Sample records for acid cycle tca

  1. Metabolism: Part II. The Tricarboxylic Acid (TCA), Citric Acid, or Krebs Cycle.

    ERIC Educational Resources Information Center

    Bodner, George M.

    1986-01-01

    Differentiates the tricarboxylic acid (TCA) cycle (or Krebs cycle) from glycolysis, and describes the bridge between the two as being the conversion of pyruvate into acetyl coenzyme A. Discusses the eight steps in the TCA cycle, the results of isotopic labeling experiments, and the net effects of the TCA cycle. (TW)

  2. The emerging role and targetability of the TCA cycle in cancer metabolism.

    PubMed

    Anderson, Nicole M; Mucka, Patrick; Kern, Joseph G; Feng, Hui

    2018-02-01

    The tricarboxylic acid (TCA) cycle is a central route for oxidative phosphorylation in cells, and fulfills their bioenergetic, biosynthetic, and redox balance requirements. Despite early dogma that cancer cells bypass the TCA cycle and primarily utilize aerobic glycolysis, emerging evidence demonstrates that certain cancer cells, especially those with deregulated oncogene and tumor suppressor expression, rely heavily on the TCA cycle for energy production and macromolecule synthesis. As the field progresses, the importance of aberrant TCA cycle function in tumorigenesis and the potentials of applying small molecule inhibitors to perturb the enhanced cycle function for cancer treatment start to evolve. In this review, we summarize current knowledge about the fuels feeding the cycle, effects of oncogenes and tumor suppressors on fuel and cycle usage, common genetic alterations and deregulation of cycle enzymes, and potential therapeutic opportunities for targeting the TCA cycle in cancer cells. With the application of advanced technology and in vivo model organism studies, it is our hope that studies of this previously overlooked biochemical hub will provide fresh insights into cancer metabolism and tumorigenesis, subsequently revealing vulnerabilities for therapeutic interventions in various cancer types.

  3. Origin of the Reductive Tricarboxylic Acid (rTCA) Cycle-Type CO2 Fixation: A Perspective

    PubMed Central

    Fujishima, Kosuke

    2017-01-01

    The reductive tricarboxylic acid (rTCA) cycle is among the most plausible candidates for the first autotrophic metabolism in the earliest life. Extant enzymes fixing CO2 in this cycle contain cofactors at the catalytic centers, but it is unlikely that the protein/cofactor system emerged at once in a prebiotic process. Here, we discuss the feasibility of non-enzymatic cofactor-assisted drive of the rTCA reactions in the primitive Earth environments, particularly focusing on the acetyl-CoA conversion to pyruvate. Based on the energetic and mechanistic aspects of this reaction, we propose that the deep-sea hydrothermal vent environments with active electricity generation in the presence of various sulfide catalysts are a promising setting for it to progress. Our view supports the theory of an autotrophic origin of life from primordial carbon assimilation within a sulfide-rich hydrothermal vent.

  4. Glutamatergic and GABAergic TCA cycle and neurotransmitter cycling fluxes in different regions of mouse brain.

    PubMed

    Tiwari, Vivek; Ambadipudi, Susmitha; Patel, Anant B

    2013-10-01

    The (13)C nuclear magnetic resonance (NMR) studies together with the infusion of (13)C-labeled substrates in rats and humans have provided important insight into brain energy metabolism. In the present study, we have extended a three-compartment metabolic model in mouse to investigate glutamatergic and GABAergic tricarboxylic acid (TCA) cycle and neurotransmitter cycle fluxes across different regions of the brain. The (13)C turnover of amino acids from [1,6-(13)C2]glucose was monitored ex vivo using (1)H-[(13)C]-NMR spectroscopy. The astroglial glutamate pool size, one of the important parameters of the model, was estimated by a short infusion of [2-(13)C]acetate. The ratio Vcyc/VTCA was calculated from the steady-state acetate experiment. The (13)C turnover curves of [4-(13)C]/[3-(13)C]glutamate, [4-(13)C]glutamine, [2-(13)C]/[3-(13)C]GABA, and [3-(13)C]aspartate from [1,6-(13)C2]glucose were analyzed using a three-compartment metabolic model to estimate the rates of the TCA cycle and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The glutamatergic TCA cycle rate was found to be highest in the cerebral cortex (0.91 ± 0.05 μmol/g per minute) and least in the hippocampal region (0.64 ± 0.07 μmol/g per minute) of the mouse brain. In contrast, the GABAergic TCA cycle flux was found to be highest in the thalamus-hypothalamus (0.28 ± 0.01 μmol/g per minute) and least in the cerebral cortex (0.24 ± 0.02 μmol/g per minute). These findings indicate that the energetics of excitatory and inhibitory function is distinct across the mouse brain.

  5. Contribution of the tricarboxylic acid (TCA) cycle and the glyoxylate shunt in Saccharomyces cerevisiae to succinic acid production during dough fermentation.

    PubMed

    Rezaei, Mohammad N; Aslankoohi, Elham; Verstrepen, Kevin J; Courtin, Christophe M

    2015-07-02

    Succinic acid produced by yeast during bread dough fermentation can significantly affect the rheological properties of the dough. By introducing mutations in the model S288C yeast strain, we show that the oxidative pathway of the TCA cycle and the glyoxylate shunt contribute significantly to succinic acid production during dough fermentation. More specifically, deletion of ACO1 and double deletion of ACO1 and ICL1 resulted in a 36 and 77% decrease in succinic acid levels in fermented dough, respectively. Similarly, double deletion of IDH1 and IDP1 decreased succinic acid production by 85%, while also affecting the fermentation rate. By contrast, double deletion of SDH1 and SDH2 resulted in a two-fold higher succinic acid accumulation compared to the wild-type. Deletion of fumarate reductase activity (FRD1 and OSM1) in the reductive pathway of the TCA cycle did not affect the fermentation rate and succinic acid production. The changes in the levels of succinic acid produced by mutants Δidh1Δidp1 (low level) and Δsdh1Δsdh2 (high level) in fermented dough only resulted in small pH differences, reflecting the buffering capacity of dough at a pH of around 5.1. Moreover, Rheofermentometer analysis using these mutants revealed no difference in maximum dough height and gas retention capacity with the dough prepared with S288C. The impact of the changed succinic acid profile on the organoleptic or antimicrobial properties of bread remains to be demonstrated. Copyright © 2015 Elsevier B.V. All rights reserved.

  6. Integration of the tricarboxylic acid (TCA) cycle with cAMP signaling and Sfl2 pathways in the regulation of CO2 sensing and hyphal development in Candida albicans

    PubMed Central

    Tao, Li; Zhang, Yulong; Fan, Shuru; Nobile, Clarissa J.; Guan, Guobo; Huang, Guanghua

    2017-01-01

    Morphological transitions and metabolic regulation are critical for the human fungal pathogen Candida albicans to adapt to the changing host environment. In this study, we generated a library of central metabolic pathway mutants in the tricarboxylic acid (TCA) cycle, and investigated the functional consequences of these gene deletions on C. albicans biology. Inactivation of the TCA cycle impairs the ability of C. albicans to utilize non-fermentable carbon sources and dramatically attenuates cell growth rates under several culture conditions. By integrating the Ras1-cAMP signaling pathway and the heat shock factor-type transcription regulator Sfl2, we found that the TCA cycle plays fundamental roles in the regulation of CO2 sensing and hyphal development. The TCA cycle and cAMP signaling pathways coordinately regulate hyphal growth through the molecular linkers ATP and CO2. Inactivation of the TCA cycle leads to lowered intracellular ATP and cAMP levels and thus affects the activation of the Ras1-regulated cAMP signaling pathway. In turn, the Ras1-cAMP signaling pathway controls the TCA cycle through both Efg1- and Sfl2-mediated transcriptional regulation in response to elevated CO2 levels. The protein kinase A (PKA) catalytic subunit Tpk1, but not Tpk2, may play a major role in this regulation. Sfl2 specifically binds to several TCA cycle and hypha-associated genes under high CO2 conditions. Global transcriptional profiling experiments indicate that Sfl2 is indeed required for the gene expression changes occurring in response to these elevated CO2 levels. Our study reveals the regulatory role of the TCA cycle in CO2 sensing and hyphal development and establishes a novel link between the TCA cycle and Ras1-cAMP signaling pathways. PMID:28787458

  7. Systematic engineering of TCA cycle for optimal production of a four-carbon platform chemical 4-hydroxybutyric acid in Escherichia coli.

    PubMed

    Choi, Sol; Kim, Hyun Uk; Kim, Tae Yong; Lee, Sang Yup

    2016-11-01

    To address climate change and environmental problems, it is becoming increasingly important to establish biorefineries for the production of chemicals from renewable non-food biomass. Here we report the development of Escherichia coli strains capable of overproducing a four-carbon platform chemical 4-hybroxybutyric acid (4-HB). Because 4-HB production is significantly affected by aeration level, genome-scale metabolic model-based engineering strategies were designed under aerobic and microaerobic conditions with emphasis on oxidative/reductive TCA branches and glyoxylate shunt. Several different metabolic engineering strategies were employed to develop strains suitable for fermentation both under aerobic and microaerobic conditions. It was found that microaerobic condition was more efficient than aerobic condition in achieving higher titer and productivity of 4-HB. The final engineered strain produced 103.4g/L of 4-HB by microaerobic fed-batch fermentation using glycerol. The aeration-dependent optimization strategy of TCA cycle will be useful for developing microbial strains producing other reduced derivative chemicals of TCA cycle intermediates. Copyright © 2016 International Metabolic Engineering Society. Published by Elsevier Inc. All rights reserved.

  8. Succinate links TCA cycle dysfunction to oncogenesis by inhibiting HIF-alpha prolyl hydroxylase.

    PubMed

    Selak, Mary A; Armour, Sean M; MacKenzie, Elaine D; Boulahbel, Houda; Watson, David G; Mansfield, Kyle D; Pan, Yi; Simon, M Celeste; Thompson, Craig B; Gottlieb, Eyal

    2005-01-01

    Several mitochondrial proteins are tumor suppressors. These include succinate dehydrogenase (SDH) and fumarate hydratase, both enzymes of the tricarboxylic acid (TCA) cycle. However, to date, the mechanisms by which defects in the TCA cycle contribute to tumor formation have not been elucidated. Here we describe a mitochondrion-to-cytosol signaling pathway that links mitochondrial dysfunction to oncogenic events: succinate, which accumulates as a result of SDH inhibition, inhibits HIF-alpha prolyl hydroxylases in the cytosol, leading to stabilization and activation of HIF-1alpha. These results suggest a mechanistic link between SDH mutations and HIF-1alpha induction, providing an explanation for the highly vascular tumors that develop in the absence of VHL mutations.

  9. The Krebs Uric Acid Cycle: A Forgotten Krebs Cycle.

    PubMed

    Salway, Jack G

    2018-05-25

    Hans Kornberg wrote a paper entitled 'Krebs and his trinity of cycles' commenting that every school biology student knows of the Krebs cycle, but few know that Krebs discovered two other cycles. These are (i) the ornithine cycle (urea cycle), (ii) the citric acid cycle (tricarboxylic acid or TCA cycle), and (iii) the glyoxylate cycle that was described by Krebs and Kornberg. Ironically, Kornberg, codiscoverer of the 'glyoxylate cycle', overlooked a fourth Krebs cycle - (iv) the uric acid cycle. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. Streptomyces clavuligerus shows a strong association between TCA cycle intermediate accumulation and clavulanic acid biosynthesis.

    PubMed

    Ramirez-Malule, Howard; Junne, Stefan; Nicolás Cruz-Bournazou, Mariano; Neubauer, Peter; Ríos-Estepa, Rigoberto

    2018-05-01

    Clavulanic acid (CA) is produced by Streptomyces clavuligerus (S. clavuligerus) as a secondary metabolite. Knowledge about the carbon flux distribution along the various routes that supply CA precursors would certainly provide insights about metabolic performance. In order to evaluate metabolic patterns and the possible accumulation of tricarboxylic acid (TCA) cycle intermediates during CA biosynthesis, batch and subsequent continuous cultures with steadily declining feed rates were performed with glycerol as the main substrate. The data were used to in silico explore the metabolic capabilities and the accumulation of metabolic intermediates in S. clavuligerus. While clavulanic acid accumulated at glycerol excess, it steadily decreased at declining dilution rates; CA synthesis stopped when glycerol became the limiting substrate. A strong association of succinate, oxaloacetate, malate, and acetate accumulation with CA production in S. clavuligerus was observed, and flux balance analysis (FBA) was used to describe the carbon flux distribution in the network. This combined experimental and numerical approach also identified bottlenecks during the synthesis of CA in a batch and subsequent continuous cultivation and demonstrated the importance of this type of methodologies for a more advanced understanding of metabolism; this potentially derives valuable insights for future successful metabolic engineering studies in S. clavuligerus.

  11. IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...

    EPA Pesticide Factsheets

    EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database. The draft Toxicological Review of trichloroacetic acid provides scientific support and rationale for the hazard and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.

  12. Lipotoxicity in steatohepatitis occurs despite an increase in tricarboxylic acid cycle activity

    PubMed Central

    Patterson, Rainey E.; Kalavalapalli, Srilaxmi; Williams, Caroline M.; Nautiyal, Manisha; Mathew, Justin T.; Martinez, Janie; Reinhard, Mary K.; McDougall, Danielle J.; Rocca, James R.; Yost, Richard A.; Cusi, Kenneth; Garrett, Timothy J.

    2016-01-01

    The hepatic tricarboxylic acid (TCA) cycle is central to integrating macronutrient metabolism and is closely coupled to cellular respiration, free radical generation, and inflammation. Oxidative flux through the TCA cycle is induced during hepatic insulin resistance, in mice and humans with simple steatosis, reflecting early compensatory remodeling of mitochondrial energetics. We hypothesized that progressive severity of hepatic insulin resistance and the onset of nonalcoholic steatohepatitis (NASH) would impair oxidative flux through the hepatic TCA cycle. Mice (C57/BL6) were fed a high-trans-fat high-fructose diet (TFD) for 8 wk to induce simple steatosis and NASH by 24 wk. In vivo fasting hepatic mitochondrial fluxes were determined by 13C-nuclear magnetic resonance (NMR)-based isotopomer analysis. Hepatic metabolic intermediates were quantified using mass spectrometry-based targeted metabolomics. Hepatic triglyceride accumulation and insulin resistance preceded alterations in mitochondrial metabolism, since TCA cycle fluxes remained normal during simple steatosis. However, mice with NASH had a twofold induction (P < 0.05) of mitochondrial fluxes (μmol/min) through the TCA cycle (2.6 ± 0.5 vs. 5.4 ± 0.6), anaplerosis (9.1 ± 1.2 vs. 16.9 ± 2.2), and pyruvate cycling (4.9 ± 1.0 vs. 11.1 ± 1.9) compared with their age-matched controls. Induction of the TCA cycle activity during NASH was concurrent with blunted ketogenesis and accumulation of hepatic diacylglycerols (DAGs), ceramides (Cer), and long-chain acylcarnitines, suggesting inefficient oxidation and disposal of excess free fatty acids (FFA). Sustained induction of mitochondrial TCA cycle failed to prevent accretion of “lipotoxic” metabolites in the liver and could hasten inflammation and the metabolic transition to NASH. PMID:26814015

  13. Linked cycles of oxidative decarboxylation of glyoxylate as protometabolic analogs of the citric acid cycle.

    PubMed

    Springsteen, Greg; Yerabolu, Jayasudhan Reddy; Nelson, Julia; Rhea, Chandler Joel; Krishnamurthy, Ramanarayanan

    2018-01-08

    The development of metabolic approaches towards understanding the origins of life, which have focused mainly on the citric acid (TCA) cycle, have languished-primarily due to a lack of experimentally demonstrable and sustainable cycle(s) of reactions. We show here the existence of a protometabolic analog of the TCA involving two linked cycles, which convert glyoxylate into CO 2 and produce aspartic acid in the presence of ammonia. The reactions proceed from either pyruvate, oxaloacetate or malonate in the presence of glyoxylate as the carbon source and hydrogen peroxide as the oxidant under neutral aqueous conditions and at mild temperatures. The reaction pathway demonstrates turnover under controlled conditions. These results indicate that simpler versions of metabolic cycles could have emerged under potential prebiotic conditions, laying the foundation for the appearance of more sophisticated metabolic pathways once control by (polymeric) catalysts became available.

  14. Metabolite profiling of human colon carcinoma--deregulation of TCA cycle and amino acid turnover.

    PubMed

    Denkert, Carsten; Budczies, Jan; Weichert, Wilko; Wohlgemuth, Gert; Scholz, Martin; Kind, Tobias; Niesporek, Silvia; Noske, Aurelia; Buckendahl, Anna; Dietel, Manfred; Fiehn, Oliver

    2008-09-18

    Apart from genetic alterations, development and progression of colorectal cancer has been linked to influences from nutritional intake, hyperalimentation, and cellular metabolic changes that may be the basis for new diagnostic and therapeutic approaches. However, in contrast to genomics and proteomics, comprehensive metabolomic investigations of alterations in malignant tumors have rarely been conducted. In this study we investigated a set of paired samples of normal colon tissue and colorectal cancer tissue with gas-chromatography time-of-flight mass-spectrometry, which resulted in robust detection of a total of 206 metabolites. Metabolic phenotypes of colon cancer and normal tissues were different at a Bonferroni corrected significance level of p=0.00170 and p=0.00005 for the first two components of an unsupervised PCA analysis. Subsequent supervised analysis found 82 metabolites to be significantly different at p<0.01. Metabolites were connected to abnormalities in metabolic pathways by a new approach that calculates the distance of each pair of metabolites in the KEGG database interaction lattice. Intermediates of the TCA cycle and lipids were found down-regulated in cancer, whereas urea cycle metabolites, purines, pyrimidines and amino acids were generally found at higher levels compared to normal colon mucosa. This study demonstrates that metabolic profiling facilitates biochemical phenotyping of normal and neoplastic colon tissue at high significance levels and points to GC-TOF-based metabolomics as a new method for molecular pathology investigations.

  15. Metabolic engineering in the biotechnological production of organic acids in the tricarboxylic acid cycle of microorganisms: Advances and prospects.

    PubMed

    Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian

    2015-11-01

    Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

  16. IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...

    EPA Pesticide Factsheets

    EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development Process. Comments received from other Federal agencies and White House Offices are provided below with external peer review panel comments. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.

  17. The antidiabetic drug metformin decreases mitochondrial respiration and tricarboxylic acid cycle activity in cultured primary rat astrocytes.

    PubMed

    Hohnholt, Michaela C; Blumrich, Eva-Maria; Waagepetersen, Helle S; Dringen, Ralf

    2017-11-01

    Metformin is an antidiabetic drug that is used daily by millions of patients worldwide. Metformin is able to cross the blood-brain barrier and has recently been shown to increase glucose consumption and lactate release in cultured astrocytes. However, potential effects of metformin on mitochondrial tricarboxylic acid (TCA) cycle metabolism in astrocytes are unknown. We investigated this by mapping 13 C labeling in TCA cycle intermediates and corresponding amino acids after incubation of primary rat astrocytes with [U- 13 C]glucose. The presence of metformin did not compromise the viability of cultured astrocytes during 4 hr of incubation, but almost doubled cellular glucose consumption and lactate release. Compared with control cells, the presence of metformin dramatically lowered the molecular 13 C carbon labeling (MCL) of the cellular TCA cycle intermediates citrate, α-ketoglutarate, succinate, fumarate, and malate, as well as the MCL of the TCA cycle intermediate-derived amino acids glutamate, glutamine, and aspartate. In addition to the total molecular 13 C labeling, analysis of the individual isotopomers of TCA cycle intermediates confirmed a severe decline in labeling and a significant lowering in TCA cycling ratio in metformin-treated astrocytes. Finally, the oxygen consumption of mitochondria isolated from metformin-treated astrocytes was drastically reduced in the presence of complex I substrates, but not of complex II substrates. These data demonstrate that exposure to metformin strongly impairs complex I-mediated mitochondrial respiration in astrocytes, which is likely to cause the observed decrease in labeling of mitochondrial TCA cycle intermediates and the stimulation of glycolytic lactate production. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  18. Glycation inhibits trichloroacetic acid (TCA)-induced whey protein precipitation

    USDA-ARS?s Scientific Manuscript database

    Four different WPI saccharide conjugates were successfully prepared to test whether glycation could inhibit WPI precipitation induced by trichloroacetic acid (TCA). Conjugates molecular weights after glycation were analyzed with SDS-PAGE. No significant secondary structure change due to glycation wa...

  19. Anaerobic Respiration Using a Complete Oxidative TCA Cycle Drives Multicellular Swarming in Proteus mirabilis

    PubMed Central

    Alteri, Christopher J.; Himpsl, Stephanie D.; Engstrom, Michael D.; Mobley, Harry L. T.

    2012-01-01

    ABSTRACT Proteus mirabilis rapidly migrates across surfaces using a periodic developmental process of differentiation alternating between short swimmer cells and elongated hyperflagellated swarmer cells. To undergo this vigorous flagellum-mediated motility, bacteria must generate a substantial proton gradient across their cytoplasmic membranes by using available energy pathways. We sought to identify the link between energy pathways and swarming differentiation by examining the behavior of defined central metabolism mutants. Mutations in the tricarboxylic acid (TCA) cycle (fumC and sdhB mutants) caused altered patterns of swarming periodicity, suggesting an aerobic pathway. Surprisingly, the wild-type strain swarmed on agar containing sodium azide, which poisons aerobic respiration; the fumC TCA cycle mutant, however, was unable to swarm on azide. To identify other contributing energy pathways, we screened transposon mutants for loss of swarming on sodium azide and found insertions in the following genes that involved fumarate metabolism or respiration: hybB, encoding hydrogenase; fumC, encoding fumarase; argH, encoding argininosuccinate lyase (generates fumarate); and a quinone hydroxylase gene. These findings validated the screen and suggested involvement of anaerobic electron transport chain components. Abnormal swarming periodicity of fumC and sdhB mutants was associated with the excretion of reduced acidic fermentation end products. Bacteria lacking SdhB were rescued to wild-type pH and periodicity by providing fumarate, independent of carbon source but dependent on oxygen, while fumC mutants were rescued by glycerol, independent of fumarate only under anaerobic conditions. These findings link multicellular swarming patterns with fumarate metabolism and membrane electron transport using a previously unappreciated configuration of both aerobic and anaerobic respiratory chain components. PMID:23111869

  20. IRIS Toxicological Review of Trichloroacetic Acid (TCA) ...

    EPA Pesticide Factsheets

    On September 24, 2009, the Toxicological Review of Trichloroacetic Acid (TCA) and the charge to external peer reviewers were released for external peer review and public comment. The Toxicological Review and charge were reviewed internally by EPA and by other federal agencies and White House Offices before public release. In the new IRIS process, introduced by the EPA Administrator, all written comments on IRIS assessments submitted by other federal agencies and White House Offices will be made publicly available. Accordingly, interagency comments and the interagency science consultation draft of the IRIS Toxicological Review of Trichloroacetic Acid and the charge to external peer reviewers are posted on this site. The draft Toxicological Review of Trichloroacetic Acid provides scientific support and rationale for the hazard identification and dose-response assessment pertaining to chronic exposure to trichloroacetic acid.

  1. Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) mixture toxicity to the macrophytes Myriophyllum spicatum and Myriophyllum sibiricum in aquatic microcosms.

    PubMed

    Hanson, Mark L; Sibley, Paul K; Mabury, Scott A; Solomon, Keith R; Muir, Derek C G

    2002-02-21

    Trichloroacetic acid (TCA) and trifluoroacetic acid (TFA) have been detected together in environmental water samples throughout the world. TCA may enter into aquatic systems via rainout as the degradation product of chlorinated solvents, herbicide use, as a by-product of water disinfection and from emissions of spent bleach liquor of kraft pulp mills. Sources of TFA include degradation of hydrofluorocarbons (HFCs) refrigerants and pesticides. These substances are phytotoxic and widely distributed in aquatic environments. A study to assess the risk of a binary mixture of TCA and TFA to macrophytes in aquatic microcosms was conducted as part of a larger study on haloacetic acids. M. spicatum and M. sibiricum were exposed to 0.1, 1, 3 and 10 mg/l of both TCA and TFA (neutralized with sodium hydroxide) in replicate (n = 3) 12000 l aquatic microcosms for 49 days in an one-way analysis of variance design. Each microcosm was stocked with 14 individual apical shoots per species. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a, chlorophyll-b, carotenoid content and citric acid levels. Results indicate that there were statistically significant effects of the TCA/TFA mixture on certain pigment concentrations immediately after the start of exposure (2-7 days), but the plants showed no signs of stress thereafter. These data suggest that TCA/TFA mixtures at environmentally relevant concentrations do not pose a significant risk to these aquatic macrophytes.

  2. The Tricarboxylic Acid Cycle, an Ancient Metabolic Network with a Novel Twist

    PubMed Central

    Mailloux, Ryan J.; Bériault, Robin; Lemire, Joseph; Singh, Ranji; Chénier, Daniel R.; Hamel, Robert D.; Appanna, Vasu D.

    2007-01-01

    The tricarboxylic acid (TCA) cycle is an essential metabolic network in all oxidative organisms and provides precursors for anabolic processes and reducing factors (NADH and FADH2) that drive the generation of energy. Here, we show that this metabolic network is also an integral part of the oxidative defence machinery in living organisms and α-ketoglutarate (KG) is a key participant in the detoxification of reactive oxygen species (ROS). Its utilization as an anti-oxidant can effectively diminish ROS and curtail the formation of NADH, a situation that further impedes the release of ROS via oxidative phosphorylation. Thus, the increased production of KG mediated by NADP-dependent isocitrate dehydrogenase (NADP-ICDH) and its decreased utilization via the TCA cycle confer a unique strategy to modulate the cellular redox environment. Activities of α-ketoglutarate dehydrogenase (KGDH), NAD-dependent isocitrate dehydrogenase (NAD-ICDH), and succinate dehydrogenase (SDH) were sharply diminished in the cellular systems exposed to conditions conducive to oxidative stress. These findings uncover an intricate link between TCA cycle and ROS homeostasis and may help explain the ineffective TCA cycle that characterizes various pathological conditions and ageing. PMID:17668068

  3. Teaching about citric acid cycle using plant mitochondrial preparations: Some assays for use in laboratory courses*.

    PubMed

    Vicente, Joaquim A F; Gomes-Santos, Carina S S; Sousa, Ana Paula M; Madeira, Vítor M C

    2005-03-01

    Potato tubers and turnip roots were used to prepare purified mitochondria for laboratory practical work in the teaching of the citric acid cycle (TCA cycle). Plant mitochondria are particularly advantageous over the animal fractions to demonstrate the TCA cycle enzymatic steps, by using simple techniques to measure O(2) consumption and transmembrane potential (ΔΨ). The several TCA cycle intermediates induce specific enzyme activities, which can be identified by respiratory parameters. Such a strategy is also used to evidence properties of the TCA cycle enzymes: ADP stimulation of isocitrate dehydrogenase and α-ketoglutarate dehydrogenase; activation by citrate of downstream oxidation steps, e.g. succinate dehydrogenase; and regulation of the activity of isocitrate dehydrogenase by citrate action on the citrate/isocitrate carrier. Furthermore, it has been demonstrated that, in the absence of exogenous Mg(2+) , isocitrate-dependent respiration favors the alternative oxidase pathway, as judged by changes of the ADP/O elicited by the inhibitor n-propyl galate. These are some examples of assays related with TCA cycle intermediates we can use in laboratory courses. Copyright © 2005 International Union of Biochemistry and Molecular Biology, Inc.

  4. IRIS Toxicological Review of Trichloroacetic Acid (TCA) (External Review Draft)

    EPA Science Inventory

    EPA is conducting a peer review and public comment of the scientific basis supporting the human health hazard and dose-response assessment of Trichloroacetic acid (TCA) that when finalized will appear on the Integrated Risk Information System (IRIS) database.

  5. Temporal fluxomics reveals oscillations in TCA cycle flux throughout the mammalian cell cycle.

    PubMed

    Ahn, Eunyong; Kumar, Praveen; Mukha, Dzmitry; Tzur, Amit; Shlomi, Tomer

    2017-11-06

    Cellular metabolic demands change throughout the cell cycle. Nevertheless, a characterization of how metabolic fluxes adapt to the changing demands throughout the cell cycle is lacking. Here, we developed a temporal-fluxomics approach to derive a comprehensive and quantitative view of alterations in metabolic fluxes throughout the mammalian cell cycle. This is achieved by combining pulse-chase LC-MS-based isotope tracing in synchronized cell populations with computational deconvolution and metabolic flux modeling. We find that TCA cycle fluxes are rewired as cells progress through the cell cycle with complementary oscillations of glucose versus glutamine-derived fluxes: Oxidation of glucose-derived flux peaks in late G1 phase, while oxidative and reductive glutamine metabolism dominates S phase. These complementary flux oscillations maintain a constant production rate of reducing equivalents and oxidative phosphorylation flux throughout the cell cycle. The shift from glucose to glutamine oxidation in S phase plays an important role in cell cycle progression and cell proliferation. © 2017 The Authors. Published under the terms of the CC BY 4.0 license.

  6. Genetic investigation of tricarboxylic acid metabolism during the Plasmodium falciparum life cycle.

    PubMed

    Ke, Hangjun; Lewis, Ian A; Morrisey, Joanne M; McLean, Kyle J; Ganesan, Suresh M; Painter, Heather J; Mather, Michael W; Jacobs-Lorena, Marcelo; Llinás, Manuel; Vaidya, Akhil B

    2015-04-07

    New antimalarial drugs are urgently needed to control drug-resistant forms of the malaria parasite Plasmodium falciparum. Mitochondrial electron transport is the target of both existing and new antimalarials. Herein, we describe 11 genetic knockout (KO) lines that delete six of the eight mitochondrial tricarboxylic acid (TCA) cycle enzymes. Although all TCA KOs grew normally in asexual blood stages, these metabolic deficiencies halted life-cycle progression in later stages. Specifically, aconitase KO parasites arrested as late gametocytes, whereas α-ketoglutarate-dehydrogenase-deficient parasites failed to develop oocysts in the mosquitoes. Mass spectrometry analysis of (13)C-isotope-labeled TCA mutant parasites showed that P. falciparum has significant flexibility in TCA metabolism. This flexibility manifested itself through changes in pathway fluxes and through altered exchange of substrates between cytosolic and mitochondrial pools. Our findings suggest that mitochondrial metabolic plasticity is essential for parasite development. Copyright © 2015 The Authors. Published by Elsevier Inc. All rights reserved.

  7. Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain

    PubMed Central

    Rink, Cameron; Gnyawali, Surya; Stewart, Richard; Teplitsky, Seth; Harris, Hallie; Roy, Sashwati; Sen, Chandan K.; Khanna, Savita

    2017-01-01

    Ischemic stroke results in excessive release of glutamate, which contributes to neuronal cell death. Here, we test the hypothesis that otherwise neurotoxic glutamate can be productively metabolized by glutamate oxaloacetate transaminase (GOT) to maintain cellular energetics and protect the brain from ischemic stroke injury. The GOT-dependent metabolism of glutamate was studied in primary neural cells and in stroke-affected C57-BL6 mice using magnetic resonance spectroscopy and GC-MS. Extracellular Glu sustained cell viability under hypoglycemic conditions and increased GOT-mediated metabolism in vitro. Correction of stroke-induced hypoxia using supplemental oxygen in vivo lowered Glu levels as measured by 1H magnetic resonance spectroscopy. GOT knockdown abrogated this effect and caused ATP loss in the stroke-affected brain. GOT overexpression increased anaplerotic refilling of tricarboxylic acid cycle intermediates in mouse brain during ischemic stroke. Furthermore, GOT overexpression not only reduced ischemic stroke lesion volume but also attenuated neurodegeneration and improved poststroke sensorimotor function. Taken together, our results show that GOT enables metabolism of otherwise neurotoxic extracellular Glu through a truncated tricarboxylic acid cycle under hypoglycemic conditions.—Rink, C., Gnyawali, S., Stewart, R., Teplitsky, S., Harris, H., Roy, S., Sen, C. K., Khanna, S. Glutamate oxaloacetate transaminase enables anaplerotic refilling of TCA cycle intermediates in stroke-affected brain. PMID:28096234

  8. The oxidative TCA cycle operates during methanotrophic growth of the Type I methanotroph Methylomicrobium buryatense 5GB1.

    PubMed

    Fu, Yanfen; Li, Yi; Lidstrom, Mary

    2017-07-01

    Methanotrophs are a group of bacteria that use methane as sole carbon and energy source. Type I methanotrophs are gamma-proteobacterial methanotrophs using the ribulose monophosphate cycle (RuMP) cycle for methane assimilation. In order to facilitate metabolic engineering in the industrially promising Type I methanotroph Methylomicrobium buryatense 5GB1, flux analysis of cellular metabolism is needed and 13 C tracer analysis is a foundational tool for such work. This biological system has a single-carbon input and a special network topology that together pose challenges to the current well-established methodology for 13 C tracer analysis using a multi-carbon input such as glucose, and to date, no 13 C tracer analysis of flux in a Type I methanotroph has been reported. In this study, we showed that by monitoring labeling patterns of several key intermediate metabolites in core metabolism, it is possible to quantitate the relative flux ratios for important branch points, such as the malate node. In addition, it is possible to assess the operation of the TCA cycle, which has been thought to be incomplete in Type I methanotrophs. Surprisingly, our analysis provides direct evidence of a complete, oxidative TCA cycle operating in M. buryatense 5GB1 using methane as sole carbon and energy substrate, contributing about 45% of the total flux for de novo malate production. Combined with mutant analysis, this method was able to identify fumA (METBUDRAFT_1453/MBURv2__60244) as the primary fumarase involved in the oxidative TCA cycle, among 2 predicted fumarases, supported by 13 C tracer analysis on both fumA and fumC single knockouts. Interrupting the oxidative TCA cycle leads to a severe growth defect, suggesting that the oxidative TCA cycle functions to not only provide precursors for de novo biomass synthesis, but also to provide reducing power to the system. This information provides new opportunities for metabolic engineering of M. buryatense for the production of

  9. TCA precipitation.

    PubMed

    Koontz, Laura

    2014-01-01

    Trichloroacetic acid (TCA) precipitation of proteins is commonly used to concentrate protein samples or remove contaminants, including salts and detergents, prior to downstream applications such as SDS-PAGE or 2D-gels. TCA precipitation denatures the protein, so it should not be used if the protein must remain in its folded state (e.g., if you want to measure a biochemical activity of the protein). © 2014 Elsevier Inc. All rights reserved.

  10. The Variations of Glycolysis and TCA Cycle Intermediate Levels Grown in Iron and Copper Mediums of Trichoderma harzianum.

    PubMed

    Tavsan, Zehra; Ayar Kayali, Hulya

    2015-05-01

    The efficiency of optimal metabolic function by microorganism depends on various parameters, especially essential metal supplementation. In the present study, the effects of iron and copper metals on metabolism were investigated by determination of glycolysis and tricarboxylic acid (TCA) cycle metabolites' levels with respect to the metal concentrations and incubation period in Trichoderma harzianum. The pyruvate and citrate levels of T. harzianum increased up to 15 mg/L of copper via redirection of carbon flux though glycolysis by suppression of pentose phosphate pathway (PPP). However, the α-ketoglutarate levels decreased at concentration higher than 5 mg/L of copper to overcome damage of oxidative stress. The fumarate levels correlated with the α-ketoglutarate levels because of substrate limitation. Besides, in T. harzianum cells grown in various concentrations of iron-containing medium, the intracellular pyruvate, citrate, and α-ketoglutarate levels showed positive correlation with iron concentration due to modifying of expression of glycolysis and TCA cycle enzymes via a mechanism involving cofactor or allosteric regulation. However, as a result of consuming of prior substrates required for fumarate production, its levels rose up to 10 mg/L.

  11. Computational exploration of the chemical structure space of possible reverse tricarboxylic acid cycle constituents.

    PubMed

    Meringer, Markus; Cleaves, H James

    2017-12-13

    The reverse tricarboxylic acid (rTCA) cycle has been explored from various standpoints as an idealized primordial metabolic cycle. Its simplicity and apparent ubiquity in diverse organisms across the tree of life have been used to argue for its antiquity and its optimality. In 2000 it was proposed that chemoinformatics approaches support some of these views. Specifically, defined queries of the Beilstein database showed that the molecules of the rTCA are heavily represented in such compound databases. We explore here the chemical structure "space," e.g. the set of organic compounds which possesses some minimal set of defining characteristics, of the rTCA cycle's intermediates using an exhaustive structure generation method. The rTCA's chemical space as defined by the original criteria and explored by our method is some six to seven times larger than originally considered. Acknowledging that each assumption in what is a defining criterion making the rTCA cycle special limits possible generative outcomes, there are many unrealized compounds which fulfill these criteria. That these compounds are unrealized could be due to evolutionary frozen accidents or optimization, though this optimization may also be for systems-level reasons, e.g., the way the pathway and its elements interface with other aspects of metabolism.

  12. Comparative study of 15% TCA peel versus 35% glycolic acid peel for the treatment of melasma

    PubMed Central

    Puri, Neerja

    2012-01-01

    Background: Chemical peels are the mainstay of a cosmetic practitioner's armamentarium because they can be used to treat some skin disorders and can provide aesthetic benefit. Objectives: To compare 15% TCA peel and 35% glycolic acid peel for the treatment of melasma. Material and Methods: We selected 30 participants of melasma aged between 20 and 50 years from the dermatology outpatient department and treated equal numbers with 15% TCA and 35% glycolic acid. Results: Subjective response as graded by the patient showed good or very good response in 70% participants in the glycolic acid group and 64% in the TCA group. Conclusions: There was statistically insignificant difference in the efficacy between the two groups for the treatment of melasma. PMID:23130283

  13. A Process-Based Model of TCA Cycle Functioning to Analyze Citrate Accumulation in Pre- and Post-Harvest Fruits.

    PubMed

    Etienne, Audrey; Génard, Michel; Bugaud, Christophe

    2015-01-01

    Citrate is one of the most important organic acids in many fruits and its concentration plays a critical role in organoleptic properties. The regulation of citrate accumulation throughout fruit development, and the origins of the phenotypic variability of the citrate concentration within fruit species remain to be clarified. In the present study, we developed a process-based model of citrate accumulation based on a simplified representation of the TCA cycle to predict citrate concentration in fruit pulp during the pre- and post-harvest stages. Banana fruit was taken as a reference because it has the particularity of having post-harvest ripening, during which citrate concentration undergoes substantial changes. The model was calibrated and validated on the two stages, using data sets from three contrasting cultivars in terms of citrate accumulation, and incorporated different fruit load, potassium supply, and harvest dates. The model predicted the pre and post-harvest dynamics of citrate concentration with fairly good accuracy for the three cultivars. The model suggested major differences in TCA cycle functioning among cultivars during post-harvest ripening of banana, and pointed to a potential role for NAD-malic enzyme and mitochondrial malate carriers in the genotypic variability of citrate concentration. The sensitivity of citrate accumulation to growth parameters and temperature differed among cultivars during post-harvest ripening. Finally, the model can be used as a conceptual basis to study citrate accumulation in fleshy fruits and may be a powerful tool to improve our understanding of fruit acidity.

  14. IRIS Toxicological Review of Trichloroacetic Acid (TCA) (Interagency Science Discussion Draft)

    EPA Science Inventory

    EPA is releasing the draft report, Toxicological Review of Trichloroacetic Acid (TCA), that was distributed to Federal agencies and White House Offices for comment during the Science Discussion step of the IRIS Assessment Development ...

  15. Quantitative importance of the pentose phosphate pathway determined by incorporation of 13C from [2-13C]- and [3-13C]glucose into TCA cycle intermediates and neurotransmitter amino acids in functionally intact neurons.

    PubMed

    Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

    2012-09-01

    The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-(13)C]glucose or [3-(13)C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of (13)C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ~6% of glucose metabolism in cortical neurons and ~4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that (13)C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons.

  16. Disruption of TCA Cycle and Glutamate Metabolism Identified by Metabolomics in an In Vitro Model of Amyotrophic Lateral Sclerosis.

    PubMed

    Veyrat-Durebex, Charlotte; Corcia, Philippe; Piver, Eric; Devos, David; Dangoumau, Audrey; Gouel, Flore; Vourc'h, Patrick; Emond, Patrick; Laumonnier, Frédéric; Nadal-Desbarats, Lydie; Gordon, Paul H; Andres, Christian R; Blasco, Hélène

    2016-12-01

    This study aims to develop a cellular metabolomics model that reproduces the pathophysiological conditions found in amyotrophic lateral sclerosis in order to improve knowledge of disease physiology. We used a co-culture model combining the motor neuron-like cell line NSC-34 and the astrocyte clone C8-D1A, with each over-expressing wild-type or G93C mutant human SOD1, to examine amyotrophic lateral sclerosis (ALS) physiology. We focused on the effects of mutant human SOD1 as well as oxidative stress induced by menadione on intracellular metabolism using a metabolomics approach through gas chromatography coupled with mass spectrometry (GC-MS) analysis. Preliminary non-supervised analysis by Principal Component Analysis (PCA) revealed that cell type, genetic environment, and time of culture influenced the metabolomics profiles. Supervised analysis using orthogonal partial least squares discriminant analysis (OPLS-DA) on data from intracellular metabolomics profiles of SOD1 G93C co-cultures produced metabolites involved in glutamate metabolism and the tricarboxylic acid cycle (TCA) cycle. This study revealed the feasibility of using a metabolomics approach in a cellular model of ALS. We identified potential disruption of the TCA cycle and glutamate metabolism under oxidative stress, which is consistent with prior research in the disease. Analysis of metabolic alterations in an in vitro model is a novel approach to investigation of disease physiology.

  17. Glucose-independent glutamine metabolism via TCA cycling for proliferation and survival in B-cells

    PubMed Central

    Le, Anne; Lane, Andrew N.; Hamaker, Max; Bose, Sminu; Gouw, Arvin; Barbi, Joseph; Tsukamoto, Takashi; Rojas, Camilio J.; Slusher, Barbara S.; Zhang, Haixia; Zimmerman, Lisa J.; Liebler, Daniel C.; Slebos, Robbert J.C.; Lorkiewicz, Pawel K.; Higashi, Richard M.; Fan, Teresa W. M.; Dang, Chi V.

    2012-01-01

    Summary Because MYC plays a causal role in many human cancers, including those with hypoxic and nutrient-poor tumor microenvironments, we have determined the metabolic responses of a MYC-inducible human Burkitt lymphoma model P493 cell line to aerobic and hypoxic conditions, and to glucose deprivation, using Stable Isotope Resolved Metabolomics. Using [U-13C]-glucose as the tracer, both glucose consumption and lactate production were increased by MYC expression and hypoxia. Using [U-13C,15N]-glutamine as the tracer, glutamine import and metabolism through the TCA cycle persisted under hypoxia, and glutamine contributed significantly to citrate carbons. Under glucose deprivation, glutamine-derived fumarate, malate, and citrate were significantly increased. Their 13C labeling patterns demonstrate an alternative energy-generating glutaminolysis pathway involving a glucose-independent TCA cycle. The essential role of glutamine metabolism in cell survival and proliferation under hypoxia and glucose deficiency, makes them susceptible to the glutaminase inhibitor BPTES, and hence could be targeted for cancer therapy. PMID:22225880

  18. Inhibition of Pyruvate Dehydrogenase Kinase 2 Protects Against Hepatic Steatosis Through Modulation of Tricarboxylic Acid Cycle Anaplerosis and Ketogenesis.

    PubMed

    Go, Younghoon; Jeong, Ji Yun; Jeoung, Nam Ho; Jeon, Jae-Han; Park, Bo-Yoon; Kang, Hyeon-Ji; Ha, Chae-Myeong; Choi, Young-Keun; Lee, Sun Joo; Ham, Hye Jin; Kim, Byung-Gyu; Park, Keun-Gyu; Park, So Young; Lee, Chul-Ho; Choi, Cheol Soo; Park, Tae-Sik; Lee, W N Paul; Harris, Robert A; Lee, In-Kyu

    2016-10-01

    Hepatic steatosis is associated with increased insulin resistance and tricarboxylic acid (TCA) cycle flux, but decreased ketogenesis and pyruvate dehydrogenase complex (PDC) flux. This study examined whether hepatic PDC activation by inhibition of pyruvate dehydrogenase kinase 2 (PDK2) ameliorates these metabolic abnormalities. Wild-type mice fed a high-fat diet exhibited hepatic steatosis, insulin resistance, and increased levels of pyruvate, TCA cycle intermediates, and malonyl-CoA but reduced ketogenesis and PDC activity due to PDK2 induction. Hepatic PDC activation by PDK2 inhibition attenuated hepatic steatosis, improved hepatic insulin sensitivity, reduced hepatic glucose production, increased capacity for β-oxidation and ketogenesis, and decreased the capacity for lipogenesis. These results were attributed to altered enzymatic capacities and a reduction in TCA anaplerosis that limited the availability of oxaloacetate for the TCA cycle, which promoted ketogenesis. The current study reports that increasing hepatic PDC activity by inhibition of PDK2 ameliorates hepatic steatosis and insulin sensitivity by regulating TCA cycle anaplerosis and ketogenesis. The findings suggest PDK2 is a potential therapeutic target for nonalcoholic fatty liver disease. © 2016 by the American Diabetes Association.

  19. Quantitative importance of the pentose phosphate pathway determined by incorporation of 13C from [2-13C]- and [3-13C]glucose into TCA cycle intermediates and neurotransmitter amino acids in functionally intact neurons

    PubMed Central

    Brekke, Eva M F; Walls, Anne B; Schousboe, Arne; Waagepetersen, Helle S; Sonnewald, Ursula

    2012-01-01

    The brain is highly susceptible to oxidative injury, and the pentose phosphate pathway (PPP) has been shown to be affected by pathological conditions, such as Alzheimer's disease and traumatic brain injury. While this pathway has been investigated in the intact brain and in astrocytes, little is known about the PPP in neurons. The activity of the PPP was quantified in cultured cerebral cortical and cerebellar neurons after incubation in the presence of [2-13C]glucose or [3-13C]glucose. The activity of the PPP was several fold lower than glycolysis in both types of neurons. While metabolism of 13C-labeled glucose via the PPP does not appear to contribute to the production of releasable lactate, it contributes to labeling of tricarboxylic acid (TCA) cycle intermediates and related amino acids. Based on glutamate isotopomers, it was calculated that PPP activity accounts for ∼6% of glucose metabolism in cortical neurons and ∼4% in cerebellar neurons. This is the first demonstration that pyruvate generated from glucose via the PPP contributes to the synthesis of acetyl CoA for oxidation in the TCA cycle. Moreover, the fact that 13C labeling from glucose is incorporated into glutamate proves that both the oxidative and the nonoxidative stages of the PPP are active in neurons. PMID:22714050

  20. Index markers of chronic fatigue syndrome with dysfunction of TCA and urea cycles

    PubMed Central

    Yamano, Emi; Sugimoto, Masahiro; Hirayama, Akiyoshi; Kume, Satoshi; Yamato, Masanori; Jin, Guanghua; Tajima, Seiki; Goda, Nobuhito; Iwai, Kazuhiro; Fukuda, Sanae; Yamaguti, Kouzi; Kuratsune, Hirohiko; Soga, Tomoyoshi; Watanabe, Yasuyoshi; Kataoka, Yosky

    2016-01-01

    Chronic fatigue syndrome (CFS) is a persistent and unexplained pathological state characterized by exertional and severely debilitating fatigue, with/without infectious or neuropsychiatric symptoms, lasting at least 6 consecutive months. Its pathogenesis remains incompletely understood. Here, we performed comprehensive metabolomic analyses of 133 plasma samples obtained from CFS patients and healthy controls to establish an objective diagnosis of CFS. CFS patients exhibited significant differences in intermediate metabolite concentrations in the tricarboxylic acid (TCA) and urea cycles. The combination of ornithine/citrulline and pyruvate/isocitrate ratios discriminated CFS patients from healthy controls, yielding area under the receiver operating characteristic curve values of 0.801 (95% confidential interval [CI]: 0.711–0.890, P < 0.0001) and 0.750 (95% CI: 0.584–0.916, P = 0.0069) for training (n = 93) and validation (n = 40) datasets, respectively. These findings provide compelling evidence that a clinical diagnostic tool could be developed for CFS based on the ratios of metabolites in plasma. PMID:27725700

  1. Methylcitrate cycle defines the bactericidal essentiality of isocitrate lyase for survival of Mycobacterium tuberculosis on fatty acids

    PubMed Central

    Eoh, Hyungjin; Rhee, Kyu Y.

    2014-01-01

    Few mutations attenuate Mycobacterium tuberculosis (Mtb) more profoundly than deletion of its isocitrate lyases (ICLs). However, the basis for this attenuation remains incompletely defined. Mtb’s ICLs are catalytically bifunctional isocitrate and methylisocitrate lyases required for growth on even and odd chain fatty acids. Here, we report that Mtb’s ICLs are essential for survival on both acetate and propionate because of its methylisocitrate lyase (MCL) activity. Lack of MCL activity converts Mtb’s methylcitrate cycle into a “dead end” pathway that sequesters tricarboxylic acid (TCA) cycle intermediates into methylcitrate cycle intermediates, depletes gluconeogenic precursors, and results in defects of membrane potential and intrabacterial pH. Activation of an alternative vitamin B12-dependent pathway of propionate metabolism led to selective corrections of TCA cycle activity, membrane potential, and intrabacterial pH that specifically restored survival, but not growth, of ICL-deficient Mtb metabolizing acetate or propionate. These results thus resolve the biochemical basis of essentiality for Mtb’s ICLs and survival on fatty acids. PMID:24639517

  2. Metabolomics and transcriptomics profiles reveal the dysregulation of the tricarboxylic acid cycle and related mechanisms in prostate cancer.

    PubMed

    Shao, Yaping; Ye, Guozhu; Ren, Shancheng; Piao, Hai-Long; Zhao, Xinjie; Lu, Xin; Wang, Fubo; Ma, Wang; Li, Jia; Yin, Peiyuan; Xia, Tian; Xu, Chuanliang; Yu, Jane J; Sun, Yinghao; Xu, Guowang

    2018-07-15

    Genetic alterations drive metabolic reprograming to meet increased biosynthetic precursor and energy demands for cancer cell proliferation and survival in unfavorable environments. A systematic study of gene-metabolite regulatory networks and metabolic dysregulation should reveal the molecular mechanisms underlying prostate cancer (PCa) pathogenesis. Herein, we performed gas chromatography-mass spectrometry (GC-MS)-based metabolomics and RNA-seq analyses in prostate tumors and matched adjacent normal tissues (ANTs) to elucidate the molecular alterations and potential underlying regulatory mechanisms in PCa. Significant accumulation of metabolic intermediates and enrichment of genes in the tricarboxylic acid (TCA) cycle were observed in tumor tissues, indicating TCA cycle hyperactivation in PCa tissues. In addition, the levels of fumarate and malate were highly correlated with the Gleason score, tumor stage and expression of genes encoding related enzymes and were significantly related to the expression of genes involved in branched chain amino acid degradation. Using an integrated omics approach, we further revealed the potential anaplerotic routes from pyruvate, glutamine catabolism and branched chain amino acid (BCAA) degradation contributing to replenishing metabolites for TCA cycle. Integrated omics techniques enable the performance of network-based analyses to gain a comprehensive and in-depth understanding of PCa pathophysiology and may facilitate the development of new and effective therapeutic strategies. © 2018 UICC.

  3. Glutamine oxidation maintains the TCA cycle and cell survival during impaired mitochondrial pyruvate transport.

    PubMed

    Yang, Chendong; Ko, Bookyung; Hensley, Christopher T; Jiang, Lei; Wasti, Ajla T; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E; DeBerardinis, Ralph J

    2014-11-06

    Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and reroutes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Glutamine oxidation maintains the TCA cycle and cell survival during impaired mitochondrial pyruvate transport

    PubMed Central

    Yang, Chendong; Ko, Bookyung; Hensley, Christopher T.; Jiang, Lei; Wasti, Ajla T.; Kim, Jiyeon; Sudderth, Jessica; Calvaruso, Maria Antonietta; Lumata, Lloyd; Mitsche, Matthew; Rutter, Jared; Merritt, Matthew E.; DeBerardinis, Ralph J.

    2014-01-01

    Summary Alternative modes of metabolism enable cells to resist metabolic stress. Inhibiting these compensatory pathways may produce synthetic lethality. We previously demonstrated that glucose deprivation stimulated a pathway in which acetyl-CoA was formed from glutamine downstream of glutamate dehydrogenase (GDH). Here we show that import of pyruvate into the mitochondria suppresses GDH and glutamine-dependent acetyl-CoA formation. Inhibiting the mitochondrial pyruvate carrier (MPC) activates GDH and re-routes glutamine metabolism to generate both oxaloacetate and acetyl-CoA, enabling persistent tricarboxylic acid (TCA) cycle function. Pharmacological blockade of GDH elicited largely cytostatic effects in culture, but these effects became cytotoxic when combined with MPC inhibition. Concomitant administration of MPC and GDH inhibitors significantly impaired tumor growth compared to either inhibitor used as a single agent. Together, the data define a mechanism to induce glutaminolysis and uncover a survival pathway engaged during compromised supply of pyruvate to the mitochondria. PMID:25458842

  5. Enzymatic mechanism of oxalate production in the TCA and glyoxylate pathways using various isolates of Antrodia radiculosa

    Treesearch

    K.M. Jenkins; S.V. Diehl; C.A. Clausen; F. Green

    2011-01-01

    Brown-rot fungi produce oxalate in large amounts; however, levels of accumulation and function vary by species. Copper-tolerant fungi, like Antrodia radiculosa, produce and accumulate high levels of oxalate in response to copper. Oxalate biosynthesis in copper-tolerant fungi has been linked to the glyoxylate and tricarboxylic acid (TCA) cycles. Within these two cycles...

  6. Effect of tricarboxylic acid cycle regulator on carbon retention and organic component transformation during food waste composting.

    PubMed

    Lu, Qian; Zhao, Yue; Gao, Xintong; Wu, Junqiu; Zhou, Haixuan; Tang, Pengfei; Wei, Qingbin; Wei, Zimin

    2018-05-01

    Composting is an environment friendly method to recycling organic waste. However, with the increasing concern about greenhouse gases generated in global atmosphere, it is significant to reduce the emission of carbon dioxide (CO 2 ). This study analyzes tricarboxylic acid (TCA) cycle regulators on the effect of reducing CO 2 emission, and the relationship among organic component (OC) degradation and transformation and microorganism during composting. The results showed that adding adenosine tri-phosphate (ATP) and nicotinamide adenine dinucleotide (NADH) could enhance the transformation of OC and increase the diversity of microorganism community. Malonic acid (MA) as a competitive inhibitor could decrease the emission of CO 2 by inhibiting the TCA cycle. A structural equation model was established to explore effects of different OC and microorganism on humic acid (HA) concentration during composting. Furthermore, added MA provided an environmental benefit in reducing the greenhouse gas emission for manufacture sustainable products. Copyright © 2018 Elsevier Ltd. All rights reserved.

