Physiological changes induced in four bacterial strains following oxidative stress.

PubMed

Baatout, S; De Boever, P; Mergeay, M

2006-01-01

In order to study the behaviour and resistance of bacteria under extreme conditions, physiological changes associated with oxidative stress were monitored using flow cytometry. The study was conducted to assess the maintenance of membrane integrity and potential as well as the esterase activity, the intracellular pH and the production of superoxide anions in four bacterial strains (Ralstonia metallidurans, Escherichia coli, Shewanella oneidensis and Deinococcus radiodurans). The strains were chosen for their potential usefulness in bioremediation. Suspensions of R. metallidurans, E. coli, S. oneidensis and D. radiodurans were submitted to 1 h oxidative stress (H2O2 at various concentrations from 0 to 880 mM). Cell membrane permeability (propidium iodide) and potential (rhodamine-123, 3,3'-dihexyloxacarbocyanine iodide), intracellular esterase activity (fluorescein diacetate), intracellular reactive oxygen species concentration (hydroethidine) and intracellular pH (carboxyflurorescein diacetate succinimidyl ester (5(6)) were monitored to evaluate the physiological state and the overall fitness of individual bacterial cells under oxidative stress. The four bacterial strains exhibited varying sensitivities towards H2O2. However, for all bacterial strains, some physiological damage could already be observed from 13.25 mM H2O2 onwards, in particular with regard to their membrane permeability. Depending on the bacterial strains, moderate to high physiological damage could be observed between 13.25 mM and 220 mM H2O2. Membrane potential, esterase activity, intracellular pH and production of superoxide anion production were considerably modified at high H2O2 concentrations in all four strains. In conclusion, we show that a range of significant physiological alterations occurs when bacteria are challenged with H2O2 and fluorescent staining methods coupled with flow cytometry are useful for monitoring the changes induced not only by oxidative stress but also by other

Production of Succinic Acid from Citric Acid and Related Acids by Lactobacillus Strains

PubMed Central

Kaneuchi, Choji; Seki, Masako; Komagata, Kazuo

1988-01-01

A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, α-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli. PMID:16347795

Production of succinic Acid from citric Acid and related acids by lactobacillus strains.

PubMed

Kaneuchi, C; Seki, M; Komagata, K

1988-12-01

A number of Lactobacillus strains produced succinic acid in de Man-Rogosa-Sharpe broth to various extents. Among 86 fresh isolates from fermented cane molasses in Thailand, 30 strains (35%) produced succinic acid; namely, 23 of 39 Lactobacillus reuteri strains, 6 of 18 L. cellobiosus strains, and 1 of 6 unidentified strains. All of 10 L. casei subsp. casei strains, 5 L. casei subsp. rhamnosus strains, 6 L. mali strains, and 2 L. buchneri strains did not produce succinic acid. Among 58 known strains including 48 type strains of different Lactobacillus species, the strains of L. acidophilus, L. crispatus, L. jensenii, and L. parvus produced succinic acid to the same extent as the most active fresh isolates, and those of L. alimentarius, L. collinoides, L. farciminis, L. fructivorans (1 of 2 strains tested), L. malefermentans, and L. reuteri were also positive, to lesser extents. Diammonium citrate in de Man-Rogosa-Sharpe broth was determined as a precursor of the succinic acid produced. Production rates were about 70% on a molar basis with two fresh strains tested. Succinic acid was also produced from fumaric and malic acids but not from dl-isocitric, alpha-ketoglutaric, and pyruvic acids. The present study is considered to provide the first evidence on the production of succinic acid, an important flavoring substance in dairy products and fermented beverages, from citrate by lactobacilli.

Bacterial fatty acid metabolism in modern antibiotic discovery.

PubMed

Yao, Jiangwei; Rock, Charles O

2017-11-01

Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.

StrainSeeker: fast identification of bacterial strains from raw sequencing reads using user-provided guide trees.

PubMed

Roosaare, Märt; Vaher, Mihkel; Kaplinski, Lauris; Möls, Märt; Andreson, Reidar; Lepamets, Maarja; Kõressaar, Triinu; Naaber, Paul; Kõljalg, Siiri; Remm, Maido

2017-01-01

Fast, accurate and high-throughput identification of bacterial isolates is in great demand. The present work was conducted to investigate the possibility of identifying isolates from unassembled next-generation sequencing reads using custom-made guide trees. A tool named StrainSeeker was developed that constructs a list of specific k -mers for each node of any given Newick-format tree and enables the identification of bacterial isolates in 1-2 min. It uses a novel algorithm, which analyses the observed and expected fractions of node-specific k -mers to test the presence of each node in the sample. This allows StrainSeeker to determine where the isolate branches off the guide tree and assign it to a clade whereas other tools assign each read to a reference genome. Using a dataset of 100 Escherichia coli isolates, we demonstrate that StrainSeeker can predict the clades of E. coli with 92% accuracy and correct tree branch assignment with 98% accuracy. Twenty-five thousand Illumina HiSeq reads are sufficient for identification of the strain. StrainSeeker is a software program that identifies bacterial isolates by assigning them to nodes or leaves of a custom-made guide tree. StrainSeeker's web interface and pre-computed guide trees are available at http://bioinfo.ut.ee/strainseeker. Source code is stored at GitHub: https://github.com/bioinfo-ut/StrainSeeker.

Bacterial utilization of L-sugars and D-amino acids

NASA Astrophysics Data System (ADS)

Pikuta, Elena V.; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

2006-08-01

The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group-radicals was described a relatively long time ago. Louis Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have the capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice as high. Another alkaliphilic strain SCA T (= ATCC BAA-1084 T = JCM 12857 T = DSM 17722 T = CIP 107910 T) was found to be capable of growth on L-ribose and L-arabinose. It is interesting that this strain was incapable of growth on D-arabinose, which suggests the involvement of some alternative mechanism of enzyme activity. In this paper, we describe the preliminary results of

Recovery of succinic acid produced by fermentation of a metabolically engineered Mannheimia succiniciproducens strain.

PubMed

Song, Hyohak; Huh, Yun Suk; Lee, Sang Yup; Hong, Won Hi; Hong, Yeon Ki

2007-12-01

There have recently been much advances in the production of succinic acid, an important four-carbon dicarboxylic acid for many industrial applications, by fermentation of several natural and engineered bacterial strains. Mannheimia succiniciproducens MBEL55E isolated from bovine rumen is able to produce succinic acid with high efficiency, but also produces acetic, formic and lactic acids just like other anaerobic succinic acid producers. We recently reported the development of an engineered M. succiniciproducens LPK7 strain which produces succinic acid as a major fermentation product while producing much reduced by-products. Having an improved succinic acid producer developed, it is equally important to develop a cost-effective downstream process for the recovery of succinic acid. In this paper, we report the development of a simpler and more efficient method for the recovery of succinic acid. For the recovery of succinic acid from the fermentation broth of LPK7 strain, a simple process composed of a single reactive extraction, vacuum distillation, and crystallization yielded highly purified succinic acid (greater than 99.5% purity, wt%) with a high yield of 67.05wt%. When the same recovery process or even multiple reactive extraction steps were applied to the fermentation broth of MBEL55E, lower purity and yield of succinic acid were obtained. These results suggest that succinic acid can be purified in a cost-effective manner by using the fermentation broth of engineered LPK7 strain, showing the importance of integrating the strain development, fermentation and downstream process for optimizing the whole processes for succinic acid production.

Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives.

PubMed

Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

2015-10-01

The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils.

Antimicrobial effect against different bacterial strains and bacterial adaptation to essential oils used as feed additives

PubMed Central

Melo, Antonio Diego Brandão; Amaral, Amanda Figueiredo; Schaefer, Gustavo; Luciano, Fernando Bittencourt; de Andrade, Carla; Costa, Leandro Batista; Rostagno, Marcos Horácio

2015-01-01

The aim of this study was to evaluate the antimicrobial activity and determine the minimum bactericidal concentration (MBC) of the essential oils derived from Origanum vulgare (oregano), Melaleuca alternifolia (tea tree), Cinnamomum cassia (cassia), and Thymus vulgaris (white thyme) against Salmonella Typhimurium, Salmonella Enteritidis, Escherichia coli, Staphylococcus aureus and Enterococcus faecalis. The study also investigated the ability of these different bacterial strains to develop adaptation after repetitive exposure to sub-lethal concentrations of these essential oils. The MBC of the essential oils studied was determined by disc diffusion and broth dilution methods. All essential oils showed antimicrobial effect against all bacterial strains. In general, the development of adaptation varied according to the bacterial strain and the essential oil (tea tree > white thyme > oregano). Therefore, it is important to use essential oils at efficient bactericidal doses in animal feed, food, and sanitizers, since bacteria can rapidly develop adaptation when exposed to sub-lethal concentrations of these oils. PMID:26424908

Ohr plays a central role in bacterial responses against fatty acid hydroperoxides and peroxynitrite

PubMed Central

Alegria, Thiago G. P.; Hugo, Martín; Trujillo, Madia; de Oliveira, Marcos Antonio; Miyamoto, Sayuri; Queiroz, Raphael F.; Valadares, Napoleão Fonseca; Garratt, Richard C.; Radi, Rafael; Di Mascio, Paolo; Augusto, Ohara

2017-01-01

Organic hydroperoxide resistance (Ohr) enzymes are unique Cys-based, lipoyl-dependent peroxidases. Here, we investigated the involvement of Ohr in bacterial responses toward distinct hydroperoxides. In silico results indicated that fatty acid (but not cholesterol) hydroperoxides docked well into the active site of Ohr from Xylella fastidiosa and were efficiently reduced by the recombinant enzyme as assessed by a lipoamide-lipoamide dehydrogenase–coupled assay. Indeed, the rate constants between Ohr and several fatty acid hydroperoxides were in the 107–108 M−1⋅s−1 range as determined by a competition assay developed here. Reduction of peroxynitrite by Ohr was also determined to be in the order of 107 M−1⋅s−1 at pH 7.4 through two independent competition assays. A similar trend was observed when studying the sensitivities of a ∆ohr mutant of Pseudomonas aeruginosa toward different hydroperoxides. Fatty acid hydroperoxides, which are readily solubilized by bacterial surfactants, killed the ∆ohr strain most efficiently. In contrast, both wild-type and mutant strains deficient for peroxiredoxins and glutathione peroxidases were equally sensitive to fatty acid hydroperoxides. Ohr also appeared to play a central role in the peroxynitrite response, because the ∆ohr mutant was more sensitive than wild type to 3-morpholinosydnonimine hydrochloride (SIN-1 , a peroxynitrite generator). In the case of H2O2 insult, cells treated with 3-amino-1,2,4-triazole (a catalase inhibitor) were the most sensitive. Furthermore, fatty acid hydroperoxide and SIN-1 both induced Ohr expression in the wild-type strain. In conclusion, Ohr plays a central role in modulating the levels of fatty acid hydroperoxides and peroxynitrite, both of which are involved in host–pathogen interactions. PMID:28028230

Screening of bacterial strains isolated from uranium mill tailings porewaters for bioremediation purposes.

PubMed

Sánchez-Castro, Iván; Amador-García, Ahinara; Moreno-Romero, Cristina; López-Fernández, Margarita; Phrommavanh, Vannapha; Nos, Jeremy; Descostes, Michael; Merroun, Mohamed L

2017-01-01

The present work characterizes at different levels a number of bacterial strains isolated from porewaters sampled in the vicinity of two French uranium tailing repositories. The 16S rRNA gene from 33 bacterial isolates, corresponding to the different morphotypes recovered, was almost fully sequenced. The resulting sequences belonged to 13 bacterial genera comprised in the phyla Firmicutes, Actinobacteria and Proteobacteria. Further characterization at physiological level and metals/metalloid tolerance provided evidences for an appropriate selection of bacterial strains potentially useful for immobilization of uranium and other common contaminants. By using High Resolution Transmission Electron Microscope (HRTEM), this potential ability to immobilize uranium as U phosphate mineral phases was confirmed for the bacterial strains Br3 and Br5 corresponding to Arthrobacter sp. and Microbacterium oxydans, respectively. Scanning Transmission Electron Microscope- High-Angle Annular Dark-Field (STEM-HAADF) analysis showed U accumulates on the surface and within bacterial cytoplasm, in addition to the extracellular space. Energy Dispersive X-ray (EDX) element-distribution maps demonstrated the presence of U and P within these accumulates. These results indicate the potential of certain bacterial strains isolated from porewaters of U mill tailings for immobilizing uranium, likely as uranium phosphates. Some of these bacterial isolates might be considered as promising candidates in the design of uranium bioremediation strategies. Copyright © 2016 Elsevier Ltd. All rights reserved.

Activation of Multiple Antibiotic Resistance in Uropathogenic Escherichia coli Strains by Aryloxoalcanoic Acid Compounds

PubMed Central

Balagué, Claudia; Véscovi, Eleonora García

2001-01-01

Clofibric and ethacrynic acids are prototypical pharmacological agents administered in the treatment of hypertrigliceridemia and as a diuretic agent, respectively. They share with 2,4-dichlorophenoxyacetic acid (the widely used herbicide known as 2,4-D) a chlorinated phenoxy structural moiety. These aryloxoalcanoic agents (AOAs) are mainly excreted by the renal route as unaltered or conjugated active compounds. The relatedness of these agents at the structural level and their potential effect on therapeutically treated or occupationally exposed individuals who are simultaneously undergoing a bacterial urinary tract infection led us to analyze their action on uropathogenic, clinically isolated Escherichia coli strains. We found that exposure to these compounds increases the bacterial resistance to an ample variety of antibiotics in clinical isolates of both uropathogenic and nonpathogenic E. coli strains. We demonstrate that the AOAs induce an alteration of the bacterial outer membrane permeability properties by the repression of the major porin OmpF in a micF-dependent process. Furthermore, we establish that the antibiotic resistance phenotype is primarily due to the induction of the MarRAB regulatory system by the AOAs, while other regulatory pathways that also converge into micF modulation (OmpR/EnvZ, SoxRS, and Lrp) remained unaltered. The fact that AOAs give rise to uropathogenic strains with a diminished susceptibility to antimicrobials highlights the impact of frequently underestimated or ignored collateral effects of chemical agents. PMID:11353631

Intraspecies cellular fatty acids heterogeneity of Lactobacillus plantarum strains isolated from fermented foods in Ukraine.

PubMed

Garmasheva, I; Vasyliuk, O; Kovalenko, N; Ostapchuk, A; Oleschenko, L

2015-09-01

The intraspecies heterogeneity of cellular fatty acids composition of Lactobacillus plantarum strains isolated from Ukrainian traditional fermented foods was examined. Seven cellular fatty acids were identified. All Lact. plantarum strains investigated contained C16:0 (from 7·54 to 49·83% of total fatty acids), cC18:1 (3·23-38·67% of total fatty acids) and cycC19:0 acids (9·03-67·68% of total fatty acids) as the major fatty acids. The tC18:1 acid made up 1·47-22·0% of the total fatty acids. The C14:0 and C16:1 acids were present in small amounts (0·22-6·96% and 0·66-7·42% respectively) in most Lact. plantarum strains. Differences in relative contents of some fatty acids between Lact. plantarum strains depending on the source isolation were found. Isolates of dairy origin contained slightly greater levels of the C16:0 and tC18:1 fatty acids and lower levels of the cC18:1 than strains obtained from fermented vegetables. The origin of Lact. plantarum strains affects their fatty acids composition, which in turn, appears to be related to their ability to growth under stress factors. Cellular fatty acids composition is an important chemotaxonomic characteristic of bacterial cells. At the same time cellular fatty acids play a key role in maintaining the viability of micro-organisms in different environmental conditions. In this study, intraspecies heterogeneity of cellular fatty acids composition of Lactobacillus plantarum strains was examined. This work provides novel and important information about a relationship between cellular fatty acids composition of Lact. plantarum strains and source of isolation or stress resistance profile. Our results showed that cellular fatty acids composition is quite diverse among Lact. plantarum strains derived from different sources and may reflect previous cell's history. Our findings should be considered in chemotaxonomic studies of lactic acid bacteria and its ecology. © 2015 The Society for Applied Microbiology.

Identification and characterisation of potential biofertilizer bacterial strains

NASA Astrophysics Data System (ADS)

Karagöz, Kenan; Kotan, Recep; Dadaşoǧlu, Fatih; Dadaşoǧlu, Esin

2016-04-01

In this study we aimed that isolation, identification and characterizations of PGPR strains from rhizosphere of legume plants. 188 bacterial strains isolated from different legume plants like clover, sainfoin and vetch in Erzurum province of Turkey. These three plants are cultivated commonly in the Erzurum province. It was screen that 50 out of 188 strains can fix nitrogen and solubilize phosphate. These strains were identified via MIS (Microbial identification system). According to MIS identification results, 40 out of 50 strains were identified as Bacillus, 5 as Pseudomonas, 3 as Paenibacillus, 1 as Acinetobacter, 1 as Brevibacterium. According to classical test results, while the catalase test result of all isolates are positive, oxidase, KOH and starch hydrolysis rest results are variable.

Genome engineering and gene expression control for bacterial strain development.

PubMed

Song, Chan Woo; Lee, Joungmin; Lee, Sang Yup

2015-01-01

In recent years, a number of techniques and tools have been developed for genome engineering and gene expression control to achieve desired phenotypes of various bacteria. Here we review and discuss the recent advances in bacterial genome manipulation and gene expression control techniques, and their actual uses with accompanying examples. Genome engineering has been commonly performed based on homologous recombination. During such genome manipulation, the counterselection systems employing SacB or nucleases have mainly been used for the efficient selection of desired engineered strains. The recombineering technology enables simple and more rapid manipulation of the bacterial genome. The group II intron-mediated genome engineering technology is another option for some bacteria that are difficult to be engineered by homologous recombination. Due to the increasing demands on high-throughput screening of bacterial strains having the desired phenotypes, several multiplex genome engineering techniques have recently been developed and validated in some bacteria. Another approach to achieve desired bacterial phenotypes is the repression of target gene expression without the modification of genome sequences. This can be performed by expressing antisense RNA, small regulatory RNA, or CRISPR RNA to repress target gene expression at the transcriptional or translational level. All of these techniques allow efficient and rapid development and screening of bacterial strains having desired phenotypes, and more advanced techniques are expected to be seen. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Production of lactic acid from sucrose: strain selection, fermentation, and kinetic modeling.

PubMed

Lunelli, Betânia H; Andrade, Rafael R; Atala, Daniel I P; Wolf Maciel, Maria Regina; Maugeri Filho, Francisco; Maciel Filho, Rubens

2010-05-01

Lactic acid is an important product arising from the anaerobic fermentation of sugars. It is used in the pharmaceutical, cosmetic, chemical, and food industries as well as for biodegradable polymer and green solvent production. In this work, several bacterial strains were isolated from industrial ethanol fermentation, and the most efficient strain for lactic acid production was selected. The fermentation was conducted in a batch system under anaerobic conditions for 50 h at a temperature of 34 degrees C, a pH value of 5.0, and an initial sucrose concentration of 12 g/L using diluted sugarcane molasses. Throughout the process, pulses of molasses were added in order to avoid the cell growth inhibition due to high sugar concentration as well as increased lactic acid concentrations. At the end of the fermentation, about 90% of sucrose was consumed to produce lactic acid and cells. A kinetic model has been developed to simulate the batch lactic acid fermentation results. The data obtained from the fermentation were used for determining the kinetic parameters of the model. The developed model for lactic acid production, growth cell, and sugar consumption simulates the experimental data well.

Isolation and characterization of two new methanesulfonic acid-degrading bacterial isolates from a Portuguese soil sample.

PubMed

De Marco, P; Murrell, J C; Bordalo, A A; Moradas-Ferreira, P

2000-02-01

Two novel bacterial strains that can utilize methanesulfonic acid as a source of carbon and energy were isolated from a soil sample collected in northern Portugal. Morphological, physiological, biochemical and molecular biological characterization of the two isolates indicate that strain P1 is a pink-pigmented facultative methylotroph belonging to the genus Methylobacterium, while strain P2 is a restricted methylotroph belonging to the genus Hyphomicrobium. Both strains are strictly aerobic, degrade methanesulfonate, and release small quantities of sulfite into the medium. Growth on methanesulfonate induces a specific polypeptide profile in each strain. This, together with the positive hybridization to a DNA probe that carries the msm genes of Methylosulfonomonas methylovora strain M2, strongly endorses the contention that a methanesulfonic acid monooxygenase related to that found in the previously known methanesulfonate-utilizing bacteria is present in strains P1 and P2. The isolation of bacteria containing conserved msm genes from diverse environments and geographical locations supports the hypothesis that a common enzyme may be globally responsible for the oxidation of methanesulfonate by natural methylotrophic communities.

CAMBerVis: visualization software to support comparative analysis of multiple bacterial strains.

PubMed

Woźniak, Michał; Wong, Limsoon; Tiuryn, Jerzy

2011-12-01

A number of inconsistencies in genome annotations are documented among bacterial strains. Visualization of the differences may help biologists to make correct decisions in spurious cases. We have developed a visualization tool, CAMBerVis, to support comparative analysis of multiple bacterial strains. The software manages simultaneous visualization of multiple bacterial genomes, enabling visual analysis focused on genome structure annotations. The CAMBerVis software is freely available at the project website: http://bioputer.mimuw.edu.pl/camber. Input datasets for Mycobacterium tuberculosis and Staphylocacus aureus are integrated with the software as examples. m.wozniak@mimuw.edu.pl Supplementary data are available at Bioinformatics online.

Solubilization of municipal sewage waste activated sludge by novel lytic bacterial strains.

PubMed

Lakshmi, M Veera; Merrylin, J; Kavitha, S; Kumar, S Adish; Banu, J Rajesh; Yeom, Ick-Tae

2014-02-01

Extracellular polymeric substances (EPS) are an extracellular matrix found in sludge which plays a crucial role in flocculation by interacting with the organic solids. Therefore, to enhance pretreatment of sludge, EPS have to be removed. In this study, EPS were removed with a chemical extractant, NaOH, to enhance the bacterial pretreatment. A lysozyme secreting bacterial consortium was isolated from the waste activated sludge (WAS). The result of density gradient gel electrophoresis (DGGE) analysis revealed that the isolated consortium consists of two strains. The two novel strains isolated were named as Jerish03 (NCBI accession number KC597266) and Jerish 04 (NCBI accession number KC597267) and they belong to the genus Bacillus. Pretreatment with these novel strains enhances the efficiency of the aerobic digestion of sludge. Sludge treated with the lysozyme secreting bacterial consortium produced 29 % and 28.5 % increase in suspended solids (SS) reduction and chemical oxygen demand (COD) removal compared to the raw activated sludge (without pretreatment) during aerobic digestion. It is specified that these two novel strains had a high potential to enhance WAS degradation efficiency in aerobic digestion.

[The range of antagonistic effects of Lactobacillus bacterial strains on etiologic agents of bacterial vaginosis].

PubMed

Strus, M; Malinowska, M

1999-01-01

Bacterial vaginosis is caused by uncontrolled sequential overgrowth of some anaerobic bacteria: Gardnerella vaginalis, Prevotella bivia, Bacteroides spp., Peptostreptococcus spp., Mobiluncus sp. usually occurring in stable numbers in the bacterial flora of healthy women. On the other hand, different species of bacteria belonging to the genus Lactobacillus, most frequently L. plantarum, L. rhamnosus and L. acidophilus, form a group of aerobic bacteria dominating in the same environment. The diversity and density of their populations depend on the age and health conditions. Thanks to their antagonistic and adherence properties bacteria of the genus Lactobacillus can maintain a positive balance role in this ecosystem. The aim of this study was to assess the antagonistic properties of Lactobacillus strains isolated from the vagina of healthy women against most common agents of bacterial vaginosis. It was found that nearly all of the tested Lactobacillus strains exerted distinct antagonistic activity against anaerobic bacteria: Gardnerella vaginalis, Prevotella bivia and Peptostreptococcus anaerobius and quite a number also against Gram-negative rods, while only some of them were able to inhibit Gram-positive aerobic cocci as Enterococcus faecalis or Staphylococcus aureus.

Bacterial Utilization of L-sugars and D-amino Acids

NASA Technical Reports Server (NTRS)

Pikuta, Elena; Hoover, Richard B.; Klyce, Brig; Davies, Paul C. W.; Davies, Pauline

2006-01-01

The fact that organotrophic organisms on Earth use L-amino acids and D-sugars as an energy source is recognized as one of the universal features of life. The chirality of organic molecules with asymmetric location of group- radicals was described a relatively long time ago. In 1848, Louis Pasteur discovered chiral molecules when he investigated the way that crystals of sodium ammonium paratartrate rotated the plane of polarization of light. He found that the crystal structures represented the underlying asymmetry of molecules that existed in either lea-handed or right-handed forms (enantiomers). Pasteur observed that abiotic (chemical) processes produced mixtures with equal numbers (racemic) of the two forms but that living organisms possessed a molecular asymmetry that included only one of the enantiomers (homochirality). He speculated that the origin of the asymmetry of chiral biomolecules might hold the key to the nature of life. All of the amino acids in proteins (except for Glycine which is symmetrical) exhibit the same absolute steric configuration as L-glyceraldehyde. D-amino acids are never found in proteins, although they do exist in nature and are often found in polypeptide antibiotics. Constitutional sugars of cells, opposite to the amino acids, are the D-enantiomers, and the appearance of L-sugars in Nature is extremely rare. Notwithstanding this fact, the metabolism of some bacteria does have capability to use amino acids and sugars with alternative chirality. This property may be caused by the function of specific enzymes belonging to the class of isomerases (racemases, epimerases, isomerases, tautomerases). In our laboratory, we have investigated several anaerobic bacterial strains, and have found that some of these bacteria are capable of using D-amino acids and L-sugars. Strain BK1 is capable of growth on D-arginine, but its growth characteristics on L-arginine are approximately twice higher. Another alkaliphilic strain SCAT(sup T) (= ATCC BAA-1084

Individual and co-operative roles of lactic acid and hydrogen peroxide in the killing activity of enteric strain Lactobacillus johnsonii NCC933 and vaginal strain Lactobacillus gasseri KS120.1 against enteric, uropathogenic and vaginosis-associated pathogens.

PubMed

Atassi, Fabrice; Servin, Alain L

2010-03-01

The mechanism underlying the killing activity of Lactobacillus strains against bacterial pathogens appears to be multifactorial. Here, we investigate the respective contributions of hydrogen peroxide and lactic acid in killing bacterial pathogens associated with the human vagina, urinary tract or intestine by two hydrogen peroxide-producing strains. In co-culture, the human intestinal strain Lactobacillus johnsonii NCC933 and human vaginal strain Lactobacillus gasseri KS120.1 strains killed enteric Salmonella enterica serovar Typhimurium SL1344, vaginal Gardnerella vaginalis DSM 4944 and urinary tract Escherichia coli CFT073 pathogens. The cell-free culture supernatants (CFCSs) produced the same reduction in SL1344, DSM 4944 and CFT073 viability, whereas isolated bacteria had no effect. The killing activity of CFCSs was heat-stable. In the presence of Dulbecco's modified Eagle's minimum essential medium inhibiting the lactic acid-dependent killing activity, CFCSs were less effective at killing of the pathogens. Catalase-treated CFCSs displayed a strong decreased activity. Tested alone, hydrogen peroxide triggered a concentration-dependent killing activity against all three pathogens. Lactic acid alone developed a killing activity only at concentrations higher than that present in CFCSs. In the presence of lactic acid at a concentration present in Lactobacillus CFCSs, hydrogen peroxide displayed enhanced killing activity. Collectively, these results demonstrate that for hydrogen peroxide-producing Lactobacillus strains, the main metabolites of Lactobacillus, lactic acid and hydrogen peroxide, act co-operatively to kill enteric, vaginosis-associated and uropathogenic pathogens.

A novel production process for optically pure L-lactic acid from kitchen refuse using a bacterial consortium at high temperatures.

PubMed

Tashiro, Yukihiro; Matsumoto, Hiroko; Miyamoto, Hirokuni; Okugawa, Yuki; Pramod, Poudel; Miyamoto, Hisashi; Sakai, Kenji

2013-10-01

We investigated L-lactic acid production in static batch fermentation of kitchen refuse using a bacterial consortium from marine-animal-resource (MAR) composts at temperatures ranging from 30 to 65 °C. At relatively low temperatures butyric acid accumulated, whereas at higher temperatures L-lactic acid was produced. In particular, fermentation at 50 °C produced 34.5 g L(-1) L-lactic acid with 90% lactic acid selectivity and 100% optical purity. Denaturing gradient gel electrophoresis indicated that dominant bacteria present in the original MAR composts diminished rapidly and Bacillus coagulans strains became the dominant contributors to L-lactic acid production at 45, 50 and 55 °C. This is the first report of the achievement of 100% optical purity of L-lactic acid using a bacterial consortium. Copyright © 2013 Elsevier Ltd. All rights reserved.

Pilot Screening to Determine Antimicrobial Synergies in a Multidrug-Resistant Bacterial Strain Library

PubMed Central

Kim, Si-Hyun; Park, Chulmin; Chun, Hye-Sun; Choi, Jae-Ki; Lee, Hyo-Jin; Cho, Sung-Yeon; Park, Sun Hee; Choi, Su-Mi; Choi, Jung-Hyun; Yoo, Jin-Hong

2016-01-01

With the rise in multidrug-resistant (MDR) bacterial infections, there has been increasing interest in combinations of ≥2 antimicrobial agents with synergistic effects. We established an MDR bacterial strain library to screen for in vitro antimicrobial synergy by using a broth microdilution checkerboard method and high-throughput luciferase-based bacterial cell viability assay. In total, 39 MDR bacterial strains, including 23 carbapenem-resistant gram-negative bacteria, 9 vancomycin-intermediate Staphylococcus aureus, and 7 vancomycin-resistant Enterococcus faecalis, were used to screen for potential antimicrobial synergies. Synergies were more frequently identified with combinations of imipenem plus trimethoprim–sulfamethoxazole for carbapenem-resistant Acinetobacter baumannii in the library. To verify this finding, we tested 34 A. baumannii clinical isolates resistant to both imipenem and trimethoprim–sulfamethoxazole by the checkerboard method. The imipenem plus trimethoprim–sulfamethoxazole combination showed synergy in the treatment of 21 (62%) of the clinical isolates. The results indicate that pilot screening for antimicrobial synergy in the MDR bacterial strain library could be valuable in the selection of combination therapeutic regimens to treat MDR bacterial infections. Further studies are warranted to determine whether this screening system can be useful to screen for the combined effects of conventional antimicrobials and new-generation antimicrobials or nonantimicrobials. PMID:26974861

Transport processes and mutual interactions of three bacterial strains in saturated porous media

NASA Astrophysics Data System (ADS)

Stumpp, Christine; Lawrence, John R.; Hendry, M. Jim; Maloszewski, Pitor

2010-05-01

Transport processes of the bacterial strains Klebsiella oxytoca, Burkholderia cepacia G4PR-1 and Pseudomonas sp #5 were investigated in saturated column experiments to study the differences in transport characteristics and the mutual interactions of these strains during transport. Soil column experiments (114 mm long x 33 mm in diameter) were conducted with constant water velocities (3.9-5.7 cm/h) through a medium to coarse grained silica sand. All experiments were performed in freshly packed columns in quadruplicate. Chloride was used as tracer to determine the mean transit time, dispersivity and flow rate. It was injected as a pulse into the columns together with the bacterial strains suspended in artificial groundwater medium. In the first setup, each strain was investigated alone. In the second setup, transport processes were performed injecting two strains simultaneously. Finally, the transport characteristics were studied in successive experiments when one bacterium was resident on the sand grains prior to the introduction of the second strain. In all experiments the peak C/Co bacterial concentrations were attenuated with respect to the conservative tracer chloride and a well defined tailing was observed. A one dimensional mathematical model for advective-dispersive transport that accounts for irreversible and reversible sorption was used to analyze the bacterial breakthrough curves and tailing patterns. It was shown that the sorption parameters were different for the three strains that can be explained by the properties of the bacteria. For the species Klebsiella oxytoca and Burkholderia cepacia G4PR-the transport parameters were mostly in the same range independent of the experimental setup. However, Pseudomonas sp #5, which is a motile bacterium, showed differences in the breakthrough curves and sorption parameters during the experiments. The simultaneous and successive experiments indicated an influence on the reversible sorption processes when another

Requirement of a Functional Flavin Mononucleotide Prenyltransferase for the Activity of a Bacterial Decarboxylase in a Heterologous Muconic Acid Pathway in Saccharomyces cerevisiae.

PubMed

Weber, Heike E; Gottardi, Manuela; Brückner, Christine; Oreb, Mislav; Boles, Eckhard; Tripp, Joanna

2017-05-15

Biotechnological production of cis , cis -muconic acid from renewable feedstocks is an environmentally sustainable alternative to conventional, petroleum-based methods. Even though a heterologous production pathway for cis , cis -muconic acid has already been established in the host organism Saccharomyces cerevisiae , the generation of industrially relevant amounts of cis , cis -muconic acid is hampered by the low activity of the bacterial protocatechuic acid (PCA) decarboxylase AroY isomeric subunit C iso (AroY-C iso ), leading to secretion of large amounts of the intermediate PCA into the medium. In the present study, we show that the activity of AroY-C iso in S. cerevisiae strongly depends on the strain background. We could demonstrate that the strain dependency is caused by the presence or absence of an intact genomic copy of PAD1 , which encodes a mitochondrial enzyme responsible for the biosynthesis of a prenylated form of the cofactor flavin mononucleotide (prFMN). The inactivity of AroY-C iso in strain CEN.PK2-1 could be overcome by plasmid-borne expression of Pad1 or its bacterial homologue AroY subunit B (AroY-B). Our data reveal that the two enzymes perform the same function in decarboxylation of PCA by AroY-C iso , although coexpression of Pad1 led to higher decarboxylase activity. Conversely, AroY-B can replace Pad1 in its function in decarboxylation of phenylacrylic acids by ferulic acid decarboxylase Fdc1. Targeting of the majority of AroY-B to mitochondria by fusion to a heterologous mitochondrial targeting signal did not improve decarboxylase activity of AroY-C iso , suggesting that mitochondrial localization has no major impact on cofactor biosynthesis. IMPORTANCE In Saccharomyces cerevisiae , the decarboxylation of protocatechuic acid (PCA) to catechol is the bottleneck reaction in the heterologous biosynthetic pathway for production of cis , cis -muconic acid, a valuable precursor for the production of bulk chemicals. In our work, we demonstrate

Lactic acid bacterial extract as a biogenic mineral growth modifier

NASA Astrophysics Data System (ADS)

Borah, Ballav M.; Singh, Atul K.; Ramesh, Aiyagari; Das, Gopal

2009-04-01

The formation of minerals and mechanisms by which bacteria could control their formation in natural habitats is now of current interest for material scientists to have an insight of the mechanism of in vivo mineralization, as well as to seek industrial and technological applications. Crystalline uniform structures of calcium and barium minerals formed micron-sized building blocks when synthesized in the presence of an organic matrix consisting of secreted protein extracts from three different lactic acid bacteria (LAB) viz.: Lactobacillus plantarum MTCC 1325, Lactobacillus acidophilus NRRL B4495 and Pediococcus acidilactici CFR K7. LABs are not known to form organic matrix in biological materialization processes. The influence of these bacterial extracts on the crystallization behavior was investigated in details to test the basic coordination behavior of the acidic protein. In this report, varied architecture of the mineral crystals obtained in presence of high molecular weight protein extracts of three different LAB strains has been discussed. The role of native form of high molecular weight bacterial protein extracts in the generation of nucleation centers for crystal growth was clearly established. A model for the formation of organic matrix-cation complex and the subsequent events leading to crystal growth is proposed.

Screening and characterization of lactic acid bacterial strains that produce fermented milk and reduce cholesterol levels.

PubMed

Guan, Xuefang; Xu, Qingxian; Zheng, Yi; Qian, Lei; Lin, Bin

To screen for and characterize lactic acid bacteria strains with the ability to produce fermented milk and reduce cholesterol levels. The strains were isolated from traditional fermented milk in China. In vitro and in vivo evaluation of cholesterol-reduction were used to identify and verify strains of interest. Characteristics were analyzed using spectrophotometry and plate counting assays. The isolate HLX37 consistently produced fermented milk with strong cholesterol-reducing properties was identified as Lactobacillus plantarum (accession number: KR105940) and was thus selected for further study. The cholesterol reduction by strain HLX37 was 45.84%. The isolates were acid-tolerant at pH 2.5 and bile-tolerant at 0.5% (w/v) in simulated gastric juice (pH 2.5) for 2h and in simulated intestinal fluid (pH 8.0) for 3h. The auto-aggregation rate increased to 87.74% after 24h, while the co-aggregation with Escherichia coli DH5 was 27.76%. Strain HLX37 was intrinsically resistant to antibiotics such as penicillin, tobramycin, kanamycin, streptomycin, vancomycin and amikacin. Compared with rats in the model hyperlipidemia group, the total cholesterol content in the serum and the liver as well as the atherogenic index of rats in the viable fermented milk group significantly decreased by 23.33%, 32.37% and 40.23%, respectively. Fewer fat vacuoles and other lesions in liver tissue were present in both the inactivated and viable fermented milk groups compared to the model group. These studies indicate that strain HLX37 of L. plantarum demonstrates probiotic potential, potential for use as a candidate for commercial use for promoting health. Copyright © 2017 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Screening lactic acid bacteria strains with ability to bind di-n-butyl phthalate via Turbiscan technique.

PubMed

Lili, Zhao; Hongfei, Zhao; Shoukat, Sana; Xiaochen, Zhang; Bolin, Zhang

2017-06-01

Di-n-butyl phthalate (DBP) is a ubiquitous environmental contaminant that poses a risk to humans. Previous work indicates that the ability of lactic acid bacteria (LAB) to bind phthalic acid esters is strain-specific. As cell suspensions of LAB strains in aqueous solution are likely to be colloidal dispersions, this study provided a technique to efficiently screen LAB strains that bind DBP via Turbiscan, which has been widely used to measure the stability of emulsions or colloidal dispersions. Eleven LAB strains belonging to Lactobacillus plantarum, Lb. pentosus, Lb. paralimentarius, Lb. helveticus, Leuconostoc mesenteroides, Lb. acidophilus, Bifidobacterium lactis, and Bifidobacterium bifidum species were used in this study, and seven of them were selected to test in an earlier stage of exploring the process for finding a screening method; others were used for a validation test. It was observed that the various values of the 10 h Turbiscan Stability Index (TSI) of the cell suspension from each strain, at the equilibrium time of dispersed particles according to the peak thickness of cell-suspensions as measured by Turbiscan, had significant negative correlations with the DBP-binding percentage of LAB strains. Higher TSI values are correlated with lower binding of bacteria strains to DBP with a correlation coefficient of 0.8292. Cell surface hydrocarbons of LAB strains and their adherence were observed to correlate with DBP-binding percentages and may lead to the different states of aggregation or equilibrium of bacterial cell-suspensions, and the aggregation of bacterial cells resulted in fewer binding sites in the cell wall for DBP. Finally, four LAB strains were randomly selected to verify the feasibility of the method. In all, the findings demonstrate that TSI might be used as a tool to quickly screen strains that bind DBP. The present work could be extended to the removal of other toxic compounds, when screening of high-efficiency strains is required.

Bacterial CS2 Hydrolases from Acidithiobacillus thiooxidans Strains Are Homologous to the Archaeal Catenane CS2 Hydrolase

PubMed Central

Smeulders, Marjan J.; Pol, Arjan; Venselaar, Hanka; Barends, Thomas R. M.; Hermans, John; Jetten, Mike S. M.

2013-01-01

Carbon disulfide (CS2) and carbonyl sulfide (COS) are important in the global sulfur cycle, and CS2 is used as a solvent in the viscose industry. These compounds can be converted by sulfur-oxidizing bacteria, such as Acidithiobacillus thiooxidans species, to carbon dioxide (CO2) and hydrogen sulfide (H2S), a property used in industrial biofiltration of CS2-polluted airstreams. We report on the mechanism of bacterial CS2 conversion in the extremely acidophilic A. thiooxidans strains S1p and G8. The bacterial CS2 hydrolases were highly abundant. They were purified and found to be homologous to the only other described (archaeal) CS2 hydrolase from Acidianus strain A1-3, which forms a catenane of two interlocked rings. The enzymes cluster in a group of β-carbonic anhydrase (β-CA) homologues that may comprise a subclass of CS2 hydrolases within the β-CA family. Unlike CAs, the CS2 hydrolases did not hydrate CO2 but converted CS2 and COS with H2O to H2S and CO2. The CS2 hydrolases of A. thiooxidans strains G8, 2Bp, Sts 4-3, and BBW1, like the CS2 hydrolase of Acidianus strain A1-3, exist as both octamers and hexadecamers in solution. The CS2 hydrolase of A. thiooxidans strain S1p forms only octamers. Structure models of the A. thiooxidans CS2 hydrolases based on the structure of Acidianus strain A1-3 CS2 hydrolase suggest that the A. thiooxidans strain G8 CS2 hydrolase may also form a catenane. In the A. thiooxidans strain S1p enzyme, two insertions (positions 26 and 27 [PD] and positions 56 to 61 [TPAGGG]) and a nine-amino-acid-longer C-terminal tail may prevent catenane formation. PMID:23836868

Thin-layer chromatographic technique for rapid detection of bacterial phospholipases.

PubMed

Legakis, N J; Papavassiliou, J

1975-11-01

Silica gel thin-layer chromatography was employed to detect lecithinase activity induced from bacterial resting cell preparations induced from bacterial resting cell preparations incubated at 37 C for 4 h in the presence of purified egg yolk lecithin. Bacillus subtilis, Bacillus cereus, Serratia marcescens, and Pseudomonas aeruginosa hydrolyzed lecithin with the formation of free fatty acids as the sole lipid-soluble product. In none of the Escherichia coli and Citrobacter freundii strains tested could lecithinase activity be detected. Four among eight strains of Enterobacter aerogenes and one among 12 strains of Proteus tested produced negligible amounts of free fatty acid.

Heme Derived from Corynebacterium glutamicum: A Potential Iron Additive for Swine and an Electron Carrier Additive for Lactic Acid Bacterial Culture.

PubMed

Choi, Su-In; Park, Jihoon; Kim, Pil

2017-03-28

To investigate the potential applications of bacterial heme, aminolevulinic acid synthase (HemA) was expressed in a Corynebacterium glutamicum HA strain that had been adaptively evolved against oxidative stress. The red pigment from the constructed strain was extracted and it exhibited the typical heme absorbance at 408 nm from the spectrum. To investigate the potential of this strain as an iron additive for swine, a prototype feed additive was manufactured in pilot scale by culturing the strain in a 5 ton fermenter followed by spray-drying the biomass with flour as an excipient (biomass: flour = 1:10 (w/w)). The 10% prototype additive along with regular feed was supplied to a pig, resulting in a 1.1 kg greater increase in weight gain with no diarrhea in 3 weeks as compared with that in a control pig that was fed an additive containing only flour. To verify if C. glutamicum -synthesized heme is a potential electron carrier, lactic acid bacteria were cultured under aerobic conditions with the extracted heme. The biomasses of the aerobically grown Lactococcus lactis , Lactobacillus rhamosus , and Lactobacillus casei were 97%, 15%, and 4% greater, respectively, than those under fermentative growth conditions. As a potential preservative, cultures of the four strains of lactic acid bacteria were stored at 4°C with the extracted heme and living lactic acid bacterial cells were counted. There were more L. lactis and L. plantarum live cells when stored with heme, whereas L. rhamosus and L. casei showed no significant differences in live-cell numbers. The potential uses of the heme from C. glutamicum are further discussed.

Screening of species-specific lactic acid bacteria for veal calves multi-strain probiotic adjuncts.

PubMed

Ripamonti, Barbara; Agazzi, Alessandro; Bersani, Carla; De Dea, Paola; Pecorini, Chiara; Pirani, Silvia; Rebucci, Raffaella; Savoini, Giovanni; Stella, Simone; Stenico, Alberta; Tirloni, Erica; Domeneghini, Cinzia

2011-06-01

The selection of promising specific species of lactic acid bacteria with potential probiotic characteristics is of particular interest in producing multi species-specific probiotic adjuncts in veal calves rearing. The aim of the present work was to select and evaluate in vitro the functional activity of lactic acid bacteria, Bifidobacterium longum and Bacillus coagulans strains isolated from veal calves in order to assess their potential use as multi species-specific probiotics for veal calves. For this purpose, bacterial strains isolated from faeces collected from 40 healthy 50-day-calves, were identified by RiboPrinter and 16s rRNA gene sequence. The most frequent strains belonged to the species B. longum, Streptococcus bovis, Lactobacillus animalis and Streptococcus macedonicus. Among these, 7 strains were chosen for testing their probiotic characteristics in vitro. Three strains, namely L. animalis SB310, Lactobacillus paracasei subsp. paracasei SB137 and B. coagulans SB117 showed varying individual but promising capabilities to survive in the gastrointestinal tract, to adhere, to produce antimicrobial compounds. These three selected species-specific bacteria demonstrated in vitro, both singularly and mixed, the functional properties needed for their use as potential probiotics in veal calves. Copyright © 2011 Elsevier Ltd. All rights reserved.

Biodegradation of the xenobiotic organic disulphide 4,4'-dithiodibutyric acid by Rhodococcus erythropolis strain MI2 and comparison with the microbial utilization of 3,3'-dithiodipropionic acid and 3,3'-thiodipropionic acid.

PubMed

Wübbeler, Jan Hendrik; Bruland, Nadine; Wozniczka, Milena; Steinbüchel, Alexander

2010-04-01

Application of the non-toxic 3,3'-thiodipropionic acid (TDP) and 3,3'-dithiodipropionic acid (DTDP) as precursors for the microbial production of polythioesters (PTEs), a class of biologically persistent biopolymers containing sulphur in the backbone, was successfully established previously. However, synthesis of PTEs containing 4-mercaptobutyrate (4MB) as building blocks could not be achieved. The very harmful 4MB is not used as a PTE precursor or as the carbon source for growth by any known strain. As a promising alternative, the harmless oxidized disulfide of two molecules of 4MB, 4,4'-dithiodibutyric acid (DTDB), was employed for enrichments of bacterial strains capable of biodegradation. Investigation of novel precursor substrates for PTEs and comparison of respective strains growing on TDP, DTDP and DTDB as sole carbon source was accomplished. A broad variety of bacteria capable of using one of these organic sulphur compounds were isolated and compared. TDP and DTDP were degraded by several strains belonging to different genera, whereas all DTDB-utilizing strains were affiliated to the species Rhodococcus erythropolis. Transposon mutagenesis of R. erythropolis strain MI2 and screening of 7500 resulting mutants yielded three mutants exhibiting impaired growth on DTDB. Physiological studies revealed production of volatile hydrogen sulphide and accumulation of significant amounts of 4MB, 4-oxo-4-sulphanylbutanoic acid and succinic acid in the culture supernatants. Based on this knowledge, a putative pathway for degradation of DTDB was proposed: DTDB could be cleaved into two molecules of 4MB, followed by an oxidation yielding 4-oxo-4-sulphanylbutanoic acid. A putative desulphydrase probably catalyses the abstraction of sulphur, thereby generating succinic acid and hydrogen sulphide.

Effectiveness of 5-Pyrrolidone-2-carboxylic Acid and Copper Sulfate Pentahydrate Association against Drug Resistant Staphylococcus Strains.

PubMed

Governa, Paolo; Miraldi, Elisabetta; De Fina, Gianna; Biagi, Marco

2016-04-01

Bacterial resistance is an ongoing challenge for pharmacotherapy and pharmaceutical chemistry. Staphylococcus aureus is the bacterial species which makes it most difficult to treat skin and soft tissue infections and it is seen in thousands of hospitalization cases each year. Severe but often underrated infectious diseases, such as complicated nasal infections, are primarily caused by MRSA and S. epidermidis too. With the aim of studying new drugs with antimicrobial activity and effectiveness on drug resistant Staphylococcus strains, our attention in this study was drawn on the activity of a new association between two natural products: 5-pyrrolidone-2-carboxylic acid (PCA), naturally produced by certain Lactobacillus species, and copper sulfate pentahydrate (CS). The antimicrobial susceptibility test was conducted taking into account 12 different Staphylococcus strains, comprising 6 clinical isolates and 6 resistant strains. PCA 4%, w/w, and CS 0.002%, w/w, association in distilled water solution was found to have bactericidal activity against all tested strains. Antimicrobial kinetics highlighted that PCA 4%, w/w, and CS 0.002% association could reduce by 5 log10 viable bacterial counts of MRSA and oxacillin resistant S. epidennidis in less than 5 and 3 minutes respectively. Microscopic investigations suggest a cell wall targeting mechanism of action. Being very safe and highly tolerated, the natural product PCA and CS association proved to be a promising antimicrobial agent to treat Staphylococcus related infections.

Effects of different fermentation methods on bacterial cellulose and acid production by Gluconacetobacter xylinus in Cantonese-style rice vinegar.

PubMed

Fu, Liang; Chen, Siqian; Yi, Jiulong; Hou, Zongxia

2014-07-01

A strain of acidogenic bacterium was isolated from the fermentation liquid of Cantonese-style rice vinegar produced by traditional surface fermentation. 16S rDNA identification confirmed the bacterium as Gluconacetobacter xylinus, which synthesizes bacterial cellulose, and the acid productivity of the strain was investigated. In the study, the effects of the membrane integrity and the comparison of the air-liquid interface membrane with immerged membrane on total acidity, cellulose production, alcohol dehydrogenase (ADH) activity and number of bacteria were investigated. The cellulose membrane and the bacteria were observed under SEM for discussing their relationship. The correlations between oxygen consumption and total acid production rate were compared in surface and shake flask fermentation. The results showed the average acid productivity of the strain was 0.02g/(100mL/h), and the integrity of cellulose membrane in surface fermentation had an important effect on total acidity and cellulose production. With a higher membrane integrity, the total acidity after 144 h of fermentation was 3.75 g/100 mL, and the cellulose production was 1.71 g/100 mL after 360 h of fermentation. However, when the membrane was crushed by mechanical force, the total acidity and the cellulose production were as low as 0.36 g/100 mL and 0.14 g/100 mL, respectively. When the cellulose membrane was forced under the surface of fermentation liquid, the total acid production rate was extremely low, but the activity of ADH in the cellulose membrane was basically the same with the one above the liquid surface. The bacteria were mainly distributed in the cellulose membrane during the fermentation. The bacterial counts in surface fermentation were more than in the shake flask fermentation and G. xylinus consumed the substrate faster, in surface fermentation than in shake flask fermentation. The oxygen consumption rate and total acid production rate of surface fermentation were respectively 26

Revealing Differences in Metabolic Flux Distributions between a Mutant Strain and Its Parent Strain Gluconacetobacter xylinus CGMCC 2955

PubMed Central

Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano

2014-01-01

A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455

Isolation and characterization of butachlor-catabolizing bacterial strain Stenotrophomonas acidaminiphila JS-1 from soil and assessment of its biodegradation potential.

PubMed

Dwivedi, S; Singh, B R; Al-Khedhairy, A A; Alarifi, S; Musarrat, J

2010-07-01

Isolation, characterization and assessment of butachlor-degrading potential of bacterial strain JS-1 in soil. Butachlor-degrading bacteria were isolated using enrichment culture technique. The morphological, biochemical and genetic characteristics based on 16S rDNA sequence homology and phylogenetic analysis confirmed the isolate as Stenotrophomonas acidaminiphila strain JS-1. The strain JS-1 exhibited substantial growth in M9 mineral salt medium supplemented with 3.2 mmol l(-1) butachlor, as a sole source of carbon and energy. The HPLC analysis revealed almost complete disappearance of butachlor within 20 days in soil at a rate constant of 0.17 day(-1) and half-life (t((1/2))) of 4.0 days, following the first-order rate kinetics. The strain JS-1 in stationary phase of culture also produced 21.0 microg ml(-1) of growth hormone indole acetic acid (IAA) in the presence of 500 microg ml(-1) of tryptophan. The IAA production was stimulated at lower concentrations of butachlor, whereas higher concentrations above 0.8 mmol l(-1) were found inhibitory. The isolate JS-1 characterized as Stenotrophomonas acidaminiphila was capable of utilizing butachlor as sole source of carbon and energy. Besides being an efficient butachlor degrader, it substantially produces IAA. The bacterial strain JS-1 has a potential for butachlor remediation with a distinctive auxiliary attribute of plant growth stimulation.

Use of Fatty Acid Methyl Ester Profiles to Compare Copper-Tolerant and Copper-Sensitive Strains of Pantoea ananatis.

PubMed

Nischwitz, C; Gitaitis, R; Sanders, H; Langston, D; Mullinix, B; Torrance, R; Boyhan, G; Zolobowska, L

2007-10-01

acid/14-methylpentadecenoic acid) also had an impact on the differences observed between copper-sensitive parents and copper-resistant mutants. Finding these changes in bacterial fatty acid composition could lead to the development of a laboratory assay to identify copper-tolerant strains using gas chromatography as well as providing clues to further elucidate the mode of action of copper tolerance.

D-amino acids inhibit initial bacterial adhesion: thermodynamic evidence.

PubMed

Xing, Su-Fang; Sun, Xue-Fei; Taylor, Alicia A; Walker, Sharon L; Wang, Yi-Fu; Wang, Shu-Guang

2015-04-01

Bacterial biofilms are structured communities of cells enclosed in a self-produced hydrated polymeric matrix that can adhere to inert or living surfaces. D-Amino acids were previously identified as self-produced compounds that mediate biofilm disassembly by causing the release of the protein component of the polymeric matrix. However, whether exogenous D-amino acids could inhibit initial bacterial adhesion is still unknown. Here, the effect of the exogenous amino acid D-tyrosine on initial bacterial adhesion was determined by combined use of chemical analysis, force spectroscopic measurement, and theoretical predictions. The surface thermodynamic theory demonstrated that the total interaction energy increased with more D-tyrosine, and the contribution of Lewis acid-base interactions relative to the change in the total interaction energy was much greater than the overall nonspecific interactions. Finally, atomic force microscopy analysis implied that the hydrogen bond numbers and adhesion forces decreased with the increase in D-tyrosine concentrations. D-Tyrosine contributed to the repulsive nature of the cell and ultimately led to the inhibition of bacterial adhesion. This study provides a new way to regulate biofilm formation by manipulating the contents of D-amino acids in natural or engineered systems. © 2014 Wiley Periodicals, Inc.

Decolorization of sulfonated azo dye Metanil Yellow by newly isolated bacterial strains: Bacillus sp. strain AK1 and Lysinibacillus sp. strain AK2.

PubMed

Anjaneya, O; Souche, S Yogesh; Santoshkumar, M; Karegoudar, T B

2011-06-15

Two different bacterial strains capable of decolorizing a highly water soluble azo dye Metanil Yellow were isolated from dye contaminated soil sample collected from Atul Dyeing Industry, Bellary, India. The individual bacterial strains Bacillus sp. AK1 and Lysinibacillus sp. AK2 decolorized Metanil Yellow (200 mg L(-1)) completely within 27 and 12h respectively. Various parameters like pH, temperature, NaCl and initial dye concentrations were optimized to develop an economically feasible decolorization process. The maximum concentration of Metanil Yellow (1000 mg L(-1)) was decolorized by strains AK2 and AK1 within 78 and 84 h respectively. These strains could decolorize Metanil Yellow over a broad pH range 5.5-9.0; the optimum pH was 7.2. The decolorization of Metanil Yellow was most efficient at 40°C and confirmed by UV-visible spectroscopy, TLC, HPLC and GC/MS analysis. Further, both the strains showed the involvement of azoreductase in the decolorization process. Phytotoxicity studies of catabolic products of Metanil Yellow on the seeds of chick pea and pigeon pea revealed much reduction in the toxicity of metabolites as compared to the parent dye. These results indicating the effectiveness of strains AK1 and AK2 for the treatment of textile effluents containing azo dyes. Copyright © 2011 Elsevier B.V. All rights reserved.

Probiotic Potential of Lactobacillus Strains with Antimicrobial Activity against Some Human Pathogenic Strains

PubMed Central

Shokryazdan, Parisa; Sieo, Chin Chin; Kalavathy, Ramasamy; Liang, Juan Boo; Alitheen, Noorjahan Banu; Faseleh Jahromi, Mohammad; Ho, Yin Wan

2014-01-01

The objective of this study was to isolate, identify, and characterize some lactic acid bacterial strains from human milk, infant feces, and fermented grapes and dates, as potential probiotics with antimicrobial activity against some human pathogenic strains. One hundred and forty bacterial strains were isolated and, after initial identification and a preliminary screening for acid and bile tolerance, nine of the best isolates were selected and further identified using 16 S rRNA gene sequences. The nine selected isolates were then characterized in vitro for their probiotic characteristics and their antimicrobial activities against some human pathogens. Results showed that all nine isolates belonged to the genus Lactobacillus. They were able to tolerate pH 3 for 3 h, 0.3% bile salts for 4 h, and 1.9 mg/mL pancreatic enzymes for 3 h. They exhibited good ability to attach to intestinal epithelial cells and were not resistant to the tested antibiotics. They also showed good antimicrobial activities against the tested pathogenic strains of humans, and most of them exhibited stronger antimicrobial activity than the reference strain L. casei Shirota. Thus, the nine Lactobacillus strains could be considered as potential antimicrobial probiotic strains against human pathogens and should be further studied for their human health benefits. PMID:25105147

D-lactic acid measurements in the diagnosis of bacterial infections.

