exposure of simulated acid rain (SAR) for 5 times during a period of 50 days. Variable responses of P (N) to SAR occurred depending on the type of plant. A majority (13 species) of the dosage-response relationship could be described by an S-shaped curve and be fitted with the Boltzmann model. Model fitting allowed quantitative evaluation of the dosage-response relationship and an accurate estimation of the EC(10), termed as the pH of the acid rain resulting in a P (N) 10 % lower than the reference value. The top 9 species (Camellia sasanqua, Cinnamomum camphora, etc. EC(10) ≤ 3.0) are highly endurable to very acid rain. The rare, relict plant Metasequoia glyptostroboides was the most sensitive species (EC(10) = 5.1) recommended for protection.
Streptococcus pneumoniae Can Utilize Multiple Sources of Hyaluronic Acid for Growth
Marion, Carolyn; Stewart, Jason M.; Tazi, Mia F.; Burnaugh, Amanda M.; Linke, Caroline M.; Woodiga, Shireen A.
2012-01-01
The mechanisms by which Streptococcus pneumoniae obtains carbohydrates for growth during airway colonization remain to be elucidated. The low concentration of free carbohydrates in the normal human airway suggests that pneumococci must utilize complex glycan structures for growth. The glycosaminoglycan hyaluronic acid is present on the apical surface of airway epithelial cells. As pneumococci express a hyaluronate lyase (Hyl) that cleaves hyaluronic acid into disaccharides, we hypothesized that during colonization pneumococci utilize the released carbohydrates for growth. Hyaluronic acid supported significant pneumococcal growth in an hyl-dependent manner. A phosphoenolpyruvate-dependent phosphotransferase system (PTS) and an unsaturated glucuronyl hydrolase (Ugl) encoded downstream of hyl are also essential for growth on hyaluronic acid. This genomic arrangement is present in several other organisms, suggesting conservation of the utilization mechanism between species. In vivo experiments support the hypothesis that S. pneumoniae utilizes hyaluronic acid as a carbon source during colonization. We also demonstrate that pneumococci can utilize the hyaluronic acid capsule of other bacterial species for growth, suggesting an alternative carbohydrate source for pneumococcal growth. Together, these data support a novel function for pneumococcal degradation of hyaluronic acid in vivo and provide mechanistic details of growth on this glycosaminoglycan. PMID:22311922
Park, Doo-Sang; Oh, Hyun-Woo; Jeong, Won-Jin; Kim, Hyangmi; Park, Ho-Yong; Bae, Kyung Sook
2007-10-01
In this study, bacterial communities within the guts of several longicorn beetles were investigated by a culture-dependent method. A total of 142 bacterial strains were isolated from nine species of longicorn beetle, including adults and larvae. A comparison of their partial 16S rRNA gene sequences showed that most of the bacteria constituting the gut communities can typically be found in soil, plants and the intestines of animals, and approximately 10% were proposed as unreported. Phylogenetic analysis demonstrated that the bacterial species comprised 7 phyla, and approximately half were Gammaproteobacteria. Actinobacteria were the second most populous group (19%), followed by Firmicutes (13%) and Alphaproteobacteria (11%). Betaproteobacteria, Flavobacteria, and Acidobacteria were minor constituents. The taxonomic compositions of the isolates were variable according to the species of longicorn beetle. Particularly, an abundance of Actinobacteria existed in Moechotypa diphysis and Mesosa hirsute, which eat broadleaf trees; however, no Actinobacteria were isolated from Corymbia rubra and Monochamus alternatus, which are needle-leaf eaters. Considerable proportions of xylanase and pectinase producing bacteria in the guts of the longicorn beetles implied that the bacteria may play an important role in the digestion of woody diets. Actinobacteria and Gammaproteobacteria were the dominant xylanase producers in the guts of the beetles.
Cattò, C; James, G; Villa, F; Villa, S; Cappitelli, F
2018-05-04
The active moieties of the anti-biofilm natural compounds zosteric (ZA) and salicylic (SA) acids have been covalently immobilized on a low density polyethylene (LDPE) surface. The grafting procedure provided new non-toxic eco-friendly materials (LDPE-CA and LDPE-SA) with anti-biofilm properties superior to the conventional biocide-based approaches and with features suitable for applications in challenging fields where the use of antimicrobial agents is limited. Microbiological investigation proved that LDPE-CA and LDPE-SA: (1) reduced Escherichia coli biofilm biomass by up to 61% with a mechanism that did not affect bacterial viability; (2) significantly affected biofilm morphology, decreasing biofilm thickness, roughness, substratum coverage, cell and matrix polysaccharide bio-volumes by >80% and increasing the surface to bio-volume ratio; (3) made the biofilm more susceptible to ampicillin and ethanol. Since no molecules were leached from the surface, they remained constantly effective and below the lethal level; therefore, the risk of inducing resistance was minimized.
Bagatini, Inessa Lacativa; Eiler, Alexander; Bertilsson, Stefan; Klaveness, Dag; Tessarolli, Letícia Piton; Vieira, Armando Augusto Henriques
2014-01-01
Many freshwater phytoplankton species have the potential to form transient nuisance blooms that affect water quality and other aquatic biota. Heterotrophic bacteria can influence such blooms via nutrient regeneration but also via antagonism and other biotic interactions. We studied the composition of bacterial communities associated with three bloom-forming freshwater phytoplankton species, the diatom Aulacoseira granulata and the cyanobacteria Microcystis aeruginosa and Cylindrospermopsis raciborskii. Experimental cultures incubated with and without lake bacteria were sampled in three different growth phases and bacterial community composition was assessed by 454-Pyrosequencing of 16S rRNA gene amplicons. Betaproteobacteria were dominant in all cultures inoculated with lake bacteria, but decreased during the experiment. In contrast, Alphaproteobacteria, which made up the second most abundant class of bacteria, increased overall during the course of the experiment. Other bacterial classes responded in contrasting ways to the experimental incubations causing significantly different bacterial communities to develop in response to host phytoplankton species, growth phase and between attached and free-living fractions. Differences in bacterial community composition between cyanobacteria and diatom cultures were greater than between the two cyanobacteria. Despite the significance, major differences between phytoplankton cultures were in the proportion of the OTUs rather than in the absence or presence of specific taxa. Different phytoplankton species favoring different bacterial communities may have important consequences for the fate of organic matter in systems where these bloom forming species occur. The dynamics and development of transient blooms may also be affected as bacterial communities seem to influence phytoplankton species growth in contrasting ways. PMID:24465807
DOE Office of Scientific and Technical Information (OSTI.GOV)
Senko, John M.; Wanjugi, Pauline; Lucas, Melanie
2008-06-12
We characterized the microbiologically mediated oxidative precipitation of Fe(II) from coalminederived acidic mine drainage (AMD) along flow-paths at two sites in northern Pennsylvania. At the Gum Boot site, dissolved Fe(II) was efficiently removed from AMD whereas minimal Fe(II) removal occurred at the Fridays-2 site. Neither site received human intervention to treat the AMD. Culturable Fe(II) oxidizing bacteria were most abundant at sampling locations along the AMD flow path corresponding to greatest Fe(II) removal and where overlying water contained abundant dissolved O2. Rates of Fe(II) oxidation determined in laboratory-based sediment incubations were also greatest at these sampling locations. Ribosomal RNA intergenicmore » spacer analysis and sequencing of partial 16S rRNA genes recovered from sediment bacterial communities revealed similarities among populations at points receiving regular inputs of Fe(II)-rich AMD and provided evidence for the presence of bacterial lineages capable of Fe(II) oxidation. A notable difference between bacterial communities at the two sites was the abundance of Chloroflexi-affiliated 16S rRNA gene sequences in clone libraries derived from the Gum Boot sediments. Our results suggest that inexpensive and reliable AMD treatment strategies can be implemented by mimicking the conditions present at the Gum Boot field site.« less
Auer, George K; Weibel, Douglas B
2017-07-25
Cellular mechanical properties play an integral role in bacterial survival and adaptation. Historically, the bacterial cell wall and, in particular, the layer of polymeric material called the peptidoglycan were the elements to which cell mechanics could be primarily attributed. Disrupting the biochemical machinery that assembles the peptidoglycan (e.g., using the β-lactam family of antibiotics) alters the structure of this material, leads to mechanical defects, and results in cell lysis. Decades after the discovery of peptidoglycan-synthesizing enzymes, the mechanisms that underlie their positioning and regulation are still not entirely understood. In addition, recent evidence suggests a diverse group of other biochemical elements influence bacterial cell mechanics, may be regulated by new cellular mechanisms, and may be triggered in different environmental contexts to enable cell adaptation and survival. This review summarizes the contributions that different biomolecular components of the cell wall (e.g., lipopolysaccharides, wall and lipoteichoic acids, lipid bilayers, peptidoglycan, and proteins) make to Gram-negative and Gram-positive bacterial cell mechanics. We discuss the contribution of individual proteins and macromolecular complexes in cell mechanics and the tools that make it possible to quantitatively decipher the biochemical machinery that contributes to bacterial cell mechanics. Advances in this area may provide insight into new biology and influence the development of antibacterial chemotherapies.