  7. Protein-protein interactions and metabolite channelling in the plant tricarboxylic acid cycle

    PubMed Central

    Zhang, Youjun; Beard, Katherine F. M.; Swart, Corné; Bergmann, Susan; Krahnert, Ina; Nikoloski, Zoran; Graf, Alexander; Ratcliffe, R. George; Sweetlove, Lee J.; Fernie, Alisdair R.; Obata, Toshihiro

    2017-01-01

    Protein complexes of sequential metabolic enzymes, often termed metabolons, may permit direct channelling of metabolites between the enzymes, providing increased control over metabolic pathway fluxes. Experimental evidence supporting their existence in vivo remains fragmentary. In the present study, we test binary interactions of the proteins constituting the plant tricarboxylic acid (TCA) cycle. We integrate (semi-)quantitative results from affinity purification-mass spectrometry, split-luciferase and yeast-two-hybrid assays to generate a single reliability score for assessing protein–protein interactions. By this approach, we identify 158 interactions including those between catalytic subunits of sequential enzymes and between subunits of enzymes mediating non-adjacent reactions. We reveal channelling of citrate and fumarate in isolated potato mitochondria by isotope dilution experiments. These results provide evidence for a functional TCA cycle metabolon in plants, which we discuss in the context of contemporary understanding of this pathway in other kingdoms. PMID:28508886

  8. In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance.

    PubMed

    Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf

    2012-12-01

    The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics.

  9. In vivo detection of brain Krebs cycle intermediate by hyperpolarized magnetic resonance

    PubMed Central

    Mishkovsky, Mor; Comment, Arnaud; Gruetter, Rolf

    2012-01-01

    The Krebs (or tricarboxylic acid (TCA)) cycle has a central role in the regulation of brain energy regulation and metabolism, yet brain TCA cycle intermediates have never been directly detected in vivo. This study reports the first direct in vivo observation of a TCA cycle intermediate in intact brain, namely, 2-oxoglutarate, a key biomolecule connecting metabolism to neuronal activity. Our observation reveals important information about in vivo biochemical processes hitherto considered undetectable. In particular, it provides direct evidence that transport across the inner mitochondria membrane is rate limiting in the brain. The hyperpolarized magnetic resonance protocol designed for this study opens the way to direct and real-time studies of TCA cycle kinetics. PMID:22990416

  10. TCA cycle rewiring fosters metabolic adaptation to oxygen restriction in skeletal muscle from rodents and humans.

    PubMed

    Capitanio, Daniele; Fania, Chiara; Torretta, Enrica; Viganò, Agnese; Moriggi, Manuela; Bravatà, Valentina; Caretti, Anna; Levett, Denny Z H; Grocott, Michael P W; Samaja, Michele; Cerretelli, Paolo; Gelfi, Cecilia

    2017-08-29

    In mammals, hypoxic stress management is under the control of the Hypoxia Inducible Factors, whose activity depends on the stabilization of their labile α subunit. In particular, the skeletal muscle appears to be able to react to changes in substrates and O 2 delivery by tuning its metabolism. The present study provides a comprehensive overview of skeletal muscle metabolic adaptation to hypoxia in mice and in human subjects exposed for 7/9 and 19 days to high altitude levels. The investigation was carried out combining proteomics, qRT-PCR mRNA transcripts analysis, and enzyme activities assessment in rodents, and protein detection by antigen antibody reactions in humans and rodents. Results indicate that the skeletal muscle react to a decreased O 2 delivery by rewiring the TCA cycle. The first TCA rewiring occurs in mice in 2-day hypoxia and is mediated by cytosolic malate whereas in 10-day hypoxia the rewiring is mediated by Idh1 and Fasn, supported by glutamine and HIF-2α increments. The combination of these specific anaplerotic steps can support energy demand despite HIFs degradation. These results were confirmed in human subjects, demonstrating that the TCA double rewiring represents an essential factor for the maintenance of muscle homeostasis during adaptation to hypoxia.

  11. Decreased glycolytic and tricarboxylic acid cycle intermediates coincide with peripheral nervous system oxidative stress in a murine model of type 2 diabetes.

    PubMed

    Hinder, Lucy M; Vivekanandan-Giri, Anuradha; McLean, Lisa L; Pennathur, Subramaniam; Feldman, Eva L

    2013-01-01

    Diabetic neuropathy (DN) is the most common complication of diabetes and is characterized by distal-to-proximal loss of peripheral nerve axons. The idea of tissue-specific pathological alterations in energy metabolism in diabetic complications-prone tissues is emerging. Altered nerve metabolism in type 1 diabetes models is observed; however, therapeutic strategies based on these models offer limited efficacy to type 2 diabetic patients with DN. Therefore, understanding how peripheral nerves metabolically adapt to the unique type 2 diabetic environment is critical to develop disease-modifying treatments. In the current study, we utilized targeted liquid chromatography-tandem mass spectrometry (LC/MS/MS) to characterize the glycolytic and tricarboxylic acid (TCA) cycle metabolomes in sural nerve, sciatic nerve, and dorsal root ganglia (DRG) from male type 2 diabetic mice (BKS.Cg-m+/+Lepr(db); db/db) and controls (db/+). We report depletion of glycolytic intermediates in diabetic sural nerve and sciatic nerve (glucose-6-phosphate, fructose-6-phosphate, fructose-1,6-bisphosphate (sural nerve only), 3-phosphoglycerate, 2-phosphoglycerate, phosphoenolpyruvate, and lactate), with no significant changes in DRG. Citrate and isocitrate TCA cycle intermediates were decreased in sural nerve, sciatic nerve, and DRG from diabetic mice. Utilizing LC/electrospray ionization/MS/MS and HPLC methods, we also observed increased protein and lipid oxidation (nitrotyrosine; hydroxyoctadecadienoic acids) in db/db tissue, with a proximal-to-distal increase in oxidative stress, with associated decreased aconitase enzyme activity. We propose a preliminary model, whereby the greater change in metabolomic profile, increase in oxidative stress, and decrease in TCA cycle enzyme activity may cause distal peripheral nerves to rely on truncated TCA cycle metabolism in the type 2 diabetes environment.

  12. Oxaloacetate-to-malate conversion by mineral photoelectrochemistry: implications for the viability of the reductive tricarboxylic acid cycle in prebiotic chemistry

    NASA Astrophysics Data System (ADS)

    Guzman, Marcelo I.; Martin, Scot T.

    2008-10-01

    The carboxylic acids produced by the reductive tricarboxylic acid (rTCA) cycle are possibly a biosynthetic core of initial life, although several steps such as the reductive kinetics of oxaloacetate (OAA) to malate (MA) are problematic by conventional chemical routes. In this context, we studied the kinetics of this reaction as promoted by ZnS mineral photoelectrochemistry. The quantum efficiency φMA of MA production from the photoelectrochemical reduction of OAA followed φMA=0.13 [OAA] (2.1×10-3+[OAA])-1 and was independent of temperature (5 to 50°C). To evaluate the importance of this forward rate under a prebiotic scenario, we also studied the temperature-dependent rate of the backward thermal decarboxylation of OAA to pyruvate (PA), which followed an Arrhenius behavior as log (k-2)=11.74 4956/T, where k-2 is in units of s-1. These measured rates were employed in conjunction with the indirectly estimated carboxylation rate of PA to OAA to assess the possible importance of mineral photoelectrochemistry in the conversion of OAA to MA under several scenarios of prebiotic conditions on early Earth. As an example, our analysis shows that there is 90% efficiency with a forward velocity of 3 yr/cycle for the OAA→MA step of the rTCA cycle at 280 K. Efficiency and velocity both decrease for increasing temperature. These results suggest high viability for mineral photoelectrochemistry as an enzyme-free engine to drive the rTCA cycle through the early aeons of early Earth, at least for the investigated OAA→MA step.

  13. The TCA cycle is not required for selection or survival of multidrug-resistant Salmonella

    PubMed Central

    Ricci, Vito; Loman, Nick; Pallen, Mark; Ivens, Alasdair; Fookes, Maria; Langridge, Gemma C.; Wain, John; Piddock, Laura J. V.

    2012-01-01

    Objectives The initial aim of this study was to use a systems biology approach to analyse a ciprofloxacin-selected multidrug-resistant (MDR) Salmonella enterica serotype Typhimurium, L664. Methods The whole genome sequence and transcriptome of L664 were analysed. Site-directed mutagenesis to recreate each mutation was carried out, followed by phenotypic characterization and mutation frequency analysis. As a mutation in the TCA cycle was detected we tested the controversial hypothesis regarding the bacterial response to bactericidal antibiotics, put forward by Kohanski et al. (Cell 2007; 130: 797–810 and Mol Cell 2010; 37: 311–20), that exposure of bacteria to agents such as ciprofloxacin produces reactive oxygen species (ROS), which transiently increase the mutation rate giving rise to MDR bacteria. Results L664 contained a mutation in ramR that conferred MDR. A mutation in tctA affected the TCA cycle and conferred the inability to grow on minimal agar. The virulence of L664 was not attenuated. Ciprofloxacin exposure produced ROS in L664 and SL1344 (tctA::aph), but it was reduced and occurred later. There were no significant differences in the rates of killing or mutations per generation to antibiotic resistance between the strains. Conclusions Whilst we confirm production of ROS in response to ciprofloxacin, we have no data to support the hypothesis that this leads to selection of MDR strains. Our results indicate that the mutations in tctA and glgA were random as they did not pre-exist in the parental strain, and that the mutation in tctA did not provide a survival advantage or disadvantage in the presence of antibiotic. PMID:22186876

  14. Poly(3-hydroxybutyrate) fuels the tricarboxylic acid cycle and de novo lipid biosynthesis during Bacillus anthracis sporulation.

    PubMed

    Sadykov, Marat R; Ahn, Jong-Sam; Widhelm, Todd J; Eckrich, Valerie M; Endres, Jennifer L; Driks, Adam; Rutkowski, Gregory E; Wingerd, Kevin L; Bayles, Kenneth W

    2017-06-01

    Numerous bacteria accumulate poly(3-hydroxybutyrate) (PHB) as an intracellular reservoir of carbon and energy in response to imbalanced nutritional conditions. In Bacillus spp., where PHB biosynthesis precedes the formation of the dormant cell type called the spore (sporulation), the direct link between PHB accumulation and efficiency of sporulation was observed in multiple studies. Although the idea of PHB as an intracellular carbon and energy source fueling sporulation was proposed several decades ago, the mechanisms underlying PHB contribution to sporulation have not been defined. Here, we demonstrate that PHB deficiency impairs Bacillus anthracis sporulation through diminishing the energy status of the cells and by reducing carbon flux into the tricarboxylic acid (TCA) cycle and de novo lipid biosynthesis. Consequently, this metabolic imbalance decreased biosynthesis of the critical components required for spore integrity and resistance, such as dipicolinic acid (DPA) and the spore's inner membrane. Supplementation of the PHB deficient mutant with exogenous fatty acids overcame these sporulation defects, highlighting the importance of the TCA cycle and lipid biosynthesis during sporulation. Combined, the results of this work reveal the molecular mechanisms of PHB contribution to B. anthracis sporulation and provide valuable insight into the metabolic requirements for this developmental process in Bacillus species. © 2017 John Wiley & Sons Ltd.

  15. Use of response surface methodology in a fed-batch process for optimization of tricarboxylic acid cycle intermediates to achieve high levels of canthaxanthin from Dietzia natronolimnaea HS-1.

    PubMed

    Nasri Nasrabadi, Mohammad Reza; Razavi, Seyed Hadi

    2010-04-01

    In this work, we applied statistical experimental design to a fed-batch process for optimization of tricarboxylic acid cycle (TCA) intermediates in order to achieve high-level production of canthaxanthin from Dietzia natronolimnaea HS-1 cultured in beet molasses. A fractional factorial design (screening test) was first conducted on five TCA cycle intermediates. Out of the five TCA cycle intermediates investigated via screening tests, alfaketoglutarate, oxaloacetate and succinate were selected based on their statistically significant (P<0.05) and positive effects on canthaxanthin production. These significant factors were optimized by means of response surface methodology (RSM) in order to achieve high-level production of canthaxanthin. The experimental results of the RSM were fitted with a second-order polynomial equation by means of a multiple regression technique to identify the relationship between canthaxanthin production and the three TCA cycle intermediates. By means of this statistical design under a fed-batch process, the optimum conditions required to achieve the highest level of canthaxanthin (13172 + or - 25 microg l(-1)) were determined as follows: alfaketoglutarate, 9.69 mM; oxaloacetate, 8.68 mM; succinate, 8.51 mM. Copyright 2009 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  16. Urinary Loss of Tricarboxylic Acid Cycle Intermediates As Revealed by Metabolomics Studies: An Underlying Mechanism to Reduce Lipid Accretion by Whey Protein Ingestion?

    PubMed Central

    2015-01-01

    Whey protein intake is associated with the modulation of energy metabolism and altered body composition both in human subjects and in animals, but the underlying mechanisms are not yet elucidated. We fed obesity-prone C57BL/6J mice high-fat diets with either casein (HF casein) or whey (HF whey) for 6 weeks. At equal energy intake and apparent fat and nitrogen digestibility, mice fed HF whey stored less energy as lipids, evident both as lower white adipose tissue mass and as reduced liver lipids, compared with HF-casein-fed mice. Explorative analyses of 48 h urine, both by 1H NMR and LC–MS metabolomic platforms, demonstrated higher urinary excretion of tricarboxylic acid (TCA) cycle intermediates citric acid and succinic acid (identified by both platforms), and cis-aconitic acid and isocitric acid (identified by LC–MS platform) in the HF whey, relative to in the HF-casein-fed mice. Targeted LC–MS analyses revealed higher citric acid and cis-aconitic acid concentrations in fed state plasma, but not in liver of HF-whey-fed mice. We propose that enhanced urinary loss of TCA cycle metabolites drain available substrates for anabolic processes, such as lipogenesis, thereby leading to reduced lipid accretion in HF-whey-fed compared to HF-casein-fed mice. PMID:24702026

  17. Mitochondria-Translocated PGK1 Functions as a Protein Kinase to Coordinate Glycolysis and the TCA Cycle in Tumorigenesis.

    PubMed

    Li, Xinjian; Jiang, Yuhui; Meisenhelder, Jill; Yang, Weiwei; Hawke, David H; Zheng, Yanhua; Xia, Yan; Aldape, Kenneth; He, Jie; Hunter, Tony; Wang, Liwei; Lu, Zhimin

    2016-03-03

    It is unclear how the Warburg effect that exemplifies enhanced glycolysis in the cytosol is coordinated with suppressed mitochondrial pyruvate metabolism. We demonstrate here that hypoxia, EGFR activation, and expression of K-Ras G12V and B-Raf V600E induce mitochondrial translocation of phosphoglycerate kinase 1 (PGK1); this is mediated by ERK-dependent PGK1 S203 phosphorylation and subsequent PIN1-mediated cis-trans isomerization. Mitochondrial PGK1 acts as a protein kinase to phosphorylate pyruvate dehydrogenase kinase 1 (PDHK1) at T338, which activates PDHK1 to phosphorylate and inhibit the pyruvate dehydrogenase (PDH) complex. This reduces mitochondrial pyruvate utilization, suppresses reactive oxygen species production, increases lactate production, and promotes brain tumorigenesis. Furthermore, PGK1 S203 and PDHK1 T338 phosphorylation levels correlate with PDH S293 inactivating phosphorylation levels and poor prognosis in glioblastoma patients. This work highlights that PGK1 acts as a protein kinase in coordinating glycolysis and the tricarboxylic acid (TCA) cycle, which is instrumental in cancer metabolism and tumorigenesis. Copyright © 2016 Elsevier Inc. All rights reserved.

  18. Glutamate is the major anaplerotic substrate in the tricarboxylic acid cycle of isolated rumen epithelial and duodenal mucosal cells from beef cattle

    USDA-ARS?s Scientific Manuscript database

    This study aimed to determine the contribution of substrates to tricarboxylic acid (TCA) cycle fluxes in rumen epithelial (REC) and duodenal mucosal (DMC) cells isolated from bulls (n = 6) fed either a 75% forage (HF) or 75% concentrate (HC) diet. In separate incubations, [13C6]glucose, [13C5]glutam...

  19. Artificial Autopolyploidization Modifies the Tricarboxylic Acid Cycle and GABA Shunt in Arabidopsis thaliana Col-0

    NASA Astrophysics Data System (ADS)

    Vergara, Fredd; Kikuchi, Jun; Breuer, Christian

    2016-05-01

    Autopolyploidy is a process whereby the chromosome set is multiplied and it is a common phenomenon in angiosperms. Autopolyploidy is thought to be an important evolutionary force that has led to the formation of new plant species. Despite its relevance, the consequences of autopolyploidy in plant metabolism are poorly understood. This study compares the metabolic profiles of natural diploids and artificial autotetraploids of Arabidopsis thaliana Col-0. Different physiological parameters are compared between diploids and autotetraploids using nuclear magnetic resonance (NMR), elemental analysis (carbon:nitrogen balance) and quantitative real-time PCR (qRT-PCR). The main difference between diploid and autotetraploid A. thaliana Col-0 is observed in the concentration of metabolites related to the tricarboxylic acid cycle (TCA) and γ-amino butyric acid (GABA) shunt, as shown by multivariate statistical analysis of NMR spectra. qRT-PCR shows that genes related to the TCA and GABA shunt are also differentially expressed between diploids and autotetraploids following similar trends as their corresponding metabolites. Solid evidence is presented to demonstrate that autopolyploidy influences core plant metabolic processes.

  20. TCA High Lift Preliminary Assessment

    NASA Technical Reports Server (NTRS)

    Wyatt, G. H.; Polito, R. C.; Yeh, D. T.; Elzey, M. E.; Tran, J. T.; Meredith, Paul T.

    1999-01-01

    This paper presents a TCA (Technology Concept Airplane) High lift Preliminary Assessment. The topics discussed are: 1) Model Description; 2) Data Repeatability; 3) Effect of Inboard L.E. (Leading Edge) Flap Span; 4) Comparison of 14'x22' TCA-1 With NTF (National Transonic Facility) Modified Ref. H; 5) Comparison of 14'x22' and NTF Ref. H Results; 6) Effect of Outboard Sealed Slat on TCA; 7) TCA Full Scale Build-ups; 8) Full Scale L/D Comparisons; 9) TCA Full Scale; and 10) Touchdown Lift Curves. This paper is in viewgraph form.

  1. Alternative reactions at the interface of glycolysis and citric acid cycle in Saccharomyces cerevisiae

    PubMed Central

    van Rossum, Harmen M.; Kozak, Barbara U.; Niemeijer, Matthijs S.; Duine, Hendrik J.; Luttik, Marijke A. H.; Boer, Viktor M.; Kötter, Peter; Daran, Jean-Marc G.; van Maris, Antonius J. A.

    2016-01-01

    Pyruvate and acetyl-coenzyme A, located at the interface between glycolysis and TCA cycle, are important intermediates in yeast metabolism and key precursors for industrially relevant products. Rational engineering of their supply requires knowledge of compensatory reactions that replace predominant pathways when these are inactivated. This study investigates effects of individual and combined mutations that inactivate the mitochondrial pyruvate-dehydrogenase (PDH) complex, extramitochondrial citrate synthase (Cit2) and mitochondrial CoA-transferase (Ach1) in Saccharomyces cerevisiae. Additionally, strains with a constitutively expressed carnitine shuttle were constructed and analyzed. A predominant role of the PDH complex in linking glycolysis and TCA cycle in glucose-grown batch cultures could be functionally replaced by the combined activity of the cytosolic PDH bypass and Cit2. Strongly impaired growth and a high incidence of respiratory deficiency in pda1Δ ach1Δ strains showed that synthesis of intramitochondrial acetyl-CoA as a metabolic precursor requires activity of either the PDH complex or Ach1. Constitutive overexpression of AGP2, HNM1, YAT2, YAT1, CRC1 and CAT2 enabled the carnitine shuttle to efficiently link glycolysis and TCA cycle in l-carnitine-supplemented, glucose-grown batch cultures. Strains in which all known reactions at the glycolysis-TCA cycle interface were inactivated still grew slowly on glucose, indicating additional flexibility at this key metabolic junction. PMID:26895788

  2. Effects of tretinoin pretreatment on TCA chemical peel in guinea pig skin.

    PubMed Central

    Kim, I. H.; Kim, H. K.; Kye, Y. C.

    1996-01-01

    This study was done to characterize the structural changes in the tretinoin pretreatment on trichloroacetic acid(TCA) chemical peel. In guinea pigs, the right halves pretreated with tretinoin and the left halves treated nothing were compared in their structural changes after TCA chemical peel. Epidermal thickness in the tretinoin pretreated group was almost the same in the first and second week. But epidermis of the TCA group increased continuously. In the first week, mitotic figures in the epidermis were more increased in the TCA group, but those in hair follicles were more increased in the tretinoin pretreated group. In the second week, mitotic figures in the epidermis were almost same in both group, but in hair follicles of the tretinoin pretreated group, mitotic figures were much more increased. In alcian blue staining, glycosaminoglycan was stained much more strongly in dermis of the TCA group in first week, but was more strongly stained in the tretinoin pretreated group in second week. On electron microscopic findings, the fibroblasts in upper dermis were larger and had plentier cytoplasm with more organelles in the tretinoin pretreated group. Conclusively, tretinoin pretreatment on TCA chemical peel sustained the effects of TCA longer and showed synergistic effects of TCA and induced enhanced wound healing. PMID:8878803

  3. Sulfate radicals enable a non-enzymatic Krebs cycle precursor

    PubMed Central

    Keller, Markus A.; Kampjut, Domen; Harrison, Stuart A.; Ralser, Markus

    2017-01-01

    The evolutionary origins of the tricarboxylic acid cycle (TCA), or Krebs cycle, are so far unclear. Despite a few years ago, the existence of a simple non-enzymatic Krebs-cycle catalyst has been dismissed ‘as an appeal to magic’, citrate and other intermediates have meanwhile been discovered on a carbonaceous meteorite and do interconvert non-enzymatically. To identify the non-enzymatic Krebs cycle catalyst, we used combinatorial, quantitative high-throughput metabolomics to systematically screen iron and sulfate reaction milieus that orient on Archean sediment constituents. TCA cycle intermediates are found stable in water and in the presence of most iron and sulfate species, including simple iron-sulfate minerals. However, we report that TCA intermediates undergo 24 interconversion reactions in the presence of sulfate radicals that form from peroxydisulfate. The non-enzymatic reactions critically cover a topology as present in the Krebs cycle, the glyoxylate shunt and the succinic semialdehyde pathways. Assembled in a chemical network, the reactions achieve more than ninety percent carbon recovery. Our results show that a non-enzymatic precursor for the Krebs cycle is biologically sensible, efficient, and forms spontaneously in the presence of sulfate radicals. PMID:28584880

  4. In Folio Respiratory Fluxomics Revealed by 13C Isotopic Labeling and H/D Isotope Effects Highlight the Noncyclic Nature of the Tricarboxylic Acid “Cycle” in Illuminated Leaves1[W

    PubMed Central

    Tcherkez, Guillaume; Mahé, Aline; Gauthier, Paul; Mauve, Caroline; Gout, Elizabeth; Bligny, Richard; Cornic, Gabriel; Hodges, Michael

    2009-01-01

    While the possible importance of the tricarboxylic acid (TCA) cycle reactions for leaf photosynthesis operation has been recognized, many uncertainties remain on whether TCA cycle biochemistry is similar in the light compared with the dark. It is widely accepted that leaf day respiration and the metabolic commitment to TCA decarboxylation are down-regulated in illuminated leaves. However, the metabolic basis (i.e. the limiting steps involved in such a down-regulation) is not well known. Here, we investigated the in vivo metabolic fluxes of individual reactions of the TCA cycle by developing two isotopic methods, 13C tracing and fluxomics and the use of H/D isotope effects, with Xanthium strumarium leaves. We provide evidence that the TCA “cycle” does not work in the forward direction like a proper cycle but, rather, operates in both the reverse and forward directions to produce fumarate and glutamate, respectively. Such a functional division of the cycle plausibly reflects the compromise between two contrasted forces: (1) the feedback inhibition by NADH and ATP on TCA enzymes in the light, and (2) the need to provide pH-buffering organic acids and carbon skeletons for nitrate absorption and assimilation. PMID:19675152

  5. Excessive Hepatic Mitochondrial TCA Cycle and Gluconeogenesis in Humans with Nonalcoholic Fatty Liver Disease

    PubMed Central

    Sunny, Nishanth E.; Parks, Elizabeth J.; Browning, Jeffrey D.; Burgess, Shawn C.

    2013-01-01

    Summary Approximately one-third of the U.S. population has nonalcoholic fatty liver disease (NAFLD), a condition closely associated with insulin resistance and increased risk of liver injury. Dysregulated mitochondrial metabolism is central in these disorders, but the manner and degree of dysregulation are disputed. This study tested whether humans with NAFLD have abnormal in vivo hepatic mitochondrial metabolism. Subjects with low (3.0%) and high (17%) intrahepatic triglyceride (IHTG) were studied using 2H and 13C tracers to evaluate systemic lipolysis, hepatic glucose production, and mitochondrial pathways (TCA cycle, anaplerosis, and ketogenesis). Individuals with NAFLD had 50% higher rates of lipolysis and 30% higher rates of gluconeogenesis. There was a positive correlation between IHTG content and both mitochondrial oxidative and anaplerotic fluxes. These data indicate that mitochondrial oxidative metabolism is ∼2-fold greater in those with NAFLD, providing a potential link between IHTG content, oxidative stress, and liver damage. PMID:22152305

  6. A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector

    PubMed Central

    Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I.

    2018-01-01

    ABSTRACT Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L-serine, L-threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L-proline, L-aspartic acid, and L-pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L-proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector. PMID:28594267

  7. A plant pathogenic bacterium exploits the tricarboxylic acid cycle metabolic pathway of its insect vector.

    PubMed

    Killiny, Nabil; Nehela, Yasser; Hijaz, Faraj; Vincent, Christopher I

    2018-01-01

    Huanglongbing in citrus is caused by a phloem-limited, uncultivable, gram-negative α-proteobacterium, Candidatus Liberibacter asiaticus (CLas). CLas is transmitted by the phloem-sucking insect, Diaphorina citri (Hemiptera: Liviidae), in a persistent, circulative, and propagative manner. In this study, we investigated the metabolomic and respiration rates changes in D. citri upon infection with CLas using gas chromatography-mass spectrometry (GC-MS) and gas exchange analysis. The level of glycine, L -serine, L -threonine, and gamma-amino butyric acid were higher in CLas-infected D. citri, while L -proline, L -aspartic acid, and L -pyroglutamic acid were lower in CLas-infected D. citri compared with the control. Citric acid was increased in CLas-infected D. citri, whereas malic and succinic acids were reduced. Interestingly, most of the reduced metabolites such as malate, succinate, aspartate, and L -proline are required for the growth of CLas. The increase in citric acid, serine, and glycine indicated that CLas induced glycolysis and the tricarboxylic acid cycle (TCA) in its vector. In agreement with the GC-MS results, the gene expression results also indicated that glycolysis and TCA were induced in CLas-infected D. citri and this was accompanied with an increases in respiration rate. Phosphoric acid and most of the sugar alcohols were higher in CLas-infected D. citri, indicating a response to the biotic stress or cell damage. Only slight increases in the levels of few sugars were observed in CLas-infected D. citri, which indicated that sugars are tightly regulated by D. citri. Our results indicated that CLas induces nutrient and energetic stress in its host insect. This study may provide some insights into the mechanism of colonization of CLas in its vector.

  8. Cross-talk between branched-chain amino acids and hepatic mitochondria is compromised in nonalcoholic fatty liver disease.

    PubMed

    Sunny, Nishanth E; Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J; Nautiyal, Manisha; Mathew, Justin T; Williams, Caroline M; Cusi, Kenneth

    2015-08-15

    Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD.

  9. Catabolism of α-Ketoglutarate by a sucA Mutant of Bradyrhizobium japonicum: Evidence for an Alternative Tricarboxylic Acid Cycle

    PubMed Central

    Green, Laura S.; Li, Youzhong; Emerich, David W.; Bergersen, Fraser J.; Day, David A.

    2000-01-01

    A complete tricarboxylic acid (TCA) cycle is generally considered necessary for energy production from the dicarboxylic acid substrates malate, succinate, and fumarate. However, a Bradyrhizobium japonicum sucA mutant that is missing α-ketoglutarate dehydrogenase is able to grow on malate as its sole source of carbon. This mutant also fixes nitrogen in symbiosis with soybean, where dicarboxylic acids are its principal carbon substrate. Using a flow chamber system to make direct measurements of oxygen consumption and ammonium excretion, we confirmed that bacteroids formed by the sucA mutant displayed wild-type rates of respiration and nitrogen fixation. Despite the absence of α-ketoglutarate dehydrogenase activity, whole cells of the mutant were able to decarboxylate α-[U-14C]ketoglutarate and [U-14C]glutamate at rates similar to those of wild-type B. japonicum, indicating that there was an alternative route for α-ketoglutarate catabolism. Because cell extracts from B. japonicum decarboxylated [U-14C]glutamate very slowly, the γ-aminobutyrate shunt is unlikely to be the pathway responsible for α-ketoglutarate catabolism in the mutant. In contrast, cell extracts from both the wild type and mutant showed a coenzyme A (CoA)-independent α-ketoglutarate decarboxylation activity. This activity was independent of pyridine nucleotides and was stimulated by thiamine PPi. Thin-layer chromatography showed that the product of α-ketoglutarate decarboxylation was succinic semialdehyde. The CoA-independent α-ketoglutarate decarboxylase, along with succinate semialdehyde dehydrogenase, may form an alternative pathway for α-ketoglutarate catabolism, and this pathway may enhance TCA cycle function during symbiotic nitrogen fixation. PMID:10781553

  10. Modelling urea-cycle disorder citrullinemia type 1 with disease-specific iPSCs.

    PubMed

    Yoshitoshi-Uebayashi, Elena Yukie; Toyoda, Taro; Yasuda, Katsutaro; Kotaka, Maki; Nomoto, Keiko; Okita, Keisuke; Yasuchika, Kentaro; Okamoto, Shinya; Takubo, Noriyuki; Nishikubo, Toshiya; Soga, Tomoyoshi; Uemoto, Shinji; Osafune, Kenji

    2017-05-06

    Citrullinemia type 1 (CTLN1) is a urea cycle disorder (UCD) caused by mutations of the ASS1 gene, which is responsible for production of the enzyme argininosuccinate synthetase (ASS), and classically presented as life-threatening hyperammonemia in newborns. Therapeutic options are limited, and neurological sequelae may persist. To understand the pathophysiology and find novel treatments, induced pluripotent stem cells (iPSCs) were generated from a CTLN1 patient and differentiated into hepatocyte-like cells (HLCs). CTLN1-HLCs have lower ureagenesis, recapitulating part of the patient's phenotype. l-arginine, an amino acid clinically used for UCD treatment, improved this phenotype in vitro. Metabolome analysis revealed an increase in tricarboxylic acid (TCA) cycle metabolites in CTLN1, suggesting a connection between CTLN1 and the TCA cycle. This CTLN1-iPSC model improves the understanding of CTLN1 pathophysiology and can be used to pursue new therapeutic approaches. Copyright © 2017 Elsevier Inc. All rights reserved.

  11. Gluconeogenesis is associated with high rates of tricarboxylic acid and pyruvate cycling in fasting northern elephant seals.

    PubMed

    Champagne, Cory D; Houser, Dorian S; Fowler, Melinda A; Costa, Daniel P; Crocker, Daniel E

    2012-08-01

    Animals that endure prolonged periods of food deprivation preserve vital organ function by sparing protein from catabolism. Much of this protein sparing is achieved by reducing metabolic rate and suppressing gluconeogenesis while fasting. Northern elephant seals (Mirounga angustirostris) endure prolonged fasts of up to 3 mo at multiple life stages. During these fasts, elephant seals maintain high levels of activity and energy expenditure associated with breeding, reproduction, lactation, and development while maintaining rates of glucose production typical of a postabsorptive mammal. Therefore, we investigated how fasting elephant seals meet the requirements of glucose-dependent tissues while suppressing protein catabolism by measuring the contribution of glycogenolysis, glycerol, and phosphoenolpyruvate (PEP) to endogenous glucose production (EGP) during their natural 2-mo postweaning fast. Additionally, pathway flux rates associated with the tricarboxylic acid (TCA) cycle were measured specifically, flux through phosphoenolpyruvate carboxykinase (PEPCK) and pyruvate cycling. The rate of glucose production decreased during the fast (F(1,13) = 5.7, P = 0.04) but remained similar to that of postabsorptive mammals. The fractional contributions of glycogen, glycerol, and PEP did not change with fasting; PEP was the primary gluconeogenic precursor and accounted for ∼95% of EGP. This large contribution of PEP to glucose production occurred without substantial protein loss. Fluxes through the TCA cycle, PEPCK, and pyruvate cycling were higher than reported in other species and were the most energetically costly component of hepatic carbohydrate metabolism. The active pyruvate recycling fluxes detected in elephant seals may serve to rectify gluconeogeneic PEP production during restricted anaplerotic inflow in these fasting-adapted animals.

  12. Neuronal glucose metabolism is impaired while astrocytic TCA cycling is unaffected at symptomatic stages in the hSOD1G93A mouse model of amyotrophic lateral sclerosis.

    PubMed

    Tefera, Tesfaye W; Borges, Karin

    2018-01-01

    Although alterations in energy metabolism are known in ALS, the specific mechanisms leading to energy deficit are not understood. We measured metabolite levels derived from injected [1- 13 C]glucose and [1,2- 13 C]acetate (i.p.) in cerebral cortex and spinal cord extracts of wild type and hSOD1 G93A mice at onset and mid disease stages using high-pressure liquid chromatography, 1 H and 13 C nuclear magnetic resonance spectroscopy. Levels of spinal and cortical CNS total lactate, [3- 13 C]lactate, total alanine and [3- 13 C]alanine, but not cortical glucose and [1- 13 C]glucose, were reduced mostly at mid stage indicating impaired glycolysis. The [1- 13 C]glucose-derived [4- 13 C]glutamate, [4- 13 C]glutamine and [2- 13 C]GABA amounts were diminished at mid stage in cortex and both time points in spinal cord, suggesting decreased [3- 13 C]pyruvate entry into the TCA cycle. Lack of changes in [1,2- 13 C]acetate-derived [4,5- 13 C]glutamate, [4,5- 13 C]glutamine and [1,2- 13 C]GABA levels indicate unchanged astrocytic 13 C-acetate metabolism. Reduced levels of leucine, isoleucine and valine in CNS suggest compensatory breakdown to refill TCA cycle intermediate levels. Unlabelled, [2- 13 C] and [4- 13 C]GABA concentrations were decreased in spinal cord indicating that impaired glucose metabolism contributes to hyperexcitability and supporting the use of treatments which increase GABA amounts. In conclusion, CNS glucose metabolism is compromised, while astrocytic TCA cycling appears to be normal in the hSOD1 G93A mouse model at symptomatic disease stages.

  13. Cross-talk between branched-chain amino acids and hepatic mitochondria is compromised in nonalcoholic fatty liver disease

    PubMed Central

    Kalavalapalli, Srilaxmi; Bril, Fernando; Garrett, Timothy J.; Nautiyal, Manisha; Mathew, Justin T.; Williams, Caroline M.; Cusi, Kenneth

    2015-01-01

    Elevated plasma branched-chain amino acids (BCAA) in the setting of insulin resistance have been relevant in predicting type 2 diabetes mellitus (T2DM) onset, but their role in the etiology of hepatic insulin resistance remains uncertain. We determined the link between BCAA and dysfunctional hepatic tricarboxylic acid (TCA) cycle, which is a central feature of hepatic insulin resistance and nonalcoholic fatty liver disease (NAFLD). Plasma metabolites under basal fasting and euglycemic hyperinsulinemic clamps (insulin stimulation) were measured in 94 human subjects with varying degrees of insulin sensitivity to identify their relationships with insulin resistance. Furthermore, the impact of elevated BCAA on hepatic TCA cycle was determined in a diet-induced mouse model of NAFLD, utilizing targeted metabolomics and nuclear magnetic resonance (NMR)-based metabolic flux analysis. Insulin stimulation revealed robust relationships between human plasma BCAA and indices of insulin resistance, indicating chronic metabolic overload from BCAA. Human plasma BCAA and long-chain acylcarnitines also showed a positive correlation, suggesting modulation of mitochondrial metabolism by BCAA. Concurrently, mice with NAFLD failed to optimally induce hepatic mTORC1, plasma ketones, and hepatic long-chain acylcarnitines, following acute elevation of plasma BCAA. Furthermore, elevated BCAA failed to induce multiple fluxes through hepatic TCA cycle in mice with NAFLD. Our data suggest that BCAA are essential to mediate efficient channeling of carbon substrates for oxidation through mitochondrial TCA cycle. Impairment of BCAA-mediated upregulation of the TCA cycle could be a significant contributor to mitochondrial dysfunction in NAFLD. PMID:26058864

  14. Metabonomics Indicates Inhibition of Fatty Acid Synthesis, β-Oxidation, and Tricarboxylic Acid Cycle in Triclocarban-Induced Cardiac Metabolic Alterations in Male Mice.

    PubMed

    Xie, Wenping; Zhang, Wenpeng; Ren, Juan; Li, Wentao; Zhou, Lili; Cui, Yuan; Chen, Huiming; Yu, Wenlian; Zhuang, Xiaomei; Zhang, Zhenqing; Shen, Guolin; Li, Haishan

    2018-02-14

    Triclocarban (TCC) has been identified as a new environmental pollutant that is potentially hazardous to human health; however, the effects of short-term TCC exposure on cardiac function are not known. The aim of this study was to use metabonomics and molecular biology techniques to systematically elucidate the molecular mechanisms of TCC-induced effects on cardiac function in mice. Our results show that TCC inhibited the uptake, synthesis, and oxidation of fatty acids, suppressed the tricarboxylic acid (TCA) cycle, and increased aerobic glycolysis levels in heart tissue after short-term TCC exposure. TCC also inhibited the nuclear peroxisome proliferator-activated receptor α (PPARα), confirming its inhibitory effects on fatty acid uptake and oxidation. Histopathology and other analyses further confirm that TCC altered mouse cardiac physiology and pathology, ultimately affecting normal cardiac metabolic function. We elucidate the molecular mechanisms of TCC-induced harmful effects on mouse cardiac metabolism and function from a new perspective, using metabonomics and bioinformatics analysis data.

  15. Integrated Analysis of the Transcriptome and Metabolome of Corynebacterium glutamicum during Penicillin-Induced Glutamic Acid Production.

    PubMed

    Hirasawa, Takashi; Saito, Masaki; Yoshikawa, Katsunori; Furusawa, Chikara; Shmizu, Hiroshi

    2018-05-01

    Corynebacterium glutamicum is known for its ability to produce glutamic acid and has been utilized for the fermentative production of various amino acids. Glutamic acid production in C. glutamicum is induced by penicillin. In this study, the transcriptome and metabolome of C. glutamicum is analyzed to understand the mechanism of penicillin-induced glutamic acid production. Transcriptomic analysis with DNA microarray revealed that expression of some glycolysis- and TCA cycle-related genes, which include those encoding the enzymes involved in conversion of glucose to 2-oxoglutaric acid, is upregulated after penicillin addition. Meanwhile, expression of some TCA cycle-related genes, encoding the enzymes for conversion of 2-oxoglutaric acid to oxaloacetic acid, and the anaplerotic reactions decreased. In addition, expression of NCgl1221 and odhI, encoding proteins involved in glutamic acid excretion and inhibition of the 2-oxoglutarate dehydrogenase, respectively, is upregulated. Functional category enrichment analysis of genes upregulated and downregulated after penicillin addition revealed that genes for signal transduction systems are enriched among upregulated genes, whereas those for energy production and carbohydrate and amino acid metabolisms are enriched among the downregulated genes. As for the metabolomic analysis using capillary electrophoresis time-of-flight mass spectrometry, the intracellular content of most metabolites of the glycolysis and the TCA cycle decreased dramatically after penicillin addition. Overall, these results indicate that the cellular metabolism and glutamic acid excretion are mainly optimized at the transcription level during penicillin-induced glutamic acid production by C. glutamicum. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells

    PubMed Central

    Janzer, Andreas; German, Natalie J.; Gonzalez-Herrera, Karina N.; Asara, John M.; Haigis, Marcia C.; Struhl, Kevin

    2014-01-01

    Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation. PMID:25002509

  17. Metformin and phenformin deplete tricarboxylic acid cycle and glycolytic intermediates during cell transformation and NTPs in cancer stem cells.

    PubMed

    Janzer, Andreas; German, Natalie J; Gonzalez-Herrera, Karina N; Asara, John M; Haigis, Marcia C; Struhl, Kevin

    2014-07-22

    Metformin, a first-line diabetes drug linked to cancer prevention in retrospective clinical analyses, inhibits cellular transformation and selectively kills breast cancer stem cells (CSCs). Although a few metabolic effects of metformin and the related biguanide phenformin have been investigated in established cancer cell lines, the global metabolic impact of biguanides during the process of neoplastic transformation and in CSCs is unknown. Here, we use LC/MS/MS metabolomics (>200 metabolites) to assess metabolic changes induced by metformin and phenformin in an Src-inducible model of cellular transformation and in mammosphere-derived breast CSCs. Although phenformin is the more potent biguanide in both systems, the metabolic profiles of these drugs are remarkably similar, although not identical. During the process of cellular transformation, biguanide treatment prevents the boost in glycolytic intermediates at a specific stage of the pathway and coordinately decreases tricarboxylic acid (TCA) cycle intermediates. In contrast, in breast CSCs, biguanides have a modest effect on glycolytic and TCA cycle intermediates, but they strongly deplete nucleotide triphosphates and may impede nucleotide synthesis. These metabolic profiles are consistent with the idea that biguanides inhibit mitochondrial complex 1, but they indicate that their metabolic effects differ depending on the stage of cellular transformation.

  18. ATCA/muTCA for Physics

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Jezynski, Tomasz; /DESY; Larsen, Raymond

    ATCA/{mu}TCA platforms are attractive because of the modern serial link architecture, high availability features and many packaging options. Less-demanding availability applications can be met economically by scaling back speed and redundancy. The ATCA specification was originally targeted for the Telecom industry but has gained recently a much wider user audience. The purpose of this paper is to report on present hardware and software R and D efforts where ATCA and {mu}TCA are planned, already being used or in development using selected examples for accelerator and detectors in the Physics community. It will present also the status of a proposal formore » physics extensions to ATCA/{mu}TCA specifications to promote inter-operability of laboratory and industry designs for physics.« less

  19. Trichloroacetic Acid Versus Salicylic Acid in the Treatment of Acne Vulgaris in Dark-Skinned Patients.

    PubMed

    Abdel Meguid, Azza Mahfouz; Elaziz Ahmed Attallah, Dalia Abd; Omar, Howida

    2015-12-01

    Treatment options for acne include chemical peeling. Trichloroacetic acid (TCA) has been used for treating acne. The ability of TCA to diminish corneocyte cohesion and keratinocyte plugging addresses this mode of treatment. Salicylic acid is an excellent keratolytic agent. It is believed to function through solubilization of intercellular cement, thereby reducing corneocyte adhesion. Comparing the therapeutic efficacy of TCA 25% peels with those of salicylic acid 30% in patients with acne vulgaris. Twenty patients, Fitzpatrick skin Types III to V with facial acne, were enrolled. Twenty-five percent of TCA was applied to the right half of the face and 30% salicylic acid to the left half at 2-week interval for 2 months. Total improvement was more frequent with salicylic acid peeling (95%) versus (85%) with TCA. Total comedones improvement was more frequent with TCA peeling (80%) versus (70%) with salicylic acid. Improvement of inflammatory lesions was more frequent among the side treated with salicylic acid (85%) versus (80%) with TCA peeling. However, the results did not reach the statistical significance level. Trichloroacetic acid is more superior in treating comedonal lesions, whereas salicylic is more superior in treating inflammatory lesions, without significant different between their results.

  20. Organic Acids: The Pools of Fixed Carbon Involved in Redox Regulation and Energy Balance in Higher Plants

    PubMed Central

    Igamberdiev, Abir U.; Eprintsev, Alexander T.

    2016-01-01

    Organic acids are synthesized in plants as a result of the incomplete oxidation of photosynthetic products and represent the stored pools of fixed carbon accumulated due to different transient times of conversion of carbon compounds in metabolic pathways. When redox level in the cell increases, e.g., in conditions of active photosynthesis, the tricarboxylic acid (TCA) cycle in mitochondria is transformed to a partial cycle supplying citrate for the synthesis of 2-oxoglutarate and glutamate (citrate valve), while malate is accumulated and participates in the redox balance in different cell compartments (via malate valve). This results in malate and citrate frequently being the most accumulated acids in plants. However, the intensity of reactions linked to the conversion of these compounds can cause preferential accumulation of other organic acids, e.g., fumarate or isocitrate, in higher concentrations than malate and citrate. The secondary reactions, associated with the central metabolic pathways, in particularly with the TCA cycle, result in accumulation of other organic acids that are derived from the intermediates of the cycle. They form the additional pools of fixed carbon and stabilize the TCA cycle. Trans-aconitate is formed from citrate or cis-aconitate, accumulation of hydroxycitrate can be linked to metabolism of 2-oxoglutarate, while 4-hydroxy-2-oxoglutarate can be formed from pyruvate and glyoxylate. Glyoxylate, a product of either glycolate oxidase or isocitrate lyase, can be converted to oxalate. Malonate is accumulated at high concentrations in legume plants. Organic acids play a role in plants in providing redox equilibrium, supporting ionic gradients on membranes, and acidification of the extracellular medium. PMID:27471516

  1. Aqueous Extract of Black Maca Prevents Metabolism Disorder via Regulating the Glycolysis/Gluconeogenesis-TCA Cycle and PPARα Signaling Activation in Golden Hamsters Fed a High-Fat, High-Fructose Diet.

    PubMed

    Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen

    2018-01-01

    Maca ( Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo . Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm . Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2 , Fh , and Mdh2 . In addition, the lipid

  2. Aqueous Extract of Black Maca Prevents Metabolism Disorder via Regulating the Glycolysis/Gluconeogenesis-TCA Cycle and PPARα Signaling Activation in Golden Hamsters Fed a High-Fat, High-Fructose Diet

    PubMed Central

    Wan, Wenting; Li, Hongxiang; Xiang, Jiamei; Yi, Fan; Xu, Lijia; Jiang, Baoping; Xiao, Peigen

    2018-01-01

    Maca (Lepidium meyenii Walpers) has been used as a dietary supplement and ethnomedicine for centuries. Recently, maca has become a high profile functional food worldwide because of its multiple biological activities. This study is the first explorative research to investigate the prevention and amelioration capacity of the aqueous extract of black maca (AEM) on high-fat, high-fructose diet (HFD)-induced metabolism disorder in golden hamsters and to identify the potential mechanisms involved in these effects. For 20 weeks, 6-week-old male golden hamsters were fed the following respective diets: (1) a standard diet, (2) HFD, (3) HFD supplemented with metformin, or (4) HFD supplemented with three doses of AEM (300, 600, or 1,200 mg/kg). After 20 weeks, the golden hamsters that received daily AEM supplementation presented with the beneficial effects of improved hyperlipidemia, hyperinsulinemia, insulin resistance, and hepatic steatosis in vivo. Based on the hepatic metabolomic analysis results, alterations in metabolites associated with pathological changes were examined. A total of 194 identified metabolites were mapped to 46 relative metabolic pathways, including those of energy metabolism. In addition, via in silico profiling for secondary maca metabolites by a joint pharmacophore- and structure-based approach, a compound-target-disease network was established. The results revealed that 32 bioactive compounds in maca targeted 16 proteins involved in metabolism disorder. Considering the combined metabolomics and virtual screening results, we employed quantitative real-time PCR assays to verify the gene expression of key enzymes in the relevant pathways. AEM promoted glycolysis and inhibited gluconeogenesis via regulating the expression of key genes such as Gck and Pfkm. Moreover, AEM upregulated tricarboxylic acid (TCA) cycle flux by changing the concentrations of intermediates and increasing the mRNA levels of Aco2, Fh, and Mdh2. In addition, the lipid

  3. Overexpression of the NADP+-specific isocitrate dehydrogenase gene (icdA) in citric acid-producing Aspergillus niger WU-2223L.

    PubMed

    Kobayashi, Keiichi; Hattori, Takasumi; Hayashi, Rie; Kirimura, Kohtaro

    2014-01-01

    In the tricarboxylic acid (TCA) cycle, NADP(+)-specific isocitrate dehydrogenase (NADP(+)-ICDH) catalyzes oxidative decarboxylation of isocitric acid to form α-ketoglutaric acid with NADP(+) as a cofactor. We constructed an NADP(+)-ICDH gene (icdA)-overexpressing strain (OPI-1) using Aspergillus niger WU-2223L as a host and examined the effects of increase in NADP(+)-ICDH activity on citric acid production. Under citric acid-producing conditions with glucose as the carbon source, the amounts of citric acid produced and glucose consumed by OPI-1 for the 12-d cultivation period decreased by 18.7 and 10.5%, respectively, compared with those by WU-2223L. These results indicate that the amount of citric acid produced by A. niger can be altered with the NADP(+)-ICDH activity. Therefore, NADP(+)-ICDH is an important regulator of citric acid production in the TCA cycle of A. niger. Thus, we propose that the icdA gene is a potentially valuable tool for modulating citric acid production by metabolic engineering.

  4. Correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis

    PubMed Central

    Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin

    2017-01-01

    The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis. Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis. Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis. However, these results require verification in further studies. PMID:28962162

  5. Correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis.

    PubMed

    Liu, Wenlan; Sun, Zhirong; Qu, Jixu; Yang, Chunning; Zhang, Xiaomin; Wei, Xinxin

    2017-09-01

    The aim of the present study was to investigate the correlation between root respiration and the levels of biomass and glycyrrhizic acid in Glycyrrhiza uralensis . Root respiration was determined using a biological oxygen analyzer. Respiration-related enzymes including glucose-6-phosphate dehydrogenase plus 6-phosphogluconate dehydrogenase, phosphohexose isomerase and succinate dehydrogenase, and respiratory pathways were evaluated. Biomass was determined by a drying-weighing method. In addition, the percentage of glycyrrhizic acid was detected using high-performance liquid chromatography. The association between root respiration and the levels of biomass and glycyrrhizic acid was investigated. The glycolysis pathway (EMP), tricarboxylic acid cycle (TCA) and pentose phosphate (PPP) pathway acted concurrently in the roots of G. uralensis . Grey correlation analysis showed that TCA had the strongest correlation (correlation coefficient, 0.8003) with biomass. Starch and acetyl coenzyme A had the closest association with above-ground biomass, while soluble sugar correlated less strongly with above-ground biomass. Grey correlation analysis between biochemical pathways and the intermediates showed that pyruvic acid had the strongest correlation with EMP, while acetyl coenzyme A correlated most strongly with TCA. Among the intermediates and pathways, pyruvic acid and EMP exhibited the greatest correlation with glycyrrhizic acid, while acetyl coenzyme A and TCA correlated with glycyrrhizic acid less closely. The results of this study may aid the cultivation of G. uralensis . However, these results require verification in further studies.

  6. Glutamatergic and GABAergic neurotransmitter cycling and energy metabolism in rat cerebral cortex during postnatal development.

    PubMed

    Chowdhury, Golam M I; Patel, Anant B; Mason, Graeme F; Rothman, Douglas L; Behar, Kevin L

    2007-12-01

    The contribution of glutamatergic and gamma-aminobutyric acid (GABA)ergic neurons to oxidative energy metabolism and neurotransmission in the developing brain is not known. Glutamatergic and GABAergic fluxes were assessed in neocortex of postnatal day 10 (P10) and 30 (P30) urethane-anesthetized rats infused intravenously with [1,6-(13)C(2)]glucose for different time intervals (time course) or with [2-(13)C]acetate for 2 to 3 h (steady state). Amino acid levels and (13)C enrichments were determined in tissue extracts ex vivo using (1)H-[(13)C]-NMR spectroscopy. Metabolic fluxes were estimated from the best fits of a three-compartment metabolic model (glutamatergic neurons, GABAergic neurons, and astroglia) to the (13)C-enrichment time courses of amino acids from [1,6-(13)C(2)]glucose, constrained by the ratios of neurotransmitter cycling (V(cyc))-to-tricarboxylic acid (TCA) cycle flux (V(TCAn)) calculated from the steady-state [2-(13)C]acetate enrichment data. From P10 to P30 increases in total neuronal (glutamate plus GABA) TCA cycle flux (3 x ; 0.24+/-0.05 versus 0.71+/-0.07 micromol per g per min, P<0.0001) and total neurotransmitter cycling flux (3.1 to 5 x ; 0.07 to 0.11 (+/-0.03) versus 0.34+/-0.03 micromol per g per min, P<0.0001) were approximately proportional. Incremental changes in total cycling (DeltaV(cyc(tot))) and neuronal TCA cycle flux (DeltaV(TCAn(tot))) between P10 and P30 were 0.23 to 0.27 and 0.47 micromol per g per min, respectively, similar to the approximately 1:2 relationship previously reported for adult cortex. For the individual neurons, increases in V(TCAn) and V(cyc) were similar in magnitude (glutamatergic neurons, 2.7 x versus 2.8 to 4.6 x ; GABAergic neurons, approximately 5 x versus approximately 7 x), although GABAergic flux changes were larger. The findings show that glutamate and GABA neurons undergo large and approximately proportional increases in neurotransmitter cycling and oxidative energy metabolism during this major

  7. The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows

    PubMed Central

    White, Heather M.

    2015-01-01

    The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows. PMID:26479386

  8. The Role of TCA Cycle Anaplerosis in Ketosis and Fatty Liver in Periparturient Dairy Cows.

    PubMed

    White, Heather M

    2015-08-18

    The transition to lactation period in dairy cattle is characterized by metabolic challenges, negative energy balance, and adipose tissue mobilization. Metabolism of mobilized adipose tissue is part of the adaptive response to negative energy balance in dairy cattle; however, the capacity of the liver to completely oxidize nonesterified fatty acids may be limited and is reflective of oxaloacetate pool, the carbon carrier of the tricarboxylic acid cycle. Alternative metabolic fates of acetyl-CoA from nonesterified fatty acids include esterification to triacylglycerides and ketogenesis, and when excessive, these pathways lead to fatty liver and ketosis. Examination of the anaplerotic and cataplerotic pull of oxaloacetate by the tricarboxylic acid cycle and gluconeogenesis may provide insight into the balance of oxidation and esterification of acetyl-CoA within the liver of periparturient dairy cows.

  9. Metabolomic analysis reveals altered skeletal muscle amino acid and fatty acid handling in obese humans.

    PubMed

    Baker, Peter R; Boyle, Kristen E; Koves, Timothy R; Ilkayeva, Olga R; Muoio, Deborah M; Houmard, Joseph A; Friedman, Jacob E

    2015-05-01

    Investigate the effects of obesity and high-fat diet (HFD) exposure on fatty acid oxidation and TCA cycle intermediates and amino acids in skeletal muscle to better characterize energy metabolism. Plasma and skeletal muscle metabolomic profiles were measured from lean and obese males before and after a 5-day HFD in the 4 h postprandial condition. At both time points, plasma short-chain acylcarnitine species (SCAC) were higher in the obese subjects, while the amino acids glycine, histidine, methionine, and citrulline were lower in skeletal muscle of obese subjects. Skeletal muscle medium-chain acylcarnitines (MCAC) C6, C8, C10:2, C10:1, C10, and C12:1 increased in obese subjects, but decreased in lean subjects, from pre- to post-HFD. Plasma content of C10:1 was also decreased in the lean but increased in the obese subjects from pre- to post-HFD. CD36 increased from pre- to post-HFD in obese but not lean subjects. Lower skeletal muscle amino acid content and accumulation of plasma SCAC in obese subjects could reflect increased anaplerosis for TCA cycle intermediates, while accumulation of MCAC suggests limitations in β-oxidation. These measures may be important markers of or contributors to dysregulated metabolism observed in skeletal muscle of obese humans. © 2015 The Obesity Society.