PubMed Central

Smith, S M; Eng, R H; Campos, J M; Chmel, H

1989-01-01

Body fluids suspected of bacterial infection were cultured and examined for the presence of D-lactic acid, a specific bacterial metabolite. We examined 206 patients and 264 specimens. D-Lactic acid was found in concentrations of greater than or equal to 0.15 mM in 11 of 11 infected and 6 of 40 noninfected ascitic fluids, 6 of 6 infected and 4 of 33 noninfected pleural fluids, 4 of 4 infected and 0 of 13 noninfected synovial fluids, and 26 of 27 infected and 2 of 130 noninfected cerebrospinal fluids. The overall sensitivity was 79.7%, and the specificity was 99.5% when the D-lactic acid concentration was at least 0.15 mM. The most important clinical utility of the D-lactic acid measurement appears to be for patients with bacterial infection in various body compartments and in patients who have already received antimicrobial therapy. An elevation in D-lactic acid may indicate the presence of bacterial infection even when cultures are negative. PMID:2715313

Strain typing of acetic acid bacteria responsible for vinegar production by the submerged elaboration method.

PubMed

Fernández-Pérez, Rocío; Torres, Carmen; Sanz, Susana; Ruiz-Larrea, Fernanda

2010-12-01

Strain typing of 103 acetic acid bacteria isolates from vinegars elaborated by the submerged method from ciders, wines and spirit ethanol, was carried on in this study. Two different molecular methods were utilised: pulsed field gel electrophoresis (PFGE) of total DNA digests with a number of restriction enzymes, and enterobacterial repetitive intergenic consensus (ERIC) - PCR analysis. The comparative study of both methods showed that restriction fragment PFGE of SpeI digests of total DNA was a suitable method for strain typing and for determining which strains were present in vinegar fermentations. Results showed that strains of the species Gluconacetobacter europaeus were the most frequent leader strains of fermentations by the submerged method in the studied vinegars, and among them strain R1 was the predominant one. Results showed as well that mixed populations (at least two different strains) occurred in vinegars from cider and wine, whereas unique strains were found in spirit vinegars, which offered the most stressing conditions for bacterial growth. Copyright © 2010 Elsevier Ltd. All rights reserved.

Estimation of lactic acid bacterial cell number by DNA quantification.

PubMed

Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa

2018-01-01

Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.

Influence of hyaluronic acid on bacterial and fungal species, including clinically relevant opportunistic pathogens.

PubMed

Ardizzoni, Andrea; Neglia, Rachele G; Baschieri, Maria C; Cermelli, Claudio; Caratozzolo, Manuela; Righi, Elena; Palmieri, Beniamino; Blasi, Elisabetta

2011-10-01

Hyaluronic acid (HA) has several clinical applications (aesthetic surgery, dermatology, orthopaedics and ophtalmology). Following recent evidence, suggesting antimicrobial and antiviral properties for HA, we investigated its effects on 15 ATCC strains, representative of clinically relevant bacterial and fungal species. The in vitro system employed allowed to assess optical density of broth cultures as a measure of microbial load in a time-dependent manner. The results showed that different microbial species and, sometimes, different strains belonging to the same species, are differently affected by HA. In particular, staphylococci, enterococci, Streptococcus mutans, two Escherichia coli strains, Pseudomonas aeruginosa, Candida glabrata and C. parapsilosis displayed a HA dose-dependent growth inhibition; no HA effects were detected in E. coli ATCC 13768 and C. albicans; S. sanguinis was favoured by the highest HA dose. Therefore, the influence of HA on bacteria and fungi warrants further studies aimed at better establishing its relevance in clinical applications.

Bacillus sphaericus: the highest bacterial tannase producer with potential for gallic acid synthesis.

PubMed

Raghuwanshi, Shailendra; Dutt, Kakoli; Gupta, Pritesh; Misra, Swati; Saxena, Rajendra Kumar

2011-06-01

An indigenously isolated strain of Bacillus sphaericus was found to produce 1.21 IU/ml of tannase under unoptimized conditions. Optimizing the process one variable at a time resulted in the production of 7.6 IU/ml of tannase in 48 h in the presence of 1.5% tannic acid. A 9.26-fold increase in tannase production was achieved upon further optimization using response surface methodology (RSM), a statistical approach. This increase led to a production level of 11.2I U/ml in medium containing 2.0% tannic acid, 2.5% galactose, 0.25% ammonium chloride, and 0.1% MgSO(4) pH 6.0 incubated at 37°C and 100 rpm for 48 h with a 2.0% inoculum level. Scaling up tannase production in a 30-l bioreactor resulted in the production of 16.54 IU/ml after 36 h. Thus far, this tannase production is the highest reported in this bacterial strain. Partially purified tannase exhibited an optimum pH of 5.0 with activity in the pH range of 3 to 8; 50°C was the optimal temperature for activity. Efficient conversion of tannic acid to purified gallic acid (90.80%) was achieved through crystallization. Copyright © 2011 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Biochemical Roles for Conserved Residues in the Bacterial Fatty Acid-binding Protein Family*

PubMed Central

Broussard, Tyler C.; Miller, Darcie J.; Jackson, Pamela; Nourse, Amanda; White, Stephen W.; Rock, Charles O.

2016-01-01

Fatty acid kinase (Fak) is a ubiquitous Gram-positive bacterial enzyme consisting of an ATP-binding protein (FakA) that phosphorylates the fatty acid bound to FakB. In Staphylococcus aureus, Fak is a global regulator of virulence factor transcription and is essential for the activation of exogenous fatty acids for incorporation into phospholipids. The 1.2-Å x-ray structure of S. aureus FakB2, activity assays, solution studies, site-directed mutagenesis, and in vivo complementation were used to define the functions of the five conserved residues that define the FakB protein family (Pfam02645). The fatty acid tail is buried within the protein, and the exposed carboxyl group is bound by a Ser-93-fatty acid carboxyl-Thr-61-His-266 hydrogen bond network. The guanidinium of the invariant Arg-170 is positioned to potentially interact with a bound acylphosphate. The reduced thermal denaturation temperatures of the T61A, S93A, and H266A FakB2 mutants illustrate the importance of the hydrogen bond network in protein stability. The FakB2 T61A, S93A, and H266A mutants are 1000-fold less active in the Fak assay, and the R170A mutant is completely inactive. All FakB2 mutants form FakA(FakB2)2 complexes except FakB2(R202A), which is deficient in FakA binding. Allelic replacement shows that strains expressing FakB2 mutants are defective in fatty acid incorporation into phospholipids and virulence gene transcription. These conserved residues are likely to perform the same critical functions in all bacterial fatty acid-binding proteins. PMID:26774272

Characterization and purification of a bacterial chlorogenic acid esterase detected during the extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots.

PubMed

Negrel, Jonathan; Javelle, Francine; Morandi, Dominique; Lucchi, Géraldine

2016-12-01

A Gram-negative bacterium able to grow using chlorogenic acid (5-caffeoylquinic acid) as sole carbon source has been isolated from the roots of tomato plants inoculated with the arbuscular mycorrhizal fungus Rhizophagus irregularis. An intracellular esterase exhibiting very high affinity (K m  = 2 μM) for chlorogenic acid has been extracted and purified by FPLC from the chlorogenate-grown cultures of this bacterium. The molecular mass of the purified esterase determined by SDS-PAGE was 61 kDa and its isoelectric point determined by chromatofocusing was 7.75. The esterase hydrolysed chlorogenic acid analogues (caffeoylshikimate, and the 4- and 3-caffeoylquinic acid isomers), feruloyl esterases substrates (methyl caffeate and methyl ferulate), and even caffeoyl-CoA in vitro but all of them were less active than chlorogenic acid, demonstrating that the esterase is a genuine chlorogenic acid esterase. It was also induced when the bacterial strain was cultured in the presence of hydroxycinnamic acids (caffeic, p-coumaric or ferulic acid) as sole carbon source, but not in the presence of simple phenolics such as catechol or protocatechuic acid, nor in the presence of organic acids such as succinic or quinic acids. The purified esterase was remarkably stable in the presence of methanol, rapid formation of methyl caffeate occurring when its activity was measured in aqueous solutions containing 10-60% methanol. Our results therefore show that this bacterial chlorogenase can catalyse the transesterification reaction previously detected during the methanolic extraction of chlorogenic acid from arbuscular mycorrhizal tomato roots. Data are presented suggesting that colonisation by Rhizophagus irregularis could increase chlorogenic acid exudation from tomato roots, especially in nutrient-deprived plants, and thus favour the growth of chlorogenate-metabolizing bacteria on the root surface or in the mycorhizosphere. Copyright © 2016 Elsevier Masson SAS. All rights

Optimal Production of 7,10-dihydroxy-8(E)-hexadecenoic Acid from Palmitoleic Acid by Pseudomonas aeruginosa PR3

USDA-ARS?s Scientific Manuscript database

The hydroxylation of unsaturated fatty acids by bacterial strains is one type of value-adding bioconversion process. This process generates new hydroxy fatty acids (HFA) carrying special properties such as higher viscosity and reactivity compared with normal fatty acids. Among microbial strains te...

Transforming microbial genotyping: a robotic pipeline for genotyping bacterial strains.

PubMed

O'Farrell, Brian; Haase, Jana K; Velayudhan, Vimalkumar; Murphy, Ronan A; Achtman, Mark

2012-01-01

Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost.

Transforming Microbial Genotyping: A Robotic Pipeline for Genotyping Bacterial Strains

PubMed Central

Velayudhan, Vimalkumar; Murphy, Ronan A.; Achtman, Mark

2012-01-01

Microbial genotyping increasingly deals with large numbers of samples, and data are commonly evaluated by unstructured approaches, such as spread-sheets. The efficiency, reliability and throughput of genotyping would benefit from the automation of manual manipulations within the context of sophisticated data storage. We developed a medium- throughput genotyping pipeline for MultiLocus Sequence Typing (MLST) of bacterial pathogens. This pipeline was implemented through a combination of four automated liquid handling systems, a Laboratory Information Management System (LIMS) consisting of a variety of dedicated commercial operating systems and programs, including a Sample Management System, plus numerous Python scripts. All tubes and microwell racks were bar-coded and their locations and status were recorded in the LIMS. We also created a hierarchical set of items that could be used to represent bacterial species, their products and experiments. The LIMS allowed reliable, semi-automated, traceable bacterial genotyping from initial single colony isolation and sub-cultivation through DNA extraction and normalization to PCRs, sequencing and MLST sequence trace evaluation. We also describe robotic sequencing to facilitate cherrypicking of sequence dropouts. This pipeline is user-friendly, with a throughput of 96 strains within 10 working days at a total cost of < €25 per strain. Since developing this pipeline, >200,000 items were processed by two to three people. Our sophisticated automated pipeline can be implemented by a small microbiology group without extensive external support, and provides a general framework for semi-automated bacterial genotyping of large numbers of samples at low cost. PMID:23144721

Indoleacetic acid production and plant growth promoting potential of bacterial endophytes isolated from rice (Oryza sativa L.) seeds.

PubMed

Shahzad, Raheem; Waqas, Muhammad; Khan, Abdul Latif; Al-Hosni, Khadija; Kang, Sang-Mo; Seo, Chang-Woo; Lee, In-Jung

2017-06-01

Bacterial endophytes from the phyllosphere and rhizosphere have been used to produce bioactive metabolites and to promote plant growth. However, little is known about the endophytes residing in seeds. This study aimed to isolate and identify seed-borne bacterial endophytes from rice and elucidate their potential for phytohormone production and growth enhancement. The isolated endophytes included Micrococcus yunnanensis RWL-2, Micrococcus luteus RWL-3, Enterobacter soli RWL-4, Leclercia adecarboxylata RWL-5, Pantoea dispersa RWL-6, and Staphylococcus epidermidis RWL-7, which were identified using 16S rRNA sequencing and phylogenetic analysis. These strains were analyzed for indoleacetic acid (IAA) production by using GC-MS and IAA was found in the range of 11.50 ± 0.77 μg ml -1 to 38.80 ± 1.35 μg ml -1 . We also assessed the strains for plant growth promoting potential because these isolates were able to produce IAA in pure culture. Most of the growth attributes of rice plants (shoot and root length, fresh and dry biomass, and chlorophyll content) were significantly increased by bacterial endophytes compared to the controls. These results show that IAA producing bacterial endophytes can improve hostplant growth traits and can be used as bio-fertilizers.

Quantitative analysis of the lactic acid and acetaldehyde produced by Streptococcus thermophilus and Lactobacillus bulgaricus strains isolated from traditional Turkish yogurts using HPLC.

PubMed

Gezginc, Y; Topcal, F; Comertpay, S; Akyol, I

2015-03-01

The present study was conducted to evaluate the lactic acid- and acetaldehyde-producing abilities of lactic acid bacterial species isolated from traditionally manufactured Turkish yogurts using HPLC. The lactic acid bacterial species purified from the yogurts were the 2 most widely used species in industrial yogurt production: Streptococcus thermophilus and Lactobacillus bulgaricus. These bacteria have the ability to ferment hexose sugars homofermentatively to generate lactic acid and some carbonyl compounds, such as acetaldehyde through pyruvate metabolism. The levels of the compounds produced during fermentation influence the texture and the flavor of the yogurt and are themselves influenced by the chemical composition of the milk, processing conditions, and the metabolic activity of the starter culture. In the study, morphological, biochemical, and molecular characteristics were employed to identify the bacteria obtained from homemade yogurts produced in different regions of Turkey. A collection of 91 Strep. thermophilus and 35 L. bulgaricus strains were investigated for their lactic acid- and acetaldehyde-formation capabilities in various media such as cow milk, LM17 agar, and aerobic-anaerobic SM17 agar or de Man, Rogosa, and Sharpe agar. The amounts of the metabolites generated by each strain in all conditions were quantified by HPLC. The levels were found to vary depending on the species, the strain, and the growth conditions used. Whereas lactic acid production ranged between 0 and 77.9 mg/kg for Strep. thermophilus strains, it ranged from 0 to 103.5 mg/kg for L. bulgaricus. Correspondingly, the ability to generate acetaldehyde ranged from 0 to 105.9 mg/kg in Strep. thermophilus and from 0 to 126.9 mg/kg in L. bulgaricus. Our study constitutes the first attempt to determine characteristics of the wild strains isolated from traditional Turkish yogurts, and the approach presented here, which reveals the differences in metabolite production abilities of the

[Co-occurence of indol-producing bacterial strains in the vagina of women infected with Chlamydia trachomatis].

PubMed

Romanik, Małgorzata; Martirosian, Gayane; Wojciechowska-Wieja, Anna; Cieślik, Katarzyna; Kaźmierczak, Wojciech

2007-08-01

The aim of this study was to determine if cervicitis, caused by Chlamydia trachomatis (C. trachomatis), has an influence on the frequency of occurrence of selected aerobic and anaerobic bacterial strains, connected with etiology of aerobic vaginitis (AV) and bacterial vaginosis (BV). Indole-producing bacteria have received particular attention due to their possibly inductive role in chronic cervicitis caused by C. trachomatis. The swabs from vagina and cervical canal have been obtained from 122 women (aged 18-40). The presence of C. trachomatis antigen had been detected and diagnosed with the help of direct immunofluorescence, BV with Amesl and Nugent criteria, whereas the AV with Donders criteria. The identification of the bacterial strains isolated from vagina has been performed according to classical microbiological diagnostics. Disruption of vaginal microflora (4-10 in Nugent score) was determined in 11,5% of observed women. AV was diagnosed in 4.5% women with chlamydial cervicitis, BV was diagnosed in 10.9% and 5.45% of these women, on the basis of Amsel and Nugent criteria respectively. Indole-producing bacterial strains connected with BV and AV (Peptostreptococcus anaerobius, Propionibacterium acnes, Escherichia coli) have been isolated significantly more often from vagina of women infected with C trachomatis (p = 0.0405, chi2 = 4.20) and these findings confirm co-importance of indole-producing bacterial strains in cervicitis caused by C trachomatis .

Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.

PubMed

Young, Eric M; Zhao, Zheng; Gielesen, Bianca E M; Wu, Liang; Benjamin Gordon, D; Roubos, Johannes A; Voigt, Christopher A

2018-05-09

Metabolic engineering requires multiple rounds of strain construction to evaluate alternative pathways and enzyme concentrations. Optimizing multigene pathways stepwise or by randomly selecting enzymes and expression levels is inefficient. Here, we apply methods from design of experiments (DOE) to guide the construction of strain libraries from which the maximum information can be extracted without sampling every possible combination. We use Saccharomyces cerevisiae as a host for a novel six-gene pathway to itaconic acid, selected by comparing alternative shunt pathways that bypass the mitochondrial TCA cycle. The pathway is distinctive for the use of acetylating acetaldehyde dehydrogenase to increase cytosolic acetyl-CoA pools, a bacterial enzyme to synthesize citrate in the cytosol, and an itaconic acid exporter. Precise control over the expression of each gene is enabled by a set of promoter-terminator pairs that span a 174-fold range. Two large combinatorial libraries (160 variants, 2.4Mb and 32 variants, 0.6Mb) are designed where the expression levels are selected by statistical methods (I-optimal response surface methodology, full factorial, or Plackett-Burman) with the intent of extracting different types of guiding information after the screen. This is applied to the design of a third library (24 variants, 0.5Mb) intended to alleviate a bottleneck in cis-aconitate decarboxylase (CAD) expression. The top strain produces 815mg/l itaconic acid, a 4-fold improvement over the initial strain achieved by iteratively balancing pathway expression. Including a methylated product in the total, the strain produces 1.3g/l combined itaconic acids. Further, a regression analysis of the libraries reveals the optimal expression level of CAD as well as pairwise interdependencies between genes that result in increased titer and purity of itaconic acid. This work demonstrates adapting algorithmic design strategies to guide automated yeast strain construction and learn

A rapid NMR-based method for discrimination of strain-specific cell wall teichoic acid structures reveals a third backbone type in Lactobacillus plantarum.

PubMed

Tomita, Satoru; Tanaka, Naoto; Okada, Sanae

2017-03-01

The lactic acid bacterium Lactobacillus plantarum is capable of producing strain-specific structures of cell wall teichoic acid (WTA), an anionic polysaccharide found in the Gram-positive bacterial cell wall. In this study, we established a rapid, NMR-based procedure to discriminate WTA structures in this species, and applied it to 94 strains of L. plantarum. Six previously reported glycerol- and ribitol-containing WTA subtypes were successfully identified from 78 strains, suggesting that these were the dominant structures. However, the level of structural variety differed markedly among bacterial sources, possibly reflecting differences in strain-level microbial diversity. WTAs from eight strains were not identified based on NMR spectra and were classified into three groups. Structural analysis of a partial degradation product of an unidentified WTA produced by strain TUA 1496L revealed that the WTA was 1-O-β-d-glucosylglycerol. Two-dimensional NMR analysis of the polymer structure showed phosphodiester bonds between C-3 and C-6 of the glycerol and glucose residues, suggesting a polymer structure of 3,6΄-linked poly(1-O-β-d-glucosyl-sn-glycerol phosphate). This is the third WTA backbone structure in L. plantarum, following 3,6΄-linked poly(1-O-α-d-glucosyl-sn-glycerol phosphate) and 1,5-linked poly(ribitol phosphate). © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Biodegradation of Diclofenac by the bacterial strain Labrys portucalensis F11.

PubMed

Moreira, Irina S; Bessa, Vânia S; Murgolo, Sapia; Piccirillo, Clara; Mascolo, Giuseppe; Castro, Paula M L

2018-05-15

Diclofenac (DCF) is a widely used non-steroidal anti-inflammatory pharmaceutical which is detected in the environment at concentrations which can pose a threat to living organisms. In this study, biodegradation of DCF was assessed using the bacterial strain Labrys portucalensis F11. Biotransformation of 70% of DCF (1.7-34 μM), supplied as the sole carbon source, was achieved in 30 days. Complete degradation was reached via co-metabolism with acetate, over a period of 6 days for 1.7 µM and 25 days for 34 μM of DCF. The detection and identification of biodegradation intermediates was performed by UPLC-QTOF/MS/MS. The chemical structure of 12 metabolites is proposed. DCF degradation by strain F11 proceeds mainly by hydroxylation reactions; the formation of benzoquinone imine species seems to be a central step in the degradation pathway. Moreover, this is the first report that identified conjugated metabolites, resulting from sulfation reactions of DCF by bacteria. Stoichiometric liberation of chlorine and no detection of metabolites at the end of the experiments are strong indications of complete degradation of DCF by strain F11. To the best of our knowledge this is the first report that points to complete degradation of DCF by a single bacterial strain isolated from the environment. Copyright © 2018 Elsevier Inc. All rights reserved.

Amino Acid Proximities in Two Sup35 Prion Strains Revealed by Chemical Cross-linking*

PubMed Central

Wong, Shenq-Huey; King, Chih-Yen

2015-01-01

Strains of the yeast prion [PSI] are different folding patterns of the same Sup35 protein, which stacks up periodically to form a prion fiber. Chemical cross-linking is employed here to probe different fiber structures assembled with a mutant Sup35 fragment. The photo-reactive cross-linker, p-benzoyl-l-phenylalanine (pBpa), was biosynthetically incorporated into bacterially prepared recombinant Sup(1–61)-GFP, containing the first 61 residues of Sup35, followed by the green fluorescent protein. Four methionine substitutions and two alanine substitutions were introduced at fixed positions in Sup(1–61) to allow cyanogen bromide cleavage to facilitate subsequent mass spectrometry analysis. Amyloid fibers of pBpa and Met/Ala-substituted Sup(1–61)-GFP were nucleated from purified yeast prion particles of two different strains, namely VK and VL, and shown to faithfully transmit specific strain characteristics to yeast expressing the wild type Sup35 protein. Intra- and intermolecular cross-linking were distinguished by tandem mass spectrometry analysis on fibers seeded from solutions containing equal amounts of 14N- and 15N-labeled protein. Fibers propagating the VL strain type exhibited intra- and intermolecular cross-linking between amino acid residues 3 and 28, as well as intra- and intermolecular linking between 32 and 55. Inter- and intramolecular cross-linking between residues 32 and 55 were detected in fibers propagating the VK strain type. Adjacencies of amino acid residues in space revealed by cross-linking were used to constrain possible chain folds of different [PSI] strains. PMID:26265470

Efficient synthesis of hydroxystyrenes via biocatalytic decarboxylation/deacetylation of substituted cinnamic acids by newly isolated Pantoea agglomerans strains.

PubMed

Sharma, Upendra K; Sharma, Nandini; Salwan, Richa; Kumar, Rakesh; Kasana, Ramesh C; Sinha, Arun K

2012-02-01

Decarboxylation of substituted cinnamic acids is a predominantly followed pathway for obtaining hydroxystyrenes-one of the most extensively explored bioactive compounds in the food and flavor industry (e.g. FEMA GRAS approved 4-vinylguaiacol). For this, mild and green strategies providing good yields with high product selectivity are needed. Two newly isolated bacterial strains, i.e. Pantoea agglomerans KJLPB4 and P. agglomerans KJPB2, are reported for mild and effective decarboxylation of substituted cinnamic acids into corresponding hydroxystyrenes. Key operational parameters for the process, such as incubation temperature, incubation time, substrate concentration and effect of co-solvent, were optimized using ferulic acid as a model substrate. With strain KJLPB4, 1.51 g L⁻¹ 4-vinyl guaiacol (98% yield) was selectively obtained from 2 g L⁻¹ ferulic acid at 28 °C after 48 h incubation. However, KJPB2 provided vanillic acid in 85% yield after 72 h following the oxidative decarboxylation pathway. In addition, KJLPB4 was effectively exploited for the deacetylation of acetylated α-phenylcinnamic acids, providing corresponding compounds in 65-95% yields. Two newly isolated microbial strains are reported for the mild and selective decarboxylation of substituted cinnamic acids into hydroxystyrenes. Preparative-scale synthesis of vinyl guaiacol and utilization of renewable feedstock (ferulic acid extracted from maize bran) have been demonstrated to enhance the practical utility of the process. Copyright © 2011 Society of Chemical Industry.

Deoxyribonucleic acid-deficient strains of Candida albicans.

PubMed

Olaiya, A F; Steed, J R; Sogin, S J

1980-03-01

We analyzed a series of germ tube-negative variants isolated from Candida albicans 3153A for deoxyribonucleic acid content. As analyzed by flow microfluorometry, the deoxyribonucleic acid level in these variant strains was 50% of that of the parental strain and equivalent to that of haploid Saccharomyces cerevisiae. This finding was confirmed by comparison of survival rates when exposed to the mutagens ultraviolet light, ethyl methane sulfonate, and methyl methane sulfonate. The diameter of the variant cells as compared to the diameter of the parental 3153A strain showed a relationship similar to that of the diameters of haploid versus diploid S. cerevisiae. These results indicate that those strains may be representative of the imperfect stage of C. albicans.

Effect of acetic acid on ethanol production by Zymomonas mobilis mutant strains through continuous adaptation.

PubMed

Liu, Yu-Fan; Hsieh, Chia-Wen; Chang, Yao-Sheng; Wung, Being-Sun

2017-08-01

Acetic acid is a predominant by-product of lignocellulosic biofuel process, which inhibits microbial biocatalysts. Development of bacterial strains that are tolerant to acetic acid is challenging due to poor understanding of the underlying molecular mechanisms. In this study, we generated and characterized two acetic acid-tolerant strains of Zymomonas mobilis using N-methyl-N'-nitro-N-nitrosoguanidine (NTG)-acetate adaptive breeding. Two mutants, ZMA-142 and ZMA-167, were obtained, showing a significant growth rate at a concentration of 244 mM sodium acetate, while the growth of Z. mobilis ATCC 31823 were completely inhibited in presence of 195 mM sodium acetate. Our data showed that acetate-tolerance of ZMA-167 was attributed to a co-transcription of nhaA from ZMO0117, whereas the co-transcription was absent in ATCC 31823 and ZMA-142. Moreover, ZMA-142 and ZMA-167 exhibited a converstion rate (practical ethanol yield to theorical ethanol yield) of 90.16% and 86% at 195 mM acetate-pH 5 stress condition, respectively. We showed that acid adaptation of ZMA-142 and ZMA-167 to 146 mM acetate increased ZMA-142 and ZMA-167 resulted in an increase in ethanol yield by 32.21% and 21.16% under 195 mM acetate-pH 5 stress condition, respectively. The results indicate the acetate-adaptive seed culture of acetate-tolerant strains, ZMA-142 and ZMA-167, could enhance the ethanol production during fermentation.

40 CFR 799.9510 - TSCA bacterial reverse mutation test.

Code of Federal Regulations, 2014 CFR

2014-07-01

... 40 Protection of Environment 32 2014-07-01 2014-07-01 false TSCA bacterial reverse mutation test... REQUIREMENTS Health Effects Test Guidelines § 799.9510 TSCA bacterial reverse mutation test. (a) Scope. This... mutation test uses amino-acid requiring strains of Salmonella typhimurium and Escherichia coli to detect...

Microbial Degradation of Chlorogenic Acid by a Sphingomonas sp. Strain.

PubMed

Ma, Yuping; Wang, Xiaoyu; Nie, Xueling; Zhang, Zhan; Yang, Zongcan; Nie, Cong; Tang, Hongzhi

2016-08-01

In order to elucidate the metabolism of chlorogenic acid by environmental microbes, a strain of Sphingomonas sp. isolated from tobacco leaves was cultured under various conditions, and chlorogenic acid degradation and its metabolites were investigated. The strain converting chlorogenic acid was newly isolated and identified as a Sphingomonas sp. strain by 16S rRNA sequencing. The optimal conditions for growth and chlorogenic acid degradation were 37 °C and pH 7.0 with supplementation of 1.5 g/l (NH4)2SO4 as the nitrogen source and 2 g/l chlorogenic acid as the sole carbon source. The maximum chlorogenic acid tolerating capability for the strain was 5 g/l. The main metabolites were identified as caffeic acid, shikimic acid, and 3,4-dihydroxybenzoic acid based on gas chromatography-mass spectrometry analysis. The analysis reveals the biotransformation mechanism of chlorogenic acid in microbial cells isolated from the environment.

Investigation of lactic acid bacterial strains for meat fermentation and the product's antioxidant and angiotensin-I-converting-enzyme inhibitory activities.

PubMed

Takeda, Shiro; Matsufuji, Hisashi; Nakade, Koji; Takenoyama, Shin-Ichi; Ahhmed, Abdulatef; Sakata, Ryoichi; Kawahara, Satoshi; Muguruma, Michio

2017-03-01

In the lactic acid bacteria (LAB) strains screened from our LAB collection, Lactobacillus (L.) sakei strain no. 23 and L. curvatus strain no. 28 degraded meat protein and tolerated salt and nitrite in vitro. Fermented sausages inoculated strains no. 23 and no. 28 showed not only favorable increases in viable LAB counts and reduced pH, but also the degradation of meat protein. The sausages fermented with these strains showed significantly higher antioxidant activity than those without LAB or fermented by each LAB type strain. Angiotensin-I-converting-enzyme (ACE) inhibitory activity was also significantly higher in the sausages fermented with strain no. 23 than in those fermented with the type strain. Higher ACE inhibitory activity was also observed in the sausages fermented with strain no. 28, but did not differ significantly from those with the type strain. An analysis of the proteolysis and degradation products formed by each LAB in sausages suggested that those bioactivities yielded fermentation products such as peptides. Therefore, LAB starters that can adequately ferment meat, such as strains no. 23 and no. 28, should contribute to the production of bioactive compounds in meat products. © 2016 Japanese Society of Animal Science.

Obeticholic acid reduces bacterial translocation and inhibits intestinal inflammation in cirrhotic rats.

PubMed

Úbeda, María; Lario, Margaret; Muñoz, Leticia; Borrero, María-José; Rodríguez-Serrano, Macarena; Sánchez-Díaz, Ana-María; Del Campo, Rosa; Lledó, Lourdes; Pastor, Óscar; García-Bermejo, Laura; Díaz, David; Álvarez-Mon, Melchor; Albillos, Agustín

2016-05-01

In advanced cirrhosis, gut bacterial translocation is the consequence of intestinal barrier disruption and leads to bacterial infection. Bile acid abnormalities in cirrhosis could play a role in the integrity of the intestinal barrier and the control of microbiota, mainly through the farnesoid X receptor. We investigated the long-term effects of the farnesoid X receptor agonist, obeticholic acid, on gut bacterial translocation, intestinal microbiota composition, barrier integrity and inflammation in rats with CCl4-induced cirrhosis with ascites. Cirrhotic rats received a 2-week course of obeticholic acid or vehicle starting once ascites developed. We then determined: bacterial translocation by mesenteric lymph node culture, ileum expression of antimicrobial peptides and tight junction proteins by qPCR, fecal albumin loss, enteric bacterial load and microbiota composition by qPCR and pyrosequencing of ileum mucosa-attached contents, and intestinal inflammation by cytometry of the inflammatory infiltrate. Obeticholic acid reduced bacterial translocation from 78.3% to 33.3% (p<0.01) and upregulated the expression of the farnesoid X receptor-associated gene small heterodimer partner. Treatment improved ileum expression of antimicrobial peptides, angiogenin-1 and alpha-5-defensin, tight junction proteins zonulin-1 and occludin, and reduced fecal albumin loss and liver fibrosis. Enteric bacterial load normalized, and the distinctive mucosal microbiota of cirrhosis was reduced. Gut immune cell infiltration was reduced and inflammatory cytokine and Toll-like receptor 4 expression normalized. In ascitic cirrhotic rats, obeticholic acid reduces gut bacterial translocation via several complementary mechanisms at the intestinal level. This agent could be used as an alternative to antibiotics to prevent bacterial infection in cirrhosis. Copyright © 2016 European Association for the Study of the Liver. Published by Elsevier B.V. All rights reserved.

Trophosome of the Deep-Sea Tubeworm Riftia pachyptila Inhibits Bacterial Growth.

PubMed

Klose, Julia; Aistleitner, Karin; Horn, Matthias; Krenn, Liselotte; Dirsch, Verena; Zehl, Martin; Bright, Monika

2016-01-01

The giant tubeworm Riftia pachyptila lives in symbiosis with the chemoautotrophic gammaproteobacterium Cand. Endoriftia persephone. Symbionts are released back into the environment upon host death in high-pressure experiments, while microbial fouling is not involved in trophosome degradation. Therefore, we examined the antimicrobial effect of the tubeworm's trophosome and skin. The growth of all four tested Gram-positive, but only of one of the tested Gram-negative bacterial strains was inhibited by freshly fixed and degrading trophosome (incubated up to ten days at either warm or cold temperature), while no effect on Saccharomyces cerevisiae was observed. The skin did not show antimicrobial effects. A liquid chromatography-mass spectrometric analysis of the ethanol supernatant of fixed trophosomes lead to the tentative identification of the phospholipids 1-palmitoleyl-2-lyso-phosphatidylethanolamine, 2-palmitoleyl-1-lyso-phosphatidylethanolamine and the free fatty acids palmitoleic, palmitic and oleic acid, which are known to have an antimicrobial effect. As a result of tissue autolysis, the abundance of the free fatty acids increased with longer incubation time of trophosome samples. This correlated with an increasing growth inhibition of Bacillus subtilis and Listeria welshimeri, but not of the other bacterial strains. Therefore, the free fatty acids produced upon host degradation could be the cause of inhibition of at least these two bacterial strains.

Effects of selected pectinolytic bacterial strains on water-retting of hemp and fibre properties.

PubMed

Di Candilo, M; Bonatti, P M; Guidetti, C; Focher, B; Grippo, C; Tamburini, E; Mastromei, G

2010-01-01

To study the effect of selected bacterial strains on hemp water-retting and properties of retted fibre. The trials were performed in laboratory tanks. The traditional water-retting process, without inoculum addition, was compared to a process modified by inoculating water tanks with two selected pectinolytic bacteria: the anaerobic strain Clostridium sp. L1/6 and the aerobic strain Bacillus sp. ROO40B. Six different incubation times were compared. Half the fibre obtained from each tank was combed. Micromorphological analyses were performed by scanning electron microscopy on uncombed and combed fibres. Moreover, organoleptic and chemical analyses of uncombed fibres were performed. The inoculum, besides speeding up the process, significantly improved the fibre quality. The fibre was not damaged by mechanical hackling, thanks to the good retting level obtained by the addition of selected strains, differently to what happened with the traditionally retted fibre. The best fibre quality was obtained after 3-4 days of retting with the addition of the bacterial inoculum. Retting is the major limitation to an efficient production of high-quality hemp fibres. The water-retting process and fibre quality were substantially improved by simultaneously inoculating water tanks with two selected pectinolytic strains.

An integrated metagenomics pipeline for strain profiling reveals novel patterns of bacterial transmission and biogeography

PubMed Central

Nayfach, Stephen; Rodriguez-Mueller, Beltran; Garud, Nandita

2016-01-01

We present the Metagenomic Intra-species Diversity Analysis System (MIDAS), which is an integrated computational pipeline for quantifying bacterial species abundance and strain-level genomic variation, including gene content and single-nucleotide polymorphisms (SNPs), from shotgun metagenomes. Our method leverages a database of more than 30,000 bacterial reference genomes that we clustered into species groups. These cover the majority of abundant species in the human microbiome but only a small proportion of microbes in other environments, including soil and seawater. We applied MIDAS to stool metagenomes from 98 Swedish mothers and their infants over one year and used rare SNPs to track strains between hosts. Using this approach, we found that although species compositions of mothers and infants converged over time, strain-level similarity diverged. Specifically, early colonizing bacteria were often transmitted from an infant’s mother, while late colonizing bacteria were often transmitted from other sources in the environment and were enriched for spore-formation genes. We also applied MIDAS to 198 globally distributed marine metagenomes and used gene content to show that many prevalent bacterial species have population structure that correlates with geographic location. Strain-level genetic variants present in metagenomes clearly reveal extensive structure and dynamics that are obscured when data are analyzed at a coarser taxonomic resolution. PMID:27803195

Highly efficient production of hyaluronic acid by Streptococcus zooepidemicus R42 derived from heterologous expression of bacterial haemoglobin and mutant selection.

PubMed

Lu, J F; Zhu, Y; Sun, H L; Liang, S; Leng, F F; Li, H Y

2016-04-01

During Streptococcus zooepidemicus fermentation, most carbon sources are used to synthesize lactic acid, which can inhibit strain growth and hyaluronic acid production. Here, we expressed bacterial haemoglobin (Vhb) in Strep. zooepidemicus. Due to highly efficient oxygen use, only 15·26 g l(-1) lactic acid was produced, which is 0·73 times the quantity produced by the control strain. Compared with the control strain (1·61 g l(-1) ), hyaluronic acid (HA) production in this strain did not substantially increase, only to 2·16 g l(-1) . Next, we used a series of N-methyl-N'-nitro-N-nitroso-guanidine (NTG) treatments and selection programmes. Finally, we generated a hyaluronidase-negative and rifampin-resistant mutant strain that produces high levels of HA. The optimum carbon concentration for maximum hyaluronic acid production is only 30 g l(-1) of sucrose, which is lower than the control strain (60 g l(-1) ). The oxygen transfer rate coefficient KL a increased significantly to 372 ± 53 h(-1) from 18 ± 4 h(-1) of the control. The optimum carbon source for this strain is 21 g l(-1) of sucrose, 9 g l(-1) of maltose and 5 g l(-1) of glutamic acid. Hyaluronic acid accumulated at 6·7 g l(-1) in the culture broth. However, the molecular weight of HA decreased from 1835 KDa (Control) to 429 kDa. The prepared low-molecular weight HA could function as potential antiangiogenic substances, antiviral and antitumour agents to possibly be used as functional food ingredients. Hyaluronic acid (HA) has been used for a wide range of applications in health, cosmetic and clinical fields. During fermentation of Streptococcus to produce HA, 80-85% of the carbon source is used to produce lactic acid and acetic acid, and only approx. 5 and 10% of the carbon source is used to produce HA and biomass respectively. Here, we expressed bacteria haemoglobin (Vhb) in Streptococcus zooepidemicus, which can dramatically inhibit lactic acid production. After NTG

Addition of transcription activator-like effector binding sites to a pathogen strain-specific rice bacterial blight resistance gene makes it effective against additional strains and against bacterial leaf streak.

PubMed

Hummel, Aaron W; Doyle, Erin L; Bogdanove, Adam J

2012-09-01

Xanthomonas transcription activator-like (TAL) effectors promote disease in plants by binding to and activating host susceptibility genes. Plants counter with TAL effector-activated executor resistance genes, which cause host cell death and block disease progression. We asked whether the functional specificity of an executor gene could be broadened by adding different TAL effector binding elements (EBEs) to it. We added six EBEs to the rice Xa27 gene, which confers resistance to strains of the bacterial blight pathogen Xanthomonas oryzae pv. oryzae (Xoo) that deliver the TAL effector AvrXa27. The EBEs correspond to three other effectors from Xoo strain PXO99(A) and three from strain BLS256 of the bacterial leaf streak pathogen Xanthomonas oryzae pv. oryzicola (Xoc). Stable integration into rice produced healthy lines exhibiting gene activation by each TAL effector, and resistance to PXO99(A) , a PXO99(A) derivative lacking AvrXa27, and BLS256, as well as two other Xoo and 10 Xoc strains virulent toward wildtype Xa27 plants. Transcripts initiated primarily at a common site. Sequences in the EBEs were found to occur nonrandomly in rice promoters, suggesting an overlap with endogenous regulatory sequences. Thus, executor gene specificity can be broadened by adding EBEs, but caution is warranted because of the possible coincident introduction of endogenous regulatory elements. © 2012 The Authors. New Phytologist © 2012 New Phytologist Trust.

The use of lactic acid-producing, malic acid-producing, or malic acid-degrading yeast strains for acidity adjustment in the wine industry.

PubMed

Su, Jing; Wang, Tao; Wang, Yun; Li, Ying-Ying; Li, Hua

2014-03-01

In an era of economic globalization, the competition among wine businesses is likely to get tougher. Biotechnological innovation permeates the entire world and intensifies the severity of the competition of the wine industry. Moreover, modern consumers preferred individualized, tailored, and healthy and top quality wine products. Consequently, these two facts induce large gaps between wine production and wine consumption. Market-orientated yeast strains are presently being selected or developed for enhancing the core competitiveness of wine enterprises. Reasonable biological acidity is critical to warrant a high-quality wine. Many wild-type acidity adjustment yeast strains have been selected all over the world. Moreover, mutation breeding, metabolic engineering, genetic engineering, and protoplast fusion methods are used to construct new acidity adjustment yeast strains to meet the demands of the market. In this paper, strategies and concepts for strain selection or improvement methods were discussed, and many examples based upon selected studies involving acidity adjustment yeast strains were reviewed. Furthermore, the development of acidity adjustment yeast strains with minimized resource inputs, improved fermentation, and enological capabilities for an environmentally friendly production of healthy, top quality wine is presented.

Evaluation of indigenous bacterial strains for biocontrol of the frogeye leaf spot of soya bean caused by Cercospora sojina.

PubMed

Simonetti, E; Carmona, M A; Scandiani, M M; García, A F; Luque, A G; Correa, O S; Balestrasse, K B

2012-08-01

Assessment of biological control of Cercospora sojina, causal agent of frogeye leaf spot (FLS) of soya bean, using three indigenous bacterial strains, BNM297 (Pseudomonas fluorescens), BNM340 and BNM122 (Bacillus amyloliquefaciens). From cultures of each bacterial strain, cell suspensions and cell-free supernatants were obtained and assayed to determine their antifungal activity against C. sojina. Both mycelial growth and spore germination in vitro were more strongly inhibited by bacterial cell suspensions than by cell-free supernatants. The Bacillus strains BNM122 and BNM340 inhibited the fungal growth to a similar degree (I ≈ 52-53%), while cells from P. fluorescens BNM297 caused a lesser reduction (I ≈ 32-34%) in the fungus colony diameter. The foliar application of the two Bacillus strains on soya bean seedlings, under greenhouse conditions, significantly reduced the disease severity with respect to control soya bean seedlings and those sprayed with BNM297. This last bacterial strain was not effective in controlling FLS in vivo. Our data demonstrate that the application of antagonistic bacteria may be a promising and environmentally friendly alternative to control the FLS of soya bean.   To our knowledge, this is the first report of biological control of C. sojina by using native Bacillus strains. © 2012 The Authors. Letters in Applied Microbiology © 2012 The Society for Applied Microbiology.

Antibacterial Performance of Alginic Acid Coating on Polyethylene Film

PubMed Central

Karbassi, Elika; Asadinezhad, Ahmad; Lehocký, Marian; Humpolíček, Petr; Vesel, Alenka; Novák, Igor; Sáha, Petr

2014-01-01

Alginic acid coated polyethylene films were examined in terms of surface properties and bacteriostatic performance against two most representative bacterial strains, that is, Escherichia coli and Staphylococcus aureus. Microwave plasma treatment followed by brush formation in vapor state from three distinguished precursors (allylalcohol, allylamine, hydroxyethyl methacrylate) was carried out to deposit alginic acid on the substrate. Surface analyses via various techniques established that alginic acid was immobilized onto the surface where grafting (brush) chemistry influenced the amount of alginic acid coated. Moreover, alginic acid was found to be capable of bacterial growth inhibition which itself was significantly affected by the brush type. The polyanionic character of alginic acid as a carbohydrate polymer was assumed to play the pivotal role in antibacterial activity. The cell wall composition of two bacterial strains along with the substrates physicochemical properties accounted for different levels of bacteriostatic performance. PMID:25196604

Evaluation of insecticidal activity of a bacterial strain, Serratia sp. EML-SE1 against diamondback moth.

PubMed

Jeong, Hyung Uk; Mun, Hye Yeon; Oh, Hyung Keun; Kim, Seung Bum; Yang, Kwang Yeol; Kim, Iksoo; Lee, Hyang Burm

2010-08-01

To identify novel bioinsecticidal agents, a bacterial strain, Serratia sp. EML-SE1, was isolated from a dead larva of the lepidopteran diamondback moth (Plutella xylostella) collected from a cabbage field in Korea. In this study, the insecticidal activity of liquid cultures in Luria-Bertani broth (LBB) and nutrient broth (NB) of a bacterial strain, Serratia sp. EML-SE1 against thirty 3rd and 4th instar larvae of the diamondback moth was investigated on a Chinese cabbage leaf housed in a round plastic cage (Ø 10 x 6 cm). 72 h after spraying the cabbage leaf with LBB and NB cultures containing the bacterial strain, the mortalities of the larvae were determined to be 91.7% and 88.3%, respectively. In addition, the insecticidal activity on potted cabbage containing 14 leaves in a growth cage (165 x 83 x 124 cm) was found to be similar to that of the plastic cage experiment. The results of this study provided valuable information on the insecticidal activity of the liquid culture of a Serratia species against the diamondback moth.

Bioremediation potential of a highly mercury resistant bacterial strain Sphingobium SA2 isolated from contaminated soil.

PubMed

Mahbub, Khandaker Rayhan; Krishnan, Kannan; Megharaj, Mallavarapu; Naidu, Ravi

2016-02-01

A mercury resistant bacterial strain, SA2, was isolated from soil contaminated with mercury. The 16S rRNA gene sequence of this isolate showed 99% sequence similarity to the genera Sphingobium and Sphingomonas of α-proteobacteria group. However, the isolate formed a distinct phyletic line with the genus Sphingobium suggesting the strain belongs to Sphingobium sp. Toxicity studies indicated resistance to high levels of mercury with estimated EC50 values 4.5 mg L(-1) and 44.15 mg L(-1) and MIC values 5.1 mg L(-1) and 48.48 mg L(-1) in minimal and rich media, respectively. The strain SA2 was able to volatilize mercury by producing mercuric reductase enzyme which makes it potential candidate for remediating mercury. ICP-QQQ-MS analysis of Hg supplemented culture solutions confirmed that almost 79% mercury in the culture suspension was volatilized in 6 h. A very small amount of mercury was observed to accumulate in cell pellets which was also evident according to ESEM-EDX analysis. The mercuric reductase gene merA was amplified and sequenced. The deduced amino acid sequence demonstrated sequence homology with α-proteobacteria and Ascomycota group. Copyright © 2015 Elsevier Ltd. All rights reserved.

Isolation and characterization of a novel 2-methyl-4-chlorophenoxyacetic acid-degrading Enterobacter sp. strain SE08.

PubMed

Tan, Lin; Hu, Qiulong; Xiong, Xingyao; Su, Xiaojun; Huang, Yanning; Jiang, Ziwei; Zhou, Qingming; Zhao, Songyi; Zeng, Wei-ai

2013-10-01

A bacterial strain (SE08) capable of utilizing 2-methyl-4-chlorophenoxy acetic acid (MCPA) as the sole carbon and energy source for growth was isolated by continuous enrichment culturing in minimal salt medium (MSM) from a long term MCPA exposed soil. This bacterial strain was identified as Enterobacter sp. based on morphological, physiological and biochemical tests, as well as 16S rRNA sequence analysis. Its ability to degrade MCPA was determined using high performance liquid chromatography. The strain SE08 can tolerate unusually high MCPA concentrations (125-2000mg/L). The influences of culturing factors (initial concentration, pH, and temperature) on the bacterial growth and substrate degradation were studied. The results showed that the optimal MCPA degradation occurred at an MCPA concentration of 500mg/L, 30°C and pH 6.0. Under these conditions, 68.5 percent of MCPA in MSM was degraded by SE08, and the OD600nm reached 0.64 after culturing for 72h. The degradation of MCPA could be enhanced by addition of both carbon and nitrogen sources. At an initial MCPA concentration of 500mg/L, when 5g/L glucose and 2.5g/L yeast extract were added into the MSM media, the MCPA degradation was significantly increased to 83.8 percent, and OD600nm was increased to 1.09 after incubation at 30°C and pH 6.0 for 72h. This is the first study showing that an Enterobacter sp. strain is capable of degrading MCPA, which might provide a new approach for the remediation of MCPA contaminated soil and contribute to the limited knowledge about the function of Enterobacter species. Crown Copyright © 2013. Published by Elsevier Inc. All rights reserved.

Amino Acid and Vitamin Requirements of Several Bacteroides Strains

PubMed Central

Quinto, Grace

1966-01-01

Nutritional studies were performed on nine Bacteroides strains, by use of the methodology and media of anaerobic rumen microbiology. Ristella perfoetens CCI required l-arginine hydrochloride, l-tryptophan, l-leucine, l-histidine hydrochloride, l-cysteine hydrochloride, dl-valine, dl-tyrosine, and the vitamin calcium-d-pantothenate, since scant turbidity developed in media without these nutrients. R. perfoetens was stimulated by glycine, dl-lysine hydrochloride, dl-isoleucine, l-proline, l-glutamic acid, dl-alanine, dl-phenylalanine, dl-methionine, and the vitamins nicotinamide and p-aminobenzoic acid, since maximal turbidity developed more slowly in media without these nutrients than in complete medium. Medium A-23, which was devised for R. perfoetens, contained salts, 0.0002% nicotinamide and calcium d-pantothenate, 0.00001% p-aminobenzoic acid, 0.044% l-tryptophan, 0.09% l-glutamic acid, and 0.1% of the other 13 amino acids listed above. Zuberella clostridiformis and seven strains of R. pseudoinsolita did not require vitamins, and showed no absolute requirement for any one amino acid. Various strains produced maximal turbidity more slowly in media deficient in l-proline, glycine, l-glutamic acid, dl-serine, l-histidine hydrochloride, dl-alanine, or l-cysteine hydrochloride, than in complete medium. These eight strains grew optimally in medium A-23 plus 0.1% dl-serine but without vitamins. PMID:16349673

Beneficial role of hydrophytes in removing Cr(VI) from wastewater in association with chromate-reducing bacterial strains Ochrobactrum intermedium and Brevibacterium.

PubMed

Faisal, Muhammad; Hasnain, Shahida

2005-01-01

This study deals with the use of three chromium-resistant bacterial strains (Ochrobactrum intermedium CrT-1, Brevibacterium CrT-13, and CrM-1) in conjunction with Eichornia crassipes for the removal of toxic chromium from wastewater. Bacterial strains resulted in reduced uptake of chromate into inoculated plants as compared to noninoculated control plants. In the presence of different heavy metals, chromium uptake into the plants was 28.7 and 7.15% less at an initial K2CrO4 concentration of 100 and 500 microg ml(-1) in comparison to a metal free chromium solution. K2CrO4 uptake into the plant occurred at different pHs tested, but maximum uptake was observed at pH 5. Nevertheless, the bacterial strains caused some decrease in chromate uptake into the plants, but the combined effect of plants and bacterial strains conduce more removal of Cr(VI) from the solution.

Programmable removal of bacterial strains by use of genome-targeting CRISPR-Cas systems.

PubMed

Gomaa, Ahmed A; Klumpe, Heidi E; Luo, Michelle L; Selle, Kurt; Barrangou, Rodolphe; Beisel, Chase L

2014-01-28

CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems in bacteria and archaea employ CRISPR RNAs to specifically recognize the complementary DNA of foreign invaders, leading to sequence-specific cleavage or degradation of the target DNA. Recent work has shown that the accidental or intentional targeting of the bacterial genome is cytotoxic and can lead to cell death. Here, we have demonstrated that genome targeting with CRISPR-Cas systems can be employed for the sequence-specific and titratable removal of individual bacterial strains and species. Using the type I-E CRISPR-Cas system in Escherichia coli as a model, we found that this effect could be elicited using native or imported systems and was similarly potent regardless of the genomic location, strand, or transcriptional activity of the target sequence. Furthermore, the specificity of targeting with CRISPR RNAs could readily distinguish between even highly similar strains in pure or mixed cultures. Finally, varying the collection of delivered CRISPR RNAs could quantitatively control the relative number of individual strains within a mixed culture. Critically, the observed selectivity and programmability of bacterial removal would be virtually impossible with traditional antibiotics, bacteriophages, selectable markers, or tailored growth conditions. Once delivery challenges are addressed, we envision that this approach could offer a novel means to quantitatively control the composition of environmental and industrial microbial consortia and may open new avenues for the development of "smart" antibiotics that circumvent multidrug resistance and differentiate between pathogenic and beneficial microorganisms. Controlling the composition of microbial populations is a critical aspect in medicine, biotechnology, and environmental cycles. While different antimicrobial strategies, such as antibiotics, antimicrobial peptides, and lytic bacteriophages, offer partial solutions

Bioremediation of PCB-contaminated shallow river sediments: The efficacy of biodegradation using individual bacterial strains and their consortia.

PubMed

Horváthová, Hana; Lászlová, Katarína; Dercová, Katarína

2018-02-01

Elimination of dangerous toxic and hydrophobic chlorinated aromatic compounds, mainly PCBs from the environment, is one of the most important aims of the environmental biotechnologies. In this work, biodegradation of an industrial mixture of PCBs (Delor 103, equivalent to Aroclor 1242) was performed using bacterial consortia composed of four bacterial strains isolated from the historically PCB-contaminated sediments and characterized as Achromobacter xylosoxidans, Stenotrophomonas maltophilia, Ochrobactrum anthropi and Rhodococcus ruber. The objective of this research was to determine the biodegradation ability of the individual strains and artificially prepared consortia composed of two or three bacterial strains mentioned above. Based on the growth parameters, six consortia were constructed and inoculated into the historically contaminated sediment samples collected in the efflux canal of Chemko Strážske plant - the former producer of the industrial mixtures of PCBs. The efficacy of the biotreatment, namely bioaugmentation, was evaluated by determination of ecotoxicity of treated and non-treated sediments. The most effective consortia were those containing the strain R. ruber. In the combination with A. xylosoxidans, the biodegradation of the sum of the indicator congeners was 85% and in the combination with S. maltophilia nearly 80%, with inocula applied in the ratio 1:1 in both cases. Consortium containing the strain R. ruber and S. maltophilia showed pronounced degradation of the highly chlorinated PCB congeners. Among the consortia composed of three bacterial strains, only that consisting of O. anthropi, R. ruber and A. xylosoxidans showed higher biodegradation (73%). All created consortia significally reduced the toxicity of the contaminated sediment. Copyright © 2017 Elsevier Ltd. All rights reserved.

Biodegradation of the Herbicide 2,4-Dichlorophenoxyacetic Acid by a New Isolated Strain of Achromobacter sp. LZ35.

PubMed

Xia, Zhen-Yuan; Zhang, Long; Zhao, Yan; Yan, Xin; Li, Shun-Peng; Gu, Tao; Jiang, Jian-Dong

2017-02-01

In this study, a bacterial strain of Achromobacter sp. LZ35, which was capable of utilizing 2,4-dichlorophenoxyacetic acid (2,4-D) and 2-methyl-4-chlorophenoxy acetic acid (MCPA) as the sole sources of carbon and energy for growth, was isolated from the soil in a disused pesticide factory in Suzhou, China. The optimal 2,4-D degradation by strain LZ35 occurred at 30 °C and pH 8.0 when the initial 2,4-D concentration was 200 mg L -1 . Strain LZ35 harbored the conserved 2,4-D/alpha-ketoglutarate dioxygenase (96%) and 2,4-dichlorophenol hydroxylase (99%), and catabolized 2,4-D via the intermediate 2,4-dichlorophenol. The inoculation of 7.8 × 10 6  CFU g -1 soil of strain LZ35 cells to 2,4-D-contaminated soil could efficiently remove over 75 and 90% of 100 and 50 mg L -1 2,4-D in 12 days and significantly released the phytotoxicity of maize caused by the 2,4-D residue. This is the first report of an Achromobacter sp. strain that was capable of mineralizing both 2,4-D and MCPA. This study provides us a promising candidate for its application in the bioremediation of 2,4-D- or MCPA-contaminated sites.

Differentiation of different mixed Listeria strains and also acid-injured, heat-injured, and repaired cells of Listeria monocytogenes using fourier transform infrared spectroscopy.

PubMed

Nyarko, Esmond; Donnelly, Catherine

2015-03-01

Fourier transform infrared (FT-IR) spectroscopy was used to differentiate mixed strains of Listeria monocytogenes and mixed strains of L. monocytogenes and Listeria innocua. FT-IR spectroscopy was also applied to investigate the hypothesis that heat-injured and acid-injured cells would return to their original physiological integrity following repair. Thin smears of cells on infrared slides were prepared from cultures for mixed strains of L. monocytogenes, mixed strains of L. monocytogenes and L. innocua, and each individual strain. Heat-injured and acid-injured cells were prepared by exposing harvested cells of L. monocytogenes strain R2-764 to a temperature of 56 ± 0.2°C for 10 min or lactic acid at pH 3 for 60 min, respectively. Cellular repair involved incubating aliquots of acid-injured and heat-injured cells separately in Trypticase soy broth supplemented with 0.6% yeast extract for 22 to 24 h; bacterial thin smears on infrared slides were prepared for each treatment. Spectral collection was done using 250 scans at a resolution of 4 cm(-1) in the mid-infrared wavelength region. Application of multivariate discriminant analysis to the wavelength region from 1,800 to 900 cm(-1) separated the individual L. monocytogenes strains. Mixed strains of L. monocytogenes and L. monocytogenes cocultured with L. innocua were successfully differentiated from the individual strains when the discriminant analysis was applied. Different mixed strains of L. monocytogenes were also successfully separated when the discriminant analysis was applied. A data set for injury and repair analysis resulted in the separation of acid-injured, heat-injured, and intact cells; repaired cells clustered closer to intact cells when the discriminant analysis (1,800 to 600 cm(-1)) was applied. FT-IR spectroscopy can be used for the rapid source tracking of L. monocytogenes strains because it can differentiate between different mixed strains and individual strains of the pathogen.

Programmable Removal of Bacterial Strains by Use of Genome-Targeting CRISPR-Cas Systems

PubMed Central

Gomaa, Ahmed A.; Klumpe, Heidi E.; Luo, Michelle L.; Selle, Kurt; Barrangou, Rodolphe; Beisel, Chase L.