Ahmed, Shakeel; Liu, Huimin; Ahmad, Aqeel; Akram, Waheed; Abdelrahman, Eman K N; Ran, Fengming; Ou, Wuling; Dong, Shuang; Cai, Qian; Zhang, Qiyun; Li, Xiaohua; Hu, Sheng; Hu, Xuebo
2017-01-01
The increasing of multidrug resistance in bacterial associated infections has impaired the current antimicrobial therapy and it forces the search for other alternatives. In this study, we aimed to find the in vitro antibacterial activity of seed coat of Trachycarpus fortunei against a panel of clinically important bacterial species. Ethanolic extracts of target tissues were fractionated through macro porous resin by column chromatography, using ethanol as an organic solvent with a concentration gradient of 0-100%, each along with 20% concentration increment. The minimum inhibitory (MIC) concentrations of all fractions were measured. It is found that 20% ethanolic fraction showed the most significant inhibition against tested bacterial species. All fractions were analyzed by Ultra-Performance Liquid Chromatography/mass spectrometry (UPLC/MS) and compounds were identified by comparing mass spectra with standard libraries. By pairing the identified compounds from different fractions with the antibacterial activity of each fraction, it was shown that compounds stearamide (7), 1-(4-Fluorophenyl)-2-(methylthio)-1H-imidazole-5-carboxylic acid (9) and 2,4,5 triacetoxybiphenyl (10) topped in the list for anti-bacterial activity. Further experiment with pure chemicals verified that compounds 9 and 10 have antibacterial activity against Gram-negative bacteria. Whereas, the lowest MIC value (39.06 μg/mL) was obtained by compound 10 against Staphylococcus epidermidis . Hence, the seed coat of T. fortunei with its antimicrobial spectrum could be a good candidate for further bactericidal research.
Ahmed, Shakeel; Liu, Huimin; Ahmad, Aqeel; Akram, Waheed; Abdelrahman, Eman K. N.; Ran, Fengming; Ou, Wuling; Dong, Shuang; Cai, Qian; Zhang, Qiyun; Li, Xiaohua; Hu, Sheng; Hu, Xuebo
2017-01-01
The increasing of multidrug resistance in bacterial associated infections has impaired the current antimicrobial therapy and it forces the search for other alternatives. In this study, we aimed to find the in vitro antibacterial activity of seed coat of Trachycarpus fortunei against a panel of clinically important bacterial species. Ethanolic extracts of target tissues were fractionated through macro porous resin by column chromatography, using ethanol as an organic solvent with a concentration gradient of 0–100%, each along with 20% concentration increment. The minimum inhibitory (MIC) concentrations of all fractions were measured. It is found that 20% ethanolic fraction showed the most significant inhibition against tested bacterial species. All fractions were analyzed by Ultra-Performance Liquid Chromatography/mass spectrometry (UPLC/MS) and compounds were identified by comparing mass spectra with standard libraries. By pairing the identified compounds from different fractions with the antibacterial activity of each fraction, it was shown that compounds stearamide (7), 1-(4-Fluorophenyl)-2-(methylthio)-1H-imidazole-5-carboxylic acid (9) and 2,4,5 triacetoxybiphenyl (10) topped in the list for anti-bacterial activity. Further experiment with pure chemicals verified that compounds 9 and 10 have antibacterial activity against Gram-negative bacteria. Whereas, the lowest MIC value (39.06 μg/mL) was obtained by compound 10 against Staphylococcus epidermidis. Hence, the seed coat of T. fortunei with its antimicrobial spectrum could be a good candidate for further bactericidal research. PMID:29046668
Ouattara, Hadja D; Ouattara, Honoré G; Droux, Michel; Reverchon, Sylvie; Nasser, William; Niamke, Sébastien L
2017-09-01
Microbial fermentation is an indispensable process for high quality chocolate from cocoa bean raw material. lactic acid bacteria (LAB) are among the major microorganisms responsible for cocoa fermentation but their exact role remains to be elucidated. In this study, we analyzed the diversity of LAB in six cocoa producing regions of Ivory Coast. Ribosomal 16S gene sequence analysis showed that Lactobacillus plantarum and Leuconostoc mesenteroides are the dominant LAB species in these six regions. In addition, other species were identified as the minor microbial population, namely Lactobacillus curieae, Enterococcus faecium, Fructobacillus pseudoficulneus, Lactobacillus casei, Weissella paramesenteroides and Weissella cibaria. However, in each region, the LAB microbial population was composed of a restricted number of species (maximum 5 species), which varied between the different regions. LAB implication in the breakdown of citric acid was investigated as a fundamental property for a successful cocoa fermentation process. High citrate lyase producer strains were characterized by rapid citric acid consumption, as revealed by a 4-fold decrease in citric acid concentration in the growth medium within 12h, concomitant with an increase in acetic acid and lactic acid concentration. The production of citrate lyase was strongly dependent on environmental conditions, with optimum production at acidic pH (pH<5), and moderate temperature (30-40°C), which corresponds to conditions prevailing in the early stage of natural cocoa fermentation. This study reveals that one of the major roles of LAB in the cocoa fermentation process involves the breakdown of citric acid during the early stage of cocoa fermentation through the activity of citrate lyase. Copyright © 2017 Elsevier B.V. All rights reserved.
Nishanthan, G; Kumara, P A D A; de Croos, M D S T; Prasada, D V P; Dissanayake, D C T
2018-05-01
Processing and its impacts on proximate composition and fatty acid profile of six sea cucumber species; Bohadschia marmorata, Stichopus chloronotus, Holothuria spinifera, Thelenota anax, Holothuria scabra and Bohadschia sp. 1 collected from the northwest coast of Sri Lanka were analyzed. Sea cucumbers are processed into bêche - de - mer by both domestic and industrial level processors following the similar steps of cleaning, evisceration, first boiling, salting, second boiling and drying. However, domestically processed bêche - de - mer always reported a higher percentage of moisture, crude ash, crude fat and lower percentage of crude protein than industrially processed products. Although processing resulted in a significant reduction of total SFA and MUFA in fresh individuals of most of these species, total PUFA increased significantly in processed individuals excluding Bohadschia species. Palmitic acid was found to be the most dominant fatty acid in all these species followed by eicosapentaenoic acid, which showed a significant increase in processed products, except Bohadschia sp. 1. Total MUFA were higher than total SFA in all sea cucumber species having exceptions in Bohadchia sp.1 and fresh S. chloronotus. These findings will make a significant contribution to fill the gaps in existing information as no any previous information is available for species like H. spinifera and S. chloronotus .
Emblidge, J P; Delorenzo, M E
2006-02-01
Clofibric acid is the active metabolite of several fibrate drugs prescribed to reduce blood cholesterol levels. It is persistent and widely detected in the environment. Clofibric acid toxicity was assessed using three estuarine organisms: an alga (Dunaliella tertiolecta), a crustacean (Palaemonetes pugio), and a fish (Fundulus heteroclitus). Mortality and sublethal physiological responses (protein, lipid, cholesterol, and cytochrome P450 levels) were examined. Clofibric acid did not significantly affect cell density or growth rate of D. tertiolecta (concentrations 1000 microg/L). Survival of P. pugio and F. heteroclitus were also unaffected at clofibric acid concentrations 1000 microg/L. In addition, no significant changes in the sublethal test endpoints were found. An additional chronic (17-day) exposure of F. heteroclitus to clofibric acid (10 microg/L) was conducted and found no effects on survival or sublethal endpoints. The rabbit polyclonal CYP450 4A antibody did cross react with F. heteroclitus, demonstrating that a CYP4A-like isoform is present in this teleost species and may be used in future induction studies. Clofibric acid, however, did not alter CYP4A levels in F. heteroclitus. Measured concentrations in the environment have not exceeded 10 microg/L. Therefore, the results of this study indicate a low risk of adverse effects from environmental exposure to clofibric acid for the species tested.