  10. Involvement of organic acids and amino acids in ameliorating Ni(II) toxicity induced cell cycle dysregulation in Caulobacter crescentus: a metabolomics analysis.

    PubMed

    Jain, Abhishek; Chen, Wei Ning

    2018-05-01

    Nickel (Ni(II)) toxicity is addressed by many different bacteria, but bacterial responses to nickel stress are still unclear. Therefore, we studied the effect of Ni(II) toxicity on cell proliferation of α-proteobacterium Caulobacter crescentus. Next, we showed the mechanism that allows C. crescentus to survive in Ni(II) stress condition. Our results revealed that the growth of C. crescentus is severely affected when the bacterium was exposed to different Ni(II) concentrations, 0.003 mM slightly affected the growth, 0.008 mM reduced the growth by 50%, and growth was completely inhibited at 0.015 mM. It was further shown that Ni(II) toxicity induced mislocalization of major regulatory proteins such as MipZ, FtsZ, ParB, and MreB, resulting in dysregulation of the cell cycle. GC-MS metabolomics analysis of Ni(II) stressed C. crescentus showed an increased level of nine important metabolites including TCA cycle intermediates and amino acids. This indicates that changes in central carbon metabolism and nitrogen metabolism are linked with the disruption of cell division process. Addition of malic acid, citric acid, alanine, proline, and glutamine to 0.015 mM Ni(II)-treated C. crescentus restored its growth. Thus, the present work shows a protective effect of these organic acids and amino acids on Ni(II) toxicity. Metabolic stimulation through the PutA/GlnA pathway, accelerated degradation of CtrA, and Ni-chelation by organic acids or amino acids are some of the possible mechanisms suggested to be involved in enhancing C. crescentus's tolerance. Our results shed light on the mechanism of increased Ni(II) tolerance in C. crescentus which may be useful in bioremediation strategies and synthetic biology applications such as the development of whole cell biosensor.

  11. Inflammation and ER Stress Regulate Branched-Chain Amino Acid Uptake and Metabolism in Adipocytes

    PubMed Central

    Burrill, Joel S.; Long, Eric K.; Reilly, Brian; Deng, Yingfeng; Armitage, Ian M.; Scherer, Philipp E.

    2015-01-01

    Inflammation plays a critical role in the pathology of obesity-linked insulin resistance and is mechanistically linked to the effects of macrophage-derived cytokines on adipocyte energy metabolism, particularly that of the mitochondrial branched-chain amino acid (BCAA) and tricarboxylic acid (TCA) pathways. To address the role of inflammation on energy metabolism in adipocytes, we used high fat-fed C57BL/6J mice and lean controls and measured the down-regulation of genes linked to BCAA and TCA cycle metabolism selectively in visceral but not in subcutaneous adipose tissue, brown fat, liver, or muscle. Using 3T3-L1 cells, TNFα, and other proinflammatory cytokine treatments reduced the expression of the genes linked to BCAA transport and oxidation. Consistent with this, [14C]-leucine uptake and conversion to triglycerides was markedly attenuated in TNFα-treated adipocytes, whereas the conversion to protein was relatively unaffected. Because inflammatory cytokines lead to the induction of endoplasmic reticulum stress, we evaluated the effects of tunicamycin or thapsigargin treatment of 3T3-L1 cells and measured a similar down-regulation in the BCAA/TCA cycle pathway. Moreover, transgenic mice overexpressing X-box binding protein 1 in adipocytes similarly down-regulated genes of BCAA and TCA metabolism in vivo. These results indicate that inflammation and endoplasmic reticulum stress attenuate lipogenesis in visceral adipose depots by down-regulating the BCAA/TCA metabolism pathway and are consistent with a model whereby the accumulation of serum BCAA in the obese insulin-resistant state is linked to adipose inflammation. PMID:25635940

  12. Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

    PubMed

    Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

    2010-07-01

    Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

  13. Skeletal muscle adaptation to fatty acid depends on coordinated actions of the PPARs and PGC1 alpha: implications for metabolic disease.

    PubMed

    Muoio, Deborah M; Koves, Timothy R

    2007-10-01

    Dyslipidemia and intramuscular accumulation of fatty acid metabolites are increasingly recognized as core features of obesity and type 2 diabetes. Emerging evidence suggests that normal physiological adaptations to a heavy lipid load depend on the coordinated actions of broad transcriptional regulators such as the peroxisome proliferator activated receptors (PPARs) and PPAR gamma coactivator 1 alpha (PGC1 alpha). The application of transcriptomics and targeted metabolic profiling tools based on mass spectrometry has led to our finding that lipid-induced insulin resistance is a condition in which upregulation of PPAR-targeted genes and high rates of beta-oxidation are not supported by a commensurate upregulation of tricarboxylic acid (TCA) cycle activity. In contrast, exercise training enhances mitochondrial performance, favoring tighter coupling between beta-oxidation and the TCA cycle, and concomitantly restores insulin sensitivity in animals fed a chronic high-fat diet. The exercise-activated transcriptional coactivator, PGC1 alpha, plays a key role in coordinating metabolic flux through these 2 intersecting metabolic pathways, and its suppression by overfeeding may contribute to diet-induced mitochondrial dysfunction. Our emerging model predicts that muscle insulin resistance arises from a mitochondrial disconnect between beta-oxidation and TCA cycle activity. Understanding of this "disconnect" and its molecular basis may lead to new therapeutic approaches to combatting metabolic disease.

  14. Viscous Design of TCA Configuration

    NASA Technical Reports Server (NTRS)

    Krist, Steven E.; Bauer, Steven X. S.; Campbell, Richard L.

    1999-01-01

    The goal in this effort is to redesign the baseline TCA configuration for improved performance at both supersonic and transonic cruise. Viscous analyses are conducted with OVERFLOW, a Navier-Stokes code for overset grids, using PEGSUS to compute the interpolations between overset grids. Viscous designs are conducted with OVERDISC, a script which couples OVERFLOW with the Constrained Direct Iterative Surface Curvature (CDISC) inverse design method. The successful execution of any computational fluid dynamics (CFD) based aerodynamic design method for complex configurations requires an efficient method for regenerating the computational grids to account for modifications to the configuration shape. The first section of this presentation deals with the automated regridding procedure used to generate overset grids for the fuselage/wing/diverter/nacelle configurations analysed in this effort. The second section outlines the procedures utilized to conduct OVERDISC inverse designs. The third section briefly covers the work conducted by Dick Campbell, in which a dual-point design at Mach 2.4 and 0.9 was attempted using OVERDISC; the initial configuration from which this design effort was started is an early version of the optimized shape for the TCA configuration developed by the Boeing Commercial Airplane Group (BCAG), which eventually evolved into the NCV design. The final section presents results from application of the Natural Flow Wing design philosophy to the TCA configuration.

  15. Synthesis of the 1-Monoester of 2-Ketoalkanedioic Acids, e.g., Octyl α-Ketoglutarate

    PubMed Central

    Jung, Michael E.; Deng, Gang

    2012-01-01

    Oxidative cleavage of cycloalkene-1-carboxylates, made from the corresponding carboxylic acids, and subsequent oxidation of the resulting ketoaldehyde afforded the important 1-monoesters of 2-ketoalkanedioic acids. Thus ozonolysis of octyl cyclobutene-1-carboxylate followed by sodium chlorite oxidation afforded the 1-monooctyl 2-ketoglutarate. This is a cell-permeable prodrug form of α-ketoglutarate, an important intermediate in the tricarboxylic acid (TCA, Krebs) cycle and a promising therapeutic agent in its own right. PMID:23163977

  16. Comparison of Optimal Thermodynamic Models of the Tricarboxylic Acid Cycle from Heterotrophs, Cyanobacteria, and Green Sulfur Bacteria.

    PubMed

    Thomas, Dennis G; Jaramillo-Riveri, Sebastian; Baxter, Douglas J; Cannon, William R

    2014-12-26

    We have applied a new stochastic simulation approach to predict the metabolite levels, material flux, and thermodynamic profiles of the oxidative TCA cycles found in E. coli and Synechococcus sp. PCC 7002, and in the reductive TCA cycle typical of chemolithoautotrophs and phototrophic green sulfur bacteria such as Chlorobaculum tepidum. The simulation approach is based on modeling states using statistical thermodynamics and employs an assumption similar to that used in transition state theory. The ability to evaluate the thermodynamics of metabolic pathways allows one to understand the relationship between coupling of energy and material gradients in the environment and the self-organization of stable biological systems, and it is shown that each cycle operates in the direction expected due to its environmental niche. The simulations predict changes in metabolite levels and flux in response to changes in cofactor concentrations that would be hard to predict without an elaborate model based on the law of mass action. In fact, we show that a thermodynamically unfavorable reaction can still have flux in the forward direction when it is part of a reaction network. The ability to predict metabolite levels, energy flow, and material flux should be significant for understanding the dynamics of natural systems and for understanding principles for engineering organisms for production of specialty chemicals.

  17. Oxygenated monoterpenes citral and carvacrol cause oxidative damage in Escherichia coli without the involvement of tricarboxylic acid cycle and Fenton reaction.

    PubMed

    Chueca, Beatriz; Pagán, Rafael; García-Gonzalo, Diego

    2014-10-17

    Oxygenated monoterpenes citral and carvacrol are common constituents of many essential oils (EOs) that have been extensively studied as antimicrobial agents but whose mechanisms of microbial inactivation have not been totally elucidated. A recent study described a mechanism of Escherichia coli death for (+)-limonene, a hydrocarbon monoterpene also frequently present in EOs, similar to the common mechanism proposed for bactericidal antibiotics. This mechanism involves the formation of Fenton-mediated hydroxyl radical, a reactive oxygen species (ROS), via tricarboxylic acid (TCA) cycle, which would ultimately inactivate cells. Our objective was to determine whether E. coli MG1655 inactivation by citral and carvacrol follows a similar mechanism of cell death. Challenging experiments with 300μL/L citral and 100μL/L carvacrol inactivated at least 2.5log10cycles of exponentially growing cells in 3h under aerobic conditions. The presence of thiourea (an ROS scavenger) reduced cell inactivation in 2log10cycles, demonstrating the role of ROS in cell death. Decreased resistance of a ΔrecA mutant (deficient in an enzyme involved in SOS response to DNA damage) indicated that citral and carvacrol caused oxidative damage to DNA. Although the mechanism of E. coli inactivation by carvacrol and citral was similarly mediated by ROS, their formation did not follow the same pathways described for (+)-limonene and bactericidal drugs because neither Fenton reaction nor NADH production via the TCA cycle was involved in cell death. Moreover, further experiments demonstrated antimicrobial activity of citral and carvacrol in anaerobic environments without the involvement of ROS. As a consequence, cell death by carvacrol and citral in anaerobiosis follows a different mechanism than that observed under aerobic conditions. These results demonstrated a different mechanism of inactivation by citral and carvacrol with regard to (+)-limonene and bactericidal antibiotics, indicating the

  18. Low-temperature Storage of Cucumbers Induces Changes in the Organic Acid Content and in Citrate Synthase Activity

    USDA-ARS?s Scientific Manuscript database

    To elucidate the cause of reported pyruvate accumulation in chilled stored cucumbers (Cucumis sativus L.) cv. ‘Toppugurin’, we have examined differences in the extent of incorporation of acetate-1,2-14C into the tricarboxylic acid (TCA) cycle and the specific activity of the enzyme citrate synthase ...

  19. Quantum chemical study, spectroscopic investigations, NBO and HOMO-LUMO analyses of 3-aminoquinoline (3AQ) and [Ag(3AQ)2(TCA)] complex (TCA = Trichloroacetate)

    NASA Astrophysics Data System (ADS)

    Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abu Youssef, Morsy A.; Assem, Rania

    2014-09-01

    The new [Ag(3AQ)2(TCA)]; (3AQ = 3-aminoquinoline and TCA = Trichloroacetate) complex is synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry, vibrational frequencies, gauge-including atomic orbital (GIAO) 1H chemical shift values of the free and coordinated 3AQ in the ground state have been calculated by using DFT/B3LYP method. The TD-DFT results of the [Ag(3AQ)2(TCA)] complex showed a π-π* transition band at 240.3-242.6 nm (f = 0.1334-0.1348) which has longer wavelength and lower absorption intensity than that for the free 3AQ (233.2 nm, f = 0.3958). Dipole moment, polarizability and HOMO-LUMO gap values predicted better nonlinear optical properties (NLO) for the [Ag(3AQ)2(TCA)] than the 3AQ ligand. NBO analysis has been used to predict the most accurate Lewis structure of the studied molecules. The energies of the different intramolecular charge transfer (ICT) interactions within the studied molecules were estimated using second order perturbation theory.

  20. Evaluation results of xTCA equipment for HEP experiments at CERN

    NASA Astrophysics Data System (ADS)

    Di Cosmo, M.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.; Vichoudis, P.

    2013-12-01

    The MicroTCA and AdvancedTCA industry standards are candidate modular electronic platforms for the upgrade of the current generation of high energy physics experiments. The PH-ESE group at CERN launched in 2011 the xTCA evaluation project with the aim of performing technical evaluations and eventually providing support for commercially available components. Different devices from different vendors have been acquired, evaluated and interoperability tests have been performed. This paper presents the test procedures and facilities that have been developed and focuses on the evaluation results including electrical, thermal and interoperability aspects.

  1. Long-chain fatty acid combustion rate is associated with unique metabolite profiles in skeletal muscle mitochondria.

    PubMed

    Seifert, Erin L; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R; Wohlgemuth, Gert; Adams, Sean H; Harper, Mary-Ellen

    2010-03-24

    Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA beta-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 microM; corresponding to low, intermediate and high oxidation rates) and 9 microM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat metabolism and insulin signaling. Our results suggest that future studies

  2. Long-Chain Fatty Acid Combustion Rate Is Associated with Unique Metabolite Profiles in Skeletal Muscle Mitochondria

    PubMed Central

    Seifert, Erin L.; Fiehn, Oliver; Bezaire, Véronic; Bickel, David R.; Wohlgemuth, Gert; Adams, Sean H.; Harper, Mary-Ellen

    2010-01-01

    Background/Aim Incomplete or limited long-chain fatty acid (LCFA) combustion in skeletal muscle has been associated with insulin resistance. Signals that are responsive to shifts in LCFA β-oxidation rate or degree of intramitochondrial catabolism are hypothesized to regulate second messenger systems downstream of the insulin receptor. Recent evidence supports a causal link between mitochondrial LCFA combustion in skeletal muscle and insulin resistance. We have used unbiased metabolite profiling of mouse muscle mitochondria with the aim of identifying candidate metabolites within or effluxed from mitochondria and that are shifted with LCFA combustion rate. Methodology/Principal Findings Large-scale unbiased metabolomics analysis was performed using GC/TOF-MS on buffer and mitochondrial matrix fractions obtained prior to and after 20 min of palmitate catabolism (n = 7 mice/condition). Three palmitate concentrations (2, 9 and 19 µM; corresponding to low, intermediate and high oxidation rates) and 9 µM palmitate plus tricarboxylic acid (TCA) cycle and electron transport chain inhibitors were each tested and compared to zero palmitate control incubations. Paired comparisons of the 0 and 20 min samples were made by Student's t-test. False discovery rate were estimated and Type I error rates assigned. Major metabolite groups were organic acids, amines and amino acids, free fatty acids and sugar phosphates. Palmitate oxidation was associated with unique profiles of metabolites, a subset of which correlated to palmitate oxidation rate. In particular, palmitate oxidation rate was associated with distinct changes in the levels of TCA cycle intermediates within and effluxed from mitochondria. Conclusions/Significance This proof-of-principle study establishes that large-scale metabolomics methods can be applied to organelle-level models to discover metabolite patterns reflective of LCFA combustion, which may lead to identification of molecules linking muscle fat

  3. Pyruvate cycle increases aminoglycoside efficacy and provides respiratory energy in bacteria.

    PubMed

    Su, Yu-Bin; Peng, Bo; Li, Hui; Cheng, Zhi-Xue; Zhang, Tian-Tuo; Zhu, Jia-Xin; Li, Dan; Li, Min-Yi; Ye, Jin-Zhou; Du, Chao-Chao; Zhang, Song; Zhao, Xian-Liang; Yang, Man-Jun; Peng, Xuan-Xian

    2018-02-13

    The emergence and ongoing spread of multidrug-resistant bacteria puts humans and other species at risk for potentially lethal infections. Thus, novel antibiotics or alternative approaches are needed to target drug-resistant bacteria, and metabolic modulation has been documented to improve antibiotic efficacy, but the relevant metabolic mechanisms require more studies. Here, we show that glutamate potentiates aminoglycoside antibiotics, resulting in improved elimination of antibiotic-resistant pathogens. When exploring the metabolic flux of glutamate, it was found that the enzymes that link the phosphoenolpyruvate (PEP)-pyruvate-AcCoA pathway to the TCA cycle were key players in this increased efficacy. Together, the PEP-pyruvate-AcCoA pathway and TCA cycle can be considered the pyruvate cycle (P cycle). Our results show that inhibition or gene depletion of the enzymes in the P cycle shut down the TCA cycle even in the presence of excess carbon sources, and that the P cycle operates routinely as a general mechanism for energy production and regulation in Escherichia coli and Edwardsiella tarda These findings address metabolic mechanisms of metabolite-induced potentiation and fundamental questions about bacterial biochemistry and energy metabolism.

  4. Central metabolism controls transcription of a virulence gene regulator in Vibrio cholerae

    PubMed Central

    Minato, Yusuke; Fassio, Sara R.; Wolfe, Alan J.

    2013-01-01

    ToxT is the central regulatory protein involved in activation of the main virulence genes in Vibrio cholerae. We have identified transposon insertions in central metabolism genes, whose disruption increases toxT transcription. These disrupted genes encode the primary respiration-linked sodium pump (NADH : ubiquinone oxidoreductase or NQR) and certain tricarboxylic acid (TCA) cycle enzymes. Observations made following stimulation of respiration in the nqr mutant or chemical inhibition of NQR activity in the TCA cycle mutants led to the hypothesis that NQR affects toxT transcription via the TCA cycle. That toxT transcription increased when the growth medium was supplemented with citrate, but decreased with oxaloacetate, focused our attention on the TCA cycle substrate acetyl-CoA and its non-TCA cycle metabolism. Indeed, both the nqr and the TCA cycle mutants increased acetate excretion. A similar correlation between acetate excretion and toxT transcription was observed in a tolC mutant and upon amino acid (NRES) supplementation. As acetate and its tendency to decrease pH exerted no strong effect on toxT transcription, and because disruption of the major acetate excretion pathway increased toxT transcription, we propose that toxT transcription is regulated by either acetyl-CoA or some close derivative. PMID:23429745

  5. Metabolic interaction between urea cycle and citric acid cycle shunt: A guided approach.

    PubMed

    Pesi, Rossana; Balestri, Francesco; Ipata, Piero L

    2018-03-01

    This article is a guided pedagogical approach, devoted to postgraduate students specializing in biochemistry, aimed at presenting all single reactions and overall equations leading to the metabolic interaction between ureagenesis and citric acid cycle to be incorporated into a two-three lecture series about the interaction of urea cycle with other metabolic pathways. We emphasize that citrate synthetase, aconitase, and isocitrate dehydrogenase, three enzymes of the citric acid cycle are not involved, thus creating a shunt in citric acid cycle. In contrast, the glutamic-oxaloacetate transaminase, which does not belong to citric acid cycle, has a paramount importance in the metabolic interaction of the two cycles, because it generates aspartate, one of the two fuel molecules of urea cycle, and a-ketoglutarate, an intermediate of the citric acid cycle. Finally, students should appreciate that balancing equations for all atoms and charges is not only a stoichiometric task, but strongly facilitates the discussion of the physiological roles of metabolic pathways. Indeed, this exercise has been used in the classroom, to encourage a deeper level of understanding of an important biochemical issue. © 2017 by The International Union of Biochemistry and Molecular Biology, 46(2):182-185, 2018. © 2017 The International Union of Biochemistry and Molecular Biology.

  6. Comparison of efficacy of chemical peeling with 25% trichloroacetic acid and 0.1% retinoic acid for facial rejuvenation.

    PubMed

    Yildirim, Selda; Gurel, Mehmet Salih; Gungor, Sule; Tekeli, Omur; Canat, Dilek

    2016-06-01

    Skin aging is a problem which negatively affects the psyche of the person, social relations, as well as work life and health and which compels the patients to find appropriate treatment methods. Numerous treatment methods have been developed in order to delay aging and to reduce the aging effects in addition to having a younger, healthier and more beautiful facial appearance. To compare the efficiency, cosmetic results and possible adverse effects of the peeling treatment with 25% trichloroacetic acid (TCA) and 0.1% retinoic acid for facial rejuvenation in patients presenting with skin aging. Fifty female patients in total presenting with medium and advanced degree skin aging were subject to this study. Two separate treatment groups were formed; the first group underwent chemical skin treatment with 25% TCA while the other group was applied with 0.1% retinoic acid treatment. Following the 4 months' treatment the patients were controlled three times in total for post lesional hypopigmentation, hyperpigmentation, scars, skin irritation and other possible changes per month. The pretreatment and first follow-up visit, and final control images were comparatively evaluated by three observers via specific software. The healing rates of the group subject to retinoic acid were statistically higher (p < 0.05) compared to patients in the TCA group in the final follow-up visit following the treatment according to the first and second observers. On the other hand, according to the third observer, patients applied with retinoic acid presented with higher healing rates compared to those treated with TCA, however; this rate was not statistically significant (p > 0.05). The frequency of TCA- and retinoic acid-associated adverse effects was similar in both groups (p > 0.05). As a result of both treatments, a reduction in the quality of life scores as well as a pronounced recovery (p = 0.001) in the quality of life of those patients with skin aging was observed. The photo aging

  7. Comparison of efficacy of chemical peeling with 25% trichloroacetic acid and 0.1% retinoic acid for facial rejuvenation

    PubMed Central

    Gurel, Mehmet Salih; Gungor, Sule; Tekeli, Omur; Canat, Dilek

    2016-01-01

    Introduction Skin aging is a problem which negatively affects the psyche of the person, social relations, as well as work life and health and which compels the patients to find appropriate treatment methods. Numerous treatment methods have been developed in order to delay aging and to reduce the aging effects in addition to having a younger, healthier and more beautiful facial appearance. Aim To compare the efficiency, cosmetic results and possible adverse effects of the peeling treatment with 25% trichloroacetic acid (TCA) and 0.1% retinoic acid for facial rejuvenation in patients presenting with skin aging. Material and methods Fifty female patients in total presenting with medium and advanced degree skin aging were subject to this study. Two separate treatment groups were formed; the first group underwent chemical skin treatment with 25% TCA while the other group was applied with 0.1% retinoic acid treatment. Following the 4 months’ treatment the patients were controlled three times in total for post lesional hypopigmentation, hyperpigmentation, scars, skin irritation and other possible changes per month. The pretreatment and first follow-up visit, and final control images were comparatively evaluated by three observers via specific software. Results The healing rates of the group subject to retinoic acid were statistically higher (p < 0.05) compared to patients in the TCA group in the final follow-up visit following the treatment according to the first and second observers. On the other hand, according to the third observer, patients applied with retinoic acid presented with higher healing rates compared to those treated with TCA, however; this rate was not statistically significant (p > 0.05). The frequency of TCA- and retinoic acid-associated adverse effects was similar in both groups (p > 0.05). As a result of both treatments, a reduction in the quality of life scores as well as a pronounced recovery (p = 0.001) in the quality of life of those patients

  8. Submolecular regulation of cell transformation by deuterium depleting water exchange reactions in the tricarboxylic acid substrate cycle.

    PubMed

    Boros, László G; D'Agostino, Dominic P; Katz, Howard E; Roth, Justine P; Meuillet, Emmanuelle J; Somlyai, Gábor

    2016-02-01

    The naturally occurring isotope of hydrogen ((1)H), deuterium ((2)H), could have an important biological role. Deuterium depleted water delays tumor progression in mice, dogs, cats and humans. Hydratase enzymes of the tricarboxylic acid (TCA) cycle control cell growth and deplete deuterium from redox cofactors, fatty acids and DNA, which undergo hydride ion and hydrogen atom transfer reactions. A model is proposed that emphasizes the terminal complex of mitochondrial electron transport chain reducing molecular oxygen to deuterium depleted water (DDW); this affects gluconeogenesis as well as fatty acid oxidation. In the former, the DDW is thought to diminish the deuteration of sugar-phosphates in the DNA backbone, helping to preserve stability of hydrogen bond networks, possibly protecting against aneuploidy and resisting strand breaks, occurring upon exposure to radiation and certain anticancer chemotherapeutics. DDW is proposed here to link cancer prevention and treatment using natural ketogenic diets, low deuterium drinking water, as well as DDW production as the mitochondrial downstream mechanism of targeted anti-cancer drugs such as Avastin and Glivec. The role of (2)H in biology is a potential missing link to the elusive cancer puzzle seemingly correlated with cancer epidemiology in western populations as a result of excessive (2)H loading from processed carbohydrate intake in place of natural fat consumption. Published by Elsevier Ltd.

  9. Fur-dependent detoxification of organic acids by rpoS mutants during prolonged incubation under aerobic, phosphate starvation conditions.

    PubMed

    Guillemet, Mélanie L; Moreau, Patrice L

    2008-08-01

    The activity of amino acid-dependent acid resistance systems allows Escherichia coli to survive during prolonged incubation under phosphate (P(i)) starvation conditions. We show in this work that rpoS-null mutants incubated in the absence of any amino acid survived during prolonged incubation under aerobic, P(i) starvation conditions. Whereas rpoS(+) cells incubated with glutamate excreted high levels of acetate, rpoS mutants grew on acetic acid. The characteristic metabolism of rpoS mutants required the activity of Fur (ferric uptake regulator) in order to decrease the synthesis of the small RNA RyhB that might otherwise inhibit the synthesis of iron-rich proteins. We propose that RpoS (sigma(S)) and the small RNA RyhB contribute to decrease the synthesis of iron-rich proteins required for the activity of the tricarboxylic acid (TCA) cycle, which redirects the metabolic flux toward the production of acetic acid at the onset of stationary phase in rpoS(+) cells. In contrast, Fur activity, which represses ryhB, and the lack of RpoS activity allow a substantial activity of the TCA cycle to continue in stationary phase in rpoS mutants, which decreases the production of acetic acid and, eventually, allows growth on acetic acid and P(i) excreted into the medium. These data may help explain the fact that a high frequency of E. coli rpoS mutants is found in nature.

  10. Lack of formic acid production in rat hepatocytes and human renal proximal tubule cells exposed to chloral hydrate or trichloroacetic acid

    PubMed Central

    Lock, Edward A; Reed, Celia J; McMillan, JoEllyn M; Oatis, John R; Schnellmann, Rick G

    2007-01-01

    The industrial solvent trichloroethylene (TCE) and its major metabolites have been shown to cause formic aciduria in male rats. We have examined whether chloral hydrate (CH) and trichloroacetic acid (TCA), known metabolites of TCE, produce an increase in formic acid in vitro in cultures of rat hepatocytes or human renal proximal tubule cells (HRPTC). The metabolism and cytotoxicity of CH was also examined to establish that the cells were metabolically active and not compromised by toxicity. Rat hepatocytes and HRPTC were cultured in serum-free medium and then treated with 0.3–3mM CH for 3 days or 0.03–3mM CH for 10 days respectively and formic acid production, metabolism to trichloroethanol (TCE-OH) and TCA and cytotoxicity determined. No increase in formic acid production in rat hepatocytes or HRPTC exposed to CH was observed over and above that due to chemical degradation, neither was formic acid production observed in rat hepatocytes exposed to TCA. HRPTC metabolised CH to TCE-OH and TCA with a 12-fold greater capacity to form TCE-OH versus TCA. Rat hepatocytes exhibited a 1.6-fold and 3-fold greater capacity than HRPTC to form TCE-OH and TCA respectively. CH and TCA were not cytotoxic to rat hepatocytes at concentrations up to 3mM/day for 3 days. With HRPTC, one sample showed no cytotoxicity to CH at concentrations up to 3mM/day for 10 days, while in another cytotoxicity was seen at 1mM/day for 3 days. In summary, increased formic acid production was not observed in rat hepatocytes or HRPTC exposed to TCE metabolites, suggesting that the in vivo response cannot be modelled in vitro. CH was toxic to HRPTC at millimolar concentrations/day over 10 days, while glutathione derived metabolites of TCE were toxic at micromolar concentrations/day over 10 days (Lock et al., 2006) supporting the view that glutathione derived metabolites are likely to be responsible for nephrotoxicity. PMID:17161896

  11. Tricarboxylic acid cycle inhibition by Li+ in the human neuroblastoma SH-SY5Y cell line: a 13C NMR isotopomer analysis.

    PubMed

    Fonseca, Carla P; Jones, John G; Carvalho, Rui A; Jeffrey, F Mark H; Montezinho, Liliana P; Geraldes, Carlos F G C; Castro, M M C A

    2005-11-01

    Li+ effects on glucose metabolism and on the competitive metabolism of glucose and lactate were investigated in the human neuroblastoma SH-SY5Y cell line using 13C NMR spectroscopy. The metabolic model proposed for glucose and lactate metabolism in these cells, based on tcaCALC best fitting solutions, for both control and Li+ conditions, was consistent with: (i) a single pyruvate pool; (ii) anaplerotic flux from endogenous unlabelled substrates; (iii) no cycling between pyruvate and oxaloacetate. Li+ was shown to induce a 38 and 53% decrease, for 1 and 15 mM Li+, respectively, in the rate of glucose conversion into pyruvate, when [U-13C]glucose was present, while no effects on lactate production were observed. Pyruvate oxidation by the tricarboxylic acid cycle and citrate synthase flux were shown to be significantly reduced by 64 and 84% in the presence of 1 and 15 mM Li+, respectively, suggesting a direct inhibitory effect of Li+ on tricarboxylic acid cycle flux. This work also showed that when both glucose and lactate are present as energetic substrates, SH-SY5Y cells preferentially consumed exogenous lactate over glucose, as 62% of the acetyl-CoA was derived from [3-13C]lactate while only 26% was derived from [U-13C]glucose. Li+ did not significantly affect the relative utilisation of these two substrates by the cells or the residual contribution of unlabelled endogenous sources for the acetyl-CoA pool.

  12. Bile acids induce arrhythmias in human atrial myocardium--implications for altered serum bile acid composition in patients with atrial fibrillation.

    PubMed

    Rainer, Peter P; Primessnig, Uwe; Harenkamp, Sandra; Doleschal, Bernhard; Wallner, Markus; Fauler, Guenter; Stojakovic, Tatjana; Wachter, Rolf; Yates, Ameli; Groschner, Klaus; Trauner, Michael; Pieske, Burkert M; von Lewinski, Dirk

    2013-11-01

    High bile acid serum concentrations have been implicated in cardiac disease, particularly in arrhythmias. Most data originate from in vitro studies and animal models. We tested the hypotheses that (1) high bile acid concentrations are arrhythmogenic in adult human myocardium, (2) serum bile acid concentrations and composition are altered in patients with atrial fibrillation (AF) and (3) the therapeutically used ursodeoxycholic acid has different effects than other potentially toxic bile acids. Multicellular human atrial preparations ('trabeculae') were exposed to primary bile acids and the incidence of arrhythmic events was assessed. Bile acid concentrations were measured in serum samples from 250 patients and their association with AF and ECG parameters analysed. Additionally, we conducted electrophysiological studies in murine myocytes. Taurocholic acid (TCA) concentration-dependently induced arrhythmias in atrial trabeculae (14/28 at 300 µM TCA, p<0.01) while ursodeoxycholic acid did not. Patients with AF had significantly decreased serum levels of ursodeoxycholic acid conjugates and increased levels of non-ursodeoxycholic bile acids. In isolated myocytes, TCA depolarised the resting membrane potential, enhanced Na(+)/Ca(2+) exchanger (NCX) tail current density and induced afterdepolarisations. Inhibition of NCX prevented arrhythmias in atrial trabeculae. High TCA concentrations induce arrhythmias in adult human atria while ursodeoxycholic acid does not. AF is associated with higher serum levels of non-ursodeoxycholic bile acid conjugates and low levels of ursodeoxycholic acid conjugates. These data suggest that higher levels of toxic (arrhythmogenic) and low levels of protective bile acids create a milieu with a decreased arrhythmic threshold and thus may facilitate arrhythmic events.

  13. Viral affects on metabolism: changes in glucose and glutamine utilization during human cytomegalovirus infection

    PubMed Central

    Yu, Yongjun; Clippinger, Amy J.; Alwine, James C.

    2011-01-01

    Human cytomegalovirus (HCMV) infection causes dramatic alterations of intermediary metabolism, similar to those found in tumor cells. In infected cells, glucose carbon is not completely broken down by the tricarboxylic acid (TCA) cycle for energy; instead it is used biosynthetically. This process requires increased glucose uptake, increased glycolysis and the diversion of glucose carbon, in the form of citrate, from the TCA cycle for use in HCMV-induced fatty acid biosynthesis. The diversion of citrate from the TCA cycle (cataplerosis) requires induction of enzymes to promote glutaminolysis, the conversion of glutamine to -ketoglutarate in order to maintain the TCA cycle (anaplerosis) and ATP production. Such changes could result in heretofore uncharacterized pathogenesis, potentially implicating HCMV as a subtle co-factor in many maladies, including oncogenesis. Recognition of the effects of HCMV, and other viruses, on host cell metabolism will provide new understanding of viral pathogenesis and novel avenues for antiviral therapy. PMID:21570293

  14. Asparagine plays a critical role in regulating cellular adaptation to glutamine depletion.

    PubMed

    Zhang, Ji; Fan, Jing; Venneti, Sriram; Cross, Justin R; Takagi, Toshimitsu; Bhinder, Bhavneet; Djaballah, Hakim; Kanai, Masayuki; Cheng, Emily H; Judkins, Alexander R; Pawel, Bruce; Baggs, Julie; Cherry, Sara; Rabinowitz, Joshua D; Thompson, Craig B

    2014-10-23

    Many cancer cells consume large quantities of glutamine to maintain TCA cycle anaplerosis and support cell survival. It was therefore surprising when RNAi screening revealed that suppression of citrate synthase (CS), the first TCA cycle enzyme, prevented glutamine-withdrawal-induced apoptosis. CS suppression reduced TCA cycle activity and diverted oxaloacetate, the substrate of CS, into production of the nonessential amino acids aspartate and asparagine. We found that asparagine was necessary and sufficient to suppress glutamine-withdrawal-induced apoptosis without restoring the levels of other nonessential amino acids or TCA cycle intermediates. In complete medium, tumor cells exhibiting high rates of glutamine consumption underwent rapid apoptosis when glutamine-dependent asparagine synthesis was suppressed, and expression of asparagine synthetase was statistically correlated with poor prognosis in human tumors. Coupled with the success of L-asparaginase as a therapy for childhood leukemia, the data suggest that intracellular asparagine is a critical suppressor of apoptosis in many human tumors.

  15. The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases

    PubMed Central

    Rueda, Elda M.; Johnson, Jerry E.; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J.; Sigel, Irena; Chaney, Shawnta Y.

    2016-01-01

    Purpose The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. Methods mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. Results The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor

  16. The cellular and compartmental profile of mouse retinal glycolysis, tricarboxylic acid cycle, oxidative phosphorylation, and ~P transferring kinases.

    PubMed

    Rueda, Elda M; Johnson, Jerry E; Giddabasappa, Anand; Swaroop, Anand; Brooks, Matthew J; Sigel, Irena; Chaney, Shawnta Y; Fox, Donald A

    2016-01-01

    The homeostatic regulation of cellular ATP is achieved by the coordinated activity of ATP utilization, synthesis, and buffering. Glucose is the major substrate for ATP synthesis through glycolysis and oxidative phosphorylation (OXPHOS), whereas intermediary metabolism through the tricarboxylic acid (TCA) cycle utilizes non-glucose-derived monocarboxylates, amino acids, and alpha ketoacids to support mitochondrial ATP and GTP synthesis. Cellular ATP is buffered by specialized equilibrium-driven high-energy phosphate (~P) transferring kinases. Our goals were twofold: 1) to characterize the gene expression, protein expression, and activity of key synthesizing and regulating enzymes of energy metabolism in the whole mouse retina, retinal compartments, and/or cells and 2) to provide an integrative analysis of the results related to function. mRNA expression data of energy-related genes were extracted from our whole retinal Affymetrix microarray data. Fixed-frozen retinas from adult C57BL/6N mice were used for immunohistochemistry, laser scanning confocal microscopy, and enzymatic histochemistry. The immunoreactivity levels of well-characterized antibodies, for all major retinal cells and their compartments, were obtained using our established semiquantitative confocal and imaging techniques. Quantitative cytochrome oxidase (COX) and lactate dehydrogenase (LDH) activity was determined histochemically. The Affymetrix data revealed varied gene expression patterns of the ATP synthesizing and regulating enzymes found in the muscle, liver, and brain. Confocal studies showed differential cellular and compartmental distribution of isozymes involved in glucose, glutamate, glutamine, lactate, and creatine metabolism. The pattern and intensity of the antibodies and of the COX and LDH activity showed the high capacity of photoreceptors for aerobic glycolysis and OXPHOS. Competition assays with pyruvate revealed that LDH-5 was localized in the photoreceptor inner segments. The

  17. Metabolic Engineering of Actinobacillus succinogenes Provides Insights into Succinic Acid Biosynthesis

    PubMed Central

    Guarnieri, Michael T.; Chou, Yat-Chen; Salvachúa, Davinia; Mohagheghi, Ali; St. John, Peter C.; Peterson, Darren J.; Bomble, Yannick J.

    2017-01-01

    ABSTRACT Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of the key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Overall, this work demonstrates genetic modifications that can lead to succinic

  18. Metabolic Engineering of Actinobacillus succinogenes Provides Insights into Succinic Acid Biosynthesis.

    PubMed

    Guarnieri, Michael T; Chou, Yat-Chen; Salvachúa, Davinia; Mohagheghi, Ali; St John, Peter C; Peterson, Darren J; Bomble, Yannick J; Beckham, Gregg T

    2017-09-01

    Actinobacillus succinogenes , a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes , enabling examination of SA flux determinants via knockout of the primary competing pathways-namely, acetate and formate production-and overexpression of the key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Overall, this work demonstrates genetic modifications that can lead to succinic acid

  19. Metabolic Engineering of Actinobacillus succinogenes Provides Insights into Succinic Acid Biosynthesis

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Guarnieri, Michael T.; Chou, Yat -Chen; Salvachua, Davinia Rodriquez

    Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of themore » key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Altogether, this work demonstrates genetic modifications that can lead to succinic

  20. Metabolic Engineering of Actinobacillus succinogenes Provides Insights into Succinic Acid Biosynthesis

    DOE PAGES

    Guarnieri, Michael T.; Chou, Yat -Chen; Salvachua, Davinia Rodriquez; ...

    2017-06-16

    Actinobacillus succinogenes, a Gram-negative facultative anaerobe, exhibits the native capacity to convert pentose and hexose sugars to succinic acid (SA) with high yield as a tricarboxylic acid (TCA) cycle intermediate. In addition, A. succinogenes is capnophilic, incorporating CO 2 into SA, making this organism an ideal candidate host for conversion of lignocellulosic sugars and CO 2 to an emerging commodity bioproduct sourced from renewable feedstocks. In this work, we report the development of facile metabolic engineering capabilities in A. succinogenes, enabling examination of SA flux determinants via knockout of the primary competing pathways—namely, acetate and formate production—and overexpression of themore » key enzymes in the reductive branch of the TCA cycle leading to SA. Batch fermentation experiments with the wild-type and engineered strains using pentose-rich sugar streams demonstrate that the overexpression of the SA biosynthetic machinery (in particular, the enzyme malate dehydrogenase) enhances flux to SA. Additionally, removal of competitive carbon pathways leads to higher-purity SA but also triggers the generation of by-products not previously described from this organism (e.g., lactic acid). The resultant engineered strains also lend insight into energetic and redox balance and elucidate mechanisms governing organic acid biosynthesis in this important natural SA-producing microbe. IMPORTANCE Succinic acid production from lignocellulosic residues is a potential route for enhancing the economic feasibility of modern biorefineries. Here, we employ facile genetic tools to systematically manipulate competing acid production pathways and overexpress the succinic acid-producing machinery in Actinobacillus succinogenes. Furthermore, the resulting strains are evaluated via fermentation on relevant pentose-rich sugar streams representative of those from corn stover. Altogether, this work demonstrates genetic modifications that can lead to succinic

  1. Design of an AdvancedTCA board management controller (IPMC)

    NASA Astrophysics Data System (ADS)

    Mendez, J.; Bobillier, V.; Haas, S.; Joos, M.; Mico, S.; Vasey, F.

    2017-03-01

    The AdvancedTCA (ATCA) standard has been selected as the hardware platform for the upgrade of the back-end electronics of the CMS and ATLAS experiments of the Large Hadron Collider (LHC) . In this context, the electronic systems for experiments group at CERN is running a project to evaluate, specify, design and support xTCA equipment. As part of this project, an Intelligent Platform Management Controller (IPMC) for ATCA blades, based on a commercial solution, has been designed to be used on existing and future ATCA blades. This paper reports on the status of this project presenting the hardware and software developments.

  2. Analysis of L-glutamic acid fermentation by using a dynamic metabolic simulation model of Escherichia coli.

    PubMed

    Nishio, Yousuke; Ogishima, Soichi; Ichikawa, Masao; Yamada, Yohei; Usuda, Yoshihiro; Masuda, Tadashi; Tanaka, Hiroshi

    2013-09-22

    Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. We constructed an L-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for L-glutamic acid production; the results of this process corresponded with previous experimental data regarding L-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of L-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model L-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in L-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation.

  3. Improving intestinal absorption and oral bioavailability of curcumin via taurocholic acid-modified nanostructured lipid carriers.

    PubMed

    Tian, Cihui; Asghar, Sajid; Wu, Yifan; Chen, Zhipeng; Jin, Xin; Yin, Lining; Huang, Lin; Ping, Qineng; Xiao, Yanyu

    2017-01-01

    The expression of multiple receptors on intestinal epithelial cells enables an actively targeted carrier to significantly enhance the oral delivery of payloads. Conjugating the receptors' ligands on the surfaces of a particulate-delivery system allows site-specific targeting. Here, we used taurocholic acid (TCA) as a ligand for uptake of nanostructured lipid carriers (NLCs) mediated by a bile-acid transporter to improve oral bioavailability of curcumin (Cur). First, synthesis of TCA-polyethylene glycol 100-monostearate (S100-TCA) was carried out. Then, the physical and chemical properties of S100-TCA-modified Cur-loaded NLCs (Cur-TCA NLCs) with varying levels of S100-TCA modifications were investigated. Small particle size (<150 nm), high drug encapsulation (>90%), drug loading (about 3%), negative ζ-potential (-7 to -3 mV), and sustained release were obtained. In situ intestinal perfusion studies demonstrated improved absorption rate and permeability coefficient of Cur-TCA NLCs. Depending on the degree of modification, Cur-TCA NLCs displayed about a five- to 15-fold higher area under the curve in rats after oral administration than unmodified Cur NLCs, which established that the addition of S100-TCA to the NLCs boosted absorption of Cur. Further investigations of TCA NLCs might reveal a bright future for effective oral delivery of poorly bioavailable drugs.

  4. Isomerization of α-pinene in the terpentin oil with TCA/Natural Zeolite using microwave irradiation

    NASA Astrophysics Data System (ADS)

    Wijayati, N.; Supartono; Kusumastuti, E.

    2018-04-01

    The catalytic potensial of trichloroacetic acid (TCA)//Natural Zeolite in the isomerization of α-pinene in the terpentin oil was investigated. The purpose of this study is to investigate the influence of the power of microvawe on activity and selectivity of catalyst. The main product were champhene, terpinene, limonene, p-cymene, and terpinolene. The highest selectivity was 28.26% with a conversion of 23.25%, whereas the higher conversion was 98.99% with selectivity of 16.90% at room temperature using power of microwave 640 W.

  5. Reversal of metabolic deficits by lipoic acid in a triple transgenic mouse model of Alzheimer's disease: a 13C NMR study

    PubMed Central

    Sancheti, Harsh; Kanamori, Keiko; Patil, Ishan; Díaz Brinton, Roberta; Ross, Brian D; Cadenas, Enrique

    2014-01-01

    Alzheimer's disease is an age-related neurodegenerative disease characterized by deterioration of cognition and loss of memory. Several clinical studies have shown Alzheimer's disease to be associated with disturbances in glucose metabolism and the subsequent tricarboxylic acid (TCA) cycle-related metabolites like glutamate (Glu), glutamine (Gln), and N-acetylaspartate (NAA). These metabolites have been viewed as biomarkers by (a) assisting early diagnosis of Alzheimer's disease and (b) evaluating the efficacy of a treatment regimen. In this study, 13-month-old triple transgenic mice (a mouse model of Alzheimer's disease (3xTg-AD)) were given intravenous infusion of [1-13C]glucose followed by an ex vivo 13C NMR to determine the concentrations of 13C-labeled isotopomers of Glu, Gln, aspartate (Asp), GABA, myo-inositol, and NAA. Total (12C+13C) Glu, Gln, and Asp were quantified by high-performance liquid chromatography to calculate enrichment. Furthermore, we examined the effects of lipoic acid in modulating these metabolites, based on its previously established insulin mimetic effects. Total 13C labeling and percent enrichment decreased by ∼50% in the 3xTg-AD mice. This hypometabolism was partially or completely restored by lipoic acid feeding. The ability of lipoic acid to restore glucose metabolism and subsequent TCA cycle-related metabolites further substantiates its role in overcoming the hypometabolic state inherent in early stages of Alzheimer's disease. PMID:24220168

  6. Methicillin-Susceptible Teicoplanin-Resistant Staphylococcus haemolyticus Isolate from a Bloodstream Infection with Novel Mutations in the tcaRAB Teicoplanin Resistance Operon.

    PubMed

    Bakthavatchalam, Yamuna Devi; Sudarsanam, Thambu David; Babu, Priyanka; Munuswamy, Elakkiya; Muthuirulandi Sethuvel, Dhiviya Prabaa; Devanga Ragupathi, Naveen Kumar; Veeraraghavan, Balaji

    2017-07-24

    Staphylococcus haemolyticus is a coagulase-negative staphylococcus that is frequently isolated from blood cultures. Here, we report a case of methicillin-susceptible S. haemolyticus that is resistant to teicoplanin (TEC) and heteroresistant to vancomycin (VAN). The isolate was susceptible to cefoxitin and resistant to TEC by Etest. Population analysis profile-area under the curve analysis confirmed the presence of a VAN heteroresistant subpopulation. Next-generation sequencing analysis of the genome revealed the presence of blaZ and msr(A), which encode cross-resistance to macrolide, lincosamide, and streptogramin B, and the quinolone resistance-conferring gene norA. In addition, several amino acid substitutions were observed in the TEC resistance operon tcaRAB, including I3N, I390N, and L450I in tcaA and L44V, G52V, and S87P in tcaR, as well as in the transpeptidase encoding gene walK (D336Y, R375L, and V404A) and L315 and P316 in graS. We hypothesized that this combination of mutations could confer TEC resistance and reduced VAN susceptibility.

  7. Analysis of l-glutamic acid fermentation by using a dynamic metabolic simulation model of Escherichia coli

    PubMed Central

    2013-01-01

    Background Understanding the process of amino acid fermentation as a comprehensive system is a challenging task. Previously, we developed a literature-based dynamic simulation model, which included transcriptional regulation, transcription, translation, and enzymatic reactions related to glycolysis, the pentose phosphate pathway, the tricarboxylic acid (TCA) cycle, and the anaplerotic pathway of Escherichia coli. During simulation, cell growth was defined such as to reproduce the experimental cell growth profile of fed-batch cultivation in jar fermenters. However, to confirm the biological appropriateness of our model, sensitivity analysis and experimental validation were required. Results We constructed an l-glutamic acid fermentation simulation model by removing sucAB, a gene encoding α-ketoglutarate dehydrogenase. We then performed systematic sensitivity analysis for l-glutamic acid production; the results of this process corresponded with previous experimental data regarding l-glutamic acid fermentation. Furthermore, it allowed us to predicted the possibility that accumulation of 3-phosphoglycerate in the cell would regulate the carbon flux into the TCA cycle and lead to an increase in the yield of l-glutamic acid via fermentation. We validated this hypothesis through a fermentation experiment involving a model l-glutamic acid-production strain, E. coli MG1655 ΔsucA in which the phosphoglycerate kinase gene had been amplified to cause accumulation of 3-phosphoglycerate. The observed increase in l-glutamic acid production verified the biologically meaningful predictive power of our dynamic metabolic simulation model. Conclusions In this study, dynamic simulation using a literature-based model was shown to be useful for elucidating the precise mechanisms involved in fermentation processes inside the cell. Further exhaustive sensitivity analysis will facilitate identification of novel factors involved in the metabolic regulation of amino acid fermentation. PMID

  8. The influence of alternative pathways of respiration that utilize branched-chain amino acids following water shortage in Arabidopsis.

    PubMed

    Pires, Marcel V; Pereira Júnior, Adilson A; Medeiros, David B; Daloso, Danilo M; Pham, Phuong Anh; Barros, Kallyne A; Engqvist, Martin K M; Florian, Alexandra; Krahnert, Ina; Maurino, Veronica G; Araújo, Wagner L; Fernie, Alisdair R

    2016-06-01

    During dark-induced senescence isovaleryl-CoA dehydrogenase (IVDH) and D-2-hydroxyglutarate dehydrogenase (D-2HGDH) act as alternate electron donors to the ubiquinol pool via the electron-transfer flavoprotein/electron-transfer flavoprotein:ubiquinone oxidoreductase (ETF/ETFQO) pathway. However, the role of this pathway in response to other stresses still remains unclear. Here, we demonstrated that this alternative pathway is associated with tolerance to drought in Arabidopsis. In comparison with wild type (WT) and lines overexpressing D-2GHDH, loss-of-function etfqo-1, d2hgdh-2 and ivdh-1 mutants displayed compromised respiration rates and were more sensitive to drought. Our results demonstrated that an operational ETF/ETFQO pathway is associated with plants' ability to withstand drought and to recover growth once water becomes replete. Drought-induced metabolic reprogramming resulted in an increase in tricarboxylic acid (TCA) cycle intermediates and total amino acid levels, as well as decreases in protein, starch and nitrate contents. The enhanced levels of the branched-chain amino acids in loss-of-function mutants appear to be related to their increased utilization as substrates for the TCA cycle under water stress. Our results thus show that mitochondrial metabolism is highly active during drought stress responses and provide support for a role of alternative respiratory pathways within this response. © 2015 John Wiley & Sons Ltd.

  9. Astrocytic and neuronal oxidative metabolism are coupled to the rate of glutamate-glutamine cycle in the tree shrew visual cortex.

    PubMed

    Sonnay, Sarah; Poirot, Jordan; Just, Nathalie; Clerc, Anne-Catherine; Gruetter, Rolf; Rainer, Gregor; Duarte, João M N

    2018-03-01

    Astrocytes play an important role in glutamatergic neurotransmission, namely by clearing synaptic glutamate and converting it into glutamine that is transferred back to neurons. The rate of this glutamate-glutamine cycle (V NT ) has been proposed to couple to that of glucose utilization and of neuronal tricarboxylic acid (TCA) cycle. In this study, we tested the hypothesis that glutamatergic neurotransmission is also coupled to the TCA cycle rate in astrocytes. For that we investigated energy metabolism by means of magnetic resonance spectroscopy (MRS) in the primary visual cortex of tree shrews (Tupaia belangeri) under light isoflurane anesthesia at rest and during continuous visual stimulation. After identifying the activated cortical volume by blood oxygenation level-dependent functional magnetic resonance imaging, 1 H MRS was performed to measure stimulation-induced variations in metabolite concentrations. Relative to baseline, stimulation of cortical activity for 20 min caused a reduction of glucose concentration by -0.34 ± 0.09 µmol/g (p < 0.001), as well as a -9% ± 1% decrease of the ratio of phosphocreatine-to-creatine (p < 0.05). Then 13 C MRS during [1,6- 13 C]glucose infusion was employed to measure fluxes of energy metabolism. Stimulation of glutamatergic activity, as indicated by a 20% increase of V NT , resulted in increased TCA cycle rates in neurons by 12% ( VTCAn, p < 0.001) and in astrocytes by 24% ( VTCAg, p = 0.007). We further observed linear relationships between V NT and both VTCAn and VTCAg. Altogether, these results suggest that in the tree shrew primary visual cortex glutamatergic neurotransmission is linked to overall glucose oxidation and to mitochondrial metabolism in both neurons and astrocytes. © 2017 Wiley Periodicals, Inc.

  10. Alternative Fuels in Epilepsy and Amyotrophic Lateral Sclerosis.

    PubMed

    Tefera, Tesfaye W; Tan, Kah Ni; McDonald, Tanya S; Borges, Karin

    2017-06-01

    This review summarises the recent findings on metabolic treatments for epilepsy and Amyotrophic Lateral Sclerosis (ALS) in honour of Professor Ursula Sonnewald. The metabolic impairments in rodent models of these disorders as well as affected patients are being discussed. In both epilepsy and ALS, there are defects in glucose uptake and reduced tricarboxylic acid (TCA) cycling, at least in part due to reduced amounts of C4 TCA cycle intermediates. In addition there are impairments in glycolysis in ALS. A reduction in glucose uptake can be addressed by providing the brain with alternative fuels, such as ketones or medium-chain triglycerides. As anaplerotic fuels, such as the triglyceride of heptanoate, triheptanoin, refill the TCA cycle C4/C5 intermediate pool that is deficient, they are ideal to boost TCA cycling and thus the oxidative metabolism of all fuels.