2014-01-01

ABSTRACT CRISPR (clustered regularly interspaced short palindromic repeats)-Cas (CRISPR-associated) systems in bacteria and archaea employ CRISPR RNAs to specifically recognize the complementary DNA of foreign invaders, leading to sequence-specific cleavage or degradation of the target DNA. Recent work has shown that the accidental or intentional targeting of the bacterial genome is cytotoxic and can lead to cell death. Here, we have demonstrated that genome targeting with CRISPR-Cas systems can be employed for the sequence-specific and titratable removal of individual bacterial strains and species. Using the type I-E CRISPR-Cas system in Escherichia coli as a model, we found that this effect could be elicited using native or imported systems and was similarly potent regardless of the genomic location, strand, or transcriptional activity of the target sequence. Furthermore, the specificity of targeting with CRISPR RNAs could readily distinguish between even highly similar strains in pure or mixed cultures. Finally, varying the collection of delivered CRISPR RNAs could quantitatively control the relative number of individual strains within a mixed culture. Critically, the observed selectivity and programmability of bacterial removal would be virtually impossible with traditional antibiotics, bacteriophages, selectable markers, or tailored growth conditions. Once delivery challenges are addressed, we envision that this approach could offer a novel means to quantitatively control the composition of environmental and industrial microbial consortia and may open new avenues for the development of “smart” antibiotics that circumvent multidrug resistance and differentiate between pathogenic and beneficial microorganisms. PMID:24473129

Pipecolic acid enhances resistance to bacterial infection and primes salicylic acid and nicotine accumulation in tobacco

PubMed Central

Vogel-Adghough, Drissia; Stahl, Elia; Návarová, Hana; Zeier, Jürgen

2013-01-01

Distinct amino acid metabolic pathways constitute integral parts of the plant immune system. We have recently identified pipecolic acid (Pip), a lysine-derived non-protein amino acid, as a critical regulator of systemic acquired resistance (SAR) and basal immunity to bacterial infection in Arabidopsis thaliana. In Arabidopsis, Pip acts as an endogenous mediator of defense amplification and priming. For instance, Pip conditions plants for effective biosynthesis of the phenolic defense signal salicylic acid (SA), accumulation of the phytoalexin camalexin, and expression of defense-related genes. Here, we show that tobacco plants respond to leaf infection by the compatible bacterial pathogen Pseudomonas syringae pv tabaci (Pstb) with a significant accumulation of several amino acids, including Lys, branched-chain, aromatic, and amide group amino acids. Moreover, Pstb strongly triggers, alongside the biosynthesis of SA and increases in the defensive alkaloid nicotine, the production of the Lys catabolites Pip and α-aminoadipic acid. Exogenous application of Pip to tobacco plants provides significant protection to infection by adapted Pstb or by non-adapted, hypersensitive cell death-inducing P. syringae pv maculicola. Pip thereby primes tobacco for rapid and strong accumulation of SA and nicotine following bacterial infection. Thus, our study indicates that the role of Pip as an amplifier of immune responses is conserved between members of the rosid and asterid groups of eudicot plants and suggests a broad practical applicability for Pip as a natural enhancer of plant disease resistance. PMID:24025239

Very high gravity ethanol and fatty acid production of Zymomonas mobilis without amino acid and vitamin.

PubMed

Wang, Haoyong; Cao, Shangzhi; Wang, William Tianshuo; Wang, Kaven Tianyv; Jia, Xianhui

2016-06-01

Very high gravity (VHG) fermentation is the mainstream technology in ethanol industry, which requires the strains be resistant to multiple stresses such as high glucose concentration, high ethanol concentration, high temperature and harsh acidic conditions. To our knowledge, it was not reported previously that any ethanol-producing microbe showed a high performance in VHG fermentations without amino acid and vitamin. Here we demonstrate the engineering of a xylose utilizing recombinant Zymomonas mobilis for VHG ethanol fermentations. The recombinant strain can produce ethanol up to 136 g/L without amino acid and vitamin with a theoretical yield of 90 %, which is significantly superior to that produced by all the reported ethanol-producing strains. The intracellular fatty acids of the bacterial were about 16 % of the bacterial dry biomass, with the ratio of ethanol:fatty acids was about 273:1 (g/g). The recombinant strain was achieved by a multivariate-modular strategy tackles with the multiple stresses which are closely linked to the ethanol productivity of Z. mobilis. The over-expression of metB/yfdZ operon enabled the growth of the recombinant Z. mobilis in a chemically defined medium without amino acid and vitamin; and the fatty acids overproduction significantly increased ethanol tolerance and ethanol production. The coupled production of ethanol with fatty acids of the Z. mobilis without amino acid and vitamin under VHG fermentation conditions may permit a significant reduction of the production cost of ethanol and microbial fatty acids.

Substrate utilization profiles of bacterial strains in plankton from the River Warnow, a humic and eutrophic river in north Germany.

PubMed

Freese, Heike M; Eggert, Anja; Garland, Jay L; Schumann, Rhena

2010-01-01

Bacteria are very important degraders of organic substances in aquatic environments. Despite their influential role in the carbon (and many other element) cycle(s), the specific genetic identity of active bacteria is mostly unknown, although contributing phylogenetic groups had been investigated. Moreover, the degree to which phenotypic potential (i. e., utilization of environmentally relevant carbon substrates) is related to the genomic identity of bacteria or bacterial groups is unclear. The present study compared the genomic fingerprints of 27 bacterial isolates from the humic River Warnow with their ability to utilize 14 environmentally relevant substrates. Acetate was the only substrate utilized by all bacterial strains. Only 60% of the strains respired glucose, but this substrate always stimulated the highest bacterial activity (respiration and growth). Two isolates, both closely related to the same Pseudomonas sp., also had very similar substrate utilization patterns. However, similar substrate utilization profiles commonly belonged to genetically different strains (e.g., the substrate profile of Janthinobacterium lividum OW6/RT-3 and Flavobacterium sp. OW3/15-5 differed by only three substrates). Substrate consumption was sometimes totally different for genetically related isolates. Thus, the genomic profiles of bacterial strains were not congruent with their different substrate utilization profiles. Additionally, changes in pre-incubation conditions strongly influenced substrate utilization. Therefore, it is problematic to infer substrate utilization and especially microbial dissolved organic matter transformation in aquatic systems from bacterial molecular taxonomy.

Production and Reutilization of Fluorescent Dissolved Organic Matter by a Marine Bacterial Strain, Alteromonas macleodii

PubMed Central

Goto, Shuji; Tada, Yuya; Suzuki, Koji; Yamashita, Youhei

2017-01-01

The recalcitrant fraction of marine dissolved organic matter (DOM) plays an important role in carbon storage on the earth’s surface. Bacterial production of recalcitrant DOM (RDOM) has been proposed as a carbon sequestration process. It is still unclear whether bacterial physiology can affect RDOM production. In this study, we conducted a batch culture using the marine bacterial isolate Alteromonas macleodii, a ubiquitous gammaproteobacterium, to evaluate the linkage between bacterial growth and DOM production. Glucose (1 mmol C L-1) was used as the sole carbon source, and the bacterial number, the DOM concentration in terms of carbon, and the excitation–emission matrices (EEMs) of DOM were monitored during the 168-h incubation. The incubation period was partitioned into the exponential growth (0–24 h) and stationary phases (24–168 h) based on the growth curve. Although the DOM concentration decreased during the exponential growth phase due to glucose consumption, it remained stable during the stationary phase, corresponding to approximately 4% of the initial glucose in terms of carbon. Distinct fluorophores were not evident in the EEMs at the beginning of the incubation, but DOM produced by the strain exhibited five fluorescent peaks during exponential growth. Two fluorescent peaks were similar to protein-like fluorophores, while the others could be categorized as humic-like fluorophores. All fluorophores increased during the exponential growth phase. The tryptophan-like fluorophore decreased during the stationary phase, suggesting that the strain reused the large exopolymer. The tyrosine-like fluorophore seemed to be stable during the stationary phase, implying that the production of tyrosine-containing small peptides through the degradation of exopolymers was correlated with the reutilization of the tyrosine-like fluorophore. Two humic-like fluorophores that showed emission maxima at the longer wavelength (525 nm) increased during the stationary phase

Detoxification of cancerogenic compounds by lactic acid bacteria strains.

PubMed

Lili, Zhao; Junyan, Wei; Hongfei, Zhao; Baoqing, Zhu; Bolin, Zhang

2017-10-20

Carcinogens in food are an important issue that threat people's health right now. Lactic acid bacteria (LAB) strains as well-known probiotics have shown numerous perspectives in being used as a good food additive to confront cancerogenic compounds in recent years. Some LAB strains can remove cancerogenic compounds from medium environment via direct physical binding and avoid re-pollution of poisonous secondary metabolites which are generated from degradation of cancerogenic compounds. This article presents a whole overview of the physical-binding of LAB strains to such common cancerogenic compounds existed in food and feed environments as mycotoxins, polycyclic aromatic hydrocarbons (PAHs), heterocyclic amines (HAs) and pthalic acid esters (PAEs).In most cases, summaries of these published researches show that the binding of LAB strains to cancerogenic compounds is a physical process. Binding sites generally take place in cell wall, and peptidoglycan from LAB cells is the chief binding site. The adsorption of lactic acid bacteria to cancerogenic compounds is strain-specific. Specially, the strains from the two genera Lactobacillus and Bifidobacterium show a better potential in binding cancerogenic compounds. Moreover, we firstly used molecular dynamic computer model as a highly potential tool to simulate the binding behavior of peptidoglycan from Lactobacillus acidophilus to DBP, one of pthalic acid esters with genetic toxicity. It was seen that the theoretical data were quite consistent with the experimental results in terms of the ability of this bacterium to bind DBP. Also, the toxicity reduction of cancerogenic compounds by LAB strains could be achieved either in gastrointestinal model or animal tests and clinical researches as well. In conclusion, carefully selected LAB strains should be a good solution as one of safety strategies to reduce potential risk of cancerogenic compounds from food-based products.

Bacterial Metabolism of Chlorinated Dehydroabietic Acids Occurring in Pulp and Paper Mill Effluents

PubMed Central

Mohn, W. W.; Stewart, G. R.

1997-01-01

Chlorinated dehydroabietic acids are formed during the chlorine bleaching of wood pulp and are very toxic to fish. Thus, destruction of these compounds is an important function of biological treatment systems for pulp and paper mill effluents. In this study, 12 strains of diverse, aerobic resin acid-degrading bacteria were screened for the ability to grow on chlorinated dehydroabietic acids as sole organic substrates. All seven strains of the class Proteobacteria able to use dehydroabietic acid were also able to use a mixture of 12- and 14-chlorodehydroabietic acid (Cl-DhA). None of the strains used 12,14-dichlorodehydroabietic acid. Sphingomonas sp. strain DhA-33 grew best on Cl-DhA and simultaneously removed both Cl-DhA isomers. Ralstonia sp. strain BKME-6 was typical of most of the strains tested, growing more slowly on Cl-DhA and leaving higher residual concentrations of Cl-DhA than DhA-33 did. Strains DhA-33 and BKME-6 mineralized (converted to CO(inf2) plus biomass) 32 and 43%, respectively, of carbon in Cl-DhA consumed. Strain DhA-33 produced a metabolite from Cl-DhA, tentatively identified as 3-oxo-14-chlorodehydroabietin, and both strains produced dissolved organic carbon which may include unidentified metabolites. Cl-DhA removal was inducible in both DhA-33 and BKME-6, and induced DhA-33 cells also removed 12,14-dichlorodehydroabietic acid. Based on activities of strains DhA-33 and BKME-6, chlorinated DhAs, and potentially toxic metabolite(s) of these compounds, are relatively persistent in biological treatment systems and in the environment. PMID:16535663

Simultaneous Microcystis Algicidal and Microcystin Degrading Capability by a Single Acinetobacter Bacterial Strain.

PubMed

Li, Hong; Ai, Hainan; Kang, Li; Sun, Xingfu; He, Qiang

2016-11-01

Measures for removal of toxic harmful algal blooms often cause lysis of algal cells and release of microcystins (MCs). In this study, Acinetobacter sp. CMDB-2 that exhibits distinct algal lysing activity and MCs degradation capability was isolated. The physiological response and morphological characteristics of toxin-producing Microcystis aeruginosa, the dynamics of intra- and extracellular MC-LR concentration were studied in an algal/bacterial cocultured system. The results demonstrated that Acinetobacter sp. CMDB-2 caused thorough decomposition of algal cells and impairment of photosynthesis within 24 h. Enhanced algal lysis and MC-LR release appeared with increasing bacterial density from 1 × 10 3 to 1 × 10 7 cells/mL; however, the MC-LR was reduced by nearly 94% within 14 h irrespective of bacterial density. Measurement of extracellular and intracellular MC-LR revealed that the toxin was decreased by 92% in bacterial cell incubated systems relative to control and bacterial cell-free filtrate systems. The results confirmed that the bacterial metabolite caused 92% lysis of Microcystis aeruginosa cells, whereas the bacterial cells were responsible for approximately 91% reduction of MC-LR. The joint efforts of the bacterium and its metabolite accomplished the sustainable removal of algae and MC-LR. This is the first report of a single bacterial strain that achieves these dual actions.

Amylolytic bacterial lactic acid fermentation - a review.

PubMed

Reddy, Gopal; Altaf, Md; Naveena, B J; Venkateshwar, M; Kumar, E Vijay

2008-01-01

Lactic acid, an enigmatic chemical has wide applications in food, pharmaceutical, leather, textile industries and as chemical feed stock. Novel applications in synthesis of biodegradable plastics have increased the demand for lactic acid. Microbial fermentations are preferred over chemical synthesis of lactic acid due to various factors. Refined sugars, though costly, are the choice substrates for lactic acid production using Lactobacillus sps. Complex natural starchy raw materials used for production of lactic acid involve pretreatment by gelatinization and liquefaction followed by enzymatic saccharification to glucose and subsequent conversion of glucose to lactic acid by Lactobacillus fermentation. Direct conversion of starchy biomass to lactic acid by bacteria possessing both amylolytic and lactic acid producing character will eliminate the two step process to make it economical. Very few amylolytic lactic acid bacteria with high potential to produce lactic acid at high substrate concentrations are reported till date. In this view, a search has been made for various amylolytic LAB involved in production of lactic acid and utilization of cheaply available renewable agricultural starchy biomass. Lactobacillus amylophilus GV6 is an efficient and widely studied amylolytic lactic acid producing bacteria capable of utilizing inexpensive carbon and nitrogen substrates with high lactic acid production efficiency. This is the first review on amylolytic bacterial lactic acid fermentations till date.

Specificity of monoclonal antibodies to strains of Dickeya sp. that cause bacterial heart rot of pineapple.

PubMed

Peckham, Gabriel D; Kaneshiro, Wendy S; Luu, Van; Berestecky, John M; Alvarez, Anne M

2010-10-01

During a severe outbreak of bacterial heart rot that occurred in pineapple plantations on Oahu, Hawaii, in 2003 and years following, 43 bacterial strains were isolated from diseased plants or irrigation water and identified as Erwinia chrysanthemi (now Dickeya sp.) by phenotypic, molecular, and pathogenicity assays. Rep-PCR fingerprint patterns grouped strains from pineapple plants and irrigation water into five genotypes (A-E) that differed from representatives of other Dickeya species, Pectobacterium carotovorum and other enteric saprophytes isolated from pineapple. Monoclonal antibodies produced following immunization of mice with virulent type C Dickeya sp. showed only two specificities. MAb Pine-1 (2D11G1, IgG1 with kappa light chain) reacted to all 43 pineapple/water strains and some reference strains (D. dianthicola, D. chrysanthemi, D. paradisiaca, some D. dadantii, and uncharacterized Dickeya sp.) but did not react to reference strains of D. dieffenbachiae, D. zeae, or one of the two Malaysian pineapple strains. MAb Pine-2 (2A7F2, IgG3 with kappa light chain) reacted to all type B, C, and D strains but not to any A or E strains or any reference strains except Dickeya sp. isolated from Malaysian pineapple. Pathogenicity tests showed that type C strains were more aggressive than type A strains when inoculated during cool months. Therefore, MAb Pine-2 distinguishes the more virulent type C strains from less virulent type A pineapple strains and type E water strains. MAbs with these two specificities enable development of rapid diagnostic tests that will distinguish the systemic heart rot pathogen from opportunistic bacteria associated with rotted tissues. Use of the two MAbs in field assays also permits the monitoring of a known subpopulation and provides additional decision tools for disease containment and management practices.

Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo

PubMed Central

McDonald, Nathan D.; Lubin, Jean-Bernard; Chowdhury, Nityananda

2016-01-01

ABSTRACT A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota. Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. PMID:27073099

The strains recommended for use in the bacterial reverse mutation test (OECD guideline 471) can be certified as non-genetically modified organisms.

PubMed

Sugiyama, Kei-Ichi; Yamada, Masami; Awogi, Takumi; Hakura, Atsushi

2016-01-01

The bacterial reverse mutation test, commonly called Ames test, is used worldwide. In Japan, the genetically modified organisms (GMOs) are regulated under the Cartagena Domestic Law, and organisms obtained by self-cloning and/or natural occurrence would be exempted from the law case by case. The strains of Salmonella typhimurium and Escherichia coli recommended for use in the bacterial reverse mutation test (OECD guideline 471), have been considered as non-GMOs because they can be constructed by self-cloning or naturally occurring bacterial strains, or do not disturb the biological diversity. The present article explains the reasons why these tester strains should be classified as non-GMOs.

Bacterially Induced Weathering of Ultramafic Rock and Its Implications for Phytoextraction

PubMed Central

Kidd, Petra; Kuffner, Melanie; Prieto-Fernández, Ángeles; Hann, Stephan; Monterroso, Carmela; Sessitsch, Angela; Wenzel, Walter; Puschenreiter, Markus

2013-01-01

The bioavailability of metals in soil is often cited as a limiting factor of phytoextraction (or phytomining). Bacterial metabolites, such as organic acids, siderophores, or biosurfactants, have been shown to mobilize metals, and their use to improve metal extraction has been proposed. In this study, the weathering capacities of, and Ni mobilization by, bacterial strains were evaluated. Minimal medium containing ground ultramafic rock was inoculated with either of two Arthrobacter strains: LA44 (indole acetic acid [IAA] producer) or SBA82 (siderophore producer, PO4 solubilizer, and IAA producer). Trace elements and organic compounds were determined in aliquots taken at different time intervals after inoculation. Trace metal fractionation was carried out on the remaining rock at the end of the experiment. The results suggest that the strains act upon different mineral phases. LA44 is a more efficient Ni mobilizer, apparently solubilizing Ni associated with Mn oxides, and this appeared to be related to oxalate production. SBA82 also leads to release of Ni and Mn, albeit to a much lower extent. In this case, the concurrent mobilization of Fe and Si indicates preferential weathering of Fe oxides and serpentine minerals, possibly related to the siderophore production capacity of the strain. The same bacterial strains were tested in a soil-plant system: the Ni hyperaccumulator Alyssum serpyllifolium subsp. malacitanum was grown in ultramafic soil in a rhizobox system and inoculated with each bacterial strain. At harvest, biomass production and shoot Ni concentrations were higher in plants from inoculated pots than from noninoculated pots. Ni yield was significantly enhanced in plants inoculated with LA44. These results suggest that Ni-mobilizing inoculants could be useful for improving Ni uptake by hyperaccumulator plants. PMID:23793627

A quasi-universal medium to break the aerobic/anaerobic bacterial culture dichotomy in clinical microbiology.

PubMed

Dione, N; Khelaifia, S; La Scola, B; Lagier, J C; Raoult, D

2016-01-01

In the mid-19th century, the dichotomy between aerobic and anaerobic bacteria was introduced. Nevertheless, the aerobic growth of strictly anaerobic bacterial species such as Ruminococcus gnavus and Fusobacterium necrophorum, in a culture medium containing antioxidants, was recently demonstrated. We tested aerobically the culture of 623 bacterial strains from 276 bacterial species including 82 strictly anaerobic, 154 facultative anaerobic, 31 aerobic and nine microaerophilic bacterial species as well as ten fungi. The basic culture medium was based on Schaedler agar supplemented with 1 g/L ascorbic acid and 0.1 g/L glutathione (R-medium). We successively optimized this media, adding 0.4 g/L uric acid, using separate autoclaving of the component, or adding haemin 0.1 g/L or α-ketoglutarate 2 g/L. In the basic medium, 237 bacterial species and ten fungal species grew but with no growth of 36 bacterial species, including 22 strict anaerobes. Adding uric acid allowed the growth of 14 further species including eight strict anaerobes, while separate autoclaving allowed the growth of all tested bacterial strains. To extend its potential use for fastidious bacteria, we added haemin for Haemophilus influenzae, Haemophilus parainfluenzae and Eikenella corrodens and α-ketoglutarate for Legionella pneumophila. This medium allowed the growth of all tested strains with the exception of Mycobacterium tuberculosis and Mycobacterium bovis. Testing primoculture and more fastidious species will constitute the main work to be done, but R-medium coupled with a rapid identification method (matrix-assisted laser desorption/ionization time-of-flight mass spectrometry) will facilitate the anaerobic culture in clinical microbiology laboratories. Copyright © 2015 The Authors. Published by Elsevier Ltd.. All rights reserved.

Proof of Principle for a Real-Time Pathogen Isolation Media Diagnostic: The Use of Laser-Induced Breakdown Spectroscopy to Discriminate Bacterial Pathogens and Antimicrobial-Resistant Staphylococcus aureus Strains Grown on Blood Agar

PubMed Central

Multari, Rosalie A.; Cremers, David A.; Bostian, Melissa L.; Dupre, Joanne M.

2013-01-01

Laser-Induced Breakdown Spectroscopy (LIBS) is a rapid, in situ, diagnostic technique in which light emissions from a laser plasma formed on the sample are used for analysis allowing automated analysis results to be available in seconds to minutes. This speed of analysis coupled with little or no sample preparation makes LIBS an attractive detection tool. In this study, it is demonstrated that LIBS can be utilized to discriminate both the bacterial species and strains of bacterial colonies grown on blood agar. A discrimination algorithm was created based on multivariate regression analysis of spectral data. The algorithm was deployed on a simulated LIBS instrument system to demonstrate discrimination capability using 6 species. Genetically altered Staphylococcus aureus strains grown on BA, including isogenic sets that differed only by the acquisition of mutations that increase fusidic acid or vancomycin resistance, were also discriminated. The algorithm successfully identified all thirteen cultures used in this study in a time period of 2 minutes. This work provides proof of principle for a LIBS instrumentation system that could be developed for the rapid discrimination of bacterial species and strains demonstrating relatively minor genomic alterations using data collected directly from pathogen isolation media. PMID:24109513

Measurement of the incorporation rates of four amino acids into proteins for estimating bacterial production.

PubMed

Servais, P

1995-03-01

In aquatic ecosystems, [(3)H]thymidine incorporation into bacterial DNA and [(3)H]leucine incorporation into proteins are usually used to estimate bacterial production. The incorporation rates of four amino acids (leucine, tyrosine, lysine, alanine) into proteins of bacteria were measured in parallel on natural freshwater samples from the basin of the river Meuse (Belgium). Comparison of the incorporation into proteins and into the total macromolecular fraction showed that these different amino acids were incorporated at more than 90% into proteins. From incorporation measurements at four subsaturated concentrations (range, 2-77 nm), the maximum incorporation rates were determined. Strong correlations (r > 0.91 for all the calculated correlations) were found between the maximum incorporation rates of the different tested amino acids over a range of two orders of magnitude of bacterial activity. Bacterial production estimates were calculated using theoretical and experimental conversion factors. The productions calculated from the incorporation rates of the four amino acids were in good concordance, especially when the experimental conversion factors were used (slope range, 0.91-1.11, and r > 0.91). This study suggests that the incorporation of various amino acids into proteins can be used to estimate bacterial production.

Production of a novel 9,12-dihydroxy-10(E)-eicosenoic acid from eicosenoic acid by Pseudomonas aeruginosa PR3

USDA-ARS?s Scientific Manuscript database

Microbial conversions of unsaturated fatty acids often generate polyhydroxy fatty acids rendering them to have new properties such as higher viscosity and reactivity. A bacterial strain Pseudomonas aeruginosa (PR3) has been intensively studied to produce mono-, di-, and tri-hydroxy fatty acids from...

Plant domestication and the assembly of bacterial and fungal communities associated with strains of the common sunflower, Helianthus annuus.

PubMed

Leff, Jonathan W; Lynch, Ryan C; Kane, Nolan C; Fierer, Noah

2017-04-01

Root and rhizosphere microbial communities can affect plant health, but it remains undetermined how plant domestication may influence these bacterial and fungal communities. We grew 33 sunflower (Helianthus annuus) strains (n = 5) that varied in their extent of domestication and assessed rhizosphere and root endosphere bacterial and fungal communities. We also assessed fungal communities in the sunflower seeds to investigate the degree to which root and rhizosphere communities were influenced by vertical transmission of the microbiome through seeds. Neither root nor rhizosphere bacterial communities were affected by the extent of sunflower domestication, but domestication did affect the composition of rhizosphere fungal communities. In particular, more modern sunflower strains had lower relative abundances of putative fungal pathogens. Seed-associated fungal communities strongly differed across strains, but several lines of evidence suggest that there is minimal vertical transmission of fungi from seeds to the adult plants. Our results indicate that plant-associated fungal communities are more strongly influenced by host genetic factors and plant breeding than bacterial communities, a finding that could influence strategies for optimizing microbial communities to improve crop yields. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

Total lipid and fatty acid composition of eight strains of marine diatoms

NASA Astrophysics Data System (ADS)

Liang, Ying; Mai, Kang-Sen; Sun, Shi-Chun

2000-12-01

Fatty acid composition and total lipid content of 8 strains of marine diatoms ( Nitzschia frustrula, Nitzschia closterium, Nitzschia incerta, Navicula pelliculosa, Phaeodactylum tricornutum, Synedra fragilaroides) were examined. The microalgae were grown under defined conditions and harvested at the late exponential phase. The major fatty acids in most strains were 14∶0 (1.0% 6.3%), 16∶0 (13.5 26.4%), 16∶1n-7 (21.1% 46.3%) and 20∶5n-3 (6.5% 19.5%). The polyunsaturated fatty acids 16∶2n-4, 16∶3n-4, 16∶4n-1 and 20∶4n-6 also comprised a significant proportion of the total fatty acids in some strains. The characteristic fatty acid composition of diatoms is readily distinguishable from those of other microalgal groups. Significant concentration of the polyunsaturated fatty acid 20∶5n-3 (eicosapentaenoic acid) was present in each strain, with the highest proportion in B222 (19.5%).

Free lactic acid production under acidic conditions by lactic acid bacteria strains: challenges and future prospects.

PubMed

Singhvi, Mamata; Zendo, Takeshi; Sonomoto, Kenji

2018-05-26

Lactic acid (LA) is an important platform chemical due to its significant applications in various fields and its use as a monomer for the production of biodegradable poly(lactic acid) (PLA). Free LA production is required to get rid of CaSO 4 , a waste material produced during fermentation at neutral pH which will lead to easy purification of LA required for the production of biodegradable PLA. Additionally, there is no need to use corrosive acids to release free LA from the calcium lactate produced during neutral fermentation. To date, several attempts have been made to improve the acid tolerance of lactic acid bacteria (LAB) by using both genome-shuffling approaches and rational design based on known mechanisms of LA tolerance and gene deletion in yeast strains. However, the lack of knowledge and the complexity of acid-tolerance mechanisms have made it challenging to generate LA-tolerant strains by simply modifying few target genes. Currently, adaptive evolution has proven an efficient strategy to improve the LA tolerance of individual/engineered strains. The main objectives of this article are to summarize the conventional biotechnological LA fermentation processes to date, assess their overall economic and environmental cost, and to introduce modern LA fermentation strategies for free LA production. In this review, we provide a broad overview of free LA fermentation processes using robust LAB that can ferment in acidic environments, the obstacles to these processes and their possible solutions, and the impact on future development of free LA fermentation processes commercially.

Methods for producing 3-hydroxypropionic acid and other products

DOEpatents

Lynch, Michael D.; Gill, Ryan T.; Lipscomb, Tanya E. W.

2016-07-12

This invention relates to metabolically engineered microorganism strains, such as bacterial strains, in which there is an increased utilization of malonyl-CoA for production of a chemical product, which includes 3-hydroxypropionic acid.

Method for producing 3-hydroxypropionic acid and other products

DOEpatents

Lynch, Michael D.; Gill, Ryan T.; Lipscomb, Tanya E.W.

2016-08-30

This invention relates to metabolically engineered microorganism strains, such as bacterial strains, in which there is an increased utilization of malonyl-CoA for production of a chemical product, which includes 3-hydroxypropionic acid.

Draft Genome Sequence of Two Strains of Xanthomonas arboricola Isolated from Prunus persica Which Are Dissimilar to Strains That Cause Bacterial Spot Disease on Prunus spp.

PubMed Central

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.

2016-01-01

The draft genome sequences of two strains of Xanthomonas arboricola, isolated from asymptomatic peach trees in Spain, are reported here. These strains are avirulent and do not belong to the same phylogroup as X. arboricola pv. pruni, a causal agent of bacterial spot disease of stone fruits and almonds. PMID:27609931

Effects of acetic acid, ethanol, and SO(2) on the removal of volatile acidity from acidic wines by two Saccharomyces cerevisiae commercial strains.

PubMed

Vilela-Moura, Alice; Schuller, Dorit; Mendes-Faia, Arlete; Côrte-Real, Manuela

2010-07-01

Herein, we report the influence of different combinations of initial concentration of acetic acid and ethanol on the removal of acetic acid from acidic wines by two commercial Saccharomyces cerevisiae strains S26 and S29. Both strains reduced the volatile acidity of an acidic wine (1.0 gl(-1) acetic acid and 11% (v/v) ethanol) by 78% and 48%, respectively. Acetic acid removal by strains S26 and S29 was associated with a decrease in ethanol concentration of 0.7 and 1.2% (v/v), respectively. Strain S26 revealed better removal efficiency due to its higher tolerance to stress factors imposed by acidic wines. Sulfur dioxide (SO(2)) in the concentration range 95-170 mg l(-1)inhibits the ability of both strains to reduce the volatile acidity of the acidic wine used under our experimental conditions. Therefore, deacidification should be carried out either in wines stabilized by filtration or in wines with SO(2)concentrations up to 70 mg l(-1). Deacidification of wines with the better performing strain S26 was associated with changes in the concentration of volatile compounds. The most pronounced increase was observed for isoamyl acetate (banana) and ethyl hexanoate (apple, pineapple), with an 18- and 25-fold increment, respectively, to values above the detection threshold. The acetaldehyde concentration of the deacidified wine was 2.3 times higher, and may have a detrimental effect on the wine aroma. Moreover, deacidification led to increased fatty acids concentration, but still within the range of values described for spontaneous fermentations, and with apparently no negative impact on the organoleptical properties.

Identification of Rhizobium phaseoli Strains That Are Tolerant or Sensitive to Soil Acidity

PubMed Central

Lowendorf, Henry S.; Alexander, Martin

1983-01-01

A study was conducted to determine whether the survival of Rhizobium phaseoli in acid soils could be predicted on the basis of the tolerance of the organism to acidity in culture. Of 16 strains tested, all grew in culture at pH 4.6, but only those that grew at pH 3.8 survived in soils having pH values of 4.1 to 4.6. Strains that tolerated the lowest pH values in culture were tolerant of the highest aluminum concentrations. In one acid soil, an acid-tolerant strain was unable to survive in numbers greater than 100/g, but the poor survival was not related to the level of extractable aluminum or manganese in the soil. Reproduction of an acid-tolerant strain of R. phaseoli was enhanced in the rhizosphere of Phaseolus vulgaris in both acid and limed soils, but stimulation of an acid-sensitive strain by the plant occurred only in the limed soil. These results indicate that cultural tests can be used to predict the ability of R. phaseoli to survive in acid soil. PMID:16346239

Strain improvement and metabolic flux analysis in the wild-type and a mutant Lactobacillus lactis strain for L(+)-lactic acid production.

PubMed

Bai, Dong-Mei; Zhao, Xue-Ming; Li, Xin-Gang; Xu, Shi-Min

2004-12-20

The effects of initial glucose concentration and calcium lactate concentration on the lactic acid production by the parent strain, Lactobacillus lactis BME5-18, were studied. The results of the experiments indicated that glucose and lactate repressed the cell growth and the lactic acid production by Lactobacillus lactis BME5-18. A L(+)-lactic acid overproducing strain, Lactobacillus lactis BME5-18M, was screened by mutagenizing the parent strain with ultraviolet (UV) light irradiation and selecting the high glucose and lactate calcium concentration repression resistant mutant. Starting with a concentration of 100g L(-1) glucose, the mutant produced 98.6 g L(-1) lactic acid after 60 h in flasks, 73.9% higher than that of the parent strain. The L(+)-lactic acid purity was 98.1% by weight based on the amount of total lactic acid. The culture of the parent strain could not be analyzed well by conventional metabolic flux analysis techniques, since some pyruvate were accumulated intracellularly. Therefore, a revised flux analysis method was proposed by introducing intracellular pyruvate pool. Further studies demonstrate that there is a high level of NADH oxidase activity (12.11 mmol mg(-1) min(-1)) in the parent strain. The molecular mechanisms of the strain improvement were proposed, i.e., the high level of NADH oxidase activity was eliminated and the uptake rate of glucose was increased from 82.1 C-mmol (g DW h)(-1) to 98.9 C-mmol (g DW h)(-1) by mutagenizing the parent strain with UV, and therefore the mutant strain converts mostly pyruvate to lactic acid with a higher productivity (1.76 g L(-1) h(-1)) than the parent strain (0.95 g L(-1) h(-1)).

Analysis of the bacterial strains using Biolog plates in the contaminated soil from Riyadh community.

PubMed

Al-Dhabaan, Fahad Abdullah M; Bakhali, Ali Hassan

2017-05-01

Routine manufacture, detonation and disposal of explosives in land and groundwater have resulted in complete pollution. Explosives are xenobiotic compounds, being toxic to biological systems, and their recalcitrance leads to persistence in the environment. The methods currently used for the remediation of explosive contaminated sites are expensive and can result in the formation of toxic products. The present study aimed to investigate the bacterial strains using the Biolog plates in the soil from the Riyadh community. The microbial strains were isolated using the spread plate technique and were identified using the Biolog method. In this study we have analyzed from bacterial families of soil samples, obtained from the different sites in 5 regions at Explosive Institute. Our results conclude that Biolog MicroPlates were developed for the rapid identification of bacterial isolates by sole-carbon source utilization and can be used for the identification of bacteria. Out of five communities, only four families of bacteria indicate that the microbial community lacks significant diversity in region one from the Riyadh community in Saudi Arabia. More studies are needed to be carried out in different regions to validate our results.

Comparisons of Internal Behavior after Exposure to Flavobacterium psychrophilum between Two Ayu (Plecoglossus altivelis altivelis) Strains Showing Different Cumulative Mortality to Bacterial Cold Water Disease

PubMed Central

KAGEYAMA, Tetsushi; KUWADA, Tomonori; OHARA, Kenichi; NOUNO, Aya; UMINO, Tetsuya; FURUSAWA, Shuichi

2013-01-01

ABSTRACT Bacterial cold water disease (BCWD) in ayu (Plecoglossus altivelis altivelis) has a serious impact on aquaculture and fisheries. There is known to be a significant difference among ayu strains with regard to mortality caused by BCWD. In this study, the immune response of different ayu strains against Flavobacterium psychrophilum infection was observed. One strain was resistant to infection by F. psychrophilum, and the other was susceptible to infection by the same bacteria. The number of bacteria in the body was observed in each ayu strain, and the change in bacterial counts was similar. However, there was a significant difference in bacterial count in the spleen between the two strains on days 6, 9, 12 and 15 after exposure. To observe the immune response against F. psychrophilum, agglutination assay using serum was performed. An agglutination reaction in the resistant ayu strain was observed in 4 out of 6 ayu on day 6 after exposure, while no reactions in the susceptible ayu strain were observed in any sampled fish until day 12. However, some reactions in the susceptible ayu strain were observed in surviving ayu. These results indicate that there is a correlation between the presence of bacterial multiplication and agglutination reaction against F. psychrophilum. PMID:23902927

Polysaccharide capsule and sialic acid-mediated regulation promote biofilm-like intracellular bacterial communities during cystitis.

PubMed

Anderson, Gregory G; Goller, Carlos C; Justice, Sheryl; Hultgren, Scott J; Seed, Patrick C

2010-03-01

Uropathogenic Escherichia coli (UPEC) is the leading cause of urinary tract infections (UTIs). A murine UTI model has revealed an infection cascade whereby UPEC undergoes cycles of invasion of the bladder epithelium, intracellular proliferation in polysaccharide-containing biofilm-like masses called intracellular bacterial communities (IBC), and then dispersal into the bladder lumen to initiate further rounds of epithelial colonization and invasion. We predicted that the UPEC K1 polysaccharide capsule is a key constituent of the IBC matrix. Compared to prototypic E. coli K1 strain UTI89, a capsule assembly mutant had a fitness defect in functionally TLR4(+) and TLR4(-) mice, suggesting a protective role of capsule in inflamed and noninflamed hosts. K1 capsule assembly and synthesis mutants had dramatically reduced IBC formation, demonstrating the common requirement for K1 polysaccharide in IBC development. The capsule assembly mutant appeared dispersed in the cytoplasm of the bladder epithelial cells and failed to undergo high-density intracellular replication during later stages of infection, when the wild-type strain continued to form serial generations of IBC. Deletion of the sialic acid regulator gene nanR partially restored IBC formation in the capsule assembly mutant. These data suggest that capsule is necessary for efficient IBC formation and that aberrant sialic acid accumulation, resulting from disruption of K1 capsule assembly, produces a NanR-mediated defect in intracellular proliferation and IBC development. Together, these data demonstrate the complex but important roles of UPEC polysaccharide encapsulation and sialic acid signaling in multiple stages of UTI pathogenesis.

Engineering Escherichia coli for Biodiesel Production Utilizing a Bacterial Fatty Acid Methyltransferase▿†

PubMed Central

Nawabi, Parwez; Bauer, Stefan; Kyrpides, Nikos; Lykidis, Athanasios

2011-01-01

The production of low-cost biofuels in engineered microorganisms is of great interest due to the continual increase in the world's energy demands. Biodiesel is a renewable fuel that can potentially be produced in microbes cost-effectively. Fatty acid methyl esters (FAMEs) are a common component of biodiesel and can be synthesized from either triacylglycerol or free fatty acids (FFAs). Here we report the identification of a novel bacterial fatty acid methyltransferase (FAMT) that catalyzes the formation of FAMEs and 3-hydroxyl fatty acid methyl esters (3-OH-FAMEs) from the respective free acids and S-adenosylmethionine (AdoMet). FAMT exhibits a higher specificity toward 3-hydroxy free fatty acids (3-OH-FFAs) than FFAs, synthesizing 3-hydroxy fatty acid methyl esters (3-OH-FAMEs) in vivo. We have also identified bacterial members of the fatty acyl-acyl carrier protein (ACP) thioesterase (FAT) enzyme family with distinct acyl chain specificities. These bacterial FATs exhibit increased specificity toward 3-hydroxyacyl-ACP, generating 3-OH-FFAs, which can subsequently be utilized by FAMTs to produce 3-OH-FAMEs. PhaG (3-hydroxyacyl ACP:coenzyme A [CoA] transacylase) constitutes an alternative route to 3-OH-FFA synthesis; the coexpression of PhaG with FAMT led to the highest level of accumulation of 3-OH-FAMEs and FAMEs. The availability of AdoMet, the second substrate for FAMT, is an important factor regulating the amount of methyl esters produced by bacterial cells. Our results indicate that the deletion of the global methionine regulator metJ and the overexpression of methionine adenosyltransferase result in increased methyl ester synthesis. PMID:21926202

Mineralization of the sulfonated azo dye Mordant Yellow 3 by a 6-aminonaphthalene-2-sulfonate-degrading bacterial consortium.

PubMed Central

Haug, W; Schmidt, A; Nörtemann, B; Hempel, D C; Stolz, A; Knackmuss, H J

1991-01-01

Under anaerobic conditions the sulfonated azo dye Mordant Yellow 3 was reduced by the biomass of a bacterial consortium grown aerobically with 6-aminonaphthalene-2-sulfonic acid. Stoichiometric amounts of the aromatic amines 6-aminonaphthalene-2-sulfonate and 5-aminosalicylate were generated and excreted into the medium. After re-aeration of the culture, these amines were mineralized by different members of the bacterial culture. Thus, total degradation of a sulfonated azo dye was achieved by using an alternating anaerobic-aerobic treatment. The ability of the mixed bacterial culture to reduce the azo dye was correlated with the presence of strain BN6, which possessed the ability to oxidize various naphthalenesulfonic acids. It is suggested that strain BN6 has a transport system for naphthalenesulfonic acids which also catalyzes uptake of sulfonated azo dyes. These dyes are then gratuitously reduced in the cytoplasm by unspecific reductases. PMID:1781678

A Nonluminescent and Highly Virulent Vibrio harveyi Strain Is Associated with “Bacterial White Tail Disease” of Litopenaeus vannamei Shrimp

PubMed Central

Zhou, Junfang; Fang, Wenhong; Yang, Xianle; Zhou, Shuai; Hu, Linlin; Li, Xincang; Qi, Xinyong; Su, Hang; Xie, Layue

2012-01-01

Recurrent outbreaks of a disease in pond-cultured juvenile and subadult Litopenaeus vannamei shrimp in several districts in China remain an important problem in recent years. The disease was characterized by “white tail” and generally accompanied by mass mortalities. Based on data from the microscopical analyses, PCR detection and 16S rRNA sequencing, a new Vibrio harveyi strain (designated as strain HLB0905) was identified as the etiologic pathogen. The bacterial isolation and challenge tests demonstrated that the HLB0905 strain was nonluminescent but highly virulent. It could cause mass mortality in affected shrimp during a short time period with a low dose of infection. Meanwhile, the histopathological and electron microscopical analysis both showed that the HLB0905 strain could cause severe fiber cell damages and striated muscle necrosis by accumulating in the tail muscle of L. vannamei shrimp, which led the affected shrimp to exhibit white or opaque lesions in the tail. The typical sign was closely similar to that caused by infectious myonecrosis (IMN), white tail disease (WTD) or penaeid white tail disease (PWTD). To differentiate from such diseases as with a sign of “white tail” but of non-bacterial origin, the present disease was named as “bacterial white tail disease (BWTD)”. Present study revealed that, just like IMN and WTD, BWTD could also cause mass mortalities in pond-cultured shrimp. These results suggested that some bacterial strains are changing themselves from secondary to primary pathogens by enhancing their virulence in current shrimp aquaculture system. PMID:22383954

Isolation of bacterial cellulose nanocrystalline from pineapple peel waste: Optimization of acid concentration in the hydrolysis method

NASA Astrophysics Data System (ADS)

Anwar, Budiman; Rosyid, Nurul Huda; Effendi, Devi Bentia; Nandiyanto, Asep Bayu Dani; Mudzakir, Ahmad; Hidayat, Topik

2016-02-01

Isolation of needle-shaped bacterial cellulose nanocrystalline with a diameter of 16-64 nm, a fiber length of 258-806 nm, and a degree of crystallinity of 64% from pineapple peel waste using an acid hydrolysis process was investigated. Experimental showed that selective concentration of acid played important roles in isolating the bacterial cellulose nanocrystalline from the cellulose source. To achieve the successful isolation of bacterial cellulose nanocrystalline, various acid concentrations were tested. To confirm the effect of acid concentration on the successful isolation process, the reaction conditions were fixed at a temperature of 50°C, a hydrolysis time of 30 minutes, and a bacterial cellulose-to-acid ratio of 1:50. Pineapple peel waste was used as a model for a cellulose source because to the best of our knowledge, there is no report on the use of this raw material for producing bacterial cellulose nanocrystalline. In fact, this material can be used as an alternative for ecofriendly and cost-free cellulose sources. Therefore, understanding in how to isolate bacterial cellulose nanocrystalline from pineapple peel waste has the potential for large-scale production of inexpensive cellulose nanocrystalline.

Rhizospheric Bacterial Strain Brevibacterium casei MH8a Colonizes Plant Tissues and Enhances Cd, Zn, Cu Phytoextraction by White Mustard.

PubMed

Płociniczak, Tomasz; Sinkkonen, Aki; Romantschuk, Martin; Sułowicz, Sławomir; Piotrowska-Seget, Zofia

2016-01-01

Environmental pollution by heavy metals has become a serious problem in the world. Phytoextraction, which is one of the plant-based technologies, has attracted the most attention for the bioremediation of soils polluted with these contaminants. The aim of this study was to determine whether the multiple-tolerant bacterium, Brevibacterium casei MH8a isolated from the heavy metal-contaminated rhizosphere soil of Sinapis alba L., is able to promote plant growth and enhance Cd, Zn, and Cu uptake by white mustard under laboratory conditions. Additionally, the ability of the rifampicin-resistant spontaneous mutant of MH8a to colonize plant tissues and its mechanisms of plant growth promotion were also examined. In order to assess the ecological consequences of bioaugmentation on autochthonous bacteria, the phospholipid fatty acid (PLFA) analysis was used. The MH8a strain exhibited the ability to produce ammonia, 1-amino-cyclopropane-1-carboxylic acid deaminase, indole 3-acetic acid and HCN but was not able to solubilize inorganic phosphate and produce siderophores. Introduction of MH8a into soil significantly increased S. alba biomass and the accumulation of Cd (208%), Zn (86%), and Cu (39%) in plant shoots in comparison with those grown in non-inoculated soil. Introduced into the soil, MH8a was able to enter the plant and was found in the roots and leaves of inoculated plants thus indicating its endophytic features. PLFA analysis revealed that the MH8a that was introduced into soil had a temporary influence on the structure of the autochthonous bacterial communities. The plant growth-promoting features of the MH8a strain and its ability to enhance the metal uptake by white mustard and its long-term survival in soil as well as its temporary impact on autochthonous microorganisms make the strain a suitable candidate for the promotion of plant growth and the efficiency of phytoextraction.

Novel approach for the use of dairy industry wastes for bacterial growth media production.

PubMed

Kasmi, Mariam; Elleuch, Lobna; Dahmeni, Ameni; Hamdi, Moktar; Trabelsi, Ismail; Snoussi, Mejdi

2018-04-15

This work proposes a novel approach for the reuse and the recovery of dairy wastes valuable components. Thermal coagulation was performed for dairy effluents and the main responsible fraction for the organic matter content (protein and fat) was separated. Dairy curds were prepared for the formulation of bacterial growth media. Protein, sugar, fat and fatty acids contents have been assessed. Samples treated at 100 °C exhibited marked improvement in terms of protein (25-50%) recovery compared to those treated at 80 °C. Fatty acid analysis revealed the presence of unsaturated fatty acids (mainly oleic acid) that are essential to promote Lactobacillus growth. Previously isolated and identified bacterial strains from dairy wastes (Lactobacillus paracasei, Lactobacillus plantarum, Lactococcus lactis and Lactobacillus brevis) were investigated for their ability to grow on the formulated media. All the tested lactic acid bacteria exhibited greater bacterial growth on the formulated media supplemented with glucose only or with both glucose and yeast extract compared to the control media. By reference to the commercial growth medium, the productivity ratio of the supplemented bactofugate (B) and decreaming (D) formulated media exceeded 0.6 for L. paracasei culture. Whereas, the productivity ratio of the supplemented B medium was greater than 1 compared to the control medium for all the tested strains. As for the supplemented D medium, its productivity ratio was greater than 1 compared to the control medium for both L. paracasei and L. plantarum strains. Copyright © 2018 Elsevier Ltd. All rights reserved.

[Isolation, identification and characterization of acid-producing strains from psychrotolerant biogas fermentation].

PubMed

Wan, Yongqing; Zhang, Wei; Mandlaa; Tian, Ruihua; Wang, Ruigang; Duan, Kaihong

2015-11-04

The aim of this study was to screen acid-producing strains from the broth of psychrotolerant biogas fermentation and evaluate the acid-producing character of them. Acid-producing strains were isolated by a medium with methyl red at 4 degrees C in Petri dishes and identified by morphology observation and 16S rRNA sequencing. Moreover, the ability of hydrolysis of starch, fermentation of carbohydrates, liquefaction of gelatin and production of catalase were studied. Two acid-producing strains (FJ-8 and FJ-15) were isolated. The result of the 16S rRNA phylogenetic tree shows that FJ-8 and FJ-15 belong to Pseudomonas sp. and Shewanella sp., respectively. Both FJ-8 and FJ-15 could hydrolyze starch, liquidize gelatin and produce catalase. The optimum temperature for acid-producing of FJ-8 and FJ-15 is 15 degrees C and 20 degrees C, respectively. After 10 days cultivation at 4 degrees C, the concentration of acetic acid was 792 mg/L and 966 mg/L of FJ-8 and FJ-15, respectively. The selected strains, FJ-8 and FJ-15, have the potential to produce acids at low temperature.

Evaluating the potential of immobilized bacterial consortium for black liquor biodegradation.

PubMed

Paliwal, Rashmi; Uniyal, Shivani; Rai, J P N

2015-05-01

Two indigenous bacterial strains, Bacillus megaterium ETLB-1 (accession no. KC767548) and Pseudomonas plecoglossicida ETLB-3 (accession no. KC767547), isolated from soil contaminated with paper mill effluent, were co-immobilized on corncob cubes to investigate their biodegradation potential against black liquor (BL). Results exhibit conspicuous reduction in color and lignin of BL upto 913.46 Co-Pt and 531.45 mg l(-1), respectively. Reduction in chlorophenols up to 12 mg l(-1) was recorded with highest release of chloride ions, i.e., 1290 mg l(-1). Maximum enzyme activity for lignin peroxidase (LiP), manganese peroxidase (MnP), and laccase (LAC) was recorded as 5.06, 8.13, and 8.23 U ml(-1), respectively, during the treatment. Scanning electron microscopy (SEM) revealed successful immobilization of bacterial strains in porous structures of biomaterial. Gas chromatography/mass spectroscopy (GC/MS) showed formation of certain low molecular weight metabolites such as 4-hydroxy-benzoic acid, 3-hydroxy-4-methoxybenzaldehyde, ferulic acid, and t-cinnamic acid and removal of majority of the compounds (such as teratogenic phthalate derivatives) during the period of treatment. Results demonstrated that the indigenous bacterial consortium possesses excellent decolorization and lignin degradation capability which enables its commercial utilization in effluents treatment system.

Characterization and degradation potential of diesel-degrading bacterial strains for application in bioremediation.

PubMed

Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco

2017-10-03

Bioremediation of polluted soils is a promising technique with low environmental impact, which uses soil organisms to degrade soil contaminants. In this study, 19 bacterial strains isolated from a diesel-contaminated soil were screened for their diesel-degrading potential, biosurfactant (BS) production, and biofilm formation abilities, all desirable characteristics when selecting strains for re-inoculation into hydrocarbon-contaminated soils. Diesel-degradation rates were determined in vitro in minimal medium with diesel as the sole carbon source. The capacity to degrade diesel range organics (DROs) of strains SPG23 (Arthobacter sp.) and PF1 (Acinetobacter oleivorans) reached 17-26% of total DROs after 10 days, and 90% for strain GK2 (Acinetobacter calcoaceticus). The amount and rate of alkane degradation decreased significantly with increasing carbon number for strains SPG23 and PF1. Strain GK2, which produced BSs and biofilms, exhibited a greater extent, and faster rate of alkane degradation compared to SPG23 and PF1. Based on the outcomes of degradation experiments, in addition to BS production, biofilm formation capacities, and previous genome characterizations, strain GK2 is a promising candidate for microbial-assisted phytoremediation of diesel-contaminated soils. These results are of particular interest to select suitable strains for bioremediation, not only presenting high diesel-degradation rates, but also other characteristics which could improve rhizosphere colonization.

Bio-degradation of oily food waste employing thermophilic bacterial strains.

PubMed

Awasthi, Mukesh Kumar; Selvam, Ammaiyappan; Chan, Man Ting; Wong, Jonathan W C

2018-01-01

The objective of this work was to isolate a novel thermophilic bacterial strain and develop a bacterial consortium (BC) for efficient degradation oily food waste. Four treatments were designed: 1:1 mixture of pre-consumption food wastes (PrCFWs) and post-consumption food wastes (PCFWs) (T-1), 1:2 mixture of PrCFWs and PCFWs mixture (T-2), PrCFWs (T-3) and PCFWs (T-4). Equal quantity of BC was inoculated into each treatment to compare the oil degradation efficiency. Results showed that after 15days of incubation, a maximum oil reduction of 65.12±0.08% was observed in treatment T-4, followed by T-2 (55.44±0.12%), T-3 (54.79±0.04%) and T-1 (52.52±0.02%), while oil reduction was negligible in control. Results indicate that the development of oil utilizing thermophilic BC was more cost-effective in solving the degradation of oily food wastes and conversion into a stable end product. Copyright © 2017 Elsevier Ltd. All rights reserved.

PHYLOGENETIC AFFILIATION OF WATER DISTRIBUTION SYSTEM BACTERIAL ISOLATES USING 16S RDNA SEQUENCE ANALYSIS

EPA Science Inventory

In a previously described study, only 15% of the bacterial strains isolated from a water distribution system (WDS) grown on R2A agar were identifiable using fatty acid methyl esthers (FAME) profiling. The lack of success was attributed to the use of fatty acid databases of bacter...

Selected Schizosaccharomyces pombe Strains Have Characteristics That Are Beneficial for Winemaking

PubMed Central

Benito, Ángel; Jeffares, Daniel; Palomero, Felipe; Calderón, Fernando; Bai, Feng-Yan; Bähler, Jürg; Benito, Santiago

2016-01-01

At present, wine is generally produced using Saccharomyces yeast followed by Oenococus bacteria to complete malolactic fermentation. This method has some unsolved problems, such as the management of highly acidic musts and the production of potentially toxic products including biogenic amines and ethyl carbamate. Here we explore the potential of the fission yeast Schizosaccharomyces pombe to solve these problems. We characterise an extensive worldwide collection of S. pombe strains according to classic biochemical parameters of oenological interest. We identify three genetically different S. pombe strains that appear suitable for winemaking. These strains compare favourably to standard Saccharomyces cerevisiae winemaking strains, in that they perform effective malic acid deacidification and significantly reduce levels of biogenic amines and ethyl carbamate precursors without the need for any secondary bacterial malolactic fermentation. These findings indicate that the use of certain S. pombe strains could be advantageous for winemaking in regions where malic acid is problematic, and these strains also show superior performance with respect to food safety. PMID:27007548

[Fatty acids composition of cellular lipids of the collected and newly isolated Pseudomonas lupini strains].

PubMed

Hvozdiak, R I; Dankevych, L A; Votselko, S K; Holubets', O V

2005-01-01

Fatty acid composition of cellular lipids of 23 Pseudomonas lupini strains (Beltjukova et Koroljova 1968) has been investigated. Cellular fatty acids which contained from C10 to C19 carbon atoms have been identified. Basic fatty acid of those Pseudomonas cells are hexadecanoic, hexadecenoic and octadecanoic acids. The 3-hydroxydecanoic (C10:0 3OH), 3-hydroxydodecanoic (C12:0 3OH), 2-hydroxydodecanoic (C12:0 2OH) and cyclopropane fatty acids which contain 17 and 19 carbon atoms have been detected in cellular lipids. The cellular fatty acids spectra of 22 P. lupini strains are similar to cellular fatty acids spectrum of the type strain Pseudomonas syringae pv. syringae 8511. Pathogenic isolate 2, which fatty acid content of cell lipids significantly differ from lipids of cell fatty acids from P. lupini strains and cell lipids of fatty acids of typical strains Pseudomonas syringae pv. syringae 8511 and Pseudomonas savastanoi pv. phaseolicola 9066 is the exception.

Phage-Encoded Colanic Acid-Degrading Enzyme Permits Lytic Phage Infection of a Capsule-Forming Resistant Mutant Escherichia coli Strain

PubMed Central

Kim, Min Soo; Kim, Young Deuk; Hong, Sung Sik; Park, Kwangseo; Ko, Kwan Soo

2014-01-01

In this study, we isolated a bacteriophage T7-resistant mutant strain of Escherichia coli (named S3) and then proceeded to characterize it. The mutant bacterial colonies appeared to be mucoid. Microarray analysis revealed that genes related to colanic acid production were upregulated in the mutant. Increases in colanic acid production by the mutant bacteria were observed when l-fucose was measured biochemically, and protective capsule formation was observed under an electron microscope. We found a point mutation in the lon gene promoter in S3, the mutant bacterium. Overproduction of colanic acid was observed in some phage-resistant mutant bacteria after infection with other bacteriophages, T4 and lambda. Colanic acid overproduction was also observed in clinical isolates of E. coli upon phage infection. The overproduction of colanic acid resulted in the inhibition of bacteriophage adsorption to the host. Biofilm formation initially decreased shortly after infection but eventually increased after 48 h of incubation due to the emergence of the mutant bacteria. Bacteriophage PBECO4 was shown to infect the colanic acid-overproducing mutant strains of E. coli. We confirmed that the gene product of open reading frame 547 (ORF547) of PBECO4 harbored colanic acid-degrading enzymatic (CAE) activity. Treatment of the T7-resistant bacteria with both T7 and PBECO4 or its purified enzyme (CAE) led to successful T7 infection. Biofilm formation decreased with the mixed infection, too. This procedure, using a phage cocktail different from those exploiting solely receptor differences, represents a novel strategy for overcoming phage resistance in mutant bacteria. PMID:25416767

Cellulose-ethylenediaminetetraacetic acid conjugates protect mammalian cells from bacterial cells.

PubMed

Luo, Jie; Lv, Wei; Deng, Ying; Sun, Yuyu

2013-04-08

Cellulose-ethylenediaminetetraacetic acid (EDTA) conjugates were synthesized by the esterification of cellulose with ethylenediaminetetraacetic dianhydride (EDTAD). The new materials provided potent antimicrobial activities against Staphylococcus aureus (S. aureus, Gram-positive bacteria) and Pseudomonas aeruginosa (P. aeruginosa, Gram-negative bacteria), and inhibited the formation of bacterial biofilms. The biocompatibility of the new cellulose-EDTA conjugates was evaluated with mouse skin fibroblasts for up to 14 days. SEM observation and DNA content analysis suggested that the new materials sustained the viability of fibroblast cells. Moreover, in mouse skin fibroblast-bacteria co-culture systems, the new cellulose-EDTA conjugates prevented bacterial biofilm formation and protected the mammalian cells from the bacterial cells for at least one day.