Joyce, E; Phull, S S; Lorimer, J P; Mason, T J
2003-10-01
Some species of bacteria produce colonies and spores which agglomerate in spherical clusters (Bacillus subtilis) and this serves as a protection for the organisms inside against biocidal attack. Flocs of fine particles e.g. clay can entrap bacteria which can also protect them against the biocides. It is because of problems such as these that alternative methods of disinfecting water are under active investigation. One such method is the use of power ultrasound, either alone or in combination with other methods. Ultrasound is able to inactivate bacteria and deagglomerate bacterial clusters or flocs through a number of physical, mechanical and chemical effects arising from acoustic cavitation. The aim of this study was to investigate the effect of power ultrasound at different powers and frequencies on Bacillus subtilis. Viable plate count techniques were used as a measure of microbial activity. Results showed a significant increase in percent kill for Bacillus species with increasing duration of exposure and intensity of ultrasound in the low-kilohertz range (20 and 38 kHz). Results obtained at two higher frequencies (512 and 850 kHz) indicated a significant increase in bacteria count suggesting declumping. In assessing the bacterial kill with time under different sonication regimes three types of behaviour were characterized: High power ultrasound (lower frequencies) in low volumes of bacterial suspension results in a continuous reduction in bacterial cell numbers i.e. the kill rate predominates. High power ultrasound (lower frequencies) in larger volumes results in an initial rise in cell numbers suggesting declumping of the bacteria but this initial rise then falls as the declumping finishes and the kill rate becomes more important. Low intensity ultrasound (higher frequencies) gives an initial rise in cell numbers as a result of declumping. The kill rate is low and so there is no significant subsequent decrease in bacterial cell numbers.
Pascual, Javier; García-López, Marina; Bills, Gerald F; Genilloud, Olga
2015-02-01
During the course of screening bacterial isolates as sources of as-yet unknown bioactive compounds with pharmaceutical applications, a chemo-organotrophic, Gram-negative bacterium was isolated from a soil sample taken from the Tejeda, Almijara and Alhama Natural Park, Granada, Spain. Strain F-278,770(T) was oxidase- and catalase-positive, aerobic, with a respiratory type of metabolism with oxygen as the terminal electron acceptor, non-spore-forming and motile by one polar flagellum, although some cells had two polar flagella. Phylogenetic analysis of the 16S rRNA, gyrB, rpoB and rpoD genes revealed that strain F-278,770(T) belongs to the Pseudomonas koreensis subgroup (Pseudomonas fluorescens lineage), with Pseudomonas moraviensis, P. koreensis, P. baetica and P. helmanticensis as its closest relatives. Chemotaxonomic traits such as polar lipid and fatty acid compositions and G+C content of genomic DNA corroborated the placement of strain F-278,770(T) in the genus Pseudomonas. DNA-DNA hybridization assays and phenotypic traits confirmed that this strain represents a novel species of the genus Pseudomonas, for which the name Pseudomonas granadensis sp. nov. is proposed. The type strain is F-278,770(T) ( = DSM 28040(T) = LMG 27940(T)). © 2015 Fundacion MEDINA, Centro de Excelencia en Investigacion de Medicamentos Innovadores en Andalucia.
Delgado, Susana; Arroyo, Rebeca; Martín, Rocío; Rodríguez, Juan M
2008-01-01
Background Infectious mastitis is a common condition during lactation and in fact, represents one of the main causes leading to a precocious weaning. The number of studies dealing with lactational mastitis is low and, up to now, the etiological diagnosis is frequently made on the basis of unspecific clinical signs. The aim of this study was to investigate the microbial diversity of breast milk in 20 women with lactational mastitis employing culture-dependent and culture-independent (PCR-DGGE) approaches. Methods Breast milk samples were cultured in different media to investigate the presence of bacteria and/or yeasts, and a total of 149 representative isolates were identified to the species level by 16S rRNA gene PCR sequencing. The microorganisms recovered were compared with those found by PCR-DGGE analysis. To identify the DGGE profiles two reference markers of different microbial species were constructed. Sequence analysis of unknown bands was also performed. Results Staphylococci were the dominant bacterial group and Staphylococcus epidermidis was the dominant species. In a lower number of samples, other bacteria (mainly streptococci and a few gram-negative species) were also identified. Globally, PCR-DGGE results showed a good correlation with those obtained by culture-based methods. However, although DNA bands corresponding to different lactic acid bacteria were detected, such bacteria could not be isolated from the milk samples. Conclusion Staphylococci seem to be the main etiological agents of human lactational mastitis. The combined use of culture and molecular techniques allowed a better characterization of the bacterial diversity in milk from women suffering from infectious mastitis. Our results suggest that this condition could be the result of a disbiotic process where some of the bacterial species usually present in human milk outgrow (staphylococci) while others disappear (lactobacilli or lactococci). PMID:18423017
Delgado, Susana; Arroyo, Rebeca; Martín, Rocío; Rodríguez, Juan M
2008-04-18
Infectious mastitis is a common condition during lactation and in fact, represents one of the main causes leading to a precocious weaning. The number of studies dealing with lactational mastitis is low and, up to now, the etiological diagnosis is frequently made on the basis of unspecific clinical signs. The aim of this study was to investigate the microbial diversity of breast milk in 20 women with lactational mastitis employing culture-dependent and culture-independent (PCR-DGGE) approaches. Breast milk samples were cultured in different media to investigate the presence of bacteria and/or yeasts, and a total of 149 representative isolates were identified to the species level by 16S rRNA gene PCR sequencing. The microorganisms recovered were compared with those found by PCR-DGGE analysis. To identify the DGGE profiles two reference markers of different microbial species were constructed. Sequence analysis of unknown bands was also performed. Staphylococci were the dominant bacterial group and Staphylococcus epidermidis was the dominant species. In a lower number of samples, other bacteria (mainly streptococci and a few gram-negative species) were also identified. Globally, PCR-DGGE results showed a good correlation with those obtained by culture-based methods. However, although DNA bands corresponding to different lactic acid bacteria were detected, such bacteria could not be isolated from the milk samples. Staphylococci seem to be the main etiological agents of human lactational mastitis. The combined use of culture and molecular techniques allowed a better characterization of the bacterial diversity in milk from women suffering from infectious mastitis. Our results suggest that this condition could be the result of a disbiotic process where some of the bacterial species usually present in human milk outgrow (staphylococci) while others disappear (lactobacilli or lactococci).
Zou, Lingyun; Nan, Chonghan; Hu, Fuquan
2013-12-15
Various human pathogens secret effector proteins into hosts cells via the type IV secretion system (T4SS). These proteins play important roles in the interaction between bacteria and hosts. Computational methods for T4SS effector prediction have been developed for screening experimental targets in several isolated bacterial species; however, widely applicable prediction approaches are still unavailable In this work, four types of distinctive features, namely, amino acid composition, dipeptide composition, .position-specific scoring matrix composition and auto covariance transformation of position-specific scoring matrix, were calculated from primary sequences. A classifier, T4EffPred, was developed using the support vector machine with these features and their different combinations for effector prediction. Various theoretical tests were performed in a newly established dataset, and the results were measured with four indexes. We demonstrated that T4EffPred can discriminate IVA and IVB effectors in benchmark datasets with positive rates of 76.7% and 89.7%, respectively. The overall accuracy of 95.9% shows that the present method is accurate for distinguishing the T4SS effector in unidentified sequences. A classifier ensemble was designed to synthesize all single classifiers. Notable performance improvement was observed using this ensemble system in benchmark tests. To demonstrate the model's application, a genome-scale prediction of effectors was performed in Bartonella henselae, an important zoonotic pathogen. A number of putative candidates were distinguished. A web server implementing the prediction method and the source code are both available at http://bioinfo.tmmu.edu.cn/T4EffPred.
Lazzi, C; Rossetti, L; Zago, M; Neviani, E; Giraffa, G
2004-01-01
To detect bacteria present in controlled dairy ecosystems with defined composition by length-heterogeneity (LH)-PCR. LH-PCR allows to distinguish different organisms on the basis of natural variations in the length of 16S rRNA gene sequences. LH-PCR was applied to depict population structure of the lactic acid bacteria (LAB) species recoverable from Grana Padano cheese whey starters. Typical bacterial species present in the LAB community were evidenced and well discriminated. Small differences in species composition, e.g. the frequent finding of Streptococcus thermophilus and the constant presence of thermophilic lactobacilli (Lactobacillus helveticus, Lact. delbrueckii subsp. lactis/bulgaricus and Lact. fermentum) were reliably highlighted. Specificity of LH-PCR was confirmed by species-specific PCR from total DNA of the cultures. LH-PCR is a useful tool to monitor microbial composition and population dynamics in dairy starter cultures. When present, non-dominant bacterial species present in the whey starters, such as Strep. thermophilus, can easily be visualized and characterized without isolating and cultivating single strains. A similar approach can be applied to more complex dairy ecosystems such as milk or cheese curd. Community members and differences in population structure of controlled dairy ecosystems such as whey starters for hard cheeses can be evaluated and compared in a relative easy, fast, reliable and highly reproducible way.