  11. A STUDY COMPARING CHEMICAL PEELING USING MODIFIED JESSNER'S SOLUTION AND 15%TRICHLOROACETIC ACID VERSUS 15% TRICHLOROACETIC ACID IN THE TREATMENT OF MELASMA

    PubMed Central

    Safoury, Omar Soliman; Zaki, Nagla Mohamed; El Nabarawy, Eman Ahmad; Farag, Eman Abas

    2009-01-01

    Background: Melasma is a symmetric progressive hyperpigmentation of the facial skin that occurs in all races but has a predilection for darker skin phenotypes. Depigmenting agents, laser and chemical peeling as classic Jessner's solution, modified Jessner's solution and trichloroacetic acid have been used alone and in combination in the treatment of melasma. Objectives: The aim of the study was to compare the therapeutic effect of combined 15% Trichloroacetic acid (TCA) and modified Jessner's solution with 15% TCA on melasma. Materials and Methods: Twenty married females with melasma (epidermal type), with a mean age of 38.25 years, were included in this study. All were of skin type III or IV. Fifteen percent TCA was applied to the whole face, with the exception of the left malar area to which combined TCA 15% and modified Jessner's solution was applied. Results: Our results revealed statistically highly significant difference between MASI Score (Melasma Area and Severity Index) between the right malar area and the left malar area. Conclusion: Modified Jessner's solution proved to be useful as an adjuvant treatment with TCA in the treatment of melasma, improving the results and minimizing postinflammatory hyperpigmentation. PMID:20049268

  12. The Aurora kinase A inhibitor TC-A2317 disrupts mitotic progression and inhibits cancer cell proliferation

    PubMed Central

    Min, Yoo Hong; Kim, Wootae; Kim, Ja-Eun

    2016-01-01

    Mitotic progression is crucial for the maintenance of chromosomal stability. A proper progression is ensured by the activities of multiple kinases. One of these enzymes, the serine/threonine kinase Aurora A, is required for proper mitosis through the regulation of centrosome and spindle assembly. In this study, we functionally characterized a newly developed Aurora kinase A inhibitor, TC-A2317. In human lung cancer cells, TC-A2317 slowed proliferation by causing aberrant formation of centrosome and microtubule spindles and prolonging the duration of mitosis. Abnormal mitotic progression led to accumulation of cells containing micronuclei or multinuclei. Furthermore, TC-A2317–treated cells underwent apoptosis, autophagy or senescence depending on cell type. In addition, TC-A2317 inactivated the spindle assembly checkpoint triggered by paclitaxel, thereby exacerbating mitotic catastrophe. Consistent with this, the expression level of Aurora A in tumors was inversely correlated with survival in lung cancer patients. Collectively, these data suggest that inhibition of Aurora kinase A using TC-A2317 is a promising target for anti-cancer therapeutics. PMID:27713168

  13. Imaging Prostate Cancer (PCa) Phenotype and Evolution

    DTIC Science & Technology

    2016-10-01

    inhibit growth of some but not all cell lines. 2. Keywords: Deferiprone, aconitase, metabolism, tricarboxylic acid cycle , magnetic resonance 3...TRAMP C2 and MycCaP cell proliferation, migration, and invasiveness. Determine if knockdown of m-acon and Deferiprone inhibit TCA cycle activity...migration and inhibits TCA cycle (metabolism). Similarly in vivo (Aim 2), we 6 Fig. 2: Effect of DFP on in vivo growth of MycCaP (left) and TRAMP C2

  14. Determining Multiple Responses of Pseudomonas aeruginosa PAO1 to an Antimicrobial Agent, Free Nitrous Acid.

    PubMed

    Gao, Shu-Hong; Fan, Lu; Peng, Lai; Guo, Jianhua; Agulló-Barceló, Míriam; Yuan, Zhiguo; Bond, Philip L

    2016-05-17

    Free nitrous acid (FNA) has recently been demonstrated as an antimicrobial agent on a range of micro-organisms, especially in wastewater-treatment systems. However, the antimicrobial mechanism of FNA is largely unknown. Here, we report that the antimicrobial effects of FNA are multitargeted. The response of a model denitrifier, Pseudomnas aeruginosa PAO1 (PAO1), common in wastewater treatment, was investigated in the absence and presence of inhibitory level of FNA (0.1 mg N/L) under anaerobic denitrifying conditions. This was achieved through coupling gene expression analysis, by RNA sequencing, and with a suite of physiological analyses. Various transcripts exhibited significant changes in abundance in the presence of FNA. Respiration was likely inhibited because denitrification activity was severely depleted, and decreased transcript levels of most denitrification genes occurred. As a consequence, the tricarboxylic acid (TCA) cycle was inhibited due to the lowered cellular redox state in the FNA-exposed cultures. Meanwhile, during FNA exposure, PAO1 rerouted its carbon metabolic pathway from the TCA cycle to pyruvate fermentation with acetate as the end product as a possible survival mechanism. Additionally, protein synthesis was significantly decreased, and ribosome preservation was evident. These findings improve our understanding of PAO1 in response to FNA and contribute toward the potential application for use of FNA as an antimicrobial agent.

  15. Effects of pentylenetetrazole and glutamate on metabolism of [U-(13)C]glucose in cultured cerebellar granule neurons.

    PubMed

    Eloqayli, Haytham; Qu, Hong; Unsgård, Geirmund; Sletvold, Olav; Hadidi, Hakam; Sonnewald, Ursula

    2002-02-01

    This study was performed to analyze the effects of glutamate and the epileptogenic agent pentylenetetrazole (PTZ) on neuronal glucose metabolism. Cerebellar granule neurons were incubated for 2 h in medium containing 3 mM [U-(13)C]glucose, with and without 0.25 mM glutamate and/or 10 mM PTZ. In the presence of PTZ, decreased glucose consumption with unchanged lactate release was observed, indicating decreased glucose oxidation. PTZ also slowed down tricarboxylic acid (TCA) cycle activity as evidenced by the decreased amounts of labeled aspartate and [1,2-(13)C]glutamate. When glutamate was present, glucose consumption was also decreased. However, the amount of glutamate, derived from [U-(13)C]glucose via the first turn of the TCA cycle, was increased. The decreased amount of [1,2-(13)C]glutamate, derived from the second turn in the TCA cycle, and increased amount of aspartate indicated the dilution of label due to the entrance of unlabeled glutamate into TCA cycle. In the presence of glutamate plus PTZ, the effect of PTZ was enhanced by glutamate. Labeled alanine was detected only in the presence of glutamate plus PTZ, which indicated that oxaloacetate was a better amino acid acceptor than pyruvate. Furthermore, there was also evidence for intracellular compartmentation of oxaloacetate metabolism. Glutamate and PTZ caused similar metabolic changes, however, via different mechanisms. Glutamate substituted for glucose as energy substrate in the TCA cycle, whereas, PTZ appeared to decrease mitochondrial activity.

  16. De novo Fatty Acid Biosynthesis Contributes Significantly to Establishment of a Bioenergetically Favorable Environment for Vaccinia Virus Infection

    PubMed Central

    Greseth, Matthew D.; Traktman, Paula

    2014-01-01

    The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in

  17. De novo fatty acid biosynthesis contributes significantly to establishment of a bioenergetically favorable environment for vaccinia virus infection.

    PubMed

    Greseth, Matthew D; Traktman, Paula

    2014-03-01

    The poxvirus life cycle, although physically autonomous from the host nucleus, is nevertheless dependent upon cellular functions. A requirement for de novo fatty acid biosynthesis was implied by our previous demonstration that cerulenin, a fatty acid synthase inhibitor, impaired vaccinia virus production. Here we show that additional inhibitors of this pathway, TOFA and C75, reduce viral yield significantly, with partial rescue provided by exogenous palmitate, the pathway's end-product. Palmitate's major role during infection is not for phospholipid synthesis or protein palmitoylation. Instead, the mitochondrial import and β-oxidation of palmitate are essential, as shown by the impact of etomoxir and trimetazidine, which target these two processes respectively. Moreover, the impact of these inhibitors is exacerbated in the absence of exogenous glucose, which is otherwise dispensable for infection. In contrast to glucose, glutamine is essential for productive viral infection, providing intermediates that sustain the TCA cycle (anaplerosis). Cumulatively, these data suggest that productive infection requires the mitochondrial β-oxidation of palmitate which drives the TCA cycle and energy production. Additionally, infection causes a significant rise in the cellular oxygen consumption rate (ATP synthesis) that is ablated by etomoxir. The biochemical progression of the vaccinia life cycle is not impaired in the presence of TOFA, C75, or etomoxir, although the levels of viral DNA and proteins synthesized are somewhat diminished. However, by reversibly arresting infections at the onset of morphogenesis, and then monitoring virus production after release of the block, we determined that virion assembly is highly sensitive to TOFA and C75. Electron microscopic analysis of cells released into C75 revealed fragmented aggregates of viroplasm which failed to be enclosed by developing virion membranes. Taken together, these data indicate that vaccinia infection, and in

  18. Blood metabolomics analysis identifies abnormalities in the citric acid cycle, urea cycle, and amino acid metabolism in bipolar disorder.

    PubMed

    Yoshimi, Noriko; Futamura, Takashi; Kakumoto, Keiji; Salehi, Alireza M; Sellgren, Carl M; Holmén-Larsson, Jessica; Jakobsson, Joel; Pålsson, Erik; Landén, Mikael; Hashimoto, Kenji

    2016-06-01

    Bipolar disorder (BD) is a severe and debilitating psychiatric disorder. However, the precise biological basis remains unknown, hampering the search for novel biomarkers. We performed a metabolomics analysis to discover novel peripheral biomarkers for BD. We quantified serum levels of 116 metabolites in mood-stabilized male BD patients (n = 54) and age-matched male healthy controls (n = 39). After multivariate logistic regression, serum levels of pyruvate, N-acetylglutamic acid, α-ketoglutarate, and arginine were significantly higher in BD patients than in healthy controls. Conversely, serum levels of β-alanine, and serine were significantly lower in BD patients than in healthy controls. Chronic (4-weeks) administration of lithium or valproic acid to adult male rats did not alter serum levels of pyruvate, N-acetylglutamic acid, β-alanine, serine, or arginine, but lithium administration significantly increased serum levels of α-ketoglutarate. The metabolomics analysis demonstrated altered serum levels of pyruvate, N-acetylglutamic acid, β-alanine, serine, and arginine in BD patients. The present findings suggest that abnormalities in the citric acid cycle, urea cycle, and amino acid metabolism play a role in the pathogenesis of BD.

  19. Cell cycle nucleic acids, polypeptides and uses thereof

    DOEpatents

    Gordon-Kamm, William J [Urbandale, IA; Lowe, Keith S [Johnston, IA; Larkins, Brian A [Tucson, AZ; Dilkes, Brian R [Tucson, AZ; Sun, Yuejin [Westfield, IN

    2007-08-14

    The invention provides isolated nucleic acids and their encoded proteins that are involved in cell cycle regulation. The invention further provides recombinant expression cassettes, host cells, transgenic plants, and antibody compositions. The present invention provides methods and compositions relating to altering cell cycle protein content, cell cycle progression, cell number and/or composition of plants.

  20. Serum uric acid in relation to endogenous reproductive hormones during the menstrual cycle: findings from the BioCycle study

    PubMed Central

    Mumford, Sunni L.; Dasharathy, Sonya S.; Pollack, Anna Z.; Perkins, Neil J.; Mattison, Donald R.; Cole, Stephen R.; Wactawski-Wende, Jean; Schisterman, Enrique F.

    2013-01-01

    STUDY QUESTION Do uric acid levels across the menstrual cycle show associations with endogenous estradiol (E2) and reproductive hormone concentrations in regularly menstruating women? SUMMARY ANSWER Mean uric acid concentrations were highest during the follicular phase, and were inversely associated with E2 and progesterone, and positively associated with FSH. WHAT IS KNOWN ALREADY E2 may decrease serum levels of uric acid in post-menopausal women; however, the interplay between endogenous reproductive hormones and uric acid levels among regularly menstruating women has not been elucidated. STUDY DESIGN, SIZE, DURATION The BioCycle study was a prospective cohort study conducted at the University at Buffalo research centre from 2005 to 2007, which followed healthy women for one (n = 9) or 2 (n = 250) menstrual cycle(s). PARTICIPANTS/MATERIALS, SETTING, METHODS Participants were healthy women aged 18–44 years. Hormones and uric acid were measured in serum eight times each cycle for up to two cycles. Marginal structural models with inverse probability of exposure weights were used to evaluate the associations between endogenous hormones and uric acid concentrations. MAIN RESULTS AND THE ROLE OF CHANCE Uric acid levels were observed to vary across the menstrual cycle, with the lowest levels observed during the luteal phase. Every log-unit increase in E2 was associated with a decrease in uric acid of 1.1% (β = −0.011; 95% confidence interval (CI): −0.019, −0.004; persistent-effects model), and for every log-unit increase in progesterone, uric acid decreased by ∼0.8% (β = −0.008; 95% CI: −0.012, −0.004; persistent-effects model). FSH was positively associated with uric acid concentrations, such that each log-unit increase was associated with a 1.6% increase in uric acid (β = 0.016; 95% CI: 0.005, 0.026; persistent-effects model). Progesterone and FSH were also associated with uric acid levels in acute-effects models. Of 509 cycles, 42 were anovulatory

  1. Inhibition of akt phosphorylation diminishes mitochondrial biogenesis regulators, tricarboxylic acid cycle activity and exacerbates recognition memory deficit in rat model of Alzheimer's disease.

    PubMed

    Shaerzadeh, Fatemeh; Motamedi, Fereshteh; Khodagholi, Fariba

    2014-11-01

    3-Methyladenine (3-MA), as a PI3K inhibitor, is widely used for inhibition of autophagy. Inhibition of PI3K class I leads to inhibition of Akt phosphorylation, a central molecule involved in diverse arrays of intracellular cascades in nervous system. Accordingly, in the present study, we aimed to determine the alterations of specific mitochondrial biogenesis markers and mitochondrial function in 3-MA-injected rats following amyloid beta (Aβ) insult. Our data revealed that inhibition of Akt phosphorylation downregulates master regulator of mitochondrial biogenesis, peroxisome proliferator-activated receptor gamma coactivator 1-alpha (PGC-1α). Our data also showed that decrease in PGC-1α level presumably is due to decrease in the phosphorylation of cAMP-response element binding and AMP-activated kinase, two upstream activators of PGC-1α. As a consequence, the level of some mitochondrial biogenesis factors including nuclear respiratory factor-1, mitochondrial transcription factor A, and Cytochrome c decreased significantly. Also, activities of tricarboxylic acid cycle (TCA) enzymes such as Aconitase, a-ketoglutarate dehydrogenase, and malate dehydrogenase reduced in the presence of 3-MA with or without Aβ insult. Decrease in mitochondrial biogenesis factors and TCA enzyme activity in the rats receiving 3-MA and Aβ were more compared to the rats that received either alone; indicating the additive destructive effects of these two agents. In agreement with our molecular results, data obtained from behavioral test (using novel objective recognition test) indicated that inhibition of Akt phosphorylation with or without Aβ injection impaired novel recognition (non-spatial) memory. Our results suggest that 3-MA amplified deleterious effects of Aβ by targeting central molecule Akt.

  2. Metabolic Interaction between Urea Cycle and Citric Acid Cycle Shunt: A Guided Approach

    ERIC Educational Resources Information Center

    Pesi, Rossana; Balestri, Francesco; Ipata, Piero L.

    2018-01-01

    This article is a guided pedagogical approach, devoted to postgraduate students specializing in biochemistry, aimed at presenting all single reactions and overall equations leading to the metabolic interaction between ureagenesis and citric acid cycle to be incorporated into a two-three lecture series about the interaction of urea cycle with other…

  3. Alterations in Hepatic Glucose and Energy Metabolism as a Result of Calorie and Carbohydrate Restriction

    PubMed Central

    Browning, Jeffrey D.; Weis, Brian; Davis, Jeannie; Satapati, Santhosh; Merritt, Matthew; Malloy, Craig R.; Burgess, Shawn C.

    2009-01-01

    Carbohydrate-restriction is a common weight-loss approach that modifies hepatic metabolism by increasing gluconeogenesis and ketosis. Because little is known regarding the effect of carbohydrate-restriction on the origin of gluconeogenic precursors (gluconeogenesis from glycerol (GNGglycerol) and lactate/amino acids (GNGPEP)) or its consequence to hepatic energy homeostasis, we studied these parameters in a group of overweight/obese subjects undergoing weight-loss via dietary restriction. We used 2H and 13C tracers and nuclear magnetic resonance spectroscopy to measure the sources of hepatic glucose and TCA cycle flux in weight-stable subjects(n=7) and subjects following carbohydrate-(n=7) or calorie-restriction(n=7). The majority of hepatic glucose production in carbohydrate-restricted subjects came from GNGPEP. The contribution of glycerol to gluconeogenesis was similar in all groups despite evidence of increased fat oxidation in carbohydrate-restricted subjects. A strong correlation between TCA cycle flux and GNGPEP was found, though the reliance on TCA cycle energy production for gluconeogenesis was attenuated in subjects undergoing carbohydrate restriction. Together, these data imply that the TCA cycle is the energetic patron of gluconeogenesis. However, the relationship between these two pathways is modified by carbohydrate restriction, suggesting an increased reliance of the hepatocyte on energy generated outside of the TCA cycle when GNGPEP is maximal. In conclusion, carbohydrate-restriction modifies hepatic gluconeogenesis by increasing reliance on substrates like lactate or amino acids but not glycerol. This modification is associated with a reorganization of hepatic energy metabolism suggestive of enhanced hepatic β-oxidation. PMID:18925642

  4. Combined effects of a high-fat diet and chronic valproic acid treatment on hepatic steatosis and hepatotoxicity in rats

    PubMed Central

    Zhang, Li-fang; Liu, Ling-sheng; Chu, Xiao-man; Xie, Hao; Cao, Li-juan; Guo, Cen; A, Ji-ye; Cao, Bei; Li, Meng-jie; Wang, Guang-ji; Hao, Hai-ping

    2014-01-01

    Aim: To investigate the potential interactive effects of a high-fat diet (HFD) and valproic acid (VPA) on hepatic steatosis and hepatotoxicity in rats. Methods: Male SD rats were orally administered VPA (100 or 500 mg·kg−1·d−1) combined with HFD or a standard diet for 8 weeks. Blood and liver samples were analyzed to determine lipid levels and hepatic function biomarkers using commercial kit assays. Low-molecular-weight compounds in serum, urine and bile samples were analyzed using a metabonomic approach based on GC/TOF-MS. Results: HFD alone induced extensive hepatocyte steatosis and edema in rats, while VPA alone did not cause significant liver lesions. VPA significantly aggravated HFD-induced accumulation of liver lipids, and caused additional spotty or piecemeal necrosis, accompanied by moderate infiltration of inflammatory cells in the liver. Metabonomic analysis of serum, urine and bile samples revealed that HFD significantly increased the levels of amino acids, free fatty acids (FFAs) and 3-hydroxy-butanoic acid, whereas VPA markedly decreased the levels of amino acids, FFAs and the intermediate products of the tricarboxylic acid cycle (TCA) compared with the control group. HFD aggravated VPA-induced inhibition on lipid and amino acid metabolism. Conclusion: HFD magnifies VPA-induced impairment of mitochondrial β-oxidation of FFAs and TCA, thereby increases hepatic steatosis and hepatotoxicity. The results suggest the patients receiving VPA treatment should be advised to avoid eating HFD. PMID:24442146

  5. Comparative transcriptome analysis reveals different molecular mechanisms of Bacillus coagulans 2-6 response to sodium lactate and calcium lactate during lactic acid production.

    PubMed

    Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping

    2015-01-01

    Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that 'ATP-binding cassette transporters' were significantly affected by calcium lactate stress, and 'amino sugar and nucleotide sugar metabolism' was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of 'glycolysis/gluconeogenesis' genes but positive effect on the expression of 'citrate cycle (TCA cycle)' genes. However, calcium lactate stress had positive influence on the expression of 'glycolysis/gluconeogenesis' genes and had minor influence on 'citrate cycle (TCA cycle)' genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans.

  6. Comparative Transcriptome Analysis Reveals Different Molecular Mechanisms of Bacillus coagulans 2-6 Response to Sodium Lactate and Calcium Lactate during Lactic Acid Production

    PubMed Central

    Qin, Jiayang; Wang, Xiuwen; Wang, Landong; Zhu, Beibei; Zhang, Xiaohua; Yao, Qingshou; Xu, Ping

    2015-01-01

    Lactate production is enhanced by adding calcium carbonate or sodium hydroxide during fermentation. However, Bacillus coagulans 2-6 can produce more than 180 g/L L-lactic acid when calcium lactate is accumulated, but less than 120 g/L L-lactic acid when sodium lactate is formed. The molecular mechanisms by which B. coagulans responds to calcium lactate and sodium lactate remain unclear. In this study, comparative transcriptomic methods based on high-throughput RNA sequencing were applied to study gene expression changes in B. coagulans 2-6 cultured in non-stress, sodium lactate stress and calcium lactate stress conditions. Gene expression profiling identified 712 and 1213 significantly regulated genes in response to calcium lactate stress and sodium lactate stress, respectively. Gene ontology assignments of the differentially expressed genes were performed. KEGG pathway enrichment analysis revealed that ‘ATP-binding cassette transporters’ were significantly affected by calcium lactate stress, and ‘amino sugar and nucleotide sugar metabolism’ was significantly affected by sodium lactate stress. It was also found that lactate fermentation was less affected by calcium lactate stress than by sodium lactate stress. Sodium lactate stress had negative effect on the expression of ‘glycolysis/gluconeogenesis’ genes but positive effect on the expression of ‘citrate cycle (TCA cycle)’ genes. However, calcium lactate stress had positive influence on the expression of ‘glycolysis/gluconeogenesis’ genes and had minor influence on ‘citrate cycle (TCA cycle)’ genes. Thus, our findings offer new insights into the responses of B. coagulans to different lactate stresses. Notably, our RNA-seq dataset constitute a robust database for investigating the functions of genes induced by lactate stress in the future and identify potential targets for genetic engineering to further improve L-lactic acid production by B. coagulans. PMID:25875592

  7. Dihydrolipoyl dehydrogenase as a potential UVB target in skin epidermis; using an integrated approach of label-free quantitative proteomics and targeted metabolite analysis.

    PubMed

    Moon, Eunjung; Park, Hye Min; Lee, Choong Hwan; Do, Seon-Gil; Park, Jong-Moon; Han, Na-Young; Do, Moon Ho; Lee, Jong Ha; Lee, Hookeun; Kim, Sun Yeou

    2015-03-18

    Photodamage is extrinsically induced by overexposure to ultraviolet (UV) radiation, and it increases the risk of various skin disorders. Therefore, discovery of novel biomarkers of photodamage is important. In this study, using LC-MS/MS analysis of epidermis from UVB-irradiated hairless mice, we identified 57 proteins whose levels changed after UVB exposure, and selected 7 proteins related to the tricarboxylic acid (TCA) cycle through pathway analysis. Dihydrolipoyl dehydrogenase (DLD) was the only TCA cycle-associated protein that showed a decreased expression after the UVB exposure. We also performed targeted analysis to detect intermediates and products of the TCA cycle using GC-TOF-MS. Interestingly, malic acid and fumaric acid levels significantly decreased in the UVB-treated group. Our results demonstrate that DLD and its associated metabolites, malic acid and fumaric acid, may be candidate biomarkers of UVB-induced skin photoaging. Additionally, we showed that Aloe vera, a natural skin moisturizer, regulated DLD, malic acid and fumaric acid levels in UVB-exposed epidermis. Our strategy to integrate the proteome and targeted metabolite to detect novel UVB targets will lead to a better understanding of skin photoaging and photodamage. Our study also supports that A. vera exerts significant anti-photodamage activity via regulation of DLD, a novel UVB target, in the epidermis. This study is the first example of an integration of proteomic and metabolite analysis techniques to find new biomarker candidates for the regulation of the UVB-induced skin photoaging. DLD, malic acid, and fumaric acid can be used for development of cosmeceuticals and nutraceuticals regulating the change of skin metabolism induced by the UVB overexposure. Moreover, this is also the first attempt to investigate the role of the TCA cycle in photodamaged epidermis. Our integration of the proteomic and targeted metabolite analyses will lead to a better understanding of the unidentified

  8. Performance improvement of GaN-based metal-semiconductor-metal photodiodes grown on Si(111) substrate by thermal cycle annealing process

    NASA Astrophysics Data System (ADS)

    Lin, Jyun-Hao; Huang, Shyh-Jer; Su, Yan-Kuin

    2014-01-01

    A simple thermal cycle annealing (TCA) process was used to improve the quality of GaN grown on a Si substrate. The X-ray diffraction (XRD) and etch pit density (EPD) results revealed that using more process cycles, the defect density cannot be further reduced. However, the performance of GaN-based metal-semiconductor-metal (MSM) photodiodes (PDs) prepared on Si substrates showed significant improvement. With a two-cycle TCA process, it is found that the dark current of the device was only 1.46 × 10-11 A, and the photo-to-dark-current contrast ratio was about 1.33 × 105 at 5 V. Also, the UV/visible rejection ratios can reach as high as 1077.

  9. Closed cycle ion exchange method for regenerating acids, bases and salts

    DOEpatents

    Dreyfuss, Robert M.

    1976-01-01

    A method for conducting a chemical reaction in acidic, basic, or neutral solution as required and then regenerating the acid, base, or salt by means of ion exchange in a closed cycle reaction sequence which comprises contacting the spent acid, base, or salt with an ion exchanger, preferably a synthetic organic ion-exchange resin, so selected that the counter ions thereof are ions also produced as a by-product in the closed reaction cycle, and then regenerating the spent ion exchanger by contact with the by-product counter ions. The method is particularly applicable to closed cycle processes for the thermochemical production of hydrogen.

  10. Trichloroacetic acid fate and toxicity to the macrophytes Myriophyllum spicatum and Myriophyllum sibiricum under field conditions.

    PubMed

    Hanson, Mark L; Sibley, Paul K; Ellis, David A; Fineberg, Neil A; Mabury, Scott A; Solomon, Keith R; Muir, Derek C

    2002-03-01

    Trichloroacetic acid (TCA) has been detected in rain, snow, and river samples throughout the world. It may enter into natural water systems via herbicide use, as a by-product of water disinfection, from emissions of spent bleach liquor of kraft pulp mills, and as a natural fungal product. This compound is phytotoxic and likely to accumulate in aquatic environments. A study to assess the fate of TCA in semi-natural aquatic environments and the toxicity of TCA to rooted aquatic macrophytes was conducted. The experiment involved exposing three replicate 12000 l aquatic microcosms at the University of Guelph Microcosm Facility to 0.05, 0.5, 3, and 10 mg/l of TCA for 35 days in a one-way analysis of variance design. Each microcosm was stocked with 14 individual 5 cm apical shoots of Myriophyllum spicatum and M. sibiricum. The plants were sampled at regular intervals and assessed for the somatic endpoints of plant length, root growth, number of nodes and wet and dry mass and the biochemical endpoints of chlorophyll-a and chlorophyll-b, carotenoid content, and citric acid levels. TCA half-lives in the microcosms ranged from 190 to 296 h depending on the initial concentration of TCA. Myriophyllum spp. results indicate that while there were some statistically significant differences from controls, there were no biologically significant effects of TCA for any of the endpoints examined. These data suggest that TCA does not pose a significant risk to these macrophytes up to 10 mg/l, which typically exceeds environmentally relevant concentrations by several orders of magnitude.

  11. Trichloroacetic acid in the environment.

    PubMed

    McCulloch, A

    2002-05-01

    Suppositions that the trichloroacetic acid (TCA, CCl3C(O)OH) found in nature was a consequence solely of the use of chlorinated hydrocarbon solvents prompted this critical review of the literature on its environmental fluxes and occurrences. TCA is widely distributed in forest soils (where it was rarely used as an herbicide) and measurements suggest a soil flux of 160 000 tonnes yr(-1) in European forests alone. TCA is also produced during oxidative water treatment and the global flux could amount to 55 000 tonnes yr(-1) (from pulp and paper manufacture, potable water and cooling water treatments). By contrast, the yields of TCA from chlorinated hydrocarbon solvents are small: from tetrachloroethene 13 600 tonnes yr(-1) and from 1,1,1-trichloroethane 4300 tonnes yr(-1) on a global basis, at the atmospheric burdens and removal rates typical of the late 1990s. TCA is ubiquitous in rainwater and snow. Its concentrations are highly variable and the variations cannot be connected with location or date. However, there is no significant difference between the concentrations found in Chile and in eastern Canada (by the same analysts), or between Malawi and western Canada, or between Antarctica and Switzerland, nor any significant difference globally between the concentrations in cloud, rain and snow (although local enhancement in fog water has been shown). TCA is present in old ice and firn. At the deepest levels, the firn was deposited early in the 19th century, well before the possibility of contamination by industrial production of reactive chlorine, implying a non-industrial background. This proposition is supported by plume measurements from pulp mills in Finland. TCA is ubiquitous in soils; concentrations are very variable but there are some indications that soils under coniferous trees contain higher amounts. The concentrations of TCA found in plant tissue are region-specific and may also be plant-specific, to the extent that conifers seem to contain more than other

  12. Molecular structure and spectral properties of ethyl 3-quinolinecarboxylate (E3Q) and [Ag(E3Q)2(TCA)] complex (TCA = Trichloroacetate)

    NASA Astrophysics Data System (ADS)

    Soliman, Saied M.; Kassem, Taher S.; Badr, Ahmed M. A.; Abou Youssef, Morsy A.; Assem, Rania

    2014-09-01

    A new [Ag(E3Q)2(TCA)] complex; (E3Q = Ethyl 3-quinolinecarboxylate and TCA = Trichloroacetate) has been synthesized and characterized using elemental analysis, FTIR, NMR and mass spectroscopy. The molecular geometry and spectroscopic properties of the complex as well as the free ligand have been calculated using the hybrid B3LYP method. The calculations predicted a distorted tetrahedral arrangement around Ag(I) ion. The vibrational spectra of the studied compounds have been assigned using potential energy distribution (PED). TD-DFT method was used to predict the electronic absorption spectra. The most intense absorption band showed a bathochromic shift and lowering of intensity in case of the complex (233.7 nm, f = 0.5604) compared to E3Q (λmax = 228.0 nm, f = 0.9072). The calculated 1H NMR chemical shifts using GIAO method showed good correlations with the experimental data. The computed dipole moment, polarizability and HOMO-LUMO energy gap were used to predict the nonlinear optical (NLO) properties. It is found that Ag(I) enhances the NLO activity. The natural bond orbital (NBO) analyses were used to elucidate the intramolecular charge transfer interactions causing stabilization for the investigated systems.

  13. Metabolomics Reveals that Dietary Ferulic Acid and Quercetin Modulate Metabolic Homeostasis in Rats.

    PubMed

    Zhang, Limin; Dong, Manyuan; Guangyong Xu; Yuan Tian; Tang, Huiru; Wang, Yulan

    2018-02-21

    Phenolic compounds ingestion has been shown to have potential preventive and therapeutic effects against various metabolic diseases such as obesity and cancer. To provide a better understanding of these potential benefit effects, we investigated the metabolic alterations in urine and feces of rat ingested ferulic acid (FA) and quercetin (Qu) using NMR-based metabolomics approach. Our results suggested that dietary FA and/or Qu significantly decreased short chain fatty acids and elevated oligosaccharides in the feces, implying that dietary FA and Qu may modulate gut microbial community with inhibition of bacterial fermentation of dietary fibers. We also found that dietary FA and/or Qu regulated several host metabolic pathways including TCA cycle and energy metabolism, bile acid, amino acid, and nucleic acid metabolism. These biological effects suggest that FA and Qu display outstanding bioavailability and bioactivity and could be used for treatment of some metabolic syndromes, such as inflammatory bowel diseases and obesity.

  14. Ecotypic variability in the metabolic response of seeds to diurnal hydration-dehydration cycles and its relationship to seed vigor.

    PubMed

    Bai, Bing; Sikron, Noga; Gendler, Tanya; Kazachkova, Yana; Barak, Simon; Grafi, Gideon; Khozin-Goldberg, Inna; Fait, Aaron

    2012-01-01

    Seeds in the seed bank experience diurnal cycles of imbibition followed by complete dehydration. These conditions pose a challenge to the regulation of germination. The effect of recurring hydration-dehydration (Hy-Dh) cycles were tested on seeds from four Arabidopsis thaliana accessions [Col-0, Cvi, C24 and Ler]. Diurnal Hy-Dh cycles had a detrimental effect on the germination rate and on the final percentage of germination in Col-0, Cvi and C24 ecotypes, but not in the Ler ecotype, which showed improved vigor following the treatments. Membrane permeability measured by ion conductivity was generally increased following each Hy-Dh cycle and was correlated with changes in the redox status represented by the GSSG/GSH (oxidized/reduced glutathione) ratio. Among the ecotypes, Col-0 seeds displayed the highest membrane permeability, whilst Ler was characterized by the greatest increase in electrical conductivity following Hy-Dh cycles. Following Dh 2 and Dh 3, the respiratory activity of Ler seeds significantly increased, in contrast to the other ecotypes, indicative of a dramatic shift in metabolism. These differences were associated with accession-specific content and patterns of change of (i) cell wall-related laminaribiose and mannose; (ii) fatty acid composition, specifically of the unsaturated oleic acid and α-linoleic acid; and (iii) asparagine, ornithine and the related polyamine putrescine. Furthermore, in the Ler ecotype the content of the tricarboxylic acid (TCA) cycle intermediates fumarate, succinate and malate increased in response to dehydration, in contrast to a decrease in the other three ecotypes. These findings provide a link between seed respiration, energy metabolism, fatty acid β-oxidation, nitrogen mobilization and membrane permeability and the improved germination of Ler seeds following Hy-Dh cycles.

  15. Analysis of hyaluronic acid concentration in rat vocal folds during estral and gravidic puerperal cycles.

    PubMed

    Pedroso, José Eduardo de Sá; Brasil, Osíris Camponês do; Martins, João Roberto Maciel; Nader, Helena Bociane; Simões, Manuel de Jesus

    2009-01-01

    Hormone plays an important role in the larynx. Among other substances, vocal folds contain hyaluronic acid, which tissue concentration may vary according to hormone action. the objective of this study is to analyze hyaluronic acid concentration in the vocal folds during estral and gravidic-puerperal cycles. Experimental study. 40 adult rats were divided into two groups. In the first group we used 20 rats to establish the concentration of hyaluronic acid during the estral cycle and in the second group, 20 animals were submitted to the same procedure but during the gravidic-puerperal cycle. Variations in hyaluronic acid concentration was not observed during the estral cycle. In the gravidic puerperal cycle group, an increase in hyaluronic acid concentration was observed in the puerperal subgroup. Comparing the two groups of estral and gravidic-puerperal cycles, no difference was observed. In comparing all subgroups of estral and gravidic-puerperal cycles, an increase in hyaluronic acid concentration was noticed only in the puerperal phase.

  16. Mitochondrial Respiration Can Support NO(3) and NO(2) Reduction during Photosynthesis : Interactions between Photosynthesis, Respiration, and N Assimilation in the N-Limited Green Alga Selenastrum minutum.

    PubMed

    Weger, H G; Turpin, D H

    1989-02-01

    Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH(4) (+), NO(2) (-), NO(3) (-)) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO(2) release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH(4) (+) assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O(2) consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO(3) (-) and NO(2) (-) assimilation resulted in a larger stimulation of TCA cycle CO(2) release than did NH(4) (+), but a much smaller stimulation of mitochondrial O(2) consumption. NH(4) (+) assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO(3) (-) and NO(2) (-) assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH(4) (+), NO(3) (-) and NO(2) (-) assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO(3) (-) and NO(2) (-) assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O(2) consumption during NO(3) (-) and NO(2) (-) assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO(3) (-) and NO(2) (-) reduction.

  17. Sulfuric acid-sulfur heat storage cycle

    DOEpatents

    Norman, John H.

    1983-12-20

    A method of storing heat is provided utilizing a chemical cycle which interconverts sulfuric acid and sulfur. The method can be used to levelize the energy obtained from intermittent heat sources, such as solar collectors. Dilute sulfuric acid is concentrated by evaporation of water, and the concentrated sulfuric acid is boiled and decomposed using intense heat from the heat source, forming sulfur dioxide and oxygen. The sulfur dioxide is reacted with water in a disproportionation reaction yielding dilute sulfuric acid, which is recycled, and elemental sulfur. The sulfur has substantial potential chemical energy and represents the storage of a significant portion of the energy obtained from the heat source. The sulfur is burned whenever required to release the stored energy. A particularly advantageous use of the heat storage method is in conjunction with a solar-powered facility which uses the Bunsen reaction in a water-splitting process. The energy storage method is used to levelize the availability of solar energy while some of the sulfur dioxide produced in the heat storage reactions is converted to sulfuric acid in the Bunsen reaction.

  18. In vitro anticancer effects of insect tea in TCA8113 cells.

    PubMed

    Qian, Yu; Li, Gui-Jie; Wang, Rui; Zhou, Ya-Lin; Sun, Peng; Zhao, Xin

    2014-01-01

    Insect tea is widely used a traditional drink or traditional Chinese medicine in China. This study was conducted with an aim to determine the in vitro anticancer effect of Insect tea in cancer cells. The anticancer effects of Insect tea were evaluated in human tongue carcinoma TCA8113 cells using 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyltetrazolium bromide (MTT) assay, flow cytometry analysis, nuclear staining with 4,6-diamidino-2-phenylindole (DAPI), reverse transcription-polymerase chain reaction (RT-PCR) analysis, and western bolt assay. At 200 μg/mL, Insect tea inhibited the growth of TCA8113 cells by 80.7%, which was higher than the inhibition caused by 100 μg/mL Insect tea but lower than that of 200 μg/mL green tea. Compared to the control cancer cells, Insect tea significantly (P<0.05) induced apoptosis as determined by DAPI staining and flow cytometry analysis results. Insect tea significantly induced apoptosis in cancer cells by upregulating BAX, CASP3, CASP9 and downregulating BCL2. Genes encoding nuclear factor kappa-light-chain-enhancer of activated B cells (NF-κB), inducible nitric oxide synthase (iNOS), and cyclooxygenase-2 (COX-2) were significantly downregulated by Insect tea, demonstrating its anti-inflammatory properties. Insect tea also exerted a great anti-metastasis effect on cancer cells as demonstrated by decreased expression of matrix metalloproteinase (MMP) genes and increased expression of tissue inhibitors of metalloproteinases (TIMPs). The results showed that Insect tea has good in vitro anticancer effects in TCA8113 cells, like green tea.

  19. Geobiochemistry of metabolism: Standard state thermodynamic properties of the citric acid cycle

    NASA Astrophysics Data System (ADS)

    Canovas, Peter A.; Shock, Everett L.

    2016-12-01

    Integrating microbial metabolism into geochemical modeling allows assessments of energy and mass transfer between the geosphere and the microbial biosphere. Energy and power supplies and demands can be assessed from analytical geochemical data given thermodynamic data for compounds involved in catabolism and anabolism. Results are reported here from a critique of the available standard state thermodynamic data for organic acids and acid anions involved in the citric acid cycle (also known as the tricarboxylic acid cycle or the Krebs cycle). The development of methods for estimating standard state data unavailable from experiments is described, together with methods to predict corresponding values at elevated temperatures and pressures using the revised Helgeson-Kirkham-Flowers (HKF) equation of state for aqueous species. Internal consistency is maintained with standard state thermodynamic data for organic and inorganic aqueous species commonly used in geochemical modeling efforts. Standard state data and revised-HKF parameters are used to predict equilibrium dissociation constants for the organic acids in the citric acid cycle, and to assess standard Gibbs energies of reactions for each step in the cycle at elevated temperatures and pressures. The results presented here can be used with analytical data from natural and experimental systems to assess the energy and power demands of microorganisms throughout the habitable ranges of pressure and temperature, and to assess the consequences of abiotic organic compound alteration processes at conditions of subsurface aquifers, sedimentary basins, hydrothermal systems, meteorite parent bodies, and ocean worlds throughout the solar system.

  20. Sulfuric acid on Europa and the radiolytic sulfur cycle.

    PubMed

    Carlson, R W; Johnson, R E; Anderson, M S

    1999-10-01

    A comparison of laboratory spectra with Galileo data indicates that hydrated sulfuric acid is present and is a major component of Europa's surface. In addition, this moon's visually dark surface material, which spatially correlates with the sulfuric acid concentration, is identified as radiolytically altered sulfur polymers. Radiolysis of the surface by magnetospheric plasma bombardment continuously cycles sulfur between three forms: sulfuric acid, sulfur dioxide, and sulfur polymers, with sulfuric acid being about 50 times as abundant as the other forms. Enhanced sulfuric acid concentrations are found in Europa's geologically young terrains, suggesting that low-temperature, liquid sulfuric acid may influence geological processes.

  1. Evaluation of 99mtechnetium-radiopharmaceutical binding to blood elements using different trichloroacetic acid concentrations.

    PubMed

    Freitas, R S; Gutfilen, B; da Fonseca, L M; Bernardo-Filho, M

    1996-01-01

    Secure determination of the binding of 99mTc-radiopharmaceuticals to plasma (P) and blood cell (BC) constituents can help to understand the biodistribution of radiophamaceuticals. The reported precipitation studies of blood with radiopharmaceuticals have shown that the results can not be easily compared between studies. We decided to determine the "gold standard" concentration of trichloroacetic acid (TCA) to evaluate the binding to blood elements for several radiopharmaceuticals used in routine nuclear medicine. We have studied phytic (99mTc-PHY), diethylenetriaminepentaacetic (99mTc-DTPA), glucoheptonic (99mTc-GHA) and dimercaptosuccinic (99mTc-DMSA) acids. Blood was incubated with radiopharmaceuticals, centrifuged and P and BC separated. Samples of P and BC were also precipitated with TCA concentrations (20.0, 10.0, 5.0, 1.0, 0.5 and 0.1 percent) and soluble (SF) and insoluble fractions (IF) were isolated. The percent radioactivity (percent rad) in IF-P depends on TCA concentration. It varied from 36.4 to 65.0 (99mTc-PHY), from 17.9 to 32.0 (99mTc-DTPA), from 11.5 to 38.8 (99mTc-GHA) and from 52.8 to 66.2 (99mTc-DMSA). The results for the binding of 99mTc-PHY to IF-P show that there was no differences in the percent rad when TCA concentrations of 0.1 to 1.0 percent were used. For 99mTc-DTPA, 5.0 percent is the best TCA concentration. For 99mTc-GHA, low values of percent rad bound to IF-P is found with TCA concentrations of 0.1, 0.5 and 1.0. Interestingly, with 99mTc-DMSA, high values of bound radioactivity are not dependent on TCA concentrations (0.1 to 10.0). Radioactivity in IF-BC depends on TCA concentration and it varied for 99mTc-PHY (80.1 to 54.1) and for 99mTc-GHA (85.5 to 61.7). With 99mTc-DTPA and with 99mTc-DMSA the percent rad in IF-BC seems independent of TCA concentration. We suggest that the evaluation of the binding of the various 99mTc-radiopharmaceuticals to blood constituents, using only one TCA concentration, should be avoided.

  2. Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids.

    PubMed

    Terpolilli, Jason J; Masakapalli, Shyam K; Karunakaran, Ramakrishnan; Webb, Isabel U C; Green, Rob; Watmough, Nicholas J; Kruger, Nicholas J; Ratcliffe, R George; Poole, Philip S

    2016-10-15

    Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2 Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [(13)C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2 However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox

  3. Lipogenesis and Redox Balance in Nitrogen-Fixing Pea Bacteroids

    PubMed Central

    Terpolilli, Jason J.; Masakapalli, Shyam K.; Karunakaran, Ramakrishnan; Webb, Isabel U. C.; Green, Rob; Watmough, Nicholas J.; Kruger, Nicholas J.; Ratcliffe, R. George

    2016-01-01

    ABSTRACT Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the tricarboxylic acid (TCA) cycle to generate NAD(P)H for reduction of N2. Metabolic flux analysis of laboratory-grown Rhizobium leguminosarum showed that the flux from [13C]succinate was consistent with respiration of an obligate aerobe growing on a TCA cycle intermediate as the sole carbon source. However, the instability of fragile pea bacteroids prevented their steady-state labeling under N2-fixing conditions. Therefore, comparative metabolomic profiling was used to compare free-living R. leguminosarum with pea bacteroids. While the TCA cycle was shown to be essential for maximal rates of N2 fixation, levels of pyruvate (5.5-fold reduced), acetyl coenzyme A (acetyl-CoA; 50-fold reduced), free coenzyme A (33-fold reduced), and citrate (4.5-fold reduced) were much lower in bacteroids. Instead of completely oxidizing acetyl-CoA, pea bacteroids channel it into both lipid and the lipid-like polymer poly-β-hydroxybutyrate (PHB), the latter via a type III PHB synthase that is active only in bacteroids. Lipogenesis may be a fundamental requirement of the redox poise of electron donation to N2 in all legume nodules. Direct reduction by NAD(P)H of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent with their redox potentials. Instead, bacteroids must balance the production of NAD(P)H from oxidation of acetyl-CoA in the TCA cycle with its storage in PHB and lipids. IMPORTANCE Biological nitrogen fixation by symbiotic bacteria (rhizobia) in legume root nodules is an energy-expensive process. Within legume root nodules, rhizobia differentiate into bacteroids that oxidize host-derived dicarboxylic acids, which is assumed to occur via the TCA cycle to generate NAD(P)H for reduction of N2. However, direct reduction of the likely electron donors for nitrogenase, such as ferredoxin, is inconsistent

  4. Global Regulatory Mutations in csrA and rpoS Cause Severe Central Carbon Stress in Escherichia coli in the Presence of Acetate

    PubMed Central

    Wei, Bangdong; Shin, Sooan; LaPorte, David; Wolfe, Alan J.; Romeo, Tony

    2000-01-01

    The csrA gene encodes a small RNA-binding protein, which acts as a global regulator in Escherichia coli and other bacteria (T. Romeo, Mol. Microbiol. 29:1321–1330, 1998). Its key regulatory role in central carbon metabolism, both as an activator of glycolysis and as a potent repressor of glycogen biosynthesis and gluconeogenesis, prompted us to examine the involvement of csrA in acetate metabolism and the tricarboxylic acid (TCA) cycle. We found that growth of csrA rpoS mutant strains was very poor on acetate as a sole carbon source. Surprisingly, growth also was inhibited specifically by the addition of modest amounts of acetate to rich media (e.g., tryptone broth). Cultures grown in the presence of ≥25 mM acetate consisted substantially of glycogen biosynthesis (glg) mutants, which were no longer inhibited by acetate. Several classes of glg mutations were mapped to known and novel loci. Several hypotheses were examined to provide further insight into the effects of acetate on growth and metabolism in these strains. We determined that csrA positively regulates acs (acetyl-coenzyme A synthetase; Acs) expression and isocitrate lyase activity without affecting key TCA cycle enzymes or phosphotransacetylase. TCA cycle intermediates or pyruvate, but not glucose, galactose, or glycerol, restored growth and prevented the glg mutations in the presence of acetate. Furthermore, amino acid uptake was inhibited by acetate specifically in the csrA rpoS strain. We conclude that central carbon flux imbalance, inhibition of amino acid uptake, and a deficiency in acetate metabolism apparently are combined to cause metabolic stress by depleting the TCA cycle. PMID:10692369

  5. Metabolites Identified during Varied Doses of Aspergillus Species in Zea mays Grains, and Their Correlation with Aflatoxin Levels.

    PubMed

    Falade, Titilayo D O; Chrysanthopoulos, Panagiotis K; Hodson, Mark P; Sultanbawa, Yasmina; Fletcher, Mary; Darnell, Ross; Korie, Sam; Fox, Glen

    2018-05-07

    Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol ( R = 0.48) and turanose and ( R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity.

  6. Selective modification of the pyruvate dehydrogenase kinase isoform profile in skeletal muscle in hyperthyroidism: implications for the regulatory impact of glucose on fatty acid oxidation.

    PubMed

    Sugden, M C; Lall, H S; Harris, R A; Holness, M J

    2000-11-01

    The pyruvate dehydrogenase kinases (PDK1-4) regulate glucose oxidation through inhibitory phosphorylation of the pyruvate dehydrogenase complex (PDC). Immunoblot analysis with antibodies raised against recombinant PDK isoforms demonstrated changes in PDK isoform expression in response to experimental hyperthyroidism (100 microg/100 g body weight; 3 days) that was selective for fast-twitch vs slow-twitch skeletal muscle in that PDK2 expression was increased in the fast-twitch skeletal muscle (the anterior tibialis) (by 1. 6-fold; P<0.05) but not in the slow-twitch muscle (the soleus). PDK4 protein expression was increased by experimental hyperthyroidism in both muscle types, there being a greater response in the anterior tibialis (4.2-fold increase; P<0.05) than in the soleus (3.2-fold increase; P<0.05). The hyperthyroidism-associated up-regulation of PDK4 expression was observed in conjunction with suppression of skeletal-muscle PDC activity, but not suppression of glucose uptake/phosphorylation, as measured in vivo in conscious unrestrained rats (using the 2-[(3)H]deoxyglucose technique). We propose that increased PDK isoform expression contributes to the pathology of hyperthyroidism and to PDC inactivation by facilitating the operation of the glucose --> lactate --> glucose (Cori) and glucose --> alanine --> glucose cycles. We also propose that enhanced relative expression of the pyruvate-insensitive PDK isoform (PDK4) in skeletal muscle in hyperthyroidism uncouples glycolytic flux from pyruvate oxidation, sparing pyruvate for non-oxidative entry into the tricarboxylic acid (TCA) cycle, and thereby supporting entry of acetyl-CoA (derived from fatty acid oxidation) into the TCA cycle.

  7. Mitochondrial Respiration Can Support NO3− and NO2− Reduction during Photosynthesis 1

    PubMed Central

    Weger, Harold G.; Turpin, David H.

    1989-01-01

    Mass spectrometric analysis shows that assimilation of inorganic nitrogen (NH4+, NO2−, NO3−) by N-limited cells of Selenastrum minutum (Naeg.) Collins results in a stimulation of tricarboxylic acid cycle (TCA cycle) CO2 release in both the light and dark. In a previous study we have shown that TCA cycle reductant generated during NH4+ assimilation is oxidized via the cytochrome electron transport chain, resulting in an increase in respiratory O2 consumption during photosynthesis (HG Weger, DG Birch, IR Elrifi, DH Turpin [1988] Plant Physiol 86: 688-692). NO3− and NO2− assimilation resulted in a larger stimulation of TCA cycle CO2 release than did NH4+, but a much smaller stimulation of mitochondrial O2 consumption. NH4+ assimilation was the same in the light and dark and insensitive to DCMU, but was 82% inhibited by anaerobiosis in both the light and dark. NO3− and NO2− assimilation rates were maximal in the light, but assimilation could proceed at substantial rates in the light in the presence of DCMU and in the dark. Unlike NH4+, NO3− and NO2− assimilation were relatively insensitive to anaerobiosis. These results indicated that operation of the mitochondrial electron transport chain was not required to maintain TCA cycle activity during NO3− and NO2− assimilation, suggesting an alternative sink for TCA cycle generated reductant. Evaluation of changes in gross O2 consumption during NO3− and NO2− assimilation suggest that TCA cycle reductant was exported to the chloroplast during photosynthesis and used to support NO3− and NO2− reduction. PMID:16666557

  8. Metabolic changes associated with tumor metastasis, part 2: Mitochondria, lipid and amino acid metabolism.

    PubMed

    Porporato, Paolo E; Payen, Valéry L; Baselet, Bjorn; Sonveaux, Pierre

    2016-04-01

    Metabolic alterations are a hallmark of cancer controlling tumor progression and metastasis. Among the various metabolic phenotypes encountered in tumors, this review focuses on the contributions of mitochondria, lipid and amino acid metabolism to the metastatic process. Tumor cells require functional mitochondria to grow, proliferate and metastasize, but shifts in mitochondrial activities confer pro-metastatic traits encompassing increased production of mitochondrial reactive oxygen species (mtROS), enhanced resistance to apoptosis and the increased or de novo production of metabolic intermediates of the TCA cycle behaving as oncometabolites, including succinate, fumarate, and D-2-hydroxyglutarate that control energy production, biosynthesis and the redox state. Lipid metabolism and the metabolism of amino acids, such as glutamine, glutamate and proline are also currently emerging as focal control points of cancer metastasis.

  9. NF-κB controls four genes encoding core enzymes of tricarboxylic acid cycle.

    PubMed

    Zhou, Fei; Xu, Xinhui; Wu, Jian; Wang, Danyang; Wang, Jinke

    2017-07-20

    NF-κB may promote tumor progression by altering cell metabolism. Hence, finding its target genes that are involved in cell metabolism is helpful for understanding its role in tumor growth. Here we discovered four metabolism-related target genes of this transcription factor. By analyzing a chromatin immunoprecipitation followed by deep sequencing (ChIP-Seq) data that characterizing the global binding sites (BSs) of NF-κB RelA in the TNFα-stimulated HeLa cells, we found that four genes that encode core enzymes of the tricarboxylic acid (TCA) cycle, including IDH1, IDH3A, ACO2, and SUCLA2, were multiply bound by this transcription factor. The subsequent bioinformatic analysis revealed that the NF-κB BSs contained many canonical κB sequences and the NF-κB-like DNA-binding motifs. Detection of ChIPed DNA with polymerase chain reaction (ChIP-PCR) also indicated that the NF-κB BSs were bound by NF-κB in both TNFα-treated HeLa and HepG2 cells. The reporter construct showed that the NF-κB BSs could activate the luciferase expression in cells in a NF-κB-specific manner. The quantitative PCR and Western blot detections demonstrated that NF-κB could regulate the expressions of IDH1, IDH3A, and ACO2 genes at both mRNA and protein levels and that of SUCLA2 gene at mRNA level in the TNFα-treated HeLa and HepG2 cells. Based on these investigations we identified the four genes as new target genes of NF-κB. The finding provides new insights into the role of NF-κB in cellular energetic metabolism, which may be beneficial for understanding the metabolic physiology of tumor growth. Copyright © 2017. Published by Elsevier B.V.

  10. Comparative Study of the Use of Trichloroacetic Acid and Phenolic Acid in the Treatment of Atrophic-Type Acne Scars.

    PubMed

    Dalpizzol, Mariana; Weber, Magda B; Mattiazzi, Anna Paula F; Manzoni, Ana Paula D

    2016-03-01

    Many therapies involving varying degrees of complexity have been used to treat acne scars, but none is considered the gold standard treatment. A comparative evaluation of 88% phenol and 90% trichloroacetic acid (TCA) applied using the chemical reconstruction of skin scars (CROSS) technique. A nonrandomized, single-blinded self-controlled clinical trial was conducted among patients with ice pick-type and boxcar-type atrophic acne scars. Using 88% phenol on the left hemiface and 90% TCA on the right hemiface was adopted as the standard practice of the CROSS technique. The dermatological quality of life index (DLQI) questionnaire, acne scar grading scale Échelle d´Evaluation Clinique des Cicatrices d'Acne (ECCA), and evaluation of improvement were performed pretreatment and post-treatment. Regarding ECCA, significant differences were found in pretreatment and post-treatment (p < .001). Regarding tolerance to pain, it was found that the discomfort felt with 90% TCA was significantly less than that felt with 88% phenol (p = .020). Regarding the quality of life measured with the DLQI, the results showed that the mean score in post-treatment assessment was significantly lower than that in the pretreatment assessment (p < .05). Hypochromia and enlargement scar were only seen after the use of 90% TCA. This study confirmed the efficacy of both TCA and phenol for treating such scars, with less severe complications from the use of phenol.

  11. Dwell Time and Surface Parameter Effects on Removal of Silicone Oil From D6ac Steel Using TCA

    NASA Technical Reports Server (NTRS)

    Boothe, R. E.

    2003-01-01

    This study was conducted to evaluate the impact of dwell time, surface roughness, and the surface activation state on 1,1,1-trichloroethane's (TCA's) effectiveness for removing silicone oil from D6ac steel. Silicone-contaminated test articles were washed with TCA solvent, and then the surfaces were analyzed for residue, using Fourier transform infrared spectroscopy. The predominant factor affecting the ability to remove the silicone oil was surface roughness.

  12. Extraction-less, rapid assay for the direct detection of 2,4,6-trichloroanisole (TCA) in cork samples.

    PubMed

    Apostolou, Theofylaktos; Pascual, Nuria; Marco, M-Pilar; Moschos, Anastassios; Petropoulos, Anastassios; Kaltsas, Grigoris; Kintzios, Spyridon

    2014-07-01

    2,4,6-trichloroanisole (TCA), the cork taint molecule, has been the target of several analytical approaches over the few past years. In spite of the development of highly efficient and sensitive tools for its detection, ranging from advanced chromatography to biosensor-based techniques, a practical breakthrough for routine cork screening purposes has not yet been realized, in part due to the requirement of a lengthy extraction of TCA in organic solvents, mostly 12% ethanol and the high detectability required. In the present report, we present a modification of a previously reported biosensor system based on the measurement of the electric response of cultured fibroblast cells membrane-engineered with the pAb78 TCA-specific antibody. Samples were prepared by macerating cork tissue and mixing it directly with the cellular biorecognition elements, without any intervening extraction process. By using this novel approach, we were able to detect TCA in just five minutes at extremely low concentrations (down to 0.2 ppt). The novel biosensor offers a number of practical benefits, including a very considerable reduction in the total assay time by one day, and a full portability, enabling its direct employment for on-site, high throughput screening of cork in the field and production facilities, without requiring any type of supporting infrastructure. Copyright © 2014 Elsevier B.V. All rights reserved.