Biotransformation of Tributyltin chloride by Pseudomonas stutzeri strain DN2

PubMed Central

Khanolkar, Dnyanada S.; Naik, Milind Mohan; Dubey, Santosh Kumar

2014-01-01

A bacterial isolate capable of utilizing tributyltin chloride (TBTCl) as sole carbon source was isolated from estuarine sediments of west coast of India and identified as Pseudomonas stutzeri based on biochemical tests and Fatty acid methyl ester (FAME) analysis. This isolate was designated as strain DN2. Although this bacterial isolate could resist up to 3 mM TBTCl level, it showed maximum growth at 2 mM TBTCl in mineral salt medium (MSM). Pseudomonas stutzeri DN2 exposed to 2 mM TBTCl revealed significant alteration in cell morphology as elongation and shrinkage in cell size along with roughness of cell surface. FTIR and NMR analysis of TBTCl degradation product extracted using chloroform and purified using column chromatography clearly revealed biotransformation of TBTCl into Dibutyltin dichloride (DBTCl2) through debutylation process. Therefore, Pseudomonas stutzeri strain DN2 may be used as a potential bacterial strain for bioremediation of TBTCl contaminated aquatic environmental sites. PMID:25763027

Bacterial Prostatitis: Bacterial Virulence, Clinical Outcomes, and New Directions.

PubMed

Krieger, John N; Thumbikat, Praveen

2016-02-01

Four prostatitis syndromes are recognized clinically: acute bacterial prostatitis, chronic bacterial prostatitis, chronic prostatitis/chronic pelvic pain syndrome, and asymptomatic prostatitis. Because Escherichia coli represents the most common cause of bacterial prostatitis, we investigated the importance of bacterial virulence factors and antimicrobial resistance in E. coli strains causing prostatitis and the potential association of these characteristics with clinical outcomes. A structured literature review revealed that we have limited understanding of the virulence-associated characteristics of E. coli causing acute prostatitis. Therefore, we completed a comprehensive microbiological and molecular investigation of a unique strain collection isolated from healthy young men. We also considered new data from an animal model system suggesting certain E. coli might prove important in the etiology of chronic prostatitis/chronic pelvic pain syndrome. Our human data suggest that E. coli needs multiple pathogenicity-associated traits to overcome anatomic and immune responses in healthy young men without urological risk factors. The phylogenetic background and accumulation of an exceptional repertoire of extraintestinal pathogenic virulence-associated genes indicate that these E. coli strains belong to a highly virulent subset of uropathogenic variants. In contrast, antibiotic resistance confers little added advantage to E. coli strains in these healthy outpatients. Our animal model data also suggest that certain pathogenic E. coli may be important in the etiology of chronic prostatitis/chronic pelvic pain syndrome through mechanisms that are dependent on the host genetic background and the virulence of the bacterial strain.

Triacetic acid lactone production in industrial Saccharomyces yeast strains

USDA-ARS?s Scientific Manuscript database

Triacetic acid lactone (TAL) is a potential platform chemical that can be produced in yeast. To evaluate the potential for industrial yeast strains to produce TAL, the g2ps1 gene encoding 2-pyrone synthase was transformed into thirteen industrial yeast strains of varied genetic background. TAL produ...

[Mitigating the repress of cinnamic acid to cucumber growth by microbial strain].

PubMed

Yu, Guo-hui; Xie, Yin-hua; Chen, Yan-hong; Chen, Yuan-feng; Cheng, Ping

2006-12-01

Cucumber is one of the most important vegetable species. Its continuous planting has become a common practice demand in many areas of China, but an obstacle from continuous planting made sustainable production of this crop to be prohibited. The self-toxic effect was considered as an important negative factor to continuous cropping cucumber. And cinnamic acid was found to be the main substance to cause self-toxic. Strain Ha8, which isolated from waste water estuary in Zhuhai city and has been authenticated as Cellulosimicrobium cellulans, was found to be able to degrade cinnamic acid, benzoic acid, paraaminobenzoic acid and phenol. Its biologic degrading rate to cinnamic acid was 64.1% and its total degrading rate to cinnamic acid was 79.32% . Therefore, strain Ha8 was used to mitigate the growth stress of cucumber caused by cinnamic acid in the research. In the experiment by hydroponic culturing method, it was found that the stem length, root length, stem weight, leaf weight, root weight, numbers of flower and harvest weight of cucumbers were lower than those untreated ones when added 2micromol/L or 10micromol/L cinnamic acid in culturing solution. But when added 10(7)cfu/L of strain Ha8 and 2micromol/L or 10micromol/L cinnamic acid in same culturing solution, these parameters were higher than those treated only by 2mircomol/L or 10micromol/L cinnamic acid. The result shown that strain Ha8 could mitigate the self-toxic effect caused by cinnamic acid. In edaphic culturing experiments, it was found that organic fertilizer mixed with strain Ha8 could mitigate the growth stress of cucumber caused by 100mg/kg cinnamic acid. When added 3mg/kg sterilized organic fertilizer with strain Ha8 (> or = 10(6)cfu/g dry organic fertilizer) in the culturing soil, the result was satisfied. This treatment could not only improve the growth of cucumber, enhance their root dehydrogenase activity and output, promote their nutrition absorption rate, but also adjust the microbial groups in

Identification of Electrode Respiring, Hydrocarbonoclastic Bacterial Strain Stenotrophomonas maltophilia MK2 Highlights the Untapped Potential for Environmental Bioremediation

PubMed Central

Venkidusamy, Krishnaveni; Megharaj, Mallavarapu

2016-01-01

Electrode respiring bacteria (ERB) possess a great potential for many biotechnological applications such as microbial electrochemical remediation systems (MERS) because of their exoelectrogenic capabilities to degrade xenobiotic pollutants. Very few ERB have been isolated from MERS, those exhibited a bioremediation potential toward organic contaminants. Here we report once such bacterial strain, Stenotrophomonas maltophilia MK2, a facultative anaerobic bacterium isolated from a hydrocarbon fed MERS, showed a potent hydrocarbonoclastic behavior under aerobic and anaerobic environments. Distinct properties of the strain MK2 were anaerobic fermentation of the amino acids, electrode respiration, anaerobic nitrate reduction and the ability to metabolize n-alkane components (C8–C36) of petroleum hydrocarbons (PH) including the biomarkers, pristine and phytane. The characteristic of diazoic dye decolorization was used as a criterion for pre-screening the possible electrochemically active microbial candidates. Bioelectricity generation with concomitant dye decolorization in MERS showed that the strain is electrochemically active. In acetate fed microbial fuel cells (MFCs), maximum current density of 273 ± 8 mA/m2 (1000 Ω) was produced (power density 113 ± 7 mW/m2) by strain MK2 with a coulombic efficiency of 34.8%. Further, the presence of possible alkane hydroxylase genes (alkB and rubA) in the strain MK2 indicated that the genes involved in hydrocarbon degradation are of diverse origin. Such observations demonstrated the potential of facultative hydrocarbon degradation in contaminated environments. Identification of such a novel petrochemical hydrocarbon degrading ERB is likely to offer a new route to the sustainable bioremedial process of source zone contamination with simultaneous energy generation through MERS. PMID:28018304

Protease and lipase activities of fungal and bacterial strains derived from an artisanal raw ewe's milk cheese.

PubMed

Ozturkoglu-Budak, Sebnem; Wiebenga, Ad; Bron, Peter A; de Vries, Ronald P

2016-11-21

We previously identified the microbiota present during cheese ripening and observed high protease and lipase activity in Divle Cave cheese. To determine the contribution of individual isolates to enzyme activities, we investigated a range of species representing this microbiota for their proteolytic and lipolytic ability. In total, 17 fungal, 5 yeast and 18 bacterial strains, previously isolated from Divle Cave cheese, were assessed. Qualitative protease and lipase activities were performed on skim-milk agar and spirit-blue lipase agar, respectively, and resulted in a selection of strains for quantitative assays. For the quantitative assays, the strains were grown on minimal medium containing irradiated Divle Cave cheese, obtained from the first day of ripening. Out of 16 selected filamentous fungi, Penicillium brevicompactum, Penicillium cavernicola and Penicillium olsonii showed the highest protease activity, while Mucor racemosus was the best lipase producer. Yarrowia lipolytica was the best performing yeast with respect to protease and lipase activity. From the 18 bacterial strains, 14 and 11 strains, respectively showed protease and lipase activity in agar plates. Micrococcus luteus, Bacillus stratosphericus, Brevibacterium antiquum, Psychrobacter glacincola and Pseudomonas proteolytica displayed the highest protease and lipase activity. The proteases of yeast and filamentous fungi were identified as mainly aspartic protease by specific inhibition with Pepstatin A, whereas inhibition by PMSF (phenylmethylsulfonyl fluoride) indicated that most bacterial enzymes belong to serine type protease. Our results demonstrate that aspartic proteases, which usually have high milk clotting activity, are predominantly derived from fungal strains, and therefore fungal enzymes appear to be more suitable for use in the cheese industry. Microbial enzymes studied in this research might be alternatives for rennin (chymosin) from animal source because of their low cost and stable

pH feedback and phenotypic diversity within bacterial functional groups of the human gut.

PubMed

Kettle, Helen; Donnelly, Ruairi; Flint, Harry J; Marion, Glenn

2014-02-07

Microbial diversity in the human colon is very high with apparently large functional redundancy such that within each bacterial functional group there are many coexisting strains. Modelling this mathematically is problematic since strains within a functional group are often competing for the same limited number of resources and therefore competitive exclusion theory predicts a loss of diversity over time. Here we investigate, through computer simulation, a fluctuation dependent mechanism for the promotion of diversity. A variable pH environment caused by acidic by-products of bacterial growth on a fluctuating substrate coupled with small differences in acid tolerance between strains promotes diversity under both equilibrium and far-from-equilibrium conditions. Under equilibrium conditions pH fluctuations and relative nonlinearity in pH limitation among strains combine to prevent complete competitive exclusion. Under far-from-equilibrium conditions, loss of diversity through extinctions is made more difficult because pH cycling leads to fluctuations in the competitive ranking of strains, thereby helping to equalise fitness. We assume a trade-off between acid tolerance and maximum growth rate so that our microbial system consists of strains ranging from specialists to generalists. By altering the magnitude of the effect of the system on its pH environment (e.g. the buffering capacity of the colon) and the pattern of incoming resource we explore the conditions that promote diversity. © 2013 Elsevier Ltd. Published by Elsevier Ltd. All rights reserved.

Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

PubMed Central

Parsons, Joshua B.; Rock, Charles O.

2011-01-01

The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

Screening of mercury-resistant and indole-3-acetic acid producing bacterial-consortium for growth promotion of Cicer arietinum L.

PubMed

Amin, Aatif; Latif, Zakia

2017-03-01

Mercury resistant (Hg R ) bacteria were screened from industrial effluents and effluents-polluted rhizosphere soils near to districts Kasur and Sheikhupura, Pakistan. Out of 60 isolates, three bacterial strains, Bacillus sp. AZ-1, Bacillus cereus AZ-2, and Enterobacter cloacae AZ-3 showed Hg-resistance as 20 μg ml -1 of HgCl 2 and indole-3-acetic acid (IAA) production as 8-38 μg ml -1 . Biochemical and molecular characterization of selected bacteria was confirmed by 16S ribotyping. Mercury resistant genes merA, merB, and merE of mer operon in Bacillus spp. were checked by PCR amplification. The merE gene involved in the transportation of elemental mercury (Hg 0 ) via cell membrane was first time cloned into pHLV vector and transformed in C43(DE3) Escherichia coli cells. The recombinant plasmid (pHLMerE) was expressed and purified by nickel (Ni +2 ) affinity chromatography. Chromatographic techniques viz. thin layer chromatography (TLC), high performance liquid chromatography (HPLC), and Gas chromatography-mass spectrometry (GC-MS) confirmed the presence of Indole-3-acetic acid (IAA) in supernatant of selected bacteria. The strain E. cloacae AZ-3 detoxified 88% of mercury (Hg +2 ) from industrial effluent (p < 0.05) after immobilization in Na-alginate beads. Finally, Hg-resistant and IAA producing bacterial consortium of two strains, Bacillus sp. AZ-1 and E. cloacae AZ-3, inoculated in mercury amended soil with 20 μg ml -1 HgCl 2 resulted 80, 22, 64, 116, 50, 75, 30, and 100% increase as compared to control plants in seed germination, shoot and root length, shoot and root fresh weight, number of pods per plant, number of seeds and weight of seeds, respectively, of chickpea (Cicer arietinum L.) in pot experiments (p < 0.05). © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

The efficacy of different anti-microbial metals at preventing the formation of, and eradicating bacterial biofilms of pathogenic indicator strains.

PubMed

Gugala, Natalie; Lemire, Joe A; Turner, Raymond J

2017-06-01

The emergence of multidrug-resistant pathogens and the prevalence of biofilm-related infections have generated a demand for alternative anti-microbial therapies. Metals have not been explored in adequate detail for their capacity to combat infectious disease. Metal compounds can now be found in textiles, medical devices and disinfectants-yet, we know little about their efficacy against specific pathogens. To help fill this knowledge gap, we report on the anti-microbial and antibiofilm activity of seven metals: silver, copper, titanium, gallium, nickel, aluminum and zinc against three bacterial strains, Pseudomonas aeruginosa, Staphylococcus aureus and Escherichia coli. To evaluate the capacity of metal ions to prevent the growth of, and eradicate biofilms and planktonic cells, bacterial cultures were inoculated in the Calgary Biofilm Device (minimal biofilm eradication concentration) in the presence of the metal salts. Copper, gallium and titanium were capable of preventing planktonic and biofilm growth, and eradicating established biofilms of all tested strains. Further, we observed that the efficacies of the other tested metal salts displayed variable efficacy against the tested strains. Further, contrary to the enhanced resistance anticipated from bacterial biofilms, particular metal salts were observed to be more effective against biofilm communities versus planktonic cells. In this study, we have demonstrated that the identity of the bacterial strain must be considered before treatment with a particular metal ion. Consequent to the use of metal ions as anti-microbial agents to fight multidrug-resistant and biofilm-related infections increases, we must aim for more selective deployment in a given infectious setting.

Bile resistance in Lactococcus lactis strains varies with cellular fatty acid composition: analysis by using different growth media.

PubMed

Kimoto-Nira, Hiromi; Kobayashi, Miho; Nomura, Masaru; Sasaki, Keisuke; Suzuki, Chise

2009-05-31

Bile resistance is one of the basic characteristics of probiotic bacteria. The aim of this study was to investigate the characteristics of bile resistance in lactococci by studying the relationship between bile resistance and cellular fatty acid composition in lactococcci grown on different media. We determined the bile resistance of 14 strains in lactose-free M17 medium supplemented with either glucose only (GM17) or lactose only (LM17). Gas chromatographic analyses of free lipids extracted from the tested strains were used for determining their fatty acid composition. A correlation analysis of all strains grown in both media revealed significant positive correlations between bile resistance and relative contents of hexadecanoic acid and octadecenoic acid, and negative correlations between bile resistance and relative contents of hexadecenoic acid and C-19 cyclopropane fatty acid. It is also a fact that the fatty acids associated with bile resistance depended on species, strain, and/or growth medium. In L. lactis subsp. cremoris strains grown in GM17 medium, the bile-resistant strains had significantly more octadecenoic acid than the bile-sensitive strains. In LM17 medium, bile-resistant strains had significantly more octadecenoic acid and significantly less C-19 cyclopropane fatty acid than the bile-sensitive strains. In L. lactis subsp. lactis strains, bile resistances of some of the tested strains were altered by growth medium. Some strains were resistant to bile in GM17 medium but sensitive to bile in LM17 medium. Some strains were resistant in both media tested. The strains grown in GM17 medium had significantly more hexadecanoic acid and octadecenoic acid, and significantly less tetradecanoic acid, octadecadienoic acid and C-19 cyclopropane fatty acid than the strains grown in LM17 medium. In conclusion, the fatty acid compositions of the bile-resistant lactococci differed from those of the bile-sensitive ones. More importantly, our data suggest that

Isolation and Identification of Lactic Acid Bacteria Isolated from a Traditional Jeotgal Product in Korea

NASA Astrophysics Data System (ADS)

Cho, Gyu Sung; Do, Hyung Ki

2006-06-01

Seventeen lactic acid bacterial strains (LAB) were isolated using MRS agar medium from Jeotgal, a Korean fermented food, purchased at the Jukdo market of Pohang. To identify the strains isolated, they were tested by examining their cell morphologies, gram-staining, catalase activity, arginine hydrolase activity, D-L lactate form and carbohydrate fermentation. According to the phenotypic characteristics, three strains were tent atively identified as Lactobacillus spp., ten were Enterococcus spp. (or Streptococcus spp., or Pediococcus spp.) and the rest were Leuconostoc spp. (or Weissella spp.). Five strains among 17 were chosen by preliminary bacteriocin activity test. Four bacterial strains which inhibited both indicator microorganisms were identified by 16S rRNA sequencing. The results are as follows; Leuconostoc mesenteroides (HK 4), Leuconostoc mesenteroides (HK 5), Leuconostoc mesenteroides(HK 11), Streptococcus salivarius(HK 8). In order to check LAB which are showing a high survival rate in gut, we investigated three strains inhibiting both indicator microorganisms in artificial gastric acid and bile juice -all except HK8. The three strains mentioned above grew in extreme low acid conditions.

Isolating and evaluating lactic acid bacteria strains for effectiveness of Leymus chinensis silage fermentation.

PubMed

Zhang, Q; Li, X J; Zhao, M M; Yu, Z

2014-10-01

Five LAB strains were evaluated using the acid production ability test, morphological observation, Gram staining, physiological, biochemical and acid tolerance tests. All five strains (LP1, LP2, LP3, LC1 and LC2) grew at pH 4·0, and LP1 grew at 15°C. Strains LP1, LP2 and LP3 were identified as Lactobacillus plantarum, whereas LC1 and LC2 were classified as Lactobacillus casei by sequencing 16S rDNA. The five isolated strains and two commercial inoculants (PS and CL) were added to native grass and Leymus chinensis (Trin.) Tzvel. for ensiling. All five isolated strains decreased the pH and ammonia nitrogen content, increased the lactic acid content and LP1, LP2 and LP3 increased the acetic content and lactic/acetic acid ratio of L. chinensis silage significantly. The five isolated strains and two commercial inoculants decreased the butyric acid content of the native grass silage. LP2 treatment had lower butyric acid content and ammonia nitrogen content than the other treatments. The five isolated strains improved the quality of L. chinensis silage. The five isolated strains and the two commercial inoculants were not effective in improving the fermentation quality of the native grass silage, but LP2 performed better comparatively. Significance and impact of the study: Leymus chinensis is an important grass in China and Russia, being the primary grass of the short grassland 'steppe' regions of central Asia. However, it has been difficult to make high-quality silage of this species because of low concentration of water-soluble carbohydrates (WSC). Isolating and evaluating lactic acid bacteria strains will be helpful for improving the silage quality of this extensively grown species. © 2014 The Society for Applied Microbiology.

Effect of disinfection upon dissolved organic carbon (DOC) in wastewater: bacterial bioassays.

PubMed

Arana, I; Santorum, P; Muela, A; Barcina, I

2000-08-01

Quantitative and qualitative changes in organic matter content of wastewater effluents attributable to chlorination and ozonation have been analysed using bioassays as well as organic carbon direct measures. Bioassays were carried out using the bacterial populations of wastewater and two Escherichia coli strains as test micro-organisms. Our results indicate that pure strains present some advantages over indigenous bacteria. Although wastewater bacterial populations are better adapted to growth in wastewater, E. coli strains are more sensitive to changes in dissolved organic carbon (DOC) content. Moreover, the use of pure cultures allows estimation of the portion of DOC which can be converted in cell biomass, the assimilable organic carbon (AOC). Finally, the results obtained using prototrophic and the auxotrophic strains of E. coli suggested that ozonation alters the amino acid composition of wastewater while chlorination does not change the quantity nor the quality of the DOC present in effluents.

[Algicidal activity against red-tide algaes by marine bacterial strain N3 isolated from a HABs area, southern China].

PubMed

Shi, Rong-jun; Huang, Hong-hui; Qi, Zhan-hui; Hu, Wei-an; Tian, Zi-yang; Dai, Ming

2013-05-01

A marine algicidal bacterium N3 was isolated from a HABs area in Mirs Bay, a subtropical bay, in southern China. Algicidal activity and algicidal mode against Phaeodactylum tricornutum, Scrippsiella trochoidea, Prorocentrum micans and Skeletonema costatum were observed by the liquid infection method. The results showed that there were no algicidal activities against P. tricornutum and S. costatum. However, when the bacterial volume fractions were 2% and 10% , S. trochoidea and P. micans could be killed, respectively. S. trochoidea cells which were exposed to strain N3 became irregular in shape and the cellular components lost their integrity and were decomposed. While, the P. micans cells became inflated and the cellular components aggregated, followed by cell lysis. Strain N3 killed S. trochoidea and P. micans directly, and the algicidal activities of the bacterial strain N3 was concentration-dependent. To S. trochoidea, 2% (V/V) of bacteria in algae showed the strongest algicidal activity, all of the S. trochoidea cells were killed within 120 h. But the growth rates of cells, in the 1% and 0. 1% treatment groups, were only slightly lower than that in the control group. In all treatment groups, the densities of strain N3 were in declining trends. While, to P. micans, 10% and 5% of bacteria in algae showed strong algicidal activities, 78% and 70% of the S. trochoidea were killed within 120 h, respectively. However, the number of S. trochoidea after exposure to 1% of bacterial cultures still increased up to 5 incubation days. And in the three treatment groups, the densities of strain N3 experienced a decrease process. The isolated strain N3 was identified as Bacillus sp. by morphological observation, physiological and biochemical characterization, and homology comparisons based on 16S rRNA sequences.

Cost-effective production of bacterial cellulose using acidic food industry by-products.

PubMed

Revin, Victor; Liyaskina, Elena; Nazarkina, Maria; Bogatyreva, Alena; Shchankin, Mikhail

2018-03-13

To reduce the cost of obtaining bacterial cellulose, acidic by-products of the alcohol and dairy industries were used without any pretreatment or addition of other nitrogen sources. Studies have shown that the greatest accumulation of bacterial cellulose (6.19g/L) occurs on wheat thin stillage for 3 days of cultivation under dynamic conditions, which is almost 3 times higher than on standard Hestrin and Schramm medium (2.14g/L). The use of whey as a nutrient medium makes it possible to obtain 5.45g/L bacterial cellulose under similar conditions of cultivation. It is established that the pH of the medium during the growth of Gluconacetobacter sucrofermentans B-11267 depends on the feedstock used and its initial value. By culturing the bacterium on thin stillage and whey, there is a decrease in the acidity of the waste. It is shown that the infrared spectra of bacterial cellulose obtained in a variety of environments have a similar character, but we found differences in the micromorphology and crystallinity of the resulting biopolymer. Copyright © 2018 Sociedade Brasileira de Microbiologia. Published by Elsevier Editora Ltda. All rights reserved.

Effect of fatty acids on growth of conjugated-linoleic-acids-producing bacteria in rumen.

PubMed

Koppová, I; Lukás, F; Kopecný, J

2006-01-01

Microorganisms with high activity of linoleic acid delta12-cis,delta11-trans-isomerase were isolated from the digestive tract of ruminants and characterized. The isolate with the highest isomerase activity was identified as Pseudobutyrivibrio ruminis. The susceptibility of this strain to 3 fatty acids added to the grow medium was determined. A significant inhibition of bacterial growth (during a 3-d period) by linoleic acid (0.1 %) and oleic acid (5 ppm) was observed; no inhibition was found in the presence of stearic acid.

RIG-I detects infection with live Listeria by sensing secreted bacterial nucleic acids

PubMed Central

Abdullah, Zeinab; Schlee, Martin; Roth, Susanne; Mraheil, Mobarak Abu; Barchet, Winfried; Böttcher, Jan; Hain, Torsten; Geiger, Sergej; Hayakawa, Yoshihiro; Fritz, Jörg H; Civril, Filiz; Hopfner, Karl-Peter; Kurts, Christian; Ruland, Jürgen; Hartmann, Gunther; Chakraborty, Trinad; Knolle, Percy A

2012-01-01

Immunity against infection with Listeria monocytogenes is not achieved from innate immune stimulation by contact with killed but requires viable Listeria gaining access to the cytosol of infected cells. It has remained ill-defined how such immune sensing of live Listeria occurs. Here, we report that efficient cytosolic immune sensing requires access of nucleic acids derived from live Listeria to the cytoplasm of infected cells. We found that Listeria released nucleic acids and that such secreted bacterial RNA/DNA was recognized by the cytosolic sensors RIG-I, MDA5 and STING thereby triggering interferon β production. Secreted Listeria nucleic acids also caused RIG-I-dependent IL-1β-production and inflammasome activation. The signalling molecule CARD9 contributed to IL-1β production in response to secreted nucleic acids. In conclusion, cytosolic recognition of secreted bacterial nucleic acids by RIG-I provides a mechanistic explanation for efficient induction of immunity by live bacteria. PMID:23064150

Different response to acetic acid stress in Saccharomyces cerevisiae wild-type and l-ascorbic acid-producing strains.

PubMed

Martani, Francesca; Fossati, Tiziana; Posteri, Riccardo; Signori, Lorenzo; Porro, Danilo; Branduardi, Paola

2013-09-01

Biotechnological processes are of increasing significance for industrial production of fine and bulk chemicals, including biofuels. Unfortunately, under operative conditions microorganisms meet multiple stresses, such as non-optimal pH, temperature, oxygenation and osmotic stress. Moreover, they have to face inhibitory compounds released during the pretreatment of lignocellulosic biomasses, which constitute the preferential substrate for second-generation processes. Inhibitors include furan derivatives, phenolic compounds and weak organic acids, among which acetic acid is one of the most abundant and detrimental for cells. They impair cellular metabolism and growth, reducing the productivity of the process: therefore, the development of robust cell factories with improved production rates and resistance is of crucial importance. Here we show that a yeast strain engineered to endogenously produce vitamin C exhibits an increased tolerance compared to the parental strain when exposed to acetic acid at moderately toxic concentrations, measured as viability on plates. Starting from this evidence, we investigated more deeply: (a) the nature and levels of reactive oxygen species (ROS); (b) the activation of enzymes that act directly as detoxifiers of reactive oxygen species, such as superoxide dismutase (SOD) and catalase, in parental and engineered strains during acetic acid stress. The data indicate that the engineered strain can better recover from stress by limiting ROS accumulation, independently from SOD activation. The engineered yeast can be proposed as a model for further investigating direct and indirect mechanism(s) by which an antioxidant can rescue cells from organic acid damage; moreover, these studies will possibly provide additional targets for further strain improvements. Copyright © 2013 John Wiley & Sons, Ltd.

BacDive--The Bacterial Diversity Metadatabase in 2016.

PubMed

Söhngen, Carola; Podstawka, Adam; Bunk, Boyke; Gleim, Dorothea; Vetcininova, Anna; Reimer, Lorenz Christian; Ebeling, Christian; Pendarovski, Cezar; Overmann, Jörg

2016-01-04

BacDive-the Bacterial Diversity Metadatabase (http://bacdive.dsmz.de) provides strain-linked information about bacterial and archaeal biodiversity. The range of data encompasses taxonomy, morphology, physiology, sampling and concomitant environmental conditions as well as molecular biology. The majority of data is manually annotated and curated. Currently (with release 9/2015), BacDive covers 53 978 strains. Newly implemented RESTful web services provide instant access to the content in machine-readable XML and JSON format. Besides an overall increase of data content, BacDive offers new data fields and features, e.g. the search for gene names, plasmids or 16S rRNA in the advanced search, as well as improved linkage of entries to external life science web resources. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Genomic and Transcriptomic Analysis of Escherichia coli Strains Associated with Persistent and Transient Bovine Mastitis and the Role of Colanic Acid.

PubMed

Lippolis, John D; Holman, Devin B; Brunelle, Brian W; Thacker, Tyler C; Bearson, Bradley L; Reinhardt, Timothy A; Sacco, Randy E; Casey, Thomas A

2018-01-01

Escherichia coli is a leading cause of bacterial mastitis in dairy cattle. It is most often transient in nature, causing an infection that lasts 2 to 3 days. However, E. coli has been shown to cause a persistent infection in a minority of cases. Mechanisms that allow for a persistent E. coli infection are not fully understood. The goal of this work was to determine differences between E. coli strains originally isolated from dairy cattle with transient and persistent mastitis. Using RNA sequencing, we show gene expression differences in nearly 200 genes when bacteria from the two clinical phenotypes are compared. We sequenced the genomes of the E. coli strains and report genes unique to the two phenotypes. Differences in the wca operon, which encodes colanic acid, were identified by DNA as well as RNA sequencing and differentiated the two phenotypes. Previous work demonstrated that E. coli strains that cause persistent infections were more motile than those that cause transient infections. Deletion of genes in the wca operon from a persistent-infection strain resulted in a reduction of motility as measured in swimming and swarming assays. Furthermore, colanic acid has been shown to protect bacteria from complement-mediated killing. We show that transient-infection E. coli strains were more sensitive to complement-mediated killing. The deletion of genes from the wca operon caused a persistent-infection E. coli strain to become sensitive to complement-mediated killing. This work identifies important differences between E. coli strains that cause persistent and transient mammary infections in dairy cattle. This is a work of the U.S. Government and is not subject to copyright protection in the United States. Foreign copyrights may apply.

Use of plant growth promoting bacterial strains to improve Cytisus striatus and Lupinus luteus development for potential application in phytoremediation.

PubMed

Balseiro-Romero, María; Gkorezis, Panagiotis; Kidd, Petra S; Van Hamme, Jonathan; Weyens, Nele; Monterroso, Carmen; Vangronsveld, Jaco

2017-03-01

Plant growth promoting (PGP) bacterial strains possess different mechanisms to improve plant development under common environmental stresses, and are therefore often used as inoculants in soil phytoremediation processes. The aims of the present work were to study the effects of a collection of plant growth promoting bacterial strains on plant development, antioxidant enzyme activities and nutritional status of Cytisus striatus and/or Lupinus luteus plants a) growing in perlite under non-stress conditions and b) growing in diesel-contaminated soil. For this, two greenhouse experiments were designed. Firstly, C. striatus and L. luteus plants were grown from seeds in perlite, and periodically inoculated with 6 PGP strains, either individually or in pairs. Secondly, L. luteus seedlings were grown in soil samples of the A and B horizons of a Cambisol contaminated with 1.25% (w/w) of diesel and inoculated with best PGP inoculant selected from the first experiment. The results indicated that the PGP strains tested in perlite significantly improved plant growth. Combination treatments provoked better growth of L. luteus than the respective individual strains, while individual inoculation treatments were more effective for C. striatus. L. luteus growth in diesel-contaminated soil was significantly improved in the presence of PGP strains, presenting a 2-fold or higher increase in plant biomass. Inoculants did not provoke significant changes in plant nutritional status, with the exception of a subset of siderophore-producing and P-solubilising bacterial strains that resulted in significantly modification of Fe or P concentrations in leaf tissues. Inoculants did not cause significant changes in enzyme activities in perlite experiments, however they significantly reduced oxidative stress in contaminated soils suggesting an improvement in plant tolerance to diesel. Some strains were applied to non-host plants, indicating a non-specific performance of their plant growth promotion

Extracellular polymeric substances (EPS) producing bacterial strains of municipal wastewater sludge: isolation, molecular identification, EPS characterization and performance for sludge settling and dewatering.

PubMed

Bala Subramanian, S; Yan, S; Tyagi, R D; Surampalli, R Y

2010-04-01

Wastewater treatment plants often face the problems of sludge settling mainly due to sludge bulking. Generally, synthetic organic polymer and/or inorganic coagulants (ferric chloride, alum and quick lime) are used for sludge settling. These chemicals are very expensive and further pollute the environment. Whereas, the bioflocculants are environment friendly and may be used to flocculate the sludge. Extracellular polymeric substances (EPS) produced by sludge microorganisms play a definite role in sludge flocculation. In this study, 25 EPS producing strains were isolated from municipal wastewater treatment plant. Microorganisms were selected based on EPS production properties on solid agar medium. Three types of EPS (slime, capsular and bacterial broth mixture of both slime and capsular) were harvested and their characteristics were studied. EPS concentration (dry weight), viscosity and their charge (using a Zetaphoremeter) were also measured. Bioflocculability of obtained EPS was evaluated by measuring the kaolin clay flocculation activity. Six bacterial strains (BS2, BS8, BS9, BS11, BS15 and BS25) were selected based on the kaolin clay flocculation. The slime EPS was better for bioflocculation than capsular EPS and bacterial broth. Therefore, extracted slime EPS (partially purified) from six bacterial strains was studied in terms of sludge settling [sludge volume index (SVI)] and dewatering [capillary suction time (CST)]. Biopolymers produced by individual strains substantially improved dewaterability. The extracted slime EPS from six different strains were partially characterized. Copyright (c) 2009 Elsevier Ltd. All rights reserved.

Bioremediation using Novosphingobium strain DY4 for 2,4-dichlorophenoxyacetic acid-contaminated soil and impact on microbial community structure.

PubMed

Dai, Yu; Li, Ningning; Zhao, Qun; Xie, Shuguang

2015-04-01

The herbicide 2,4-dichlorophenoxyacetic acid (2,4-D) is commonly used for weed control. The ubiquity of 2,4-D has gained increasing environmental concerns. Biodegradation is an attractive way to clean up 2,4-D in contaminated soil. However, information on the bioaugmentation trial for remediating contaminated soil is still very limited. The impact of bioaugmentation using 2,4-D-degraders on soil microbial community remains unknown. The present study investigated the bioremediation potential of a novel degrader (strain DY4) for heavily 2,4-D-polluted soil and its bioaugmentation impact on microbial community structure. The strain DY4 was classified as a Novosphingobium species within class Alphaproteobacteria and harbored 2,4-D-degrading TfdAα gene. More than 50 and 95 % of the herbicide could be dissipated in bioaugmented soil (amended with 200 mg/kg 2,4-D) respectively in 3-4 and 5-7 days after inoculation of Novosphingobium strain DY4. A significant growth of the strain DY4 was observed in bioaugmented soil with the biodegradation of 2,4-D. Moreover, herbicide application significantly altered soil bacterial community structure but bioaumentation using the strain DY4 showed a relatively weak impact.

Genetic diversity and dynamics of bacterial and yeast strains associated to Spanish-style green table-olive fermentations in large manufacturing companies.

PubMed

Lucena-Padrós, Helena; Caballero-Guerrero, Belén; Maldonado-Barragán, Antonio; Ruiz-Barba, José Luis

2014-11-03

We have genotyped a total of 1045 microbial isolates obtained along the fermentation time of Spanish-style green table olives from the fermentation yards (patios) of two large manufacturing companies in the Province of Sevilla, south of Spain. Genotyping was carried out using RAPD-PCR fingerprinting. In general, isolates clustered well into the relevant phylogenetic dendrograms, forming separate groups in accordance to their species adscription. We could identify which bacterial and yeast genotypes (strains) persisted throughout the fermentation at each patio. Also, which of them were more adapted to any of the three stages, i.e. initial, middle and final, described for this food fermentation. A number of genotypes were found to be shared by both patios. Fifty seven of these belonged to five different bacterial species, i.e. Lactobacillus pentosus, Lactobacillus paracollinoides/collinoides, Lactobacillus rapi, Pediococcus ethanolidurans and Staphylococcus sp., although most of them (51) belonged to L. pentosus. Four yeast genotypes were also shared, belonging to the species Candida thaimueangensis, Saccharomyces cerevisiae and Hanseniaspora sp. Two genotypes of L. pentosus were found to be grouped with those of two strains used in commercially available starter cultures, one of them bacteriocinogenic, which were used up to three years before this study in these patios, demonstrating the persistence of selected strains in this environment. Biodiversity was assessed though different indexes, including richness, diversity and dominance. A statistically significant decrease in biodiversity between the initial and final stages of the fermentation was found in both patios. However, values of biodiversity indexes in the fermenters were very similar, and no significant differences were found in the total biodiversity between both patios. This study allowed us to identify a range of well adapted strains (genotypes), especially those belonging to the lactic acid bacteria

Survivial Strategies in Bacterial Range Expansions

NASA Astrophysics Data System (ADS)

Frey, Erwin

2014-03-01

Bacterial communities represent complex and dynamic ecological systems. Different environmental conditions as well as bacterial interactions determine the establishment and sustainability of bacterial diversity. In this talk we discuss the competition of three Escherichia coli strains during range expansions on agar plates. In this bacterial model system, a colicin E2 producing strain C competes with a colicin resistant strain R and with a colicin sensitive strain S for new territory. Genetic engineering allows us to tune the growth rates of the strains and to study distinct ecological scenarios. These scenarios may lead to either single-strain dominance, pairwise coexistence, or to the coexistence of all three strains. In order to elucidate the survival mechanisms of the individual strains, we also developed a stochastic agent-based model to capture the ecological scenarios in silico. In a combined theoretical and experimental approach we are able to show that the level of biodiversity depends crucially on the composition of the inoculum, on the relative growth rates of the three strains, and on the effective reach of colicin toxicity.

Improving survival of probiotic bacteria using bacterial poly-γ-glutamic acid.

PubMed

Bhat, A R; Irorere, V U; Bartlett, T; Hill, D; Kedia, G; Charalampopoulos, D; Nualkaekul, S; Radecka, I

2015-03-02

A major hurdle in producing a useful probiotic food product is bacterial survival during storage and ingestion. The aim of this study was to test the effect of γ-PGA immobilisation on the survival of probiotic bacteria when stored in acidic fruit juice. Fruit juices provide an alternative means of probiotic delivery, especially to lactose intolerant individuals. In addition, the survival of γ-PGA-immobilised cells in simulated gastric juice was also assessed. Bifidobacteria strains (Bifidobacteria longum, Bifidobacteria breve), immobilised on 2.5% γ-PGA, survived significantly better (P<0.05) in orange and pomegranate juice for 39 and 11 days respectively, compared to free cells. However, cells survived significantly better (P<0.05) when stored in orange juice compared to pomegranate juice. Moreover, both strains, when protected with 2.5% γ-PGA, survived in simulated gastric juice (pH2.0) with a marginal reduction (<0.47 log CFU/ml) or no significant reduction in viable cells after 4h, whereas free cells died within 2h. In conclusion, this research indicates that γ-PGA can be used to protect Bifidobacteria cells in fruit juice, and could also help improve the survival of cells as they pass through the harsh conditions of the gastrointestinal tract (GIT). Following our previous report on the use of γ-PGA as a cryoprotectant for probiotic bacteria, this research further suggests that γ-PGA could be used to improve probiotic survival during the various stages of preparation, storage and ingestion of probiotic cells. Copyright © 2014 Elsevier B.V. All rights reserved.

Dual Induction of New Microbial Secondary Metabolites by Fungal Bacterial Co-cultivation.

PubMed

Wakefield, Jennifer; Hassan, Hossam M; Jaspars, Marcel; Ebel, Rainer; Rateb, Mostafa E

2017-01-01

The frequent re-isolation of known compounds is one of the major challenges in drug discovery. Many biosynthetic genes are not expressed under standard culture conditions, thus limiting the chemical diversity of microbial compounds that can be obtained through fermentation. On the other hand, the competition during co-cultivation of two or more different microorganisms in most cases leads to an enhanced production of constitutively present compounds or an accumulation of cryptic compounds that are not detected in axenic cultures of the producing strain under different fermentation conditions. Herein, we report the dual induction of newly detected bacterial and fungal metabolites by the co-cultivation of the marine-derived fungal isolate Aspergillus fumigatus MR2012 and two hyper-arid desert bacterial isolates Streptomyces leeuwenhoekii strain C34 and strain C58. Co-cultivation of the fungal isolate MR2012 with the bacterial strain C34 led to the production of luteoride D, a new luteoride derivative and pseurotin G, a new pseurotin derivative in addition to the production of terezine D and 11- O -methylpseurotin A which were not traced before from this fungal strain under different fermentation conditions. In addition to the previously detected metabolites in strain C34, the lasso peptide chaxapeptin was isolated under co-culture conditions. The gene cluster for the latter compound had been identified through genome scanning, but it had never been detected before in the axenic culture of strain C34. Furthermore, when the fungus MR2012 was co-cultivated with the bacterial strain C58, the main producer of chaxapeptin, the titre of this metabolite was doubled, while additionally the bacterial metabolite pentalenic acid was detected and isolated for the first time from this strain, whereas the major fungal metabolites that were produced under axenic culture were suppressed. Finally, fermentation of the MR2012 by itself led to the isolation of the new diketopiperazine

Contribution of bacterial cells to lacustrine organic matter based on amino sugars and D-amino acids

NASA Astrophysics Data System (ADS)

Carstens, Dörte; Köllner, Krista E.; Bürgmann, Helmut; Wehrli, Bernhard; Schubert, Carsten J.

2012-07-01

Amino sugars (ASs), D-amino acids (D-AAs), and bacterial cell counts were measured in two Swiss lakes to study the contribution of bacterial cells to organic matter (OM) and the fate of ASs and bacterial amino biomarkers during OM degradation. Concentrations of individual ASs (glucosamine, galactosamine, muramic acid, and mannosamine) in the particulate and total OM pools were analyzed in water-column profiles of Lake Brienz (oligotrophic and oxic throughout the entire water column) and Lake Zug (eutrophic, stratified, and permanently anoxic below 170 m) in spring and in fall. Generally, carbon-normalized AS concentrations decreased with water depth, indicating the preferential decomposition of ASs. For Lake Brienz the relative loss of particulate ASs was higher than in Lake Zug, suggesting enhanced AS turnover in an oligotrophic environment. AS ratio changes in the water column revealed a replacement of plankton biomass with OM from heterotrophic microorganisms with increasing water depth. Similar to the ASs, highest carbon normalized D-AA concentrations were found in the upper water column with decreasing concentrations with depth and an increase close to the sediments. In Lake Zug, an increase in the percentage of D-AAs also showed the involvement of bacteria in OM degradation. Estimations of OM derived from bacterial cells using cell counts and the bacterial biomarkers muramic acid and D-AAs gave similar results. For Lake Brienz 0.2-14% of the organic carbon pool originated from bacterial cells, compared to only 0.1-5% in Lake Zug. Based on our estimates, muramic acid appeared primarily associated with bacterial biomass and not with refractory bacterial necromass. Our study underscores that bacteria are not only important drivers of OM degradation in lacustrine systems, they also represent a significant source of OM themselves, especially in oligotrophic lakes.

Bacterial keratitis: a prospective clinical and microbiological study

PubMed Central

Schaefer, F.; Bruttin, O.; Zografos, L.; Guex-Crosier, Y.

2001-01-01

AIM—To define the clinical and microbiological profile of bacterial keratitis at the Jules Gonin Eye Hospital and to test the in vitro bacterial resistance.
METHODS—Patients presenting with bacterial keratitis were prospectively followed; clinical features (age, risk factors, visual acuity) and response to therapy were analysed. Bacteriological profile was determined and the sensitivity/resistance of isolated strains were tested towards 12 ocular antibiotics (NCCLS disc diffusion test).
RESULTS—85 consecutive patients (mean age 44.3 (SD 20.7) years) were prospectively enrolled from 1 March 1997 to 30 November 1998. The following risk factors were identified: contact lens wear, 36%; blepharitis, 21%; trauma, 20%; xerophthalmia, 15%; keratopathies, 8%; and eyelid abnormalities, 6%. The most commonly isolated bacteria were Staphylococcus epidermidis, 40%; Staphylococcus aureus, 22%; Streptococcus pneumoniae, 8%; others Streptococcus species, 5%; Pseudomonas, 9%; Moraxella and Serratia marcescens, 5% each; Bacillus, Corynebacterium, Alcaligenes xyloxidans, Morganella morganii, and Haemophilus influenza, 1% each. 1-15% of strains were resistant to fluoroquinolones, 13-22% to aminoglycosides, 37% to cefazolin, 18% to chloramphenicol, 54% to polymyxin B, 51% to fusidic acid, and 45% to bacitracin. Five of the 85 patients (5.8%) had a poor clinical outcome with a visual loss of one or more lines of visual acuity.
CONCLUSION—Fluoroquinolones appear to be the therapy of choice for bacterial keratitis, but, based upon these in vitro studies, some strains may be resistant.

 PMID:11423460

Fermentation and recovery process for lactic acid production

DOEpatents

Tsai, S.P.; Moon, S.H.; Coleman, R.

1995-11-07

A method is described for converting starch to glucose and fermenting glucose to lactic acid, including simultaneous saccharification and fermentation through use of a novel consortium of bacterial strains. 2 figs.

Effect of acid adaptation on the environmental stress tolerance of three strains of Vibrio parahaemolyticus.

PubMed

Chiang, Ming-Lun; Chen, Hsi-Chia; Wu, Chieh; Chen, Ming-Ju

2014-04-01

Three strains of Vibrio parahaemolyticus (690, BCRC 13023, and BCRC 13025), involved in foodborne outbreaks in Taiwan, were subjected to acid adaptation at pH 5.5 for 90 min. The effects of acid adaptation on the tolerance of V. parahaemolyticus to various environmental stresses, including heat (47°C), cold (4°C and -20°C), ethanol (8%), high salt (20% NaCl), and hydrogen peroxide (20 ppm) were examined. Results showed that acid adaptation increased the thermal tolerance of the three test strains of V. parahaemolyticus, while it did not affect their cold tolerance. Acid adaptation also increased the ethanol tolerance in V. parahaemolyticus 690 and BCRC 13025, but not in BCRC 13023. Differences in the tolerance to high salts were noted among the three strains after prior acid adaptation. However, these acid-adapted V. parahaemolyticus strains were more susceptible to hydrogen peroxide than their nonadapted controls. These findings demonstrated that acid adaption responses of V. parahaemolyticus varied among strains and types of stress challenge.

Expert Opinion on Three Phage Therapy Related Topics: Bacterial Phage Resistance, Phage Training and Prophages in Bacterial Production Strains.

PubMed

Rohde, Christine; Resch, Grégory; Pirnay, Jean-Paul; Blasdel, Bob G; Debarbieux, Laurent; Gelman, Daniel; Górski, Andrzej; Hazan, Ronen; Huys, Isabelle; Kakabadze, Elene; Łobocka, Małgorzata; Maestri, Alice; Almeida, Gabriel Magno de Freitas; Makalatia, Khatuna; Malik, Danish J; Mašlaňová, Ivana; Merabishvili, Maia; Pantucek, Roman; Rose, Thomas; Štveráková, Dana; Van Raemdonck, Hilde; Verbeken, Gilbert; Chanishvili, Nina

2018-04-05

Phage therapy is increasingly put forward as a "new" potential tool in the fight against antibiotic resistant infections. During the "Centennial Celebration of Bacteriophage Research" conference in Tbilisi, Georgia on 26-29 June 2017, an international group of phage researchers committed to elaborate an expert opinion on three contentious phage therapy related issues that are hampering clinical progress in the field of phage therapy. This paper explores and discusses bacterial phage resistance, phage training and the presence of prophages in bacterial production strains while reviewing relevant research findings and experiences. Our purpose is to inform phage therapy stakeholders such as policy makers, officials of the competent authorities for medicines, phage researchers and phage producers, and members of the pharmaceutical industry. This brief also points out potential avenues for future phage therapy research and development as it specifically addresses those overarching questions that currently call for attention whenever phages go into purification processes for application.

Expert Opinion on Three Phage Therapy Related Topics: Bacterial Phage Resistance, Phage Training and Prophages in Bacterial Production Strains

PubMed Central

Rohde, Christine; Resch, Grégory; Blasdel, Bob G.; Gelman, Daniel; Górski, Andrzej; Hazan, Ronen; Huys, Isabelle; Kakabadze, Elene; Łobocka, Małgorzata; Maestri, Alice; Makalatia, Khatuna; Malik, Danish J.; Mašlaňová, Ivana; Merabishvili, Maia; Rose, Thomas; Štveráková, Dana; Van Raemdonck, Hilde; Verbeken, Gilbert; Chanishvili, Nina

2018-01-01

Phage therapy is increasingly put forward as a “new” potential tool in the fight against antibiotic resistant infections. During the “Centennial Celebration of Bacteriophage Research” conference in Tbilisi, Georgia on 26–29 June 2017, an international group of phage researchers committed to elaborate an expert opinion on three contentious phage therapy related issues that are hampering clinical progress in the field of phage therapy. This paper explores and discusses bacterial phage resistance, phage training and the presence of prophages in bacterial production strains while reviewing relevant research findings and experiences. Our purpose is to inform phage therapy stakeholders such as policy makers, officials of the competent authorities for medicines, phage researchers and phage producers, and members of the pharmaceutical industry. This brief also points out potential avenues for future phage therapy research and development as it specifically addresses those overarching questions that currently call for attention whenever phages go into purification processes for application. PMID:29621199

Functional properties of Lactobacillus plantarum strains isolated from Maasai traditional fermented milk products in Kenya.

PubMed

Mathara, Julius Maina; Schillinger, Ulrich; Kutima, Phillip M; Mbugua, Samuel K; Guigas, Claudia; Franz, Charles; Holzapfel, Wilhelm H

2008-04-01

Lactobacillus plantarum was the major species among the lactic acid bacterial strains isolated from traditional fermented milk of the Maasai in Kenya. Selected strains were characterized for their functional properties using in vitro standard procedures. All strains expressed acid tolerance at pH 2.0 after 2-h exposure of values that ranged from 1% to 100%, while bile tolerance of acid-stressed cells at 0.3% oxgal varied from 30% to 80%. In vitro adhesion to the mucus-secreting cell line HT 29 MTX and binding capacity to extracellular protein matrices was demonstrated for several strains. The four strains tested in a simulated stomach duodenum passage survived with recovery rates ranging from 17% to 100%. Strains were intrinsically resistant to several antibiotics tested. From these in vitro studies, a number of Lb. plantarum strains isolated from the Maasai traditional fermented milk showed probiotic potential. The strains are good candidates for multifunctional starter culture development.

Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains

DOE PAGES

Whitman, William B.; Woyke, Tanja; Klenk, Hans-Peter; ...

2015-05-17

The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Here in this paper, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while theymore » are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity« less

Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains

PubMed Central

2015-01-01

The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Herein, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while they are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity. PMID:26203337

Genomic Encyclopedia of Bacterial and Archaeal Type Strains, Phase III: the genomes of soil and plant-associated and newly described type strains

DOE Office of Scientific and Technical Information (OSTI.GOV)

Whitman, William B.; Woyke, Tanja; Klenk, Hans-Peter

The Genomic Encyclopedia of Bacteria and Archaea (GEBA) project was launched by the JGI in 2007 as a pilot project to sequence about 250 bacterial and archaeal genomes of elevated phylogenetic diversity. Here in this paper, we propose to extend this approach to type strains of prokaryotes associated with soil or plants and their close relatives as well as type strains from newly described species. Understanding the microbiology of soil and plants is critical to many DOE mission areas, such as biofuel production from biomass, biogeochemistry, and carbon cycling. We are also targeting type strains of novel species while theymore » are being described. Since 2006, about 630 new species have been described per year, many of which are closely aligned to DOE areas of interest in soil, agriculture, degradation of pollutants, biofuel production, biogeochemical transformation, and biodiversity« less

Modeling bacterial contamination of fuel ethanol fermentation.

PubMed

Bischoff, Kenneth M; Liu, Siqing; Leathers, Timothy D; Worthington, Ronald E; Rich, Joseph O

2009-05-01

The emergence of antibiotic-resistant bacteria may limit the effectiveness of antibiotics to treat bacterial contamination in fuel ethanol plants, and therefore, new antibacterial intervention methods and tools to test their application are needed. Using shake-flask cultures of Saccharomyces cerevisiae grown on saccharified corn mash and strains of lactic acid bacteria isolated from a dry-grind ethanol facility, a simple model to simulate bacterial contamination and infection was developed. Challenging the model with 10(8) CFU/mL Lactobacillus fermentum decreased ethanol yield by 27% and increased residual glucose from 6.2 to 45.5 g/L. The magnitude of the effect was proportional to the initial bacterial load, with 10(5) CFU/mL L. fermentum still producing an 8% decrease in ethanol and a 3.2-fold increase in residual glucose. Infection was also dependent on the bacterial species used to challenge the fermentation, as neither L. delbrueckii ATCC 4797 nor L. amylovorus 0315-7B produced a significant decrease in ethanol when inoculated at a density of 10(8) CFU/mL. In the shake-flask model, treatment with 2 microg/mL virginiamycin mitigated the infection when challenged with a susceptible strain of L. fermentum (MIC for virginiamycin < or =2 ppm), but treatment was ineffective at treating infection by a resistant strain of L. fermentum (MIC = 16 ppm). The model may find application in developing new antibacterial agents and management practices for use in controlling contamination in the fuel ethanol industry. Copyright 2008 Wiley Periodicals, Inc.

Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation.

PubMed

Oshoma, Cyprian E; Greetham, Darren; Louis, Edward J; Smart, Katherine A; Phister, Trevor G; Powell, Chris; Du, Chenyu

2015-01-01

Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid.

Screening of Non- Saccharomyces cerevisiae Strains for Tolerance to Formic Acid in Bioethanol Fermentation

PubMed Central

Oshoma, Cyprian E.; Greetham, Darren; Louis, Edward J.; Smart, Katherine A.; Phister, Trevor G.; Powell, Chris; Du, Chenyu

2015-01-01

Formic acid is one of the major inhibitory compounds present in hydrolysates derived from lignocellulosic materials, the presence of which can significantly hamper the efficiency of converting available sugars into bioethanol. This study investigated the potential for screening formic acid tolerance in non-Saccharomyces cerevisiae yeast strains, which could be used for the development of advanced generation bioethanol processes. Spot plate and phenotypic microarray methods were used to screen the formic acid tolerance of 7 non-Saccharomyces cerevisiae yeasts. S. kudriavzeii IFO1802 and S. arboricolus 2.3319 displayed a higher formic acid tolerance when compared to other strains in the study. Strain S. arboricolus 2.3319 was selected for further investigation due to its genetic variability among the Saccharomyces species as related to Saccharomyces cerevisiae and availability of two sibling strains: S. arboricolus 2.3317 and 2.3318 in the lab. The tolerance of S. arboricolus strains (2.3317, 2.3318 and 2.3319) to formic acid was further investigated by lab-scale fermentation analysis, and compared with S. cerevisiae NCYC2592. S. arboricolus 2.3319 demonstrated improved formic acid tolerance and a similar bioethanol synthesis capacity to S. cerevisiae NCYC2592, while S. arboricolus 2.3317 and 2.3318 exhibited an overall inferior performance. Metabolite analysis indicated that S. arboricolus strain 2.3319 accumulated comparatively high concentrations of glycerol and glycogen, which may have contributed to its ability to tolerate high levels of formic acid. PMID:26284784

Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

NASA Astrophysics Data System (ADS)

Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

2015-12-01

Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics.

PubMed

Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

2015-12-22

Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains.

Rhizospheric Bacterial Strain Brevibacterium casei MH8a Colonizes Plant Tissues and Enhances Cd, Zn, Cu Phytoextraction by White Mustard

PubMed Central

Płociniczak, Tomasz; Sinkkonen, Aki; Romantschuk, Martin; Sułowicz, Sławomir; Piotrowska-Seget, Zofia

2016-01-01

Environmental pollution by heavy metals has become a serious problem in the world. Phytoextraction, which is one of the plant-based technologies, has attracted the most attention for the bioremediation of soils polluted with these contaminants. The aim of this study was to determine whether the multiple-tolerant bacterium, Brevibacterium casei MH8a isolated from the heavy metal-contaminated rhizosphere soil of Sinapis alba L., is able to promote plant growth and enhance Cd, Zn, and Cu uptake by white mustard under laboratory conditions. Additionally, the ability of the rifampicin-resistant spontaneous mutant of MH8a to colonize plant tissues and its mechanisms of plant growth promotion were also examined. In order to assess the ecological consequences of bioaugmentation on autochthonous bacteria, the phospholipid fatty acid (PLFA) analysis was used. The MH8a strain exhibited the ability to produce ammonia, 1-amino-cyclopropane-1-carboxylic acid deaminase, indole 3-acetic acid and HCN but was not able to solubilize inorganic phosphate and produce siderophores. Introduction of MH8a into soil significantly increased S. alba biomass and the accumulation of Cd (208%), Zn (86%), and Cu (39%) in plant shoots in comparison with those grown in non-inoculated soil. Introduced into the soil, MH8a was able to enter the plant and was found in the roots and leaves of inoculated plants thus indicating its endophytic features. PLFA analysis revealed that the MH8a that was introduced into soil had a temporary influence on the structure of the autochthonous bacterial communities. The plant growth-promoting features of the MH8a strain and its ability to enhance the metal uptake by white mustard and its long-term survival in soil as well as its temporary impact on autochthonous microorganisms make the strain a suitable candidate for the promotion of plant growth and the efficiency of phytoextraction. PMID:26909087

Isolation of a high malic and low acetic acid-producing sake yeast Saccharomyces cerevisiae strain screened from respiratory inhibitor 2,4-dinitrophenol (DNP)-resistant strains.

PubMed

Kosugi, Shingo; Kiyoshi, Keiji; Oba, Takahiro; Kusumoto, Kenichi; Kadokura, Toshimori; Nakazato, Atsumi; Nakayama, Shunichi

2014-01-01

We isolated 2,4-dinitrophenol (DNP)-resistant sake yeast strains by UV mutagenesis. Among the DNP-resistant mutants, we focused on strains exhibiting high malic acid and low acetic acid production. The improved organic acid composition is unlikely to be under the control of enzyme activities related to malic and acetic acid synthesis pathways. Instead, low mitochondrial activity was observed in DNP-resistant mutants, indicating that the excess pyruvic acid generated during glycolysis is not metabolized in the mitochondria but converted to malic acid in the cytosol. In addition, the NADH/NAD(+) ratio of the DNP-resistant strains was higher than that of the parental strain K901. These results suggest that the increased NADH/NAD(+) ratio together with the low mitochondrial activity alter the organic acid composition because malic acid synthesis requires NADH, while acetic acid uses NAD(+). Copyright © 2013 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Two similar but atypical strains of coryneform group A-4 isolated from patients with endophthalmitis.