Contreras, Roberto; Figueiras, Ana M; Gallego, F Javier; Benavente, Elena; Manzaneda, Antonio J; Benito, César
2017-11-01
Aluminium (Al) toxicity is the main abiotic stress limiting plant productivity in acidic soils that are widely distributed among arable lands. Plant species differ in the level of Al resistance showing intraspecific and interspecific variation in many crop species. However, the origin of Al-tolerance is not well known. Three annual species, difficult to distinguish phenotypically and that were until recently misinterpreted as a single complex species under Brachypodium distachyon , have been recently separated into three distinct species: the diploids B. distachyon (2 n = 10) and B. stacei (2 n = 20), and B. hybridum (2 n = 30), the allotetraploid derived from the two diploid species. The aims of this work were to know the origin of Al-tolerance in acidic soil conditions within these three Brachypodium species and to develop new DNA markers for species discrimination. Two multiplex SSR-PCRs allowed to genotype a group of 94 accessions for 17 pentanucleotide microsatellite (SSRs) loci. The variability for 139 inter-microsatellite (ISSRs) markers was also examined. The genetic relationships obtained using those neutral molecular markers (SSRs and ISSRs) support that all Al-tolerant allotetraploid accessions of B. hybridum have a common origin that is related with both geographic location and acidic soils. The possibility that the adaptation to acidic soils caused the isolation of the tolerant B. hybridum populations from the others is discussed. We finally describe a new, easy, DNA barcoding method based in the upstream-intron 1 region of the ALMT1 gene, a tool that is 100 % effective to distinguish among these three Brachypodium species.
Contreras, Roberto; Figueiras, Ana M; Gallego, F Javier; Benavente, Elena; Manzaneda, Antonio J
2017-01-01
Abstract Aluminium (Al) toxicity is the main abiotic stress limiting plant productivity in acidic soils that are widely distributed among arable lands. Plant species differ in the level of Al resistance showing intraspecific and interspecific variation in many crop species. However, the origin of Al-tolerance is not well known. Three annual species, difficult to distinguish phenotypically and that were until recently misinterpreted as a single complex species under Brachypodium distachyon, have been recently separated into three distinct species: the diploids B. distachyon (2n = 10) and B. stacei (2n = 20), and B. hybridum (2n = 30), the allotetraploid derived from the two diploid species. The aims of this work were to know the origin of Al-tolerance in acidic soil conditions within these three Brachypodium species and to develop new DNA markers for species discrimination. Two multiplex SSR-PCRs allowed to genotype a group of 94 accessions for 17 pentanucleotide microsatellite (SSRs) loci. The variability for 139 inter-microsatellite (ISSRs) markers was also examined. The genetic relationships obtained using those neutral molecular markers (SSRs and ISSRs) support that all Al-tolerant allotetraploid accessions of B. hybridum have a common origin that is related with both geographic location and acidic soils. The possibility that the adaptation to acidic soils caused the isolation of the tolerant B. hybridum populations from the others is discussed. We finally describe a new, easy, DNA barcoding method based in the upstream-intron 1 region of the ALMT1 gene, a tool that is 100 % effective to distinguish among these three Brachypodium species. PMID:29302302
Wang, Jianming; Zhang, Tianhan; Li, Liping; Li, Jingwen; Feng, Yiming; Lu, Qi
2017-01-01
Dryland ecosystems cover more than 30% of the terrestrial area of China, while processes that shape the biogeographic patterns of bacterial and fungal β-diversity have rarely been evaluated synchronously. To compare the biogeographic patterns and its drivers of bacterial and fungal β-diversity, we collected 62 soil samples from a typical dryland region of northwest China. We assessed bacterial and fungal communities by sequencing bacterial 16S rRNA gene and fungal ITS data. Meanwhile, the β-diversity was decomposed into two components: species replacement (species turnover) and nestedness to further explore the bacterial and fungal β-diversity patterns and its causes. The results show that both bacterial and fungal β-diversity were derived almost entirely from species turnover rather than from species nestedness. Distance-decay relationships confirmed that the geographic patterns of bacterial and fungal β-diversity were significantly different. Environmental factors had the dominant influence on both the bacterial and fungal β-diversity and species turnover, however, the role of geographic distance varied across bacterial and fungal communities. Furthermore, both bacterial and fungal nestedness did not significantly respond to the environmental and geographic distance. Our findings suggest that the different response of bacterial and fungal species turnover to dispersal limitation and other, unknown processes may result in different biogeographic patterns of bacterial and fungal β-diversity in the drylands of northwest China. Together, we highlight that the drivers of β-diversity patterns vary between bacterial and fungal communities, and microbial β-diversity are driven by multiple factors in the drylands of northwest China.
Singhal, Kopal; Khanna, Radhika; Mohanty, Sujata
2017-06-01
The present work aims to identify the microbial diversity associated with six Indian Drosophila species using next generation sequencing (NGS) technology and to discover the nature of their distribution across species and eco-geographic regions. Whole fly gDNA of six Drosophila species were used to generate sequences in an Illumina platform using NGS technology. De novo based assembled raw reads were blasted against the NR database of NCBI using BLASTn for identification of their bacterial loads. We have tried to include Drosophila species from different taxonomical groups and subgroups and from three different eco-climatic regions India; four species belong to Central India, while the rest two, D. melanogaster and D. ananassae, belong to West and South India to determine both their species-wise and region-wide distribution. We detected the presence of 33 bacterial genera across all six study species, predominated by the class Proteobacteria. Amongst all, D. melanogaster was found to be the most diverse by carrying around 85% of the bacterial diversity. Our findings infer both species-specific and environment-specific nature of the bacterial species inhabiting the Drosophila host. Though the present results are consistent with most of the earlier studies, they also remain incoherent with some. The present study outcome on the host-bacteria association and their species specific adaptation may provide some insight to understand the host-microbial interactions and the phenotypic implications of microbes on the host physiology. The knowledge gained may be importantly applied into the recent insect and pest population control strategy going to implement through gut microflora in India and abroad.
Host plant species determines symbiotic bacterial community mediating suppression of plant defenses.
Chung, Seung Ho; Scully, Erin D; Peiffer, Michelle; Geib, Scott M; Rosa, Cristina; Hoover, Kelli; Felton, Gary W
2017-01-03
Herbivore associated bacteria are vital mediators of plant and insect interactions. Host plants play an important role in shaping the gut bacterial community of insects. Colorado potato beetles (CPB; Leptinotarsa decemlineata) use several Solanum plants as hosts in their natural environment. We previously showed that symbiotic gut bacteria from CPB larvae suppressed jasmonate (JA)-induced defenses in tomato. However, little is known about how changes in the bacterial community may be involved in the manipulation of induced defenses in wild and cultivated Solanum plants of CPB. Here, we examined suppression of JA-mediated defense in wild and cultivated hosts of CPB by chemical elicitors and their symbiotic bacteria. Furthermore, we investigated associations between the gut bacterial community and suppression of plant defenses using 16 S rRNA amplicon sequencing. Symbiotic bacteria decreased plant defenses in all Solanum hosts and there were different gut bacterial communities in CPB fed on different host plants. When larvae were reared on different hosts, defense suppression differed among host plants. These results demonstrate that host plants influence herbivore gut bacterial communities and consequently affect the herbivore's ability to manipulate JA-mediated plant defenses. Thus, the presence of symbiotic bacteria that suppress plant defenses might help CPB adapt to host plants.
Host plant species determines symbiotic bacterial community mediating suppression of plant defenses
Chung, Seung Ho; Scully, Erin D.; Peiffer, Michelle; Geib, Scott M.; Rosa, Cristina; Hoover, Kelli; Felton, Gary W.