  13. Combined Jessner Solution and Trichloroacetic Acid Versus Trichloroacetic Acid Alone in the Treatment of Melasma in Dark-Skinned Patients.

    PubMed

    Abdel-Meguid, Azza M; Taha, Emad A; Ismail, Sahar A

    2017-05-01

    Melasma is a common challenging pigmentary skin disorder especially in dark-skinned females urging them to seek medical help. Many modalities of treatment are available, but none is satisfactory. To compare safety and efficacy of combined trichloroacetic acid (TCA) (20%-25%) and Jessner's solution versus TCA (20%-25%) alone in dark patients with melasma. The study design was a split face, right-left, assessor-blinded, randomized controlled study. Twenty-four adult female patients (skin phototypes IV-V) with bilateral melasma were treated for 6 sessions at 2 weeks intervals. Clinical assessment of the 2 sides of the face with Melasma Area and Severity Index (MASI) score was performed, and photographs were taken before and after the peeling course. Both therapeutic modalities showed significant decrease in MASI score, which was significantly lower on the side treated with both Jessner solution and TCA. There were significant negative correlations between the percentage of improvement of MASI score and both age of the patients and duration of the melasma. Dark skin melasma can be treated with both regimens safely and effectively; however, combined Jessner solution and TCA is more effective.

  14. Glutaric aciduria type 1 metabolites impair the succinate transport from astrocytic to neuronal cells.

    PubMed

    Lamp, Jessica; Keyser, Britta; Koeller, David M; Ullrich, Kurt; Braulke, Thomas; Mühlhausen, Chris

    2011-05-20

    The inherited neurodegenerative disorder glutaric aciduria type 1 (GA1) results from mutations in the gene for the mitochondrial matrix enzyme glutaryl-CoA dehydrogenase (GCDH), which leads to elevations of the dicarboxylates glutaric acid (GA) and 3-hydroxyglutaric acid (3OHGA) in brain and blood. The characteristic clinical presentation of GA1 is a sudden onset of dystonia during catabolic situations, resulting from acute striatal injury. The underlying mechanisms are poorly understood, but the high levels of GA and 3OHGA that accumulate during catabolic illnesses are believed to play a primary role. Both GA and 3OHGA are known to be substrates for Na(+)-coupled dicarboxylate transporters, which are required for the anaplerotic transfer of the tricarboxylic acid cycle (TCA) intermediate succinate between astrocytes and neurons. We hypothesized that GA and 3OHGA inhibit the transfer of succinate from astrocytes to neurons, leading to reduced TCA cycle activity and cellular injury. Here, we show that both GA and 3OHGA inhibit the uptake of [(14)C]succinate by Na(+)-coupled dicarboxylate transporters in cultured astrocytic and neuronal cells of wild-type and Gcdh(-/-) mice. In addition, we demonstrate that the efflux of [(14)C]succinate from Gcdh(-/-) astrocytic cells mediated by a not yet identified transporter is strongly reduced. This is the first experimental evidence that GA and 3OHGA interfere with two essential anaplerotic transport processes: astrocytic efflux and neuronal uptake of TCA cycle intermediates, which occur between neurons and astrocytes. These results suggest that elevated levels of GA and 3OHGA may lead to neuronal injury and cell death via disruption of TCA cycle activity. © 2011 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. IRIS Toxicological Review of Trichloroacetic Acid (Tca) (Final Report)

    EPA Science Inventory

    EPA has finalized the Toxicological Review of Trichloroacetic Acid: in support of the Integrated Risk Information System (IRIS). Now final, this assessment may be used by EPA’s program and regional offices to inform decisions to protect human health.

  16. Hyperammonaemia‐induced skeletal muscle mitochondrial dysfunction results in cataplerosis and oxidative stress

    PubMed Central

    Davuluri, Gangarao; Allawy, Allawy; Thapaliya, Samjhana; Rennison, Julie H.; Singh, Dharmvir; Kumar, Avinash; Sandlers, Yana; Van Wagoner, David R.; Flask, Chris A.; Hoppel, Charles; Kasumov, Takhar

    2016-01-01

    Key points Hyperammonaemia occurs in hepatic, cardiac and pulmonary diseases with increased muscle concentration of ammonia.We found that ammonia results in reduced skeletal muscle mitochondrial respiration, electron transport chain complex I dysfunction, as well as lower NAD+/NADH ratio and ATP content.During hyperammonaemia, leak of electrons from complex III results in oxidative modification of proteins and lipids.Tricarboxylic acid cycle intermediates are decreased during hyperammonaemia, and providing a cell‐permeable ester of αKG reversed the lower TCA cycle intermediate concentrations and increased ATP content.Our observations have high clinical relevance given the potential for novel approaches to reverse skeletal muscle ammonia toxicity by targeting the TCA cycle intermediates and mitochondrial ROS. Abstract Ammonia is a cytotoxic metabolite that is removed primarily by hepatic ureagenesis in humans. Hyperammonaemia occurs in advanced hepatic, cardiac and pulmonary disease, and in urea cycle enzyme deficiencies. Increased skeletal muscle ammonia uptake and metabolism are the major mechanism of non‐hepatic ammonia disposal. Non‐hepatic ammonia disposal occurs in the mitochondria via glutamate synthesis from α‐ketoglutarate resulting in cataplerosis. We show skeletal muscle mitochondrial dysfunction during hyperammonaemia in a comprehensive array of human, rodent and cellular models. ATP synthesis, oxygen consumption, generation of reactive oxygen species with oxidative stress, and tricarboxylic acid (TCA) cycle intermediates were quantified. ATP content was lower in the skeletal muscle from cirrhotic patients, hyperammonaemic portacaval anastomosis rat, and C2C12 myotubes compared to appropriate controls. Hyperammonaemia in C2C12 myotubes resulted in impaired intact cell respiration, reduced complex I/NADH oxidase activity and electron leak occurring at complex III of the electron transport chain. Consistently, lower NAD+/NADH ratio was observed

  17. Input of trichloroacetic acid into the vegetation of various climate zones--measurements on several continents.

    PubMed

    Weissflog, Ludwig; Krüger, Gert; Elansky, Nikolai; Putz, Erich; Pfennigsdorff, Andrea; Seyfarth, Klaus Ullrich; Nüchter, Matthias; Lange, Christian; Kotte, Karsten

    2003-07-01

    Trichloroacetic acid (TCA, CCl(3)COOH) is a phytotoxic chemical. Although TCA salts and derivates were once used as herbicides to combat perennial grasses and weeds, they have since been banned because of their indiscriminate herbicidal effects on woody plant species. However, TCA can also be formed in the atmosphere. For instance, the high-volatile C(2)-chlorohydrocarbons tetrachloroethene (TECE, C(2)Cl(4)) and 1,1,1-trichloroethane (TCE, CCl(3)CH(3)) can react under oxidative conditions in the atmosphere to form TCA and other substances. The ongoing industrialisation of Southeast Asia, South Africa and South America means that use of TECE as solvents in the metal and textile industries of these regions in the southern hemisphere can be expected to rise. The increasing emissions of this substance--together with the rise in the atmospheric oxidation potential caused by urban activities, slash and burn agriculture and forest fires in the southern hemisphere--could lead to a greater input/formation of TCA in the vegetation located in the lee of these emission sources. By means of biomonitoring studies, the input/formation of TCA in vegetation was detected at various locations in South America, North America, Africa, and Europe.

  18. SURFACE DEGRADATION OF COMPOSITE RESINS BY ACIDIC MEDICINES AND pH-CYCLING

    PubMed Central

    Valinoti, Ana Carolina; Neves, Beatriz Gonçalves; da Silva, Eduardo Moreira; Maia, Lucianne Cople

    2008-01-01

    This study evaluated the effects of acidic medicines (Dimetapp® and Claritin®), under pH-cycling conditions, on the surface degradation of four composite resins (microhybrid: TPH, Concept, Opallis and Nanofilled: Supreme). Thirty disc-shaped specimens (Ø = 5.0 mm / thickness = 2.0 mm) of each composite were randomly assigned to 3 groups (n = 10): a control and two experimental groups, according to the acidic medicines evaluated. The specimens were finished and polished with aluminum oxide discs, and the surface roughness was measured by using a profilometer. After the specimens were submitted to a pH-cycling regimen and immersion in acidic medicines for 12 days, the surface roughness was measured again. Two specimens for each material and group were analyzed by scanning electron microscopy (SEM) before and after pH-cycling. Data were analyzed by the Student's-t test, ANOVA, Duncan's multiple range test and paired t-test (α=0.05). Significant increase in roughness was found only for TPH in the control group and TPH and Supreme immersed in Claritin® (p<0.05). SEM analyses showed that the 4 composite resins underwent erosion and surface degradation after being subjected to the experimental conditions. In conclusion, although the roughness was slightly affected, the pH-cycling and acidic medicines caused surface degradation of the composite resins evaluated. Titratable acidity seemed to play a more crucial role on surface degradation of composite resins than pH. PMID:19089257

  19. PEPCK Coordinates the Regulation of Central Carbon Metabolism to Promote Cancer Cell Growth.

    PubMed

    Montal, Emily D; Dewi, Ruby; Bhalla, Kavita; Ou, Lihui; Hwang, Bor Jang; Ropell, Ashley E; Gordon, Chris; Liu, Wan-Ju; DeBerardinis, Ralph J; Sudderth, Jessica; Twaddel, William; Boros, Laszlo G; Shroyer, Kenneth R; Duraisamy, Sekhar; Drapkin, Ronny; Powers, R Scott; Rohde, Jason M; Boxer, Matthew B; Wong, Kwok-Kin; Girnun, Geoffrey D

    2015-11-19

    Phosphoenolpyruvate carboxykinase (PEPCK) is well known for its role in gluconeogenesis. However, PEPCK is also a key regulator of TCA cycle flux. The TCA cycle integrates glucose, amino acid, and lipid metabolism depending on cellular needs. In addition, biosynthetic pathways crucial to tumor growth require the TCA cycle for the processing of glucose and glutamine derived carbons. We show here an unexpected role for PEPCK in promoting cancer cell proliferation in vitro and in vivo by increasing glucose and glutamine utilization toward anabolic metabolism. Unexpectedly, PEPCK also increased the synthesis of ribose from non-carbohydrate sources, such as glutamine, a phenomenon not previously described. Finally, we show that the effects of PEPCK on glucose metabolism and cell proliferation are in part mediated via activation of mTORC1. Taken together, these data demonstrate a role for PEPCK that links metabolic flux and anabolic pathways to cancer cell proliferation. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. Environment impacts the metabolic dependencies of Ras-driven non-small cell lung cancer

    PubMed Central

    Davidson, Shawn M.; Papagiannakopoulos, Thales; Olenchock, Benjamin A.; Heyman, Julia E.; Keibler, Mark A.; Luengo, Alba; Bauer, Matthew R.; Jha, Abhishek K.; O’Brien, James P.; Pierce, Kerry A.; Gui, Dan Y.; Sullivan, Lucas B.; Wasylenko, Thomas M.; Subbaraj, Lakshmipriya; Chin, Christopher R.; Stephanopolous, Gregory; Mott, Bryan T.; Jacks, Tyler; Clish, Clary B.; Vander Heiden, Matthew G.

    2016-01-01

    SUMMARY Cultured cells convert glucose to lactate and glutamine is the major source of tricarboxylic acid (TCA) cycle carbon, but whether the same metabolic phenotype is found in tumors is less studied. We infused mice with lung cancers with isotope-labeled glucose or glutamine and compared the fate of these nutrients in tumor and normal tissue. As expected, lung tumors exhibit increased lactate production from glucose. However, glutamine utilization by both lung tumors and normal lung was minimal, with lung tumors showing increased glucose contribution to the TCA cycle relative to normal lung tissue. Deletion of enzymes involved in glucose oxidation demonstrates that glucose carbon contribution to the TCA cycle is required for tumor formation. These data suggest that understanding nutrient utilization by tumors can predict metabolic dependencies of cancers in vivo. Furthermore, these data argue that the in vivo environment is an important determinant of the metabolic phenotype of cancer cells. PMID:26853747

  1. Oxaloacetate Ameliorates Chemical Liver Injury via Oxidative Stress Reduction and Enhancement of Bioenergetic Fluxes.

    PubMed

    Kuang, Ye; Han, Xiaoyun; Xu, Mu; Wang, Yue; Zhao, Yuxiang; Yang, Qing

    2018-05-31

    Chemical injury is partly due to free radical lipid peroxidation, which can induce oxidative stress and produce a large number of reactive oxygen species (ROS). Oxaloacetic acid is an important intermediary in the tricarboxylic acid cycle (TCA cycle) and participates in metabolism and energy production. In our study, we found that oxaloacetate (OA) effectively alleviated liver injury which was induced by hydrogen peroxide (H₂O₂) in vitro and carbon tetrachloride (CCl₄) in vivo. OA scavenged ROS, prevented oxidative damage and maintained the normal structure of mitochondria. We further confirmed that OA increased adenosine triphosphate (ATP) by promoting the TCA production cycle and oxidative phosphorylation (OXPHOS). Finally, OA inhibited the mitogen-activated protein kinase (MAPK) and apoptotic pathways by suppressing tumor necrosis factor-α (TNF-α). Our findings reveal a mechanism for OA ameliorating chemical liver injury and suggest a possible implementation for preventing the chemical liver injury.

  2. Di(2-ethylhexyl)phthalate Alters the Synthesis and β-Oxidation of Fatty Acids and Hinders ATP Supply in Mouse Testes via UPLC-Q-Exactive Orbitrap MS-Based Metabonomics Study.

    PubMed

    Shen, Guolin; Zhou, Lili; Liu, Wei; Cui, Yuan; Xie, Wenping; Chen, Huiming; Yu, Wenlian; Li, Wentao; Li, Haishan

    2017-06-21

    Di(2-ethylhexyl) phthalate (DEHP) is considered to be an environmental endocrine disruptor at high levels of general exposure. Studies show that DEHP may cause testicular toxicity on human being. In this study, metabonomics techniques were used to identify differential endogenous metabolites, draw the network metabolic pathways, and conduct network analysis, to determine the underlying mechanisms of testicular toxicity induced by DEHP. The results showed that DEHP inhibited synthesis and accelerated β-oxidation of fatty acids and impaired the tricarboxylic acid cycle (TCA cycle) and gluconeogenesis, resulting in lactic acid accumulation and an insufficient ATP supply in the microenvironment of the testis. These alterations led to testicular atrophy and, thus, may be the underlying causes of testicular toxicity. DEHP also inhibited peroxisome proliferator activated receptors in the testis, which may be another potential reason for the testicular atrophy. These findings provided new insights to better understand the mechanisms of testicular toxicity induced by DEHP exposure.

  3. Application of dynamic metabolomics to examine in vivo skeletal muscle glucose metabolism in the chronically high-fat fed mouse

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kowalski, Greg M., E-mail: greg.kowalski@deakin.edu.au; De Souza, David P.; Burch, Micah L.

    Rationale: Defects in muscle glucose metabolism are linked to type 2 diabetes. Mechanistic studies examining these defects rely on the use of high fat-fed rodent models and typically involve the determination of muscle glucose uptake under insulin-stimulated conditions. While insightful, they do not necessarily reflect the physiology of the postprandial state. In addition, most studies do not examine aspects of glucose metabolism beyond the uptake process. Here we present an approach to study rodent muscle glucose and intermediary metabolism under the dynamic and physiologically relevant setting of the oral glucose tolerance test (OGTT). Methods and results: In vivo muscle glucose andmore » intermediary metabolism was investigated following oral administration of [U-{sup 13}C] glucose. Quadriceps muscles were collected 15 and 60 min after glucose administration and metabolite flux profiling was determined by measuring {sup 13}C mass isotopomers in glycolytic and tricarboxylic acid (TCA) cycle intermediates via gas chromatography–mass spectrometry. While no dietary effects were noted in the glycolytic pathway, muscle from mice fed a high fat diet (HFD) exhibited a reduction in labelling in TCA intermediates. Interestingly, this appeared to be independent of alterations in flux through pyruvate dehydrogenase. In addition, our findings suggest that TCA cycle anaplerosis is negligible in muscle during an OGTT. Conclusions: Under the dynamic physiologically relevant conditions of the OGTT, skeletal muscle from HFD fed mice exhibits alterations in glucose metabolism at the level of the TCA cycle. - Highlights: • Dynamic metabolomics was used to investigate muscle glucose metabolism in vivo. • Mitochondrial TCA cycle metabolism is altered in muscle of HFD mice. • This defect was not pyruvate dehydrogenase mediated, as has been previously thought. • Mitochondrial TCA cycle anaplerosis in muscle is virtually absent during the OGTT.« less

  4. Q-switched Nd: YAG laser versus trichloroacetic acid peeling in the treatment of melasma among Egyptian patients.

    PubMed

    Moubasher, Alaa E A; Youssef, Eman M K; Abou-Taleb, Doaa A E

    2014-08-01

    Melasma is a common disorder of facial hyperpigmentation that is often resistant to treatment. To evaluate the efficacy of trichloroacetic acid (TCA) peeling in comparison with double frequency Q-switched neodymium-doped:yttrium aluminum garnet (QS-Nd:YAG) laser in the treatment of melasma. Sixty-five adult Egyptian female patients with melasma were enrolled in this study. Wood light was used for determination of the histological type of melasma. The patients were divided into 4 groups according to treatment modalities: peeling with different concentrations of TCA and double frequency QS-Nd:YAG laser. Trichloroacetic acid peeling was performed every 2 weeks up to 8 sessions, whereas laser treatment was performed every month up to 6 sessions. Melasma area and severity index (MASI) score was used before and after treatment for evaluation. Improvement percentage of MASI score was significantly higher among patients treated with TCA 25% (p < .001). Epidermal type of melasma was significantly improved compared with the dermal type (p = .0029). Q-switched neodymium-doped:yttrium aluminum garnet laser showed the highest incidence of postinflammatory hyperpigmentation (53.3%). Trichloroacetic acid peeling is effective in the treatment of melasma, TCA 25% was the most effective concentration. Q-switched neodymium-doped:yttrium aluminum garnet laser is not recommended in the treatment of melasma because it was associated with the highest incidence of complications.

  5. Enhancement of ε-poly-L-lysine (ε-PL) production by a novel producer Bacillus cereus using metabolic precursors and glucose feeding.

    PubMed

    Chheda, Anuj H; Vernekar, Madhavi R

    2015-10-01

    Epsilon poly-L-lysine (ε-PL) is a homo-biopolymer with approximately 25-30 L-lysine residues. It is a promising natural biopolymer widely used in food and pharmaceutical industry. The present work reports enhanced production of ε-PL with a novel producer Bacillus cereus using amino acids and TCA cycle intermediates in the fermentation medium. Among the various amino acids and TCA cycle intermediates tested 2 mM L-aspartic acid and 5 mM citric acid gave ε-PL yield of 145.5 and 230 mg/L, respectively. A combination of citric acid after 24 h and L-aspartic acid after 36 h improved ε-PL yield from 85 mg/L (control) to 335 mg/L. Glucose feeding strategy along with metabolic precursors was employed which further enhanced ε-PL yield to 565 mg/L. Thus, more than sixfold increase in ε-PL yield was achieved suggesting the potential of Bacillus cereus as a novel ε-PL producer.

  6. Inhibition of histone deacetylases by trans-cinnamic acid and its antitumor effect against colon cancer xenografts in athymic mice

    PubMed Central

    ZHU, BINGYAN; SHANG, BOYANG; LI, YI; ZHEN, YONGSU

    2016-01-01

    Previous studies have shown that trans-cinnamic acid (tCA) has a broad spectrum of biological activities, and exhibits antioxidant, anti-inflammatory and anticancer properties. In addition, tCA and a variety of its analogs have been detected as gut microbe-derived metabolites exerting various biological effects in the colon. The aim of this study was to assess the antitumor activity of tCA in vitro and in vivo, in particular its therapeutic efficacy against colon cancer xenografts in athymic mice. Furthermore, it aimed to examine the effects of tCA on histone deacetylases (HDACs) and to identify the underlying molecular mechanisms. Using an MTT assay, tCA was observed to inhibit the proliferation of several cancer cell lines, and the half maximal inhibitory concentration (IC50) in HT29 colon carcinoma cells was ~1 mM. Western blot analysis demonstrated that tCA upregulated the expression of acetyl-H3 and acetyl-H4 proteins, which was consistent with the effects of the HDAC inhibitor, trichostatin A (TSA). Furthermore, expression of Bcl-2 (a marker of cell proliferation) was reduced, and apoptosis was induced. Apoptosis was shown by the activation of cleavage of poly ADP ribose polymerase and the increased expression of Bax. Apoptosis was also confirmed using APC Annexin V and SYTOX Green Nucleic Acid Stain. In addition, the tCA-induced inhibition of the expression of HDAC markers and activation of apoptosis in tumor tissues were further confirmed by immunohistochemistry. Intragastric administration of tCA at doses of 1.0 and 1.5 mmol/kg body weight suppressed the growth of HT29 human colon carcinoma xenografts in athymic mice at well-tolerated doses. No toxic changes were found in the heart, lung, liver, kidney, colon or bone marrow following histopathological examination. This study indicated that tCA is effective against colon cancer xenograft in nude mice. The antitumor mechanism of tCA was mediated, at least in part, by inhibition of HDACs in cancer cells. As

  7. Chopper-controlled discharge life cycling studies on lead-acid batteries

    NASA Technical Reports Server (NTRS)

    Kraml, J. J.; Ames, E. P.

    1982-01-01

    State-of-the-art 6 volt lead-acid golf car batteries were tested. A daily charge/discharge cycling to failure points under various chopper controlled pulsed dc and continuous current load conditions was undertaken. The cycle life and failure modes were investigated for depth of discharge, average current chopper frequency, and chopper duty cycle. It is shown that battery life is primarily and inversely related to depth of discharge and discharge current. Failure mode is characterized by a gradual capacity loss with consistent evidence of cell element aging.

  8. Induction of Tca8113 tumor cell apoptosis by icotinib is associated with reactive oxygen species mediated p38-MAPK activation.

    PubMed

    Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang

    2014-08-01

    Icotinib, a selective EGFR tyrosine kinase inhibitor (EGFR-TKI), has been shown to exhibit anti-tumor activity against several tumor cell lines. However, the exact molecular mechanism of icotinib's anti-tumor effect remains unknown. This study aims to examine the zytotoxic effect of icotinib on Tca8113 cells and its potential molecular mechanism. Icotinib significantly resulted in dose-dependent cell death as determined by MTT assay, accompanied by increased levels of Bax and DNA fragmentation. Icotinib could also induce Reactive Oxygen Species (ROS) generation. Further studies confirmed that scavenging of reactive oxygen species by N-acetyl-L-cysteine (NAC), and pharmacological inhibition of MAPK reversed icotinib-induced apoptosis in Tca8113 cells. Our data provide evidence that icotinib induces apoptosis, possibly via ROS-mediated MAPK pathway in Tca8113 cells.

  9. PPARδ activation in human myotubes increases mitochondrial fatty acid oxidative capacity and reduces glucose utilization by a switch in substrate preference.

    PubMed

    Feng, Yuan Z; Nikolić, Nataša; Bakke, Siril S; Boekschoten, Mark V; Kersten, Sander; Kase, Eili T; Rustan, Arild C; Thoresen, G Hege

    2014-02-01

    The role of peroxisome proliferator-activated receptor δ (PPARδ) activation on global gene expression and mitochondrial fuel utilization were investigated in human myotubes. Only 21 genes were up-regulated and 3 genes were down-regulated after activation by the PPARδ agonist GW501516. Pathway analysis showed up-regulated mitochondrial fatty acid oxidation, TCA cycle and cholesterol biosynthesis. GW501516 increased oleic acid oxidation and mitochondrial oxidative capacity by 2-fold. Glucose uptake and oxidation were reduced, but total substrate oxidation was not affected, indicating a fuel switch from glucose to fatty acid. Cholesterol biosynthesis was increased, but lipid biosynthesis and mitochondrial content were not affected. This study confirmed that the principal effect of PPARδ activation was to increase mitochondrial fatty acid oxidative capacity. Our results further suggest that PPARδ activation reduced glucose utilization through a switch in mitochondrial substrate preference by up-regulating pyruvate dehydrogenase kinase isozyme 4 and genes involved in lipid metabolism and fatty acid oxidation.

  10. A comprehensive analysis of myocardial substrate preference emphasizes the need for a synchronized fluxomic/metabolomic research design.

    PubMed

    Ragavan, Mukundan; Kirpich, Alexander; Fu, Xiaorong; Burgess, Shawn C; McIntyre, Lauren M; Merritt, Matthew E

    2017-06-01

    The heart oxidizes fatty acids, carbohydrates, and ketone bodies inside the tricarboxylic acid (TCA) cycle to generate the reducing equivalents needed for ATP production. Competition between these substrates makes it difficult to estimate the extent of pyruvate oxidation. Previously, hyperpolarized pyruvate detected propionate-mediated activation of carbohydrate oxidation, even in the presence of acetate. In this report, the optimal concentration of propionate for the activation of glucose oxidation was measured in mouse hearts perfused in Langendorff mode. This study was performed with a more physiologically relevant perfusate than the previous work. Increasing concentrations of propionate did not cause adverse effects on myocardial metabolism, as evidenced by unchanged O 2 consumption, TCA cycle flux, and developed pressures. Propionate at 1 mM was sufficient to achieve significant increases in pyruvate dehydrogenase flux (3×), and anaplerosis (6×), as measured by isotopomer analysis. These results further demonstrate the potential of propionate as an aid for the correct estimation of total carbohydrate oxidative capacity in the heart. However, liquid chromotography/mass spectroscopy-based metabolomics detected large changes (~30-fold) in malate and fumarate pool sizes. This observation leads to a key observation regarding mass balance in the TCA cycle; flux through a portion of the cycle can be drastically elevated without changing the O 2 consumption. Copyright © 2017 the American Physiological Society.

  11. The odd-carbon medium-chain fatty triglyceride triheptanoin does not reduce hepatic steatosis.

    PubMed

    Comhair, Tine M; Garcia Caraballo, Sonia C; Dejong, Cornelis H C; Lamers, Wouter H; Koehler, S Eleonore

    2017-02-01

    Non-alcoholic fatty-liver disease (NAFLD) is the hepatic manifestation of the metabolic syndrome. Previously, we showed that a high-protein diet minimized diet-induced development of fatty liver and even reversed pre-existing steatosis. A high-protein diet leads to amino-acid catabolism, which in turn causes anaplerosis of the tricarboxylic-acid (TCA) cycle. Therefore, we hypothesized that anaplerosis of the TCA cycle could be responsible for the high-protein diet-induced improvement of NAFLD by channeling amino acids into the TCA cycle. Next we considered that an efficient anaplerotic agent, the odd-carbon medium-chain triglyceride triheptanoin (TH), might have similar beneficial effects. C57BL/6J mice were fed low-fat (8en%) or high-fat (42en%) oleate-containing diets with or without 15en% TH for 3 weeks. TH treatment enhanced the hepatic capacity for fatty-acid oxidation by a selective increase in hepatic Ppara, Acox, and Cd36 expression, and a decline in plasma acetyl-carnitines. It also induced pyruvate cycling through an increased hepatic PCK1 protein concentration and it increased thermogenesis reflected by an increased Ucp2 mRNA content. TH, however, did not reduce hepatic lipid content. The comparison of the present effects of dietary triheptanoin with a previous study by our group on protein supplementation shows that the beneficial effects of the high-protein diet are not mimicked by TH. This argues against anaplerosis as the sole explanatory mechanism for the anti-steatotic effect of a high-protein diet. Copyright © 2015 Elsevier Ltd and European Society for Clinical Nutrition and Metabolism. All rights reserved.

  12. Amino acids rather than glucose account for the majority of cell mass in proliferating mammalian cells

    PubMed Central

    Hosios, Aaron M.; Hecht, Vivian C.; Danai, Laura V.; Johnson, Marc O.; Rathmell, Jeffrey C.; Steinhauser, Matthew L.; Manalis, Scott R.; Vander Heiden, Matthew G.

    2016-01-01

    Cells must duplicate their mass in order to proliferate. Glucose and glutamine are the major nutrients consumed by proliferating mammalian cells, but the extent to which these and other nutrients contribute to cell mass is unknown. We quantified the fraction of cell mass derived from different nutrients and find that the majority of carbon mass in cells is derived from other amino acids, which are consumed at much lower rates than glucose and glutamine. While glucose carbon has diverse fates, glutamine contributes most to protein, and this suggests that glutamine’s ability to replenish TCA cycle intermediates (anaplerosis) is primarily used for amino acid biosynthesis. These findings demonstrate that rates of nutrient consumption are indirectly associated with mass accumulation and suggest that high rates of glucose and glutamine consumption support rapid cell proliferation beyond providing carbon for biosynthesis. PMID:26954548

  13. Influence of trichloroacetic acid peeling on the skin stress response system.

    PubMed

    Kimura, Ayako; Kanazawa, Nobuo; Li, Hong-Jin; Yonei, Nozomi; Yamamoto, Yuki; Furukawa, Fukumi

    2011-08-01

    Although trichloroacetic acid (TCA) peeling is widely applied for cosmetic treatment of photodamaged skin, the entire biological mechanisms have yet to be determined. The skin stress response system (SSRS) involves corticotropin-releasing hormone (CRH) and proopiomelanocortin (POMC) products that are locally-generated in response to locally-provided stressors or pro-inflammatory cytokines. This system would restrict tissue damage and restore local homeostasis. To determine the influence of TCA peeling on the SSRS in vitro and in vivo, expressions of POMC, melanocortin receptor 1 (MC1R), CRH and CRH receptor 1 (CRHR1) mRNA were examined by reverse transcription polymerase chain reaction in Pam212 murine keratinocytes, murine plantar and healthy human abdominal skin specimens after TCA treatment. In addition, their protein expressions as well as those of POMC-derived peptides were examined immunohistochemically. After TCA treatment, transient upregulation of POMC and MC1R mRNA expressions was observed in both murine and human skin, as well as in Pam212. Enhanced POMC protein, recovery of once-impaired MC1R protein, and no enhancement of POMC-derived peptide productions were revealed immunohistochemically in both murine and human epidermis. In contrast, neither expression levels of CRH and CRHR1 mRNA nor epidermal protein were enhanced after TCA application in murine and human skin, except for induction of human CRH mRNA expression. These results suggest that TCA activates the SSRS by inducing POMC and MC1R productions of keratinocytes in the CRH-independent manner, and that the biological effects of POMC itself are responsible for the TCA-induced epidermal SSRS activation. © 2010 Japanese Dermatological Association.

  14. Comparative proteomic analysis of engineered Saccharomyces cerevisiae with enhanced free fatty acid accumulation.

    PubMed

    Chen, Liwei; Lee, Jaslyn Jie Lin; Zhang, Jianhua; Chen, Wei Ning

    2016-02-01

    The engineered Saccharomyces cerevisiae strain △faa1△faa4 [Acot5s] was demonstrated to accumulate more free fatty acids (FFA) previously. Here, comparative proteomic analysis was performed to get a global overview of metabolic regulation in the strain. Over 500 proteins were identified, and 82 of those proteins were found to change significantly in the engineered strains. Proteins involved in glycolysis, acetate metabolism, fatty acid synthesis, TCA cycle, glyoxylate cycle, the pentose phosphate pathway, respiration, transportation, and stress response were found to be upregulated in △faa1△faa4 [Acot5s] as compared to the wild type. On the other hand, proteins involved in glycerol, ethanol, ergosterol, and cell wall synthesis were downregulated. Taken together with our metabolite analysis, our results showed that the disruption of Faa1 and Faa4 and expression of Acot5s in the engineered strain △faa1△faa4 [Acot5s] not only relieved the feedback inhibition of fatty acyl-CoAs on fatty acid synthesis, but also caused a major metabolic rearrangement. The rearrangement redirected carbon flux toward the pathways which generate the essential substrates and cofactors for fatty acid synthesis, such as acetyl-CoA, ATP, and NADPH. Therefore, our results help shed light on the mechanism for the increased production of fatty acids in the engineered strains, which is useful in providing information for future studies in biofuel production.

  15. A lignocellulosic hydrolysate-tolerant Aurantiochytrium sp. mutant strain for docosahexaenoic acid production.

    PubMed

    Qi, Feng; Zhang, Mingliang; Chen, Youwei; Jiang, Xianzhang; Lin, Jinxin; Cao, Xiao; Huang, Jianzhong

    2017-03-01

    To utilize lignocellulosic hydrolysate for docosahexaenoic acid (DHA) production, a novel mutant Aurantiochytrium sp. FN21 with strong tolerance against inhibitory lignocellulosic hydrolysate was obtained through continuous domestication processes from the parent strain Aurantiochytrium sp. FJU-512. Aurantiochytrium sp. FN21 can accumulate 21.3% and 30.7% more DHA compared to its parent strain cultured in fermentation medium and a medium with 50% (v/v) sugarcane bagasse hydrolysate (SBH), respectively. After optimization with different nitrogen sources, the highest lipid (11.84g/L) and DHA (3.15g/L) production were achieved in SBH. The results demonstrated that Aurantiochytrium sp. FN21 has the commercial applications for DHA production using lignocellulosic hydrolysate. In order to elucidate the tolerance mechanism, transcriptomic profiling of the two strains was studied. The highly up-regulated genes and corresponding cellular pathways (TCA cycle, amino acid biosynthesis, fatty acid metabolism and degradation of aromatic compounds) are considered to be associated with the hydrolysate-tolerance of Aurantiochytrium sp. FN21. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Increased Dynamics of Tricarboxylic Acid Cycle and Glutamate Synthesis in Obese Adipose Tissue

    PubMed Central

    Nagao, Hirofumi; Nishizawa, Hitoshi; Bamba, Takeshi; Nakayama, Yasumune; Isozumi, Noriyoshi; Nagamori, Shushi; Kanai, Yoshikatsu; Tanaka, Yoshimitsu; Kita, Shunbun; Fukuda, Shiro; Funahashi, Tohru; Maeda, Norikazu; Fukusaki, Eiichiro; Shimomura, Iichiro

    2017-01-01

    Obesity is closely associated with various metabolic disorders. However, little is known about abnormalities in the metabolic change of obese adipose tissue. Here we use static metabolic analysis and in vivo metabolic turnover analysis to assess metabolic dynamics in obese mice. The static metabolic analyses showed that glutamate and constitutive metabolites of the TCA cycle were increased in the white adipose tissue (WAT) of ob/ob and diet-induced obesity mice but not in the liver or skeletal muscle of these obese mice. Moreover, in vivo metabolic turnover analyses demonstrated that these glucose-derived metabolites were dynamically and specifically produced in obese WAT compared with lean WAT. Glutamate rise in obese WAT was associated with down-regulation of glutamate aspartate transporter (GLAST), a major glutamate transporter for adipocytes, and low uptake of glutamate into adipose tissue. In adipocytes, glutamate treatment reduced adiponectin secretion and insulin-mediated glucose uptake and phosphorylation of Akt. These data suggest that a high intra-adipocyte glutamate level potentially relates to adipocyte dysfunction in obesity. This study provides novel insights into metabolic dysfunction in obesity through comprehensive application of in vivo metabolic turnover analysis in two obese animal models. PMID:28119455

  17. Expression of long non-coding RNA-HOTAIR in oral squamous cell carcinoma Tca8113 cells and its associated biological behavior

    PubMed Central

    Liu, Huawei; Li, Zhiyong; Wang, Chao; Feng, Lin; Huang, Haitao; Liu, Changkui; Li, Fengxia

    2016-01-01

    As a long noncoding RNA, HOX transcript antisense intergenic RNA (HOTAIR) is highly expressed in many types of tumors. However, its expression and function in oral squamous cell carcinoma (OSCC) cells and tissues remains largely unknown. We herein studied the biological functions of HOTAIR in OSCC Tca8113 cells. Real-time quantitative PCR showed that HOTAIR, p21 and p53 mRNA expressions in doxorubicin (DOX)-treated or γ-ray-irradiated Tca8113 cells were up-regulated. Knockdown of p53 expression inhibited DOX-induced HOTAIR up-regulation, suggesting that DNA damage-induced HOTAIR expression may be associated with p53. Transfection and CCK-8 assays showed that compared with the control group, overexpression of HOTAIR promoted the proliferation of Tca8113 cells, while interfering with its expression played an opposite role. Flow cytometry exhibited that HOTAIR overexpression decreased the rate of DOX-induced apoptosis. When HOTAIR expression was inhibited by siRNA, the proportions of cells in G2/M and S phases increased and decreased respectively. Meanwhile, the rate of DOX-induced apoptosis rose. DNA damage-induced HOTAIR expression facilitated the proliferation of Tca8113 cells and decreased their apoptosis. However, whether the up-regulation depends on p53 still needs in-depth studies. PMID:27904675

  18. Nuclear magnetic resonance (NMR) studies on the biosynthesis of fusaric acid from Fusarium oxysporum f. sp. vasinfectum.

    PubMed

    Stipanovic, Robert D; Wheeler, Michael H; Puckhaber, Lorraine S; Liu, Jinggao; Bell, Alois A; Williams, Howard J

    2011-05-25

    Fusarium oxysporum is a fungal pathogen that attacks many important plants. Uniquely pathogenic strains of F. oxysporum f. sp. vasinfectum were inadvertently imported into the United States on live cottonseed for dairy cattle feed. These strains produce exceptionally high concentrations of the phytotoxin fusaric acid. Thus, fusaric acid may be a critical component in the pathogenicity of these biotypes. This study investigated the biosynthesis of fusaric acid using (13)C-labeled substrates including [1,2-(13)C(2)]acetate as well as (13)C- and (15)N-labeled aspartate and [(15)N]glutamine. The incorporation of labeled substrates is consistent with the biosynthesis of fusaric acid from three acetate units at C5-C6, C7-C8, and C9-C10, with the remaining carbons being derived from aspartate via oxaloacetate and the TCA cycle; the oxaloacetate originates in part by transamination of aspartate, but most of the oxaloacetate is derived by deamination of aspartate to fumarate by aspartase. The nitrogen from glutamine is more readily incorporated into fusaric acid than that from aspartate.

  19. Metaproteomics and ultrastructure characterization of Komagataeibacter spp. involved in high-acid spirit vinegar production.

    PubMed

    Andrés-Barrao, Cristina; Saad, Maged M; Cabello Ferrete, Elena; Bravo, Daniel; Chappuis, Marie-Luise; Ortega Pérez, Ruben; Junier, Pilar; Perret, Xavier; Barja, François

    2016-05-01

    Acetic acid bacteria (AAB) are widespread microorganisms in nature, extensively used in food industry to transform alcohols and sugar alcohols into their corresponding organic acids. Specialized strains are used in the production of vinegar through the oxidative transformation of ethanol into acetic acid. The main AAB involved in the production of high-acid vinegars using the submerged fermentation method belong to the genus Komagataeibacter, characterized by their higher ADH stability and activity, and higher acetic acid resistance (15-20%), compared to other AAB. In this work, the bacteria involved in the production of high-acid spirit vinegar through a spontaneous acetic acid fermentation process was studied. The analysis using a culture-independent approach revealed a homogeneous bacterial population involved in the process, identified as Komagataeibacter spp. Differentially expressed proteins during acetic acid fermentation were investigated by using 2D-DIGE and mass spectrometry. Most of these proteins were functionally related to stress response, the TCA cycle and different metabolic processes. In addition, scanning and transmission electron microscopy and specific staining of polysaccharide SDS-PAGE gels confirmed that Komagataeibacter spp. lacked the characteristic polysaccharide layer surrounding the outer membrane that has been previously reported to have an important role in acetic acid resistance in the genus Acetobacter. Copyright © 2015 Elsevier Ltd. All rights reserved.

  20. Evolution of the enzymes of the citric acid cycle and the glyoxylate cycle of higher plants. A case study of endosymbiotic gene transfer.

    PubMed

    Schnarrenberger, Claus; Martin, William

    2002-02-01

    The citric acid or tricarboxylic acid cycle is a central element of higher-plant carbon metabolism which provides, among other things, electrons for oxidative phosphorylation in the inner mitochondrial membrane, intermediates for amino-acid biosynthesis, and oxaloacetate for gluconeogenesis from succinate derived from fatty acids via the glyoxylate cycle in glyoxysomes. The tricarboxylic acid cycle is a typical mitochondrial pathway and is widespread among alpha-proteobacteria, the group of eubacteria as defined under rRNA systematics from which mitochondria arose. Most of the enzymes of the tricarboxylic acid cycle are encoded in the nucleus in higher eukaryotes, and several have been previously shown to branch with their homologues from alpha-proteobacteria, indicating that the eukaryotic nuclear genes were acquired from the mitochondrial genome during the course of evolution. Here, we investigate the individual evolutionary histories of all of the enzymes of the tricarboxylic acid cycle and the glyoxylate cycle using protein maximum likelihood phylogenies, focusing on the evolutionary origin of the nuclear-encoded proteins in higher plants. The results indicate that about half of the proteins involved in this eukaryotic pathway are most similar to their alpha-proteobacterial homologues, whereas the remainder are most similar to eubacterial, but not specifically alpha-proteobacterial, homologues. A consideration of (a) the process of lateral gene transfer among free-living prokaryotes and (b) the mechanistics of endosymbiotic (symbiont-to-host) gene transfer reveals that it is unrealistic to expect all nuclear genes that were acquired from the alpha-proteobacterial ancestor of mitochondria to branch specifically with their homologues encoded in the genomes of contemporary alpha-proteobacteria. Rather, even if molecular phylogenetics were to work perfectly (which it does not), then some nuclear-encoded proteins that were acquired from the alpha

  1. Adaptation of oxidative phosphorylation to photoperiod-induced seasonal metabolic states in migratory songbirds.

    PubMed

    Trivedi, Amit Kumar; Malik, Shalie; Rani, Sangeeta; Kumar, Vinod

    2015-06-01

    Eukaryotic cells produce chemical energy in the form of ATP by oxidative phosphorylation of metabolic fuels via a series of enzyme mediated biochemical reactions. We propose that the rates of these reactions are altered, as per energy needs of the seasonal metabolic states in avian migrants. To investigate this, blackheaded buntings were photoperiodically induced with non-migratory, premigratory, migratory and post-migratory phenotypes. High plasma levels of free fatty acids, citrate (an intermediate that begins the TCA cycle) and malate dehydrogenase (mdh, an enzyme involved at the end of the TCA cycle) confirmed increased availability of metabolic reserves and substrates to the TCA cycle during the premigratory and migratory states, respectively. Further, daily expression pattern of genes coding for enzymes involved in the oxidative decarboxylation of pyruvate to acetyl-CoA (pdc and pdk) and oxidative phosphorylation in the TCA cycle (cs, odgh, sdhd and mdh) was monitored in the hypothalamus and liver. Reciprocal relationship between pdc and pdk expressions conformed with the altered requirements of acetyl-CoA for the TCA cycle in different metabolic states. Except for pdk, all genes had a daily expression pattern, with high mRNA expression during the day in the premigratory/migratory phenotypes, and at night (cs, odhg, sdhd and mdh) in the nonmigratory phenotype. Differences in mRNA expression patterns of pdc, sdhd and mdh, but not of pdk, cs and odgh, between the hypothalamus and liver indicated a tissue dependent metabolism in buntings. These results suggest the adaptation of oxidative phosphorylation pathway(s) at gene levels to the seasonal alternations in metabolism in migratory songbirds. Copyright © 2015 Elsevier Inc. All rights reserved.

  2. Topology of modified helical gears and Tooth Contact Analysis (TCA) program

    NASA Technical Reports Server (NTRS)

    Litvin, Faydor L.; Zhang, Jiao

    1989-01-01

    The contents of this report covers: (1) development of optimal geometries for crowned helical gears; (2) a method for their generation; (3) tooth contact analysis (TCA) computer programs for the analysis of meshing and bearing contact of the crowned helical gears; and (4) modelling and simulation of gear shaft deflection. The developed method for synthesis was used to determine the optimal geometry for a crowned helical pinion surface and was directed to localize the bearing contact and guarantee favorable shape and a low level of transmission errors. Two new methods for generation of the crowned helical pinion surface are proposed. One is based on the application of a tool with a surface of revolution that slightly deviates from a regular cone surface. The tool can be used as a grinding wheel or as a shaver. The other is based on a crowning pinion tooth surface with predesigned transmission errors. The pinion tooth surface can be generated by a computer-controlled automatic grinding machine. The TCA program simulates the meshing and bearing contact of the misaligned gears. The transmission errors are also determined. The gear shaft deformation was modelled and investigated. It was found that the deflection of gear shafts has the same effect as gear misalignment.

  3. Loss of Mitochondrial Pyruvate Carrier 2 in the Liver Leads to Defects in Gluconeogenesis and Compensation via Pyruvate-Alanine Cycling.

    PubMed

    McCommis, Kyle S; Chen, Zhouji; Fu, Xiaorong; McDonald, William G; Colca, Jerry R; Kletzien, Rolf F; Burgess, Shawn C; Finck, Brian N

    2015-10-06

    Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite for gluconeogenesis in hepatocytes, which is important for the maintenance of normoglycemia during prolonged food deprivation but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2(-/-)) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte conversion of labeled pyruvate to TCA cycle intermediates and glucose. Unbiased metabolomic analyses of livers from fasted LS-Mpc2(-/-) mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for the loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2(-/-) hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. Copyright © 2015 Elsevier Inc. All rights reserved.

  4. Studies on the Growth Effects of the Canaline-Urea Cycle Amino Acids with Lemna minor L. 1

    PubMed Central

    Rosenthal, Gerald A.; Gulati, Dushyant K.; Sabharwal, P. S.

    1975-01-01

    The aquatic microphyte, Lemna minor L., was utilized to assess the relative toxicity and general growth effects of canavanine, canaline, ureidohomoserine (UHS), and canavaninosuccinate (CSA). These amino acids are constituents of the canaline-urea cycle and structural analogues of the ornithine-urea cycle amino acids. Comparative growth studies with L. minor revealed that the canaline-urea cycle amino acids are potent antimetabolites. With the exception of CSA, they are extremely toxic at a concentration of 5 μm. Over a concentration range of 1 to 4 μm, canavanine is the most growth-inhibiting of the canaline-urea cycle amino acids. At or above 5 μm, canavanine and canaline possess comparable toxicity. UHS is less growth-inhibiting than canavanine or canaline, and CSA is the least toxic of the canaline-urea cycle intermediates. PMID:16659316

  5. Cerebral glucose metabolism and the glutamine cycle as detected by in vivo and in vitro 13C NMR spectroscopy.

    PubMed

    García-Espinosa, María A; Rodrigues, Tiago B; Sierra, Alejandra; Benito, Marina; Fonseca, Carla; Gray, Heather L; Bartnik, Brenda L; García-Martín, María L; Ballesteros, Paloma; Cerdán, Sebastián

    2004-01-01

    We review briefly 13C NMR studies of cerebral glucose metabolism with an emphasis on the roles of glial energetics and the glutamine cycle. Mathematical modeling analysis of in vivo 13C turnover experiments from the C4 carbons of glutamate and glutamine are consistent with: (i) the glutamine cycle being the major cerebral metabolic route supporting glutamatergic neurotransmission, (ii) glial glutamine synthesis being stoichiometrically coupled to glycolytic ATP production, (iii) glutamine serving as the main precursor of neurotransmitter glutamate and (iv) glutamatergic neurotransmission being supported by lactate oxidation in the neurons in a process accounting for 60-80% of the energy derived from glucose catabolism. However, more recent experimental approaches using inhibitors of the glial tricarboxylic acid (TCA) cycle (trifluoroacetic acid, TFA) or of glutamine synthase (methionine sulfoximine, MSO) reveal that a considerable portion of the energy required to support glutamine synthesis is derived from the oxidative metabolism of glucose in the astroglia and that a significant amount of the neurotransmitter glutamate is produced from neuronal glucose or lactate rather than from glial glutamine. Moreover, a redox switch has been proposed that allows the neurons to use either glucose or lactate as substrates for oxidation, depending on the relative availability of these fuels under resting or activation conditions, respectively. Together, these results suggest that the coupling mechanisms between neuronal and glial metabolism are more complex than initially envisioned.

  6. Proteome analysis of Acetobacter pasteurianus during acetic acid fermentation.

    PubMed

    Andrés-Barrao, Cristina; Saad, Maged M; Chappuis, Marie-Louise; Boffa, Mauro; Perret, Xavier; Ortega Pérez, Ruben; Barja, François

    2012-03-16

    Acetic acid bacteria (AAB) are Gram-negative, strictly aerobic microorganisms that show a unique resistance to ethanol (EtOH) and acetic acid (AcH). Members of the Acetobacter and Gluconacetobacter genera are capable of transforming EtOH into AcH via the alcohol dehydrogenase (ADH) and aldehyde dehydrogenase (ALDH) enzymes and are used for the industrial production of vinegar. Several mechanisms have been proposed to explain how AAB resist high concentrations of AcH, such as the assimilation of acetate through the tricarboxylic acid (TCA) cycle, the export of acetate by various transporters and modifications of the outer membrane. However, except for a few acetate-specific proteins, little is known about the global proteome responses to AcH. In this study, we used 2D-DIGE to compare the proteome of Acetobacter pasteurianus LMG 1262(T) when growing in glucose or ethanol and in the presence of acetic acid. Interesting protein spots were selected using the ANOVA p-value of 0.05 as threshold and 1.5-fold as the minimal level of differential expression, and a total of 53 proteins were successfully identified. Additionally, the size of AAB was reduced by approximately 30% in length as a consequence of the acidity. A modification in the membrane polysaccharides was also revealed by PATAg specific staining. Copyright © 2011 Elsevier B.V. All rights reserved.

  7. Brown Pine Leaf Extract and Its Active Component Trans-Communic Acid Inhibit UVB-Induced MMP-1 Expression by Targeting PI3K

    PubMed Central

    Park, Gaeun; Lim, Tae-gyu; Kwon, Jung Yeon; Song, Da Som; Jeong, Eun Hee; Lee, Charles C.; Son, Joe Eun; Seo, Sang Gwon; Lee, Eunjung; Kim, Jong Rhan; Lee, Chang Yong; Park, Jun Seong; Lee, Ki Won

    2015-01-01

    Japanese red pine (Pinus densiflora) is widely present in China, Japan, and Korea. Its green pine leaves have traditionally been used as a food as well as a coloring agent. After being shed, pine leaves change their color from green to brown within two years, and although the brown pine leaves are abundantly available, their value has not been closely assessed. In this study, we investigated the potential anti-photoaging properties of brown pine leaves for skin. Brown pine leaf extract (BPLE) inhibited UVB-induced matrix metalloproteinase-1 (MMP-1) expression to a greater extent than pine leaf extract (PLE) in human keratinocytes and a human skin equivalent model. HPLC analysis revealed that the quantity of trans-communic acid (TCA) and dehydroabietic acid (DAA) significantly increases when the pine leaf color changes from green to brown. BPLE and TCA elicited reductions in UVB-induced MMP-1 mRNA expression and activator protein-1 (AP-1) transactivation by reducing DNA binding activity of phospho-c-Jun, c-fos and Fra-1. BPLE and TCA also inhibited UVB-induced Akt phosphorylation, but not mitogen activated protein kinase (MAPK), known regulators of AP-1 transactivation. We additionally found that BPLE and TCA inhibited phosphoinositide 3-kinase (PI3K), the upstream kinase of Akt, in vitro. In summary, both BPLE and its active component TCA exhibit protective effects against UVB-induced skin aging. Taken together, these findings underline the potential for BPLE and TCA to be utilized as anti-wrinkling agents and cosmetic ingredients, as they suppress UVB-induced MMP-1 expression. PMID:26066652

  8. A medium-chain fatty acid as an alternative energy source in mouse preimplantation development.

    PubMed

    Yamada, Mitsutoshi; Takanashi, Kazumi; Hamatani, Toshio; Hirayama, Akiyoshi; Akutsu, Hidenori; Fukunaga, Tomoko; Ogawa, Seiji; Sugawara, Kana; Shinoda, Kosaku; Soga, Tomoyoshi; Umezawa, Akihiro; Kuji, Naoaki; Yoshimura, Yasunori; Tomita, Masaru

    2012-01-01

    To further optimize the culturing of preimplantation embryos, we undertook metabolomic analysis of relevant culture media using capillary electrophoresis time-of-flight mass spectrometry (CE-TOFMS). We detected 28 metabolites: 23 embryo-excreted metabolites including 16 amino acids and 5 media-derived metabolites (e.g., octanoate, a medium-chain fatty acid (MCFA)). Due to the lack of information on MCFAs in mammalian preimplantation development, this study examined octanoate as a potential alternative energy source for preimplantation embryo cultures. No embryos survived in culture media lacking FAs, pyruvate, and glucose, but supplementation of octanoate rescued the embryonic development. Immunoblotting showed significant expression of acyl-CoA dehydrogenase and hydroxyacyl-CoA dehydrogenase, important enzymes for ß-oxidation of MCFAs, in preimplantation embryo. Furthermore, CE-TOFMS traced [1-(13)C(8)] octanoate added to the culture media into intermediate metabolites of the TCA cycle via ß-oxidation in mitochondria. These results are the first demonstration that octanoate could provide an efficient alternative energy source throughout preimplantation development.

  9. Trichloroacetic acid in the vegetation of polluted and remote areas of both hemispheres—Part I. Its formation, uptake and geographical distribution

    NASA Astrophysics Data System (ADS)

    Weissflog, Ludwig; Pfennigsdorff, Andrea; Martinez-Pastur, Guillermo; Puliafito, Enrique; Figueroa, Dante; Elansky, Nikolai; Nikonov, Vyasheslav; Putz, Erich; Krüger, Gert; Kellner, Klaus

    Trichloroacetic acid (TCA; CCl 3COOH) is a phytotoxic chemical. Although TCA salts and derivatives were once deployed as herbicides against perennial grasses and weeds, their use has since been banned because of their indiscriminate herbicidal effects on woody plant species. However, TCA can also be formed in the atmosphere. For instance, high-volatile C 2-chlorohydrocarbons tetrachloroethene (TECE, C 2Cl 4) and 1,1,1-trichloroethane (TCE, CCl 3CH 3) can react to TCA and other substances under oxidative conditions here. Owing to further industrialisation of Southeast Asia, South Africa and South America, a rise can be expected in the use of TECE as solvents in the metal and textile industries of these regions in the southern hemisphere (SH). The increasing emissions of this substance—together with the rise in the atmospheric oxidation potential caused by urban activities, slash and burn agriculture and forest fires in the SH—will result in the increased input/formation of TCA in the vegetation located on the lee side of these emission sources. By means of biomonitoring studies, inputs/formation of TCA related to the climatic conditions were detected at various locations in South America, Africa, and Europe.

  10. Inhibitors of the alpha-ketoglutarate dehydrogenase complex alter [1-13C]glucose and [U-13C]glutamate metabolism in cerebellar granule neurons.