PubMed Central

Coudron, P E; Harris, R C; Vaughan, M G; Dalton, H P

1985-01-01

Corynebacterium species and other coryneform organisms isolated from clinical specimens are frequently considered contaminants. We isolated two strains of a gram-positive organism from the vitreous fluid of two patients with endophthalmitis who had previously received intraocular lens transplants. The biochemical characteristics and gas chromatographic patterns of both isolates were similar to those of coryneform group A-4 strains. Major differences included esculin hydrolysis, nitrate reduction, growth pigment, and lactic acid production. These two strains along with a limited number of strains collected at the Special Bacterial Pathogens Laboratory (Division of Bacterial Diseases, Centers for Disease Control, Atlanta, Ga.) may represent a subgroup of coryneform group A-4. Results of in vitro susceptibility testing performed with antimicrobial agents commonly used to treat patients with bacterial endophthalmitis underscore the importance of determining MBCs for slow-growing organisms. This report cautions microbiologists not to discard organisms frequently considered contaminants when isolated from body fluids that are normally sterile and from patients receiving local steroids. PMID:3935657

Inhibition of Herpes Simplex Virus Strains Isolated from Herpetic Keratitis by Polyinosinic Acid-Polycytidylic Acid

PubMed Central

Smetana, Ofira; Eylan, Emanuel; Weinberg, Miriam

1977-01-01

Fifty strains of herpes simplex virus, isolated from patients with herpetic keratitis, were examined in vitro for susceptibility to polyinosinic acid-polycytidylic acid [poly(I:C)] in the presence of a constant concentration of diethylaminoethyl-dextran. The minimal inhibitory concentration of poly(I:C) for 44 of these strains ranged from 0.0001 to 0.1 μg/ml; for the remaining six strains, the minimal inhibitory concentration stood at 1 to 2 μg/ml. Fifteen isolates from primary infections were more susceptible to poly(I:C) than 35 isolates from recurrent infections. Isolates acquired at different points of a given clinical episode showed similar susceptibilities to poly(I:C). In two patients, isolates from consecutive recurrences of infection exhibited reduced susceptibilities. The implications of the above observations for the therapeutic use of poly(I:C) are discussed. PMID:195515

Characteristics of the high malic acid production mechanism in Saccharomyces cerevisiae sake yeast strain No. 28.

PubMed

Nakayama, Shunichi; Tabata, Ken; Oba, Takahiro; Kusumoto, Kenichi; Mitsuiki, Shinji; Kadokura, Toshimori; Nakazato, Atsumi

2012-09-01

We characterized a high malic acid production mechanism in sake yeast strain No. 28. No considerable differences in the activity of the enzymes that were involved in malic acid synthesis were observed between strain No. 28 and its parent strain, K1001. However, compared with strain K1001, which actively took up rhodamine 123 during staining, the cells of strain No. 28 were only lightly stained, even when cultured in high glucose concentrations. In addition, malic acid production by the respiratory-deficient strain of K1001 was 2.5-fold higher than that of the wild-type K1001 and wild-type No. 28. The findings of this study demonstrated that the high malic acid production by strain No. 28 is attributed to the suppression of mitochondrial activity. Copyright © 2012. Published by Elsevier B.V.

Characterization of a chromosomally encoded 2,4-dichlorophenoxyacetic acid/alpha-ketoglutarate dioxygenase from Burkholderia sp. strain RASC.

PubMed Central

Suwa, Y; Wright, A D; Fukimori, F; Nummy, K A; Hausinger, R P; Holben, W E; Forney, L J

1996-01-01

The findings of previous studies indicate that the genes required for metabolism of the pesticide 2,4-dichlorophenoxyacetic acid (2,4-D) are typically encoded on broad-host-range plasmids. However, characterization of plasmid-cured strains of Burkholderia sp. strain RASC, as well as mutants obtained by transposon mutagenesis, suggested that the 2,4-D catabolic genes were located on the chromosome of this strain. Mutants of Burkholderia strain RASC unable to degrade 2,4-D (2,4-D- strains) were obtained by insertional inactivation with Tn5. One such mutant (d1) was shown to have Tn5 inserted in tfdARASC, which encodes 2,4-D/alpha-ketoglutarate dioxygenase. This is the first reported example of a chromosomally encoded tfdA. The tfdARASC gene was cloned from a library of wild-type Burkholderia strain RASC DNA and shown to express 2,4-D/alpha-ketoglutarate dioxygenase activity in Escherichia coli. The DNA sequence of the gene was determined and shown to be similar, although not identical, to those of isofunctional genes from other bacteria. Moreover, the gene product (TfdARASC) was purified and shown to be similar in molecular weight, amino-terminal sequence, and reaction mechanism to the canonical TfdA of Alcaligenes eutrophus JMP134. The data presented here indicate that tfdA genes can be found on the chromosome of some bacterial species and suggest that these catabolic genes are rather mobile and may be transferred by means other than conjugation. PMID:8779585

Global insights into acetic acid resistance mechanisms and genetic stability of Acetobacter pasteurianus strains by comparative genomics

PubMed Central

Wang, Bin; Shao, Yanchun; Chen, Tao; Chen, Wanping; Chen, Fusheng

2015-01-01

Acetobacter pasteurianus (Ap) CICC 20001 and CGMCC 1.41 are two acetic acid bacteria strains that, because of their strong abilities to produce and tolerate high concentrations of acetic acid, have been widely used to brew vinegar in China. To globally understand the fermentation characteristics, acid-tolerant mechanisms and genetic stabilities, their genomes were sequenced. Genomic comparisons with 9 other sequenced Ap strains revealed that their chromosomes were evolutionarily conserved, whereas the plasmids were unique compared with other Ap strains. Analysis of the acid-tolerant metabolic pathway at the genomic level indicated that the metabolism of some amino acids and the known mechanisms of acetic acid tolerance, might collaboratively contribute to acetic acid resistance in Ap strains. The balance of instability factors and stability factors in the genomes of Ap CICC 20001 and CGMCC 1.41 strains might be the basis for their genetic stability, consistent with their stable industrial performances. These observations provide important insights into the acid resistance mechanism and the genetic stability of Ap strains and lay a foundation for future genetic manipulation and engineering of these two strains. PMID:26691589

[Modeling of lactic acid fermentation of leguminous plant juices].

PubMed

Shurkhno, R A; Validov, Sh Z; Boronin, A M; Naumova, R P

2006-01-01

Lactic acid fermentation of leguminous plant juices was modeled to provide a comparative efficiency assessment of the previously selected strains of lactic acid bacteria as potential components of starter cultures. Juices of the legumes fodder galega, red clover, and alfalfa were subjected to lactic acid fermentation in 27 variants of experiment. Local strains (Lactobacillus sp. RS 2, Lactobacillus sp. RS 3, and Lactobacillus sp. RS 4) and the collection strain Lactobacillus plantarum BS 933 appeared the most efficient (with reference to the rate and degree of acidogenesis, ratio of lactic and acetic acids, and dynamics of microflora) in fermenting fodder galega juice; Lactobacillus sp. RS 1, Lactobacillus sp. RS 2, Lactobacillus sp. RS 3, Lactobacillus sp. RS 4, and L. plantarum BS 933 were the most efficient for red clover juice. Correction of alfalfa juice fermentation using the tested lactic acid bacterial strains appeared inefficient, which is explainable by its increased protein content and a low level of the acids produced during fermentation.

Protozoan, Bacterial, and Volatile Fatty Acid Changes Associated with Feeding Tylosin

PubMed Central

Satapathy, N.; Purser, D. B.

1967-01-01

Tylosin was fed to two of six wethers for 79 days, to a second two for only 28 days, and not at all to a third pair (controls). The addition of tylosin to the daily feed resulted in a rapid twofold increase in protozoal concentration and a change in the composition or characteristics, or both, of the bacterial population. The results indicate that the bacterial population was modified to the extent of about 80%. Total acid concentrations were initially depressed but appeared to be greater than those in control animals at the termination of the experiment. Deletion of tylosin from the ration resulted in a rapid decrease in protozoal concentrations, whereas changes in the bacterial population did not occur for a further 30 days. PMID:16349756

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

Effectiveness of acidic oxidative potential water in preventing bacterial infection in islet transplantation.

PubMed

Miyamoto, M; Inoue, K; Gu, Y; Hoki, M; Haji, S; Ohyanagi, H

1999-01-01

At a number of points in the current procedures of islet isolation and islet culture after the harvesting of donor pancreata, microorganisms could potentially infect the islet preparation. Furthermore, the use of islets from multiple donors can compound the risks of contamination of individual recipients. Acidic oxidative potential water (also termed electrolyzed strong acid solution, function water, or acqua oxidation water), which was developed in Japan, is a strong acid formed on the anode in the electrolysis of water containing a small amount of sodium chloride. It has these physical properties: pH, from 2.3 to 2.7; oxidative-reduction potential, from 1,000 to 1,100 mV; dissolved chlorine, from 30 to 40 ppm; and dissolved oxygen, from 10 to 30 ppm. Because of these properties, acidic oxidative potential water has strong bactericidal effects on all bacteria including methicillin-resistant Staphylococcus aureus (MRSA), viruses including HIV, HBV, HCV, CMV, and fungi as a result of the action of the active oxygen and active chlorine that it contains. We conducted this study to evaluate the effect of acidic oxidative potential water irrigation on bacterial contamination on the harvesting of porcine pancreata from slaughterhouses for islet xenotransplantation by counting the number of pancreatic surface bacteria using the Dip-slide method, and on the results of islet culture; and to evaluate the direct effect on isolated islets when it is used to prevent bacterial contamination by the static incubation test and by morphological examination. Direct irrigation of the pancreas by acidic oxidative potential water was found to be very effective in preventing bacterial contamination, but direct irrigation of isolated islets slightly decreased their viability and function.

Enterobacter sp. LU1 as a novel succinic acid producer - co-utilization of glycerol and lactose.

PubMed

Podleśny, Marcin; Jarocki, Piotr; Wyrostek, Jakub; Czernecki, Tomasz; Kucharska, Jagoda; Nowak, Anna; Targoński, Zdzisław

2017-03-01

Succinic acid is an important C4-building chemical platform for many applications. A novel succinic acid-producing bacterial strain was isolated from goat rumen. Phylogenetic analysis based on the 16S rRNA sequence and physiological analysis indicated that the strain belongs to the genus Enterobacter. This is the first report of a wild bacterial strain from the genus Enterobacter that is capable of efficient succinic acid production. Co-fermentation of glycerol and lactose significantly improved glycerol utilization under anaerobic conditions, debottlenecking the utilization pathway of this valuable biodiesel waste product. Succinic acid production reached 35 g l -1 when Enterobacter sp. LU1 was cultured in medium containing 50 g l -1 of glycerol and 25 g l -1 of lactose as carbon sources. © 2016 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Biological characterization of lead-enhanced exopolysaccharide produced by a lead resistant Enterobacter cloacae strain P2B.

PubMed

Naik, Milind Mohan; Pandey, Anju; Dubey, Santosh Kumar

2012-09-01

A lead resistant bacterial strain isolated from effluent of lead battery manufacturing company of Goa, India has been identified as Enterobacter cloacae strain P2B based on morphological, biochemical characters, FAME profile and 16S rDNA sequence data. This bacterial strain could resist lead nitrate up to 1.6 mM. Significant increase in exopolysaccharide (EPS) production was observed as the production increased from 28 to 108 mg/L dry weight when exposed to 1.6 mM lead nitrate in Tris buffered minimal medium. Fourier-transformed infrared spectroscopy of this EPS revealed presence of several functional groups involved in metal binding viz. carboxyl, hydroxyl and amide groups along with glucuronic acid. Gas chromatography coupled with mass spectrometry analysis of alditol-acetate derivatives of acid hydrolysed EPS produced in presence of 1.6 mM lead nitrate demonstrated presence of several neutral sugars such as rhamnose, arabinose, xylose, mannose, galactose and glucose, which contribute to lead binding hydroxyl groups. Scanning electron microscope coupled with energy dispersive X-ray spectrometric analysis of this lead resistant strain exposed to 1.6 mM lead nitrate interestingly revealed mucous EPS surrounding bacterial cells which sequestered 17 % lead (as weight %) extracellularly and protected the bacterial cells from toxic effects of lead. This lead resistant strain also showed multidrug resistance. Thus these results significantly contribute to better understanding of structure, function and environmental application of lead-enhanced EPSs produced by bacteria. This lead-enhanced biopolymer can play a very important role in bioremediation of several heavy metals including lead.

Functional role of pyruvate kinase from Lactobacillus bulgaricus in acid tolerance and identification of its transcription factor by bacterial one-hybrid

PubMed Central

Zhai, Zhengyuan; An, Haoran; Wang, Guohong; Luo, Yunbo; Hao, Yanling

2015-01-01

Lactobacillus delbrueckii subsp. bulgaricus develops acid tolerance response when subjected to acid stress conditions, such as the induction of enzymes associated with carbohydrate metabolism. In this study, pyk gene encoding pyruvate kinase was over-expressed in heterologous host Lactococcus lactis NZ9000, and SDS-PAGE analysis revealed the successful expression of this gene in NZ9000. The survival rate of Pyk-overproducing strain was 45-fold higher than the control under acid stress condition (pH 4.0). In order to determine the transcription factor (TF) which regulates the expression of pyk by bacterial one-hybrid, we constructed a TF library including 65 TFs of L. bulgaricus. Western blotting indicated that TFs in this library could be successfully expressed in host strains. Subsequently, the promoter of pfk-pyk operon in L. bulgaricus was identified by 5′-RACE PCR. The bait plasmid pH3U3-p01 carrying the deletion fragment of pfk-pyk promoter captured catabolite control protein A (CcpA) which could regulate the expression of pyk by binding to a putative catabolite-responsive element (5′-TGTAAGCCCTAACA-3′) upstream the -35 region. Real-time qPCR analysis revealed the transcription of pyk was positively regulated by CcpA. This is the first report about identifying the TF of pyk in L. bulgaricus, which will provide new insight into the regulatory network. PMID:26581248

Acidovorax anthurii sp. nov., a new phytopathogenic bacterium which causes bacterial leaf-spot of anthurium.

PubMed

Gardan, L; Dauga, C; Prior, P; Gillis, M; Saddler, G S

2000-01-01

The bacterial leaf-spot of anthurium emerged during the 1980s, in the French West Indies and Trinidad. This new bacterial disease is presently wide spread and constitutes a serious limiting factor for commercial anthurium production. Twenty-nine strains isolated from leaf-spots of naturally infected anthurium were characterized and compared with reference strains belonging to the Comamonadaceae family, the genera Ralstonia and Burkholderia, and representative fluorescent pseudomonads. From artificial inoculations 25 out of 29 strains were pathogenic on anthurium. Biochemical and physiological tests, fatty acid analysis, DNA-DNA hybridization, 16S rRNA gene sequence analysis, DNA-16S RNA hybridization were performed. The 25 pathogenic strains on anthurium were clustered in one phenon closely related to phytopathogenic strains of the genus Acidovorax. Anthurium strains were 79-99% (deltaTm range 0.2-1.6) related to the strain CFBP 3232 and constituted a discrete DNA homology group indicating that they belong to the same species. DNA-rRNA hybridization, 16S rRNA sequence and fatty acid analysis confirmed that this new species belongs to the beta-subclass of Proteobacteria and to rRNA superfamily III, to the family of Comamonadaceae and to the genus Acidovorax. The name Acidovorax anthurii is proposed for this new phytopathogenic bacterium. The type strain has been deposited in the Collection Française des Bactéries Phytopathogènes as CFBP 3232T.

Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I

DOE Office of Scientific and Technical Information (OSTI.GOV)

Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew

Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less

Overexpression of a phosphatidic acid phosphatase type 2 leads to an increase in triacylglycerol production in oleaginous Rhodococcus strains.

PubMed

Hernández, Martín A; Comba, Santiago; Arabolaza, Ana; Gramajo, Hugo; Alvarez, Héctor M

2015-03-01

Oleaginous Rhodococcus strains are able to accumulate large amounts of triacylglycerol (TAG). Phosphatidic acid phosphatase (PAP) enzyme catalyzes the dephosphorylation of phosphatidic acid (PA) to yield diacylglycerol (DAG), a key precursor for TAG biosynthesis. Studies to establish its role in lipid metabolism have been mainly focused in eukaryotes but not in bacteria. In this work, we identified and characterized a putative PAP type 2 (PAP2) encoded by the ro00075 gene in Rhodococcus jostii RHA1. Heterologous expression of ro00075 in Escherichia coli resulted in a fourfold increase in PAP activity and twofold in DAG content. The conditional deletion of ro00075 in RHA1 led to a decrease in the content of DAG and TAG, whereas its overexpression in both RHA1 and Rhodococcus opacus PD630 promoted an increase up to 10 to 15 % by cellular dry weight in TAG content. On the other hand, expression of ro00075 in the non-oleaginous strain Rhodococcus fascians F7 promoted an increase in total fatty acid content up to 7 % at the expense of free fatty acid (FFA), DAG, and TAG fractions. Moreover, co-expression of ro00075/atf2 genes resulted in a fourfold increase in total fatty acid content by a further increase of the FFA and TAG fractions. The results of this study suggest that ro00075 encodes for a PAP2 enzyme actively involved in TAG biosynthesis. Overexpression of this gene, as single one or with an atf gene, provides an alternative approach to increase the biosynthesis and accumulation of bacterial oils as a potential source of raw material for biofuel production.

Bacterial adaptation to the gut environment favors successful colonization: microbial and metabonomic characterization of a simplified microbiota mouse model.

PubMed

Rezzonico, Enea; Mestdagh, Renaud; Delley, Michèle; Combremont, Séverine; Dumas, Marc-Emmanuel; Holmes, Elaine; Nicholson, Jeremy; Bibiloni, Rodrigo

2011-01-01

Rodent models harboring a simple yet functional human intestinal microbiota provide a valuable tool to study the relationships between mammals and their bacterial inhabitants. In this study, we aimed to develop a simplified gnotobiotic mouse model containing 10 easy-to-grow bacteria, readily available from culture repositories, and of known genome sequence, that overall reflect the dominant commensal bacterial makeup found in adult human feces. We observed that merely inoculating a mix of fresh bacterial cultures into ex-germ free mice did not guarantee a successful intestinal colonization of the entire bacterial set, as mice inoculated simultaneously with all strains only harbored 3 after 21 d. Therefore, several inoculation procedures were tested and levels of individual strains were quantified using molecular tools. Best results were obtained by inoculating single bacterial strains into individual animals followed by an interval of two weeks before allowing the animals to socialize to exchange their commensal microbes. Through this procedure, animals were colonized with almost the complete bacterial set (9/10). Differences in the intestinal composition were also reflected in the urine and plasma metabolic profiles, where changes in lipids, SCFA, and amino acids were observed. We conclude that adaptation of bacterial strains to the host's gut environment (mono-colonization) may predict a successful establishment of a more complex microbiota in rodents.

Complete Genome Sequence of a Putative New Bacterial Strain, I507, Isolated from the Indian Ocean

PubMed Central

Wang, Shu-yan; Wei, Jia-qiang

2018-01-01

ABSTRACT Bacterial strain I507 was isolated from the central Indian Ocean and may be a potential novel species, according to the 16S rRNA gene sequence. Here, we present its complete genome sequence and expect that it will provide researchers with valuable information to further understand its classification and function in the future. PMID:29674539

TolC is important for bacterial survival and oxidative stress response in Salmonella enterica serovar Choleraesuis in an acidic environment.

PubMed

Lee, Jen-Jie; Wu, Ying-Chen; Kuo, Chih-Jung; Hsuan, Shih-Ling; Chen, Ter-Hsin

2016-09-25

The outer membrane protein TolC, which is one of the key components of several multidrug efflux pumps, is thought to be involved in various independent systems in Enterobacteriaceae. Since the acidic environment of the stomach is an important protection barrier against foodborne pathogen infections in hosts, we evaluated whether TolC played a role in the acid tolerance of Salmonella enterica serovar Choleraesuis. Comparison of the acid tolerance of the tolC mutant and the parental wild-type strain showed that the absence of TolC limits the ability of Salmonella to sustain life under extreme acidic conditions. Additionally, the mutant exhibited morphological changes during growth in an acidic medium, leading to the conflicting results of cell viability measured by spectrophotometry and colony-forming unit counting. Reverse-transcriptional-PCR analysis indicated that acid-related molecules, apparatus, or enzymes and oxidation-induced factors were significantly affected by the acidic environment in the null-tolC mutant. The elongated cellular morphology was restored by adding antioxidants to the culture medium. Furthermore, we found that increased cellular antioxidative activity provides an overlapping protection against acid killing, demonstrating the complexity of the bacterial acid stress response. Our findings reinforce the multifunctional characteristics of TolC in acid tolerance or oxidative stress resistance and support the correlative protection mechanism between oxygen- and acid-mediated stress responses in Salmonella enterica serovar Choleraesuis. Copyright © 2016 Elsevier B.V. All rights reserved.

Spatial variation in deposition rate coefficients of an adhesion-deficient bacterial strain in quartz sand.

PubMed

Tong, Meiping; Camesano, Terri A; Johnson, William P

2005-05-15

The transport of bacterial strain DA001 was examined in packed quartz sand under a variety of environmentally relevant ionic strength and flow conditions. Under all conditions, the retained bacterial concentrations decreased with distance from the column inlet at a rate that was faster than loglinear, indicating that the deposition rate coefficient decreased with increasing transport distance. The hyperexponential retained profile contrasted againstthe nonmonotonic retained profiles that had been previously observed for this same bacterial strain in glass bead porous media, demonstrating that the form of deviation from log-linear behavior is highly sensitive to system conditions. The deposition rate constants in quartz sand were orders of magnitude below those expected from filtration theory, even in the absence of electrostatic energy barriers. The degree of hyperexponential deviation of the retained profiles from loglinear behavior did not decrease with increasing ionic strength in quartz sand. These observations demonstrate thatthe observed low adhesion and deviation from log-linear behavior was not driven by electrostatic repulsion. Measurements of the interaction forces between DA001 cells and the silicon nitride tip of an atomic force microscope (AFM) showed that the bacterium possesses surface polymers with an average equilibrium length of 59.8 nm. AFM adhesion force measurements revealed low adhesion affinities between silicon nitride and DA001 polymers with approximately 95% of adhesion forces having magnitudes < 0.8 nN. Steric repulsion due to surface polymers was apparently responsible for the low adhesion to silicon nitride, indicating that steric interactions from extracellular polymers controlled DA001 adhesion deficiency and deviation from log-linear behavior on quartz sand.

Characterization of Asymptomatic Bacteriuria Escherichia coli Isolates in Search of Alternative Strains for Efficient Bacterial Interference against Uropathogens

PubMed Central

Stork, Christoph; Kovács, Beáta; Rózsai, Barnabás; Putze, Johannes; Kiel, Matthias; Dorn, Ágnes; Kovács, Judit; Melegh, Szilvia; Leimbach, Andreas; Kovács, Tamás; Schneider, György; Kerényi, Monika; Emödy, Levente; Dobrindt, Ulrich

2018-01-01

Asymptomatic bacterial colonization of the urinary bladder (asymptomatic bacteriuria, ABU) can prevent bladder colonization by uropathogens and thus symptomatic urinary tract infection (UTI). Deliberate bladder colonization with Escherichia coli ABU isolate 83972 has been shown to outcompete uropathogens and prevent symptomatic UTI by bacterial interference. Many ABU isolates evolved from uropathogenic ancestors and, although attenuated, may still be able to express virulence-associated factors. Our aim was to screen for efficient and safe candidate strains that could be used as alternatives to E. coli 83972 for preventive and therapeutic bladder colonization. To identify ABU E. coli strains with minimal virulence potential but maximal interference efficiency, we compared nine ABU isolates from diabetic patients regarding their virulence- and fitness-associated phenotypes in vitro, their virulence in a murine model of sepsis and their genome content. We identified strains in competitive growth experiments, which successfully interfere with colonization of ABU isolate 83972 or uropathogenic E. coli strain 536. Six isolates were able to outcompete E. coli 83972 and two of them also outcompeted UPEC 536 during growth in urine. Superior competitiveness was not simply a result of better growth abilities in urine, but seems also to involve expression of antagonistic factors. Competitiveness in urine did not correlate with the prevalence of determinants coding for adhesins, iron uptake, toxins, and antagonistic factors. Three ABU strains (isolates 61, 106, and 123) with superior competitiveness relative to ABU model strain 83972 display low in vivo virulence in a murine sepsis model, and susceptibility to antibiotics. They belong to different phylogroups and differ in the presence of ExPEC virulence- and fitness-associated genes. Importantly, they all lack marked cytotoxic activity and exhibit a high LD50 value in the sepsis model. These strains represent promising

Host-Derived Sialic Acids Are an Important Nutrient Source Required for Optimal Bacterial Fitness In Vivo.

PubMed

McDonald, Nathan D; Lubin, Jean-Bernard; Chowdhury, Nityananda; Boyd, E Fidelma

2016-04-12

A major challenge facing bacterial intestinal pathogens is competition for nutrient sources with the host microbiota.Vibrio cholerae is an intestinal pathogen that causes cholera, which affects millions each year; however, our knowledge of its nutritional requirements in the intestinal milieu is limited. In this study, we demonstrated that V. cholerae can grow efficiently on intestinal mucus and its component sialic acids and that a tripartite ATP-independent periplasmic SiaPQM strain, transporter-deficient mutant NC1777, was attenuated for colonization using a streptomycin-pretreated adult mouse model. In in vivo competition assays, NC1777 was significantly outcompeted for up to 3 days postinfection. NC1777 was also significantly outcompeted in in vitro competition assays in M9 minimal medium supplemented with intestinal mucus, indicating that sialic acid uptake is essential for fitness. Phylogenetic analyses demonstrated that the ability to utilize sialic acid was distributed among 452 bacterial species from eight phyla. The majority of species belonged to four phyla, Actinobacteria (members of Actinobacillus, Corynebacterium, Mycoplasma, and Streptomyces), Bacteroidetes (mainly Bacteroides, Capnocytophaga, and Prevotella), Firmicutes (members of Streptococcus, Staphylococcus, Clostridium, and Lactobacillus), and Proteobacteria (including Escherichia, Shigella, Salmonella, Citrobacter, Haemophilus, Klebsiella, Pasteurella, Photobacterium, Vibrio, and Yersinia species), mostly commensals and/or pathogens. Overall, our data demonstrate that the ability to take up host-derived sugars and sialic acid specifically allows V. cholerae a competitive advantage in intestinal colonization and that this is a trait that is sporadic in its occurrence and phylogenetic distribution and ancestral in some genera but horizontally acquired in others. Sialic acids are nine carbon amino sugars that are abundant on all mucous surfaces. The deadly human pathogen Vibrio cholerae contains

Isolation and characterization of a hydrocarbonoclastic bacterial enrichment from total petroleum hydrocarbon contaminated sediments: potential candidates for bioaugmentation in bio-based processes.

PubMed

Di Gregorio, Simona; Siracusa, Giovanna; Becarelli, Simone; Mariotti, Lorenzo; Gentini, Alessandro; Lorenzi, Roberto

2016-06-01

Seven hydrocarbonoclastic new bacterial isolates were isolated from dredged sediments of a river estuary in Italy. The sediments were contaminated by shipyard activities since decades, mainly ascribable to the exploitation of diesel oil as the fuel for recreational and commercial navigation of watercrafts. The bacterial isolates were able to utilize diesel oil as sole carbon source. Their metabolic capacities were evaluated by GC-MS analysis, with reference to the depletion of both the normal and branched alkanes, the nC18 fatty acid methyl ester and the unresolved complex mixture of organic compounds. They were taxonomically identified as different species of Stenotrophomonas and Pseudomonas spp. by the combination of amplified ribosomal DNA restriction analysis (ARDRA) and repetitive sequence-based PCR (REP-PCR) analysis. The metabolic activities of interest were analyzed both in relation to the single bacterial strains and to the combination of the latter as a multibacterial species system. After 6 days of incubation in mineral medium with diesel oil as sole carbon source, the Stenotrophomonas sp. M1 strain depleted 43-46 % of Cn-alkane from C28 up to C30, 70 % of the nC18 fatty acid methyl ester and the 46 % of the unresolved complex mixture of organic compounds. On the other hand, the Pseudomonas sp. NM1 strain depleted the 76 % of the nC18 fatty acid methyl ester, the 50 % of the unresolved complex mixture of organic compounds. The bacterial multispecies system was able to completely deplete Cn-alkane from C28 up to C30 and to deplete the 95 % of the unresolved complex mixture of organic compounds. The isolates, either as single strains and as a bacterial multispecies system, were proposed as candidates for bioaugmentation in bio-based processes for the decontamination of dredged sediments.

A simple synthesis of 2-keto-3-deoxy-D-erythro-hexonic acid isopropyl ester, a key sugar for the bacterial population living under metallic stress.

PubMed

Grison, Claire M; Renard, Brice-Loïc; Grison, Claude

2014-02-01

2-Keto-3-deoxy-D-erythro-hexonic acid (KDG) is the key intermediate metabolite of the Entner Doudoroff (ED) pathway. A simple, efficient and stereoselective synthesis of KDG isopropyl ester is described in five steps from 2,3-O-isopropylidene-D-threitol with an overall yield of 47%. KDG isopropyl ester is studied as an attractive marker of a functional Entner Doudoroff pathway. KDG isopropyl ester is used to promote growth of ammonium producing bacterial strains, showing interesting features in the remediation of heavy-metal polluted soils. Copyright © 2013 Elsevier Inc. All rights reserved.

Biomimetic Synthesis of Selenium Nanospheres by Bacterial Strain JS-11 and Its Role as a Biosensor for Nanotoxicity Assessment: A Novel Se-Bioassay

PubMed Central

Dwivedi, Sourabh; AlKhedhairy, Abdulaziz A.; Ahamed, Maqusood; Musarrat, Javed

2013-01-01

Selenium nanoparticles (Se-NPs) were synthesized by green technology using the bacterial isolate Pseudomonas aeruginosa strain JS-11. The bacteria exhibited significant tolerance to selenite (SeO3 2−) up to 100 mM concentration with an EC50 value of 140 mM. The spent medium (culture supernatant) contains the potential of reducing soluble and colorless SeO3 2− to insoluble red elemental selenium (Se0) at 37°C. Characterization of red Se° product by use of UV-Vis spectroscopy, X-ray diffraction (XRD), atomic force microscopy (AFM) and transmission electron microscopy (TEM) with energy dispersive X-ray spectrum (EDX) analysis revealed the presence of stable, predominantly monodispersed and spherical selenium nanoparticles (Se-NPs) of an average size of 21 nm. Most likely, the metabolite phenazine-1-carboxylic acid (PCA) released by strain JS-11 in culture supernatant along with the known redox agents like NADH and NADH dependent reductases are responsible for biomimetic reduction of SeO3 2− to Se° nanospheres. Based on the bioreduction of a colorless solution of SeO3 2− to elemental red Se0, a high throughput colorimetric bioassay (Se-Assay) was developed for parallel detection and quantification of nanoparticles (NPs) cytotoxicity in a 96 well format. Thus, it has been concluded that the reducing power of the culture supernatant of strain JS-11 could be effectively exploited for developing a simple and environmental friendly method of Se-NPs synthesis. The results elucidated that the red colored Se° nanospheres may serve as a biosensor for nanotoxicity assessment, contemplating the inhibition of SeO3 2− bioreduction process in NPs treated bacterial cell culture supernatant, as a toxicity end point. PMID:23483909

Biomimetic synthesis of selenium nanospheres by bacterial strain JS-11 and its role as a biosensor for nanotoxicity assessment: a novel se-bioassay.

PubMed

Dwivedi, Sourabh; Alkhedhairy, Abdulaziz A; Ahamed, Maqusood; Musarrat, Javed

2013-01-01

Selenium nanoparticles (Se-NPs) were synthesized by green technology using the bacterial isolate Pseudomonas aeruginosa strain JS-11. The bacteria exhibited significant tolerance to selenite (SeO3(2-)) up to 100 mM concentration with an EC50 value of 140 mM. The spent medium (culture supernatant) contains the potential of reducing soluble and colorless SeO3(2-) to insoluble red elemental selenium (Se(0)) at 37°C. Characterization of red Se° product by use of UV-Vis spectroscopy, X-ray diffraction (XRD), atomic force microscopy (AFM) and transmission electron microscopy (TEM) with energy dispersive X-ray spectrum (EDX) analysis revealed the presence of stable, predominantly monodispersed and spherical selenium nanoparticles (Se-NPs) of an average size of 21 nm. Most likely, the metabolite phenazine-1-carboxylic acid (PCA) released by strain JS-11 in culture supernatant along with the known redox agents like NADH and NADH dependent reductases are responsible for biomimetic reduction of SeO3(2-) to Se° nanospheres. Based on the bioreduction of a colorless solution of SeO3(2-) to elemental red Se(0), a high throughput colorimetric bioassay (Se-Assay) was developed for parallel detection and quantification of nanoparticles (NPs) cytotoxicity in a 96 well format. Thus, it has been concluded that the reducing power of the culture supernatant of strain JS-11 could be effectively exploited for developing a simple and environmental friendly method of Se-NPs synthesis. The results elucidated that the red colored Se° nanospheres may serve as a biosensor for nanotoxicity assessment, contemplating the inhibition of SeO3(2-) bioreduction process in NPs treated bacterial cell culture supernatant, as a toxicity end point.

Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid

PubMed Central

Alonzo, Francis

2016-01-01

To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

Staphylococcus aureus Tissue Infection During Sepsis Is Supported by Differential Use of Bacterial or Host-Derived Lipoic Acid.

PubMed

Zorzoli, Azul; Grayczyk, James P; Alonzo, Francis

2016-10-01

To thrive in diverse environments, bacteria must shift their metabolic output in response to nutrient bioavailability. In many bacterial species, such changes in metabolic flux depend upon lipoic acid, a cofactor required for the activity of enzyme complexes involved in glycolysis, the citric acid cycle, glycine catabolism, and branched chain fatty acid biosynthesis. The requirement of lipoic acid for metabolic enzyme activity necessitates that bacteria synthesize the cofactor and/or scavenge it from environmental sources. Although use of lipoic acid is a conserved phenomenon, the mechanisms behind its biosynthesis and salvage can differ considerably between bacterial species. Furthermore, low levels of circulating free lipoic acid in mammals underscore the importance of lipoic acid acquisition for pathogenic microbes during infection. In this study, we used a genetic approach to characterize the mechanisms of lipoic acid biosynthesis and salvage in the bacterial pathogen Staphylococcus aureus and evaluated the requirements for both pathways during murine sepsis. We determined that S. aureus lipoic acid biosynthesis and salvage genes exist in an arrangement that directly links redox stress response and acetate biosynthesis genes. In addition, we found that lipoic acid salvage is dictated by two ligases that facilitate growth and lipoylation in distinct environmental conditions in vitro, but that are fully compensatory for survival in vivo. Upon infection of mice, we found that de novo biosynthesis or salvage promotes S. aureus survival in a manner that depends upon the infectious site. In addition, when both lipoic acid biosynthesis and salvage are blocked S. aureus is rendered avirulent, implying an inability to induce lipoic acid-independent metabolic programs to promote survival. Together, our results define the major pathways of lipoic acid biosynthesis and salvage in S. aureus and support the notion that bacterial nutrient acquisition schemes are instrumental

Production and characterization of bacterial cellulose membranes with hyaluronic acid from chicken comb.

PubMed

de Oliveira, Sabrina Alves; da Silva, Bruno Campos; Riegel-Vidotti, Izabel Cristina; Urbano, Alexandre; de Sousa Faria-Tischer, Paula Cristina; Tischer, Cesar Augusto

2017-04-01

The bacterial cellulose (BC), from Gluconacetobacter hansenii, is a biofilm with a high degree of crystallinity that can be used for therapeutic purposes and as a candidate for healing wounds. Hyaluronic acid (HA) is a constitutive polysaccharide found in the extracellular matrix and is a material used in tissue engineering and scaffolding for tissue regeneration. In this study, polymeric composites were produced in presence of hyaluronic acid isolated from chicken comb on different days of fermentation, specifically on the first (BCHA-SABT0) and third day (BCHA-SABT3) of fermentation. The structural characteristics, thermal stability and molar mass of hyaluronic acid from chicken comb were evaluated. Native membrane and polymeric composites were characterized with respect to their morphology and crystallinity. The optimized process of extraction and purification of hyaluronic acid resulted in low molar mass hyaluronic acid with structural characteristics similar to the standard commercial hyaluronic acid. The results demonstrate that the polymeric composites (BC/HA-SAB) can be produced in situ. The membranes produced on the third day presented better incorporation of HA-SAB between cellulose microfiber, resulting in membranes with higher thermal stability, higher roughness and lower crystallinity. The biocompatiblily of bacterial cellulose and the importance of hyaluronic acid as a component of extracellular matrix qualify the polymeric composites as promising biomaterials for tissue engineering. Copyright © 2017 Elsevier B.V. All rights reserved.

Kinetics of D-lactic acid production by Sporolactobacillus sp. strain CASD using repeated batch fermentation.

PubMed

Zhao, Bo; Wang, Limin; Li, Fengsong; Hua, Dongliang; Ma, Cuiqing; Ma, Yanhe; Xu, Ping

2010-08-01

D-lactic acid was produced by Sporolactobacillus sp. strain CASD in repeated batch fermentation with one- and two-reactor systems. The strain showed relatively high energy consumption in its growth-related metabolism in comparison with other lactic acid producers. When the fermentation was repeated with 10% (v/v) of previous culture to start a new batch, D-lactic acid production shifted from being cell-maintenance-dependent to cell-growth-dependent. In comparison with the one-reactor system, D-lactic acid production increased approximately 9% in the fourth batch of the two-reactor system. Strain CASD is an efficient D-lactic acid producer with increased growth rate at the early stage of repeated cycles, which explains the strain's physiological adaptation to repeated batch culture and improved performance in the two-reactor fermentation system. From a kinetic point of view, two-reactor fermentation system was shown to be an alternative for conventional one-reactor repeated batch operation. Copyright 2010 Elsevier Ltd. All rights reserved.

Heterologous co-expression of accA, fabD, and thioesterase genes for improving long-chain fatty acid production in Pseudomonas aeruginosa and Escherichia coli.

PubMed

Lee, Sunhee; Jeon, Eunyoung; Jung, Yeontae; Lee, Jinwon

2012-05-01

The goal of the present study was to increase the content of intracellular long-chain fatty acids in two bacterial strains, Pseudomonas aeruginosa PA14 and Escherichia coli K-12 MG1655, by co-overexpressing essential enzymes that are involved in the fatty acid synthesis metabolic pathway. Recently, microbial fatty acids and their derivatives have been receiving increasing attention as an alternative source of fuel. By introducing two genes (accA and fabD) of P. aeruginosa into the two bacterial strains and by co-expressing with them the fatty acyl-acyl carrier protein thioesterase gene of Streptococcus pyogenes (strain MGAS10270), we have engineered recombinant strains that are efficient producers of long-chain fatty acids (C16 and C18). The recombinant strains exhibit a 1.3-1.7-fold increase in the production of long-chain fatty acids over the wild-type strains. To enhance the production of total long-chain fatty acids, we researched the carbon sources for optimized culture conditions and results were used for post-culture incubation period. E. coli SGJS17 (containing the accA, fabD, and thioesterase genes) produced the highest content of intracellular total fatty acids; in particular, the unsaturated fatty acid content was about 20-fold higher than that in the wild-type E. coli.

Deletion of JJJ1 improves acetic acid tolerance and bioethanol fermentation performance of Saccharomyces cerevisiae strains.

PubMed

Wu, Xuechang; Zhang, Lijie; Jin, Xinna; Fang, Yahong; Zhang, Ke; Qi, Lei; Zheng, Daoqiong

2016-07-01

To improve tolerance to acetic acid that is present in lignocellulosic hydrolysates and affects bioethanol production by Saccharomyces cerevisiae. Saccharomyces cerevisiae strains with improved tolerance to acetic acid were obtained through deletion of the JJJ1 gene. The lag phase of the JJJ1 deletion mutant BYΔJJJ1 was ~16 h shorter than that of the parent strain, BY4741, when the fermentation medium contained 4.5 g acetic acid/l. Additionally, the specific ethanol production rate of BYΔJJJ1 was increased (0.057 g/g h) compared to that of the parent strain (0.051 g/g h). Comparative transcription and physiological analyses revealed higher long chain fatty acid, trehalose, and catalase contents might be critical factors responsible for the acetic acid resistance of JJJ1 knockout strains. JJJ1 deletion improves acetic acid tolerance and ethanol fermentation performance of S. cerevisiae.

The effects of abscisic acid, salicylic acid and jasmonic acid on lipid accumulation in two freshwater Chlorella strains.

PubMed

Wu, Guanxun; Gao, Zhengquan; Du, Huanmin; Lin, Bin; Yan, Yuchen; Li, Guoqiang; Guo, Yanyun; Fu, Shenggui; Wei, Gongxiang; Wang, Miaomiao; Cui, Meng; Meng, Chunxiao

2018-03-27

Sustainable renewable energy is being hotly debated globally because the continued use of finite fossil fuels is now widely recognized as being unsustainable. Microalgae potentially offer great opportunities for resolving this challenge. Abscisic acid (ABA), jasmonic acid (JA) and salicylic acid (SA) are involved in regulating many physiological properties and have been widely used in higher plants. To test if phytohormones have an impact on accumulating lipid for microalgae, ABA, JA and SA were used to induce two Chlorella strains in the present study. The results showed 1.0 mg/L ABA, 10 mg/L SA, and 0.5 mg/L JA, led strain C. vulgaris ZF strain to produce a 45%, 42% and 49% lipid content that was 1.8-, 1.7- and 2.0-fold that of controls, respectively. For FACHB 31 (number 31 of the Freshwater Algae Culture Collection at the Institute of Hydrobiology, Chinese Academy of Sciences), the addition of 1.0 mg/L ABA, 10 mg/L SA, and 0.5 mg/L, JA produced 33%, 30% and 38% lipid content, which was 1.8-, 1.6- and 2.1-fold that of controls, respectively. As for lipid productivity, 1.0 mg/L ABA increased the lipid productivity of C. vulgaris ZF strain and FACHB-31 by 123% and 44%; 10 mg/L SA enhanced lipid productivity by 100% and 33%; the best elicitor, 0.5 mg/L JA, augmented lipid productivity by 127% and 75% compared to that of controls, respectively. The results above suggest that the three phytohormones at physiological concentrations play crucial roles in inducing lipid accumulation in Chlorella.

Effect of simulated acid rain on fluorine mobility and the bacterial community of phosphogypsum.

PubMed

Wang, Mei; Tang, Ya; Anderson, Christopher W N; Jeyakumar, Paramsothy; Yang, Jinyan

2018-06-01

Contamination of soil and water with fluorine (F) leached from phosphogypsum (PG) stacks is a global environmental issue. Millions of tons of PG is produced each year as a by-product of fertilizer manufacture, and in China, weathering is exacerbated by acid rain. In this work, column leaching experiments using simulated acid rain were run to evaluate the mobility of F and the impact of weathering on native bacterial community composition in PG. After a simulated summer rainfall, 2.42-3.05 wt% of the total F content of PG was leached and the F concentration in leachate was above the quality standard for surface water and groundwater in China. Acid rain had no significant effect on the movement of F in PG. A higher concentration of F was observed at the bottom than the top section of PG columns suggesting mobility and reprecipitation of F. Throughout the simulation, the PG was environmentally safe according the TCLP testing. The dominant bacteria in PG were from the Enterococcus and Bacillus genus. Bacterial community composition in PG leached by simulated acid rain (pH 3.03) was more abundant than at pH 6.88. Information on F mobility and bacterial community in PG under conditions of simulated rain is relevant to management of environmental risk in stockpiled PG waste.

Molecular complexity of successive bacterial epidemics deconvoluted by comparative pathogenomics.

PubMed

Beres, Stephen B; Carroll, Ronan K; Shea, Patrick R; Sitkiewicz, Izabela; Martinez-Gutierrez, Juan Carlos; Low, Donald E; McGeer, Allison; Willey, Barbara M; Green, Karen; Tyrrell, Gregory J; Goldman, Thomas D; Feldgarden, Michael; Birren, Bruce W; Fofanov, Yuriy; Boos, John; Wheaton, William D; Honisch, Christiane; Musser, James M

2010-03-02

Understanding the fine-structure molecular architecture of bacterial epidemics has been a long-sought goal of infectious disease research. We used short-read-length DNA sequencing coupled with mass spectroscopy analysis of SNPs to study the molecular pathogenomics of three successive epidemics of invasive infections involving 344 serotype M3 group A Streptococcus in Ontario, Canada. Sequencing the genome of 95 strains from the three epidemics, coupled with analysis of 280 biallelic SNPs in all 344 strains, revealed an unexpectedly complex population structure composed of a dynamic mixture of distinct clonally related complexes. We discovered that each epidemic is dominated by micro- and macrobursts of multiple emergent clones, some with distinct strain genotype-patient phenotype relationships. On average, strains were differentiated from one another by only 49 SNPs and 11 insertion-deletion events (indels) in the core genome. Ten percent of SNPs are strain specific; that is, each strain has a unique genome sequence. We identified nonrandom temporal-spatial patterns of strain distribution within and between the epidemic peaks. The extensive full-genome data permitted us to identify genes with significantly increased rates of nonsynonymous (amino acid-altering) nucleotide polymorphisms, thereby providing clues about selective forces operative in the host. Comparative expression microarray analysis revealed that closely related strains differentiated by seemingly modest genetic changes can have significantly divergent transcriptomes. We conclude that enhanced understanding of bacterial epidemics requires a deep-sequencing, geographically centric, comparative pathogenomics strategy.

Growth and Survival of Acid-Resistant and Non-Acid-Resistant Shiga-Toxin-Producing Escherichia coli Strains during the Manufacture and Ripening of Camembert Cheese.

PubMed

Montet, M P; Jamet, E; Ganet, S; Dizin, M; Miszczycha, S; Dunière, L; Thevenot, D; Vernozy-Rozand, C

2009-01-01

Growth and survival of acid-resistant (AR) and non-acid-resistant (NAR) Shiga-toxin-producing Escherichia coli (STEC) strains were investigated during the manufacture and ripening of microfiltered milk Camembert cheeses. The induction of acid resistance of the STEC strains in cheeses was also studied. Six different mixtures of AR and/or NAR STEC strains were inoculated separately into microfiltered milk at a level of 10(3) CFU mL(-1). The STEC counts (AR and NAR) initially increased by 1 to 2 log(10) CFU g(-1) during cheese-making. Thereafter, the populations stabilized during salting/drying and then decreased during the early stages of ripening. Exposing the STEC strains in artificially inoculated cheeses to simulated gastric fluid (SGF - pH: 2.0) reduced the number of NAR strains to undetectable levels within 40 minutes, versus 120 minutes for the AR STEC strains. AR and NAR STEC were able to survive during the manufacture and ripening of Camembert cheese prepared from microfiltered milk with no evidence of induced acid tolerance in NAR STEC strains.

Growth and Survival of Acid-Resistant and Non-Acid-Resistant Shiga-Toxin-Producing Escherichia coli Strains during the Manufacture and Ripening of Camembert Cheese

PubMed Central

Montet, M. P.; Jamet, E.; Ganet, S.; Dizin, M.; Miszczycha, S.; Dunière, L.; Thevenot, D.; Vernozy-Rozand, C.

2009-01-01

Growth and survival of acid-resistant (AR) and non-acid-resistant (NAR) Shiga-toxin-producing Escherichia coli (STEC) strains were investigated during the manufacture and ripening of microfiltered milk Camembert cheeses. The induction of acid resistance of the STEC strains in cheeses was also studied. Six different mixtures of AR and/or NAR STEC strains were inoculated separately into microfiltered milk at a level of 103 CFU mL−1. The STEC counts (AR and NAR) initially increased by 1 to 2 log10 CFU g−1 during cheese-making. Thereafter, the populations stabilized during salting/drying and then decreased during the early stages of ripening. Exposing the STEC strains in artificially inoculated cheeses to simulated gastric fluid (SGF - pH: 2.0) reduced the number of NAR strains to undetectable levels within 40 minutes, versus 120 minutes for the AR STEC strains. AR and NAR STEC were able to survive during the manufacture and ripening of Camembert cheese prepared from microfiltered milk with no evidence of induced acid tolerance in NAR STEC strains. PMID:20016668

ASSAY OF POLY-β-HYDROXYBUTYRIC ACID

PubMed Central

Law, John H.; Slepecky, Ralph A.

1961-01-01

Law, John H. (Harvard University, Cambridge, Mass.) and Ralph A. Splepecky. Assay of poly-β-hydroxybutyric acid. J. Bacteriol. 82:33–36. 1961—A convenient spectrophotometric assay of bacterial poly-β-hydroxybutyric acid has been devised. Quantitative conversion of poly-β-hydroxybutyric acid to crotonic acid by heating in concentrated sulfuric acid and determination of the ultraviolet absorption of the produce permits an accurate determination of this material in quantities down to 5 μg. This method has been used to follow the production of poly-β-hydroxybutyric acid by Bacillus megaterium strain KM. PMID:13759651

Differing Daphnia magna assimilation efficiencies for terrestrial, bacterial, and algal carbon and fatty acids.

PubMed

Taipale, Sami J; Brett, Michael T; Hahn, Martin W; Martin-Creuzburg, Dominik; Yeung, Sean; Hiltunen, Minna; Strandberg, Ursula; Kankaala, Paula

2014-02-01

There is considerable interest in the pathways by which carbon and growth-limiting elemental and biochemical nutrients are supplied to upper trophic levels. Fatty acids and sterols are among the most important molecules transferred across the plant-animal interface of food webs. In lake ecosystems, in addition to phytoplankton, bacteria and terrestrial organic matter are potential trophic resources for zooplankton, especially in those receiving high terrestrial organic matter inputs. We therefore tested carbon, nitrogen, and fatty acid assimilation by the crustacean Daphnia magna when consuming these resources. We fed Daphnia with monospecific diets of high-quality (Cryptomonas marssonii) and intermediate-quality (Chlamydomonas sp. and Scenedesmus gracilis) phytoplankton species, two heterotrophic bacterial strains, and particles from the globally dispersed riparian grass, Phragmites australis, representing terrestrial particulate organic carbon (t-POC). We also fed Daphnia with various mixed diets, and compared Daphnia fatty acid, carbon, and nitrogen assimilation across treatments. Our results suggest that bacteria were nutritionally inadequate diets because they lacked sterols and polyunsaturated omega-3 and omega-6 (omega-3 and omega-6) fatty acids (PUFAs). However, Daphnia were able to effectively use carbon and nitrogen from Actinobacteria, if their basal needs for essential fatty acids and sterols were met by phytoplankton. In contrast to bacteria, t-POC contained sterols and omega-6 and omega-3 fatty acids, but only at 22%, 1.4%, and 0.2% of phytoplankton levels, respectively, which indicated that t-POC food quality was especially restricted with regard to omega-3 PUFAs. Our results also showed higher assimilation of carbon than fatty acids from t-POC and bacteria into Daphnia, based on stable-isotope and fatty acids analysis, respectively. A relatively high (>20%) assimilation of carbon and fatty acids from t-POC was observed only when the proportion of t

Production of L-lactic acid from metabolically engineered strain of Enterobacter aerogenes ATCC 29007.

PubMed

Thapa, Laxmi Prasad; Lee, Sang Jun; Park, Chulhwan; Kim, Seung Wook

2017-07-01

In this study, L-lactic acid production was investigated from metabolically engineered strain of E. aerogenes ATCC 29007. The engineered strain E. aerogenes SUMI01 (Δpta) was generated by the deletion of phosphate acetyltransferase (pta) gene from the chromosome of E. aerogenes ATCC 29007 and deletion was confirmed by colony PCR. Under the optimized fermentation conditions, at 37°C and pH 6 for 84h, the L-lactic acid produced by engineered strain E. aerogenes SUMI01 (Δpta) in flask fermentation using 100g/L mannitol as the carbon source was 40.05g/L as compared to that of the wild type counterpart 20.70g/L. At the end of the batch fermentation in bioreactor the production of L-lactic acid reached to 46.02g/L and yield was 0.41g/g by utilizing 112.32g/L mannitol. This is the first report regarding the production of L-lactic acid from Enterobacter species. We believe that this result may provide valuable guidelines for further engineering Enterobacter strain for the improvement of L-lactic acid production. Copyright © 2017 Elsevier Inc. All rights reserved.

Pan-Genomic Analysis Permits Differentiation of Virulent and Non-virulent Strains of Xanthomonas arboricola That Cohabit Prunus spp. and Elucidate Bacterial Virulence Factors

PubMed Central

Garita-Cambronero, Jerson; Palacio-Bielsa, Ana; López, María M.; Cubero, Jaime

2017-01-01

Xanthomonas arboricola is a plant-associated bacterial species that causes diseases on several plant hosts. One of the most virulent pathovars within this species is X. arboricola pv. pruni (Xap), the causal agent of bacterial spot disease of stone fruit trees and almond. Recently, a non-virulent Xap-look-a-like strain isolated from Prunus was characterized and its genome compared to pathogenic strains of Xap, revealing differences in the profile of virulence factors, such as the genes related to the type III secretion system (T3SS) and type III effectors (T3Es). The existence of this atypical strain arouses several questions associated with the abundance, the pathogenicity, and the evolutionary context of X. arboricola on Prunus hosts. After an initial characterization of a collection of Xanthomonas strains isolated from Prunus bacterial spot outbreaks in Spain during the past decade, six Xap-look-a-like strains, that did not clustered with the pathogenic strains of Xap according to a multi locus sequence analysis, were identified. Pathogenicity of these strains was analyzed and the genome sequences of two Xap-look-a-like strains, CITA 14 and CITA 124, non-virulent to Prunus spp., were obtained and compared to those available genomes of X. arboricola associated with this host plant. Differences were found among the genomes of the virulent and the Prunus non-virulent strains in several characters related to the pathogenesis process. Additionally, a pan-genomic analysis that included the available genomes of X. arboricola, revealed that the atypical strains associated with Prunus were related to a group of non-virulent or low virulent strains isolated from a wide host range. The repertoire of the genes related to T3SS and T3Es varied among the strains of this cluster and those strains related to the most virulent pathovars of the species, corylina, juglandis, and pruni. This variability provides information about the potential evolutionary process associated to the

Functional Analysis of d-Alanylation of Lipoteichoic Acid in the Probiotic Strain Lactobacillus rhamnosus GG▿

PubMed Central

Vélez, Mónica Perea; Verhoeven, Tine L. A.; Draing, Christian; Von Aulock, Sonja; Pfitzenmaier, Markus; Geyer, Armin; Lambrichts, Ivo; Grangette, Corinne; Pot, Bruno; Vanderleyden, Jos; De Keersmaecker, Sigrid C. J.

2007-01-01

Lipoteichoic acid (LTA) is a macroamphiphile molecule which performs several functions in gram-positive bacteria, such as maintenance of cell wall homeostasis. d-Alanylation of LTA requires the proteins encoded by the dlt operon, and this process is directly related to the charge properties of this polymer strongly contributing to its function. The insertional inactivation of dltD of the probiotic strain Lactobacillus rhamnosus GG (ATCC 53103) resulted in the complete absence of d-alanyl esters in the LTA as confirmed by nuclear magnetic resonance analysis. This was reflected in modifications of the bacterial cell surface properties. The dltD strain showed 2.4-fold-increased cell length, a low survival capacity in response to gastric juice challenge, an increased sensitivity to human beta-defensin-2, an increased rate of autolysis, an increased capacity to initiate growth in the presence of an anionic detergent, and a decreased capacity to initiate growth in the presence of cationic peptides compared to wild-type results. However, in vitro experiments revealed no major differences for adhesion to human intestinal epithelial cells, biofilm formation, and immunomodulation. These properties are considered to be important for probiotics. The role of the dlt operon in lactobacilli is discussed in view of these results. PMID:17434999

MALDI-TOF-MS with PLS Modeling Enables Strain Typing of the Bacterial Plant Pathogen Xanthomonas axonopodis

NASA Astrophysics Data System (ADS)

Sindt, Nathan M.; Robison, Faith; Brick, Mark A.; Schwartz, Howard F.; Heuberger, Adam L.; Prenni, Jessica E.

2018-02-01

Matrix-assisted desorption/ionization time of flight mass spectrometry (MALDI-TOF-MS) is a fast and effective tool for microbial species identification. However, current approaches are limited to species-level identification even when genetic differences are known. Here, we present a novel workflow that applies the statistical method of partial least squares discriminant analysis (PLS-DA) to MALDI-TOF-MS protein fingerprint data of Xanthomonas axonopodis, an important bacterial plant pathogen of fruit and vegetable crops. Mass spectra of 32 X. axonopodis strains were used to create a mass spectral library and PLS-DA was employed to model the closely related strains. A robust workflow was designed to optimize the PLS-DA model by assessing the model performance over a range of signal-to-noise ratios (s/n) and mass filter (MF) thresholds. The optimized parameters were observed to be s/n = 3 and MF = 0.7. The model correctly classified 83% of spectra withheld from the model as a test set. A new decision rule was developed, termed the rolled-up Maximum Decision Rule (ruMDR), and this method improved identification rates to 92%. These results demonstrate that MALDI-TOF-MS protein fingerprints of bacterial isolates can be utilized to enable identification at the strain level. Furthermore, the open-source framework of this workflow allows for broad implementation across various instrument platforms as well as integration with alternative modeling and classification algorithms.