2017-01-01
Herbivore associated bacteria are vital mediators of plant and insect interactions. Host plants play an important role in shaping the gut bacterial community of insects. Colorado potato beetles (CPB; Leptinotarsa decemlineata) use several Solanum plants as hosts in their natural environment. We previously showed that symbiotic gut bacteria from CPB larvae suppressed jasmonate (JA)-induced defenses in tomato. However, little is known about how changes in the bacterial community may be involved in the manipulation of induced defenses in wild and cultivated Solanum plants of CPB. Here, we examined suppression of JA-mediated defense in wild and cultivated hosts of CPB by chemical elicitors and their symbiotic bacteria. Furthermore, we investigated associations between the gut bacterial community and suppression of plant defenses using 16 S rRNA amplicon sequencing. Symbiotic bacteria decreased plant defenses in all Solanum hosts and there were different gut bacterial communities in CPB fed on different host plants. When larvae were reared on different hosts, defense suppression differed among host plants. These results demonstrate that host plants influence herbivore gut bacterial communities and consequently affect the herbivore’s ability to manipulate JA-mediated plant defenses. Thus, the presence of symbiotic bacteria that suppress plant defenses might help CPB adapt to host plants. PMID:28045052
Iyer, Lakshminarayan M.; Zhang, Dapeng; Rogozin, Igor B.; Aravind, L.
2011-01-01
The deaminase-like fold includes, in addition to nucleic acid/nucleotide deaminases, several catalytic domains such as the JAB domain, and others involved in nucleotide and ADP-ribose metabolism. Using sensitive sequence and structural comparison methods, we develop a comprehensive natural classification of the deaminase-like fold and show that its ancestral version was likely to operate on nucleotides or nucleic acids. Consequently, we present evidence that a specific group of JAB domains are likely to possess a DNA repair function, distinct from the previously known deubiquitinating peptidase activity. We also identified numerous previously unknown clades of nucleic acid deaminases. Using inference based on contextual information, we suggest that most of these clades are toxin domains of two distinct classes of bacterial toxin systems, namely polymorphic toxins implicated in bacterial interstrain competition and those that target distantly related cells. Genome context information suggests that these toxins might be delivered via diverse secretory systems, such as Type V, Type VI, PVC and a novel PrsW-like intramembrane peptidase-dependent mechanism. We propose that certain deaminase toxins might be deployed by diverse extracellular and intracellular pathogens as also endosymbionts as effectors targeting nucleic acids of host cells. Our analysis suggests that these toxin deaminases have been acquired by eukaryotes on several independent occasions and recruited as organellar or nucleo-cytoplasmic RNA modifiers, operating on tRNAs, mRNAs and short non-coding RNAs, and also as mutators of hyper-variable genes, viruses and selfish elements. This scenario potentially explains the origin of mutagenic AID/APOBEC-like deaminases, including novel versions from Caenorhabditis, Nematostella and diverse algae and a large class of fast-evolving fungal deaminases. These observations greatly expand the distribution of possible unidentified mutagenic processes catalyzed by
Morphodynamics of growing bacterial colony
NASA Astrophysics Data System (ADS)
Ghosh, Pushpita; Perlekar, Prasad; Rana, Navdeep
Self-organization into multicellular communities is a natural trend of most of the bacteria. Mutual interactions and competition among the bacterial cells in such multicellular organization play essential role in governing the spatiotemporal dynamics. We here present the spatiotemporal dynamics of growing bacterial colony using theory and a particle-based or individual-based simulation model of nonmotile cells growing utilizing a diffusing nutrient/food on a semi-solid surface by their growth and division forces and by pushing each-other through sliding motility. We show how the resource competition over a fixed amount of food, the diffusion coefficient of the nutrient and the random genetic noise govern the morphodynamics of a single species and a well-mixed two-species bacterial colonies. Our results show that for a very low initial food concentrations, colony develops fingering pattern at the front, while for intermediate values of initial food sources, the colony undergoes transitions to branched structures at the periphery and for very high values of food colony develops smoother fronts.
The Evolution of Stomach Acidity and Its Relevance to the Human Microbiome
Beasley, DeAnna E.; Koltz, Amanda M.; Lambert, Joanna E.; Fierer, Noah; Dunn, Rob R.
2015-01-01
Gastric acidity is likely a key factor shaping the diversity and composition of microbial communities found in the vertebrate gut. We conducted a systematic review to test the hypothesis that a key role of the vertebrate stomach is to maintain the gut microbial community by filtering out novel microbial taxa before they pass into the intestines. We propose that species feeding either on carrion or on organisms that are close phylogenetic relatives should require the most restrictive filter (measured as high stomach acidity) as protection from foreign microbes. Conversely, species feeding on a lower trophic level or on food that is distantly related to them (e.g. herbivores) should require the least restrictive filter, as the risk of pathogen exposure is lower. Comparisons of stomach acidity across trophic groups in mammal and bird taxa show that scavengers and carnivores have significantly higher stomach acidities compared to herbivores or carnivores feeding on phylogenetically distant prey such as insects or fish. In addition, we find when stomach acidity varies within species either naturally (with age) or in treatments such as bariatric surgery, the effects on gut bacterial pathogens and communities are in line with our hypothesis that the stomach acts as an ecological filter. Together these results highlight the importance of including measurements of gastric pH when investigating gut microbial dynamics within and across species. PMID:26222383
The Evolution of Stomach Acidity and Its Relevance to the Human Microbiome.
Beasley, DeAnna E; Koltz, Amanda M; Lambert, Joanna E; Fierer, Noah; Dunn, Rob R
2015-01-01
Gastric acidity is likely a key factor shaping the diversity and composition of microbial communities found in the vertebrate gut. We conducted a systematic review to test the hypothesis that a key role of the vertebrate stomach is to maintain the gut microbial community by filtering out novel microbial taxa before they pass into the intestines. We propose that species feeding either on carrion or on organisms that are close phylogenetic relatives should require the most restrictive filter (measured as high stomach acidity) as protection from foreign microbes. Conversely, species feeding on a lower trophic level or on food that is distantly related to them (e.g. herbivores) should require the least restrictive filter, as the risk of pathogen exposure is lower. Comparisons of stomach acidity across trophic groups in mammal and bird taxa show that scavengers and carnivores have significantly higher stomach acidities compared to herbivores or carnivores feeding on phylogenetically distant prey such as insects or fish. In addition, we find when stomach acidity varies within species either naturally (with age) or in treatments such as bariatric surgery, the effects on gut bacterial pathogens and communities are in line with our hypothesis that the stomach acts as an ecological filter. Together these results highlight the importance of including measurements of gastric pH when investigating gut microbial dynamics within and across species.
Guirro, Elaine Caldeira de Oliveira; Angelis, Dejanira de Franceschi de; Sousa, Natanael Teixeira Alves de; Guirro, Rinaldo Roberto de Jesus
2016-09-01
Staphylococcus aureus and Escherichia coli are among the major bacterial species that colonize skin ulcers. Therapeutic ultrasound (TUS) produces biophysical effects that are relevant to wound healing; however, its application over a contaminated injury is not evidence-based. The objective of this research was to analyze the effect of TUS on in vitro-isolated S. aureus and E. coli, including the combination of ultrasound and antibiotics, in order to assess their antibiotic action on bacterial susceptibility. For the experiments, the bacterial strains were suspended in saline, then diluted (10(4)CFU/mL) for irradiation (at 1 and 3MHz, 0.5 and 0.8W/cm(2) for 0 and 15min) and the combination treatment of ultrasonication and antibiotics was administered by adding nalidixic acid (S. aureus) and tetracycline (E. coli) at concentrations equivalent to 50% of the minimum inhibitory concentration (MIC). The experiments were carried out in duplicate with six repetitions. The suspensions were inoculated on to Petri plates and incubated at 37°C and the colony forming units (CFUs) were counted after 24h. The results were subjected to the Shapiro-Wilk normality test, followed by parametric ANOVA and Tukey's post hoc test at a significance level of 1%. The results demonstrated that the action of TUS at 1MHz inhibited bacterial growth while at 3MHz, bacterial growth was observed in both species. However, the synergistic combination of ultrasound and antibiotics was able to inhibit the growth of both bacteria completely after 15min of ultrasonication. The results suggest that the action of ultrasound on S. aureus and E. coli are dependent on the oscillation frequency as well as the intensity and time of application. The combination of ultrasound with antibiotics was able to inhibit bacterial growth fully at all frequencies and doses in both species. Copyright © 2016 Elsevier B.V. All rights reserved.
Bacterial glycobiology: rhamnose-containing cell wall polysaccharides in Gram-positive bacteria
Mistou, Michel-Yves; Sutcliffe, Iain C.; van Sorge, Nina M.