    PubMed

    Santos, Sónia Sá; Gibson, Gary E; Cooper, Arthur J L; Denton, Travis T; Thompson, Charles M; Bunik, Victoria I; Alves, Paula M; Sonnewald, Ursula

    2006-02-15

    Diminished activity of the alpha-ketoglutarate dehydrogenase complex (KGDHC), an important component of the tricarboxylic acid (TCA) cycle, occurs in several neurological diseases. The effect of specific KGDHC inhibitors [phosphonoethyl ester of succinyl phosphonate (PESP) and the carboxy ethyl ester of succinyl phosphonate (CESP)] on [1-13C]glucose and [U-13C]glutamate metabolism in intact cerebellar granule neurons was investigated. Both inhibitors decreased formation of [4-13C]glutamate from [1-13C]glucose, a reduction in label in glutamate derived from [1-13C]glucose/[U-13C]glutamate through a second turn of the TCA cycle and a decline in the amounts of gamma-aminobutyric acid (GABA), aspartate, and alanine. PESP decreased formation of [U-13C]aspartate and total glutathione, whereas CESP decreased concentrations of valine and leucine. The findings are consistent with decreased KGDHC activity; increased alpha-ketoglutarate formation; increased transamination of alpha-ketoglutarate with valine, leucine, and GABA; and new equilibrium position of the aspartate aminotransferase reaction. Overall, the findings also suggest that some carbon derived from alpha-ketoglutarate may bypass the block in the TCA cycle at KGDHC by means of the GABA shunt and/or conversion of valine to succinate. The results suggest the potential of succinyl phosphonate esters for modeling the biochemical and pathophysiological consequences of reduced KGDHC activity in brain diseases.

  11. Alternative carbohydrate reserves used in the daily cycle of crassulacean acid metabolism

    Treesearch

    C.C. Black; J.-Q. Chen; R.L. Doong; M.N. Angelov; Shi-Jean S. Sung

    1996-01-01

    Each day a massive interlocked biochemical cycle occurs in the green tissues of crassulacean acid metabolism plants.The function of this interlocked cycle, in its simplest context, is to furnish most of the CO2 for CAM plant photosynthesis.In this unified presentation our aims are (1) to divide CAM plants into two metabolic groups, (2) to...

  12. Salicylic acid antagonizes abscisic acid inhibition of shoot growth and cell cycle progression in rice

    NASA Astrophysics Data System (ADS)

    Meguro, Ayano; Sato, Yutaka

    2014-04-01

    We analysed effects of abscisic acid (ABA, a negative regulatory hormone), alone and in combination with positive or neutral hormones, including salicylic acid (SA), on rice growth and expression of cell cycle-related genes. ABA significantly inhibited shoot growth and induced expression of OsKRP4, OsKRP5, and OsKRP6. A yeast two-hybrid assay showed that OsKRP4, OsKRP5, and OsKRP6 interacted with OsCDKA;1 and/or OsCDKA;2. When SA was simultaneously supplied with ABA, the antagonistic effect of SA completely blocked ABA inhibition. SA also blocked ABA inhibition of DNA replication and thymidine incorporation in the shoot apical meristem. These results suggest that ABA arrests cell cycle progression by inducing expression of OsKRP4, OsKRP5, and OsKRP6, which inhibit the G1/S transition, and that SA antagonizes ABA by blocking expression of OsKRP genes.

  13. Optimisation of trans-cinnamic acid and hydrocinnamyl alcohol production with recombinant Saccharomyces cerevisiae and identification of cinnamyl methyl ketone as a by-product.

    PubMed

    Gottardi, Manuela; Grün, Peter; Bode, Helge B; Hoffmann, Thomas; Schwab, Wilfried; Oreb, Mislav; Boles, Eckhard

    2017-12-01

    Trans-cinnamic acid (tCA) and hydrocinnamyl alcohol (HcinOH) are valuable aromatic compounds with applications in the flavour, fragrance and cosmetic industry. They can be produced with recombinant yeasts from sugars via phenylalanine after expression of a phenylalanine ammonia lyase (PAL) and an aryl carboxylic acid reductase. Here, we show that in Saccharomyces cerevisiae a PAL enzyme from the bacterium Photorhabdus luminescens was superior to a previously used plant PAL enzyme for the production of tCA. Moreover, after expression of a UDP-glucose:cinnamate glucosyltransferase (FaGT2) from Fragaria x ananassa, tCA could be converted to cinnamoyl-D-glucose which is expected to be less toxic to the yeast cells. Production of tCA and HcinOH from glucose could be increased by eliminating feedback-regulated steps of aromatic amino acid biosynthesis and diminishing the decarboxylation step of the competing Ehrlich pathway. Finally, an unknown by-product resulting from further metabolisation of a carboligation product of cinnamaldehyde (cinALD) with activated acetaldehyde, mediated by pyruvate decarboxylases, could be identified as cinnamyl methyl ketone providing a new route for the biosynthesis of precursors, such as (2S,3R) 5-phenylpent-4-ene-2,3-diol, necessary for the chemical synthesis of specific biologically active drugs such as daunomycin. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  14. Revealing Differences in Metabolic Flux Distributions between a Mutant Strain and Its Parent Strain Gluconacetobacter xylinus CGMCC 2955

    PubMed Central

    Liu, Miao; Yang, Xiao-Ning; Zhu, Hui-Xia; Jia, Yuan-Yuan; Jia, Shi-Ru; Piergiovanni, Luciano

    2014-01-01

    A better understanding of metabolic fluxes is important for manipulating microbial metabolism toward desired end products, or away from undesirable by-products. A mutant strain, Gluconacetobacter xylinus AX2-16, was obtained by combined chemical mutation of the parent strain (G. xylinus CGMCC 2955) using DEC (diethyl sulfate) and LiCl. The highest bacterial cellulose production for this mutant was obtained at about 11.75 g/L, which was an increase of 62% compared with that by the parent strain. In contrast, gluconic acid (the main byproduct) concentration was only 5.71 g/L for mutant strain, which was 55.7% lower than that of parent strain. Metabolic flux analysis indicated that 40.1% of the carbon source was transformed to bacterial cellulose in mutant strain, compared with 24.2% for parent strain. Only 32.7% and 4.0% of the carbon source were converted into gluconic acid and acetic acid in mutant strain, compared with 58.5% and 9.5% of that in parent strain. In addition, a higher flux of tricarboxylic acid (TCA) cycle was obtained in mutant strain (57.0%) compared with parent strain (17.0%). It was also indicated from the flux analysis that more ATP was produced in mutant strain from pentose phosphate pathway (PPP) and TCA cycle. The enzymatic activity of succinate dehydrogenase (SDH), which is one of the key enzymes in TCA cycle, was 1.65-fold higher in mutant strain than that in parent strain at the end of culture. It was further validated by the measurement of ATPase that 3.53–6.41 fold higher enzymatic activity was obtained from mutant strain compared with parent strain. PMID:24901455

  15. Halogenated methanesulfonic acids: A new class of organic micropollutants in the water cycle.

    PubMed

    Zahn, Daniel; Frömel, Tobias; Knepper, Thomas P

    2016-09-15

    Mobile and persistent organic micropollutants may impact raw and drinking waters and are thus of concern for human health. To identify such possible substances of concern nineteen water samples from five European countries (France, Switzerland, The Netherlands, Spain and Germany) and different compartments of the water cycle (urban effluent, surface water, ground water and drinking water) were enriched with mixed-mode solid phase extraction. Hydrophilic interaction liquid chromatography - high resolution mass spectrometry non-target screening of these samples led to the detection and structural elucidation of seven novel organic micropollutants. One structure could already be confirmed by a reference standard (trifluoromethanesulfonic acid) and six were tentatively identified based on experimental evidence (chloromethanesulfonic acid, dichloromethanesulfonic acid, trichloromethanesulfonic acid, bromomethanesulfonic acid, dibromomethanesulfonic acid and bromochloromethanesulfonic acid). Approximated concentrations for these substances show that trifluoromethanesulfonic acid, a chemical registered under the European Union regulation REACH with a production volume of more than 100 t/a, is able to spread along the water cycle and may be present in concentrations up to the μg/L range. Chlorinated and brominated methanesulfonic acids were predominantly detected together which indicates a common source and first experimental evidence points towards water disinfection as a potential origin. Halogenated methanesulfonic acids were detected in drinking waters and thus may be new substances of concern. Copyright © 2016 Elsevier Ltd. All rights reserved.

  16. Metabolic Analysis of Adaptation to Short-Term Changes in Culture Conditions of the Marine Diatom Thalassiosira pseudonana

    PubMed Central

    Bromke, Mariusz A.; Giavalisco, Patrick; Willmitzer, Lothar; Hesse, Holger

    2013-01-01

    This report describes the metabolic and lipidomic profiling of 97 low-molecular weight compounds from the primary metabolism and 124 lipid compounds of the diatom Thalassiosira pseudonana. The metabolic profiles were created for diatoms perturbed for 24 hours with four different treatments: (I) removal of nitrogen, (II) lower iron concentration, (III) addition of sea salt, (IV) addition of carbonate to their growth media. Our results show that as early as 24 hours after nitrogen depletion significant qualitative and quantitative change in lipid composition as well as in the primary metabolism of Thalassiosira pseudonana occurs. So we can observe the accumulation of several storage lipids, namely triacylglycerides, and TCA cycle intermediates, of which citric acid increases more than 10-fold. These changes are positively correlated with expression of TCA enzymes genes. Next to the TCA cycle intermediates and storage lipid changes, we have observed decrease in N-containing lipids and primary metabolites such as amino acids. As a measure of counteracting nitrogen starvation, we have observed elevated expression levels of nitrogen uptake and amino acid biosynthetic genes. This indicates that diatoms can fast and efficiently adapt to changing environment by altering the metabolic fluxes and metabolite abundances. Especially, the accumulation of proline and the decrease of dimethylsulfoniopropionate suggest that the proline is the main osmoprotectant for the diatom in nitrogen rich conditions. PMID:23799147

  17. Production of Caproic Acid from Mixed Organic Waste: An Environmental Life Cycle Perspective

    PubMed Central

    2017-01-01

    Caproic acid is an emerging platform chemical with diverse applications. Recently, a novel biorefinery process, that is, chain elongation, was developed to convert mixed organic waste and ethanol into renewable caproic acids. In the coming years, this process may become commercialized, and continuing to improve on the basis of numerous ongoing technological and microbiological studies. This study aims to analyze the environmental performance of caproic acid production from mixed organic waste via chain elongation at this current, early stage of technological development. To this end, a life cycle assessment (LCA) was performed to evaluate the environmental impact of producing 1 kg caproic acid from organic waste via chain elongation, in both a lab-scale and a pilot-scale system. Two mixed organic waste were used as substrates: the organic fraction of municipal solid waste (OFMSW) and supermarket food waste (SFW). Ethanol use was found to be the dominant cause of environmental impact over the life cycle. Extraction solvent recovery was found to be a crucial uncertainty that may have a substantial influence on the life-cycle impacts. We recommend that future research and industrial producers focus on the reduction of ethanol use in chain elongation and improve the recovery efficiency of the extraction solvent. PMID:28513150

  18. Gluconeogenesis from labeled carbon: estimating isotope dilution

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kelleher, J.K.

    1986-03-01

    To estimate the rate of gluconeogenesis from steady-state incorporation of labeled 3-carbon precursors into glucose, isotope dilution must be considered so that the rate of labeling of glucose can be quantitatively converted to the rate of gluconeogenesis. An expression for the value of this isotope dilution can be derived using mathematical techniques and a model of the tricarboxylic acid (TCA) cycle. The present investigation employs a more complex model than that used in previous studies. This model includes the following pathways that may affect the correction for isotope dilution: 1) flux of 3-carbon precursor to the oxaloacetate pool via acetyl-CoAmore » and the TCA cycle; 2) flux of 4- or 5-carbon compounds into the TCA cycle; 3) reversible flux between oxaloacetate (OAA) and pyruvate and between OAA and fumarate; 4) incomplete equilibrium between OAA pools; and 5) isotope dilution of 3-carbon tracers between the experimentally measured pool and the precursor for the TCA-cycle OAA pool. Experimental tests are outlined which investigators can use to determine whether these pathways are significant in a specific steady-state system. The study indicated that flux through these five pathways can significantly affect the correction for isotope dilution. To correct for the effects of these pathways an alternative method for calculating isotope dilution is proposed using citrate to relate the specific activities of acetyl-CoA and OAA.« less

  19. Clinical benefit using sperm hyaluronic acid binding technique in ICSI cycles: a systematic review and meta-analysis.

    PubMed

    Beck-Fruchter, Ronit; Shalev, Eliezer; Weiss, Amir

    2016-03-01

    The human oocyte is surrounded by hyaluronic acid, which acts as a natural selector of spermatozoa. Human sperm that express hyaluronic acid receptors and bind to hyaluronic acid have normal shape, minimal DNA fragmentation and low frequency of chromosomal aneuploidies. Use of hyaluronic acid binding assays in intracytoplasmic sperm injection (ICSI) cycles to improve clinical outcomes has been studied, although none of these studies had sufficient statistical power. In this systematic review and meta-analysis, electronic databases were searched up to June 2015 to identify studies of ICSI cycles in which spermatozoa able to bind hyaluronic acid was selected. The main outcomes were fertilization rate and clinical pregnancy rate. Secondary outcomes included cleavage rate, embryo quality, implantation rate, spontaneous abortion and live birth rate. Seven studies and 1437 cycles were included. Use of hyaluronic acid binding sperm selection technique yielded no improvement in fertilization and pregnancy rates. A meta-analysis of all available studies showed an improvement in embryo quality and implantation rate; an analysis of prospective studies only showed an improvement in embryo quality. Evidence does not support routine use of hyaluronic acid binding assays in all ICSI cycles. Identification of patients that might benefit from this technique needs further study. Copyright © 2015 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  20. An Optimized Trichloroacetic Acid/Acetone Precipitation Method for Two-Dimensional Gel Electrophoresis Analysis of Qinchuan Cattle Longissimus Dorsi Muscle Containing High Proportion of Marbling.

    PubMed

    Hao, Ruijie; Adoligbe, Camus; Jiang, Bijie; Zhao, Xianlin; Gui, Linsheng; Qu, Kaixing; Wu, Sen; Zan, Linsen

    2015-01-01

    Longissimus dorsi muscle (LD) proteomics provides a novel opportunity to reveal the molecular mechanism behind intramuscular fat deposition. Unfortunately, the vast amounts of lipids and nucleic acids in this tissue hampered LD proteomics analysis. Trichloroacetic acid (TCA)/acetone precipitation is a widely used method to remove contaminants from protein samples. However, the high speed centrifugation employed in this method produces hard precipitates, which restrict contaminant elimination and protein re-dissolution. To address the problem, the centrifugation precipitates were first grinded with a glass tissue grinder and then washed with 90% acetone (TCA/acetone-G-W) in the present study. According to our result, the treatment for solid precipitate facilitated non-protein contaminant removal and protein re-dissolution, ultimately improving two-dimensional gel electrophoresis (2-DE) analysis. Additionally, we also evaluated the effect of sample drying on 2-DE profile as well as protein yield. It was found that 30 min air-drying did not result in significant protein loss, but reduced horizontal streaking and smearing on 2-DE gel compared to 10 min. In summary, we developed an optimized TCA/acetone precipitation method for protein extraction of LD, in which the modifications improved the effectiveness of TCA/acetone method.

  1. Loss of Mitochondrial Pyruvate Carrier 2 in Liver Leads to Defects in Gluconeogenesis and Compensation via Pyruvate-Alanine Cycling

    PubMed Central

    McCommis, Kyle S.; Chen, Zhouji; Fu, Xiaorong; McDonald, William G.; Colca, Jerry R.; Kletzien, Rolf F.; Burgess, Shawn C.; Finck, Brian N.

    2015-01-01

    SUMMARY Pyruvate transport across the inner mitochondrial membrane is believed to be a prerequisite step for gluconeogenesis in hepatocytes, which is important for maintenance of normoglycemia during prolonged food deprivation, but also contributes to hyperglycemia in diabetes. To determine the requirement for mitochondrial pyruvate import in gluconeogenesis, mice with liver-specific deletion of mitochondrial pyruvate carrier 2 (LS-Mpc2−/−) were generated. Loss of MPC2 impaired, but did not completely abolish, hepatocyte pyruvate metabolism, labelled pyruvate conversion to TCA cycle intermediates and glucose, and glucose production from pyruvate. Unbiased metabolomic analyses of livers from fasted LS-Mpc2−/− mice suggested that alterations in amino acid metabolism, including pyruvate-alanine cycling, might compensate for loss of MPC2. Indeed, inhibition of pyruvate-alanine transamination further reduced mitochondrial pyruvate metabolism and glucose production by LS-Mpc2−/− hepatocytes. These data demonstrate an important role for MPC2 in controlling hepatic gluconeogenesis and illuminate a compensatory mechanism for circumventing a block in mitochondrial pyruvate import. PMID:26344101

  2. Changes in sodium and uric acid concentrations in plasma during the menstrual cycle.

    PubMed

    Mira, M; Stewart, P M; Gebski, V; Llewellyn-Jones, D; Abraham, S F

    1984-03-01

    Hormonal changes during the menstrual cycle are well documented, but many other biochemical variables have not been studied. We find that in the luteal phase of the menstrual cycle the concentrations of sodium and uric acid are significantly lower. The changes may be of significance for the determination of the normal reference interval.

  3. Imbricatolic acid from Juniperus communis L. prevents cell cycle progression in CaLu-6 cells.

    PubMed

    De Marino, Simona; Cattaneo, Fabio; Festa, Carmen; Zollo, Franco; Iaccio, Annalisa; Ammendola, Rosario; Incollingo, Filomena; Iorizzi, Maria

    2011-11-01

    Imbricatolic acid was isolated from the methanolic extract of the fresh ripe berries of Juniperus communis (Cupressaceae) together with sixteen known compounds and a new dihydrobenzofuran lignan glycoside named juniperoside A. Their structures were determined by spectroscopic methods and by comparison with the spectral data reported in literature. Imbricatolic acid was evaluated for its ability to prevent cell cycle progression in p53-null CaLu-6 cells. This compound induces the upregulation of cyclin-dependent kinase inhibitors and their accumulation in the G1 phase of the cell cycle, as well as the degradation of cyclins A, D1, and E1. Furthermore, no significant imbricatolic acid-induced apoptosis was observed. Therefore, this plant-derived compound may play a role in the control of cell cycle. © Georg Thieme Verlag KG Stuttgart · New York.

  4. The effect of propionic acid and valeric acid on the cell cycle in root meristems of Pisum sativum

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tramontano, W.A.; Yang, Shauyu; Delillo, A.R.

    1990-01-01

    Propionic acid and valeric acid at 1mM reduced the mitotic index of root meristem cells of Pisum sativum to < 1% after 12 hr in aerated White's medium. This effect varied with different acid concentrations. After a 12 hr exposure to either acid, seedlings transferred to fresh medium without either acid, resumed their normal mitotic index after 12 hr, with a burst of mitosis 8 hr post-transfer. Exposure of root meristem cells to either acid also inhibited ({sup 3}H)-TdR incorporation. Neither acid significantly altered the distribution of meristematic cells in G1 and G2 after 12 hr. The incorporation of ({supmore » 3}H) - uridine was also unaltered by the addition of either acid. This information suggests that propionic acid and valeric acid, limit progression through the cell cycle by inhibiting DNA synthesis and arresting cells in G1 and G2. These results were consistent with previous data which utilized butyric acid.« less

  5. Superoxide Triggers an Acid Burst in Saccharomyces cerevisiae to Condition the Environment of Glucose-starved Cells*

    PubMed Central

    Baron, J. Allen; Laws, Kaitlin M.; Chen, Janice S.; Culotta, Valeria C.

    2013-01-01

    Although yeast cells grown in abundant glucose tend to acidify their extracellular environment, they raise the pH of the environment when starved for glucose or when grown strictly with non-fermentable carbon sources. Following prolonged periods in this alkaline phase, Saccharomyces cerevisiae cells will switch to producing acid. The mechanisms and rationale for this “acid burst” were unknown. Herein we provide strong evidence for the role of mitochondrial superoxide in initiating the acid burst. Yeast mutants lacking the mitochondrial matrix superoxide dismutase (SOD2) enzyme, but not the cytosolic Cu,Zn-SOD1 enzyme, exhibited marked acceleration in production of acid on non-fermentable carbon sources. Acid production is also dramatically enhanced by the superoxide-producing agent, paraquat. Conversely, the acid burst is eliminated by boosting cellular levels of Mn-antioxidant mimics of SOD. We demonstrate that the acid burst is dependent on the mitochondrial aldehyde dehydrogenase Ald4p. Our data are consistent with a model in which mitochondrial superoxide damage to Fe-S enzymes in the tricarboxylic acid (TCA) cycle leads to acetate buildup by Ald4p. The resultant expulsion of acetate into the extracellular environment can provide a new carbon source to glucose-starved cells and enhance growth of yeast. By triggering production of organic acids, mitochondrial superoxide has the potential to promote cell population growth under nutrient depravation stress. PMID:23281478

  6. Detoxification of ammonia in mouse cortical GABAergic cell cultures increases neuronal oxidative metabolism and reveals an emerging role for release of glucose-derived alanine.

    PubMed

    Leke, Renata; Bak, Lasse K; Anker, Malene; Melø, Torun M; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Ott, Peter; Portela, Luis V; Sonnewald, Ursula; Schousboe, Arne; Waagepetersen, Helle S

    2011-04-01

    Cerebral hyperammonemia is believed to play a pivotal role in the development of hepatic encephalopathy (HE), a debilitating condition arising due to acute or chronic liver disease. In the brain, ammonia is thought to be detoxified via the activity of glutamine synthetase, an astrocytic enzyme. Moreover, it has been suggested that cerebral tricarboxylic acid (TCA) cycle metabolism is inhibited and glycolysis enhanced during hyperammonemia. The aim of this study was to characterize the ammonia-detoxifying mechanisms as well as the effects of ammonia on energy-generating metabolic pathways in a mouse neuronal-astrocytic co-culture model of the GABAergic system. We found that 5 mM ammonium chloride affected energy metabolism by increasing the neuronal TCA cycle activity and switching the astrocytic TCA cycle toward synthesis of substrate for glutamine synthesis. Furthermore, ammonia exposure enhanced the synthesis and release of alanine. Collectively, our results demonstrate that (1) formation of glutamine is seminal for detoxification of ammonia; (2) neuronal oxidative metabolism is increased in the presence of ammonia; and (3) synthesis and release of alanine is likely to be important for ammonia detoxification as a supplement to formation of glutamine.

  7. Mechanisms of Mitochondrial Defects in Gulf War Syndrome

    DTIC Science & Technology

    2012-08-01

    oxidized; POR: porin; TCA: Tricarboxylic acid cycle ( Kreb cycle ). Page 2 Body: YEAR 1 of research (10/13/2009-7/14/2010) (9 months): Human... mitochondria , fatigue, myalgias 16. SECURITY CLASSIFICATION OF: 17. LIMITATION OF ABSTRACT 18. NUMBER OF PAGES 19a. NAME OF RESPONSIBLE PERSON...abnormalities in genes that are related to mitochondrial function. Hence, investigation of mitochondrial dysfunction in GWS is a priority. Mitochondria

  8. Evaluation of extraction methods for the identification of proteins from date palm (Phoenix dactylifera L.) seed and flesh.

    PubMed

    Lee, Hooi Xian; Ahmad, Fisal; Saad, Bahruddin; Ismail, Mohd Nazri

    2017-11-26

    Date fruits are well known to be very nutritious. Nevertheless, the protein contents of the fruit, particularly the seed and flesh, are still understudied, largely due to their difficult physical characteristics. This study was conducted to compare three different protein extraction methods which were the trichloroacetic acid (TCA)-acetone (TCA-A), phenol (Phe), and TCA-acetone-phenol (TCA-A-Phe), and to perform proteomic analysis on date palm seed and flesh. Phe extraction method showed the highest protein yields for both seed (8.26 mg/g) and flesh (1.57 mg/g). Through sodium dodecyl sulfate-polyacrylamide gel electrophoresis, Phe, and TCA-A-Phe extraction methods were shown to be efficient in removing interfering compounds and gave well-resolved bands over a wide range of molecular weights. Following liquid chromatography-tandem mass spectrometry analysis, about 50-64% of extracted proteins were identified with known functions including those involved in glycolysis, Krebs cycle, defense, and storage. Phe protein extraction method was proven to be the optimal method for date flesh and seed.

  9. In vitro inhibition of OATP-mediated uptake of phalloidin using bile acid derivatives

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Herraez, Elisa; Macias, Rocio I.R.; Vazquez-Tato, Jose

    2009-08-15

    Hepatocyte uptake of phalloidin is carried out mainly by OATP1B1. We have used this compound as a prototypic substrate and assayed the ability to inhibit OATP-mediated phalloidin transport of four bile acid derivatives (BALU-1, BALU-2, BALU-3 and BALU-4) that showed positive results in preliminary screening. Using Xenopus laevis oocytes for heterologous expression of transporters, BALUs were found to inhibit taurocholic acid (TCA) transport by OATP1B1 (but not OATP1B3) as well as by rat Oatp1a1, Oatp1a4 and Oatp1b2. The study of their ability to inhibit sodium-dependent bile acid transporters revealed that the four BALUs induced an inhibition of rat Asbt-mediated TCAmore » transport, which was similar to TCA-induced self-inhibition. Regarding human NTCP and rat Ntcp, BALU-1 differs from the other three BALUS in its lack of effect on TCA transport by these proteins. Using HPLC-MS/MS and CHO cells stably expressing OATP1B1 the ability of BALU-1 to inhibit the uptake of phalloidin itself by this transporter was confirmed. Kinetic analysis using X. laevis oocytes revealed that BALU-1-induced inhibition of OATP1B1 was mainly due to a competitive mechanism (Ki = 8 {mu}M). In conclusion, BALU-1 may be useful as a pharmacological tool to inhibit the uptake of compounds mainly taken up by OATP1B1 presumably without impairing bile acid uptake by the major carrier accounting for this process, i.e., NTCP.« less

  10. Label-free fluorescent enzymatic assay of citrate synthase by CoA-Au(I) co-ordination polymer and its application in a multi-enzyme logic gate cascade.

    PubMed

    Li, Yong; Wang, Huixia; Dai, Futao; Li, Pei; Jin, Xin; Huang, Yan; Nie, Zhou; Yao, Shouzhuo

    2016-12-15

    Citrate synthase (CS) is one of the key metabolic enzymes in the Krebs tricarboxylic acid (TCA) cycle. It regulates energy generation in mitochondrial respiration by catalysing the reaction between oxaloacetic acid (OAA) and acetyl coenzyme A (Ac-CoA) to generate citrate and coenzyme A (CoA). CS has been shown to be a biomarker of neurological diseases and various kinds of cancers. Here, a label-free fluorescent assay has been developed for homogeneously detecting CS and its inhibitor based on the in situ generation of CoA-Au(I) co-ordination polymer (CP) and the fluorescence signal-on by SYBR Green II-stained CoA-Au(I) CP. Because of the unique property of the CoA-Au(I) CP, this CS activity assay method could achieve excellent selectivity and sensitivity, with a linear range from 0.0033 U/μL to 0.264 U/μL and a limit of detection to be 0.00165 U/μL. Meanwhile, this assay method has advantages of being facile and cost effective with quick detection. Moreover, based on this method, a biomimetic logic system was established by rationally exploiting the cascade enzymatic interactions in TCA cycle for chemical information processing. In the TCA cycle-derived logic system, an AND-AND-AND-cascaded gate was rigorously operated step by step in one pot, and is outputted by a label-free fluorescent signal with visualized readout. Copyright © 2016 Elsevier B.V. All rights reserved.

  11. Integrated, Step-Wise, Mass-Isotopomeric Flux Analysis of the TCA Cycle.

    PubMed

    Alves, Tiago C; Pongratz, Rebecca L; Zhao, Xiaojian; Yarborough, Orlando; Sereda, Sam; Shirihai, Orian; Cline, Gary W; Mason, Graeme; Kibbey, Richard G

    2015-11-03

    Mass isotopomer multi-ordinate spectral analysis (MIMOSA) is a step-wise flux analysis platform to measure discrete glycolytic and mitochondrial metabolic rates. Importantly, direct citrate synthesis rates were obtained by deconvolving the mass spectra generated from [U-(13)C6]-D-glucose labeling for position-specific enrichments of mitochondrial acetyl-CoA, oxaloacetate, and citrate. Comprehensive steady-state and dynamic analyses of key metabolic rates (pyruvate dehydrogenase, β-oxidation, pyruvate carboxylase, isocitrate dehydrogenase, and PEP/pyruvate cycling) were calculated from the position-specific transfer of (13)C from sequential precursors to their products. Important limitations of previous techniques were identified. In INS-1 cells, citrate synthase rates correlated with both insulin secretion and oxygen consumption. Pyruvate carboxylase rates were substantially lower than previously reported but showed the highest fold change in response to glucose stimulation. In conclusion, MIMOSA measures key metabolic rates from the precursor/product position-specific transfer of (13)C-label between metabolites and has broad applicability to any glucose-oxidizing cell. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. An Optimized Trichloroacetic Acid/Acetone Precipitation Method for Two-Dimensional Gel Electrophoresis Analysis of Qinchuan Cattle Longissimus Dorsi Muscle Containing High Proportion of Marbling

    PubMed Central

    Hao, Ruijie; Adoligbe, Camus; Jiang, Bijie; Zhao, Xianlin; Gui, Linsheng; Qu, Kaixing; Wu, Sen; Zan, Linsen

    2015-01-01

    Longissimus dorsi muscle (LD) proteomics provides a novel opportunity to reveal the molecular mechanism behind intramuscular fat deposition. Unfortunately, the vast amounts of lipids and nucleic acids in this tissue hampered LD proteomics analysis. Trichloroacetic acid (TCA)/acetone precipitation is a widely used method to remove contaminants from protein samples. However, the high speed centrifugation employed in this method produces hard precipitates, which restrict contaminant elimination and protein re-dissolution. To address the problem, the centrifugation precipitates were first grinded with a glass tissue grinder and then washed with 90% acetone (TCA/acetone-G-W) in the present study. According to our result, the treatment for solid precipitate facilitated non-protein contaminant removal and protein re-dissolution, ultimately improving two-dimensional gel electrophoresis (2-DE) analysis. Additionally, we also evaluated the effect of sample drying on 2-DE profile as well as protein yield. It was found that 30 min air-drying did not result in significant protein loss, but reduced horizontal streaking and smearing on 2-DE gel compared to 10 min. In summary, we developed an optimized TCA/acetone precipitation method for protein extraction of LD, in which the modifications improved the effectiveness of TCA/acetone method. PMID:25893432

  13. Leukemia cells demonstrate a different metabolic perturbation provoked by 2-deoxyglucose.

    PubMed

    Miwa, Hiroshi; Shikami, Masato; Goto, Mineaki; Mizuno, Shohei; Takahashi, Miyuki; Tsunekawa-Imai, Norikazu; Ishikawa, Takamasa; Mizutani, Motonori; Horio, Tomohiro; Gotou, Mayuko; Yamamoto, Hidesuke; Wakabayashi, Motohiro; Watarai, Masaya; Hanamura, Ichiro; Imamura, Akira; Mihara, Hidetsugu; Nitta, Masakazu

    2013-05-01

    The shift in energy metabolism from oxidative phosphorylation to glycolysis can serve as a target for the inhibition of cancer growth. Here, we examined the metabolic changes induced by 2-deoxyglucose (2-DG), a glycolysis inhibitor, in leukemia cells by metabolome analysis. NB4 cells mainly utilized glucose as an energy source by glycolysis and oxidative phosphorylation in mitochondria, since metabolites in the glycolytic pathway and in the tricarboxylic acid (TCA) cycle were significantly decreased by 2-DG. In THP-1 cells, metabolites in the TCA cycle were not decreased to the same extent by 2-DG as in NB4 cells, which indicates that THP-1 utilizes energy sources other than glucose. TCA cycle metabolites in THP-1 cells may be derived from acetyl-CoA by fatty acid β-oxidation, which was supported by abundant detection of carnitine and acetylcarnitine in THP-1 cells. 2-DG treatment increased the levels of pentose phosphate pathway (PPP) metabolites and augmented the generation of NADPH by glucose-6-phosphate dehydrogenase. An increase in NADPH and upregulation of glutathione synthetase expression resulted in the increase in the reduced form of glutathione by 2-DG in NB4 cells. We demonstrated that a combination of 2-DG and inhibition of PPP by dehydroepiandrosterone (DHEA) effectively suppressed the growth of NB4 cells. The replenishment of the TCA cycle by fatty acid oxidation by carnitine palmitoyltransferase in THP-1 cells, treated by 2-DG, might be regulated by AMPK, as the combination of 2-DG and inhibition of AMPK by compound C potently suppressed the growth of THP-1 cells. Although 2-DG has been effective in preclinical and clinical studies, this treatment has not been fully explored due to concerns related to potential toxicities such as brain toxicity at high doses. We demonstrated that a combination of 2-DG and DHEA or compound C at a relatively low concentration effectively inhibits the growth of NB4 and THP-1 cells, respectively. These observations may

  14. Effect of alternative pathway therapy on branched chain amino acid metabolism in urea cycle disorder patients.

    PubMed

    Scaglia, Fernando; Carter, Susan; O'Brien, William E; Lee, Brendan

    2004-04-01

    Urea cycle disorders (UCDs) are a group of inborn errors of hepatic metabolism caused by the loss of enzymatic activities that mediate the transfer of nitrogen from ammonia to urea. These disorders often result in life-threatening hyperammonemia and hyperglutaminemia. A combination of sodium phenylbutyrate and sodium phenylacetate/benzoate is used in the clinical management of children with urea cycle defects as a glutamine trap, diverting nitrogen from urea synthesis to alternatives routes of excretion. We have observed that patients treated with these compounds have selective branched chain amino acid (BCAA) deficiency despite adequate dietary protein intake. However, the direct effect of alternative therapy on the steady state levels of plasma branched chain amino acids has not been well characterized. We have measured steady state plasma branched chain and other essential non-branched chain amino acids in control subjects, untreated ornithine transcarbamylase deficiency females and treated null activity urea cycle disorder patients in the fed steady state during the course of stable isotope studies. Steady-state leucine levels were noted to be significantly lower in treated urea cycle disorder patients when compared to either untreated ornithine transcarbamylase deficiency females or control subjects (P<0.0001). This effect was reproduced in control subjects who had depressed leucine levels when treated with sodium phenylacetate/benzoate (P<0.0001). Our studies suggest that this therapeutic modality has a substantial impact on the metabolism of branched chain amino acids in urea cycle disorder patients. These findings suggest that better titration of protein restriction could be achieved with branched chain amino acid supplementation in patients with UCDs who are on alternative route therapy.

  15. Dynamics and regulation of glycolysis-tricarboxylic acid metabolism in the midgut of Spodoptera litura during metamorphosis.

    PubMed

    Hu, D; Luo, W; Fan, L F; Liu, F L; Gu, J; Deng, H M; Zhang, C; Huang, L H; Feng, Q L

    2016-04-01

    Significant changes usually take place in the internal metabolism of insects during metamorphosis. The glycolysis-tricarboxylic acid (glycolysis-TCA) pathway is important for energy metabolism. To elucidate its dynamics, the mRNA levels of genes involved in this pathway were examined in the midgut of Spodoptera litura during metamorphosis, and the pyruvate content was quantified. The expression patterns of these genes in response to starvation were examined, and the interaction between protein phosphatase 1 (PP1) and phosphofructokinase (PFK) was studied. The results revealed that the expression or activities of most glycolytic enzymes was down-regulated in prepupae and then recovered in some degree in pupae, and all TCA-related genes were remarkably suppressed in both the prepupae and pupae. Pyruvate was enriched in the pupal midgut. Taken together, these results suggest that insects decrease both glycolysis and TCA in prepupae to save energy and then up-regulate glycolysis but down-regulate TCA in pupae to increase the supply of intermediates for construction of new organs. The expression of all these genes were down-regulated by starvation, indicating that non-feeding during metamorphosis may be a regulator of glycolysis-TCA pathway in the midgut. Importantly, interaction between PP1 and PFK was identified and is suggested to be involved in the regulation of glycolysis. © 2015 The Royal Entomological Society.

  16. Results of chopper-controlled discharge life cycling studies on lead acid batteries

    NASA Technical Reports Server (NTRS)

    Ewashinka, J. G.; Sidik, S. M.

    1982-01-01

    A group of 108 state of the art nominally 6 volt lead acid batteries were tested in a program of one charge/discharge cycle per day for over two years or to ultimate battery failure. The primary objective was to determine battery cycle life as a function of depth of discharge (25 to 75 percent), chopper frequency (100 to 1000 Hz), duty cycle (25 to 87.5 percent), and average discharge current (20 to 260 A). The secondary objective was to determine the types of battery failure modes, if any, were due to the above parameters. The four parameters above were incorporated in a statistically designed test program.

  17. Anaerobic carbon metabolism by the tricarboxylic acid cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Vanlerberghe, G.C.; Horsey, A.K.; Weger, H.G.

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH{sub 4}{sup +} in the dark under anaerobic conditions. Addition of NH{sub 4}{sup +} to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO{sub 2} efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenspyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H{sup 14}CO{sub 3}{sup {minus}} to anaerobic cells assimilating NH{sub 4}{sup +} results in the incorporation of radiolabel into the {alpha}-carboxyl carbon of glutamic acid. Incorporationmore » of radiolabel into glutamic acid is not simply a short-term phenomenon following NH{sub 4}{sup +} addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply {alpha}ketoglutarate for glutamate production. During dark aerobic NH{sub 4}{sup +} assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH{sub 4}{sup +} assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH{sub 4}{sup +} assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.« less

  18. TLNS3D/CDISC Multipoint Design of the TCA Concept

    NASA Technical Reports Server (NTRS)

    Campbell, Richard L.; Mann, Michael J.

    1999-01-01

    This paper presents the work done to date by the authors on developing an efficient approach to multipoint design and applying it to the design of the HSR TCA (High Speed Research Technology Concept Aircraft) configuration. While the title indicates that this exploratory study has been performed using the TLNS3DMB flow solver and the CDISC (Constrained Direct Iterative Surface Curvature) design method, the CDISC method could have been used with any flow solver, and the multipoint design approach does not require the use of CDISC. The goal of the study was to develop a multipoint design method that could achieve a design in about the same time as 10 analysis runs.

  19. Carbon isotopic patterns of amino acids associated with various microbial metabolic pathways and physiological conditions

    NASA Astrophysics Data System (ADS)

    Wang, P. L.; Hsiao, K. T.; Lin, L. H.

    2017-12-01

    Amino acids represent one of the most important categories of biomolecule. Their abundance and isotopic patterns have been broadly used to address issues related to biochemical processes and elemental cycling in natural environments. Previous studies have shown that various carbon assimilative pathways of microorganisms (e.g. autotrophy, heterotrophy and acetotrophy) could be distinguished by carbon isotopic patterns of amino acids. However, the taxonomic and catabolic coverage are limited in previous examination. This study aims to uncover the carbon isotopic patterns of amino acids for microorganisms remaining uncharacterized but bearing biogeochemical and ecological significance in anoxic environments. To fulfill the purpose, two anaerobic strains were isolated from riverine wetland and mud volcano in Taiwan. One strain is a sulfate reducing bacterium (related to Desulfovibrio marrakechensis), which is capable of utilizing either H2 or lactate, and the other is a methanogen (related to Methanolobus profundi), which grows solely with methyl-group compounds. Carbon isotope analyses of amino acids were performed on cells grown in exponential and stationary phase. The isotopic patterns were similar for all examined cultures, showing successive 13C depletion along synthetic pathways. No significant difference was observed for the methanogen and lactate-utilizing sulfate reducer harvested in exponential and stationary phases. In contrast, the H2-utilizing sulfate reducer harvested in stationary phase depleted and enriched 13C in aspartic acid and glycine, respectively when compared with that harvested in exponential phase. Such variations might infer the change of carbon flux during synthesis of these two amino acids in the reverse TCA cycle. In addition, the discriminant function analysis for all available data from culture studies further attests the capability of using carbon isotope patterns of amino acids in identifying microbial metabolisms.

  20. Alternative Oxidase Isoforms Are Differentially Activated by Tricarboxylic Acid Cycle Intermediates.

    PubMed

    Selinski, Jennifer; Hartmann, Andreas; Deckers-Hebestreit, Gabriele; Day, David A; Whelan, James; Scheibe, Renate

    2018-02-01

    The cyanide-insensitive alternative oxidase (AOX) is a non-proton-pumping ubiquinol oxidase that catalyzes the reduction of oxygen to water and is posttranslationally regulated by redox mechanisms and 2-oxo acids. Arabidopsis ( Arabidopsis thaliana ) possesses five AOX isoforms (AOX1A-AOX1D and AOX2). AOX1D expression is increased in aox1a knockout mutants from Arabidopsis (especially after restriction of the cytochrome c pathway) but cannot compensate for the lack of AOX1A, suggesting a difference in the regulation of these isoforms. Therefore, we analyzed the different AOX isoenzymes with the aim to identify differences in their posttranslational regulation. Seven tricarboxylic acid cycle intermediates (citrate, isocitrate, 2-oxoglutarate, succinate, fumarate, malate, and oxaloacetate) were tested for their influence on AOX1A, AOX1C, and AOX1D wild-type protein activity using a refined in vitro system. AOX1C is insensitive to all seven organic acids, AOX1A and AOX1D are both activated by 2-oxoglutarate, but only AOX1A is additionally activated by oxaloacetate. Furthermore, AOX isoforms cannot be transformed to mimic one another by substituting the variable cysteine residues at position III in the protein. In summary, we show that AOX isoforms from Arabidopsis are differentially fine-regulated by tricarboxylic acid cycle metabolites (most likely depending on the amino-terminal region around the highly conserved cysteine residues known to be involved in regulation by the 2-oxo acids pyruvate and glyoxylate) and propose that this is the main reason why they cannot functionally compensate for each other. © 2018 American Society of Plant Biologists. All Rights Reserved.

  1. The metabolic role of isoleucine in detoxification of ammonia in cultured mouse neurons and astrocytes.

    PubMed

    Johansen, Maja L; Bak, Lasse K; Schousboe, Arne; Iversen, Peter; Sørensen, Michael; Keiding, Susanne; Vilstrup, Hendrik; Gjedde, Albert; Ott, Peter; Waagepetersen, Helle S

    2007-06-01

    Cerebral hyperammonemia is a hallmark of hepatic encephalopathy, a debilitating condition arising secondary to liver disease. Pyruvate oxidation including tricarboxylic acid (TCA) cycle metabolism has been suggested to be inhibited by hyperammonemia at the pyruvate and alpha-ketoglutarate dehydrogenase steps. Catabolism of the branched-chain amino acid isoleucine provides both acetyl-CoA and succinyl-CoA, thus by-passing both the pyruvate dehydrogenase and the alpha-ketoglutarate dehydrogenase steps. Potentially, this will enable the TCA cycle to work in the face of ammonium-induced inhibition. In addition, this will provide the alpha-ketoglutarate carbon skeleton for glutamate and glutamine synthesis by glutamate dehydrogenase and glutamine synthetase (astrocytes only), respectively, both reactions fixing ammonium. Cultured cerebellar neurons (primarily glutamatergic) or astrocytes were incubated in the presence of either [U-13C]glucose (2.5 mM) and isoleucine (1 mM) or [U-13C]isoleucine and glucose. Cell cultures were treated with an acute ammonium chloride load of 2 (astrocytes) or 5 mM (neurons and astrocytes) and incorporation of 13C-label into glutamate, aspartate, glutamine and alanine was determined employing mass spectrometry. Labeling from [U-13C]glucose in glutamate and aspartate increased as a result of ammonium-treatment in both neurons and astrocytes, suggesting that the TCA cycle was not inhibited. Labeling in alanine increased in neurons but not in astrocytes, indicating elevated glycolysis in neurons. For both neurons and astrocytes, labeling from [U-13C]isoleucine entered glutamate and aspartate albeit to a lower extent than from [U-13C]glucose. Labeling in glutamate and aspartate from [U-13C]isoleucine was decreased by ammonium treatment in neurons but not in astrocytes, the former probably reflecting increased metabolism of unlabeled glucose. In astrocytes, ammonia treatment resulted in glutamine production and release to the medium, partially

  2. Stoichiometry of Reducing Equivalents and Splitting of Water in the Citric Acid Cycle.

    ERIC Educational Resources Information Center

    Madeira, Vitor M. C.

    1988-01-01

    Presents a solution to the problem of finding the source of extra reducing equivalents, and accomplishing the stoichiometry of glucose oxidation reactions. Discusses the citric acid cycle and glycolysis. (CW)

  3. The role of Pyruvate Dehydrogenase Complex in cardiovascular diseases.

    PubMed

    Sun, Wanqing; Liu, Quan; Leng, Jiyan; Zheng, Yang; Li, Ji

    2015-01-15

    The regulation of mammalian myocardial carbohydrate metabolism is complex; many factors such as arterial substrate and hormone levels, coronary flow, inotropic state and the nutritional status of the tissue play a role in regulating mammalian myocardial carbohydrate metabolism. The Pyruvate Dehydrogenase Complex (PDHc), a mitochondrial matrix multienzyme complex, plays an important role in energy homeostasis in the heart by providing the link between glycolysis and the tricarboxylic acid (TCA) cycle. In TCA cycle, PDHc catalyzes the conversion of pyruvate into acetyl-CoA. This review determines that there is altered cardiac glucose in various pathophysiological states consequently causing PDC to be altered. This review further summarizes evidence for the metabolism mechanism of the heart under normal and pathological conditions including ischemia, diabetes, hypertrophy and heart failure. Copyright © 2014 Elsevier Inc. All rights reserved.

  4. Fructose Alters Intermediary Metabolism of Glucose in Human Adipocytes and Diverts Glucose to Serine Oxidation in the One–Carbon Cycle Energy Producing Pathway

    PubMed Central

    Varma, Vijayalakshmi; Boros, László G.; Nolen, Greg T.; Chang, Ching-Wei; Wabitsch, Martin; Beger, Richard D.; Kaput, Jim

    2015-01-01

    Increased consumption of sugar and fructose as sweeteners has resulted in the utilization of fructose as an alternative metabolic fuel that may compete with glucose and alter its metabolism. To explore this, human Simpson-Golabi-Behmel Syndrome (SGBS) preadipocytes were differentiated to adipocytes in the presence of 0, 1, 2.5, 5 or 10 mM of fructose added to a medium containing 5 mM of glucose representing the normal blood glucose concentration. Targeted tracer [1,2-13C2]-d-glucose fate association approach was employed to examine the influence of fructose on the intermediary metabolism of glucose. Increasing concentrations of fructose robustly increased the oxidation of [1,2-13C2]-d-glucose to 13CO2 (p < 0.000001). However, glucose-derived 13CO2 negatively correlated with 13C labeled glutamate, 13C palmitate, and M+1 labeled lactate. These are strong markers of limited tricarboxylic acid (TCA) cycle, fatty acid synthesis, pentose cycle fluxes, substrate turnover and NAD+/NADP+ or ATP production from glucose via complete oxidation, indicating diminished mitochondrial energy metabolism. Contrarily, a positive correlation was observed between glucose-derived 13CO2 formed and 13C oleate and doses of fructose which indicate the elongation and desaturation of palmitate to oleate for storage. Collectively, these results suggest that fructose preferentially drives glucose through serine oxidation glycine cleavage (SOGC pathway) one-carbon cycle for NAD+/NADP+ production that is utilized in fructose-induced lipogenesis and storage in adipocytes. PMID:26087138

  5. DIBROMOACETIC ACID-INDUCED ELEVATIONS OF ESTRADIOL IN THE CYCLING AND OVARIECTOMOZED/ESTRADIOL-IMPLANTED FEMALE RAT

    EPA Science Inventory

    Goldman, JM and Murr, AS. Dibromoacetic Acid-induced Elevations of Estradiol in Both Cycling and Ovariectomized / Estradiol-implanted Female Rats

    ABSTRACT
    Haloacetic acids are one of the principal classes of disinfection by-products generated by the chlorination of mun...

  6. Anaerobic organic acid metabolism of Candida zemplinina in comparison with Saccharomyces wine yeasts.

    PubMed

    Magyar, Ildikó; Nyitrai-Sárdy, Diána; Leskó, Annamária; Pomázi, Andrea; Kállay, Miklós

    2014-05-16

    Organic acid production under oxygen-limited conditions has been thoroughly studied in the Saccharomyces species, but practically never investigated in Candida zemplinina, which seems to be an acidogenic species under oxidative laboratory conditions. In this study, several strains of C. zemplinina were tested for organic acid metabolism, in comparison with Saccharomyces cerevisiae, Saccharomyces uvarum and Candida stellata, under fermentative conditions. Only C. stellata produced significantly higher acidity in simple minimal media (SM) with low sugar content and two different nitrogen sources (ammonia or glutamic acid) at low level. However, the acid profile differed largely between the Saccharomyces and Candida species and showed inverse types of N-dependence in some cases. Succinic acid production was strongly enhanced on glutamic acid in Saccharomyces species, but not in Candida species. 2-oxoglutarate production was strongly supported on ammonium nitrogen in Candida species, but remained low in Saccharomyces. Candida species, C. stellata in particular, produced more pyruvic acid regardless of N-sources. From the results, we concluded that the anaerobic organic acid metabolisms of C. zemplinina and C. stellata are different from each other and also from that of the Saccharomyces species. In the formation of succinic acid, the oxidative pathway from glutamic acid seems to play little or no role in C. zemplinina. The reductive branch of the TCA cycle, however, produces acidic intermediates (malic, fumaric, and succinic acid) in a level comparable with the production of the Saccharomyces species. An unidentified organic acid, which was produced on glutamic acid only by the Candida species, needs further investigation. Copyright © 2014 Elsevier B.V. All rights reserved.

  7. Extending food deprivation reverses the short-term lipolytic response to fasting: role of the triacylglycerol/fatty acid cycle.

    PubMed

    Weber, Jean-Michel; Reidy, Shannon P

    2012-05-01

    The effects of short-term food deprivation on lipid metabolism are well documented, but little is known about prolonged fasting. This study monitored the kinetics of glycerol (rate of appearance, R(a) glycerol) and non-esterified fatty acids (R(a) NEFA) in fasting rabbits. Our goals were to determine whether lipolysis is stimulated beyond values seen for short-term fasting, and to characterize the roles of primary (intracellular) and secondary (with transit through the circulation) triacylglycerol/fatty acid cycling (TAG/FA cycling) in regulating fatty acid allocation to oxidation or re-esterification. R(a) glycerol (9.62±0.72 to 15.29±0.96 μmol kg(-1) min(-1)) and R(a) NEFA (18.05±2.55 to 31.25±1.93 μmol kg(-1) min(-1)) were stimulated during the first 2 days of fasting, but returned to baseline after 4 days. An initial increase in TAG/FA cycling was followed by a reduction below baseline after 6 days without food, with primary and secondary cycling contributing to these responses. We conclude that the classic activation of lipolysis caused by short-term fasting is abolished when food deprivation is prolonged. High rates of re-esterification may become impossible to sustain, and TAG/FA cycling could decrease to reduce its cost to 3% of total energy expenditure. Throughout prolonged fasting, fatty acid metabolism gradually shifts towards increased oxidation and reduced re-esterification. Survival is achieved by pressing fuel selection towards the fatty acid dominance of energy metabolism and by slowing substrate cycles to assist metabolic suppression. However, TAG/FA cycling remains active even after prolonged fasting, suggesting that re-esterification is a crucial mechanism that cannot be stopped without harmful consequences.

  8. Cu(II) binding by a pH-fractionated fulvic acid

    USGS Publications Warehouse

    Brown, G.K.; Cabaniss, S.E.; MacCarthy, P.; Leenheer, J.A.

    1999-01-01

    The relationship between acidity, Cu(II) binding and sorption to XAD resin was examined using Suwannee River fulvic acid (SRFA). The work was based on the hypothesis that fractions of SRFA eluted from an XAD column at various pH's from 1.0 to 12.0 would show systematic variations in acidity and possibly aromaticity which in turn would lead to different Cu(II) binding properties. We measured equilibrium Cu(II) binding to these fractions using Cu2+ ion-selective electrode (ISE) potentiometry at pH 6.0. Several model ligands were also examined, including cyclopentane-1,2,3,4-tetracarboxylic acid (CP-TCA) and tetrahydrofuran-2,3,4,5-tetracarboxylic acid (THF-TCA), the latter binding Cu(II) much more strongly as a consequence of the ether linkage. The SRFA Cu(II) binding properties agreed with previous work at high ionic strength, and binding was enhanced substantially at lower ionic strength, in agreement with Poisson-Boltzmann predictions for small spheres. Determining Cu binding constants (K(i)) by non-linear regression with total ligand concentrations (L(Ti)) taken from previous work, the fractions eluted at varying pH had K(i) similar to the unfractionated SRFA, with a maximum enhancement of 0.50 log units. We conclude that variable-pH elution from XAD does not isolate significantly strong (or weak) Cu(II)-binding components from the SRFA mixture. Copyright (C) 1999 Elsevier Science B.V.

  9. Sirt3 promotes the urea cycle and fatty acid oxidation during dietary restriction

    PubMed Central

    Hallows, William C.; Yu, Wei; Smith, Brian C.; Devries, Mark K.; Ellinger, James J.; Someya, Shinichi; Shortreed, Michael R.; Prolla, Tomas; Markley, John L.; Smith, Lloyd M.; Zhao, Shimin; Guan, Kun-Liang; Denu, John M.

    2011-01-01

    Summary Emerging evidence suggests that protein acetylation is a broad-ranging regulatory mechanism. Here we utilize acetyl-peptide arrays and metabolomic analyses to identify substrates of mitochondrial deacetylase Sirt3. We identified ornithine transcarbamoylase (OTC) from the urea cycle, and enzymes involved in β-oxidation. Metabolomic analyses of fasted mice lacking Sirt3 (sirt3−/−) revealed alterations in β-oxidation and the urea cycle. Biochemical analysis demonstrated that Sirt3 directly deacetylates OTC and stimulates its activity. Mice under caloric restriction (CR) increased Sirt3 protein levels, leading to deacetylation and stimulation of OTC activity. In contrast, sirt3−/− mice failed to deacetylate OTC in response to CR. Inability to stimulate OTC under CR led to a failure to reduce orotic acid levels, a known outcome of OTC deficiency. Thus, Sirt3 directly regulates OTC activity and promotes the urea cycle during CR, and the results suggest that under low energy input, Sirt3 modulates mitochondria by promoting amino-acid catabolism and β-oxidation. PMID:21255725

  10. Shaofu Zhuyu decoction ameliorates obesity-mediated hepatic steatosis and systemic inflammation by regulating metabolic pathways

    PubMed Central

    Park, Hee-Sook; Lee, So Min; Jeong, Nam-Joo; Kim, Soon-Hee; Lee, Kyoung-Won; Lee, Ju-A

    2017-01-01

    Shaofu Zhuyu decoction (SFZYD, also known as Sobokchugeo-tang), a classical prescription drug in traditional East Asian medicine, has been used to treat blood stasis syndrome (BSS). Hepatic steatosis is the result of excess caloric intake, and its pathogenesis involves internal retention of phlegm and dampness, blood stasis, and liver Qi stagnation. To evaluate the effects of treatment with SFZYD on obesity-induced inflammation and hepatic steatosis, we fed male C57BL/6N mice a high fat diet (HFD) for 8 weeks and then treated them with SFZYD by oral gavage for an additional 4 weeks. The results of histological and biochemical examinations indicated that SFZYD treatment ameliorates systemic inflammation and hepatic steatosis. A partial least squares-discriminant analysis (PLS-DA) scores plot of serum metabolites showed that HFD mice began to produce metabolites similar to those of normal chow (NC) mice after SFZYD administration. We noted significant alterations in the levels of twenty-seven metabolites, alterations indicating that SFZYD regulates the TCA cycle, the pentose phosphate pathway and aromatic amino acid metabolism. Increases in the levels of TCA cycle intermediate metabolites, such as 2-oxoglutaric acid, isocitric acid, and malic acid, in the serum of obese mice were significantly reversed after SFZYD treatment. In addition to inducing changes in the above metabolites, treatment with SFZYD also recovered the expression of genes related to hepatic mitochondrial dysfunction, including Ucp2, Cpt1α, and Ppargc1α, as well as the expression of genes involved in lipid metabolism and inflammation, without affecting glucose uptake or insulin signaling. Taken together, these findings suggest that treatment with SFZYD ameliorated obesity-induced systemic inflammation and hepatic steatosis by regulating inflammatory cytokine and adipokine levels in the circulation and various tissues. Moreover, treatment with SFZYD also reversed alterations in the levels of

  11. Antisense Inhibition of the Iron-Sulphur Subunit of Succinate Dehydrogenase Enhances Photosynthesis and Growth in Tomato via an Organic Acid–Mediated Effect on Stomatal Aperture[W][OA

    PubMed Central

    Araújo, Wagner L.; Nunes-Nesi, Adriano; Osorio, Sonia; Usadel, Björn; Fuentes, Daniela; Nagy, Réka; Balbo, Ilse; Lehmann, Martin; Studart-Witkowski, Claudia; Tohge, Takayuki; Martinoia, Enrico; Jordana, Xavier; DaMatta, Fábio M.; Fernie, Alisdair R.