Analysis of Growth Inhibition and Metabolism of Hydroxycinnamic Acids by Brewing and Spoilage Strains of Brettanomyces Yeast.

PubMed

Lentz, Michael; Harris, Chad

2015-10-15

Brettanomyces yeasts are well-known as spoilage organisms in both the wine and beer industries, but also contribute important desirable characters to certain beer styles. These properties are mediated in large part by Brettanomyces ' metabolism of hydroxycinnamic acids (HCAs) present in beverage raw materials. Here we compare growth inhibition by, and metabolism of, HCAs among commercial brewing strains and spoilage strains of B. bruxellensis and B. anomalus . These properties vary widely among the different strains tested and between the HCAs analyzed. Brewing strains showed more efficient metabolism of ferulic acid over p -coumaric acid, a trait not shared among the spoilage strains.

Effect of cerulenin on fatty acid composition and gene expression pattern of DHA-producing strain Colwellia psychrerythraea strain 34H.

PubMed

Wan, Xia; Peng, Yun-Feng; Zhou, Xue-Rong; Gong, Yang-Min; Huang, Feng-Hong; Moncalián, Gabriel

2016-02-06

Colwellia psychrerythraea 34H is a psychrophilic bacterium able to produce docosahexaenoic acid (DHA). Polyketide synthase pathway is assumed to be responsible for DHA production in marine bacteria. Five pfa genes from strain 34H were confirmed to be responsible for DHA formation by heterogeneous expression in Escherichia coli. The complexity of fatty acid profile of this strain was revealed by GC and GC-MS. Treatment of cells with cerulenin resulted in significantly reduced level of C16 monounsaturated fatty acid (C16:1(Δ9t), C16:1(Δ7)). In contrast, the amount of saturated fatty acids (C10:0, C12:0, C14:0), hydroxyl fatty acids (3-OH C10:0 and 3-OH C12:0), as well as C20:4ω3, C20:5ω3 and C22:6ω3 were increased. RNA sequencing (RNA-Seq) revealed the altered gene expression pattern when C. psychrerythraea cells were treated with cerulenin. Genes involved in polyketide synthase pathway and fatty acid biosynthesis pathway were not obviously affected by cerulenin treatment. In contrast, several genes involved in fatty acid degradation or β-oxidation pathway were dramatically reduced at the transcriptional level. Genes responsible for DHA formation in C. psychrerythraea was first cloned and characterized. We revealed the complexity of fatty acid profile in this DHA-producing strain. Cerulenin could substantially change the fatty acid composition by affecting the fatty acid degradation at transcriptional level. Acyl-CoA dehydrogenase gene family involved in the first step of β-oxidation pathway may be important to the selectivity of degraded fatty acids. In addition, inhibition of FabB protein by cerulenin may lead to the accumulation of malonyl-CoA, which is the substrate for DHA formation.

Identification and characterization of thermotolerant acetic acid bacteria strains isolated from coconut water vinegar in Sri Lanka.

PubMed

Perumpuli, P A B N; Watanabe, Taisuke; Toyama, Hirohide

2014-01-01

From the pellicle formed on top of brewing coconut water vinegar in Sri Lanka, three Acetobacter strains (SL13E-2, SL13E-3, and SL13E-4) that grow at 42 °C and four Gluconobacter strains (SL13-5, SL13-6, SL13-7, and SL13-8) grow at 37 °C were identified as Acetobacter pasteurianus and Gluconobacter frateurii, respectively. Acetic acid production by the isolated Acetobacter strains was examined. All three strains gave 4% acetic acid from 6% initial ethanol at 37 °C, and 2.5% acetic acid from 4% initial ethanol at 40 °C. Compared with the two other strains, SL13E-4 showed both slower growth and slower acetic acid production. As well as the thermotolerant SKU1108 strain, the activities of the alcohol dehydrogenase and the aldehyde dehydrogenase of SL13E-2 and SL13E-4 were more stable than those of the mesophilic strain. The isolated strains were used to produce coconut water vinegar at higher temperatures than typically used for vinegar production.

Butyric acid fermentation from pretreated and hydrolysed wheat straw by an adapted Clostridium tyrobutyricum strain

PubMed Central

Baroi, G N; Baumann, I; Westermann, P; Gavala, H N

2015-01-01

Butyric acid is a valuable building-block for the production of chemicals and materials and nowadays it is produced exclusively from petroleum. The aim of this study was to develop a suitable and robust strain of Clostridium tyrobutyricum that produces butyric acid at a high yield and selectivity from lignocellulosic biomasses. Pretreated (by wet explosion) and enzymatically hydrolysed wheat straw (PHWS), rich in C6 and C5 sugars (71.6 and 55.4 g l−1 of glucose and xylose respectively), was used as substrate. After one year of serial selections, an adapted strain of C. tyrobutyricum was developed. The adapted strain was able to grow in 80% (v v−1) PHWS without addition of yeast extract compared with an initial tolerance to less than 10% PHWS and was able to ferment both glucose and xylose. It is noticeable that the adapted C. tyrobutyricum strain was characterized by a high yield and selectivity to butyric acid. Specifically, the butyric acid yield at 60–80% PHWS lie between 0.37 and 0.46 g g−1 of sugar, while the selectivity for butyric acid was as high as 0.9–1.0 g g−1 of acid. Moreover, the strain exhibited a robust response in regards to growth and product profile at pH 6 and 7. PMID:26230610

Fates of Acid-Resistant and Non-Acid-Resistant Shiga Toxin-Producing Escherichia coli Strains in Ruminant Digestive Contents in the Absence and Presence of Probiotics ▿

PubMed Central

Chaucheyras-Durand, Frédérique; Faqir, Fahima; Ameilbonne, Aurélie; Rozand, Christine; Martin, Christine

2010-01-01

Healthy ruminants are the main reservoir of Shiga toxin-producing Escherichia coli (STEC). During their transit through the ruminant gastrointestinal tract, STEC encounters a number of acidic environments. As all STEC strains are not equally resistant to acidic conditions, the purpose of this study was to investigate whether acid resistance confers an ecological advantage to STEC strains in ruminant digestive contents and whether acid resistance mechanisms are induced in the rumen compartment. We found that acid-resistant STEC survived at higher rates during prolonged incubation in rumen fluid than acid-sensitive STEC and that they resisted the highly acidic conditions of the abomasum fluid, whereas acid-sensitive strains were killed. However, transit through the rumen contents allowed acid-sensitive strains to survive in the abomasum fluid at levels similar to those of acid-resistant STEC. The acid resistance status of the strains had little influence on STEC growth in jejunal and cecal contents. Supplementation with the probiotic Saccharomyces cerevisiae CNCM I-1077 or Lactobacillus acidophilus BT-1386 led to killing of all of the strains tested during prolonged incubation in the rumen contents, but it did not have any influence in the other digestive compartments. In addition, S. cerevisiae did not limit the induction of acid resistance in the rumen fluid. Our results indicate that the rumen compartment could be a relevant target for intervention strategies that could both limit STEC survival and eliminate induction of acid resistance mechanisms in order to decrease the number of viable STEC cells reaching the hindgut and thus STEC shedding and food contamination. PMID:19948865

Time series analysis of aerobic bacterial flora during Miso fermentation.

PubMed

Onda, T; Yanagida, F; Tsuji, M; Shinohara, T; Yokotsuka, K

2003-01-01

This article reports a microbiological study of aerobic mesophilic bacteria that are present during the fermentation process of Miso. Aerobic bacteria were enumerated and isolated from Miso during fermentation and divided into nine groups using traditional phenotypic tests. The strains were identified by biochemical analysis and 16S rRNA sequence analysis. They were identified as Bacillus subtilis, B. amyloliquefaciens, Kocuria kristinae, Staphylococcus gallinarum and S. kloosii. All strains were sensitive to the bacteriocins produced by the lactic acid bacteria isolated from Miso. The dominant species among the undesirable species throughout the fermentation process were B. subtilis and B. amyloliquefaciens. It is suggested that bacteriocin-producing lactic acid bacteria are effective in the growth prevention of aerobic bacteria in Miso. This study has provided useful information for controlling of bacterial flora during Miso fermentation.

Phenotypic Signatures Arising from Unbalanced Bacterial Growth

PubMed Central

Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

2014-01-01

Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify “phenotypic signatures” by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains. PMID:25101949

Phenotypic signatures arising from unbalanced bacterial growth.

PubMed

Tan, Cheemeng; Smith, Robert Phillip; Tsai, Ming-Chi; Schwartz, Russell; You, Lingchong

2014-08-01

Fluctuations in the growth rate of a bacterial culture during unbalanced growth are generally considered undesirable in quantitative studies of bacterial physiology. Under well-controlled experimental conditions, however, these fluctuations are not random but instead reflect the interplay between intra-cellular networks underlying bacterial growth and the growth environment. Therefore, these fluctuations could be considered quantitative phenotypes of the bacteria under a specific growth condition. Here, we present a method to identify "phenotypic signatures" by time-frequency analysis of unbalanced growth curves measured with high temporal resolution. The signatures are then applied to differentiate amongst different bacterial strains or the same strain under different growth conditions, and to identify the essential architecture of the gene network underlying the observed growth dynamics. Our method has implications for both basic understanding of bacterial physiology and for the classification of bacterial strains.

Antagonistic effect of chosen lactic acid bacteria strains on Salmonella species in meat and fermented sausages.

PubMed

Gomółka-Pawlicka, M; Uradziński, J

2003-01-01

The aim of this study was to determine of influence of 15 strains of lactic acid bacteria on the growth of 7 Salmonella spp. strains in model set-ups, and in meat and ripened fermented sausages. The investigations were performed within the framework of three alternate stages which differed in respect to the products studied, the number of Lactobacillus spp. strains and, partly, methodological approach. The ratio between lactic acid bacteria and Salmonella strains studied was, depending on the alternate, 1:1, 1:2 and 2:1, respectively. The investigations also covered the water activity (a(w)) and pH of the tested products. The results obtained are shown in 12 figures and suggest that all the lactic acid bacteria strains used within the framework of the model set-ups showed antagonistic effect on all the Salmonella spp. strains. However, these abilities were not observed with respect to some lactic acid bacteria strains in meat and fermented sausage. The temperature and length of the incubation period of sausages, but not a(w) and pH, were found to have a distinct influence on the antagonistic interaction between the bacteria.

[Characterization of a bacterial biocontrol strain 1404 and its efficacy in controlling postharvest citrus anthracnose].

PubMed

Wang, Qian; Hu, Chunjin; Ke, Fanggang; Huang, Siliang; Li, Qiqin

2010-09-01

Anthracnose caused by Colletotrichum gloeosporioides (Penz.) Sacc. is a main disease in citrus production. To develop an effective biocontrol measure against citrus postharvest anthracnose, we screened antagonistic microbes and obtained a bacterial strain 1404 from the rhizospheric soil of chili plants in Nanning city, Guangxi, China. The objectives of the present study were to: (1) identify and characterize the antagonistic bacterium; and (2) to evaluate the efficacy of the antagonistic strain in controlling citrus postharvest anthracnose disease. Strain 1404 was identified by comparing its 16S rDNA sequence with related bacteria from GenBank database, as well as analyzing its morphological, physiological and biochemical characters. The antagonistic stability of the strain 1404 was determined by continuously transferring it on artificial media. The effect of the strain on suppressing citrus anthracnose at postharvest stage was tested by stab inoculation method. The 16S rDNA of strain 1404 was amplified with primers PF1 (5'-AGAGTTTGATCATGGCTCAG-3') and PR1 (5'-TACGGTTACCTTGTTACGACTT-3') and its sequence submitted to GenBank (accession number: GU361113). Strain 1404 clustered with the GenBank-derived Brevibacillus brevis strains in the 16S-rDNA-sequence-based phylogenetic tree at 100% bootstrap level. The morphological traits, physiological and biochemical characters of strain 1404 agreed with that of Brevibacillus brevis. Less change in the suppressive ability of antagonist against growth of Colletotrichum gloeosporioides was observed during four continuous transfers on artificial media. The average control efficacy of the strain was 64. 9 % against the disease 20 days after the antagonist application. Strain 1404 was identified as Brevibacillus brevis based on its morphological traits, phyiological and biochemical characters as well as 16S rDNA sequence analysis. The antagonist was approved to be a promising biocontrol agent. This is the first report of

Identification of a new steroid degrading bacterial strain H5 from the Baltic Sea and isolation of two estradiol inducible genes.

PubMed

Sang, Yingying; Xiong, Guangming; Maser, Edmund

2012-03-01

The presence of steroid hormones in the aquatic environment is potentially threatening the population dynamics of all kinds of sea animals and public health. Environmental estrogens in water have been reported to be associated with abnormal sexual development and abnormal feminizing responses in some animals. New approaches for the bioremediation of steroid hormones from the environment are therefore urgently sought. We have previously isolated a steroid degrading bacterial strain (H5) from the Baltic Sea, at Kiel, Germany. In the present investigation, 16S rRNA analysis showed that marine strain H5 belongs to the genus Vibrio, family Vibrionaceae and class Gamma-Proteobacteria. To enable identification of steroid inducible genes from bacterial strain H5, a library was constructed of H5 chromosomal DNA fragments cloned into a fluorescent reporter (pKEGFP-2). A reporter plasmid pK3α-4.6-EGFP3 containing the estrogen-inducible gene 3α-hydroxysteroid dehydrogenase/carbonyl reductase (3α-HSD/CR) from Comamonas testosteroni (C. testosteroni) was created as a positive control. Steroid induction could be detected by a microplate fluorescence reader, when the plasmids were transformed into Escherichia coli (E. coli) HB101 cells. With our meta-genomic pKEGFP-2 approach, we identified two estradiol-inducible genes from marine strain H5, which are obviously involved in steroid degradation. Sequencing of the pKEGFP-2 inserts and data base research at NCBI revealed that one gene corresponds to 3-ketosteroid-delta-1-dehydrogenase from several Mycobacterium strains, while the other showed high similarity to carboxylesterase in Sebadella termitidis and Brachyspira murdochii. Both 3-ketosteroid-delta-1-dehydrogenase and carboxylesterase are one of the first enzymes in steroid degradation. In addition, we identified a strain H5 specific DNA sequence of 480bp which allows sensitive PCR detection and quantification of strain H5 bacteria in "unknown" seawater samples. Currently, the

Characterization of rumen bacterial strains isolated from enrichments of rumen content in the presence of propolis.

PubMed

de Aguiar, Sílvia Cristina; Zeoula, Lucia Maria; do Prado, Odimari Pricila Pires; Arcuri, Pedro Braga; Forano, Evelyne

2014-11-01

Propolis presents many biological properties, including antibacterial activities, and has been proposed as an additive in ruminant nutrition. Twenty bacterial strains, previously isolated from enrichments of Brazilian cow rumen contents in the presence of different propolis extracts (LLOS), were characterized using phenotyping and 16S rRNA identification. Seven strains were assigned to Streptococcus sp., most likely S. bovis, and were all degrading starch. One amylolytic lactate-utilizing strain of Selenomonas ruminantium was also found. Two strains of Clostridium bifermentans were identified and showed proteolytic activity. Two strains were assigned to Mitsuokella jalaludinii and were saccharolytic. One strain belonged to a Bacillus species and seven strains were affiliated with Escherichia coli. All of the 20 strains were able to use many sugars, but none of them were able to degrade the polysaccharides carboxymethylcellulose and xylans. The effect of three propolis extracts (LLOS B1, C1 and C3) was tested on the in vitro growth of four representative isolates of S. bovis, E. coli, M. jalaludinii and C. bifermentans. The growth of S. bovis, E. coli and M. jalaludinii was not affected by the three propolis extracts at 1 mg ml(-1). C. bifermentans growth was completely inhibited at this LLOS concentration, but this bacterium was partially resistant at lower concentrations. LLOS C3, with the lower concentration of phenolic compounds, was a little less inhibitory than B1 and C1 on this strain.

Characterization of certain bacterial strains for potential use as starter or probiotic cultures in dairy products.

PubMed

Monteagudo-Mera, A; Caro, I; Rodríguez-Aparicio, L B; Rúa, J; Ferrero, M A; García-Armesto, M R

2011-08-01

The present work was aimed at characterizing 12 strains of lactic acid bacteria (LAB) to obtain improved potential starter or probiotic cultures that could be used for making dairy products from ewe's milk and cow's milk. Eight strains with antimicrobial properties, isolated from ewe's milk and from cheese made from ewe's and/or cow's milk, were studied. They were identified as Enterococcus faecalis (five strains), Lactococcus lactis subsp. cremoris, Leuconostoc mesenteroides, and Lactobacillus paracasei subsp. paracasei (one strain of each species). Additionally, four strains were obtained from the American Type Culture Collection: Lactobacillus casei 393 (isolated from cheese), L. lactis subsp. lactis 11454 (origin nonspecified and a producer of nisin), and two strains isolated from human feces (L. paracasei subsp. paracasei 27092 and Lactobacillus rhamnosus 53103, antibacterial agent producer). All E. faecalis strains showed at least one virulence factor (either hemolysin or gelatinase), which emphasizes the importance of these studies in this species. Both L. lactis strains and most Lactobacillus spp. were good acidifiers in ewe's milk and cow's milk at 30°C. High β-galactosidase activity, as well as aminopeptidase activities that favor the development of desirable flavors in cheese, were detected in all Lactobacillus spp. strains. Furthermore, L. rhamnosus ATCC 53103 showed α-fucosidase activity (thought to help colonization of the intestine) and lack of α-glucosidase activity (a trait considered positive for diabetic and obese humans). This last enzymatic activity was also lacking in L. lactis ATCC 11454. L. mesenteroides was the only strain D(2)-lactic acid producer. The selection of any particular strain for probiotic or dairy cultures should be performed according to the technological and/or functional abilities needed.

Strain improvement of Lactobacillus lactis for D-lactic acid production.

PubMed

Joshi, D S; Singhvi, M S; Khire, J M; Gokhale, D V

2010-04-01

Three mutants, isolated by repeated UV mutagenesis of Lactobacillus lactis NCIM 2368, produced increased D: -lactic acid concentrations. These mutants were compared with the wild type using 100 g hydrolyzed cane sugar/l in the fermentation medium. One mutant, RM2-24, produced 81 g lactic acid/l which was over three times that of the wild type. The highest D: -lactic acid (110 g/l) in batch fermentation was obtained with 150 g cane sugar/l with a 73% lactic acid yield. The mutant utilizes cellobiose efficiently, converting it into D-lactic acid suggesting the presence of cellobiase. Thus, this strain could be used to obtain D-lactic acid from cellulosic materials that are pre-hydrolyzed with cellulase.

Cellular and lipopolysaccharide fatty acid composition of the type strains of Klebsiella pneumoniae, Klebsiella oxytoca, and Klebsiella nonpathogenic species.

PubMed

Vasyurenko, Z P; Opanasenko, L S; Koval', G M; Turyanitsa, A I; Ruban, N M

2001-01-01

The cellular and lipopolysaccharide (LPS) fatty acid compositions of the type strains of Klebsiella pneumoniae, K. oxytoca, K. terrigena, K. planticola, and "K. trevisanii" were studied. The cellular fatty acids of klebsiellae were presented by straight-chain saturated and monounsaturated, cyclopropane, and hydroxy fatty acids. Hexadecanoic, methylenehexadecanoic, octadecenoic and hexadecenoic acids prevailed. The K. pneumoniae strain mainly differed from the strains of other species by two and more times lower level of dodecanoic acid in cells. Variations of cyclopropane and unsaturated fatty acid contents in cells were observed. LPS fatty acids profiles of klebsiellae mainly consisted of straight-chain saturated and hydroxy fatty acids with predominance of tetradecanoic and 3-hydroxytetradecanoic acids. LPS fatty acids profiles of K. oxytoca, K. terrigena, K. planticola, and "K. trevisanii" strains were very similar and differed from that of the K. pneumoniae strain by higher levels of dodecanoic acid (approximately 5-6 times) and absence of 2-hydroxytetradecanoic acid. The obtained data indicated more close relatedness of K. oxytoca, K. terrigena, and K. planticola and some their remoteness from K. pneumoniae.

Diverse bacterial PKS sequences derived from okadaic acid-producing dinoflagellates.

PubMed

Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S

2008-05-22

Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum.

Diverse Bacterial PKS Sequences Derived From Okadaic Acid-Producing Dinoflagellates

PubMed Central

Perez, Roberto; Liu, Li; Lopez, Jose; An, Tianying; Rein, Kathleen S.

2008-01-01

Okadaic acid (OA) and the related dinophysistoxins are isolated from dinoflagellates of the genus Prorocentrum and Dinophysis. Bacteria of the Roseobacter group have been associated with okadaic acid producing dinoflagellates and have been previously implicated in OA production. Analysis of 16S rRNA libraries reveals that Roseobacter are the most abundant bacteria associated with OA producing dinoflagellates of the genus Prorocentrum and are not found in association with non-toxic dinoflagellates. While some polyketide synthase (PKS) genes form a highly supported Prorocentrum clade, most appear to be bacterial, but unrelated to Roseobacter or Alpha-Proteobacterial PKSs or those derived from other Alveolates Karenia brevis or Crytosporidium parvum. PMID:18728765

Effect of inoculant strain and organic matter content on kinetics of 2,4-dichlorophenoxyacetic acid degradation in soil.

PubMed

Greer, L E; Shelton, D R

1992-05-01

We monitored rates of degradation of soluble and sorbed 2,4-dichlorophenoxyacetic acid (2,4-D) in low-organic-matter soil at field capacity amended with 1, 10, or 100 micrograms of 2,4-D per g of wet soil and inoculated with one of two bacterial strains (MI and 155) with similar maximum growth rates (mu max) but significantly different half-saturation growth constants (Ks). Concentrations of soluble 2,4-D were determined by analyzing samples of pore water pressed from soil, and concentrations of sorbed 2,4-D were determined by solvent extraction. Between 65 and 75% of the total 2,4-D was present in the soluble phase at equilibrium, resulting in soil solution concentrations of ca. 8, 60, and 600 micrograms of 2,4-D per ml, respectively. Soluble 2,4-D was metabolized preferentially; this was followed by degradation of both sorbed (after desorption) and soluble 2,4-D. Rates of degradation were comparable for the two strains at soil concentrations of 10 and 100 micrograms of 2,4-D per g; however, at 1 microgram/g of soil, 2,4-D was metabolized more rapidly by the strain with the lower Ks value (strain MI). We also monitored rates of biodegradation of soluble and sorbed 2,4-D in high-organic-matter soil at field capacity amended with 100 micrograms of 2,4-D per g of wet soil and inoculated with the low-Ks strain (strain MI). Ten percent of total 2,4-D was present in the soluble phase, resulting in a soil solution concentration of ca. 30 micrograms of 2,4-D per ml.(ABSTRACT TRUNCATED AT 250 WORDS)

Analysis of Growth Inhibition and Metabolism of Hydroxycinnamic Acids by Brewing and Spoilage Strains of Brettanomyces Yeast

PubMed Central

Lentz, Michael; Harris, Chad

2015-01-01

Brettanomyces yeasts are well-known as spoilage organisms in both the wine and beer industries, but also contribute important desirable characters to certain beer styles. These properties are mediated in large part by Brettanomyces’ metabolism of hydroxycinnamic acids (HCAs) present in beverage raw materials. Here we compare growth inhibition by, and metabolism of, HCAs among commercial brewing strains and spoilage strains of B. bruxellensis and B. anomalus. These properties vary widely among the different strains tested and between the HCAs analyzed. Brewing strains showed more efficient metabolism of ferulic acid over p-coumaric acid, a trait not shared among the spoilage strains. PMID:28231223

Hexavalent chromium reduction by bacterial consortia and pure strains from an alkaline industrial effluent.

PubMed

Piñón-Castillo, H A; Brito, E M S; Goñi-Urriza, M; Guyoneaud, R; Duran, R; Nevarez-Moorillon, G V; Gutiérrez-Corona, J F; Caretta, C A; Reyna-López, G E

2010-12-01

To characterize the bacterial consortia and isolates selected for their role in hexavalent chromium removal by adsorption and reduction. Bacterial consortia from industrial wastes revealed significant Cr(VI) removal after 15 days when incubated in medium M9 at pH 6·5 and 8·0. The results suggested chromium reduction. The bacterial consortia diversity (T-RFLP based on 16S rRNA gene) indicated a highest number of operational taxonomic units in an alkaline carbonate medium mimicking in situ conditions. However, incubations under such conditions revealed low Cr(VI) removal. Genomic libraries were obtained for the consortia exhibiting optimal Cr(VI) removal (M9 medium at pH 6·5 and 8·0). They revealed the dominance of 16S rRNA gene sequences related to the genera Pseudomonas/Stenotrophomonas or Enterobacter/Halomonas, respectively. Isolates related to Pseudomonas fluorescens and Enterobacter aerogenes were efficient in Cr(VI) reduction and adsorption to the biomass. Cr(VI) reduction was better at neutral pH rather than under in situ conditions (alkaline pH with carbonate). Isolated strains exhibited significant capacity for Cr(VI) reduction and adsorption. Bacterial communities from chromium-contaminated industrial wastes as well as isolates were able to remove Cr(VI). The results suggest a good potential for bioremediation of industrial wastes when optimal conditions are applied. Journal of Applied Microbiology © 2010 The Society for Applied Microbiology. No claim to Mexican Government works.

[New antibiotics produced by Bacillus subtilis strains].

PubMed

Malanicheva, I A; Kozlov, D G; Efimenko, T A; Zenkova, V A; Kastrukha, G S; Reznikova, M I; Korolev, A M; Borshchevskaia, L N; Tarasova, O D; Sineokiĭ, S P; Efremenkova, O V

2014-01-01

Two Bacillus subtilis strains isolated from the fruiting body of a basidiomycete fungus Pholiota squarrosa exhibited a broad range of antibacterial activity, including those against methicillin-resistant Staphylococcus aureus INA 00761 (MRSA) and Leuconostoc mes6nteroides VKPM B-4177 resistant to glycopep-> tide antibiotics, as well as antifungal activity. The strains were identified as belonging to the "B. subtilis" com- plex based on their morphological and physiological characteristics, as well as by sequencing of the 16S rRNA gene fragments. Both strains (INA 01085 and INA 01086) produced insignificant amounts of polyene antibiotics (hexaen and pentaen, respectively). Strain INA 01086 produced also a cyclic polypeptide antibiotic containing Asp, Gly, Leu, Pro, Tyr, Thr, Trp, and Phe, while the antibiotic of strain INA 01085 contained, apart from these, two unidentified nonproteinaceous amino acids. Both polypeptide antibiotics were new compounds efficient against gram-positive bacteria and able to override the natural bacterial antibiotic resistance.

Isolation, screening and molecular identification of novel bacterial strain removing methylene blue from water solutions

NASA Astrophysics Data System (ADS)

Kilany, Mona

2017-11-01

The potentially deleterious effects of methylene blue (MB) on human health drove the interest in its removal promptly. Bioremediation is an effective and eco friendly for removing MB. Soil bacteria were isolated and examined for their potential to remove MB. The most potent bacterial candidate was characterized and identified using 16S rRNA sequence technique. The evolutionary history of the isolate was conducted by maximum likelihood method. Some physiochemical parameters were optimized for maximum decolorization. Decolorization mechanism and microbial toxicity study of MB (100 mg/l) and by-products were investigated. Participation of heat killed bacteria in color adsorption have been investigated too. The bacterial isolate was identified as Stenotrophomonas maltophilia strain Kilany_MB 16S ribosomal RNA gene with 99% sequence similarity. The sequence was submitted to NCBI (Accession number = KU533726). Phylogeny depicted the phylogenetic relationships between 16S ribosomal RNA gene, partial sequence (1442 bp), of the isolated strain and other strains related to Stenotrophomonas maltophilia in the GenBank database. The optimal conditions were investigated to be pH 5 at 30 °C, after 24 h using 5 mg/l MB showing optimum decolorization percentage (61.3%). Microbial toxicity study demonstrated relative reduction in the toxicity of MB decolorized products on test bacteria. Mechanism of color removal was proved by both biosorption and biodegradation, where heat-killed and live cells showed 43 and 52% of decolorization, respectively, as a maximum value after 24-h incubation. It was demonstrated that the mechanism of color removal is by adsorption. Therefore, good performance of S maltophilia in MB color removal reinforces the exploitation of these bacteria in environmental clean-up and restoration of the ecosystem.

Effects of jasmonic acid, ethylene, and salicylic acid signaling on the rhizosphere bacterial community of Arabidopsis thaliana.

PubMed

Doornbos, Rogier F; Geraats, Bart P J; Kuramae, Eiko E; Van Loon, L C; Bakker, Peter A H M

2011-04-01

Systemically induced resistance is a promising strategy to control plant diseases, as it affects numerous pathogens. However, since induced resistance reduces one or both growth and activity of plant pathogens, the indigenous microflora may also be affected by an enhanced defensive state of the plant. The aim of this study was to elucidate how much the bacterial rhizosphere microflora of Arabidopsis is affected by induced systemic resistance (ISR) or systemic acquired resistance (SAR). Therefore, the bacterial microflora of wild-type plants and plants affected in their defense signaling was compared. Additionally, ISR was induced by application of methyl jasmonate and SAR by treatment with salicylic acid or benzothiadiazole. As a comparative model, we also used wild type and ethylene-insensitive tobacco. Some of the Arabidopsis genotypes affected in defense signaling showed altered numbers of culturable bacteria in their rhizospheres; however, effects were dependent on soil type. Effects of plant genotype on rhizosphere bacterial community structure could not be related to plant defense because chemical activation of ISR or SAR had no significant effects on density and structure of the rhizosphere bacterial community. These findings support the notion that control of plant diseases by elicitation of systemic resistance will not significantly affect the resident soil bacterial microflora.

Comparative Proteome Analysis of Brucella melitensis Vaccine Strain Rev 1 and a Virulent Strain, 16M

PubMed Central

Eschenbrenner, Michel; Wagner, Mary Ann; Horn, Troy A.; Kraycer, Jo Ann; Mujer, Cesar V.; Hagius, Sue; Elzer, Philip; DelVecchio, Vito G.

2002-01-01

The genus Brucella consists of bacterial pathogens that cause brucellosis, a major zoonotic disease characterized by undulant fever and neurological disorders in humans. Among the different Brucella species, Brucella melitensis is considered the most virulent. Despite successful use in animals, the vaccine strains remain infectious for humans. To understand the mechanism of virulence in B. melitensis, the proteome of vaccine strain Rev 1 was analyzed by two-dimensional gel electrophoresis and compared to that of virulent strain 16M. The two strains were grown under identical laboratory conditions. Computer-assisted analysis of the two B. melitensis proteomes revealed proteins expressed in either 16M or Rev 1, as well as up- or down-regulation of proteins specific for each of these strains. These proteins were identified by peptide mass fingerprinting. It was found that certain metabolic pathways may be deregulated in Rev 1. Expression of an immunogenic 31-kDa outer membrane protein, proteins utilized for iron acquisition, and those that play a role in sugar binding, lipid degradation, and amino acid binding was altered in Rev 1. PMID:12193611

Comparative proteome analysis of Brucella melitensis vaccine strain Rev 1 and a virulent strain, 16M.

PubMed

Eschenbrenner, Michel; Wagner, Mary Ann; Horn, Troy A; Kraycer, Jo Ann; Mujer, Cesar V; Hagius, Sue; Elzer, Philip; DelVecchio, Vito G

2002-09-01

The genus Brucella consists of bacterial pathogens that cause brucellosis, a major zoonotic disease characterized by undulant fever and neurological disorders in humans. Among the different Brucella species, Brucella melitensis is considered the most virulent. Despite successful use in animals, the vaccine strains remain infectious for humans. To understand the mechanism of virulence in B. melitensis, the proteome of vaccine strain Rev 1 was analyzed by two-dimensional gel electrophoresis and compared to that of virulent strain 16M. The two strains were grown under identical laboratory conditions. Computer-assisted analysis of the two B. melitensis proteomes revealed proteins expressed in either 16M or Rev 1, as well as up- or down-regulation of proteins specific for each of these strains. These proteins were identified by peptide mass fingerprinting. It was found that certain metabolic pathways may be deregulated in Rev 1. Expression of an immunogenic 31-kDa outer membrane protein, proteins utilized for iron acquisition, and those that play a role in sugar binding, lipid degradation, and amino acid binding was altered in Rev 1.

A panorama of bacterial inulinases: Production, purification, characterization and industrial applications.

PubMed

Singh, Ram Sarup; Chauhan, Kanika; Kennedy, John F

2017-03-01

Inulinases are important hydrolysing enzymes which specifically act on β-2, 1 linkages of inulin to produce fructose or fructooligosaccharides. Fungi, yeasts and bacteria are the potent microbial sources of inulinases. The data on bacterial inulinases is scarce as compared to other microbial sources. Inulinases yield from bacteria is very less as compared to fungal and yeast sources of inulinases. Submerged fermentation (SmF) is the method of choice for the production of inulinases from bacterial sources. Moreover, inulin is a potent substrate for the production of inulinases in SmF. Many bacterial inulinases have been reported to display magnificent environment abiding features and variability in their biophysical and biochemical properties. These properties have attracted intention of many researchers towards exploring adverse ecological niches for more distinctive inulinase producing bacterial strains. Inulinases are substantially important in current biotechnological era due to their numerous industrial applications. High fructose syrup and fructooligosaccharides are two major industrial applications of inulinases. Additionally, there are many reports on the production of various metabolites like citric acid, lactic acid, ethanol, biofuels, butanediol etc. using mixed cultures of inulinase producing organisms with other microorganisms. The present review mainly envisages inulinase producing bacterial sources, inulinase production, purification, characterization and their applications. Copyright © 2016 Elsevier B.V. All rights reserved.

Evidence of polyethylene biodegradation by bacterial strains from the guts of plastic-eating waxworms.

PubMed

Yang, Jun; Yang, Yu; Wu, Wei-Min; Zhao, Jiao; Jiang, Lei

2014-12-02

Polyethylene (PE) has been considered nonbiodegradable for decades. Although the biodegradation of PE by bacterial cultures has been occasionally described, valid evidence of PE biodegradation has remained limited in the literature. We found that waxworms, or Indian mealmoths (the larvae of Plodia interpunctella), were capable of chewing and eating PE films. Two bacterial strains capable of degrading PE were isolated from this worm's gut, Enterobacter asburiae YT1 and Bacillus sp. YP1. Over a 28-day incubation period of the two strains on PE films, viable biofilms formed, and the PE films' hydrophobicity decreased. Obvious damage, including pits and cavities (0.3-0.4 μm in depth), was observed on the surfaces of the PE films using scanning electron microscopy (SEM) and atomic force microscopy (AFM). The formation of carbonyl groups was verified using X-ray photoelectron spectroscopy (XPS) and microattenuated total reflectance/Fourier transform infrared (micro-ATR/FTIR) imaging microscope. Suspension cultures of YT1 and YP1 (10(8) cells/mL) were able to degrade approximately 6.1 ± 0.3% and 10.7 ± 0.2% of the PE films (100 mg), respectively, over a 60-day incubation period. The molecular weights of the residual PE films were lower, and the release of 12 water-soluble daughter products was also detected. The results demonstrated the presence of PE-degrading bacteria in the guts of waxworms and provided promising evidence for the biodegradation of PE in the environment.

Intraspecies Variation in the Emergence of Hyperinfectious Bacterial Strains in Nature

PubMed Central

House, John K.; Xie, Yi; Weimer, Bart C.; Sinsheimer, Robert L.; Mahan, Michael J.

2012-01-01

Salmonella is a principal health concern because of its endemic prevalence in food and water supplies, the rise in incidence of multi-drug resistant strains, and the emergence of new strains associated with increased disease severity. Insights into pathogen emergence have come from animal-passage studies wherein virulence is often increased during infection. However, these studies did not address the prospect that a select subset of strains undergo a pronounced increase in virulence during the infective process- a prospect that has significant implications for human and animal health. Our findings indicate that the capacity to become hypervirulent (100-fold decreased LD50) was much more evident in certain S. enterica strains than others. Hyperinfectious salmonellae were among the most virulent of this species; restricted to certain serotypes; and more capable of killing vaccinated animals. Such strains exhibited rapid (and rapidly reversible) switching to a less-virulent state accompanied by more competitive growth ex vivo that may contribute to maintenance in nature. The hypervirulent phenotype was associated with increased microbial pathogenicity (colonization; cytotoxin production; cytocidal activity), coupled with an altered innate immune cytokine response within infected cells (IFN-β; IL-1β; IL-6; IL-10). Gene expression analysis revealed that hyperinfectious strains display altered transcription of genes within the PhoP/PhoQ, PhoR/PhoB and ArgR regulons, conferring changes in the expression of classical virulence functions (e.g., SPI-1; SPI-2 effectors) and those involved in cellular physiology/metabolism (nutrient/acid stress). As hyperinfectious strains pose a potential risk to human and animal health, efforts toward mitigation of these potential food-borne contaminants may avert negative public health impacts and industry-associated losses. PMID:22511871

Butyric acid fermentation from pretreated and hydrolysed wheat straw by an adapted Clostridium tyrobutyricum strain.

PubMed

Baroi, G N; Baumann, I; Westermann, P; Gavala, H N

2015-09-01

Butyric acid is a valuable building-block for the production of chemicals and materials and nowadays it is produced exclusively from petroleum. The aim of this study was to develop a suitable and robust strain of Clostridium tyrobutyricum that produces butyric acid at a high yield and selectivity from lignocellulosic biomasses. Pretreated (by wet explosion) and enzymatically hydrolysed wheat straw (PHWS), rich in C6 and C5 sugars (71.6 and 55.4 g l(-1) of glucose and xylose respectively), was used as substrate. After one year of serial selections, an adapted strain of C. tyrobutyricum was developed. The adapted strain was able to grow in 80% (v v(-1) ) PHWS without addition of yeast extract compared with an initial tolerance to less than 10% PHWS and was able to ferment both glucose and xylose. It is noticeable that the adapted C. tyrobutyricum strain was characterized by a high yield and selectivity to butyric acid. Specifically, the butyric acid yield at 60-80% PHWS lie between 0.37 and 0.46 g g(-1) of sugar, while the selectivity for butyric acid was as high as 0.9-1.0 g g(-1) of acid. Moreover, the strain exhibited a robust response in regards to growth and product profile at pH 6 and 7. © 2015 The Authors. Microbial Biotechnology published by John Wiley & Sons Ltd and Society for Applied Microbiology.

Identification of thermophilic bacterial strains producing thermotolerant hydrolytic enzymes from manure compost.

PubMed

Charbonneau, David M; Meddeb-Mouelhi, Fatma; Boissinot, Maurice; Sirois, Marc; Beauregard, Marc

2012-03-01

Ten thermophilic bacterial strains were isolated from manure compost. Phylogenetic analysis based on 16S rRNA genes and biochemical characterization allowed identification of four different species belonging to four genera: Geobacillus thermodenitrificans, Bacillus smithii, Ureibacillus suwonensis and Aneurinibacillus thermoaerophilus. PCR-RFLP profiles of the 16S-ITS-23S rRNA region allowed us to distinguish two subgroups among the G. thermodenitrificans isolates. Isolates were screened for thermotolerant hydrolytic activities (60-65°C). Thermotolerant lipolytic activities were detected for G. thermodenitrificans, A. thermoaerophilus and B. smithii. Thermotolerant protease, α-amylase and xylanase activities were also observed in the G. thermodenitrificans group. These species represent a source of potential novel thermostable enzymes for industrial applications.

Analysis of Bacterial Diversity During Acetic Acid Fermentation of Tianjin Duliu Aged Vinegar by 454 Pyrosequencing.

PubMed

Peng, Qian; Yang, Yanping; Guo, Yanyun; Han, Ye

2015-08-01

The vinegar pei harbors complex bacterial communities. Prior studies revealing the bacterial diversity involved were mainly conducted by culture-dependent methods and PCR-DGGE. In this study, 454 pyrosequencing was used to investigate the bacterial communities in vinegar pei during the acetic acid fermentation (AAF) of Tianjin Duliu aged vinegar (TDAV). The results showed that there were 7 phyla and 24 families existing in the vinegar pei, with 2 phyla (Firmicutes, Protebacteria) and 4 families (Lactobacillaceae, Acetobacteracae, Enterobacteriaceae, Chloroplast) predominating. The genus-level identification revealed that 9 genera were the relatively stable, consistent components in different stages of AAF, including the most abundant genus Lactobacillus followed by Acetobacter and Serratia. Additionally, the bacterial community in the early fermentation stage was more complex than those in the later stages, indicating that the accumulation of organic acids provided an appropriate environment to filter unwanted bacteria and to accelerate the growth of required ones. This study provided basic information of bacterial patterns in vinegar pei and relevant changes during AAF of TDAV, and could be used as references in the following study on the implementation of starter culture as well as the improvement of AAF process.

Extraction of Total Nucleic Acids From Ticks for the Detection of Bacterial and Viral Pathogens

PubMed Central

Crowder, Chris D.; Rounds, Megan A.; Phillipson, Curtis A.; Picuri, John M.; Matthews, Heather E.; Halverson, Justina; Schutzer, Steven E.; Ecker, David J.; Eshoo, Mark W.

2010-01-01

Ticks harbor numerous bacterial, protozoal, and viral pathogens that can cause serious infections in humans and domestic animals. Active surveillance of the tick vector can provide insight into the frequency and distribution of important pathogens in the environment. Nucleic-acid based detection of tick-borne bacterial, protozoan, and viral pathogens requires the extraction of both DNA and RNA (total nucleic acids) from ticks. Traditional methods for nucleic acid extraction are limited to extraction of either DNA or the RNA from a sample. Here we present a simple bead-beating based protocol for extraction of DNA and RNA from a single tick and show detection of Borrelia burgdorferi and Powassan virus from individual, infected Ixodes scapularis ticks. We determined expected yields for total nucleic acids by this protocol for a variety of adult tick species. The method is applicable to a variety of arthropod vectors, including fleas and mosquitoes, and was partially automated on a liquid handling robot. PMID:20180313

Short communication: Antiproliferative effect of wild Lactobacillus strains isolated from fermented foods on HT-29 cells.

PubMed

Tuo, Y F; Zhang, L W; Yi, H X; Zhang, Y C; Zhang, W Q; Han, X; Du, M; Jiao, Y H; Wang, S M

2010-06-01

In vitro studies, animal models, epidemiology, and human intervention studies provide evidence that some lactic acid bacteria can reduce the risk of certain cancers. In this study, heat-killed bacterial cells, genomic DNA, and cell wall of 7 wild Lactobacillus strains isolated from traditional fermented foods in western China were tested in vitro for cytotoxicity on colonic cancer cell line HT-29 by using 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. The heat-killed bacterial cells, genomic DNA, and cell wall of the 7 strains exhibited direct antiproliferative activities against HT-29 cells. Among the strains, the cellular components of Lactobacillus coryniformis ssp. torquens T3L exerted marked antiproliferative activities against HT-29 cells. The maximum inhibition rates of HT-29 cells by the heat-killed bacterial cells (1x10(7) cfu/mL), cell wall (20 microg of protein/mL) and genomic DNA (100 microg/mL) of L. coryniformis ssp. torquens T3L were 30, 44.9, and 35.9%, respectively. The results indicate that the heat-killed bacterial cells, cell wall, and genomic DNA of the 7 wild Lactobacillus strains could inhibit the growth of HT-29 cells. 2010 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

BASIC study: is intravaginal boric acid non-inferior to metronidazole in symptomatic bacterial vaginosis? Study protocol for a randomized controlled trial.

PubMed

Zeron Mullins, Melinda; Trouton, Konia M

2015-07-26

Bacterial vaginosis is associated with increased transmission of sexually transmitted infections, preterm labor, post-surgical infections, and endometritis. Current treatment for symptomatic bacterial vaginosis includes antibiotics, such as metronidazole, which are 70-80 % effective at one month after treatment and result in high recurrence rates and secondary candida infections. Intravaginal boric acid has been used for over a hundred years to treat vaginal infections, such as bacterial vaginosis. Boric acid is inexpensive, accessible, and has shown to be an effective treatment for other infections, such as vaginal candidiasis. To date, there has been no clinical trial evaluation of boric acid effectiveness to treat bacterial vaginosis. The BASIC (Boric Acid, Alternate Solution for Intravaginal Colonization) trial is a randomized, double-blinded, multicenter study. The study will enroll a minimum of 240 women of 16-50 years of age who are symptomatic with bacterial vaginosis. Eligible participants will have Amsel and Nugent scores confirming bacterial vaginosis. Women who are pregnant or menopausal or have other active co-infections will be excluded. Consenting participants who meet exclusion and inclusion criteria will be randomly assigned to one of three treatment groups: boric acid, metronidazole, or an inert placebo. Self-administration of treatment intravaginally for 10 days will be followed by clinical assessment at 7 and 30 days (days 17 and 40, respectively) after the end of the treatment phase. Primary outcome is a non-inferiority, per-protocol comparison of the effectiveness of boric acid with that of metronidazole at day 17, as measured by the Nugent score in 16-50 year olds. Secondary outcomes include: non-inferiority, intention-to-treat comparison of effectiveness of boric acid with that of metronidazole at day 17, analysis for both per-protocol and intention-to-treat at day 40, and safety considerations, including adverse effects requiring patient

Complete Genome Sequence of Lactobacillus rhamnosus Strain BPL5 (CECT 8800), a Probiotic for Treatment of Bacterial Vaginosis.

PubMed

Chenoll, Empar; Codoñer, Francisco M; Martinez-Blanch, Juan F; Ramón, Daniel; Genovés, Salvador; Menabrito, Marco

2016-04-21

ITALIC! Lactobacillus rhamnosusBPL5 (CECT 8800), is a probiotic strain suitable for the treatment of bacterial vaginosis. Here, we report its complete genome sequence deciphered by PacBio single-molecule real-time (SMRT) technology. Analysis of the sequence may provide insight into its functional activity. Copyright © 2016 Chenoll et al.

Butyric acid from anaerobic fermentation of lignocellulosic biomass hydrolysates by Clostridium sp. strain RPT-4213

USDA-ARS?s Scientific Manuscript database

A novel Clostridium sp. strain RPT-4213 was found producing butyrate under strict anaerobic conditions. This strain produced 9.47 g L-1 butyric acid from MRS media (0.48 g/g glucose). RPT-4213 was also used to ferment dilute acid pretreated hydrolysates including wheat straw (WSH), corn fiber (CFH...

Mutations in y-aminobutyric acid (GABA) transaminase genes in plants or Pseudomonas syringae reduce bacterial virulence

USDA-ARS?s Scientific Manuscript database

Pseudomonas syringae pv. tomato DC3000 is a bacterial pathogen of Arabidopsis and tomato that grows in the apoplast. The non-protein amino acid '-amino butyric acid (GABA) is produced by Arabidopsis and tomato and is the most abundant amino acid in the apoplastic fluid of tomato. The DC3000 genome h...

Kinetic analysis of strains of lactic acid bacteria and acetic acid bacteria in cocoa pulp simulation media toward development of a starter culture for cocoa bean fermentation.

PubMed

Lefeber, Timothy; Janssens, Maarten; Camu, Nicholas; De Vuyst, Luc

2010-12-01

The composition of cocoa pulp simulation media (PSM) was optimized with species-specific strains of lactic acid bacteria (PSM-LAB) and acetic acid bacteria (PSM-AAB). Also, laboratory fermentations were carried out in PSM to investigate growth and metabolite production of strains of Lactobacillus plantarum and Lactobacillus fermentum and of Acetobacter pasteurianus isolated from Ghanaian cocoa bean heap fermentations, in view of the development of a defined starter culture. In a first step, a selection of strains was made out of a pool of strains of these LAB and AAB species, obtained from previous studies, based on their fermentation kinetics in PSM. Also, various concentrations of citric acid in the presence of glucose and/or fructose (PSM-LAB) and of lactic acid in the presence of ethanol (PSM-AAB) were tested. These data could explain the competitiveness of particular cocoa-specific strains, namely, L. plantarum 80 (homolactic and acid tolerant), L. fermentum 222 (heterolactic, citric acid fermenting, mannitol producing, and less acid tolerant), and A. pasteurianus 386B (ethanol and lactic acid oxidizing, acetic acid overoxidizing, acid tolerant, and moderately heat tolerant), during the natural cocoa bean fermentation process. For instance, it turned out that the capacity to use citric acid, which was exhibited by L. fermentum 222, is of the utmost importance. Also, the formation of mannitol was dependent not only on the LAB strain but also on environmental conditions. A mixture of L. plantarum 80, L. fermentum 222, and A. pasteurianus 386B can now be considered a mixed-strain starter culture for better controlled and more reliable cocoa bean fermentation processes.

A lignocellulosic hydrolysate-tolerant Aurantiochytrium sp. mutant strain for docosahexaenoic acid production.

PubMed

Qi, Feng; Zhang, Mingliang; Chen, Youwei; Jiang, Xianzhang; Lin, Jinxin; Cao, Xiao; Huang, Jianzhong

2017-03-01

To utilize lignocellulosic hydrolysate for docosahexaenoic acid (DHA) production, a novel mutant Aurantiochytrium sp. FN21 with strong tolerance against inhibitory lignocellulosic hydrolysate was obtained through continuous domestication processes from the parent strain Aurantiochytrium sp. FJU-512. Aurantiochytrium sp. FN21 can accumulate 21.3% and 30.7% more DHA compared to its parent strain cultured in fermentation medium and a medium with 50% (v/v) sugarcane bagasse hydrolysate (SBH), respectively. After optimization with different nitrogen sources, the highest lipid (11.84g/L) and DHA (3.15g/L) production were achieved in SBH. The results demonstrated that Aurantiochytrium sp. FN21 has the commercial applications for DHA production using lignocellulosic hydrolysate. In order to elucidate the tolerance mechanism, transcriptomic profiling of the two strains was studied. The highly up-regulated genes and corresponding cellular pathways (TCA cycle, amino acid biosynthesis, fatty acid metabolism and degradation of aromatic compounds) are considered to be associated with the hydrolysate-tolerance of Aurantiochytrium sp. FN21. Copyright © 2016 Elsevier Ltd. All rights reserved.

Antarctic ice core samples: culturable bacterial diversity.

PubMed

Shivaji, Sisinthy; Begum, Zareena; Shiva Nageswara Rao, Singireesu Soma; Vishnu Vardhan Reddy, Puram V; Manasa, Poorna; Sailaja, Buddi; Prathiba, Mambatta S; Thamban, Meloth; Krishnan, Kottekkatu P; Singh, Shiv M; Srinivas, Tanuku N R

2013-01-01

Culturable bacterial abundance at 11 different depths of a 50.26 m ice core from the Tallaksenvarden Nunatak, Antarctica, varied from 0.02 to 5.8 × 10(3) CFU ml(-1) of the melt water. A total of 138 bacterial strains were recovered from the 11 different depths of the ice core. Based on 16S rRNA gene sequence analyses, the 138 isolates could be categorized into 25 phylotypes belonging to phyla Actinobacteria, Bacteroidetes, Firmicutes and Proteobacteria. All isolates had 16S rRNA sequences similar to previously determined sequences (97.2-100%). No correlation was observed in the distribution of the isolates at the various depths either at the phylum, genus or species level. The 25 phylotypes varied in growth temperature range, tolerance to NaCl, growth pH range and ability to produce eight different extracellular enzymes at either 4 or 18 °C. Iso-, anteiso-, unsaturated and saturated fatty acids together constituted a significant proportion of the total fatty acid composition. Copyright © 2012 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Effects of the inoculant strain Sphingomonas paucimobilis 20006FA on soil bacterial community and biodegradation in phenanthrene-contaminated soil.

PubMed

Coppotelli, B M; Ibarrolaza, A; Del Panno, M T; Morelli, I S

2008-02-01

The effects of the inoculant strain Sphingomonas paucimobilis 20006FA (isolated from a phenanthrene-contaminated soil) on the dynamics and structure of microbial communities and phenanthrene elimination rate were studied in soil microcosms artificially contaminated with phenanthrene. The inoculant managed to be established from the first inoculation as it was evidenced by denaturing gradient gel electrophoresis analysis, increasing the number of cultivable heterotrophic and PAH-degrading cells and enhancing phenanthrene degradation. These effects were observed only during the inoculation period. Nevertheless, the soil biological activity (dehydrogenase activity and CO(2) production) showed a late increase. Whereas gradual and successive changes in bacterial community structures were caused by phenanthrene contamination, the inoculation provoked immediate, significant, and stable changes on soil bacterial community. In spite of the long-term establishment of the inoculated strain, at the end of the experiment, the bioaugmentation did not produce significant changes in the residual soil phenanthrene concentration and did not improve the residual effects on the microbial soil community.

Optimal production of 7,10-dihydroxy-8(E)-hexadecenoic acid from palmitoleic acid by Pseudomonas aeruginosa PR3.

PubMed

Bae, Jae-Han; Suh, Min-Jung; Kim, Beom-Soo; Hou, Ching T; Lee, In-Jung; Kim, In-Hwan; Kim, Hak-Ryul

2010-09-30

The hydroxylation of unsaturated fatty acids by bacterial strains is one type of value-adding bioconversion processes. This process generates new hydroxy fatty acids (HFA) carrying special properties such as higher viscosity and reactivity compared with normal fatty acids. Among microbial strains tested for HFA production, Pseudomonas aeruginosa PR3 is well known to utilize various unsaturated fatty acids to produce mono-, di- and tri-hydroxy fatty acids. Previously we reported that strain PR3 could produce a novel value-added hydroxy fatty acid 7,10-dihydroxy-8(E)-hexadecenoic acid (DHD) from palmitoleic acid (Bae et al. (2007) Appl. Microbiol. Biotechnol. 75, 435-440). In this study, we focused on the development of the optimal nutritional and environmental conditions for DHD production from palmitoleic acid by PR3. Optimal carbon and nitrogen sources for DHD production were fructose and yeast extract, respectively. Optimal initial medium pH and incubation temperature were pH 8.0 and 30 degrees C and magnesium ion was essentially required for DHD production. Substrate concentration and time of substrate addition were also optimized. Under optimized conditions, maximal DHD production was 1600mg/l representing 26.7% conversion yield. Copyright 2009 Elsevier B.V. All rights reserved.

Bile Acids Improve the Antimicrobial Effect of Rifaximin▿ †

PubMed Central

Darkoh, Charles; Lichtenberger, Lenard M.; Ajami, Nadim; Dial, Elizabeth J.; Jiang, Zhi-Dong; DuPont, Herbert L.

2010-01-01

Diarrhea is one of the most common infirmities affecting international travelers, occurring in 20 to 50% of persons from industrialized countries visiting developing regions. Enterotoxigenic Escherichia coli (ETEC) is the most common causative agent and is isolated from approximately half of the cases of traveler's diarrhea. Rifaximin, a largely water-insoluble, nonabsorbable (<0.4%) antibiotic that inhibits bacterial RNA synthesis, is approved for use for the treatment of traveler's diarrhea caused by diarrheagenic E. coli. However, the drug has minimal effect on the bacterial flora or the infecting E. coli strain in the aqueous environment of the colon. The purpose of the present study was to evaluate the antimicrobial effect and bioavailability of rifaximin in aqueous solution in the presence and absence of physiologic concentrations of bile acids. The methods used included growth measurement of ETEC (strain H10407), rifaximin solubility measurements, total bacterial protein determination, and assessment of the functional activity of rifaximin by monitoring inhibition of bacterial β-galactosidase expression. Solubility studies showed rifaximin to be 70- to 120-fold more soluble in bile acids (approximately 30% in 4 mM bile acids) than in aqueous solution. Addition of both purified bile acids and human bile to rifaximin at subinhibitory and inhibitory concentrations significantly improved the drug's anti-ETEC effect by 71% and 73%, respectively, after 4 h. This observation was confirmed by showing a decrease in the overall amount of total bacterial protein expressed during incubation of rifaximin plus bile acids. Rifaximin-treated samples containing bile acids inhibited the expression of ETEC β-galactosidase at a higher magnitude than samples that did not contain bile acids. The study provides data showing that bile acids solubilize rifaximin on a dose-response basis, increasing the drug's bioavailability and antimicrobial effect. These observations suggest

Strain Library Imaging Protocol for high-throughput, automated single-cell microscopy of large bacterial collections arrayed on multiwell plates.

PubMed

Shi, Handuo; Colavin, Alexandre; Lee, Timothy K; Huang, Kerwyn Casey

2017-02-01

Single-cell microscopy is a powerful tool for studying gene functions using strain libraries, but it suffers from throughput limitations. Here we describe the Strain Library Imaging Protocol (SLIP), which is a high-throughput, automated microscopy workflow for large strain collections that requires minimal user involvement. SLIP involves transferring arrayed bacterial cultures from multiwell plates onto large agar pads using inexpensive replicator pins and automatically imaging the resulting single cells. The acquired images are subsequently reviewed and analyzed by custom MATLAB scripts that segment single-cell contours and extract quantitative metrics. SLIP yields rich data sets on cell morphology and gene expression that illustrate the function of certain genes and the connections among strains in a library. For a library arrayed on 96-well plates, image acquisition can be completed within 4 min per plate.

Synergism between hydrogen peroxide and seventeen acids against five agri-food-borne fungi and one yeast strain.

PubMed

Martin, H; Maris, P

2012-12-01

The objective of this study was to evaluate fungicidal efficacy of hydrogen peroxide administered in combination with 17 mineral and organic acids authorized for use in the food industry. The assays were performed on a 96-well microplate using a microdilution technique based on the checkerboard titration method. The six selected strains (one yeast and five fungi) were reference strains and strains representative of contaminating fungi found in the food industry. Each synergistic hydrogen peroxide/acid combination found after fifteen minutes contact time at 20 °C in distilled water was then tested in conditions simulating four different use conditions. Twelve combinations were synergistic in distilled water, eleven of these remained synergistic with one or more of the four mineral and organic interfering substances selected. Hydrogen peroxide/formic acid combination remained effective against four strains and was never antagonistic against the other two fungi. Combinations with propionic acid and acetic acid stayed synergistic against two strains. Those with oxalic acid and lactic acid kept their synergism only against Candida albicans. No synergism was detected against Penicillium cyclopium. Synergistic combinations of disinfectants were revealed, among them the promising hydrogen peroxide/formic acid combination. A rapid screening method developed in our laboratory for bacteria was adapted to fungi and used to reveal the synergistic potential of disinfectants and/or sanitizers combinations. © 2012 The Society for Applied Microbiology.