2016-01-01
The composition of the Gram-positive cell wall is typically described as containing peptidoglycan, proteins and essential secondary cell wall structures called teichoic acids, which comprise approximately half of the cell wall mass. The cell walls of many species within the genera Streptococcus, Enterococcus and Lactococcus contain large amounts of the sugar rhamnose, which is incorporated in cell wall-anchored polysaccharides (CWP) that possibly function as homologues of well-studied wall teichoic acids (WTA). The presence and chemical structure of many rhamnose-containing cell wall polysaccharides (RhaCWP) has sometimes been known for decades. In contrast to WTA, insight into the biosynthesis and functional role of RhaCWP has been lacking. Recent studies in human streptococcal and enterococcal pathogens have highlighted critical roles for these complex polysaccharides in bacterial cell wall architecture and pathogenesis. In this review, we provide an overview of the RhaCWP with regards to their biosynthesis, genetics and biological function in species most relevant to human health. We also briefly discuss how increased knowledge in this field can provide interesting leads for new therapeutic compounds and improve biotechnological applications. PMID:26975195
Bacterial glycobiology: rhamnose-containing cell wall polysaccharides in Gram-positive bacteria.
Mistou, Michel-Yves; Sutcliffe, Iain C; van Sorge, Nina M
2016-07-01
The composition of the Gram-positive cell wall is typically described as containing peptidoglycan, proteins and essential secondary cell wall structures called teichoic acids, which comprise approximately half of the cell wall mass. The cell walls of many species within the genera Streptococcus, Enterococcus and Lactococcus contain large amounts of the sugar rhamnose, which is incorporated in cell wall-anchored polysaccharides (CWP) that possibly function as homologues of well-studied wall teichoic acids (WTA). The presence and chemical structure of many rhamnose-containing cell wall polysaccharides (RhaCWP) has sometimes been known for decades. In contrast to WTA, insight into the biosynthesis and functional role of RhaCWP has been lacking. Recent studies in human streptococcal and enterococcal pathogens have highlighted critical roles for these complex polysaccharides in bacterial cell wall architecture and pathogenesis. In this review, we provide an overview of the RhaCWP with regards to their biosynthesis, genetics and biological function in species most relevant to human health. We also briefly discuss how increased knowledge in this field can provide interesting leads for new therapeutic compounds and improve biotechnological applications. © FEMS 2016.
Lu, Yao; Harrington, Peter B
2010-08-01
Direct methylation and solid-phase microextraction (SPME) were used as a sample preparation technique for classification of bacteria based on fatty acid methyl ester (FAME) profiles. Methanolic tetramethylammonium hydroxide was applied as a dual-function reagent to saponify and derivatize whole-cell bacterial fatty acids into FAMEs in one step, and SPME was used to extract the bacterial FAMEs from the headspace. Compared with traditional alkaline saponification and sample preparation using liquid-liquid extraction, the method presented in this work avoids using comparatively large amounts of inorganic and organic solvents and greatly decreases the sample preparation time as well. Characteristic gas chromatography/mass spectrometry (GC/MS) of FAME profiles was achieved for six bacterial species. The difference between Gram-positive and Gram-negative bacteria was clearly visualized with the application of principal component analysis of the GC/MS data of bacterial FAMEs. A cross-validation study using ten bootstrap Latin partitions and the fuzzy rule building expert system demonstrated 87 +/- 3% correct classification efficiency.
Davies, K G; Rowe, J A; Williamson, V M
2008-06-01
Specific host-parasite interactions exist between species and strains of plant parasitic root-knot nematodes and the Gram-positive bacterial hyperparasite Pasteuria penetrans. This bacterium produces endospores that adhere to the cuticle of migrating juveniles, germinate and colonise the developing female within roots. Endospore attachment of P. penetrans populations to second-stage juveniles of the root-knot nematode species Meloidogyne incognita and Meloidogyne hapla showed there were interactive differences between bacterial populations and nematode species. Infected females of M. incognita produced a few progeny which were used to establish two nematode lines from single infective juveniles encumbered with either three or 26 endospores. Single juvenile descent lines of each nematode species were produced to test whether cuticle variation was greater within M. hapla lines that reproduce by facultative meiotic parthenogenesis than within lines of M. incognita, which reproduces by obligate parthenogenesis. Assays revealed variability between broods of individual females derived from single second-stage juvenile descent lines of both M. incognita and M. hapla suggesting that progeny derived from a single individual can differ in spore adhesion in both sexual and asexual nematode species. These results suggest that special mechanisms that produced these functional differences in the cuticle surface may have evolved in both sexually and asexually reproducing nematodes as a strategy to circumvent infection by this specialised hyperparasite.
Zanetti, F; De Luca, G; Sacchetti, R; Stampi, S
2007-11-01
The aim of the study was to assess the efficiency of low doses of peracetic acid against viral and bacterial indicators in wastewater and to evaluate if the treatment allows regulatory requirements to be satisfied. A total of 31 samplings were carried out, each involving the collection of secondary effluent and of effluent disinfected with 1.2 or 1.5 mg l(-1) of peracetic acid (contact time 20 minutes). In each sample were measured: somatic coliphages, F-specific RNA bacteriophages, Escherichia coli, total and faecal coliforms, enterococci. Peracetic acid disinfection showed significant differences between the reductions of the microorganisms tested: E. coli showed the highest reduction (1.78 and 2.43 Log respectively with 1.2 and 1.5 mg l(-1) of peracetic acid) and phages the lowest (ranging between 0.52 and 0.60 Log). Only a concentration of 1.5 mg l(-1) of peracetic acid would enable the effluent to be discharged into surface waters in compliance with Italian regulations. The variability of microbial resistance against the peracetic acid disinfection treatment, underlines the importance of assessing disinfection efficiency by using more than one indicator microorganism. The detection of E. coli could be usefully accompanied by tests for more resistant microorganisms such as enterococci or coliphages. In conclusion, peracetic acid can be used for the disinfection of effluents even at low doses, with the advantage of reducing costs and preventing the formation of significant amounts of genotoxic by-products.
Menasria, Taha; Tine, Samir; Mahcene, Djaouida; Benammar, Leyla; Megri, Rochdi; Boukoucha, Mourad; Debabza, Manel
2015-04-01
A study was performed to estimate the prevalence of the external bacterial flora of two domestic cockroaches (Blattella germanica and Blatta orientalis) collected from households in Tebessa (northeast Algeria). Three major bacterial groups were cultured (total aerobic, enterobacteria, and staphylococci) from 14 specimens of cockroaches, and antibiotic susceptibility was tested for both Staphylococcus and Pseudomonas isolates. Culturing showed that the total bacterial load of cockroaches from different households were comparable (P<0.001) and enterobacteria were the predominant colonizers of the insect surface, with a bacterial load of (2.1 × 10⁵ CFU/insect), whereas the staphylococci group was the minority. Twenty-eight bacterial species were isolated, and susceptibility patterns showed that most of the staphylococci isolates were highly susceptible to chloramphenicol, gentamycin, pristinamycin, ofloxacin, clindamycin, and vancomycin; however, Pseudomonas strains exhibited resistance to amoxicillin/clavulanic acid, imipenem, and the second-generation antibiotic cephalosporin cefuroxime. Copyright © 2015 The Editorial Board of Biomedical and Environmental Sciences. Published by China CDC. All rights reserved.
Plant-plant competition outcomes are modulated by plant effects on the soil bacterial community.
Hortal, S; Lozano, Y M; Bastida, F; Armas, C; Moreno, J L; Garcia, C; Pugnaire, F I
2017-12-19
Competition is a key process that determines plant community structure and dynamics, often mediated by nutrients and water availability. However, the role of soil microorganisms on plant competition, and the links between above- and belowground processes, are not well understood. Here we show that the effects of interspecific plant competition on plant performance are mediated by feedbacks between plants and soil bacterial communities. Each plant species selects a singular community of soil microorganisms in its rhizosphere with a specific species composition, abundance and activity. When two plant species interact, the resulting soil bacterial community matches that of the most competitive plant species, suggesting strong competitive interactions between soil bacterial communities as well. We propose a novel mechanism by which changes in belowground bacterial communities promoted by the most competitive plant species influence plant performance and competition outcome. These findings emphasise the strong links between plant and soil communities, paving the way to a better understanding of plant community dynamics and the effects of soil bacterial communities on ecosystem functioning and services.