    2011-01-01

    Transgenic tomato (Solanum lycopersicum) plants expressing a fragment of the Sl SDH2-2 gene encoding the iron sulfur subunit of the succinate dehydrogenase protein complex in the antisense orientation under the control of the 35S promoter exhibit an enhanced rate of photosynthesis. The rate of the tricarboxylic acid (TCA) cycle was reduced in these transformants, and there were changes in the levels of metabolites associated with the TCA cycle. Furthermore, in comparison to wild-type plants, carbon dioxide assimilation was enhanced by up to 25% in the transgenic plants under ambient conditions, and mature plants were characterized by an increased biomass. Analysis of additional photosynthetic parameters revealed that the rate of transpiration and stomatal conductance were markedly elevated in the transgenic plants. The transformants displayed a strongly enhanced assimilation rate under both ambient and suboptimal environmental conditions, as well as an elevated maximal stomatal aperture. By contrast, when the Sl SDH2-2 gene was repressed by antisense RNA in a guard cell–specific manner, changes in neither stomatal aperture nor photosynthesis were observed. The data obtained are discussed in the context of the role of TCA cycle intermediates both generally with respect to photosynthetic metabolism and specifically with respect to their role in the regulation of stomatal aperture. PMID:21307286

  12. Ammonium Assimilation Requires Mitochondrial Respiration in the Light : A Study with the Green Alga Selenastrum minutum.

    PubMed

    Weger, H G; Birch, D G; Elrifi, I R; Turpin, D H

    1988-03-01

    Mass spectrometric analysis of O(2) and CO(2) exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH(4)Cl resulted in nearly a 250% increase in the rate of TCA cycle CO(2) efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O(2) consumption in both light and dark. Anaerobiosis inhibited the CO(2) release caused by NH(4)Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O(2) consumption in the light. This implied that the Mehler reaction did not play a significant role in O(2) consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions.

  13. Ammonium Assimilation Requires Mitochondrial Respiration in the Light 1

    PubMed Central

    Weger, Harold G.; Birch, Douglas G.; Elrifi, Ivor R.; Turpin, David H.

    1988-01-01

    Mass spectrometric analysis of O2 and CO2 exchange in the green alga Selenastrum minutum (Naeg. Collins) provides evidence for the occurrence of mitochondrial respiration in light. Stimulation of amino acid synthesis by the addition of NH4Cl resulted in nearly a 250% increase in the rate of TCA cycle CO2 efflux in both light and dark. Ammonium addition caused a similar increase in cyanide sensitive O2 consumption in both light and dark. Anaerobiosis inhibited the CO2 release caused by NH4Cl. These results indicated that the cytochrome pathway of the mitochondrial electron transport chain was operative and responsible for the oxidation of a large portion of the NADH generated during the ammonium induced increase in TCA cycle activity. In the presence of DCMU, ammonium addition also stimulated net O2 consumption in the light. This implied that the Mehler reaction did not play a significant role in O2 consumption under our conditions. These results show that both the TCA cycle and the mitochondrial electron transport chain are capable of operation in the light and that an important role of mitochondrial respiration in photosynthesizing cells is the provision of carbon skeletons for biosynthetic reactions. PMID:16665971

  14. Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle 1

    PubMed Central

    Vanlerberghe, Greg C.; Horsey, Anne K.; Weger, Harold G.; Turpin, David H.

    1989-01-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH4+ in the dark under anaerobic conditions. Addition of NH4+ to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO2 efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H14CO3− to anaerobic cells assimilating NH4+ results in the incorporation of radiolabel into the α-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH4+ addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply α-ketoglutarate for glutamate production. During dark aerobic NH4+ assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH4+ assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH4+ assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity. PMID:16667215

  15. Aerobic capacity and hepatic mitochondrial lipid oxidation alters susceptibility for chronic high-fat diet-induced hepatic steatosis.

    PubMed

    Morris, E Matthew; Meers, Grace M E; Koch, Lauren G; Britton, Steven L; Fletcher, Justin A; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C; Ibdah, Jamal A; Rector, R Scott; Thyfault, John P

    2016-10-01

    Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity.

  16. Aerobic capacity and hepatic mitochondrial lipid oxidation alters susceptibility for chronic high-fat diet-induced hepatic steatosis

    PubMed Central

    Morris, E. Matthew; Meers, Grace M. E.; Koch, Lauren G.; Britton, Steven L.; Fletcher, Justin A.; Fu, Xiaorong; Shankar, Kartik; Burgess, Shawn C.; Ibdah, Jamal A.; Rector, R. Scott

    2016-01-01

    Rats selectively bred for high capacity running (HCR) or low capacity running (LCR) display divergence for intrinsic aerobic capacity and hepatic mitochondrial oxidative capacity, both factors associated with susceptibility for nonalcoholic fatty liver disease. Here, we tested if HCR and LCR rats display differences in susceptibility for hepatic steatosis after 16 wk of high-fat diets (HFD) with either 45% or 60% of kcals from fat. HCR rats were protected against HFD-induced hepatic steatosis, whereas only the 60% HFD induced steatosis in LCR rats, as marked by a doubling of liver triglycerides. Hepatic complete fatty acid oxidation (FAO) and mitochondrial respiratory capacity were all lower in LCR compared with HCR rats. LCR rats also displayed lower hepatic complete and incomplete FAO in the presence of etomoxir, suggesting a reduced role for noncarnitine palmitoyltransferase-1-mediated lipid catabolism in LCR versus HCR rats. Hepatic complete FAO and mitochondrial respiration were largely unaffected by either chronic HFD; however, 60% HFD feeding markedly reduced 2-pyruvate oxidation, a marker of tricarboxylic acid (TCA) cycle flux, and mitochondrial complete FAO only in LCR rats. LCR rats displayed lower levels of hepatic long-chain acylcarnitines than HCR rats but maintained similar levels of hepatic acetyl-carnitine levels, further supporting lower rates of β-oxidation, and TCA cycle flux in LCR than HCR rats. Finally, only LCR rats displayed early reductions in TCA cycle genes after the acute initiation of a HFD. In conclusion, intrinsically high aerobic capacity confers protection against HFD-induced hepatic steatosis through elevated hepatic mitochondrial oxidative capacity. PMID:27600823

  17. Cinnamic acid derivatives induce cell cycle arrest in carcinoma cell lines.

    PubMed

    Sova, Matej; Žižak, Željko; Stanković, Jelena A Antic; Prijatelj, Matevž; Turk, Samo; Juranić, Zorica D; Mlinarič-Raščan, Irena; Gobec, Stanislav

    2013-08-01

    Cinnamic acid derivatives can be found in plant material, and they possess a remarkable variety of biological effects. In the present study, we have investigated the cytotoxic effects of representative cinnamic acid esters and amides. The cytotoxicity was determined by MTT test on human cervix adenocarcinoma (HeLa), myelogenous leukemia (K562), malignant melanoma (Fem-x), and estrogen-receptor-positive breast cancer (MCF-7) cells, versus peripheral blood mononuclear cells (PBMCs) without or with the addition of the plant lectin phytohemaglutinin (PHA). The compounds tested showed significant cytotoxicity (IC50s between 42 and 166 µM) and furthermore selectivity of these cytotoxic effects on the malignant cell lines versus the PBMCs was also seen, especially when electron-withdrawing groups, such as a cyano group (compound 5), were present on the aromatic rings of the alcohol or amine parts of the cinnamic acid derivatives. The additional study on cell cycle phase distribution indicated that novel cinnamic acid derivatives inhibit cell growth by induction of cell death. Thus, cinnamic acids derivatives represent important lead compounds for further development of antineoplastic agents.

  18. Quantitative protein expression and cell surface characteristics of Escherichia coli MG1655 biofilms.

    PubMed

    Mukherjee, Joy; Ow, Saw Yen; Noirel, Josselin; Biggs, Catherine A

    2011-02-01

    Cell surface physicochemical characterization techniques were combined with quantitative changes in protein expression, to investigate the biological and biophysical changes of Escherichia coli MG1655 cells when grown as a biofilm (BIO). The overall surface charge of BIO cells was found to be less negative, highlighting the need for a lower electrophoretic mobility for attachment to occur. Comparison of the chemical functional groups on the cell surface showed similar profiles, with the absorbance intensity higher for proteins and carbohydrates in the BIO cells. Quantitative proteomic analysis demonstrated that 3 proteins were significantly increased, and 9 proteins significantly decreased in abundance, in cells grown as a BIO compared to their planktonic counterparts, with 7 of these total 12 proteins unique to this study. Proteins showing significant increased or decreased abundance include proteins involved in acid resistance, DNA protection and binding and ABC transporters. Further predictive analysis of the metabolic pathways showed an increased abundance of the amino acid metabolism and tricarboxylic acid (TCA) cycle, with a decrease in expression within the pentose phosphate and glycolysis pathways. It is therefore hypothesized that cells grown as a BIO are still energetically viable potentially using amino acids as an indirect carbon backbone source into the TCA cycle. Copyright © 2011 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. C-Myc Induced Compensated Cardiac Hypertrophy Increases Free Fatty Acid Utilization for the Citric Acid Cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Olson, Aaron; Ledee, Dolena; Iwamoto, Kate

    The protooncogene C-Myc (Myc) regulates cardiac hypertrophy. Myc promotes compensated cardiac function, suggesting that the operative mechanisms differ from those leading to heart failure. Myc regulation of substrate metabolism is a reasonable target, as Myc alters metabolism in other tissues. We hypothesize that Myc-induced shifts in substrate utilization signal and promote compensated hypertrophy. We used cardiac specific Myc-inducible C57/BL6 male mice between 4-6 months old that develop hypertrophy with tamoxifen (tam). Isolated working hearts and 13Carbon (13C )-NMR were used to measure function and fractional contributions (Fc) to the citric acid cycle by using perfusate containing 13C-labeled free fatty acids,more » acetoacetate, lactate, unlabeled glucose and insulin. Studies were performed at pre-hypertrophy (3-days tam, 3dMyc), established hypertrophy (7-days tam, 7dMyc) or vehicle control (cont). Non-transgenic siblings (NTG) received 7-days tam or vehicle to assess drug effect. Hypertrophy was confirmed by echocardiograms and heart weights. Western blots were performed on key metabolic enzymes. Hypertrophy occurred in 7dMyc only. Cardiac function did not differ between groups. Tam alone did not affect substrate contribution in NTG. Substrate utilization was not significantly altered in 3dMyc versus cont. The free fatty acid FC was significantly greater in 7dMyc vs cont with decreased unlabeled Fc, which is predominately exogenous glucose. Free fatty acid flux to the citric acid cycle increased while lactate flux was diminished in 7dMyc compared to cont. Total protein levels of a panel of key metabolic enzymes were unchanged; however total protein O-GlcNAcylation was increased in 7dMyc. Substrate utilization changes did not precede hypertrophy; therefore they are not the primary signal for cardiac growth in this model. Free fatty acid utilization and oxidation increase at established hypertrophy. Understanding the mechanisms whereby this change

  20. 13-cis Retinoic acid induces apoptosis and cell cycle arrest in human SEB-1 sebocytes.

    PubMed

    Nelson, Amanda M; Gilliland, Kathryn L; Cong, Zhaoyuan; Thiboutot, Diane M

    2006-10-01

    Isotretinoin (13-cis retinoic acid (13-cis RA)) is the most potent inhibitor of sebum production, a key component in the pathophysiology of acne, yet its mechanism of action remains largely unknown. The effects of 13-cis RA, 9-cis retinoic acid (9-cis RA), and all-trans retinoic acid (ATRA) on cell proliferation, apoptosis, and cell cycle proteins were examined in SEB-1 sebocytes and keratinocytes. 13-cis RA causes significant dose-dependent and time-dependent decreases in viable SEB-1 sebocytes. A portion of this decrease can be attributed to cell cycle arrest as evidenced by decreased DNA synthesis, increased p21 protein expression, and decreased cyclin D1. Although not previously demonstrated in sebocytes, we report that 13-cis RA induces apoptosis in SEB-1 sebocytes as shown by increased Annexin V-FITC staining, increased TUNEL staining, and increased cleaved caspase 3 protein. Furthermore, the ability of 13-cis RA to induce apoptosis cannot be recapitulated by 9-cis RA or ATRA, and it is not inhibited by the presence of a retinoid acid receptor (RAR) pan-antagonist AGN 193109. Taken together these data indicate that 13-cis RA causes cell cycle arrest and induces apoptosis in SEB-1 sebocytes by a RAR-independent mechanism, which contributes to its sebosuppressive effect and the resolution of acne.

  1. (13)C heteronuclear NMR studies of the interaction of cultured neurons and astrocytes and aluminum blockade of the preferential release of citrate from astrocytes.

    PubMed

    Meshitsuka, Shunsuke; Aremu, David A

    2008-02-01

    Citrate has been identified as a major tricarboxylic acid (TCA) cycle constituent preferentially released by astrocytes. We undertook the present study to examine further the nature of metabolic compartmentation in central nervous system tissues using (13)C-labeled glucose and to provide new information on the influence of aluminum on the metabolic interaction between neurons and astrocytes. Metabolites released into the culture medium from astrocytes and neuron-astrocyte coculture, as well as the perchloric acid extracts of the cells were analyzed using 2D (1)H and (13)C NMR spectroscopy. Astrocytes released citrate into the culture medium and the released citrate was consumed by neurons in coculture. Citrate release by astrocytes was blocked in the presence of aluminum, with progressive accumulation of citrate within the cells. We propose citrate supply is a more efficient energy source than lactate for neurons to produce ATP, especially in the hypoglycemic state on account of it being a direct component of the TCA cycle. Astrocytes may be the cellular compartment for aluminum accumulation as a citrate complex in the brain.

  2. Impact of unusual fatty acid synthesis on futile cycling through beta-oxidation and on gene expression in transgenic plants.

    PubMed

    Moire, Laurence; Rezzonico, Enea; Goepfert, Simon; Poirier, Yves

    2004-01-01

    Arabidopsis expressing the castor bean (Ricinus communis) oleate 12-hydroxylase or the Crepis palaestina linoleate 12-epoxygenase in developing seeds typically accumulate low levels of ricinoleic acid and vernolic acid, respectively. We have examined the presence of a futile cycle of fatty acid degradation in developing seeds using the synthesis of polyhydroxyalkanoate (PHA) from the intermediates of the peroxisomal beta-oxidation cycle. Both the quantity and monomer composition of the PHA synthesized in transgenic plants expressing the 12-epoxygenase and 12-hydroxylase in developing seeds revealed the presence of a futile cycle of degradation of the corresponding unusual fatty acids, indicating a limitation in their stable integration into lipids. The expression profile of nearly 200 genes involved in fatty acid biosynthesis and degradation has been analyzed through microarray. No significant changes in gene expression have been detected as a consequence of the activity of the 12-epoxygenase or the 12-hydroxylase in developing siliques. Similar results have also been obtained for transgenic plants expressing the Cuphea lanceolata caproyl-acyl carrier protein thioesterase and accumulating high amounts of caproic acid. Only in developing siliques of the tag1 mutant, deficient in the accumulation of triacylglycerols and shown to have a substantial futile cycling of fatty acids toward beta-oxidation, have some changes in gene expression been detected, notably the induction of the isocitrate lyase gene. These results indicate that analysis of peroxisomal PHA is a better indicator of the flux of fatty acid through beta-oxidation than the expression profile of genes involved in lipid metabolism.

  3. Crassulacean acid metabolism-cycling in Euphorbia milii.

    PubMed

    Herrera, Ana

    2013-01-01

    Crassulacean acid metabolism (CAM) occurs in many Euphorbiaceae, particularly Euphorbia, a genus with C3 and C4 species as well. With the aim of contributing to our knowledge of the evolution of CAM in this genus, this study examined the possible occurrence of CAM in Euphorbia milii, a species with leaf succulence and drought tolerance suggestive of this carbon fixation pathway. Leaf anatomy consisted of a palisade parenchyma, a spongy parenchyma and a bundle sheath with chloroplasts, which indicates the possible functioning of C2 photosynthesis. No evidence of nocturnal CO2 fixation was found in plants of E. milii either watered or under drought; watered plants had a low nocturnal respiration rate (R). After 12 days without watering, the photosynthetic rate (P N) decreased 85 % and nocturnal R was nearly zero. Nocturnal H(+) accumulation (ΔH(+)) in watered plants was 18 ± 2 (corresponding to malate) and 18 ± 4 (citrate) μmol H(+) (g fresh mass)(-1). Respiratory CO2 recycling through acid synthesis contributed to a night-time water saving of 2 and 86 % in watered plants and plants under drought, respectively. Carbon isotopic composition (δ(13)C) was -25.2 ± 0.7 ‰ in leaves and -24.7 ± 0.1 ‰ in stems. Evidence was found for the operation of weak CAM in E. milii, with statistically significant ΔH(+), no nocturnal CO2 uptake and values of δ(13)C intermediate between C3 and constitutive CAM plants; ΔH(+) was apparently attributable to both malate and citrate. The results suggest that daily malate accumulation results from recycling of part of the nocturnal respiratory CO2, which helps explain the occurrence of an intermediate value of leaf δ(13)C. Euphorbia milii can be considered as a CAM-cycling species. The significance of the operation of CAM-cycling in E. milii lies in water conservation, rather than carbon acquisition. The possible occurrence of C2 photosynthesis merits research.

  4. Metabolites Identified during Varied Doses of Aspergillus Species in Zea mays Grains, and Their Correlation with Aflatoxin Levels

    PubMed Central

    Chrysanthopoulos, Panagiotis K.; Hodson, Mark P.; Darnell, Ross; Korie, Sam

    2018-01-01

    Aflatoxin contamination is associated with the development of aflatoxigenic fungi such as Aspergillus flavus and A. parasiticus on food grains. This study was aimed at investigating metabolites produced during fungal development on maize and their correlation with aflatoxin levels. Maize cobs were harvested at R3 (milk), R4 (dough), and R5 (dent) stages of maturity. Individual kernels were inoculated in petri dishes with four doses of fungal spores. Fungal colonisation, metabolite profile, and aflatoxin levels were examined. Grain colonisation decreased with kernel maturity: milk-, dough-, and dent-stage kernels by approximately 100%, 60%, and 30% respectively. Aflatoxin levels increased with dose at dough and dent stages. Polar metabolites including alanine, proline, serine, valine, inositol, iso-leucine, sucrose, fructose, trehalose, turanose, mannitol, glycerol, arabitol, inositol, myo-inositol, and some intermediates of the tricarboxylic acid cycle (TCA—also known as citric acid or Krebs cycle) were important for dose classification. Important non-polar metabolites included arachidic, palmitic, stearic, 3,4-xylylic, and margaric acids. Aflatoxin levels correlated with levels of several polar metabolites. The strongest positive and negative correlations were with arabitol (R = 0.48) and turanose and (R = −0.53), respectively. Several metabolites were interconnected with the TCA; interconnections of the metabolites with the TCA cycle varied depending upon the grain maturity. PMID:29735944

  5. Comparative study of toxicological and cell cycle effects of okadaic acid and dinophysistoxin-2 in primary rat hepatocytes.

    PubMed

    Rubiolo, J A; López-Alonso, H; Vega, F V; Vieytes, M R; Botana, L M

    2012-03-10

    To determine the relative toxicity and effects on the cell cycle of okadaic acid and dinophysistoxin-2 in primary hepatocyte cultures. Cytotoxicity was determined by the MTT method, caspase-3 activity and lactate dehydrogenase release to the medium. The cell cycle analysis was performed by imaging flow cytometry and the effect of the toxins on cell proliferation was studied by quantitative PCR and confocal microscopy. We show that dinophysistoxin-2 is less toxic than okadaic acid for primary hepatocytes with a similar difference in potency as that observed in vivo in mice after intraperitoneal injection. Both toxins induced apoptosis with caspase-3 increase. They also inhibited the hepatocytes cell cycle in G1 affecting diploid cells and diploid bi-nucleated cells. In proliferating hepatocytes exposed to the toxins, a decrease of p53 gene expression as well as a lower protein level was detected. Studies of the tubulin cytoskeleton in toxin treated cells, showed nuclear localization of this molecule and a granulated tubulin pattern in the cytoplasm. The results presented in this work show that the difference in toxicity between dinophysistoxin-2 and okadaic acid in cultured primary hepatocytes is the same as that observed in vivo after intraperitoneal injection. Okadaic acid and dinophysistoxin-2 arrest the cell cycle of hepatocytes at G1 even in diploid bi-nucleated cells. p53 and tubulin could be involved in the cell cycle inhibitory effect. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. Alterations in Krebs cycle enzyme activities and carbohydrate catabolism in two strains of Trypanosoma brucei during in vitro differentiation of their bloodstream to procyclic stages.

    PubMed

    Durieux, P O; Schütz, P; Brun, R; Köhler, P

    1991-03-01

    A rapid switch from a fermentative to a primarily oxidative type of glucose utilization was observed during in vitro differentiation of Trypanosoma brucei STIB348 and EATRO1244 bloodstream to procyclic trypomastigotes. In accordance with previously published reports bloodstream populations produced pyruvate as the major end product of glucose catabolism, together with very small amounts of CO2, succinate and glycerol. During differentiation pyruvate excretion decreased within 48 h to the low levels produced by 28-day procyclic stages. Concomitant with the decline in pyruvate formation, acetate appeared as a new product and the rates of respiratory CO2 increased considerably. The amount of carbon released with these compounds could account for nearly all of the glucose carbon consumed. Rates of glucose utilization and formation of acetate and CO2 in cells differentiated for 48 h were essentially the same as those found in 28-day procyclics. Succinate and glycerol excretion remained low during the entire transformation process, and no significant difference in the pattern and quantities of end products were found between the two trypanosome strains. During trypanosome differentiation the changes in metabolism were associated with marked alterations in enzyme activity levels. Activities of the tricarboxylic acid (TCA) cycle enzymes citrate synthase, isocitrate dehydrogenase (NAD+), succinate dehydrogenase and fumarase were not detectable in bloodstream trypomastigotes but appeared upon differentiation for 24 h. An exception was citrate synthase whose activity was not demonstrable until 48 h postinoculation into culture. After 48 h the majority of the TCA cycle enzyme activities continued to increase steadily until day 28. Pyruvate kinase activity decreased in differentiating cells after 48 h to about 25% of the level found in bloodstream trypomastigotes.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Arachidonic acid induces macrophage cell cycle arrest through the JNK signaling pathway.

    PubMed

    Shen, Ziying; Ma, Yunqing; Ji, Zhonghao; Hao, Yang; Yan, Xuan; Zhong, Yuan; Tang, Xiaochun; Ren, Wenzhi

    2018-02-09

    Arachidonic acid (AA) has potent pro-apoptotic effects on cancer cells at a low concentration and on macrophages at a very high concentration. However, the effects of AA on the macrophage cell cycle and related signaling pathways have not been fully investigated. Herein we aim to observe the effect of AA on macrophages cell cycle. AA exposure reduced the viability and number of macrophages in a dose- and time-dependent manner. The reduction in RAW264.7 cell viability was not caused by apoptosis, as indicated by caspase-3 and activated caspase-3 detection. Further research illustrated that AA exposure induced RAW264.7 cell cycle arrested at S phase, and some cell cycle-regulated proteins were altered accordingly. Moreover, JNK signaling was stimulated by AA, and the stimulation was partially reversed by a JNK signaling inhibitor in accordance with cell cycle-related factors. In addition, nuclear and total Foxo1/3a and phosphorylated Foxo1/3a were elevated by AA in a dose- and time-dependent manner, and this elevation was suppressed by the JNK signaling inhibitor. Our study demonstrated that AA inhibits macrophage viability by inducing S phase cell cycle arrest. The JNK signaling pathway and the downstream FoxO transcription factors are involved in AA-induced RAW264.7 cell cycle arrest.

  8. Metabolomics approach to assessing plasma 13- and 9-hydroxy-octadecadienoic acid and linoleic acid metabolite responses to 75-km cycling.

    PubMed

    Nieman, David C; Shanely, R Andrew; Luo, Beibei; Meaney, Mary Pat; Dew, Dustin A; Pappan, Kirk L

    2014-07-01

    Bioactive oxidized linoleic acid metabolites (OXLAMs) include 13- and 9-hydroxy-octadecadienoic acid (13-HODE + 9-HODE) and have been linked to oxidative stress, inflammation, and numerous pathological and physiological states. The purpose of this study was to measure changes in plasma 13-HODE + 9-HODE following a 75-km cycling bout and identify potential linkages to linoleate metabolism and established biomarkers of oxidative stress (F2-isoprostanes) and inflammation (cytokines) using a metabolomics approach. Trained male cyclists (N = 19, age 38.0 ± 1.6 yr, wattsmax 304 ± 10.5) engaged in a 75-km cycling time trial on their own bicycles using electromagnetically braked cycling ergometers (2.71 ± 0.07 h). Blood samples were collected preexercise, immediately post-, 1.5 h post-, and 21 h postexercise, and analyzed for plasma cytokines (IL-6, IL-8, IL-10, tumor necrosis factor-α, monocyte chemoattractant protein-1, granulocyte colony-stimulating factor), F2-isoprostanes, and shifts in metabolites using global metabolomics procedures with gas chromatography mass spectrometry (GC-MS) and liquid chromatography mass spectrometry (LC-MS). 13-HODE + 9-HODE increased 3.1-fold and 1.7-fold immediately post- and 1.5 h postexercise (both P < 0.001) and returned to preexercise levels by 21-h postexercise. Post-75-km cycling plasma levels of 13-HODE + 9-HODE were not significantly correlated with increases in plasma cytokines but were positively correlated with postexercise F2-isoprostanes (r = 0.75, P < 0.001), linoleate (r = 0.54, P = 0.016), arachidate (r = 0.77, P < 0.001), 12,13-dihydroxy-9Z-octadecenoate (12,13-DiHOME) (r = 0.60, P = 0.006), dihomo-linolenate (r = 0.57, P = 0.011), and adrenate (r = 0.56, P = 0.013). These findings indicate that prolonged and intensive exercise caused a transient, 3.1-fold increase in the stable linoleic acid oxidation product 13-HODE + 9-HODE and was related to increases in F2-isoprostanes, linoleate, and fatty acids in the linoleate

  9. Co-expression of bacterial aspartate kinase and adenylylsulfate reductase genes substantially increases sulfur amino acid levels in transgenic alfalfa (Medicago sativa L.).

    PubMed

    Tong, Zongyong; Xie, Can; Ma, Lei; Liu, Liping; Jin, Yongsheng; Dong, Jiangli; Wang, Tao

    2014-01-01

    Alfalfa (Medicago sativa L.) is one of the most important forage crops used to feed livestock, such as cattle and sheep, and the sulfur amino acid (SAA) content of alfalfa is used as an index of its nutritional value. Aspartate kinase (AK) catalyzes the phosphorylation of aspartate to Asp-phosphate, the first step in the aspartate family biosynthesis pathway, and adenylylsulfate reductase (APR) catalyzes the conversion of activated sulfate to sulfite, providing reduced sulfur for the synthesis of cysteine, methionine, and other essential metabolites and secondary compounds. To reduce the feedback inhibition of other metabolites, we cloned bacterial AK and APR genes, modified AK, and introduced them into alfalfa. Compared to the wild-type alfalfa, the content of cysteine increased by 30% and that of methionine increased substantially by 60%. In addition, a substantial increase in the abundance of essential amino acids (EAAs), such as aspartate and lysine, was found. The results also indicated a close connection between amino acid metabolism and the tricarboxylic acid (TCA) cycle. The total amino acid content and the forage biomass tested showed no significant changes in the transgenic plants. This approach provides a new method for increasing SAAs and allows for the development of new genetically modified crops with enhanced nutritional value.

  10. Co-Expression of Bacterial Aspartate Kinase and Adenylylsulfate Reductase Genes Substantially Increases Sulfur Amino Acid Levels in Transgenic Alfalfa (Medicago sativa L.)

    PubMed Central

    Tong, Zongyong; Xie, Can; Ma, Lei; Liu, Liping; Jin, Yongsheng; Dong, Jiangli; Wang, Tao

    2014-01-01

    Alfalfa (Medicago sativa L.) is one of the most important forage crops used to feed livestock, such as cattle and sheep, and the sulfur amino acid (SAA) content of alfalfa is used as an index of its nutritional value. Aspartate kinase (AK) catalyzes the phosphorylation of aspartate to Asp-phosphate, the first step in the aspartate family biosynthesis pathway, and adenylylsulfate reductase (APR) catalyzes the conversion of activated sulfate to sulfite, providing reduced sulfur for the synthesis of cysteine, methionine, and other essential metabolites and secondary compounds. To reduce the feedback inhibition of other metabolites, we cloned bacterial AK and APR genes, modified AK, and introduced them into alfalfa. Compared to the wild-type alfalfa, the content of cysteine increased by 30% and that of methionine increased substantially by 60%. In addition, a substantial increase in the abundance of essential amino acids (EAAs), such as aspartate and lysine, was found. The results also indicated a close connection between amino acid metabolism and the tricarboxylic acid (TCA) cycle. The total amino acid content and the forage biomass tested showed no significant changes in the transgenic plants. This approach provides a new method for increasing SAAs and allows for the development of new genetically modified crops with enhanced nutritional value. PMID:24520364

  11. Comparative Evaluation of Topical 10% Potassium Hydroxide and 30% Trichloroacetic Acid in the Treatment of Plane Warts

    PubMed Central

    Jayaprasad, Sandhaya; Subramaniyan, Radhakrishnan; Devgan, Shalini

    2016-01-01

    Background: Warts are benign proliferations of skin and mucosa caused by the human papillomavirus (HPV). Plane warts are caused by HPV types 3, 10, 28, and 41, occurring mostly in children and young adults. Among the treatment modalities, topical application of trichloroacetic acid (TCA) is age old. Potassium hydroxide (KOH) has a keratolytic effect on virus-infected cells. It is less irritating, less painful, less scar forming, and can be safely used in children too. Hence, it could be a better topical agent in the treatment of plane warts. Aims and Objectives: To compare the safety and efficacy of topical 10% KOH with 30% TCA in the treatment of plane warts. Materials and Methods: Sixty consecutive patients with plane warts were randomly assigned into two arms of thirty patients each; arm A received topical 10% KOH and arm B received topical 30% TCA as a once weekly application until the complete clearance of warts or a maximum period of 12 weeks. Results: Statistically no significant difference (P = 0.07) was found between the objective therapeutic response to 10% KOH and 30% TCA at the end of study (12 weeks). However, subjective response to 10% KOH was better and statistically significant (P = 0.03). There was no recurrence of warts seen on follow-up for 3 months of complete responders in both the arms. Conclusion: 10% KOH is found to be equally effective in the treatment of plane warts compared to 30% TCA with the advantage of faster onset of action and tendency of completely clearing warts with fewer side effects. PMID:27904181

  12. Achromobacter denitrificans Strain YD35 Pyruvate Dehydrogenase Controls NADH Production To Allow Tolerance to Extremely High Nitrite Levels

    PubMed Central

    Doi, Yuki; Shimizu, Motoyuki; Fujita, Tomoya; Nakamura, Akira; Takizawa, Noboru

    2014-01-01

    We identified the extremely nitrite-tolerant bacterium Achromobacter denitrificans YD35 that can grow in complex medium containing 100 mM nitrite (NO2−) under aerobic conditions. Nitrite induced global proteomic changes and upregulated tricarboxylate (TCA) cycle enzymes as well as antioxidant proteins in YD35. Transposon mutagenesis generated NO2−-hypersensitive mutants of YD35 that had mutations at genes for aconitate hydratase and α-ketoglutarate dehydrogenase in the TCA cycle and a pyruvate dehydrogenase (Pdh) E1 component, indicating the importance of TCA cycle metabolism to NO2− tolerance. A mutant in which the pdh gene cluster was disrupted (Δpdh mutant) could not grow in the presence of 100 mM NO2−. Nitrite decreased the cellular NADH/NAD+ ratio and the cellular ATP level. These defects were more severe in the Δpdh mutant, indicating that Pdh contributes to upregulating cellular NADH and ATP and NO2−-tolerant growth. Exogenous acetate, which generates acetyl coenzyme A and then is metabolized by the TCA cycle, compensated for these defects caused by disruption of the pdh gene cluster and those caused by NO2−. These findings demonstrate a link between NO2− tolerance and pyruvate/acetate metabolism through the TCA cycle. The TCA cycle mechanism in YD35 enhances NADH production, and we consider that this contributes to a novel NO2−-tolerating mechanism in this strain. PMID:24413603

  13. An integrated model of cardiac mitochondrial energy metabolism and calcium dynamics.

    PubMed

    Cortassa, Sonia; Aon, Miguel A; Marbán, Eduardo; Winslow, Raimond L; O'Rourke, Brian

    2003-04-01

    We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca(2+) handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH(2), which in turn are used by the electron transport chain to establish a proton motive force (Delta mu(H)), driving the F(1)F(0)-ATPase. In addition, mitochondrial matrix Ca(2+), determined by Ca(2+) uniporter and Na(+)/Ca(2+) exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and alpha-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (Delta Psi(m)), and matrix concentrations of Ca(2+), NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca(2+). The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca(2+) dynamics, and respiratory control. Significant increases in oxygen consumption (V(O(2))), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca(2+), are obtained when the Ca(2+)-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca(2+) plays an

  14. An Integrated Model of Cardiac Mitochondrial Energy Metabolism and Calcium Dynamics

    PubMed Central

    Cortassa, Sonia; Aon, Miguel A.; Marbán, Eduardo; Winslow, Raimond L.; O'Rourke, Brian

    2003-01-01

    We present an integrated thermokinetic model describing control of cardiac mitochondrial bioenergetics. The model describes the tricarboxylic acid (TCA) cycle, oxidative phosphorylation, and mitochondrial Ca2+ handling. The kinetic component of the model includes effectors of the TCA cycle enzymes regulating production of NADH and FADH2, which in turn are used by the electron transport chain to establish a proton motive force (ΔμH), driving the F1F0-ATPase. In addition, mitochondrial matrix Ca2+, determined by Ca2+ uniporter and Na+/Ca2+ exchanger activities, regulates activity of the TCA cycle enzymes isocitrate dehydrogenase and α-ketoglutarate dehydrogenase. The model is described by twelve ordinary differential equations for the time rate of change of mitochondrial membrane potential (ΔΨm), and matrix concentrations of Ca2+, NADH, ADP, and TCA cycle intermediates. The model is used to predict the response of mitochondria to changes in substrate delivery, metabolic inhibition, the rate of adenine nucleotide exchange, and Ca2+. The model is able to reproduce, qualitatively and semiquantitatively, experimental data concerning mitochondrial bioenergetics, Ca2+ dynamics, and respiratory control. Significant increases in oxygen consumption (VO2), proton efflux, NADH, and ATP synthesis, in response to an increase in cytoplasmic Ca2+, are obtained when the Ca2+-sensitive dehydrogenases are the main rate-controlling steps of respiratory flux. These responses diminished when control is shifted downstream (e.g., the respiratory chain or adenine nucleotide translocator). The time-dependent behavior of the model, under conditions simulating an increase in workload, closely reproduces experimentally observed mitochondrial NADH dynamics in heart trabeculae subjected to changes in pacing frequency. The steady-state and time-dependent behavior of the model support the hypothesis that mitochondrial matrix Ca2+ plays an important role in matching energy supply with demand in

  15. Glial dysfunction in abstinent methamphetamine abusers

    PubMed Central

    Sailasuta, Napapon; Abulseoud, Osama; Harris, Kent C; Ross, Brian D

    2010-01-01

    Persistent neurochemical abnormalities in frontal brain structures are believed to result from methamphetamine use. We developed a localized 13C magnetic resonance spectroscopy (MRS) assay on a conventional MR scanner, to quantify selectively glial metabolic flux rate in frontal brain of normal subjects and a cohort of recovering abstinent methamphetamine abusers. Steady-state bicarbonate concentrations were similar, between 11 and 15 mmol/L in mixed gray-white matter of frontal brain of normal volunteers and recovering methamphetamine-abusing subjects (P>0.1). However, glial 13C-bicarbonate production rate from [1-13C]acetate, equating with glial tricarboxylic acid (TCA) cycle rate, was significantly reduced in frontal brain of abstinent methamphetamine-addicted women (methamphetamine 0.04 μmol/g per min (N=5) versus controls 0.11 μmol/g per min (N=5), P=0.001). This is equivalent to 36% of the normal glial TCA cycle rate. Severe reduction in glial TCA cycle rate that normally comprises 10% of total cerebral metabolic rate may impact operation of the neuronal glial glutamate cycle and result in accumulation of frontal brain glutamate, as observed in these recovering methamphetamine abusers. Although these are the first studies to define directly an abnormality in glial metabolism in human methamphetamine abuse, sequential studies using analogous 13C MRS methods may determine ‘cause and effect' between glial failure and neuronal injury. PMID:20040926

  16. High temperature stimulates acetic acid accumulation and enhances the growth inhibition and ethanol production by Saccharomyces cerevisiae under fermenting conditions.

    PubMed

    Woo, Ji-Min; Yang, Kyung-Mi; Kim, Sae-Um; Blank, Lars M; Park, Jin-Byung

    2014-07-01

    Cellular responses of Saccharomyces cerevisiae to high temperatures of up to 42 °C during ethanol fermentation at a high glucose concentration (i.e., 100 g/L) were investigated. Increased temperature correlated with stimulated glucose uptake to produce not only the thermal protectant glycerol but also ethanol and acetic acid. Carbon flux into the tricarboxylic acid (TCA) cycle correlated positively with cultivation temperature. These results indicate that the increased demand for energy (in the form of ATP), most likely caused by multiple stressors, including heat, acetic acid, and ethanol, was matched by both the fermentation and respiration pathways. Notably, acetic acid production was substantially stimulated compared to that of other metabolites during growth at increased temperature. The acetic acid produced in addition to ethanol seemed to subsequently result in adverse effects, leading to increased production of reactive oxygen species. This, in turn, appeared to cause the specific growth rate, and glucose uptake rate reduced leading to a decrease of the specific ethanol production rate far before glucose depletion. These results suggest that adverse effects from heat, acetic acid, ethanol, and oxidative stressors are synergistic, resulting in a decrease of the specific growth rate and ethanol production rate and, hence, are major determinants of cell stability and ethanol fermentation performance of S. cerevisiae at high temperatures. The results are discussed in the context of possible applications.

  17. Transcriptome and metabolome analyses of sugar and organic acid metabolism in Ponkan (Citrus reticulata) fruit during fruit maturation.

    PubMed

    Lin, Qiong; Wang, Chengyang; Dong, Wencheng; Jiang, Qing; Wang, Dengliang; Li, Shaojia; Chen, Ming; Liu, Chunrong; Sun, Chongde; Chen, Kunsong

    2015-01-01

    Ponkan (Citrus reticulata Blanco cv. Ponkan) is an important mandarin citrus in China. However, the low ratio of sugars to organic acids makes it less acceptable for consumers. In this work, three stages (S120, early development stage; S195, commercial harvest stage; S205, delayed harvest stage) of Ponkan fruit were selected for study. Among 28 primary metabolites analyzed in fruit, sugars increased while organic acids in general decreased. RNA-Seq analysis was carried out and 19,504 genes were matched to the Citrus clementina genome, with 85 up-regulated and 59 down-regulated genes identified during fruit maturation. A sucrose phosphate synthase (SPS) gene was included in the up-regulated group, and this was supported by the transcript ratio distribution. Expression of two asparagine transferases (AST), and a specific ATP-citrate lyase (ACL) and glutamate decarboxylase (GAD) members increased during fruit maturation. It is suggested that SPS, AST, ACL and GAD coordinately contribute to sugar accumulation and organic acid degradation during Ponkan fruit maturation. Both the glycolysis pathway and TCA cycle were accelerated during later maturation, indicating the flux change from sucrose metabolism to organic acid metabolism was enhanced, with citrate degradation occurring mainly through the gamma-aminobutyric acid (GABA) and acetyl-CoA pathways. Copyright © 2014 Elsevier B.V. All rights reserved.

  18. Effects of phosphoenolpyruvate carboxylase desensitization on glutamic acid production in Corynebacterium glutamicum ATCC 13032.

    PubMed

    Wada, Masaru; Sawada, Kazunori; Ogura, Kotaro; Shimono, Yuta; Hagiwara, Takuya; Sugimoto, Masakazu; Onuki, Akiko; Yokota, Atsushi

    2016-02-01

    Phosphoenolpyruvate carboxylase (PEPC) in Corynebacterium glutamicum ATCC13032, a glutamic-acid producing actinobacterium, is subject to feedback inhibition by metabolic intermediates such as aspartic acid and 2-oxoglutaric acid, which implies the importance of PEPC in replenishing oxaloacetic acid into the TCA cycle. Here, we investigated the effects of feedback-insensitive PEPC on glutamic acid production. A single amino-acid substitution in PEPC, D299N, was found to relieve the feedback control by aspartic acid, but not by 2-oxoglutaric acid. A simple mutant, strain R1, having the D299N substitution in PEPC was constructed from ATCC 13032 using the double-crossover chromosome replacement technique. Strain R1 produced glutamic acid at a concentration of 31.0 g/L from 100 g/L glucose in a jar fermentor culture under biotin-limited conditions, which was significantly higher than that of the parent, 26.0 g/L (1.19-fold), indicative of the positive effect of desensitized PEPC on glutamic acid production. Another mutant, strain DR1, having both desensitized PEPC and PYK-gene deleted mutations, was constructed in a similar manner using strain D1 with a PYK-gene deleted mutation as the parent. This mutation had been shown to enhance glutamic acid production in our previous study. Although marginal, strain D1 produced higher glutamic acid, 28.8 g/L, than ATCC13032 (1.11-fold). In contrast, glutamic acid production by strain DR-1 was elevated up to 36.9 g/L, which was 1.42-fold higher than ATCC13032 and significantly higher than the other three strains. The results showed a synergistic effect of these two mutations on glutamic acid production in C. glutamicum. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  19. Icotinib inhibits the invasion of Tca8113 cells via downregulation of nuclear factor κB-mediated matrix metalloproteinase expression

    PubMed Central

    YANG, CAILING; YAN, JIANGUO; YUAN, GUOYAN; ZHANG, YINGHUA; LU, DERONG; REN, MINGXIN; CUI, WEIGANG

    2014-01-01

    Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro. The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways. PMID:25120710

  20. Icotinib inhibits the invasion of Tca8113 cells via downregulation of nuclear factor κB-mediated matrix metalloproteinase expression.

    PubMed

    Yang, Cailing; Yan, Jianguo; Yuan, Guoyan; Zhang, Yinghua; Lu, Derong; Ren, Mingxin; Cui, Weigang

    2014-09-01

    Icotinib is an epidermal growth factor receptor tyrosine kinase inhibitor, which has been revealed to inhibit proliferation in tumor cells. However, the effect of icotinib on cancer cell metastasis remains to be explained. This study examines the effect of icotinib on the migration and invasion of squamous cells of tongue carcinoma (Tca8113 cells) in vitro . The results of the Boyden chamber invasion assay demonstrated that icotinib reduced cell invasion, suppressed the protein levels of matrix metalloproteinases (MMPs), MMP-2 and MMP-9, and increased the expression of tissue inhibitor of metalloproteinase-1. In addition, icotinib was found to significantly decrease the protein levels of nuclear factor κB (NF-κB) p65, which suggested that icotinib inhibits NF-κB activity. Furthermore, treatment with the NF-κB inhibitor, pyrrolidine dithiocarbamate, suppressed cell invasion and MMP-2 expression. These results suggested that icotinib inhibits the invasion of Tca8113 cells by downregulating MMP via the inactivation of the NF-κB signaling pathways.

  1. Duty cycle dependent chemical structure and wettability of RF pulsed plasma copolymers of acrylic acid and octafluorocyclobutane

    NASA Astrophysics Data System (ADS)

    Muzammil, I.; Li, Y. P.; Li, X. Y.; Lei, M. K.

    2018-04-01

    Octafluorocyclobutane and acrylic acid (C4F8-co-AA) plasma copolymer coatings are deposited using a pulsed wave (PW) radio frequency (RF) plasma on low density polyethylene (LDPE). The influence of duty cycle in pulsed process with the monomer feed rate on the surface chemistry and wettability of C4F8-co-AA plasma polymer coatings is studied. The concentration of the carboxylic acid (hydrophilic) groups increase, and that of fluorocarbon (hydrophobic) groups decrease by lowering the duty cycle. The combined effect of surface chemistry and surface morphology of the RF pulsed plasma copolymer coatings causes tunable surface wettability and surface adhesion. The gradual emergence of hydrophilic contents leads to surface heterogeneity by lowering duty cycle causing an increased surface adhesion in hydrophobic coatings. The C4F8-co-AA plasma polymer coatings on the nanotextured surfaces are tuned from repulsive superhydrophobicity to adhesive superhydrophobicity, and further to superhydrophilicity by adjusting the duty cycles with the monomer feed rates.

  2. Glucose enhances tilapia against Edwardsiella tarda infection through metabolome reprogramming.

    PubMed

    Zeng, Zao-hai; Du, Chao-Chao; Liu, Shi-Rao; Li, Hui; Peng, Xuan-Xian; Peng, Bo

    2017-02-01

    We have recently reported that the survival of tilapia, Oreochromis niloticus, during Edwardsiella tarda infection is tightly associated with their metabolome, where the survived O. niloticus has distinct metabolomic profile to dying O. niloticus. Glucose is the key metabolite to distinguish the survival- and dying-metabolome. More importantly, exogenous administration of glucose to the fish greatly enhances their survival for the infection, indicating the functional roles of glucose in metabolome repurposing, known as reprogramming metabolomics. However, the underlying information for the reprogramming is not yet available. Here, GC/MS based metabolomics is used to understand the mechanisms by which how exogenous glucose elevates O. niloticus, anti-infectious ability to E. tarda. Results showed that exogenous glucose promotes stearic acid and palmitic acid biosynthesis but attenuates TCA cycle to potentiate O. niloticus against bacterial infection, which is confirmed by the fact that exogenous stearic acid increases immune protection in O. niloticus against E. tarda infection in a manner of Mx protein. These results indicate that exogenous glucose reprograms O. niloticus anti-infective metabolome that characterizes elevation of stearic acid and palmitic acid and attenuation of the TCA cycle. Therefore, our results proposed a novel mechanism that glucose promotes unsaturated fatty acid biosynthesis to cope with infection, thereby highlighting a potential way of enhancing fish immunity in aquaculture. Copyright © 2016 Elsevier Ltd. All rights reserved.

  3. Collagen Matrix Density Drives the Metabolic Shift in Breast Cancer Cells.

    PubMed

    Morris, Brett A; Burkel, Brian; Ponik, Suzanne M; Fan, Jing; Condeelis, John S; Aguirre-Ghiso, Julio A; Castracane, James; Denu, John M; Keely, Patricia J

    2016-11-01

    Increased breast density attributed to collagen I deposition is associated with a 4-6 fold increased risk of developing breast cancer. Here, we assessed cellular metabolic reprogramming of mammary carcinoma cells in response to increased collagen matrix density using an in vitro 3D model. Our initial observations demonstrated changes in functional metabolism in both normal mammary epithelial cells and mammary carcinoma cells in response to changes in matrix density. Further, mammary carcinoma cells grown in high density collagen matrices displayed decreased oxygen consumption and glucose metabolism via the tricarboxylic acid (TCA) cycle compared to cells cultured in low density matrices. Despite decreased glucose entry into the TCA cycle, levels of glucose uptake, cell viability, and ROS were not different between high and low density matrices. Interestingly, under high density conditions the contribution of glutamine as a fuel source to drive the TCA cycle was significantly enhanced. These alterations in functional metabolism mirrored significant changes in the expression of metabolic genes involved in glycolysis, oxidative phosphorylation, and the serine synthesis pathway. This study highlights the broad importance of the collagen microenvironment to cellular expression profiles, and shows that changes in density of the collagen microenvironment can modulate metabolic shifts of cancer cells. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

  4. Configurable Crossbar Switch for Deterministic, Low-latency Inter-blade Communications in a MicroTCA Platform

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Karamooz, Saeed; Breeding, John Eric; Justice, T Alan

    As MicroTCA expands into applications beyond the telecommunications industry from which it originated, it faces new challenges in the area of inter-blade communications. The ability to achieve deterministic, low-latency communications between blades is critical to realizing a scalable architecture. In the past, legacy bus architectures accomplished inter-blade communications using dedicated parallel buses across the backplane. Because of limited fabric resources on its backplane, MicroTCA uses the carrier hub (MCH) for this purpose. Unfortunately, MCH products from commercial vendors are limited to standard bus protocols such as PCI Express, Serial Rapid IO and 10/40GbE. While these protocols have exceptional throughput capability,more » they are neither deterministic nor necessarily low-latency. To overcome this limitation, an MCH has been developed based on the Xilinx Virtex-7 690T FPGA. This MCH provides the system architect/developer complete flexibility in both the interface protocol and routing of information between blades. In this paper, we present the application of this configurable MCH concept to the Machine Protection System under development for the Spallation Neutron Sources's proton accelerator. Specifically, we demonstrate the use of the configurable MCH as a 12x4-lane crossbar switch using the Aurora protocol to achieve a deterministic, low-latency data link. In this configuration, the crossbar has an aggregate bandwidth of 48 GB/s.« less

  5. Activities of Tricarboxylic Acid Cycle Enzymes, Glyoxylate Cycle Enzymes, and Fructose Diphosphatase in Bakers' Yeast During Adaptation to Acetate Oxidation

    PubMed Central

    Gosling, J. P.; Duggan, P. F.

    1971-01-01

    Bakers' yeast oxidizes acetate at a high rate only after an adaptation period during which the capacity of the glyoxylate cycle is found to increase. There was apparently no necessity for the activity of acetyl-coenzyme A synthetase, the capacity of the tricarboxylic acid cycle, or the concentrations of the cytochromes to increase for this adaptation to occur. Elevation of fructose 1,6 diphosphatase occurred only when acetate oxidation was nearly maximal. Cycloheximide almost completely inhibited adaptation as well as increases in the activities of isocitrate lyase and aconitate hydratase, the only enzymes assayed. p-Fluorophenylalanine was partially effective and chloramphenicol did not inhibit at all. The presence of ammonium, which considerably delayed adaptation of the yeast to acetate oxidation, inhibited the increases in the activities of the glyoxylate cycle enzymes to different degrees, demonstrating noncoordinate control of these enzymes. Under the various conditions, the only enzyme activity increase consistently related to the rising oxygen uptake rate was that of isocitrate lyase which apparently limited the activity of the cycle. PMID:5557595

  6. Promysalin Elicits Species-Selective Inhibition of Pseudomonas aeruginosa by Targeting Succinate Dehydrogenase.

    PubMed

    Keohane, Colleen E; Steele, Andrew D; Fetzer, Christian; Khowsathit, Jittasak; Van Tyne, Daria; Moynié, Lucile; Gilmore, Michael S; Karanicolas, John; Sieber, Stephan A; Wuest, William M

    2018-02-07

    Natural products have served as an inspiration to scientists both for their complex three-dimensional architecture and exquisite biological activity. Promysalin is one such Pseudomonad secondary metabolite that exhibits narrow-spectrum antibacterial activity, originally isolated from the rhizosphere. We herein utilize affinity-based protein profiling (AfBPP) to identify succinate dehydrogenase (Sdh) as the biological target of the natural product. The target was further validated in silico, in vitro, in vivo, and through the selection, and sequencing, of a resistant mutant. Succinate dehydrogenase plays an essential role in primary metabolism of Pseudomonas aeruginosa as the only enzyme that is involved both in the tricarboxylic acid cycle (TCA) and in respiration via the electron transport chain. These findings add credence to other studies that suggest that the TCA cycle is an understudied target in the development of novel therapeutics to combat P. aeruginosa, a significant pathogen in clinical settings.

  7. [Metabolic flux analysis of L-serine synthesis by Corynebacterium glutamicum SYPS-062].

    PubMed

    Zhang, Xiaomei; Dou, Wenfang; Xu, Hongyu; Xu, Zhenghong

    2010-10-01

    Corynebacterium glutamicum SYPS-062 was an L-serine producing strain stored at our lab and could produce L-serine directly from sugar. We studied the effects of cofactors in one carbon unit metabolism-folate and VB12 on the cell growth, sucrose consumption and L-serine production by SYPS-062. In the same time, the metabolic flux distribution was determined in different conditions. The supplementation of folate or VB12 enhanced the cell growth, energy synthesis, and finally increased the flux of pentose phosphate pathway (HMP), whereas the carbon flux to L-serine was decreased. The addition of VB12 not only increased the ratio of L-serine synthesis pathway on G3P joint, but also caused the insufficiency of tricarboxylic acid cycle (TCA) flux, which needed more anaplerotic reaction flux to replenish TCA cycle, that was an important limiting factor for the further increasing of the L-serine productivity.