Novel L-amino acid oxidase with algicidal activity against toxic cyanobacterium Microcystis aeruginosa synthesized by a bacterium Aquimarina sp.

PubMed

Chen, Wen Ming; Sheu, Fu Sian; Sheu, Shih Yi

2011-09-10

A brownish yellow pigmented bacterial strain, designated antisso-27, was recently isolated from a water area of saltpan in Southern Taiwan. Phylogenetic analyses based on 16S rRNA gene sequences indicate that strain antisso-27 belongs the genus Aquimarina in the family Flavobacteriacea and its only closest neighbor is Aquimarina spongiae (96.6%). Based on screening for algicidal activity, strain antisso-27 exhibits potent activity against the toxic cyanobacterium Microcystis aeruginosa. Both the strain antisso-27 bacterial culture and its culture filtrate show algicidal activity against the toxic cyanobacterium, indicating that an algicidal substance is released from strain antisso-27. The algicidal activity of strain antisso-27 occurs during the late stationary phase of bacterial growth. Strain antisso-27 can synthesize an algicidal protein with a molecular mass of 190 kDa, and its isoelectric point is approximately 9.4. This study explores the nature of this algicidal protein such as L-amino acid oxidase with broad substrate specificity. The enzyme is most active with L-leucine, L-isoleucine, L-methionine and L-valine and the hydrogen peroxide generated by its catalysis mediates algicidal activity. This is the first report on an Aquimarina strain algicidal to the toxic M. aeruginosa and the algicidal activity is generated through its enzymatic activity of L-amino acid oxidase. Copyright © 2011 Elsevier Inc. All rights reserved.

Influence of Calcium in Extracellular DNA Mediated Bacterial Aggregation and Biofilm Formation

PubMed Central

Koop, Leena; Wong, Yie Kuan; Ahmed, Safia; Siddiqui, Khawar Sohail; Manefield, Mike

2014-01-01

Calcium (Ca2+) has an important structural role in guaranteeing the integrity of the outer lipopolysaccharide layer and cell walls of bacterial cells. Extracellular DNA (eDNA) being part of the slimy matrix produced by bacteria promotes biofilm formation through enhanced structural integrity of the matrix. Here, the concurrent role of Ca2+ and eDNA in mediating bacterial aggregation and biofilm formation was studied for the first time using a variety of bacterial strains and the thermodynamics of DNA to Ca2+ binding. It was found that the eDNA concentrations under both planktonic and biofilm growth conditions were different among bacterial strains. Whilst Ca2+ had no influence on eDNA release, presence of eDNA by itself favours bacterial aggregation via attractive acid-base interactions in addition, its binding with Ca2+ at biologically relevant concentrations was shown further increase in bacterial aggregation via cationic bridging. Negative Gibbs free energy (ΔG) values in iTC data confirmed that the interaction between DNA and Ca2+ is thermodynamically favourable and that the binding process is spontaneous and exothermic owing to its highly negative enthalpy. Removal of eDNA through DNase I treatment revealed that Ca2+ alone did not enhance cell aggregation and biofilm formation. This discovery signifies the importance of eDNA and concludes that existence of eDNA on bacterial cell surfaces is a key facilitator in binding of Ca2+ to eDNA thereby mediating bacterial aggregation and biofilm formation. PMID:24651318

Glyphosate has limited short-term effects on commensal bacterial community composition in the gut environment due to sufficient aromatic amino acid levels.

PubMed

Nielsen, Lene Nørby; Roager, Henrik M; Casas, Mònica Escolà; Frandsen, Henrik L; Gosewinkel, Ulrich; Bester, Kai; Licht, Tine Rask; Hendriksen, Niels Bohse; Bahl, Martin Iain

2018-02-01

Recently, concerns have been raised that residues of glyphosate-based herbicides may interfere with the homeostasis of the intestinal bacterial community and thereby affect the health of humans or animals. The biochemical pathway for aromatic amino acid synthesis (Shikimate pathway), which is specifically inhibited by glyphosate, is shared by plants and numerous bacterial species. Several in vitro studies have shown that various groups of intestinal bacteria may be differently affected by glyphosate. Here, we present results from an animal exposure trial combining deep 16S rRNA gene sequencing of the bacterial community with liquid chromatography mass spectrometry (LC-MS) based metabolic profiling of aromatic amino acids and their downstream metabolites. We found that glyphosate as well as the commercial formulation Glyfonova ® 450 PLUS administered at up to fifty times the established European Acceptable Daily Intake (ADI = 0.5 mg/kg body weight) had very limited effects on bacterial community composition in Sprague Dawley rats during a two-week exposure trial. The effect of glyphosate on prototrophic bacterial growth was highly dependent on the availability of aromatic amino acids, suggesting that the observed limited effect on bacterial composition was due to the presence of sufficient amounts of aromatic amino acids in the intestinal environment. A strong correlation was observed between intestinal concentrations of glyphosate and intestinal pH, which may partly be explained by an observed reduction in acetic acid produced by the gut bacteria. We conclude that sufficient intestinal levels of aromatic amino acids provided by the diet alleviates the need for bacterial synthesis of aromatic amino acids and thus prevents an antimicrobial effect of glyphosate in vivo. It is however possible that the situation is different in cases of human malnutrition or in production animals. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

Molecular screening of xerophilic Aspergillus strains producing mycophenolic acid.

PubMed

Mouhamadou, Bello; Sage, Lucile; Périgon, Sophie; Séguin, Virginie; Bouchart, Valérie; Legendre, Patrick; Caillat, Mathilde; Yamouni, Hayet; Garon, David

2017-02-01

Mycophenolic acid (MPA) is the fungal secondary metabolite displaying several biological properties. Up to now, screening of fungal strains producing MPA has mainly been the result of the search of this molecule in their culture medium by chemical methods. Here we developed a molecular approach by targeting the expression level of the MpaC gene encoding the polyketide synthase, one of the key enzymes involved in the MPA synthesis. Thirty xerophilic Aspergillus strains were identified using the RNA polymerase II subunit and the β-tubulin genes. Seven Aspergillus species were evidenced. The expression level of the MpaC gene was quantified and compared to the MPA production rate. Only Aspergillus pseudoglaucus and all the eight strains of this species produced MPA. While the MpaC gene was not expressed or weakly expressed in the MPA non-producing strains, all the A. pseudoglaucus strains presented a high level of expression of this gene. The highest expression level of the MpaC gene among the MPA non-producing strains was significantly lower than the lowest expression level of this gene in the MPA producing strains. To our knowledge, this is the first study that demonstrates the effectiveness of molecular approach for the screening of MPA-producing species. Copyright © 2016 British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Biotransformation of tetracycline by a novel bacterial strain Stenotrophomonas maltophilia DT1.

PubMed

Leng, Yifei; Bao, Jianguo; Chang, Gaofeng; Zheng, Han; Li, Xingxing; Du, Jiangkun; Snow, Daniel; Li, Xu

2016-11-15

Although several abiotic processes have been reported that can transform antibiotics, little is known about whether and how microbiological processes may degrade antibiotics in the environment. This work isolated one tetracycline degrading bacterial strain, Stenotrophomonas maltophilia strain DT1, and characterized the biotransformation of tetracycline by DT1 under various environmental conditions. The biotransformation rate was the highest when the initial pH was 9 and the reaction temperature was at 30°C, and can be described using the Michaelis-Menten model under different initial tetracycline concentrations. When additional substrate was present, the substrate that caused increased biomass resulted in a decreased biotransformation rate of tetracycline. According to disk diffusion tests, the biotransformation products of tetracycline had lower antibiotic potency than the parent compound. Six possible biotransformation products were identified, and a potential biotransformation pathway was proposed that included sequential removal of N-methyl, carbonyl, and amine function groups. Results from this study can lead to better estimation of the fate and transport of antibiotics in the environment and has the potential to be utilized in designing engineering processes to remove tetracycline from water and soil. Copyright © 2016 Elsevier B.V. All rights reserved.

Modification of Norfloxacin by a Microbacterium sp. Strain Isolated from a Wastewater Treatment Plant▿

PubMed Central

Kim, Dae-Wi; Heinze, Thomas M.; Kim, Bong-Soo; Schnackenberg, Laura K.; Woodling, Kellie A.; Sutherland, John B.

2011-01-01

Antimicrobial residues found in municipal wastewater may increase selective pressure on microorganisms for development of resistance, but studies with mixed microbial cultures derived from wastewater have suggested that some bacteria are able to inactivate fluoroquinolones. Medium containing N-phenylpiperazine and inoculated with wastewater was used to enrich fluoroquinolone-modifying bacteria. One bacterial strain isolated from an enrichment culture was identified by 16S rRNA gene sequence analysis as a Microbacterium sp. similar to a plant growth-promoting bacterium, Microbacterium azadirachtae (99.70%), and a nematode pathogen, “M. nematophilum” (99.02%). During growth in medium with norfloxacin, this strain produced four metabolites, which were identified by liquid chromatography-tandem mass spectrometry (LC-MS/MS) and nuclear magnetic resonance (NMR) analyses as 8-hydroxynorfloxacin, 6-defluoro-6-hydroxynorfloxacin, desethylene norfloxacin, and N-acetylnorfloxacin. The production of the first three metabolites was enhanced by ascorbic acid and nitrate, but it was inhibited by phosphate, amino acids, mannitol, formate, and thiourea. In contrast, N-acetylnorfloxacin was most abundant in cultures supplemented with amino acids. This is the first report of defluorination and hydroxylation of a fluoroquinolone by an isolated bacterial strain. The results suggest that some bacteria may degrade fluoroquinolones in wastewater to metabolites with less antibacterial activity that could be subject to further degradation by other microorganisms. PMID:21724893

Effect of ammonium and amino acids on the growth of selected strains of Gluconobacter and Acetobacter.

PubMed

Sainz, F; Mas, A; Torija, M J

2017-02-02

Acetic acid bacteria (AAB) are a group of microorganisms highly used in the food industry. However, its use can be limited by the insufficient information known about the nutritional requirements of AAB for optimal growth. The aim of this work was to study the effects of different concentrations and sources of nitrogen on the growth of selected AAB strains and to establish which nitrogen source best encouraged their growth. Two strains of three species of AAB, Gluconobacter japonicus, Gluconobacter oxydans and Acetobacter malorum, were grown in three different media with diverse nitrogen concentrations (25, 50, 100, and 300mgN/L and 1gN/L) as a complete solution of amino acids and ammonium. With this experiment, the most favourable medium and the lowest nitrogen concentration beneficial for the growth of each strain was selected. Subsequently, under these conditions, single amino acids or ammonium were added to media individually to determine the best nitrogen sources for each AAB strain. The results showed that nitrogen requirements are highly dependent on the nitrogen source, the medium and the AAB strain. Gluconobacter strains were able to grow in the lowest nitrogen concentration tested (25mgN/L); however, one of the G. oxydans strains and both A. malorum strains required a higher concentration of nitrogen (100-300mgN/L) for optimal growth. In general, single nitrogen sources were not able to support the growth of these AAB strains as well as the complete solution of amino acids and ammonium. Copyright © 2016 Elsevier B.V. All rights reserved.

MOSAIC: an online database dedicated to the comparative genomics of bacterial strains at the intra-species level.

PubMed

Chiapello, Hélène; Gendrault, Annie; Caron, Christophe; Blum, Jérome; Petit, Marie-Agnès; El Karoui, Meriem

2008-11-27

The recent availability of complete sequences for numerous closely related bacterial genomes opens up new challenges in comparative genomics. Several methods have been developed to align complete genomes at the nucleotide level but their use and the biological interpretation of results are not straightforward. It is therefore necessary to develop new resources to access, analyze, and visualize genome comparisons. Here we present recent developments on MOSAIC, a generalist comparative bacterial genome database. This database provides the bacteriologist community with easy access to comparisons of complete bacterial genomes at the intra-species level. The strategy we developed for comparison allows us to define two types of regions in bacterial genomes: backbone segments (i.e., regions conserved in all compared strains) and variable segments (i.e., regions that are either specific to or variable in one of the aligned genomes). Definition of these segments at the nucleotide level allows precise comparative and evolutionary analyses of both coding and non-coding regions of bacterial genomes. Such work is easily performed using the MOSAIC Web interface, which allows browsing and graphical visualization of genome comparisons. The MOSAIC database now includes 493 pairwise comparisons and 35 multiple maximal comparisons representing 78 bacterial species. Genome conserved regions (backbones) and variable segments are presented in various formats for further analysis. A graphical interface allows visualization of aligned genomes and functional annotations. The MOSAIC database is available online at http://genome.jouy.inra.fr/mosaic.

Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar.

PubMed

Štornik, Aleksandra; Skok, Barbara; Trček, Janja

2016-03-01

Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S-23S rRNA gene ITS regions, we identified four different Hae III and five different Hpa II restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S-23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different Hae III and two different Hpa II restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1-5.8S rDNA‒ITS2 region as Candida ethanolica , Pichia membranifaciens and Saccharomycodes ludwigii . This study has shown for the first time that the bacterial microbiota for the industrial production of

Comparison of Cultivable Acetic Acid Bacterial Microbiota in Organic and Conventional Apple Cider Vinegar

PubMed Central

Štornik, Aleksandra; Skok, Barbara

2016-01-01

Summary Organic apple cider vinegar is produced from apples that go through very restricted treatment in orchard. During the first stage of the process, the sugars from apples are fermented by yeasts to cider. The produced ethanol is used as a substrate by acetic acid bacteria in a second separated bioprocess. In both, the organic and conventional apple cider vinegars the ethanol oxidation to acetic acid is initiated by native microbiota that survived alcohol fermentation. We compared the cultivable acetic acid bacterial microbiota in the production of organic and conventional apple cider vinegars from a smoothly running oxidation cycle of a submerged industrial process. In this way we isolated and characterized 96 bacteria from organic and 72 bacteria from conventional apple cider vinegar. Using the restriction analysis of the PCR-amplified 16S−23S rRNA gene ITS regions, we identified four different HaeIII and five different HpaII restriction profiles for bacterial isolates from organic apple cider vinegar. Each type of restriction profile was further analyzed by sequence analysis of the 16S−23S rRNA gene ITS regions, resulting in identification of the following species: Acetobacter pasteurianus (71.90%), Acetobacter ghanensis (12.50%), Komagataeibacter oboediens (9.35%) and Komagataeibacter saccharivorans (6.25%). Using the same analytical approach in conventional apple cider vinegar, we identified only two different HaeIII and two different HpaII restriction profiles of the 16S‒23S rRNA gene ITS regions, which belong to the species Acetobacter pasteurianus (66.70%) and Komagataeibacter oboediens (33.30%). Yeasts that are able to resist 30 g/L of acetic acid were isolated from the acetic acid production phase and further identified by sequence analysis of the ITS1−5.8S rDNA‒ITS2 region as Candida ethanolica, Pichia membranifaciens and Saccharomycodes ludwigii. This study has shown for the first time that the bacterial microbiota for the industrial

Effect of inoculant strain and organic matter content on kinetics of 2,4-dichlorophenoxyacetic acid degradation in soil.

PubMed Central

Greer, L E; Shelton, D R

1992-01-01

We monitored rates of degradation of soluble and sorbed 2,4-dichlorophenoxyacetic acid (2,4-D) in low-organic-matter soil at field capacity amended with 1, 10, or 100 micrograms of 2,4-D per g of wet soil and inoculated with one of two bacterial strains (MI and 155) with similar maximum growth rates (mu max) but significantly different half-saturation growth constants (Ks). Concentrations of soluble 2,4-D were determined by analyzing samples of pore water pressed from soil, and concentrations of sorbed 2,4-D were determined by solvent extraction. Between 65 and 75% of the total 2,4-D was present in the soluble phase at equilibrium, resulting in soil solution concentrations of ca. 8, 60, and 600 micrograms of 2,4-D per ml, respectively. Soluble 2,4-D was metabolized preferentially; this was followed by degradation of both sorbed (after desorption) and soluble 2,4-D. Rates of degradation were comparable for the two strains at soil concentrations of 10 and 100 micrograms of 2,4-D per g; however, at 1 microgram/g of soil, 2,4-D was metabolized more rapidly by the strain with the lower Ks value (strain MI). We also monitored rates of biodegradation of soluble and sorbed 2,4-D in high-organic-matter soil at field capacity amended with 100 micrograms of 2,4-D per g of wet soil and inoculated with the low-Ks strain (strain MI). Ten percent of total 2,4-D was present in the soluble phase, resulting in a soil solution concentration of ca. 30 micrograms of 2,4-D per ml.(ABSTRACT TRUNCATED AT 250 WORDS) PMID:1622212

Organophosphonates utilization by soil strains of Ochrobactrum anthropi and Achromobacter sp.

PubMed

Ermakova, Inna T; Shushkova, Tatyana V; Sviridov, Alexey V; Zelenkova, Nina F; Vinokurova, Natalya G; Baskunov, Boris P; Leontievsky, Alexey A

2017-07-01

Four bacterial strains from glyphosate- or alkylphosphonates-contaminated soils were tested for ability to utilize different organophosphonates. All studied strains readily utilized methylphosphonic acid and a number of other phosphonates, but differed in their ability to degrade glyphosate. Only strains Ochrobactrum anthropi GPK 3 and Achromobacter sp. Kg 16 utilized this compound after isolation from enrichment cultures with glyphosate. Achromobacter sp. MPK 7 from the same enrichment culture, similar to Achromobacter sp. MPS 12 from methylphosphonate-polluted source, required adaptation to growth on GP. Studied strains varied significantly in their growth parameters, efficiency of phosphonates degradation and characteristic products of this process, as well as in their energy metabolism. These differences give grounds to propose a possible model of interaction between these strains in microbial consortium in phosphonate-contaminated soils.

Production and purification of anti-bacterial biometabolite from wild-type Lactobacillus, isolated from fermented bamboo shoot: future suggestions and a proposed system for secondary metabolite onsite recovery during continuous fermentation.

PubMed

Badwaik, Laxmikant S; Borah, Pallab Kumar; Deka, Sankar C

2015-02-01

Wild-type lactobacillus isolated form Khorisa, a fermented bamboo shoot product of Assam, India were evaluated for production anti-bacterial secondary biometabolites, against Staphylococcus aureus. Submerged fermentation technique was used for the production of secondary anti-microbial biometabolite by a single wild-type lactobacillus strain, which tested positive for the release of anti-bacterial factor(s). Crude cell-free supernatant was obtained, followed by extraction in water-immiscible solvents viz., chloroform, hexane, petroleum ether. Chloroform extract of cell-free crude supernatant showed maximum yield (0.054 g/ml) and inhibited all indicator bacterial strains viz., Escherichia coli, Staphylococcus aureus, and Bacillus cereus. Yields of hexane and petroleum ether extract were 0.052 and 0.026 g/ml, respectively. Minimum lethal dose concentration assay of the chloroform extract showed LDmin values at 27, 1.68, and 1.68 mg/ml for E. coli, S. aureus, and B. cereus, respectively. Kill time for all the indicator bacterial strains were less than 12 h. The efficacy of the anti-bacterial substance seemed to depend on the presence of organic acids, particularly lactic acid. Conceptual-based suggestion for the development of an onsite secondary metabolites recovery system during continuous fermentation has also been attempted.

Enantioselective degradation of ofloxacin and levofloxacin by the bacterial strains Labrys portucalensis F11 and Rhodococcus sp. FP1.

PubMed

Maia, Alexandra S; Tiritan, Maria Elizabeth; Castro, Paula M L

2018-07-15

Fluoroquinolones are a class of antibiotics widely prescribed in both human and veterinary medicine of high environmental concern and characterized as environmental micropollutants due to their ecotoxicity and persistence and antibacterial resistance potential. Ofloxacin and levofloxacin are chiral fluoroquinolones commercialized as racemate and in enantiomerically pure form, respectively. Since the pharmacological properties and toxicity of the enantiomers may be very different, understanding the stereochemistry of these compounds should be a priority in environmental monitoring. This work presents the biodegradation of racemic ofloxacin and its (S)-enantiomer levofloxacin by the bacterial strains Labrys portucalensis F11 and Rhodococcus sp. FP1 at a laboratory-scale microcosm following the removal and the behavior of the enantiomers. Strain F11 could degrade both antibiotics almost completely when acetate was supplied regularly to the cultures. Enrichment of the (R)-enantiomer was observed in FP1 and F11 cultures supplied with ofloxacin. Racemization was observed in the biodegradation of the pure (S)-ofloxacin (levofloxacin) by strain F11, which was confirmed by liquid chromatography - exact mass spectrometry. Biodegradation of ofloxacin at 450 µg L -1 by both bacterial strains expressed good linear fits (R 2 > 0.98) according to the Rayleigh equation. The enantiomeric enrichment factors were comprised between - 22.5% to - 9.1%, and - 18.7% to - 9.0% in the biodegradation of ofloxacin by strains F11 and FP1, respectively, with no significant differences for the two bacteria under the same conditions. This is the first time that enantioselective biodegradation of ofloxacin and levofloxacin by single bacteria is reported. Copyright © 2018 Elsevier Inc. All rights reserved.

Kinetic Analysis of Strains of Lactic Acid Bacteria and Acetic Acid Bacteria in Cocoa Pulp Simulation Media toward Development of a Starter Culture for Cocoa Bean Fermentation ▿

PubMed Central

Lefeber, Timothy; Janssens, Maarten; Camu, Nicholas; De Vuyst, Luc

2010-01-01

The composition of cocoa pulp simulation media (PSM) was optimized with species-specific strains of lactic acid bacteria (PSM-LAB) and acetic acid bacteria (PSM-AAB). Also, laboratory fermentations were carried out in PSM to investigate growth and metabolite production of strains of Lactobacillus plantarum and Lactobacillus fermentum and of Acetobacter pasteurianus isolated from Ghanaian cocoa bean heap fermentations, in view of the development of a defined starter culture. In a first step, a selection of strains was made out of a pool of strains of these LAB and AAB species, obtained from previous studies, based on their fermentation kinetics in PSM. Also, various concentrations of citric acid in the presence of glucose and/or fructose (PSM-LAB) and of lactic acid in the presence of ethanol (PSM-AAB) were tested. These data could explain the competitiveness of particular cocoa-specific strains, namely, L. plantarum 80 (homolactic and acid tolerant), L. fermentum 222 (heterolactic, citric acid fermenting, mannitol producing, and less acid tolerant), and A. pasteurianus 386B (ethanol and lactic acid oxidizing, acetic acid overoxidizing, acid tolerant, and moderately heat tolerant), during the natural cocoa bean fermentation process. For instance, it turned out that the capacity to use citric acid, which was exhibited by L. fermentum 222, is of the utmost importance. Also, the formation of mannitol was dependent not only on the LAB strain but also on environmental conditions. A mixture of L. plantarum 80, L. fermentum 222, and A. pasteurianus 386B can now be considered a mixed-strain starter culture for better controlled and more reliable cocoa bean fermentation processes. PMID:20889778

Bacterial conversion of phenylalanine and aromatic carboxylic acids into dihydrodiols.

PubMed Central

Wegst, W; Tittmann, U; Eberspächer, J; Lingens, F

1981-01-01

Strain E of chloridazon-degrading bacteria, when grown on L-phenylalanine accumulates cis-2,3-dihydro-2,3-dihydroxyphenylalanine. In experiments with resting cells and during growth the bacterium converts the aromatic carboxylic acids phenylacetate, phenylpropionate, phenylbutyrate and phenyl-lactate into the corresponding cis-2,3-dihydrodiol compounds. The amino acids L-phenylalanine, N-acetyl-L-phenylalanine and t-butyloxycarbonyl-L-phenylalanine were also transformed into dihydrodiols. All seven dihydrodiols, thus obtained, were characterized both by conventional analytical techniques and by the ability to serve as substrates for a cis-dihydrodiol dehydrogenase. PMID:7306016

Antimicrobial activity of gallic acid against thermophilic Campylobacter is strain specific and associated with a loss of calcium ions.

PubMed

Sarjit, Amreeta; Wang, Yi; Dykes, Gary A

2015-04-01

Gallic acid has been suggested as a potential antimicrobial for the control of Campylobacter but its effectiveness is poorly studied. The minimum inhibitory concentration (MIC) and minimum bactericidal concentration (MBC) of gallic acid against Campylobacter jejuni (n = 8) and Campylobacter coli (n = 4) strains was determined. Gallic acid inhibited the growth of five C. jejuni strains and three C. coli strains (MIC: 15.63-250 μg mL(-1)). Gallic acid was only bactericidal to two C. coli strains (MBC: 125 and 62.5 μg mL(-1)). The mechanism of the bactericidal effect against these two strains (and selected non-susceptible controls) was investigated by determining decimal reduction times and by monitoring the loss of cellular content and calcium ions, and changes in cell morphology. Gallic acid did not result in a loss of cellular content or morphological changes in the susceptible strains as compared to the controls. Gallic acid resulted in a loss of calcium ions (0.58-1.53 μg mL(-1) and 0.54-1.17 μg mL(-1), respectively, over a 180 min period) from the susceptible strains but not the controls. Gallic acid is unlikely to be an effective antimicrobial against Campylobacter in a practical sense unless further interventions to ensure an effective bactericidal mode of action against all strains are developed. Copyright © 2014 Elsevier Ltd. All rights reserved.

Effects of bacterial direct-fed microbials on ruminal characteristics, methane emission, and milk fatty acid composition in cows fed high- or low-starch diets.

PubMed

Philippeau, C; Lettat, A; Martin, C; Silberberg, M; Morgavi, D P; Ferlay, A; Berger, C; Nozière, P

2017-04-01

This study investigated the effects of bacterial direct-fed microbials (DFM) on ruminal fermentation and microbial characteristics, methane (CH 4 ) emission, diet digestibility, and milk fatty acid (FA) composition in dairy cows fed diets formulated to induce different ruminal volatile fatty acid (VFA) profiles. Eight ruminally cannulated dairy cows were divided into 2 groups based on parity, days in milk, milk production, and body weight. Cows in each group were fed either a high-starch (38%, HS) or a low-starch (2%, LS) diet in a 55:45 forage-to-concentrate ratio on a dry matter (DM) basis. For each diet, cows were randomly assigned to 1 of 4 treatments in a Latin square design of (1) control (CON); (2) Propionibacterium P63 (P63); (3) P63 plus Lactobacillus plantarum 115 (P63+Lp); (4) P63 plus Lactobacillus rhamnosus 32 (P63+Lr). Strains of DFM were administered at 10 10 cfu/d. Methane emission (using the sulfur hexafluoride tracer technique), total-tract digestibility, dry matter intake, and milk production and composition were quantified in wk 3. Ruminal fermentation and microbial characteristics were measured in wk 4. Data were analyzed using the mixed procedure of SAS (SAS Institute Inc., Cary, NC). The 2 diets induced different ruminal VFA profiles, with a greater proportion of propionate at the expense of acetate and butyrate for the HS diet. Greater concentrations of total bacteria and selected bacterial species of methanogenic Archaea were reported for the HS diet, whereas the protozoa concentration in HS decreased. For both diets, bacterial DFM supplementation raised ruminal pH (+0.18 pH units, on average) compared with CON. Irrespective of diet, P63+Lp and P63+Lr increased ruminal cellulase activity (3.8-fold, on average) compared with CON, but this effect was not associated with variations in ruminal microbial numbers. Irrespective of diet, no effect of bacterial DFM on ruminal VFA was observed. For the LS diet, supplementing cows with P63+Lr tended

Bacterial dynamics and metabolite changes in solid-state acetic acid fermentation of Shanxi aged vinegar.

PubMed

Li, Sha; Li, Pan; Liu, Xiong; Luo, Lixin; Lin, Weifeng

2016-05-01

Solid-state acetic acid fermentation (AAF), a natural or semi-controlled fermentation process driven by reproducible microbial communities, is an important technique to produce traditional Chinese cereal vinegars. Highly complex microbial communities and metabolites are involved in traditional Chinese solid-state AAF, but the association between microbiota and metabolites during this process are still poorly understood. In this study, we performed amplicon 16S rRNA gene sequencing on the Illumina MiSeq platform, PCR-denaturing gradient gel electrophoresis, and metabolite analysis to trace the bacterial dynamics and metabolite changes under AAF process. A succession of bacterial assemblages was observed during the AAF process. Lactobacillales dominated all the stages. However, Acetobacter species in Rhodospirillales were considerably accelerated during AAF until the end of fermentation. Quantitative PCR results indicated that the biomass of total bacteria showed a "system microbe self-domestication" process in the first 3 days, and then peaked at the seventh day before gradually decreasing until the end of AAF. Moreover, a total of 88 metabolites, including 8 organic acids, 16 free amino acids, and 66 aroma compounds were detected during AAF. Principal component analysis and cluster analyses revealed the high correlation between the dynamics of bacterial community and metabolites.

Comparison of Lactobacillus crispatus isolates from Lactobacillus-dominated vaginal microbiomes with isolates from microbiomes containing bacterial vaginosis-associated bacteria

PubMed Central

Abdelmaksoud, Abdallah A.; Koparde, Vishal N.; Sheth, Nihar U.; Serrano, Myrna G.; Glascock, Abigail L.; Fettweis, Jennifer M.; Strauss, Jerome F.; Buck, Gregory A.

2016-01-01

Vaginal lactobacilli can inhibit colonization by and growth of other bacteria, thereby preventing development of bacterial vaginosis (BV). Amongst the lactobacilli, Lactobacillus crispatus appears to be particularly effective at inhibiting growth of BV-associated bacteria. Nonetheless, some women who are colonized with this species can still develop clinical BV. Therefore, we sought to determine whether strains of L. crispatus that colonize women with lactobacilli-dominated vaginal microbiomes are distinct from strains that colonize women who develop BV. The genomes of L. crispatus isolates from four women with lactobacilli-dominated vaginal microbiomes ( < 1 % 16S rRNA reads above threshold from genera other than Lactobacillus) and four women with microbiomes containing BV-associated bacteria (>12 % 16S rRNA reads from bacterial taxa associated with BV) were sequenced and compared. Lactic acid production by the different strains was quantified. Phage induction in the strains was also analysed. There was considerable genetic diversity between strains, and several genes were exclusive to either the strains from Lactobacillus-dominated microbiomes or those containing BV-associated bacteria. Overall, strains from microbiomes dominated by lactobacilli did not differ from strains from microbiomes containing BV-associated bacteria with respect to lactic acid production. All of the strains contained multiple phage, but there was no clear distinction between the presence or absence of BV-associated bacteria with respect to phage-induced lysis. Genes found to be exclusive to the Lactobacillus-dominated versus BV-associated bacteria-containing microbiomes could play a role in the maintenance of vaginal health and the development of BV, respectively. PMID:26747455

Comparison of Lactobacillus crispatus isolates from Lactobacillus-dominated vaginal microbiomes with isolates from microbiomes containing bacterial vaginosis-associated bacteria.

PubMed

Abdelmaksoud, Abdallah A; Koparde, Vishal N; Sheth, Nihar U; Serrano, Myrna G; Glascock, Abigail L; Fettweis, Jennifer M; Strauss, Jerome F; Buck, Gregory A; Jefferson, Kimberly K

2016-03-01

Vaginal lactobacilli can inhibit colonization by and growth of other bacteria, thereby preventing development of bacterial vaginosis (BV). Amongst the lactobacilli, Lactobacillus crispatus appears to be particularly effective at inhibiting growth of BV-associated bacteria. Nonetheless, some women who are colonized with this species can still develop clinical BV. Therefore, we sought to determine whether strains of L. crispatus that colonize women with lactobacilli-dominated vaginal microbiomes are distinct from strains that colonize women who develop BV. The genomes of L. crispatus isolates from four women with lactobacilli-dominated vaginal microbiomes ( <1% 16S rRNA reads above threshold from genera other than Lactobacillus) and four women with microbiomes containing BV-associated bacteria (>12% 16S rRNA reads from bacterial taxa associated with BV) were sequenced and compared. Lactic acid production by the different strains was quantified. Phage induction in the strains was also analysed. There was considerable genetic diversity between strains, and several genes were exclusive to either the strains from Lactobacillus-dominated microbiomes or those containing BV-associated bacteria. Overall, strains from microbiomes dominated by lactobacilli did not differ from strains from microbiomes containing BV-associated bacteria with respect to lactic acid production. All of the strains contained multiple phage, but there was no clear distinction between the presence or absence of BV-associated bacteria with respect to phage-induced lysis. Genes found to be exclusive to the Lactobacillus-dominated versus BV-associated bacteria-containing microbiomes could play a role in the maintenance of vaginal health and the development of BV, respectively.

Interactions of organic acids with Salmonella strains from feedlot water-sprinkled cattle

USDA-ARS?s Scientific Manuscript database

Organic acids are commonly used as a carcass wash to remove bacteria during food production. In this study, the interactions of four organic acids with 145 Salmonella strains comprised of six different serovars from feedlot water-sprinkled cattle were studied. The pH was determined at the molar MI...

Fate of acid-resistant and non-acid resistant Shiga toxin-producing Escherichia coli strains in experimentally contaminated French fermented raw meat sausages.

PubMed

Montet, M P; Christieans, S; Thevenot, D; Coppet, V; Ganet, S; Muller, M L Delignette; Dunière, L; Miszczycha, S; Vernozy-Rozand, C

2009-02-28

Both pathogenic and nonpathogenic E. coli exhibit a stress response to sublethal environmental stresses. Several studies have reported acid tolerance and survival characteristics of E. coli O157:H7 in foodstuffs, but there are few reports about the tolerance of non-O157 serogroups (STEC) to organic acids in foods. The purpose of this study was to examine the effect of the manufacturing process of French fermented raw meat sausages on the growth and survival of acid-resistant (AR) and non-acid resistant (NAR) STEC strains. The six strains, 3 AR and 3 NAR, were inoculated separately into raw sausage mixture at a level of 10(4)-10(5) CFU/g. A total of 19 batches of sausages were manufactured. A rapid and similar decrease in the number of both AR and NAR STEC strains, from less than 1 to 1.5 log(10) CFU/g, was observed during the first 5 days of fermentation at 20-24 degrees C. This rapid decrease was followed by a more gradual but continuous decrease in STEC counts after drying at 13-14 degrees C, up to day 35. The STEC counts were <10 CFU/g after 35 days for the NAR strains and the same concentration for the AR strains on the best before date (day 60). It was not possible to detect any NAR STEC after 60 days. The present study shows that the process used in the manufacture of French sausages results in a complete destruction of NAR STEC strains after 60 days, but it does not have the same effect on the AR STEC strains.

Synergistic Degradation of Linuron by a Bacterial Consortium and Isolation of a Single Linuron-Degrading Variovorax Strain

PubMed Central

Dejonghe, Winnie; Berteloot, Ellen; Goris, Johan; Boon, Nico; Crul, Katrien; Maertens, Siska; Höfte, Monica; De Vos, Paul; Verstraete, Willy; Top, Eva M.

2003-01-01

The bacterial community composition of a linuron-degrading enrichment culture and the role of the individual strains in linuron degradation have been determined by a combination of methods, such as denaturing gradient gel electrophoresis of the total 16S rRNA gene pool, isolation and identification of strains, and biodegradation assays. Three strains, Variovorax sp. strain WDL1, Delftia acidovorans WDL34, and Pseudomonas sp. strain WDL5, were isolated directly from the linuron-degrading culture. In addition, subculture of this enrichment culture on potential intermediates in the degradation pathway of linuron (i.e., N,O-dimethylhydroxylamine and 3-chloroaniline) resulted in the isolation of, respectively, Hyphomicrobium sulfonivorans WDL6 and Comamonas testosteroni WDL7. Of these five strains, only Variovorax sp. strain WDL1 was able to use linuron as the sole source of C, N, and energy. WDL1 first converted linuron to 3,4-dichloroaniline (3,4-DCA), which transiently accumulated in the medium but was subsequently degraded. To the best of our knowledge, this is the first report of a strain that degrades linuron further than the aromatic intermediates. Interestingly, the rate of linuron degradation by strain WDL1 was lower than that for the consortium, but was clearly increased when WDL1 was coinoculated with each of the other four strains. D. acidovorans WDL34 and C. testosteroni WDL7 were found to be responsible for degradation of the intermediate 3,4-DCA, and H. sulfonivorans WDL6 was the only strain able to degrade N,O-dimethylhydroxylamine. The role of Pseudomonas sp. strain WDL5 needs to be further elucidated. The degradation of linuron can thus be performed by a single isolate, Variovorax sp. strain WDL1, but is stimulated by a synergistic interaction with the other strains isolated from the same linuron-degrading culture. PMID:12620840

Resistance and inactivation kinetics of bacterial strains isolated from the non-chlorinated and chlorinated effluents of a WWTP.

PubMed

Martínez-Hernández, Sylvia; Vázquez-Rodríguez, Gabriela A; Beltrán-Hernández, Rosa I; Prieto-García, Francisco; Miranda-López, José M; Franco-Abuín, Carlos M; Álvarez-Hernández, Alejandro; Iturbe, Ulises; Coronel-Olivares, Claudia

2013-08-06

The microbiological quality of water from a wastewater treatment plant that uses sodium hypochlorite as a disinfectant was assessed. Mesophilic aerobic bacteria were not removed efficiently. This fact allowed for the isolation of several bacterial strains from the effluents. Molecular identification indicated that the strains were related to Aeromonas hydrophila, Escherichia coli (three strains), Enterobacter cloacae, Kluyvera cryocrescens (three strains), Kluyvera intermedia, Citrobacter freundii (two strains), Bacillus sp. and Enterobacter sp. The first five strains, which were isolated from the non-chlorinated effluent, were used to test resistance to chlorine disinfection using three sets of variables: disinfectant concentration (8, 20 and 30 mg·L(-1)), contact time (0, 15 and 30 min) and water temperature (20, 25 and 30 °C). The results demonstrated that the strains have independent responses to experimental conditions and that the most efficient treatment was an 8 mg·L(-1) dose of disinfectant at a temperature of 20 °C for 30 min. The other eight strains, which were isolated from the chlorinated effluent, were used to analyze inactivation kinetics using the disinfectant at a dose of 15 mg·L(-1) with various retention times (0, 10, 20, 30, 60 and 90 min). The results indicated that during the inactivation process, there was no relationship between removal percentage and retention time and that the strains have no common response to the treatments.

Improving itaconic acid production through genetic engineering of an industrial Aspergillus terreus strain.

PubMed

Huang, Xuenian; Lu, Xuefeng; Li, Yueming; Li, Xia; Li, Jian-Jun

2014-08-11

Itaconic acid, which has been declared to be one of the most promising and flexible building blocks, is currently used as monomer or co-monomer in the polymer industry, and produced commercially by Aspergillus terreus. However, the production level of itaconic acid hasn't been improved in the past 40 years, and mutagenesis is still the main strategy to improve itaconate productivity. The genetic engineering approach hasn't been applied in industrial A. terreus strains to increase itaconic acid production. In this study, the genes closely related to itaconic acid production, including cadA, mfsA, mttA, ATEG_09969, gpdA, ATEG_01954, acoA, mt-pfkA and citA, were identified and overexpressed in an industrial A. terreus strain respectively. Overexpression of the genes cadA (cis-aconitate decarboxylase) and mfsA (Major Facilitator Superfamily Transporter) enhanced the itaconate production level by 9.4% and 5.1% in shake flasks respectively. Overexpression of other genes showed varied effects on itaconate production. The titers of other organic acids were affected by the introduced genes to different extent. Itaconic acid production could be improved through genetic engineering of the industrially used A. terreus strain. We have identified some important genes such as cadA and mfsA, whose overexpression led to the increased itaconate productivity, and successfully developed a strategy to establish a highly efficient microbial cell factory for itaconate protuction. Our results will provide a guide for further enhancement of the itaconic acid production level through genetic engineering in future.

Lactic acid production from xylose by Geobacillus stearothermophilus strain 15

NASA Astrophysics Data System (ADS)

Kunasundari, B.; Naresh, S.; Chu, J. E.

2017-09-01

Lactic acid is an important compound with a wide range of industrial applications. The present study tested the efficiency of xylose, as a sole carbon source to be converted to lactic acid by Geobacillus stearothermophilus strain 15. To the best of our knowledge, limited information is available on the directed fermentation of xylose to lactic acid by this bacterium. The effects of different parameters such as temperature, pH, incubation time, agitation speed, concentrations of nitrogen and carbon sources on the lactic acid production were investigated statistically. It was found that the bacterium exhibited poor assimilation of xylose to lactic acid. Temperature, agitation rate and incubation time were determined to improve the lactic acid production slightly. The highest lactic acid yield obtained was 8.9% at 45°C, 300 RPM, 96 h, pH of 6.0 with carbon and nitrogen source concentrations were fixed at 5% w/v.

Compatible bacterial mixture, tolerant to desiccation, improves maize plant growth.

PubMed

Molina-Romero, Dalia; Baez, Antonino; Quintero-Hernández, Verónica; Castañeda-Lucio, Miguel; Fuentes-Ramírez, Luis Ernesto; Bustillos-Cristales, María Del Rocío; Rodríguez-Andrade, Osvaldo; Morales-García, Yolanda Elizabeth; Munive, Antonio; Muñoz-Rojas, Jesús

2017-01-01

Plant growth-promoting rhizobacteria (PGPR) increase plant growth and crop productivity. The inoculation of plants with a bacterial mixture (consortium) apparently provides greater benefits to plant growth than inoculation with a single bacterial strain. In the present work, a bacterial consortium was formulated containing four compatible and desiccation-tolerant strains with potential as PGPR. The formulation had one moderately (Pseudomonas putida KT2440) and three highly desiccation-tolerant (Sphingomonas sp. OF178, Azospirillum brasilense Sp7 and Acinetobacter sp. EMM02) strains. The four bacterial strains were able to adhere to seeds and colonize the rhizosphere of plants when applied in both mono-inoculation and multi-inoculation treatments, showing that they can also coexist without antagonistic effects in association with plants. The effects of the bacterial consortium on the growth of blue maize were evaluated. Seeds inoculated with either individual bacterial strains or the bacterial consortium were subjected to two experimental conditions before sowing: normal hydration or desiccation. In general, inoculation with the bacterial consortium increased the shoot and root dry weight, plant height and plant diameter compared to the non-inoculated control or mono-inoculation treatments. The bacterial consortium formulated in this work had greater benefits for blue maize plants even when the inoculated seeds underwent desiccation stress before germination, making this formulation attractive for future field applications.

Compatible bacterial mixture, tolerant to desiccation, improves maize plant growth

PubMed Central

Molina-Romero, Dalia; Baez, Antonino; Quintero-Hernández, Verónica; Castañeda-Lucio, Miguel; Fuentes-Ramírez, Luis Ernesto; Bustillos-Cristales, María del Rocío; Rodríguez-Andrade, Osvaldo; Morales-García, Yolanda Elizabeth; Munive, Antonio

2017-01-01

Plant growth-promoting rhizobacteria (PGPR) increase plant growth and crop productivity. The inoculation of plants with a bacterial mixture (consortium) apparently provides greater benefits to plant growth than inoculation with a single bacterial strain. In the present work, a bacterial consortium was formulated containing four compatible and desiccation-tolerant strains with potential as PGPR. The formulation had one moderately (Pseudomonas putida KT2440) and three highly desiccation-tolerant (Sphingomonas sp. OF178, Azospirillum brasilense Sp7 and Acinetobacter sp. EMM02) strains. The four bacterial strains were able to adhere to seeds and colonize the rhizosphere of plants when applied in both mono-inoculation and multi-inoculation treatments, showing that they can also coexist without antagonistic effects in association with plants. The effects of the bacterial consortium on the growth of blue maize were evaluated. Seeds inoculated with either individual bacterial strains or the bacterial consortium were subjected to two experimental conditions before sowing: normal hydration or desiccation. In general, inoculation with the bacterial consortium increased the shoot and root dry weight, plant height and plant diameter compared to the non-inoculated control or mono-inoculation treatments. The bacterial consortium formulated in this work had greater benefits for blue maize plants even when the inoculated seeds underwent desiccation stress before germination, making this formulation attractive for future field applications. PMID:29117218

Structural Characterisation of FabG from Yersinia pestis, a Key Component of Bacterial Fatty Acid Synthesis.

PubMed

Nanson, Jeffrey D; Forwood, Jade K

2015-01-01

Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.

Functional Characterization of Probiotic Potential of Novel Pigmented Bacterial Strains for Aquaculture Applications.

PubMed

Jinendiran, Sekar; Boopathi, Seenivasan; Sivakumar, Natesan; Selvakumar, Gopal

2017-11-27

The bioprospecting proficient of novel pigmented probiotic strains with respect to aquaculture industry was unexplored hitherto. In this study, we investigated the probiotic potential of novel pigmented bacterial strains isolated from the indigenous soil sediments in their vicinal habitats, which were screened for their antimicrobial activity against aquatic pathogens using agar well diffusion assay. The strains namely Exiguobacterium acetylicum (S01), Aeromonas veronii (V03), and Chryseobacterium joostei (V04) were phenotypically identified and confirmed by 16S rRNA gene sequence analysis. Further characterization revealed that strains S01 and V03 survive relatively in lower pH and higher bile salt concentrations and possess good adherence ability and broad-spectrum antibiotic susceptibility. The isolate S01 exhibited the higher adhesion ability to hydrocarbons (82%) and mannose-specific adhesion (msa) gene expression. Additionally, the probiotic effects were evaluated in Artemia nauplii fed with algae supplemented with S01, V03, and V04 strains (2.7 × 10 7  cfu/mL) for 3 days under axenic environment. We observed a significant increase (p < 0.05) in the survival rate of Artemia nauplii treated with S01 (83 ± 5%) and V03 (55 ± 5%), whereas the survival rate was only 30 ± 0% in the untreated group. Moreover, the individual length (IL) was increased in treated group S01 (156.7 ± 2.2 μm), V03 (146.1 ± 3.4 μm), and V04 (134.4 ± 2.5 μm) compared with untreated group (116.0 ± 4.8 μm). Our results revealed that E. acetylicum S01 exhibits desirable functional probiotic attributes compared to A. veronii and C. joostei and it would be a promising probiotic strain, which can be efficiently used in the aquaculture applications.

Differential lysine acetylation profiles of Erwinia amylovora strains revealed by proteomics

PubMed Central

Wu, Xia; Vellaichamy, Adaikkalam; Wang, Dongping; Zamdborg, Leonid; Kelleher, Neil L.; Huber, Steven C.; Zhao, Youfu

2015-01-01

Protein lysine acetylation (LysAc) has recently been demonstrated to be widespread in E. coli and Salmonella, and to broadly regulate bacterial physiology and metabolism. However, LysAc in plant pathogenic bacteria is largely unknown. Here we first report the lysine acetylome of Erwinia amylovora, an enterobacterium causing serious fire blight disease of apples and pears. Immunoblots using generic anti-lysine acetylation antibodies demonstrated that growth conditions strongly affected the LysAc profiles in E. amylovora. Differential LysAc profiles were also observed for two E. amylovora strains, known to have differential virulence in plants, indicating translational modification of proteins may be important in determining virulence of bacterial strains. Proteomic analysis of LysAc in two E. amylovora strains identified 141 LysAc sites in 96 proteins that function in a wide range of biological pathways. Consistent with previous reports, 44% of the proteins are involved in metabolic processes, including central metabolism, lipopolysaccharide, nucleotide and amino acid metabolism. Interestingly, for the first time, several proteins involved in E. amylovora virulence, including exopolysaccharide amylovoran biosynthesis- and type III secretion-associated proteins, were found to be lysine acetylated, suggesting that LysAc may play a major role in bacterial virulence. Comparative analysis of LysAc sites in E. amylovora and E. coli further revealed the sequence and structural commonality for LysAc in the two organisms. Collectively, these results reinforce the notion that LysAc of proteins is widespread in bacterial metabolism and virulence. PMID:23234799

Amino Acid and Peptide Utilization Profiles of the Fluoroacetate-Degrading Bacterium Synergistetes Strain MFA1 Under Varying Conditions.

PubMed

Leong, Lex E X; Denman, Stuart E; Hugenholtz, Philip; McSweeney, Christopher S

2016-02-01

Synergistetes strain MFA1 is an asaccharolytic ruminal bacterium isolated based on its ability to degrade fluoroacetate, a plant toxin. The amino acid and peptide requirements of the bacterium were investigated under different culturing conditions. The growth of strain MFA1 and its fluoroacetate degradation rate were enhanced by peptide-rich protein hydrolysates (tryptone and yeast extract) compared to casamino acid, an amino acid-rich protein hydrolysate. Complete utilization and preference for arginine, asparagine, glutamate, glycine, and histidine as free amino acids from yeast extract were observed, while the utilization of serine, threonine, and lysine in free form and peptide-bound glutamate was stimulated during growth on fluoroacetate. A predominant peptide in yeast extract preferentially utilized by strain MFA1 was partially characterized by high-liquid performance chromatography-mass spectrometry as a hepta-glutamate oligopeptide. Similar utilization profiles of amino acids were observed between the co-culture of strain MFA1 with Methanobrevibacter smithii without fluoroacetate and pure strain MFA1 culture with fluoroacetate. This suggests that growth of strain MFA1 could be enhanced by a reduction of hydrogen partial pressure as a result of hydrogen removal by a methanogen or reduction of fluoroacetate.

Characterizing endophytic competence and plant growth promotion of bacterial endophytes inhabiting the seed endosphere of Rice.

PubMed

Walitang, Denver I; Kim, Kiyoon; Madhaiyan, Munusamy; Kim, Young Kee; Kang, Yeongyeong; Sa, Tongmin

2017-10-26

Rice (Oryza sativa L. ssp. indica) seeds as plant microbiome present both an opportunity and a challenge to colonizing bacterial community living in close association with plants. Nevertheless, the roles and activities of bacterial endophytes remain largely unexplored and insights into plant-microbe interaction are compounded by its complexity. In this study, putative functions or physiological properties associated with bacterial endophytic nature were assessed. Also, endophytic roles in plant growth and germination that may allow them to be selectively chosen by plants were also studied. The cultivable seed endophytes were dominated by Proteobacteria particularly class Gammaproteobacteria. Highly identical type strains were isolated from the seed endosphere regardless of the rice host's physiological tolerance to salinity. Among the type strains, Flavobacterium sp., Microbacterium sp. and Xanthomonas sp. were isolated from the salt-sensitive and salt-tolerant cultivars. PCA-Biplot ordination also showed that specific type strains isolated from different rice cultivars have distinguishing similar characteristics. Flavobacterium sp. strains are phosphate solubilizers and indole-3-acetic acid producers with high tolerance to salinity and osmotic stress. Pseudomonas strains are characterized as high siderophore producers while Microbacterium sp. and Xanthomonas sp. strains have very high pectinase and cellulase activity. Among the physiological traits of the seed endophytes, bacterial pectinase and cellulase activity are positively correlated as well as salt and osmotic tolerance. Overall characterization shows that majority of the isolates could survive in 4-8% salt concentration as well as in 0.6 M and 1.2 M sucrose solution. The activities of catalase, pectinase and cellulase were also observed in almost all of the isolates indicating the importance of these characteristics for survival and colonization into the seed endosphere. Seed bacterial endophytes also

Bacterial migration along solid surfaces.

PubMed Central

Harkes, G; Dankert, J; Feijen, J

1992-01-01

An in vitro system was developed to study the migration of uropathogenic Escherichia coli strains. In this system an aqueous agar gel is placed against a solid surface, allowing the bacteria to migrate along the gel/solid surface interface. Bacterial strains as well as solid surfaces were characterized by means of water contact angle and zeta potential measurements. When glass was used as the solid surface, significantly different migration times for the strains investigated were observed. Relationships among the observed migration times of six strains, their contact angles, and their zeta potentials were found. Relatively hydrophobic strains exhibited migration times shorter than those of hydrophilic strains. For highly negatively charged strains shorter migration times were found than were found for less negatively charged strains. When the fastest-migrating strain with respect to glass was allowed to migrate along solid surfaces differing in hydrophobicity and charge, no differences in migration times were found. Our findings indicate that strategies to prevent catheter-associated bacteriuria should be based on inhibition of bacterial growth rather than on modifying the physicochemical character of the catheter surface. PMID:1622217

Biodegradation of the metallic carcinogen hexavalent chromium Cr(VI) by an indigenously isolated bacterial strain

PubMed Central

Mishra, Susmita

2010-01-01

Background: Hexavalent chromium [Cr(VI)], a potential mutagen and carcinogen, is regularly introduced into the environment through diverse anthropogenic activities, including electroplating, leather tanning, and pigment manufacturing. Human exposure to this toxic metal ion not only causes potential human health hazards but also affects other life forms. The World Health Organization, the International Agency for Research on Cancer, and the Environmental Protection Agency have determined that Cr(VI) compounds are known human carcinogens. The Sukinda valley in Jajpur District, Orissa, is known for its deposit of chromite ore, producing nearly 98% of the chromite ore in India and one of the prime open cast chromite ore mines in the world (CES, Orissa Newsletter). Materials and Methods: Our investigation involved microbial remediation of Cr(VI) without producing any byproduct. Bacterial cultures tolerating high concentrations of Cr were isolated from the soil sample collected from the chromite-contaminated sites of Sukinda, and their bioaccumulation properties were investigated. Strains capable of growing at 250 mg/L Cr(VI) were considered as Cr resistant. Results: The experimental investigation showed the maximum specific Cr uptake at pH 7 and temperature 30°C. At about 50 mg/L initial Cr(VI) concentrations, uptake of the selected potential strain exceeded 98% within 12 h of incubation. The bacterial isolate was identified by 16S rRNA sequencing as Brevebacterium casei. Conclusion: Results indicated promising approach for microbial remediation of effluents containing elevated levels of Cr(VI). PMID:20976016

Adaptive laboratory evolution of ethanologenic Zymomonas mobilis strain tolerant to furfural and acetic acid inhibitors.

PubMed

Shui, Zong-Xia; Qin, Han; Wu, Bo; Ruan, Zhi-yong; Wang, Lu-shang; Tan, Fu-Rong; Wang, Jing-Li; Tang, Xiao-Yu; Dai, Li-Chun; Hu, Guo-Quan; He, Ming-Xiong

2015-07-01

Furfural and acetic acid from lignocellulosic hydrolysates are the prevalent inhibitors to Zymomonas mobilis during cellulosic ethanol production. Developing a strain tolerant to furfural or acetic acid inhibitors is difficul by using rational engineering strategies due to poor understanding of their underlying molecular mechanisms. In this study, strategy of adaptive laboratory evolution (ALE) was used for development of a furfural and acetic acid-tolerant strain. After three round evolution, four evolved mutants (ZMA7-2, ZMA7-3, ZMF3-2, and ZMF3-3) that showed higher growth capacity were successfully obtained via ALE method. Based on the results of profiling of cell growth, glucose utilization, ethanol yield, and activity of key enzymes, two desired strains, ZMA7-2 and ZMF3-3, were achieved, which showed higher tolerance under 7 g/l acetic acid and 3 g/l furfural stress condition. Especially, it is the first report of Z. mobilis strain that could tolerate higher furfural. The best strain, Z. mobilis ZMF3-3, has showed 94.84% theoretical ethanol yield under 3-g/l furfural stress condition, and the theoretical ethanol yield of ZM4 is only 9.89%. Our study also demonstrated that ALE method might also be used as a powerful metabolic engineering tool for metabolic engineering in Z. mobilis. Furthermore, the two best strains could be used as novel host for further metabolic engineering in cellulosic ethanol or future biorefinery. Importantly, the two strains may also be used as novel-tolerant model organisms for the genetic mechanism on the "omics" level, which will provide some useful information for inverse metabolic engineering.

A comparative analysis of fatty acid composition and fucoxanthin content in six Phaeodactylum tricornutum strains from diff erent origins

NASA Astrophysics Data System (ADS)

Wu, Hualian; Li, Tao; Wang, Guanghua; Dai, Shikun; He, Hui; Xiang, Wenzhou

2016-03-01

Phaeodactylum tricornutum is a potential livestock for the combined production of eicosapentaenoic acid (EPA) and fucoxanthin. In this study, six marine diatom strains identified as P. tricornutum were cultured and their total lipid, fatty acid composition and major photosynthetic pigments determined. It was found that the cell dry weight concentration and mean growth rate ranged between 0.24-0.36 g/L and 0.31-0.33/d, respectively. Among the strains, SCSIO771 presented the highest total lipid content, followed by SCSIO828, and the prominent fatty acids in all strains were C16:0, C16:1, C18:1, and C20:5 (EPA). Polyunsaturated fatty acids, including C16:2, C18:2, and EPA, comprised a significant proportion of the total fatty acids. EPA was markedly high in all strains, with the highest in SCSIO828 at 25.65% of total fatty acids. Fucoxanthin was the most abundant pigment in all strains, with the highest in SCSIO828 as well, at 5.50 mg/g. The collective results suggested that strain SCSIO828 could be considered a good candidate for the concurrent production of EPA and fucoxanthin.