Kang, Jie; Thakali, Keshari M; Jensen, Gitte S; Wu, Xianli
2015-03-01
Highbush (cultivated) and lowbush (wild) are the two major blueberry species in the US market. Eight phenolic acids were detected and quantified from these two species by HPLC-MS. Chlorogenic acid was found to be the predominant phenolic acid in both species, with 0.44 mg/g fresh weight in lowbush blueberries and 0.13 mg/g fresh weight in highbush blueberries. Total phenolic content in lowbush blueberries is over three times higher than that of highbush blueberries. The phenolic acid mixtures representing those in the two species were prepared by using authentic standards to assess their contribution to total antioxidant and anti-inflammatory activities of the whole berries. Neither lowbush nor highbush blueberry phenolic acid mixture contributed significantly to the total antioxidant capacity of their relevant whole berries measured by oxygen radical absorbance capacity (ORAC). Both phenolic acid mixtures were able to enter the cell and showed in cell antioxidant activities from the cell based antioxidant protection of erythrocytes (CAP-e) assay. Lowbush blueberry phenolic acid mixture was found to show anti-inflammatory activities by inhibiting the nuclear factor-κB (NF-κB) activation and the production of inflammatory cytokines (TNF-α and IL-6) at the high dose.
NASA Astrophysics Data System (ADS)
Tani, Atsushi; Fukui, Satoshi; Ikawa, Satoshi; Kitano, Katsuhisa
2015-10-01
We investigated fatty acid oxidation by atmospheric-pressure nonthermal helium plasma using linoleic acid, an unsaturated fatty acid, together with evaluating active species induced in liquids. If the ambient gas contains oxygen, direct plasma such as plasma jets coming into contact with the liquid surface supplies various active species, such as singlet oxygen, ozone, and superoxide anion radicals, to the liquid. The direct plasma easily oxidizes linoleic acid, indicating that fatty acid oxidation will occur in the direct plasma. In contrast, afterglow flow, where the plasma is terminated in a glass tube and does not touch the surface of the liquid sample, supplies mainly superoxide anion radicals. The fact that there was no clear observation of linoleic acid oxidation using the afterglow reveals that it may not affect lipids, even in an atmosphere containing oxygen. The afterglow flow can potentially be used for the sterilization of aqueous solutions using the reduced pH method, in medical and dental applications, because it provides bactericidal activity in the aqueous solution despite containing a smaller amount of active species.
Detection of bacterial pathogens including potential new species in human head lice from Mali
Amanzougaghene, Nadia; Fenollar, Florence; Sangaré, Abdoul Karim; Sissoko, Mahamadou S.; Doumbo, Ogobara K.; Raoult, Didier
2017-01-01
In poor African countries, where no medical and biological facilities are available, the identification of potential emerging pathogens of concern at an early stage is challenging. Head lice, Pediculus humanus capitis, have a short life, feed only on human blood and do not transmit pathogens to their progeny. They are, therefore, a perfect tool for the xenodiagnosis of current or recent human infection. This study assessed the occurrence of bacterial pathogens from head lice collected in two rural villages from Mali, where a high frequency of head lice infestation had previously been reported, using molecular methods. Results show that all 600 head lice, collected from 117 individuals, belonged to clade E, specific to West Africa. Bartonella quintana, the causative agent of trench fever, was identified in three of the 600 (0.5%) head lice studied. Our study also shows, for the first time, the presence of the DNA of two pathogenic bacteria, namely Coxiella burnetii (5.1%) and Rickettsia aeschlimannii (0.6%), detected in human head lice, as well as the DNA of potential new species from the Anaplasma and Ehrlichia genera of unknown pathogenicity. The finding of several Malian head lice infected with B. quintana, C. burnetii, R. aeschlimannii, Anaplasma and Ehrlichia is alarming and highlights the need for active survey programs to define the public health consequences of the detection of these emerging bacterial pathogens in human head lice. PMID:28931077
Feder, Stefan; Lehmann, Stefanie; Kullnick, Yvonne; Buschmann, Tilo; Blumert, Conny; Horn, Friedemann; Neuhaus, Jochen; Neujahr, Ralph; Bagaev, Erik; Hagl, Christian; Pichlmaier, Maximilian; Rodloff, Arne Christian; Gräber, Sandra; Kirsch, Katharina; Sandri, Marcus; Kumbhari, Vivek; Behzadi, Armirhossein; Behzadi, Amirali; Correia, Joao Carlos; Mohr, Friedrich Wilhelm
2017-01-01
Aims In infective endocarditis (IE), a severe inflammatory disease of the endocardium with an unchanged incidence and mortality rate over the past decades, only 1% of the cases have been described as polymicrobial infections based on microbiological approaches. The aim of this study was to identify potential biodiversity of bacterial species from infected native and prosthetic valves. Furthermore, we compared the ultrastructural micro-environments to detect the localization and distribution patterns of pathogens in IE. Material and methods Using next-generation sequencing (NGS) of 16S rDNA, which allows analysis of the entire bacterial community within a single sample, we investigated the biodiversity of infectious bacterial species from resected native and prosthetic valves in a clinical cohort of 8 IE patients. Furthermore, we investigated the ultrastructural infected valve micro-environment by focused ion beam scanning electron microscopy (FIB-SEM). Results Biodiversity was detected in 7 of 8 resected heart valves. This comprised 13 bacterial genera and 16 species. In addition to 11 pathogens already described as being IE related, 5 bacterial species were identified as having a novel association. In contrast, valve and blood culture-based diagnosis revealed only 4 species from 3 bacterial genera and did not show any relevant antibiotic resistance. The antibiotics chosen on this basis for treatment, however, did not cover the bacterial spectra identified by our amplicon sequencing analysis in 4 of 8 cases. In addition to intramural distribution patterns of infective bacteria, intracellular localization with evidence of bacterial immune escape mechanisms was identified. Conclusion The high frequency of polymicrobial infections, pathogen diversity, and intracellular persistence of common IE-causing bacteria may provide clues to help explain the persistent and devastating mortality rate observed for IE. Improved bacterial diagnosis by 16S rDNA NGS that increases the
Healthy n-6/n-3 fatty acid composition from five European game meat species remains after cooking.
Valencak, Teresa G; Gamsjäger, Lisa; Ohrnberger, Sarah; Culbert, Nicole J; Ruf, Thomas
2015-06-27
Intensive farming of livestock along with recent food scandals and consumer deception have increased awareness about risks for human nutrition. In parallel, the demand for meat obtained under more natural conditions from animals that can freely forage has largely increased. Interestingly, the consumption of game meat has not become more common despite its excellent quality and content of polyunsaturated fatty acids (PUFAs). We addressed the question if game meat fatty acid composition is modified through kitchen preparation. By analysing muscle fatty acid (FA) composition (polar and total lipids) of five European game species in a raw and a processed state, we aimed to quantify the proportion of PUFA that are oxidised and hydrogenated during processing. All game meat species originated from local hunters and free-living individuals. To mimic a realistic situation a professional chef prepared the meat samples with gentle use of heat in a standardised way. Expectedly, the overall content of polyunsaturated fatty acids declined during the cooking process but the decrease size was <5% and the nutritiously most important n-3/n-6 ratio was not affected by processing (F1,54 = 0.46; p = 0.5). Generally, our samples contained species-specific high PUFA and n-3 FA contents but we point out that differentiating between species is necessary. Game meat thus provides a healthy meat source, as cooking does not substantially alter its favourable fatty acid composition. Further research is needed to elucidate species-specific differences and the role of habitat quality and locomotion for tissue composition.
Bloom, Paul
2014-02-01
Superficial bacterial folliculitis (SBF) is more common in the dog than other mammalian species. Until recently, a successful outcome in cases of canine SBF was possible by administering a potentiated amoxicillin, a first generation cephalosporin or a potentiated sulfonamide. Unfortunately, this predictable susceptibility has changed, because methicillin resistant Staphylococcus pseudintermedius (MRSP) and Staphylococcus aureus (MRSA) are becoming more prevalent in canine SBF cases. The increasing frequency of multidrug resistance complicates the selection of antimicrobial therapy. Antimicrobial agents that were once rarely used in cases of canine SBF, such as amikacin, rifampicin and chloramphenicol, are becoming the drugs of choice, based on bacterial culture and susceptibility testing. Furthermore, changes in antimicrobial susceptibility have helped to re-emphasize the importance of a multimodal approach to treatment of the disease, including topical therapy. Due to the increasing frequency of identification of highly resistant Staphylococcus spp., topical antimicrobial therapy, including the use of diluted sodium hypochlorite (bleach), is becoming necessary to successfully treat some cases of canine SBF. Other important antiseptics that can be used include chlorhexidine, benzoyl peroxide, ethyl lactate, triclosan and boric acid/acetic acid. This review discusses the diagnostic and therapeutic management of canine SBF, with a special emphasis on treating methicillin resistant staphylococcal infections. Copyright © 2013 Elsevier Ltd. All rights reserved.