Characterization of fatty acid modifying enzyme activity in staphylococcal mastitis isolates and other bacteria

PubMed Central

2012-01-01

Background Fatty acid modifying enzyme (FAME) has been shown to modify free fatty acids to alleviate their bactericidal effect by esterifying fatty acids to cholesterol or alcohols. Although it has been shown in previous studies that FAME is required for Staphylococcus aureus survival in skin abscesses, FAME is poorly studied compared to other virulence factors. FAME activity had also been detected in coagulase-negative staphylococci (CNS). However, FAME activity was only surveyed after a bacterial culture was grown for 24 h. Therefore if FAME activity was earlier in the growth phase, it would not have been detected by the assay and those strains would have been labeled as FAME negative. Results Fifty CNS bovine mastitis isolates and several S. aureus, Escherichia coli, and Streptococcus uberis strains were assayed for FAME activity over 24 h. FAME activity was detected in 54% of CNS and 80% S. aureus strains surveyed but none in E. coli or S. uberis. While some CNS strains produced FAME activity comparable to the lab strain of S. aureus, the pattern of FAME activity varied among strains and across species of staphylococci. All CNS that produced FAME activity also exhibited lipase activity. Lipase activity relative to colony forming units of these CNS decreased over the 24 h growth period. No relationship was observed between somatic cell count in the milk and FAME activity in CNS. Conclusions Some staphylococcal species surveyed produced FAME activity, but E. coli and S. uberis strains did not. All FAME producing CNS exhibited lipase activity which may indicate that both these enzymes work in concert to alter fatty acids in the bacterial environment. PMID:22726316

Resistance of bacterial biofilms formed on stainless steel surface to disinfecting agent.

PubMed

Królasik, Joanna; Zakowska, Zofia; Krepska, Milena; Klimek, Leszek

2010-01-01

The natural ability of microorganisms for adhesion and biofilm formation on various surfaces is one of the factors causing the inefficiency of a disinfection agent, despite its proven activity in vitro. The aim of the study was to determine the effectiveness of disinfecting substances on bacterial biofilms formed on stainless steel surface. A universally applied disinfecting agent was used in the tests. Bacterial strains: Listeria innocua, Pseudomonas putida, Micrococcus luteus, Staphylococcus hominis strains, were isolated from food contact surfaces, after a cleaning and disinfection process. The disinfecting agent was a commercially available acid specimen based on hydrogen peroxide and peroxyacetic acid, the substance that was designed for food industry usage. Model tests were carried out on biofilm formed on stainless steel (type 304, no 4 finish). Biofilms were recorded by electron scanning microscope. The disinfecting agent in usable concentration, 0.5% and during 10 minutes was ineffective for biofilms. The reduction of cells in biofilms was only 1-2 logarithmic cycles. The use of the agent in higher concentration--1% for 30 minutes caused reduction of cell number by around 5 logarithmic cycles only in the case of one microorganism, M. luteus. For other types: L. innocua, P. putida, S. hominis, the requirements placed on disinfecting agents were not fulfilled. The results of experiments proved that bacterial biofilms are resistant to the disinfectant applied in its operational parameters. Disinfecting effectiveness was achieved after twofold increase of the agent's concentration.

Effects of remediation on the bacterial community of an acid mine drainage impacted stream.

PubMed

Ghosh, Suchismita; Moitra, Moumita; Woolverton, Christopher J; Leff, Laura G

2012-11-01

Acid mine drainage (AMD) represents a global threat to water resources, and as such, remediation of AMD-impacted streams is a common practice. During this study, we examined bacterial community structure and environmental conditions in a low-order AMD-impacted stream before, during, and after remediation. Bacterial community structure was examined via polymerase chain reaction amplification of 16S rRNA genes followed by denaturing gradient gel electrophoresis. Also, bacterial abundance and physicochemical data (including metal concentrations) were collected and relationships to bacterial community structure were determined using BIO-ENV analysis. Remediation of the study stream altered environmental conditions, including pH and concentrations of some metals, and consequently, the bacterial community changed. However, remediation did not necessarily restore the stream to conditions found in the unimpacted reference stream; for example, bacterial abundances and concentrations of some elements, such as sulfur, magnesium, and manganese, were different in the remediated stream than in the reference stream. BIO-ENV analysis revealed that changes in pH and iron concentration, associated with remediation, primarily explained temporal alterations in bacterial community structure. Although the sites sampled in the remediated stream were in relatively close proximity to each other, spatial variation in community composition suggests that differences in local environmental conditions may have large impacts on the microbial assemblage.

Skin bacterial flora as a potential risk factor predisposing to late bacterial infection after cross-linked hyaluronic acid gel augmentation.

PubMed

Netsvyetayeva, Irina; Marusza, Wojciech; Olszanski, Romuald; Szyller, Kamila; Krolak-Ulinska, Aneta; Swoboda-Kopec, Ewa; Sierdzinski, Janusz; Szymonski, Zachary; Mlynarczyk, Grazyna

2018-01-01

Cross-linked hyaluronic acid (HA) gel is widely used in esthetic medicine. Late bacterial infection (LBI) is a rare, but severe complication after HA augmentation. The aim of this study was to determine whether patients who underwent the HA injection procedure and developed LBI had qualitatively different bacterial flora on the skin compared to patients who underwent the procedure without any complications. The study group comprised 10 previously healthy women with recently diagnosed, untreated LBI after HA augmentation. The control group comprised 17 healthy women who had a similar amount of HA injected with no complications. To assess the difference between the two groups, their skin flora was cultured from nasal swabs, both before and after antibiotic treatment in the study group. A significant increase in the incidence of Staphylococcus epidermidis was detected in the control group ( P =0.000) compared to the study group. The study group showed a significantly higher incidence of Staphylococcus aureus ( P =0.005), Klebsiella pneumoniae ( P =0.006), Klebsiella oxytoca ( P =0.048), and Staphylococcus haemolyticus ( P =0.048) compared to the control group. The bacterial flora on the skin differed in patients with LBI from the control group. The control group's bacterial skin flora was dominated by S. epidermidis . Patients with LBI had a bacterial skin flora dominated by potentially pathogenic bacteria.

Production of Oxalic Acid by a Strain of Agaricus campestris

PubMed Central

Tsao, George Tsu-Ning

1963-01-01

A strain of the common mushroom Agaricus campestris was grown on a mixture of composted sawdust and CaCO3. On incubation for 47 days, the organism produced 20.5 g of oxalic acid per 100 g of initial dry compost solids. PMID:16349635

Antibacterial activity of a 7,10-dihydroxy-8(E)-octadecenoic acid against food-bourne pathogenic bacteria

USDA-ARS?s Scientific Manuscript database

Microbial conversion of the natural unsaturated fatty acids often generate polyhydroxy fatty acids rendering them to have new properties such as higher viscosity and reactivity. A bacterial strain Pseudomonas aeruginosa (PR3) has been intensively studied to produce a novel 7,10-dihydroxy-8(E)-octad...

Autoinducer-2 detection among commensal oral streptococci is dependent on pH and boric acid.

PubMed

Cuadra, Giancarlo A; Frantellizzi, Ashley J; Gaesser, Kimberly M; Tammariello, Steven P; Ahmed, Anika

2016-07-01

Autoinducer-2, considered a universal signaling molecule, is produced by many species of bacteria; including oral strains. Structurally, autoinducer-2 can exist bound to boron (borated autoinducer-2). Functionally, autoinducer-2 has been linked to important bacterial processes such as virulence and biofilm formation. In order to test production of autoinducer-2 by a given bacterial strain, a bioassay using marine bioluminescent bacteria Vibrio harveyi as a reporter for autoinducer-2 has been designed. We hypothesize that pH adjustment and addition of boron are required for optimal bioluminescence and accurate autoinducer-2 detection. Using this reporter strain we tested autoinducer-2 activity from two oral commensal species, Streptococcus gordonii DL1 and Streptococcus oralis 34. Spent broth was collected and adjusted to pH 7.5 and supplemented with boric acid prior to measuring autoinducer- 2 activity. Results show that low pH inhibits bioluminescence of the reporter strain, but pH 7.5 allows for bioluminescence induction and proper readings of autoinducer-2 activity. Addition of boric acid also has a positive effect on bioluminescence allowing for a more sensitive detection of autoinducer-2 activity. Our data suggests that although autoinducer-2 is present in spent broth, low pH and/or low levels of boric acid become an obstacle for proper autoinducer-2 detection. For proper autoinducer-2 detection, we propose a protocol using this bioassay to include pH adjustment and boric acid addition to spent broth. Studies on autoinducer-2 activity in several bacteria species represent an important area of study as this universal signaling molecule is involved in critical bacterial phenotypes such as virulence and biofilm formation.

Plant growth promotion properties of bacterial strains isolated from the rhizosphere of the Jerusalem artichoke (Helianthus tuberosus L.) adapted to saline-alkaline soils and their effect on wheat growth.

PubMed

Liu, Xiaolin; Li, Xiangyue; Li, Yan; Li, Runzhi; Xie, Zhihong

2017-03-01

The Jerusalem artichoke (JA; Helianthus tuberosus), known to be tolerant to saline-alkaline soil conditions, has been cultivated for many years in the Yellow River delta, Shandong Province coastal zone, in China. The aim of our study was to isolate nitrogen-fixing bacteria colonizing the rhizosphere of JA and to characterize other plant growth promotion properties. The ultimate goal was to identify isolates that could be used as inoculants benefiting an economic crop, in particular for improving wheat growth production in the Yellow River delta. Bacterial strains were isolated from the rhizosphere soil of JA on the basis of growth on nitrogen-free Ashby medium. Identification and phylogenetic analysis was performed after nucleotide sequencing of 16S rRNA gene. Plant-growth-promoting traits, such as nitrogen fixation activity, phosphate solubilization activity, indole-3-acetic acid production, were determined using conventional methods. Eleven strains were isolated and 6 of them were further examined for their level of salt tolerance and their effect on plant growth promotion. Inoculation of Enterobacter sp. strain N10 on JA and wheat led to significant increases in both root and shoot dry mass and shoot height. Enterobacter sp. strain N10 appeared to be the best plant-growth-promoting rhizobacteria to increase wheat productivity in future field applications.

How Bacterial Pathogens Eat Host Lipids: Implications for the Development of Fatty Acid Synthesis Therapeutics*

PubMed Central

Yao, Jiangwei; Rock, Charles O.

2015-01-01

Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887

Rapid identification of ESKAPE bacterial strains using an autonomous microfluidic device.

PubMed

Ho, Jack Y; Cira, Nate J; Crooks, John A; Baeza, Josue; Weibel, Douglas B

2012-01-01

This article describes Bacteria ID Chips ('BacChips'): an inexpensive, portable, and autonomous microfluidic platform for identifying pathogenic strains of bacteria. BacChips consist of a set of microchambers and channels molded in the elastomeric polymer, poly(dimethylsiloxane) (PDMS). Each microchamber is preloaded with mono-, di-, or trisaccharides and dried. Pressing the layer of PDMS into contact with a glass coverslip forms the device; the footprint of the device in this article is ∼6 cm(2). After assembly, BacChips are degased under large negative pressure and are stored in vacuum-sealed plastic bags. To use the device, the bag is opened, a sample containing bacteria is introduced at the inlet of the device, and the degased PDMS draws the sample into the central channel and chambers. After the liquid at the inlet is consumed, air is drawn into the BacChip via the inlet and provides a physical barrier that separates the liquid samples in adjacent microchambers. A pH indicator is admixed with the samples prior to their loading, enabling the metabolism of the dissolved saccharides in the microchambers to be visualized. Importantly, BacChips operate without external equipment or instruments. By visually detecting the growth of bacteria using ambient light after ∼4 h, we demonstrate that BacChips with ten microchambers containing different saccharides can reproducibly detect the ESKAPE panel of pathogens, including strains of: Enterococcus faecalis, Enteroccocus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter aerogenes, and Enterobacter cloacae. This article describes a BacChip for point-of-care detection of ESKAPE pathogens and a starting point for designing multiplexed assays that identify bacterial strains from clinical samples and simultaneously determine their susceptibility to antibiotics.

Rapid Identification of ESKAPE Bacterial Strains Using an Autonomous Microfluidic Device

PubMed Central

Ho, Jack Y.; Cira, Nate J.; Crooks, John A.; Baeza, Josue; Weibel, Douglas B.

2012-01-01

This article describes Bacteria ID Chips (‘BacChips’): an inexpensive, portable, and autonomous microfluidic platform for identifying pathogenic strains of bacteria. BacChips consist of a set of microchambers and channels molded in the elastomeric polymer, poly(dimethylsiloxane) (PDMS). Each microchamber is preloaded with mono-, di-, or trisaccharides and dried. Pressing the layer of PDMS into contact with a glass coverslip forms the device; the footprint of the device in this article is ∼6 cm2. After assembly, BacChips are degased under large negative pressure and are stored in vacuum-sealed plastic bags. To use the device, the bag is opened, a sample containing bacteria is introduced at the inlet of the device, and the degased PDMS draws the sample into the central channel and chambers. After the liquid at the inlet is consumed, air is drawn into the BacChip via the inlet and provides a physical barrier that separates the liquid samples in adjacent microchambers. A pH indicator is admixed with the samples prior to their loading, enabling the metabolism of the dissolved saccharides in the microchambers to be visualized. Importantly, BacChips operate without external equipment or instruments. By visually detecting the growth of bacteria using ambient light after ∼4 h, we demonstrate that BacChips with ten microchambers containing different saccharides can reproducibly detect the ESKAPE panel of pathogens, including strains of: Enterococcus faecalis, Enteroccocus faecium, Staphylococcus aureus, Klebsiella pneumoniae, Acinetobacter baumannii, Pseudomonas aeruginosa, Enterobacter aerogenes, and Enterobacter cloacae. This article describes a BacChip for point-of-care detection of ESKAPE pathogens and a starting point for designing multiplexed assays that identify bacterial strains from clinical samples and simultaneously determine their susceptibility to antibiotics. PMID:22848451

An uncooked vegan diet shifts the profile of human fecal microflora: computerized analysis of direct stool sample gas-liquid chromatography profiles of bacterial cellular fatty acids.

PubMed Central

Peltonen, R; Ling, W H; Hänninen, O; Eerola, E

1992-01-01

The effect of an uncooked extreme vegan diet on fecal microflora was studied by direct stool sample gas-liquid chromatography (GLC) of bacterial cellular fatty acids and by quantitative bacterial culture by using classical microbiological techniques of isolation, identification, and enumeration of different bacterial species. Eighteen volunteers were divided randomly into two groups. The test group received an uncooked vegan diet for 1 month and a conventional diet of mixed Western type for the other month of the study. The control group consumed a conventional diet throughout the study period. Stool samples were collected. Bacterial cellular fatty acids were extracted directly from the stool samples and measured by GLC. Computerized analysis of the resulting fatty acid profiles was performed. Such a profile represents all bacterial cellular fatty acids in a sample and thus reflects its microflora and can be used to detect changes, differences, or similarities of bacterial flora between individual samples or sample groups. GLC profiles changed significantly in the test group after the induction and discontinuation of the vegan diet but not in the control group at any time, whereas quantitative bacterial culture did not detect any significant change in fecal bacteriology in either of the groups. The results suggest that an uncooked extreme vegan diet alters the fecal bacterial flora significantly when it is measured by direct stool sample GLC of bacterial fatty acids. PMID:1482187

Antibacterial and Antioxidant Activities of Novel Actinobacteria Strain Isolated from Gulf of Khambhat, Gujarat.

PubMed

Dholakiya, Riddhi N; Kumar, Raghawendra; Mishra, Avinash; Mody, Kalpana H; Jha, Bhavanath

2017-01-01

Bacterial secondary metabolites possess a wide range of biologically active compounds including antibacterial and antioxidants. In this study, a Gram-positive novel marine Actinobacteria was isolated from sea sediment which showed 84% 16S rRNA gene sequence (KT588655) similarity with Streptomyces variabilis (EU841661) and designated as Streptomyces variabilis RD-5. The genus Streptomyces is considered as a promising source of bioactive secondary metabolites. The isolated novel bacterial strain was characterized by antibacterial characteristics and antioxidant activities. The BIOLOG based analysis suggested that S. variabilis RD-5 utilized a wide range of substrates compared to the reference strain. The result is further supported by statistical analysis such as AWCD (average well color development), heat-map and PCA (principal component analysis). The whole cell fatty acid profiling showed the dominance of iso/anteiso branched C15-C17 long chain fatty acids. The identified strain S. variabilis RD-5 exhibited a broad spectrum of antibacterial activities for the Gram-negative bacteria ( Escherichia coli NCIM 2065, Shigella boydii NCIM, Klebsiella pneumoniae, Enterobacter cloacae, Pseudomonas sp. NCIM 2200 and Salmonella enteritidis NCIM), and Gram-positive bacteria ( Bacillus subtilis NCIM 2920 and Staphylococcus aureus MTCC 96). Extract of S. variabilis strain RD-5 showed 82.86 and 89% of 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging and metal chelating activity, respectively, at 5.0 mg/mL. While H 2 O 2 scavenging activity was 74.5% at 0.05 mg/mL concentration. Furthermore, polyketide synthases (PKSs types I and II), an enzyme complex that produces polyketides, the encoding gene(s) detected in the strain RD-5 which may probably involve for the synthesis of antibacterial compound(s). In conclusion, a novel bacterial strain of Actinobacteria , isolated from the unexplored sea sediment of Alang, Gulf of Khambhat (Gujarat), India showed promising

Antibacterial and Antioxidant Activities of Novel Actinobacteria Strain Isolated from Gulf of Khambhat, Gujarat

PubMed Central

Dholakiya, Riddhi N.; Kumar, Raghawendra; Mishra, Avinash; Mody, Kalpana H.; Jha, Bhavanath

2017-01-01

Bacterial secondary metabolites possess a wide range of biologically active compounds including antibacterial and antioxidants. In this study, a Gram-positive novel marine Actinobacteria was isolated from sea sediment which showed 84% 16S rRNA gene sequence (KT588655) similarity with Streptomyces variabilis (EU841661) and designated as Streptomyces variabilis RD-5. The genus Streptomyces is considered as a promising source of bioactive secondary metabolites. The isolated novel bacterial strain was characterized by antibacterial characteristics and antioxidant activities. The BIOLOG based analysis suggested that S. variabilis RD-5 utilized a wide range of substrates compared to the reference strain. The result is further supported by statistical analysis such as AWCD (average well color development), heat-map and PCA (principal component analysis). The whole cell fatty acid profiling showed the dominance of iso/anteiso branched C15–C17 long chain fatty acids. The identified strain S. variabilis RD-5 exhibited a broad spectrum of antibacterial activities for the Gram-negative bacteria (Escherichia coli NCIM 2065, Shigella boydii NCIM, Klebsiella pneumoniae, Enterobacter cloacae, Pseudomonas sp. NCIM 2200 and Salmonella enteritidis NCIM), and Gram-positive bacteria (Bacillus subtilis NCIM 2920 and Staphylococcus aureus MTCC 96). Extract of S. variabilis strain RD-5 showed 82.86 and 89% of 2,2-diphenyl-1-picrylhydrazyl (DPPH) free radical scavenging and metal chelating activity, respectively, at 5.0 mg/mL. While H2O2 scavenging activity was 74.5% at 0.05 mg/mL concentration. Furthermore, polyketide synthases (PKSs types I and II), an enzyme complex that produces polyketides, the encoding gene(s) detected in the strain RD-5 which may probably involve for the synthesis of antibacterial compound(s). In conclusion, a novel bacterial strain of Actinobacteria, isolated from the unexplored sea sediment of Alang, Gulf of Khambhat (Gujarat), India showed promising

Colonization of Vitis vinifera by a Green Fluorescence Protein-Labeled, gfp-Marked Strain of Xylophilus ampelinus, the Causal Agent of Bacterial Necrosis of Grapevine

PubMed Central

Grall, Sophie; Manceau, Charles

2003-01-01

The dynamics of Xylophilus ampelinus were studied in Vitis vinifera cv. Ugni blanc using gfp-marked bacterial strains to evaluate the relative importance of epiphytic and endophytic phases of plant colonization in disease development. Currently, bacterial necrosis of grapevine is of economic importance in vineyards in three regions in France: the Cognac, Armagnac, and Die areas. This disease is responsible for progressive destruction of vine shoots, leading to their death. We constructed gfp-marked strains of the CFBP2098 strain of X. ampelinus for histological studies. We studied the colonization of young plants of V. vinifera cv. Ugni blanc by X. ampelinus after three types of artificial contamination in a growth chamber and in a greenhouse. (i) After wounding of the stem and inoculation, the bacteria progressed down to the crown through the xylem vessels, where they organized into biofilms. (ii) When the bacteria were forced into woody cuttings, they rarely colonized the emerging plantlets. Xylem vessels could play a key role in the multiplication and conservation of the bacteria, rather than being a route for plant colonization. (iii) When bacterial suspensions were sprayed onto the plants, bacteria progressed in two directions: both in emerging organs and down to the crown, thus displaying the importance of epiphytic colonization in disease development. PMID:12676663

Colonization of Vitis vinifera by a green fluorescence protein-labeled, gfp-marked strain of Xylophilus ampelinus, the causal agent of bacterial necrosis of grapevine.

PubMed

Grall, Sophie; Manceau, Charles

2003-04-01

The dynamics of Xylophilus ampelinus were studied in Vitis vinifera cv. Ugni blanc using gfp-marked bacterial strains to evaluate the relative importance of epiphytic and endophytic phases of plant colonization in disease development. Currently, bacterial necrosis of grapevine is of economic importance in vineyards in three regions in France: the Cognac, Armagnac, and Die areas. This disease is responsible for progressive destruction of vine shoots, leading to their death. We constructed gfp-marked strains of the CFBP2098 strain of X. ampelinus for histological studies. We studied the colonization of young plants of V. vinifera cv. Ugni blanc by X. ampelinus after three types of artificial contamination in a growth chamber and in a greenhouse. (i) After wounding of the stem and inoculation, the bacteria progressed down to the crown through the xylem vessels, where they organized into biofilms. (ii) When the bacteria were forced into woody cuttings, they rarely colonized the emerging plantlets. Xylem vessels could play a key role in the multiplication and conservation of the bacteria, rather than being a route for plant colonization. (iii) When bacterial suspensions were sprayed onto the plants, bacteria progressed in two directions: both in emerging organs and down to the crown, thus displaying the importance of epiphytic colonization in disease development.

Influence of isolated bacterial strains on the in situ biodegradation of endosulfan and the reduction of endosulfan- contaminated soil toxicity.

PubMed

Kong, Lingfen; Zhang, Yu; Zhu, Lusheng; Wang, Jinhua; Wang, Jun; Du, Zhongkun; Zhang, Cheng

2018-09-30

The recently discovered endosulfan-degrading bacterial strains Pusillimonas sp. JW2 and Bordetella petrii NS were isolated from endosulfan-polluted water and soil environments. The optimal conditions for the growth and biodegradation activity of the strains JW2 and NS were studied in detail. In addition, the ability of the strains JW2 and NS to biodegrade endosulfan in soils during in situ bioremediation experiments was investigated. At a concentration of 2 mg of endosulfan per kilogram of soil, both JW2 and NS had positive effects on the degradation of endosulfan; JW2 degraded 100% and 91.5% of α- and β-endosulfan, respectively, and NS degraded 95.1% and 90.3% of α- and β-endosulfan, respectively. Polymerase chain reaction-denaturing gradient gel electrophoresis (PCR-DGGE) of soil samples showed the successful colonization of JW2 and NS, and the toxicity of the soil decreased, as determined by single-cell gel electrophoresis (SCGE) assays of Eiseniafetida and micronucleus (MN) assays of Viciafaba root tip cells. Furthermore, the metabolic products of the bacterially degraded endosulfan from the in situ experiments were identified as endosulfan ether and lactone. This study provided potentially foundational backgrounds information for the remediation of endosulfan-contaminated soil. Copyright © 2018 Elsevier Inc. All rights reserved.

Occurrence of trans monounsaturated and polyunsaturated fatty acids in Colwellia psychrerythraea strain 34H.

PubMed

Hashimoto, Mikako; Orikasa, Yoshitake; Hayashi, Hidenori; Watanabe, Kentaro; Yoshida, Kiyohito; Okuyama, Hidetoshi

2015-07-01

Colwellia psychrerythraea strain 34H is an obligately psychrophilic bacterium that has been used as a model cold-adapted microorganism because of its psychrophilic growth profile, significant production of cold-active enzymes, and cryoprotectant extracellular polysaccharide substances. However, its fatty acid components, particularly trans unsaturated fatty acids and long-chain polyunsaturated fatty acids (LC-PUFAs), have not been fully investigated. In this study, we biochemically identified Δ9-trans hexadecenoic acid [16:1(9t)] and LC-PUFAs such as docosahexaenoic acid. These results are comparable with the fact that the strain 34H genome sequence includes pfa and cti genes that are responsible for the biosynthesis of LC-PUFAs and trans unsaturated fatty acids, respectively. Strain 34H cells grown under static conditions at 5 °C had higher levels of 16:1(9t) than those grown under shaken conditions, and this change was accompanied by an antiparallel decrease in the levels of Δ9-cis hexadecenoic acid [16:1(9c)], suggesting that the cis-to-trans isomerization reaction of 16:1(9c) is activated under static (microanaerobic) culture conditions, that is, the enzyme could be activated by the decreased dissolved oxygen concentration of cultures. On the other hand, the levels of LC-PUFAs were too low (less than 3% of the total), even for cells grown at 5 °C, to evaluate their cold-adaptive function in this bacterium. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Bacterial endophytes enhance competition by invasive plants.

PubMed

Rout, Marnie E; Chrzanowski, Thomas H; Westlie, Tara K; DeLuca, Thomas H; Callaway, Ragan M; Holben, William E

2013-09-01

Invasive plants can alter soil microbial communities and profoundly alter ecosystem processes. In the invasive grass Sorghum halepense, these disruptions are consequences of rhizome-associated bacterial endophytes. We describe the effects of N2-fixing bacterial strains from S. halepense (Rout and Chrzanowski, 2009) on plant growth and show that bacteria interact with the plant to alter soil nutrient cycles, enabling persistence of the invasive. • We assessed fluxes in soil nutrients for ∼4 yr across a site invaded by S. halepense. We assayed the N2-fixing bacteria in vitro for phosphate solubilization, iron chelation, and production of the plant-growth hormone indole-3-acetic acid (IAA). We assessed the plant's ability to recruit bacterial partners from substrates and vertically transmit endophytes to seeds and used an antibiotic approach to inhibit bacterial activity in planta and assess microbial contributions to plant growth. • We found persistent alterations to eight biogeochemical cycles (including nitrogen, phosphorus, and iron) in soils invaded by S. halepense. In this context, three bacterial isolates solubilized phosphate, and all produced iron siderophores and IAA in vitro. In growth chamber experiments, bacteria were transmitted vertically, and molecular analysis of bacterial community fingerprints from rhizomes indicated that endophytes are also horizontally recruited. Inhibiting bacterial activity with antibiotics resulted in significant declines in plant growth rate and biomass, with pronounced rhizome reductions. • This work suggests a major role of endophytes on growth and resource allocation of an invasive plant. Indeed, bacterial isolate physiology is correlated with invader effects on biogeochemical cycles of nitrogen, phosphate, and iron.

Increasing antibiotic resistance in preservative-tolerant bacterial strains isolated from cosmetic products.

PubMed

Orús, Pilar; Gomez-Perez, Laura; Leranoz, Sonia; Berlanga, Mercedes

2015-03-01

To ensure the microbiological quality, consumer safety and organoleptic properties of cosmetic products, manufacturers need to comply with defined standards using several preservatives and disinfectants. A drawback regarding the use of these preservatives is the possibility of generating cross-insusceptibility to other disinfectants or preservatives, as well as cross resistance to antibiotics. Therefore, the objective of this study was to understand the adaptive mechanisms of Enterobacter gergoviae, Pseudomonas putida and Burkholderia cepacia that are involved in recurrent contamination in cosmetic products containing preservatives. Diminished susceptibility to formaldehyde-donors was detected in isolates but not to other preservatives commonly used in the cosmetics industry, although increasing resistance to different antibiotics (β-lactams, quinolones, rifampicin, and tetracycline) was demonstrated in these strains when compared with the wild-type strain. The outer membrane protein modifications and efflux mechanism activities responsible for the resistance trait were evaluated. The development of antibiotic-resistant microorganisms due to the selective pressure from preservatives included in cosmetic products could be a risk for the emergence and spread of bacterial resistance in the environment. Nevertheless, the large contribution of disinfection and preservation cannot be denied in cosmetic products. Copyright© by the Spanish Society for Microbiology and Institute for Catalan Studies.

Draft Genome Sequence of Xanthomonas arboricola pv. pruni Strain Xap33, Causal Agent of Bacterial Spot Disease on Almond

PubMed Central

Garita-Cambronero, J.; Sena-Vélez, M.; Palacio-Bielsa, A.

2014-01-01

We report the annotated genome sequence of Xanthomonas arboricola pv. pruni strain Xap33, isolated from almond leaves showing bacterial spot disease symptoms in Spain. The availability of this genome sequence will aid our understanding of the infection mechanism of this bacterium as well as its relationship to other species of the same genus. PMID:24903863

Prevention and cure of systemic Escherichia coli K1 infection by modification of the bacterial phenotype.

PubMed

Mushtaq, Naseem; Redpath, Maria B; Luzio, J Paul; Taylor, Peter W

2004-05-01

Escherichia coli is a common cause of meningitis and sepsis in the newborn infant, and the large majority of isolates from these infections produce a polysialic acid (PSA) capsular polysaccharide, the K1 antigen, that protects the bacterial cell from immune attack. We determined whether a capsule-depolymerizing enzyme, by removing this protective barrier, could alter the outcome of systemic infection in an animal model. Bacteriophage-derived endosialidase E (endoE) selectively degrades the PSA capsule on the surface of E. coli K1 strains. Intraperitoneal administration of small quantities of recombinant endoE (20 micro g) to 3-day-old rats, colonized with a virulent strain of K1, prevented bacteremia and death from systemic infection. The enzyme had no effect on the viability of E. coli strains but sensitized strains expressing PSA to killing by the complement system. This study demonstrates the potential therapeutic efficacy of agents that cure infections by modification of the bacterial phenotype rather than by killing or inhibition of growth of the pathogen.

Resistance and Inactivation Kinetics of Bacterial Strains Isolated from the Non-Chlorinated and Chlorinated Effluents of a WWTP

PubMed Central

Martínez-Hernández, Sylvia; Vázquez-Rodríguez, Gabriela A.; Beltrán-Hernández, Rosa I.; Prieto-García, Francisco; Miranda-López, José M.; Franco-Abuín, Carlos M.; Álvarez-Hernández, Alejandro; Iturbe, Ulises; Coronel-Olivares, Claudia

2013-01-01

The microbiological quality of water from a wastewater treatment plant that uses sodium hypochlorite as a disinfectant was assessed. Mesophilic aerobic bacteria were not removed efficiently. This fact allowed for the isolation of several bacterial strains from the effluents. Molecular identification indicated that the strains were related to Aeromonas hydrophila, Escherichia coli (three strains), Enterobacter cloacae, Kluyvera cryocrescens (three strains), Kluyvera intermedia, Citrobacter freundii (two strains), Bacillus sp. and Enterobacter sp. The first five strains, which were isolated from the non-chlorinated effluent, were used to test resistance to chlorine disinfection using three sets of variables: disinfectant concentration (8, 20 and 30 mg·L−1), contact time (0, 15 and 30 min) and water temperature (20, 25 and 30 °C). The results demonstrated that the strains have independent responses to experimental conditions and that the most efficient treatment was an 8 mg·L−1 dose of disinfectant at a temperature of 20 °C for 30 min. The other eight strains, which were isolated from the chlorinated effluent, were used to analyze inactivation kinetics using the disinfectant at a dose of 15 mg·L−1 with various retention times (0, 10, 20, 30, 60 and 90 min). The results indicated that during the inactivation process, there was no relationship between removal percentage and retention time and that the strains have no common response to the treatments. PMID:23924881

Exploring the proteomic characteristics of the Escherichia coli B and K-12 strains in different cellular compartments.

PubMed

Han, Mee-Jung

2016-07-01

Escherichia coli, one of the well-characterized prokaryotes, has been the most widely used bacterial host in scientific studies and industrial applications. Many different strains have been developed for the widespread use of E. coli in biotechnology, and selecting an ideal host to produce a specific protein of interest is a critical step in developing a production process. The E. coli B and K-12 strains are among the most frequently used bacterial hosts for the production of recombinant proteins as well as small-molecule metabolites such as amino acids, biofuels, carboxylic acids, diamines, and others. However, both strains have distinctive differences in genotypic and phenotypic attributes, and their behaviors can still be unpredictable at times, especially while expressing a recombinant protein. Therefore, in this review, an in-depth analysis of the physiological behavior on the proteomic level was performed, wherein the particularly distinct proteomic differences between the E. coli B and K-12 strains were investigated in the four distinctive cellular compartments. Interesting differences in the proteins associated with key cellular properties including cell growth, protein production and quality, cellular tolerance, and motility were observed between the two representative strains. The resulting enhancement of knowledge regarding host physiology that is summarized herein is expected to contribute to the acceleration of strain improvements and optimization for biotechnology-related processes. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain.

PubMed

Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

2016-01-01

An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates.

Lactic Acid Production from Pretreated Hydrolysates of Corn Stover by a Newly Developed Bacillus coagulans Strain

PubMed Central

Jiang, Ting; Qiao, Hui; Zheng, Zhaojuan; Chu, Qiulu; Li, Xin; Yong, Qiang; Ouyang, Jia

2016-01-01

An inhibitor-tolerance strain, Bacillus coagulans GKN316, was developed through atmospheric and room temperature plasma (ARTP) mutation and evolution experiment in condensed dilute-acid hydrolysate (CDH) of corn stover. The fermentabilities of other hydrolysates with B. coagulans GKN316 and the parental strain B. coagulans NL01 were assessed. When using condensed acid-catalyzed steam-exploded hydrolysate (CASEH), condensed acid-catalyzed liquid hot water hydrolysate (CALH) and condensed acid-catalyzed sulfite hydrolysate (CASH) as substrates, the concentration of lactic acid reached 45.39, 16.83, and 18.71 g/L by B. coagulans GKN316, respectively. But for B. coagulans NL01, only CASEH could be directly fermented to produce 15.47 g/L lactic acid. The individual inhibitory effect of furfural, 5-hydroxymethylfurfural (HMF), vanillin, syringaldehyde and p-hydroxybenzaldehyde (pHBal) on xylose utilization by B. coagulans GKN316 was also studied. The strain B. coagulans GKN316 could effectively convert these toxic inhibitors to the less toxic corresponding alcohols in situ. These results suggested that B. coagulans GKN316 was well suited to production of lactic acid from undetoxified lignocellulosic hydrolysates. PMID:26863012

Diversity and distribution of culturable lactic acid bacterial species in Indonesian Sayur Asin.

PubMed

Mangunwardoyo, Wibowo; Abinawanto; Salamah, Andi; Sukara, Endang; Sulistiani; Dinoto, Achmad

2016-08-01

Lactic acid bacteria (LAB) play important roles in processing of Sayur Asin (spontaneously fermented mustard). Unfortunately, information about LAB in Indonesian Sayur Asin, prepared by traditional manufactures which is important as baseline data for maintenance of food quality and safety, is unclear. The aim of this study was to describe the diversity and distribution of culturable lactic acid bacteria in Sayur Asin of Indonesia. Four Sayur Asin samples (fermentation liquor and fermented mustard) were collected at harvesting times (3-7 days after fermentation) from two traditional manufactures in Tulung Agung (TA) and Kediri (KDR), East Java provinces, Indonesia. LAB strains were isolated by using MRS agar method supplemented with 1% CaCO 3 and characterized morphologically. Identification of the strains was performed basedon 16S rDNA analysis and the phylogenetic tree was drawn to understand the phylogenetic relationship of the collected strains. Different profiles were detected in total count of the plates, salinity and pH of fermenting liquor of Sayur Asin in TA and KDR provinces. A total of 172 LAB isolates were successfully isolated and identified based on their 16S rDNA sequences. Phylogenetic analysis of 27 representative LAB strains from Sayur Asin showed that these strains belonged to 5 distinct species namely Lactobacilus farciminis (N=32), L. fermentum (N=4), L. namurensis (N=15), L. plantarum (N=118) and L. parafarraginis (N=1). Strains D5-S-2013 and B4-S-2013 showed a close phylogenetic relationship with L. composti and L. paralimentarius, respectively where as the sequence had slightly lower similarity of lower than 99%, suggesting that they may be classified into novel species and need further investigation due to exhibition of significant differences in their nucleotide sequences. Lactobacillus plantarum was found being dominant in all sayur asin samples. Lactobacilli were recognized as the major group of lactic acid bacteria in Sayur Asin

Fermentation of aqueous plant seed extracts by lactic acid bacteria

DOE Office of Scientific and Technical Information (OSTI.GOV)

Schafner, D.W.; Beuchat, R.L.

1986-05-01

The effects of lactic acid bacterial fermentation on chemical and physical changes in aqueous extracts of cowpea (Vigna unguiculata), peanut (Arachis hypogea), soybean (Glycine max), and sorghum (Sorghum vulgare) were studied. The bacteria investigated were Lactobacillus helveticus, L. delbrueckii, L. casei, L. bulgaricus, L. acidophilus, and Streptococcus thermophilus. Organisms were inoculated individually into all of the seed extracts; L. bulgaricus and S. thermophilus were also evaluated together as inocula for fermenting the legume extracts. During fermentation, bacterial population and changes in titratable acidity, pH, viscosity, and color were measured over a 72 h period at 37 degrees C. Maximum bacterialmore » populations, titratable acidity, pH, and viscosity varied depending upon the type of extract and bacterial strain. The maximum population of each organism was influenced by fermentable carbohydrates, which, in turn, influenced acid production and change in pH. Change in viscosity was correlated with the amount of protein and titratable acidity of products. Color was affected by pasteurization treatment and fermentation as well as the source of extract. In the extracts inoculated simultaneously with L. bulgaricus and S. thermophilus, a synergistic effect resulted in increased bacterial populations, titratable acidity, and viscosity, and decreased pH in all the legume extracts when compared to the extracts fermented with either of these organisms individually. Fermented extracts offer potential as substitutes for cultured dairy products. 24 references.« less

Nile Red Detection of Bacterial Hydrocarbons and Ketones in a High-Throughput Format

DOE Office of Scientific and Technical Information (OSTI.GOV)

Pinzon, NM; Aukema, KG; Gralnick, JA

A method for use in high-throughput screening of bacteria for the production of long-chain hydrocarbons and ketones by monitoring fluorescent light emission in the presence of Nile red is described. Nile red has previously been used to screen for polyhydroxybutyrate (PHB) and fatty acid esters, but this is the first report of screening for recombinant bacteria making hydrocarbons or ketones. The microtiter plate assay was evaluated using wild-type and recombinant strains of Shewanella oneidensis and Escherichia coli expressing the enzyme OleA, previously shown to initiate hydrocarbon biosynthesis. The strains expressing exogenous Stenotrophomonas maltophilia oleA, with increased levels of ketone productionmore » as determined by gas chromatography-mass spectrometry, were distinguished with Nile red fluorescence. Confocal microscopy images of S. oneidensis oleA-expressing strains stained with Nile red were consistent with a membrane localization of the ketones. This differed from Nile red staining of bacterial PHB or algal lipid droplets that showed intracellular inclusion bodies. These results demonstrated the applicability of Nile red in a high-throughput technique for the detection of bacterial hydrocarbons and ketones. IMPORTANCE In recent years, there has been renewed interest in advanced biofuel sources such as bacterial hydrocarbon production. Previous studies used solvent extraction of bacterial cultures followed by gas chromatography-mass spectrometry (GC-MS) to detect and quantify ketones and hydrocarbons (Beller HR, Goh EB, Keasling JD, Appl. Environ. Microbiol. 76: 1212-1223, 2010; Sukovich DJ, Seffernick JL, Richman JE, Gralnick JA, Wackett LP, Appl. Environ. Microbiol. 76: 3850-3862, 2010). While these analyses are powerful and accurate, their labor-intensive nature makes them intractable to high-throughput screening; therefore, methods for rapid identification of bacterial strains that are overproducing hydrocarbons are needed. The use of high

Selection of bacteriocin producer strains of lactic acid bacteria from a dairy environment.

PubMed

Lasagno, M; Beoleito, V; Sesma, F; Raya, R; Font de Valdez, G; Eraso, A

2002-01-01

Two strains showing bacteriocin production were selected from a total of 206 lactic acid bacteria isolated from samples of milk, milk serum, whey and homemade cheeses in Southern Cordoba, Argentina. This property was detected by means of well diffusion assays. The strains were identified as Enterococcus hirae and Enterococcus durans. The protein nature of those substances was proved by showing their sensitivity to type IV and XXV proteases, papaine, trypsin, pepsin and K proteinase. The bacteriocins inhibited the growth of Listeria monocytogenes, Bacillus cereus, Clostridium perfringes and two strains of Staphylococcus aureus, an A-enterotoxin and a B-enterotoxin producers. All of these bacteria are common pathogens usually associated with food borne diseases (ETA). These lactic acid bacteria or their bacteriocins could be suitable candidates for food preservation and specially useful in the our regional dairy industry.

Novel homologous lactate transporter improves L-lactic acid production from glycerol in recombinant strains of Pichia pastoris.

PubMed

de Lima, Pollyne Borborema Almeida; Mulder, Kelly Cristina Leite; Melo, Nadiele Tamires Moreira; Carvalho, Lucas Silva; Menino, Gisele Soares; Mulinari, Eduardo; de Castro, Virgilio H; Dos Reis, Thaila F; Goldman, Gustavo Henrique; Magalhães, Beatriz Simas; Parachin, Nádia Skorupa

2016-09-15

Crude glycerol is the main byproduct of the biodiesel industry. Although it can have different applications, its purification is costly. Therefore, in this study a biotechnological route has been proposed for further utilization of crude glycerol in the fermentative production of lactic acid. This acid is largely utilized in food, pharmaceutical, textile, and chemical industries, making it the hydroxycarboxylic acid with the highest market potential worldwide. Currently, industrial production of lactic acid is done mainly using sugar as the substrate. Thus here, for the first time, Pichia pastoris has been engineered for heterologous L-lactic acid production using glycerol as a single carbon source. For that, the Bos taurus lactate dehydrogenase gene was introduced into P. pastoris. Moreover, a heterologous and a novel homologous lactate transporter have been evaluated for L-lactic acid production. Batch fermentation of the P. pastoris X-33 strain producing LDHb allowed for lactic acid production in this yeast. Although P. pastoris is known for its respiratory metabolism, batch fermentations were performed with different oxygenation levels, indicating that lower oxygen availability increased lactic acid production by 20 %, pushing the yeast towards a fermentative metabolism. Furthermore, a newly putative lactate transporter from P. pastoris named PAS has been identified by search similarity with the lactate transporter from Saccharomyces cerevisiae Jen1p. Both heterologous and homologous transporters, Jen1p and PAS, were evaluated in one strain already containing LDH activity. Fed-batch experiments of P. pastoris strains carrying the lactate transporter were performed with the batch phase at aerobic conditions followed by an aerobic oxygen-limited phase where production of lactic acid was favored. The results showed that the strain containing PAS presented the highest lactic acid titer, reaching a yield of approximately 0.7 g/g. We showed that P. pastoris has a

Bacterial contaminants from frozen puff pastry production process and their growth inhibition by antimicrobial substances from lactic acid bacteria.

PubMed

Rumjuankiat, Kittaporn; Keawsompong, Suttipun; Nitisinprasert, Sunee

2017-05-01

Seventy-five bacterial contaminants which still persisted to cleaning system from three puff pastry production lines (dough forming, layer and filling forming, and shock freezing) were identified using 16S rDNA as seven genera of Bacillus , Corynebacterium , Dermacoccus , Enterobacter , Klebsiella, Pseudomonas , and Staphylococcus with detection frequencies of 24.00, 2.66, 1.33, 37.33, 1.33, 2.66, and 30.66, respectively. Seventeen species were discovered while only 11 species Bacillus cereus, B. subtilis, B. pumilus, Corynebacterium striatum , Dermacoccus barathri , Enterobacter asburiae, Staphylococcus kloosii, S. haemolyticus, S. hominis, S. warneri , and S. aureus were detected at the end of production. Based on their abundance, the highest abundance of E. asburiae could be used as a biomarker for product quality. While a low abundance of the mesophile pathogen C. striatum , which causes respiratory and nervous infection and appeared only at the shock freezing step was firstly reported for its detection in bakery product. Six antimicrobial substances (AMSs) from lactic acid bacteria, FF1-4, FF1-7, PFUR-242, PFUR-255, PP-174, and nisin A were tested for their inhibition activities against the contaminants. The three most effective were FF1-7, PP-174, and nisin A exhibiting wide inhibition spectra of 88.00%, 85.33%, and 86.66%, respectively. The potential of a disinfectant solution containing 800 AU/ml of PP-174 and nisin A against the most resistant strains of Enterobacter , Staphylococcus , Bacillus and Klebsiella was determined on artificially contaminated conveyor belt coupons at 0, 4, 8, 12, and 16 hr. The survival levels of the test strains were below 1 log CFU/coupon at 0 hr. The results suggested that a combined solution of PP-174 and nisin A may be beneficial as a sanitizer to inhibit bacterial contaminants in the frozen puff pastry industry.

Environmentally safe production of 7-aminodeacetoxycephalosporanic acid (7-ADCA) using recombinant strains of Acremonium chrysogenum.

PubMed

Velasco, J; Luis Adrio, J; Angel Moreno, M; Díez, B; Soler, G; Barredo, J L

2000-08-01

Medically useful semisynthetic cephalosporins are made from 7-aminodeacetoxycephalosporanic acid (7-ADCA) or 7-aminocephalosporanic acid (7-ACA). Here we describe a new industrially amenable bioprocess for the production of the important intermediate 7-ADCA that can replace the expensive and environmentally unfriendly chemical method classically used. The method is based on the disruption and one-step replacement of the cefEF gene, encoding the bifunctional expandase/hydroxylase activity, of an actual industrial cephalosporin C production strain of Acremonium chrysogenum. Subsequent cloning and expression of the cefE gene from Streptomyces clavuligerus in A. chrysogenum yield recombinant strains producing high titers of deacetoxycephalosporin C (DAOC). Production level of DAOC is nearly equivalent (75-80%) to the total beta-lactams biosynthesized by the parental overproducing strain. DAOC deacylation is carried out by two final enzymatic bioconversions catalyzed by D-amino acid oxidase (DAO) and glutaryl acylase (GLA) yielding 7-ADCA. In contrast to the data reported for recombinant strains of Penicillium chrysogenum expressing ring expansion activity, no detectable contamination with other cephalosporin intermediates occurred.

Quantification of folic acid in human feces after administration of Bifidobacterium probiotic strains.

PubMed

Strozzi, G Paolo; Mogna, Luca

2008-09-01

Folic acid, or vitamin B9, is involved in appropriate regulation of DNA replication, synthesis of purines and deoxythymidine (dTMP), conversion of homocysteine to methionine, histidine catabolism, and correct differentiation of the neural tube during fetal organogenesis. Folic acid from food sources is almost completely absorbed in the small intestine, mostly in the jejunum, and does not reach the large intestine. The administration of probiotic strains able to synthesize folates de novo and release them in the extracellular space may provide an additional, constant endogenous source of this important vitamin in the intestinal lumen of humans. A pilot study involving 23 healthy volunteers was conducted to evaluate the ability of 3 probiotic strains, Bifidobacterium adolescentis DSM 18350, B. adolescentis DSM 18352, and Bifidobacterium pseudocatenulatum DSM 18353, to produce folates in the human intestine. Volunteers were randomly assigned to 1 of 3 groups for treatment with a specific probiotic strain (5 x 10(9) colony forming units/d). Strain effectiveness was evaluated by determination of the folate concentration in feces evacuated within 48 hours before and after administration of the probiotics. Quantification of microorganisms belonging to the genus Bifidobacterium was performed in parallel to folate analysis. Ingestion of these probiotic strains resulted in a significant increase of folic acid concentration in human feces in all treated groups. Analysis of the fecal Bifidobacteria confirmed the potential of all strains, especially B. adolescentis DSM 18352, to colonize the intestinal environment. The demonstrated ability of the probiotic microorganisms B. adolescentis DSM 18350, B. adolescentis DSM 18352, and B. pseudocatenulatum DSM 18353 to synthesize and secrete folates in the human intestinal environment may provide a complementary endogenous source of such molecules, which is especially useful for the homeostasis of mucosal enterocytes of the colon and

Novel cajaninstilbene acid derivatives as antibacterial agents.

PubMed

Geng, Zhi-Zhong; Zhang, Jian-Jun; Lin, Jing; Huang, Mei-Yan; An, Lin-Kun; Zhang, Hong-Bin; Sun, Ping-Hua; Ye, Wen-Cai; Chen, Wei-Min

2015-07-15

Discovery of novel antibacterial agents with new structural scaffolds that combat drug-resistant pathogens is an urgent task. Cajaninstilbene acid, which is isolated from pigeonpea leaves, has shown antibacterial activity. In this study, a series of cajaninstilbene acid derivatives were designed and synthesized. The antibacterial activities of these compounds against gram-negative and gram-positive bacteria, as well as nine strains of methicillin-resistant staphylococcus aureus (MRSA) bacteria are evaluated，and the related structure-activity relationships are discussed. Assays suggest that some of the synthetic cajaninstilbene acid derivatives exhibit potent antibacterial activity against gram-positive bacterial strains and MRSA. Among these compounds, 5b, 5c, 5j and 5k show better antibacterial activity than the positive control compounds. The results of MTT assays illustrate the low cytotoxicity of the active compounds. Copyright © 2015 Elsevier Masson SAS. All rights reserved.

Effects of 4 Probiotic Strains in Coculture with Traditional Starters on the Flavor Profile of Yogurt.

PubMed

Tian, Huaixiang; Shen, Yongbo; Yu, Haiyan; He, Yujie; Chen, Chen

2017-07-01

To study the influence of probiotics on the flavor profile of yogurt, 4 probiotics, including Lactobacillus acidophilus, Lactobacillus plantarum, Lactobacillus rhamnosus, and Lactobacillus casei, were cofermented with traditional starters. The changes of bacterial growth, acid contents and volatile compounds of yogurt were investigated during fermentation and refrigerated storage. The strains that exhibited a low growth rate in milk did not significantly affect the bacterial population dynamics, acidity, or organic acid content during fermentation and storage. However, high viability and enhancement of postacidification were clearly observed in the samples that contained strains with a high growth rate in milk, particularly L. casei. A total of 45 volatile compounds, detected in most samples, were identified by headspace solid-phase micro-extraction followed by gas chromatography-mass spectrometry. Among these compounds, ketones and aldehydes were the most abundant. The presence of either L. rhamnosus or L. plantarum did not significantly affect the major volatile compounds, while contributions of L. casei and L. acidophilus were found in the formation of minor volatile metabolites. Electronic nose measurements exhibited a good discrimination of samples that contained different probiotics during refrigerated storage. © 2017 Institute of Food Technologists®.

Bacterial resistance modifying tetrasaccharide agents from Ipomoea murucoides.

PubMed

Chérigo, Lilia; Pereda-Miranda, Rogelio; Gibbons, Simon

2009-01-01

As part of an ongoing project to identify oligosaccharides which modulate bacterial multidrug resistance, the CHCl(3)-soluble extract from flowers of a Mexican arborescent morning glory, Ipomoea murucoides, through preparative-scale recycling HPLC, yielded five lipophilic tetrasaccharide inhibitors of Staphylococcusaureus multidrug efflux pumps, murucoidins XII-XVI (1-5). The macrocyclic lactone-type structures for these linear hetero-tetraglycoside derivatives of jalapinolic acid were established by spectroscopic methods. These compounds were tested for in vitro antibacterial and resistance modifying activity against strains of Staphylococcus aureus possessing multidrug resistance efflux mechanisms. Only murucoidin XIV (3) displayed antimicrobial activity against SA-1199B (MIC 32microg/ml), a norfloxacin-resistant strain that over-expresses the NorA MDR efflux pump. The four microbiologically inactive (MIC>512microg/ml) tetrasaccharides increased norfloxacin susceptibility of this strain by 4-fold (8microg/ml from 32microg/ml) at concentrations of 25microg/ml, while murucoidin XIV (3) exerted the same potentiation effect at a concentration of 5microg/ml.

Brachiaria Grasses (Brachiaria spp.) harbor a diverse bacterial community with multiple attributes beneficial to plant growth and development.

PubMed

Mutai, Collins; Njuguna, Joyce; Ghimire, Sita

2017-10-01

Endophytic and plant-associated bacteria were isolated from plants and rhizoplane soil of naturally grown Brachiaria grasses at International Livestock Research Institute in Nairobi, Kenya. Eighty-four bacterial strains were isolated from leaf tissues, root tissues, and rhizoplane soil on nutrient agar and 869 media. All bacterial strains were identified to the lowest possible taxonomic unit using 16S rDNA primers and were characterized for the production of Indole-3-acetic acid, hydrogen cyanide, and ACC deaminase; phosphate solubilization; siderophore production; antifungal properties; and plant biomass production. The 16S rDNA-based identification grouped these 84 bacterial strains into 3 phyla, 5 classes, 8 orders, 12 families, 16 genera, and 50 unique taxa. The four most frequently isolated genera were Pseudomonas (23), Pantoea (17), Acinetobacter (9), and Enterobacter (8). The functional characterization of these strains revealed that 41 of 84 strains had a minimum of three plant beneficial properties. Inoculation of maize seedlings with Acinetobacter spp., Microbacterium spp., Pectobacterium spp., Pseudomonas spp., and Enterobacter spp. showed positive effects on seedling biomass production. The ability of Brachiaria grasses to host genetically diverse bacteria, many of them with multiple plant growth-promoting attributes, might have contributed to high biomass production and adaptation of Brachiaria grasses to drought and low fertility soils. © 2017 International Livestock Research Institute. MicrobiologyOpen published by John Wiley & Sons Ltd.

Engineering E. coli strain for conversion of short chain fatty acids to bioalcohols

PubMed Central

2013-01-01

Background Recent progress in production of various biofuel precursors and molecules, such as fatty acids, alcohols and alka(e)nes, is a significant step forward for replacing the fossil fuels with renewable fuels. A two-step process, where fatty acids from sugars are produced in the first step and then converted to corresponding biofuel molecules in the second step, seems more viable and attractive at this stage. We have engineered an Escherichia coli strain to take care of the second step for converting short chain fatty acids into corresponding alcohols by using butyrate kinase (Buk), phosphotransbutyrylase (Ptb) and aldehyde/alcohol dehydrogenase (AdhE2) from Clostridium acetobutylicum. Results The engineered E. coli was able to convert butyric acid and other short chain fatty acids of chain length C3 to C7 into corresponding alcohols and the efficiency of conversion varied with different E. coli strain type. Glycerol proved to be a better donor of ATP and electron as compared to glucose for converting butyric acid to butanol. The engineered E. coli was able to tolerate up to 100 mM butyric acid and produced butanol with the conversion rate close to 100% under anaerobic condition. Deletion of native genes, such as fumarate reductase (frdA) and alcohol dehydrogenase (adhE), responsible for side products succinate and ethanol, which act as electron sink and could compete with butyric acid uptake, did not improve the butanol production efficiency. Indigenous acyl-CoA synthetase (fadD) was found to play no role in the conversion of butyric acid to butanol. Engineered E. coli was cultivated in a bioreactor under controlled condition where 60 mM butanol was produced within 24 h of cultivation. A continuous bioreactor with the provision of cell recycling allowed the continuous production of butanol at the average productivity of 7.6 mmol/l/h until 240 h. Conclusions E. coli engineered with the pathway from C. acetobutylicum could efficiently convert butyric acid

Carbon utilization profiles of river bacterial strains facing sole carbon sources suggest metabolic interactions.

PubMed

Goetghebuer, Lise; Servais, Pierre; George, Isabelle F

2017-05-01

Microbial communities play a key role in water self-purification. They are primary drivers of biogenic element cycles and ecosystem processes. However, these communities remain largely uncharacterized. In order to understand the diversity-heterotrophic activity relationship facing sole carbon sources, we assembled a synthetic community composed of 20 'typical' freshwater bacterial species mainly isolated from the Zenne River (Belgium). The carbon source utilization profiles of each individual strain and of the mixed community were measured in Biolog Phenotype MicroArrays PM1 and PM2A microplates that allowed testing 190 different carbon sources. Our results strongly suggest interactions occurring between our planktonic strains as our synthetic community showed metabolic properties that were not displayed by its single components. Finally, the catabolic performances of the synthetic community and a natural community from the same sampling site were compared. The synthetic community behaved like the natural one and was therefore representative of the latter in regard to carbon source consumption. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

Bacterial diversity and bioprospecting for cold-active enzymes from culturable bacteria associated with sediment from a melt water stream of Midtre Lovenbreen glacier, an Arctic glacier.

PubMed

Vardhan Reddy, Puram Vishnu; Shiva Nageswara Rao, Singireesu Soma; Pratibha, Mambatta Shankaranarayanan; Sailaja, Buddhi; Kavya, Bakka; Manorama, Ravoori Ruth; Singh, Shiv Mohan; Radha Srinivas, Tanuku Naga; Shivaji, Sisinthy

2009-10-01

Culturable bacterial diversity of Midtre Lovenbreen glacier, an Arctic glacier, was studied using 12 sediment samples collected from different points, along a transect, from the snout of Midtre Lovenbreen glacier up to the convergence point of the melt water stream with the sea. Bacterial abundance appeared to be closer to the convergence point of the glacial melt water stream with the sea than at the snout of the glacier. A total of 117 bacterial strains were isolated from the sediment samples. Based on 16S rRNA gene sequence analyses, the isolates (n=117) could be categorised in to 32 groups, with each group representing a different taxa belonging to 4 phyla (Actinobacteria, Bacilli, Flavobacteria and Proteobacteria). Representatives of the 32 groups varied in their growth temperature range (4-37 degrees C), in their tolerance to NaCl (0.1-1M NaCl) and in the growth pH range (2-13). Only 14 of 32 representative strains exhibited amylase, lipase and (or) protease activity and only one isolate (AsdM4-6) showed all three enzyme activities at 5 and 20 degrees C respectively. More than half of the isolates were pigmented. Fatty acid profile studies indicated that short-chain fatty acids, unsaturated fatty acids, branched fatty acids, cyclic and cis fatty acids are predominant in the psychrophilic bacteria.