Re-engineering of Bacterial Luciferase; For New Aspects of Bioluminescence.
Kim, Da-Som; Choi, Jeong-Ran; Ko, Jeong-Ae; Kim, Kangmin
2018-01-01
Bacterial luminescence is the end-product of biochemical reactions catalyzed by the luciferase enzyme. Nowadays, this fascinating phenomenon has been widely used as reporter and/or sensors to detect a variety of biological and environmental processes. The enhancement or diversification of the luciferase activities will increase the versatility of bacterial luminescence. Here, to establish the strategy for luciferase engineering, we summarized the identity and relevant roles of key amino acid residues modulating luciferase in Vibrio harveyi, a model luminous bacterium. The current opinions on crystal structures and the critical amino acid residues involved in the substrate binding sites and unstructured loop have been delineated. Based on these, the potential target residues and/or parameters for enzyme engineering were also suggested in limited scale. In conclusion, even though the accurate knowledge on the bacterial luciferase is yet to be reported, the structure-guided site-directed mutagenesis approaches targeting the regulatory amino acids will provide a useful platform to re-engineer the bacterial luciferase in the future. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
[Study on anti-bacterium activity of ginkgolic acids and their momomers].
Yang, Xiaoming; Zhu, Wei; Chen, Jun; Qian, Zhiyu; Xie, Jimin
2004-09-01
Ginkgolic acids and their three monomers were separated from ginkgo sarcotestas. The anti-bacterium activity of ginkgolic acids were tested. The relation between the anti-bacterium activity and side chain of ginkgolic acid were studied. The MIC of ginkgolic acids and their three monomers and salicylic acid were tested. Ginkgolic acid has strong inhibitive effect on G+-bacterium. Salicylic acid has no side chain, so no anti-bacterial activity. When the length of gingkolic acid side chain is C13:0, it has the strongest anti-bacterial activity in three monomers. The side chain of ginkgolic acid is the key functional group that possessed anti-bacterial activity. The length of Ginkgolic acid was the main effective factor of anti-bacterial activity.
Wang, Jinxing; Liang, Jidong; Gao, Sha
2018-05-10
Many bacterial strains have been demonstrated to biodegrade lignin for contaminant removal or resource regeneration. The goal of this study was to investigate the biodegradation amount and associated pathways of three lignin monomers, vanillic, p-coumaric, and syringic acid by strain Sphingobacterium sp. HY-H. Vanillic, p-coumaric, and syringic acid degradation with strain HY-H was estimated as 88.71, 76.67, and 72.78%, respectively, after 96 h. Correspondingly, the same three monomers were associated with a COD removal efficiency of 87.30, 55.17, and 67.23%, and a TOC removal efficiency of 82.14, 61.03, and 43.86%. The results of GC-MS, HPLC, FTIR, and enzyme activities show that guaiacol and o-dihydroxybenzene are key intermediate metabolites of the vanillic acid and syringic acid degradation. p-Hydroxybenzoic acid is an important intermediate metabolite for p-coumaric and syringic acid degradation. LiP and MnP play an important role in the degradation of lignin monomers and their intermediate metabolites. One possible pathway is that strain HY-H degrades lignin monomers into guaiacol (through decarboxylic and demethoxy reaction) or p-hydroxybenzoic acid (through side-chain oxidation); then guaiacol demethylates to o-dihydroxybenzene. The p-hydroxybenzoic acid and o-dihydroxybenzene are futher through ring cleavage reaction to form small molecule acids (butyric, valproic, oxalic acid, and propionic acid) and alcohols (ethanol and ethanediol), then these acids and alcohols are finally decomposed into CO 2 and H 2 O through the tricarboxylic acid cycle. If properly optimized and controlled, the strain HY-H may play a role in breaking down lignin-related compounds for biofuel and chemical production.
[Spontaneous bacterial peritonitis].
Velkey, Bálint; Vitális, Eszter; Vitális, Zsuzsanna
2017-01-01
Spontaneous bacterial peritonitis occurs most commonly in cirrhotic patients with ascites. Pathogens get into the circulation by intestinal translocation and colonize in peritoneal fluid. Diagnosis of spontaneous bacterial peritonitis is based on elevated polymorphonuclear leukocyte count in the ascites (>0,25 G/L). Ascites culture is often negative but aids to get information about antibiotic sensitivity in positive cases. Treatment in stable patient can be intravenous then orally administrated ciprofloxacin or amoxicillin/clavulanic acid, while in severe cases intravenous III. generation cephalosporin. Nosocomial spontaneous bacterial peritonitis often caused by Gram-positive bacteria and multi-resistant pathogens can also be expected thus carbapenem should be the choice of the empiric treatment. Antibiotic prophylaxis should be considered. Norfloxacin is used most commonly, but changes are expected due to increase in quinolone resistance. As a primary prophylaxis, a short-term antibiotic treatment is recommended after gastrointestinal bleeding for 5 days, while long-term prophylaxis is for patients with low ascites protein, and advanced disease (400 mg/day). Secondary prophylaxis is recommended for all patients recovered from spontaneous bacterial peritonitis. Due to increasing antibiotic use of antibiotics prophylaxis is debated to some degree. Orv. Hetil., 2017, 158(2), 50-57.
Gardan, L; Dauga, C; Prior, P; Gillis, M; Saddler, G S
2000-01-01
The bacterial leaf-spot of anthurium emerged during the 1980s, in the French West Indies and Trinidad. This new bacterial disease is presently wide spread and constitutes a serious limiting factor for commercial anthurium production. Twenty-nine strains isolated from leaf-spots of naturally infected anthurium were characterized and compared with reference strains belonging to the Comamonadaceae family, the genera Ralstonia and Burkholderia, and representative fluorescent pseudomonads. From artificial inoculations 25 out of 29 strains were pathogenic on anthurium. Biochemical and physiological tests, fatty acid analysis, DNA-DNA hybridization, 16S rRNA gene sequence analysis, DNA-16S RNA hybridization were performed. The 25 pathogenic strains on anthurium were clustered in one phenon closely related to phytopathogenic strains of the genus Acidovorax. Anthurium strains were 79-99% (deltaTm range 0.2-1.6) related to the strain CFBP 3232 and constituted a discrete DNA homology group indicating that they belong to the same species. DNA-rRNA hybridization, 16S rRNA sequence and fatty acid analysis confirmed that this new species belongs to the beta-subclass of Proteobacteria and to rRNA superfamily III, to the family of Comamonadaceae and to the genus Acidovorax. The name Acidovorax anthurii is proposed for this new phytopathogenic bacterium. The type strain has been deposited in the Collection Française des Bactéries Phytopathogènes as CFBP 3232T.
Cárdenas, Anny; Rodriguez-R, Luis M; Pizarro, Valeria; Cadavid, Luis F; Arévalo-Ferro, Catalina
2012-01-01
Coral reefs are deteriorating at an alarming rate mainly as a consequence of the emergence of coral diseases. The white plague disease (WPD) is the most prevalent coral disease in the southwestern Caribbean, affecting dozens of coral species. However, the identification of a single causal agent has proved problematic. This suggests more complex etiological scenarios involving alterations in the dynamic interaction between environmental factors, the coral immune system and the symbiotic microbial communities. Here we compare the microbiome of healthy and WPD-affected corals from the two reef-building species Diploria strigosa and Siderastrea siderea collected at the Tayrona National Park in the Caribbean of Colombia. Microbiomes were analyzed by combining culture-dependent methods and pyrosequencing of 16S ribosomal DNA (rDNA) V5-V6 hypervariable regions. A total of 20 410 classifiable 16S rDNA sequences reads were obtained including all samples. No significant differences in operational taxonomic unit diversity were found between healthy and affected tissues; however, a significant increase of Alphaproteobacteria and a concomitant decrease in the Beta- and Gammaproteobacteria was observed in WPD-affected corals of both species. Significant shifts were also observed in the orders Rhizobiales, Caulobacteriales, Burkholderiales, Rhodobacterales, Aleteromonadales and Xanthomonadales, although they were not consistent between the two coral species. These shifts in the microbiome structure of WPD-affected corals suggest a loss of community-mediated growth control mechanisms on bacterial populations specific for each holobiont system. PMID:21955993