  8. Biosynthesis of Taxadiene in Saccharomyces cerevisiae : Selection of Geranylgeranyl Diphosphate Synthase Directed by a Computer-Aided Docking Strategy

    PubMed Central

    Li, Lin-feng; Zhai, Fang; Shang, Lu-qing; Yin, Zheng; Yuan, Ying-jin

    2014-01-01

    Identification of efficient key enzymes in biosynthesis pathway and optimization of the fitness between functional modules and chassis are important for improving the production of target compounds. In this study, the taxadiene biosynthesis pathway was firstly constructed in yeast by transforming ts gene and overexpressing erg20 and thmgr. Then, the catalytic capabilities of six different geranylgeranyl diphosphate synthases (GGPPS), the key enzyme in mevalonic acid (MVA) pathway catalyzing famesyl diphosphate (FPP) to geranylgeranyl diphosphate (GGPP), were predicted using enzyme-substrate docking strategy. GGPPSs from Taxus baccata x Taxus cuspidate (GGPPSbc), Erwinia herbicola (GGPPSeh), and S. cerevisiae (GGPPSsc) which ranked 1st, 4th and 6th in docking with FPP were selected for construction. The experimental results were consistent with the computer prediction that the engineered yeast with GGPPSbc exhibited the highest production. In addition, two chassis YSG50 and W303-1A were chosen, and the titer of taxadiene reached 72.8 mg/L in chassis YSG50 with GGPPSbc. Metabolomic study revealed that the contents of tricarboxylic acid cycle (TCA) intermediates and their precursor amino acids in chassis YSG50 was lower than those in W303-1A, indicating less carbon flux was divided into TCA cycle. Furthermore, the levels of TCA intermediates in the taxadiene producing yeasts were lower than those in chassis YSG50. Thus, it may result in more carbon flux in MVA pathway in chassis YSG50, which suggested that YSG50 was more suitable for engineering the taxadiene producing yeast. These results indicated that computer-aided protein modeling directed isoenzyme selection strategy and metabolomic study could guide the rational design of terpenes biosynthetic cells. PMID:25295588

  9. Activation and Repression of Epstein-Barr Virus and Kaposi's Sarcoma-Associated Herpesvirus Lytic Cycles by Short- and Medium-Chain Fatty Acids

    PubMed Central

    Gorres, Kelly L.; Daigle, Derek; Mohanram, Sudharshan

    2014-01-01

    ABSTRACT The lytic cycles of Epstein-Barr virus (EBV) and Kaposi's sarcoma-associated herpesvirus (KSHV) are induced in cell culture by sodium butyrate (NaB), a short-chain fatty acid (SCFA) histone deacetylase (HDAC) inhibitor. Valproic acid (VPA), another SCFA and an HDAC inhibitor, induces the lytic cycle of KSHV but blocks EBV lytic reactivation. To explore the hypothesis that structural differences between NaB and VPA account for their functional effects on the two related viruses, we investigated the capacity of 16 structurally related short- and medium-chain fatty acids to promote or prevent lytic cycle reactivation. SCFAs differentially affected EBV and KSHV reactivation. KSHV was reactivated by all SCFAs that are HDAC inhibitors, including phenylbutyrate. However, several fatty acid HDAC inhibitors, such as isobutyrate and phenylbutyrate, did not reactivate EBV. Reactivation of KSHV lytic transcripts could not be blocked completely by any fatty acid tested. In contrast, several medium-chain fatty acids inhibited lytic activation of EBV. Fatty acids that blocked EBV reactivation were more lipophilic than those that activated EBV. VPA blocked activation of the BZLF1 promoter by NaB but did not block the transcriptional function of ZEBRA. VPA also blocked activation of the DNA damage response that accompanies EBV lytic cycle activation. Properties of SCFAs in addition to their effects on chromatin are likely to explain activation or repression of EBV. We concluded that fatty acids stimulate the two related human gammaherpesviruses to enter the lytic cycle through different pathways. IMPORTANCE Lytic reactivation of EBV and KSHV is needed for persistence of these viruses and plays a role in carcinogenesis. Our direct comparison highlights the mechanistic differences in lytic reactivation between related human oncogenic gammaherpesviruses. Our findings have therapeutic implications, as fatty acids are found in the diet and produced by the human microbiota

  10. Transcriptome changes favoring intramuscular fat deposition in the longissimus muscle following castration of bulls.

    PubMed

    Jeong, J; Bong, J; Kim, G D; Joo, S T; Lee, H-J; Baik, M

    2013-10-01

    Castration increases intramuscular fat (IMF) deposition, improving beef quality in cattle. The present study was performed to determine the global transcriptome changes following castration of bulls and to identify genes associated with IMF deposition in the longissimus dorsi (LM) of Korean cattle. A customized bovine CombiMatrix oligonucleotide microarray was constructed, and transcriptome changes following castration were determined by microarray hybridization. Transcriptome comparison between bulls and steers indicated that 428 of 8,407 genes were differentially expressed in the LM by greater than two fold (P < 0.05). Gene expression profiling indicated alterations in several pathways, including adipogenesis, fatty acid oxidation, tricarboxylic acid (TCA) cycle, and oxidative phosphorylation (OP), following castration. Castration upregulated transcription of adipogenic perilipin 2 (PLIN2) and visfatin, lipogenic fatty acid synthase, fatty acid esterification 1-acylglycerol-3-phosphate O-acyltransferase 5, and many fatty acid oxidation-related genes. Many TCA cycle and OP genes were also transcriptionally upregulated. Correlation analysis indicated that the IMF content in the LM was highly correlated with mRNA levels of PLIN2 (r = 0.70, P < 0.001), adenosine triphosphatase (ATPase), H(+)-transporting, lysosomal 42 kDa, V1 subunit C1 (ATP6V1C1: r = 0.66, P < 0.001), and cytochrome c oxidase assembly homolog 11 (COX11: r = 0.72, P < 0.001) genes in a pooled animal group of steers plus bulls, and significant correlations in the steer-alone group were maintained in the 3 genes, PLIN2 (r = 0.47, P < 0.05), ATP6V1C1 (r = 0.50, P < 0.05), and COX11 (r = 0.60, P < 0.01). In conclusion, our study provided evidence that castration shifts transcription of lipid metabolism genes, favoring IMF deposition by increasing adipogenesis, lipogenesis, and triglyceride synthesis. This study also indicated that castration increases transcription of genes involved in fatty acid

  11. Production of D-lactic acid in a continuous membrane integrated fermentation reactor by genetically modified Saccharomyces cerevisiae: enhancement in D-lactic acid carbon yield.

    PubMed

    Mimitsuka, Takashi; Sawai, Kenji; Kobayashi, Koji; Tsukada, Takeshi; Takeuchi, Norihiro; Yamada, Katsushige; Ogino, Hiroyasu; Yonehara, Tetsu

    2015-01-01

    Poly d-lactic acid is an important polymer because it improves the thermostability of poly l-lactic acid by stereo complex formation. To demonstrate potency of continuous fermentation using a membrane-integrated fermentation reactor (MFR) system, continuous fermentation using genetically modified Saccharomyces cerevisiae which produces d-lactic acid was performed at the low pH and microaerobic conditions. d-Lactic acid continuous fermentation using the MFR system by genetically modified yeast increased production rate by 11-fold compared with batch fermentation. In addition, the carbon yield of d-lactic acid in continuous fermentation was improved to 74.6 ± 2.3% compared to 39.0 ± 1.7% with batch fermentation. This dramatic improvement in carbon yield could not be explained by a reduction in carbon consumption to form cells compared to batch fermentation. Further detailed analysis at batch fermentation revealed that the carbon yield increased to 76.8% at late stationary phase. S. cerevisiae, which exhibits the Crabtree-positive effect, demonstrated significant changes in metabolic activities at low sugar concentrations (Rossignol et al., Yeast, 20, 1369-1385, 2003). Moreover, lactate-producing S. cerevisiae requires ATP supplied not only from the glycolytic pathway but also from the TCA cycle (van Maris et al., Appl. Environ. Microbiol., 70, 2898-2905, 2004). Our finding was revealed that continuous fermentation, which can maintain the conditions of both a low sugar concentration and air supply, results in Crabtree-positive and lactate-producing S. cerevisiae for suitable conditions of d-lactic acid production with respect to redox balance and ATP generation because of releasing the yeast from the Crabtree effect. Copyright © 2014 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  12. Continuous and batch cultures of Escherichia coli KJ134 for succinic acid fermentation: metabolic flux distributions and production characteristics.

    PubMed

    van Heerden, Carel D; Nicol, Willie

    2013-09-17

    Succinic acid (SA) has become a prominent biobased platform chemical with global production quantities increasing annually. Numerous genetically modified E. coli strains have been developed with the main aim of increasing the SA yield of the organic carbon source. In this study, a promising SA-producing strain, E. coli KJ134 [Biotechnol. Bioeng. 101:881-893, 2008], from the Department of Microbiology and Cell Science of the University of Florida was evaluated under continuous and batch conditions using D-glucose and CO2 in a mineral salt medium. Production characteristics entailing growth and maintenance rates, growth termination points and metabolic flux distributions under growth and non-growth conditions were determined. The culture remained stable for weeks under continuous conditions. Under growth conditions the redox requirements of the reductive tricarboxylic acid (TCA) cycle was solely balanced by acetic acid (AcA) production via the pyruvate dehydrogenase route resulting in a molar ratio of SA:AcA of two. A maximum growth rate of 0.22 h(-1) was obtained, while complete growth inhibition occurred at a SA concentration of 18 g L(-1). Batch culture revealed that high-yield succinate production (via oxidative TCA or glyoxylate redox balancing) occurred under non-growth conditions where a SA:AcA molar ratio of up to five was attained, with a final SA yield of 0.94 g g(-1). Growth termination of the batch culture was in agreement with that of the continuous culture. The maximum maintenance production rate of SA under batch conditions was found to be 0.6 g g(-1) h(-1). This is twice the maintenance rate observed in the continuous runs. The study revealed that the metabolic flux of E. coli KJ134 differs significantly for growth and non-growth conditions, with non-growth conditions resulting in higher SA:AcA ratios and SA yields. Bioreaction characteristics entailing growth and maintenance rates, as well as growth termination markers will guide future fermentor

  13. Impact of Unusual Fatty Acid Synthesis on Futile Cycling through β-Oxidation and on Gene Expression in Transgenic Plants1[w

    PubMed Central

    Moire, Laurence; Rezzonico, Enea; Goepfert, Simon; Poirier, Yves

    2004-01-01

    Arabidopsis expressing the castor bean (Ricinus communis) oleate 12-hydroxylase or the Crepis palaestina linoleate 12-epoxygenase in developing seeds typically accumulate low levels of ricinoleic acid and vernolic acid, respectively. We have examined the presence of a futile cycle of fatty acid degradation in developing seeds using the synthesis of polyhydroxyalkanoate (PHA) from the intermediates of the peroxisomal β-oxidation cycle. Both the quantity and monomer composition of the PHA synthesized in transgenic plants expressing the 12-epoxygenase and 12-hydroxylase in developing seeds revealed the presence of a futile cycle of degradation of the corresponding unusual fatty acids, indicating a limitation in their stable integration into lipids. The expression profile of nearly 200 genes involved in fatty acid biosynthesis and degradation has been analyzed through microarray. No significant changes in gene expression have been detected as a consequence of the activity of the 12-epoxygenase or the 12-hydroxylase in developing siliques. Similar results have also been obtained for transgenic plants expressing the Cuphea lanceolata caproyl-acyl carrier protein thioesterase and accumulating high amounts of caproic acid. Only in developing siliques of the tag1 mutant, deficient in the accumulation of triacylglycerols and shown to have a substantial futile cycling of fatty acids toward β-oxidation, have some changes in gene expression been detected, notably the induction of the isocitrate lyase gene. These results indicate that analysis of peroxisomal PHA is a better indicator of the flux of fatty acid through β-oxidation than the expression profile of genes involved in lipid metabolism. PMID:14671017

  14. Activation of Constitutive Androstane Receptor (CAR) in Mice Results in Maintained Biliary Excretion of Bile Acids Despite a Marked Decrease of Bile Acids in Liver

    PubMed Central

    Lickteig, Andrew J.; Csanaky, Iván L.; Pratt-Hyatt, Matthew

    2016-01-01

    Activation of Constitutive Androstane Receptor (CAR) protects against bile acid (BA)-induced liver injury. This study was performed to determine the effect of CAR activation on bile flow, BA profile, as well as expression of BA synthesis and transport genes. Synthetic CAR ligand 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) was administered to mice for 4 days. BAs were quantified by UPLC-MS/MS (ultraperformance liquid chromatography-tandem mass spectrometry). CAR activation decreases total BAs in livers of male (49%) and female mice (26%), largely attributable to decreases of the 12α-hydroxylated BA taurocholic acid (T-CA) (males (M) 65%, females (F) 45%). Bile flow in both sexes was increased by CAR activation, and the increases were BA-independent. CAR activation did not alter biliary excretion of total BAs, but overall BA composition changed. Excretion of muricholic (6-hydroxylated) BAs was increased in males (101%), and the 12α-OH proportion of biliary BAs was decreased in both males (37%) and females (28%). The decrease of T-CA in livers of males and females correlates with the decreased mRNA of the sterol 12α-hydroxylase Cyp8b1 in males (71%) and females (54%). As a response to restore BAs to physiologic concentrations in liver, mRNA of Cyp7a1 is upregulated following TCPOBOP (males 185%, females 132%). In ilea, mRNA of the negative feedback regulator Fgf15 was unaltered by CAR activation, indicating biliary BA excretion was sufficient to maintain concentrations of total BAs in the small intestine. In summary, the effects of CAR activation on BAs in male and female mice are quite similar, with a marked decrease in the major BA T-CA in the liver. PMID:26984780

  15. Optimized Extraction Method To Remove Humic Acid Interferences from Soil Samples Prior to Microbial Proteome Measurements

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Qian, Chen; Hettich, Robert L.

    The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling, perhaps most specifically with respect to impact on plant growth but also more broadly to global impact on carbon and nitrogen-cycling. Liquid chromatography coupled to high performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to soil proteome extraction and subsequent MS measurement. To address some of the major issues, we have designed and optimized an experimental method to enhance microbialmore » proteome extraction concomitant with minimizing the soil-borne humic substances co-extraction from soils. Among the range of interferences, humic substances are often the worst in terms of adversely impacting proteome extraction and mass spectrometry measurement. Our approach employs an in-situ detergent-based microbial lysis / TCA precipitation coupled with an additional acidification precipitation step at the peptide level which efficiently removes humic acids. By combing filtration and pH adjustment of the final peptide solution, the remaining humic acids can be differentially precipitated and removed with a membrane filter, thereby leaving much cleaner proteolytic peptide samples for MS measurement. As a result, this modified method is a reliable and straight-forward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or reducing or biasing protein identification in mass spectrometry.« less

  16. Optimized Extraction Method To Remove Humic Acid Interferences from Soil Samples Prior to Microbial Proteome Measurements

    DOE PAGES

    Qian, Chen; Hettich, Robert L.

    2017-05-24

    The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling, perhaps most specifically with respect to impact on plant growth but also more broadly to global impact on carbon and nitrogen-cycling. Liquid chromatography coupled to high performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to soil proteome extraction and subsequent MS measurement. To address some of the major issues, we have designed and optimized an experimental method to enhance microbialmore » proteome extraction concomitant with minimizing the soil-borne humic substances co-extraction from soils. Among the range of interferences, humic substances are often the worst in terms of adversely impacting proteome extraction and mass spectrometry measurement. Our approach employs an in-situ detergent-based microbial lysis / TCA precipitation coupled with an additional acidification precipitation step at the peptide level which efficiently removes humic acids. By combing filtration and pH adjustment of the final peptide solution, the remaining humic acids can be differentially precipitated and removed with a membrane filter, thereby leaving much cleaner proteolytic peptide samples for MS measurement. As a result, this modified method is a reliable and straight-forward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or reducing or biasing protein identification in mass spectrometry.« less

  17. Pharmacokinetic analysis of trichloroethylene metabolism in male B6C3F1 mice: Formation and disposition of trichloroacetic acid, dichloroacetic acid, S-(1,2-dichlorovinyl)glutathione and S-(1,2-dichlorovinyl)-L-cysteine

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kim, Sungkyoon; Kim, David; Pollack, Gary M.

    2009-07-01

    Trichloroethylene (TCE) is a well-known carcinogen in rodents and concerns exist regarding its potential carcinogenicity in humans. Oxidative metabolites of TCE, such as dichloroacetic acid (DCA) and trichloroacetic acid (TCA), are thought to be hepatotoxic and carcinogenic in mice. The reactive products of glutathione conjugation, such as S-(1,2-dichlorovinyl)-L-cysteine (DCVC), and S-(1,2-dichlorovinyl) glutathione (DCVG), are associated with renal toxicity in rats. Recently, we developed a new analytical method for simultaneous assessment of these TCE metabolites in small-volume biological samples. Since important gaps remain in our understanding of the pharmacokinetics of TCE and its metabolites, we studied a time-course of DCA, TCA,more » DCVG and DCVG formation and elimination after a single oral dose of 2100 mg/kg TCE in male B6C3F1 mice. Based on systemic concentration-time data, we constructed multi-compartment models to explore the kinetic properties of the formation and disposition of TCE metabolites, as well as the source of DCA formation. We conclude that TCE-oxide is the most likely source of DCA. According to the best-fit model, bioavailability of oral TCE was {approx} 74%, and the half-life and clearance of each metabolite in the mouse were as follows: DCA: 0.6 h, 0.081 ml/h; TCA: 12 h, 3.80 ml/h; DCVG: 1.4 h, 16.8 ml/h; DCVC: 1.2 h, 176 ml/h. In B6C3F1 mice, oxidative metabolites are formed in much greater quantities ({approx} 3600 fold difference) than glutathione-conjugative metabolites. In addition, DCA is produced to a very limited extent relative to TCA, while most of DCVG is converted into DCVC. These pharmacokinetic studies provide insight into the kinetic properties of four key biomarkers of TCE toxicity in the mouse, representing novel information that can be used in risk assessment.« less

  18. Pharmacokinetic analysis of trichloroethylene metabolism in male B6C3F1 mice: Formation and disposition of trichloroacetic acid, dichloroacetic acid, S-(1,2-dichlorovinyl)glutathione and S-(1,2-dichlorovinyl)-L-cysteine

    PubMed Central

    Kim, Sungkyoon; Kim, David; Pollack, Gary M.; Collins, Leonard B.; Rusyn, Ivan

    2009-01-01

    Trichloroethylene (TCE) is a well-known carcinogen in rodents and concerns exist regarding its potential carcinogenicity in humans. Oxidative metabolites of TCE, such as dichloroacetic acid (DCA) and trichloroacetic acid (TCA), are thought to be hepatotoxic and carcinogenic in mice. The reactive products of glutathione conjugation, such as S-(1,2-dichlorovinyl)-L-cysteine (DCVC), and S-(1,2-dichlorovinyl) glutathione (DCVG), are associated with renal toxicity in rats. Recently, we developed a new analytical method for simultaneous assessment of these TCE metabolites in small-volume biological samples. Since important gaps remain in our understanding of the pharmacokinetics of TCE and its metabolites, we studied a time-course of DCA, TCA, DCVG and DCVG formation and elimination after a single oral dose of 2100 mg/kg TCE in male B6C3F1 mice. Based on systemic concentration-time data, we constructed multi-compartment models to explore the kinetic properties of the formation and disposition of TCE metabolites, as well as the source of DCA formation. We conclude that TCE-oxide is the most likely source of DCA. According to the best-fit model, bioavailability of oral TCE was ~74%, and the half-life and clearance of each metabolite in the mouse were as follows: DCA: 0.6 hr, 0.081 ml/hr; TCA: 12 hr, 3.80 ml/hr; DCVG: 1.4 hr, 16.8 ml/hr; DCVC: 1.2 hr, 176 ml/hr. In B6C3F1 mice, oxidative metabolites are formed in much greater quantities (~3600 fold difference) than glutathione-conjugative metabolites. In addition, DCA is produced to a very limited extent relative to TCA, while most of DCVG is converted into DCVC. These pharmacokinetic studies provide insight into the kinetic properties of four key biomarkers of TCE toxicity in the mouse, representing novel information that can be used in risk assessment. PMID:19409406

  19. Systemic Activin signaling independently regulates sugar homeostasis, cellular metabolism, and pH balance in Drosophila melanogaster

    PubMed Central

    Ghosh, Arpan C.; O’Connor, Michael B.

    2014-01-01

    The ability to maintain cellular and physiological metabolic homeostasis is key for the survival of multicellular organisms in changing environmental conditions. However, our understanding of extracellular signaling pathways that modulate metabolic processes remains limited. In this study we show that the Activin-like ligand Dawdle (Daw) is a major regulator of systemic metabolic homeostasis and cellular metabolism in Drosophila. We find that loss of canonical Smad signaling downstream of Daw leads to defects in sugar and systemic pH homeostasis. Although Daw regulates sugar homeostasis by positively influencing insulin release, we find that the effect of Daw on pH balance is independent of its role in insulin signaling and is caused by accumulation of organic acids that are primarily tricarboxylic acid (TCA) cycle intermediates. RNA sequencing reveals that a number of TCA cycle enzymes and nuclear-encoded mitochondrial genes including genes involved in oxidative phosphorylation and β-oxidation are up-regulated in the daw mutants, indicating either a direct or indirect role of Daw in regulating these genes. These findings establish Activin signaling as a major metabolic regulator and uncover a functional link between TGF-β signaling, insulin signaling, and metabolism in Drosophila. PMID:24706779

  20. Integrated metabolomic and proteomic analysis reveals systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress.

    PubMed

    Mujahid, Md; Prasuna, M Lakshmi; Sasikala, Ch; Ramana, Ch Venkata

    2015-02-06

    Aromatic amines are widely distributed in the environment and are major environmental pollutants. Although degradation of aromatic amines is well studied in bacteria, physiological adaptations and stress response to these toxic compounds is not yet fully understood. In the present study, systemic responses of Rubrivivax benzoatilyticus JA2 to aniline stress were deciphered using metabolite and iTRAQ-labeled protein profiling. Strain JA2 tolerated high concentrations of aniline (30 mM) with trace amounts of aniline being transformed to acetanilide. GC-MS metabolite profiling revealed aniline stress phenotype wherein amino acid, carbohydrate, fatty acid, nitrogen metabolisms, and TCA (tricarboxylic acid cycle) were modulated. Strain JA2 responded to aniline by remodeling the proteome, and cellular functions, such as signaling, transcription, translation, stress tolerance, transport and carbohydrate metabolism, were highly modulated. Key adaptive responses, such as transcription/translational changes, molecular chaperones to control protein folding, and efflux pumps implicated in solvent extrusion, were induced in response to aniline stress. Proteo-metabolomics indicated extensive rewiring of metabolism to aniline. TCA cycle and amino acid catabolism were down-regulated while gluconeogenesis and pentose phosphate pathways were up-regulated, leading to the synthesis of extracellular polymeric substances. Furthermore, increased saturated fatty acid ratios in membranes due to aniline stress suggest membrane adaptation. The present study thus indicates that strain JA2 employs multilayered responses: stress response, toxic compound tolerance, energy conservation, and metabolic rearrangements to aniline.

  1. Functionalization of carbon nanotubes with water-insoluble porphyrin in ionic liquid: direct electrochemistry and highly sensitive amperometric biosensing for trichloroacetic acid.

    PubMed

    Tu, Wenwen; Lei, Jianping; Ju, Huangxian

    2009-01-01

    A functional composite of single-walled carbon nanotubes (SWNTs) with hematin, a water-insoluble porphyrin, was first prepared in 1-butyl-3-methylimidazolium hexafluorophosphate ([BMIM][PF(6)]) ionic liquid. The novel composite in ionic liquid was characterized by scanning electron microscopy, ultraviolet absorption spectroscopy, and electrochemical impedance spectroscopy, and showed a pair of direct redox peaks of the Fe(III)/Fe(II) couple. The composite-[BMIM][PF(6)]-modified glassy carbon electrode showed excellent electrocatalytic activity toward the reduction of trichloroacetic acid (TCA) in neutral media due to the synergic effect among SWNTs, [BMIM][PF(6)], and porphyrin, which led to a highly sensitive and stable amperometric biosensor for TCA with a linear range from 9.0x10(-7) to 1.4x10(-4) M. The detection limit was 3.8x10(-7) M at a signal-to-noise ratio of 3. The TCA biosensor had good analytical performance, such as rapid response, good reproducibility, and acceptable accuracy, and could be successfully used for the detection of residual TCA in polluted water. The functional composite in ionic liquid provides a facile way to not only obtain the direct electrochemistry of water-insoluble porphyrin, but also construct novel biosensors for monitoring analytes in real environmental samples.

  2. Rates of insulin secretion in INS-1 cells are enhanced by coupling to anaplerosis and Kreb's cycle flux independent of ATP synthesis.

    PubMed

    Cline, Gary W; Pongratz, Rebecca L; Zhao, Xiaojian; Papas, Klearchos K

    2011-11-11

    Mechanistic models of glucose stimulated insulin secretion (GSIS) established in minimal media in vitro, may not accurately describe the complexity of coupling metabolism with insulin secretion that occurs in vivo. As a first approximation, we have evaluated metabolic pathways in a typical growth media, DMEM as a surrogate in vivo medium, for comparison to metabolic fluxes observed under the typical experimental conditions using the simple salt-buffer of KRB. Changes in metabolism in response to glucose and amino acids and coupling to insulin secretion were measured in INS-1 832/13 cells. Media effects on mitochondrial function and the coupling efficiency of oxidative phosphorylation were determined by fluorometrically measured oxygen consumption rates (OCRs) combined with (31)P NMR measured rates of ATP synthesis. Substrate preferences and pathways into the TCA cycle, and the synthesis of mitochondrial 2nd messengers by anaplerosis were determined by (13)C NMR isotopomer analysis of the fate of [U-(13)C] glucose metabolism. Despite similar incremental increases in insulin secretion, the changes of OCR in response to increasing glucose from 2.5 to 15mM were blunted in DMEM relative to KRB. Basal and stimulated rates of insulin secretion rates were consistently higher in DMEM, while ATP synthesis rates were identical in both DMEM and KRB, suggesting greater mitochondrial uncoupling in DMEM. The relative rates of anaplerosis, and hence synthesis and export of 2nd messengers from the mitochondria were found to be similar in DMEM to those in KRB. And, the correlation of total PC flux with insulin secretion rates in DMEM was found to be congruous with the correlation in KRB. Together, these results suggest that signaling mechanisms associated with both TCA cycle flux and with anaplerotic flux, but not ATP production, may be responsible for the enhanced rates of insulin secretion in more complex, and physiologically-relevant media. Copyright © 2011 Elsevier Inc. All

  3. Acetaminophen Toxicity and 5-Oxoproline (Pyroglutamic Acid): A Tale of Two Cycles, One an ATP-Depleting Futile Cycle and the Other a Useful Cycle

    PubMed Central

    2014-01-01

    Summary The acquired form of 5-oxoproline (pyroglutamic acid) metabolic acidosis was first described in 1989 and its relationship to chronic acetaminophen ingestion was proposed the next year. Since then, this cause of chronic anion gap metabolic acidosis has been increasingly recognized. Many cases go unrecognized because an assay for 5-oxoproline is not widely available. Most cases occur in malnourished, chronically ill women with a history of chronic acetaminophen ingestion. Acetaminophen levels are very rarely in the toxic range; rather, they are usually therapeutic or low. The disorder generally resolves with cessation of acetaminophen and administration of intravenous fluids. Methionine or N-acetyl cysteine may accelerate resolution and methionine is protective in a rodent model. The disorder has been attributed to glutathione depletion and activation of a key enzyme in the γ-glutamyl cycle. However, the specific metabolic derangements that cause the 5-oxoproline accumulation remain unclear. An ATP-depleting futile 5-oxoproline cycle can explain the accumulation of 5-oxoproline after chronic acetaminophen ingestion. This cycle is activated by the depletion of both glutathione and cysteine. This explanation contributes to our understanding of acetaminophen-induced 5-oxoproline metabolic acidosis and the beneficial role of N-acetyl cysteine therapy. The ATP-depleting futile 5-oxoproline cycle may also play a role in the energy depletions that occur in other acetaminophen-related toxic syndromes. PMID:24235282

  4. Acetaminophen toxicity and 5-oxoproline (pyroglutamic acid): a tale of two cycles, one an ATP-depleting futile cycle and the other a useful cycle.

    PubMed

    Emmett, Michael

    2014-01-01

    The acquired form of 5-oxoproline (pyroglutamic acid) metabolic acidosis was first described in 1989 and its relationship to chronic acetaminophen ingestion was proposed the next year. Since then, this cause of chronic anion gap metabolic acidosis has been increasingly recognized. Many cases go unrecognized because an assay for 5-oxoproline is not widely available. Most cases occur in malnourished, chronically ill women with a history of chronic acetaminophen ingestion. Acetaminophen levels are very rarely in the toxic range; rather, they are usually therapeutic or low. The disorder generally resolves with cessation of acetaminophen and administration of intravenous fluids. Methionine or N-acetyl cysteine may accelerate resolution and methionine is protective in a rodent model. The disorder has been attributed to glutathione depletion and activation of a key enzyme in the γ-glutamyl cycle. However, the specific metabolic derangements that cause the 5-oxoproline accumulation remain unclear. An ATP-depleting futile 5-oxoproline cycle can explain the accumulation of 5-oxoproline after chronic acetaminophen ingestion. This cycle is activated by the depletion of both glutathione and cysteine. This explanation contributes to our understanding of acetaminophen-induced 5-oxoproline metabolic acidosis and the beneficial role of N-acetyl cysteine therapy. The ATP-depleting futile 5-oxoproline cycle may also play a role in the energy depletions that occur in other acetaminophen-related toxic syndromes.

  5. The pentose phosphate pathway leads to enhanced succinic acid flux in biofilms of wild-type Actinobacillus succinogenes.

    PubMed

    Bradfield, Michael F A; Nicol, Willie

    2016-11-01

    Increased pentose phosphate pathway flux, relative to total substrate uptake flux, is shown to enhance succinic acid (SA) yields under continuous, non-growth conditions of Actinobacillus succinogenes biofilms. Separate fermentations of glucose and xylose were conducted in a custom, continuous biofilm reactor at four different dilution rates. Glucose-6-phosphate dehydrogenase assays were performed on cell extracts derived from in situ removal of biofilm at each steady state. The results of the assays were coupled to a kinetic model that revealed an increase in oxidative pentose phosphate pathway (OPPP) flux relative to total substrate flux with increasing SA titre, for both substrates. Furthermore, applying metabolite concentration data to metabolic flux models that include the OPPP revealed similar flux relationships to those observed in the experimental kinetic analysis. A relative increase in OPPP flux produces additional reduction power that enables increased flux through the reductive branch of the TCA cycle, leading to increased SA yields, reduced by-product formation and complete closure of the overall redox balance.

  6. Potential hepatic toxicity of buprofezin at sublethal concentrations: ROS-mediated conversion of energy metabolism.

    PubMed

    Ji, Xiaotong; Ku, Tingting; Zhu, Na; Ning, Xia; Wei, Wei; Li, Guangke; Sang, Nan

    2016-12-15

    Buprofezin is known for its broad-spectrum action and environmental safety. The popularity of buprofezin has raised concerns about its potentially adverse effects on human health and risk to the environment. In this study, we first identified the liver as one of the major organs in which buprofezin accumulated, and we detected a severe oxidative stress response. Next, we demonstrated that sublethal concentrations of buprofezin promoted the conversion of energy metabolism from the aerobic tricarboxylic acid (TCA) cycle and oxidative phosphorylation to anaerobic glycolysis. Importantly, reactive oxygen species (ROS) generation partially accounted for the shunting of the energy metabolism through the buprofezin-mediated inhibition of cytochrome c oxidase activity. ROS directly perturbed the activities of several key TCA cycle enzymes, stimulated glycolysis, and indirectly disturbed the activity of the respiratory chain complex by altering mitochondrial DNA (mtDNA). These findings clarify the potential mechanisms of buprofezin toxicity and provide biomarkers for buprofezin-mediated hepatotoxicity at sublethal concentrations. Copyright © 2016 Elsevier B.V. All rights reserved.

  7. In vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI): [3,4-(13)CH(2)]glutamate/glutamine tomography in rat brain.

    PubMed

    Hyder, F; Renken, R; Rothman, D L

    1999-12-01

    A method for in vivo carbon-edited detection with proton echo-planar spectroscopic imaging (ICED PEPSI) is described. This method is composed of an echo-planar based acquisition implemented with (13)C-(1)H J editing spectroscopy and is intended for high temporal and spatial resolution in vivo spectroscopic imaging of (13)C turnover, from D-[1,6-(13)C]glucose to glutamate and glutamine, in the brain. At a static magnetic field strength of 7 T, both in vitro and in vivo chemical shift imaging data are presented with a spatial resolution of 8 microL (i.e., 1.25 x 1.25 x 5.00 mm(3)) and a maximum spectral bandwidth of 5.2 ppm in (1)H. Chemical shift imaging data acquired every 11 minutes allowed detection of regional [4-(13)CH(2)]glutamate turnover in rat brain. The [4-(13)CH(2)]glutamate turnover curves, which can be converted to tricarboxylic acid cycle fluxes, showed that the tricarboxylic acid cycle flux (V(TCA)) in pure gray and white matter can range from 1.2 +/- 0.2 to 0.5 +/- 0.1 micromol/g/min, respectively, for morphine-anesthetized rats. The mean cortical V(TCA) from 32 voxels of 1.0 +/- 0.3 micromol/g/min (N = 3) is in excellent agreement with previous localized measurements that have demonstrated that V(TCA) can range from 0.9-1.1 micromol/g/min under identical anesthetized conditions. Magn Reson Med 42:997-1003, 1999. Copyright 1999 Wiley-Liss, Inc.

  8. Residual Tensile Property of Plain Woven Jute Fiber/Poly(Lactic Acid) Green Composites during Thermal Cycling

    PubMed Central

    Katogi, Hideaki; Takemura, Kenichi; Akiyama, Motoki

    2016-01-01

    This study investigated the residual tensile properties of plain woven jute fiber reinforced poly(lactic acid) (PLA) during thermal cycling. Temperature ranges of thermal cycling tests were 35–45 °C and 35–55 °C. The maximum number of cycles was 103 cycles. The quasi-static tensile tests of jute fiber, PLA, and composite were conducted after thermal cycling tests. Thermal mechanical analyses of jute fiber and PLA were conducted after thermal cycling tests. Results led to the following conclusions. For temperatures of 35–45 °C, tensile strength of composite at 103 cycles decreased 10% compared to that of composite at 0 cycles. For temperatures of 35–55 °C, tensile strength and Young’s modulus of composite at 103 cycles decreased 15% and 10%, respectively, compared to that of composite at 0 cycles. Tensile properties and the coefficient of linear expansion of PLA and jute fiber remained almost unchanged after thermal cycling tests. From observation of a fracture surface, the length of fiber pull out in the fracture surface of composite at 103 cycles was longer than that of composite at 0 cycles. Therefore, tensile properties of the composite during thermal cycling were decreased, probably because of the decrease of interfacial adhesion between the fiber and resin. PMID:28773694

  9. A Natural Light/Dark Cycle Regulation of Carbon-Nitrogen Metabolism and Gene Expression in Rice Shoots.

    PubMed

    Li, Haixing; Liang, Zhijun; Ding, Guangda; Shi, Lei; Xu, Fangsen; Cai, Hongmei

    2016-01-01

    Light and temperature are two particularly important environmental cues for plant survival. Carbon and nitrogen are two essential macronutrients required for plant growth and development, and cellular carbon and nitrogen metabolism must be tightly coordinated. In order to understand how the natural light/dark cycle regulates carbon and nitrogen metabolism in rice plants, we analyzed the photosynthesis, key carbon-nitrogen metabolites, and enzyme activities, and differentially expressed genes and miRNAs involved in the carbon and nitrogen metabolic pathway in rice shoots at the following times: 2:00, 6:00, 10:00, 14:00, 18:00, and 22:00. Our results indicated that more CO2 was fixed into carbohydrates by a high net photosynthetic rate, respiratory rate, and stomatal conductance in the daytime. Although high levels of the nitrate reductase activity, free ammonium and carbohydrates were exhibited in the daytime, the protein synthesis was not significantly facilitated by the light and temperature. In mRNA sequencing, the carbon and nitrogen metabolism-related differentially expressed genes were obtained, which could be divided into eight groups: photosynthesis, TCA cycle, sugar transport, sugar metabolism, nitrogen transport, nitrogen reduction, amino acid metabolism, and nitrogen regulation. Additionally, a total of 78,306 alternative splicing events have been identified, which primarily belong to alternative 5' donor sites, alternative 3' acceptor sites, intron retention, and exon skipping. In sRNA sequencing, four carbon and nitrogen metabolism-related miRNAs (osa-miR1440b, osa-miR2876-5p, osa-miR1877 and osa-miR5799) were determined to be regulated by natural light/dark cycle. The expression level analysis showed that the four carbon and nitrogen metabolism-related miRNAs negatively regulated their target genes. These results may provide a good strategy to study how natural light/dark cycle regulates carbon and nitrogen metabolism to ensure plant growth and

  10. Improved Proteomic Analysis Following Trichloroacetic Acid Extraction of Bacillus anthracis Spore Proteins

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Kaiser, Brooke LD; Wunschel, David S.; Sydor, Michael A.

    2015-08-07

    Proteomic analysis of bacterial samples provides valuable information about cellular responses and functions under different environmental pressures. Proteomic analysis is dependent upon efficient extraction of proteins from bacterial samples without introducing bias toward extraction of particular protein classes. While no single method can recover 100% of the bacterial proteins, selected protocols can improve overall protein isolation, peptide recovery, or enrich for certain classes of proteins. The method presented here is technically simple and does not require specialized equipment such as a mechanical disrupter. Our data reveal that for particularly challenging samples, such as B. anthracis Sterne spores, trichloroacetic acid extractionmore » improved the number of proteins identified within a sample compared to bead beating (714 vs 660, respectively). Further, TCA extraction enriched for 103 known spore specific proteins whereas bead beating resulted in 49 unique proteins. Analysis of C. botulinum samples grown to 5 days, composed of vegetative biomass and spores, showed a similar trend with improved protein yields and identification using our method compared to bead beating. Interestingly, easily lysed samples, such as B. anthracis vegetative cells, were equally as effectively processed via TCA and bead beating, but TCA extraction remains the easiest and most cost effective option. As with all assays, supplemental methods such as implementation of an alternative preparation method may provide additional insight to the protein biology of the bacteria being studied.« less

  11. Citral exerts its antifungal activity against Penicillium digitatum by affecting the mitochondrial morphology and function.

    PubMed

    Zheng, Shiju; Jing, Guoxing; Wang, Xiao; Ouyang, Qiuli; Jia, Lei; Tao, Nengguo

    2015-07-01

    This work investigated the effect of citral on the mitochondrial morphology and function of Penicillium digitatum. Citral at concentrations of 2.0 or 4.0 μL/mL strongly damaged mitochondria of test pathogen by causing the loss of matrix and increase of irregular mitochondria. The deformation extent of the mitochondria of P. digitatum enhanced with increasing concentrations of citral, as evidenced by a decrease in intracellular ATP content and an increase in extracellular ATP content of P. digitatum cells. Oxygen consumption showed that citral resulted in an inhibition in the tricarboxylic acid cycle (TCA) pathway of P. digitatum cells, induced a decrease in activities of citrate synthetase, isocitrate dehydrogenase, α-ketoglutarate dehydrogenase, succinodehydrogenase and the content of citric acid, while enhancing the activity of malic dehydrogenase in P. digitatum cells. Our present results indicated that citral could damage the mitochondrial membrane permeability and disrupt the TCA pathway of P. digitatum. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. Evaluation of different methods of protein extraction and identification of differentially expressed proteins upon ethylene-induced early-ripening in banana peels.

    PubMed

    Zhang, Li-Li; Feng, Ren-Jun; Zhang, Yin-Dong

    2012-08-15

    Banana peels (Musa spp.) are a good example of a plant tissue where protein extraction is challenging due to the abundance of interfering metabolites. Sample preparation is a critical step in proteomic research and is critical for good results. We sought to evaluate three methods of protein extraction: trichloroacetic acid (TCA)-acetone precipitation, phenol extraction, and TCA precipitation. We found that a modified phenol extraction protocol was the most optimal method. SDS-PAGE and two-dimensional gel electrophoresis (2-DE) demonstrated good protein separation and distinct spots of high quality protein. Approximately 300 and 550 protein spots were detected on 2-DE gels at pH values of 3-10 and 4-7, respectively. Several spots were excised from the 2-DE gels and identified by mass spectrometry. The protein spots identified were found to be involved in glycolysis, the tricarboxylic acid cycle, and the biosynthesis of ethylene. Several of the identified proteins may play important roles in banana ripening. Copyright © 2012 Society of Chemical Industry.

  13. Biotin deficiency inhibits heme synthesis and impairs mitochondria in human lung fibroblasts.

    PubMed

    Atamna, Hani; Newberry, Justin; Erlitzki, Ronit; Schultz, Carla S; Ames, Bruce N

    2007-01-01

    Four of the 5 biotin-dependent carboxylases (BDC) are in the mitochondria. BDC replace intermediates in the Krebs [tricarboxylic acid (TCA)] cycle that are regularly removed for the synthesis of key metabolites such as heme or amino acids. Heme, unlike amino acids, is not recycled to regenerate these intermediates, is not utilized from the diet, and must be synthesized in situ. We studied whether biotin deficiency (BD) lowers heme synthesis and whether mitochondria would be disrupted. Biotin-deficient medium was prepared by using bovine serum stripped of biotin with charcoal/dextran or avidin. Biotin-deficient primary human lung fibroblasts (IMR90) lost their BDC and senesced before biotin-sufficient cells. BD caused heme deficiency; there was a decrease in heme content and heme synthesis, and biotin-deficient cells selectively lost mitochondrial complex IV, which contains heme-a. Loss of complex IV, which is part of the electron transport chain, triggered oxidant release and oxidative damage, hallmarks of heme deficiency. Restoring biotin to the biotin-deficient medium prevented the above changes. Old cells were more susceptible to biotin shortage than young cells. These findings highlight the biochemical connection among biotin, heme, and iron metabolism, and the mitochondria, due to the role of biotin in maintaining the biochemical integrity of the TCA cycle. The findings are discussed in relation to aging and birth defects in humans.

  14. Brain mitochondrial metabolic dysfunction and glutamate level reduction in the pilocarpine model of temporal lobe epilepsy in mice

    PubMed Central

    Smeland, Olav B; Hadera, Mussie G; McDonald, Tanya S; Sonnewald, Ursula; Borges, Karin

    2013-01-01

    Although certain metabolic characteristics such as interictal glucose hypometabolism are well established for temporal lobe epilepsy (TLE), its pathogenesis still remains unclear. Here, we performed a comprehensive study of brain metabolism in a mouse model of TLE, induced by pilocarpine–status epilepticus (SE). To investigate glucose metabolism, we injected mice 3.5–4 weeks after SE with [1,2-13C]glucose before microwave fixation of the head. Using 1H and 13C nuclear magnetic resonance spectroscopy, gas chromatography—mass spectrometry and high-pressure liquid chromatography, we quantified metabolites and 13C labeling in extracts of cortex and hippocampal formation (HF). Hippocampal levels of glutamate, glutathione and alanine were decreased in pilocarpine–SE mice compared with controls. Moreover, the contents of N-acetyl aspartate, succinate and reduced nicotinamide adenine dinucleotide (phosphate) NAD(P)H were decreased in HF indicating impairment of mitochondrial function. In addition, the reduction in 13C enrichment of hippocampal citrate and malate suggests decreased tricarboxylic acid (TCA) cycle turnover in this region. In cortex, we found reduced 13C labeling of glutamate, glutamine and aspartate via the pyruvate carboxylation and pyruvate dehydrogenation pathways, suggesting slower turnover of these amino acids and/or the TCA cycle. In conclusion, mitochondrial metabolic dysfunction and altered amino-acid metabolism is found in both cortex and HF in this epilepsy model. PMID:23611869

  15. Systems responses of rats to aflatoxin B1 exposure revealed with metabonomic changes in multiple biological matrices.

    PubMed

    Zhang, Limin; Ye, Yangfang; An, Yanpeng; Tian, Yuan; Wang, Yulan; Tang, Huiru

    2011-02-04

    Exposure to aflatoxins causes liver fibrosis and hepatocellular carcinoma posing a significant health risk for human populations and livestock. To understand the mammalian systems responses to aflatoxin-B1 (AFB1) exposure, we analyzed the AFB1-induced metabonomic changes in multiple biological matrices (plasma, urine, and liver) of rats using (1)H NMR spectroscopy together with clinical biochemistry and histopathologic assessments. We found that AFB1 exposure caused significant elevation of glucose, amino acids, and choline metabolites (choline, phosphocholine, and glycerophosphocholine) in plasma but reduction of plasma lipids. AFB1 also induced elevation of liver lipids, amino acids (tyrosine, histidine, phenylalanine, leucine, isoleucine, and valine), choline, and nucleic acid metabolites (inosine, adenosine, and uridine) together with reduction of hepatic glycogen and glucose. AFB1 further caused decreases in urinary TCA cycle intermediates (2-oxoglutarate and citrate) and elevation of gut microbiota cometabolites (phenylacetylglycine and hippurate). These indicated that AFB1 exposure caused hepatic steatosis accompanied with widespread metabolic changes including lipid and cell membrane metabolisms, protein biosynthesis, glycolysis, TCA cycle, and gut microbiota functions. This implied that AFB1 exposure probably caused oxidative-stress-mediated impairments of mitochondria functions. These findings provide an overview of biochemical consequences of AFB1 exposure and comprehensive insights into the metabolic aspects of AFB1-induced hepatotoxicity in rats.

  16. The γ-Glutamyl Cycle in the Choroid Plexus: Its Possible Function in Amino Acid Transport

    PubMed Central

    Tate, Suresh S.; Ross, Leonard L.; Meister, Alton

    1973-01-01

    Various anatomic regions of rabbit brain have been examined for activities of the enzymes of the γ-glutamyl cycle. While these enzyme activities were widely distributed in the brain, they are present in much higher concentrations in the choroid plexus than in other parts of the brain. The activities observed are of about the same order of magnitude as found in the kidney. These observations and other considerations suggest that the γ-glutamyl cycle may play a significant role in the transport of amino acids between blood and cerebrospinal fluid. PMID:4145786

  17. Not all boronic acids with a five-membered cycle induce tremor, neuronal damage and decreased dopamine.

    PubMed

    Pérez-Rodríguez, Maribel; García-Mendoza, Esperanza; Farfán-García, Eunice D; Das, Bhaskar C; Ciprés-Flores, Fabiola J; Trujillo-Ferrara, José G; Tamay-Cach, Feliciano; Soriano-Ursúa, Marvin A

    2017-09-01

    Several striatal toxins can be used to induce motor disruption. One example is MPTP (1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine), whose toxicity is accepted as a murine model of parkinsonism. Recently, 3-Thienylboronic acid (3TB) was found to produce motor disruption and biased neuronal damage to basal ganglia in mice. The aim of this study was to examine the toxic effects of four boronic acids with a close structural relationship to 3TB (all having a five-membered cycle), as well as boric acid and 3TB. These boron-containing compounds were compared to MPTP regarding brain access, morphological disruption of the CNS, and behavioral manifestations of such disruption. Data was collected through acute toxicity evaluations, motor behavior tests, necropsies, determination of neuronal survival by immunohistochemistry, Raman spectroscopic analysis of brain tissue, and HPLC measurement of dopamine in substantia nigra and striatum tissue. Each compound showed a distinct profile for motor disruption. For example, motor activity was not disrupted by boric acid, but was decreased by two boronic acids (caused by a sedative effect). 3TB, 2-Thienyl and 2-furanyl boronic acid gave rise to shaking behavior. The various manifestations generated by these compounds can be linked, in part, to different levels of dopamine (measured by HPLC) and degrees of neuronal damage in the basal ganglia and cerebellum. Clearly, motor disruption is not induced by all boronic acids with a five-membered cycle as substituent. Possible explanations are given for the diverse chemico-morphological changes and degrees of disruption of the motor system, considering the role of boron and the structure-toxicity relationship. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Sulfur alleviates arsenic toxicity by reducing its accumulation and modulating proteome, amino acids and thiol metabolism in rice leaves

    NASA Astrophysics Data System (ADS)

    Dixit, Garima; Singh, Amit Pal; Kumar, Amit; Dwivedi, Sanjay; Deeba, Farah; Kumar, Smita; Suman, Shankar; Adhikari, Bijan; Shukla, Yogeshwar; Trivedi, Prabodh Kumar; Pandey, Vivek; Tripathi, Rudra Deo

    2015-11-01

    Arsenic (As) contamination of water is a global concern and rice consumption is the biggest dietary exposure to human posing carcinogenic risks, predominantly in Asia. Sulfur (S) is involved in di-sulfide linkage in many proteins and plays crucial role in As detoxification. Present study explores role of variable S supply on rice leaf proteome, its inclination towards amino acids (AA) profile and non protein thiols under arsenite exposure. Analysis of 282 detected proteins on 2-DE gel revealed 113 differentially expressed proteins, out of which 80 were identified by MALDI-TOF-TOF. The identified proteins were mostly involved in glycolysis, TCA cycle, AA biosynthesis, photosynthesis, protein metabolism, stress and energy metabolism. Among these, glycolytic enzymes play a major role in AA biosynthesis that leads to change in AAs profiling. Proteins of glycolytic pathway, photosynthesis and energy metabolism were also validated by western blot analysis. Conclusively S supplementation reduced the As accumulation in shoot positively skewed thiol metabolism and glycolysis towards AA accumulation under AsIII stress.

  19. [Research of conjugated bile acids in gallbladder bile of patients with polypoid lesions of gallbladder].

    PubMed

    Ge, Chunlin; Sun, Tao; Meng, Jingjuan; Wang, Kun; Huang, Peng

    2014-02-01

    To investigate the difference in conjugated bile acids in the gallbladder bile between gallbladder cholesterol polyps and adenomatous polyps patients, and screen the differential diagnosis-markers for polypoid lesions of gallbladder (PLG). From January to June 2013, the 20 cholesterol polyps patients, 10 adenomatous polyps patients and 10 patients without gallbladder diseases were enrolled. High performance liquid chromatography assay with ultraviolet detection was used to test 8 conjugated bile acids in gallbladder bile. The 8 conjugated bile acids were completely analyzed in 10 minutes, and the assay was liner in the range 8-500 µg/ml. The correlation coeffients for linear regression was from 0.9996-0.9999 and the detection limits ranged from 3.90-7.81 µg/ml. The level of taurocholic acid (TCA) in adenomatous polyps group ((75 ± 51) µg/ml) was significantly lower than that in the cholesterol polyps ((228 ± 206) µg/ml, q = 3.120, P = 0.014) and control groups ((104 ± 40) µg/ml, q = 2.950, P = 0.027). The level of taurochenodeoxycholic acid (TCDCA) in cholesterol polyps group ((604 ± 444) µg/ml) was significantly higher than that in the adenomatous polyps ((310 ± 182) µg/ml, q = 2.560, P = 0.048) and control groups ((308 ± 21) µg/ml, q = 2.970, P = 0.023). The levels of TCA and TCDCA in the gallbladder biles in cholesterol polyps patients were higher than those in adenomatous polyps patients, which may be the differential diagnosis-markers for PLG.

  20. Different effects of ursodeoxycholic acid on intrahepatic cholestasis in acute and recovery stages induced by alpha-naphthylisothiocyanate in mice.

    PubMed

    Zhang, Linlin; Su, Huizong; Li, Yue; Fan, Yujuan; Wang, Qian; Jiang, Jian; Hu, Yiyang; Chen, Gaofeng; Tan, Bo; Qiu, Furong

    2018-03-01

    The aim of this study was to determine the effect of ursodeoxycholic acid (UDCA) on the alpha-naphthylisothiocyanate (ANIT)-induced acute and recovery stage of cholestasis model mice. In the acute stage of model mice, pretreatment with UDCA (25, 50, and 100 mg·kg -1 , ig) for 12 days prior to ANIT administration (50 mg·kg -1 , ig) resulted in the dramatic increase in serum biochemistry, with aggrevation of bile infarcts and hepatocyte necrosis. The elevation of beta-muricholic acid (β-MCA), cholic acid (CA), and taurocholic acid (TCA) in serum and liver, and reduction of these bile acids (BAs) in bile was observed. In contrast, in the recovery stage of model mice, treatment with UDCA (25, 50, and 100 mg·kg -1 , ig) for 7 days after ANIT administration (50 mg·kg -1 , ig) resulted in the significant decrease in levels of serum alanine aminotransferase (ALT) and total bile acid (TBA). Liver injury was attenuated, and the levels of TBA, CA, TCA, and β-MCA in the liver were significantly decreased. Additionally, UDCA can upregulate expression of BSEP, but it cannot upregulate expression of AE2. UDCA, which induced BSEP to increase bile acid-dependent bile flow, aggravated cholestasis and liver injury when the bile duct was obstructed in the acute stage of injury in model mice. In contrast, UDCA alleviated cholestasis and liver injury induced by ANIT when the obstruction was improved in the recovery stage. Copyright © 2018. Published by Elsevier Inc.

  1. Deep peeling using phenol versus percutaneous collagen induction combined with trichloroacetic acid 20% in atrophic post-acne scars; a randomized controlled trial.

    PubMed

    Leheta, Tahra Mohamed; Abdel Hay, Rania Mounir; El Garem, Yehia Farouk

    2014-04-01

    Deep peeling using phenol and percutaneous collagen induction (PCI) are used in treating acne scars. To compare deep peeling using phenol and PCI combined with trichloroacetic acid (TCA) 20% in treating atrophic acne scars. 24 patients with post-acne atrophic scars were randomly divided into two groups; group 1 was subjected to one session of deep peeling using phenol, and group 2 was subjected to four sessions of PCI combined with TCA 20%. As a secondary outcome measure, side effects were recorded and patients were asked to assess their % of improvement by a questionnaire completed 8 months after the procedure. Scar severity scores improved by a mean of 75.12% (p < 0.001) in group 1 and a mean of 69.43% (p < 0.001) in group 2. Comparing the degree of improvement in different types of scars, within the same group after treatment, revealed a significant highest degree of improvement in the rolling type (p = 0.005) in group 2. Deep peeling using phenol and PCI with TCA 20% were effective in treating post-acne atrophic scars.

  2. Acetobacter pasteurianus metabolic change induced by initial acetic acid to adapt to acetic acid fermentation conditions.

    PubMed

    Zheng, Yu; Zhang, Renkuan; Yin, Haisong; Bai, Xiaolei; Chang, Yangang; Xia, Menglei; Wang, Min

    2017-09-01

    Initial acetic acid can improve the ethanol oxidation rate of acetic acid bacteria for acetic acid fermentation. In this work, Acetobacter pasteurianus was cultured in ethanol-free medium, and energy production was found to increase by 150% through glucose consumption induced by initial acetic acid. However, oxidation of ethanol, instead of glucose, became the main energy production pathway when upon culturing ethanol containing medium. Proteome assay was used to analyze the metabolism change induced by initial acetic acid, which provided insight into carbon metabolic and energy regulation of A. pasteurianus to adapt to acetic acid fermentation conditions. Results were further confirmed by quantitative real-time PCR. In summary, decreased intracellular ATP as a result of initial acetic acid inhibition improved the energy metabolism to produce more energy and thus adapt to the acetic acid fermentation conditions. A. pasteurianus upregulated the expression of enzymes related to TCA and ethanol oxidation to improve the energy metabolism pathway upon the addition of initial acetic acid. However, enzymes involved in the pentose phosphate pathway, the main pathway of glucose metabolism, were downregulated to induce a change in carbon metabolism. Additionally, the enhancement of alcohol dehydrogenase expression promoted ethanol oxidation and strengthened the acetification rate, thereby producing a strong proton motive force that was necessary for energy production and cell tolerance to acetic acid.

  3. Microneedling combined with platelet-rich plasma or trichloroacetic acid peeling for management of acne scarring: A split-face clinical and histologic comparison.

    PubMed

    El-Domyati, Moetaz; Abdel-Wahab, Hossam; Hossam, Aliaa

    2018-02-01

    Minimally invasive procedures provide effective, safe, relatively long-lasting, and natural results without large damage to the skin. A combination treatment is considered an approach that includes at least 2 different and unrelated modalities. This study aims to evaluate the use and effectiveness of some combined minimally invasive procedures for management of acne scarring. Twenty-four volunteers with postacne atrophic scars were randomly divided into 3 equal groups according to performed procedure on each side of the face (microneedling by dermaroller alone or combined with platelet-rich plasma [PRP] or trichloroacetic acid [TCA] 15% peeling) and received 6 bi-weekly sessions of treatment. Photography and punch biopsies were taken before and after 3 months of treatment for clinical, histological, and histometrical evaluation. Combined treatment of dermaroller and PRP or dermaroller and TCA 15% showed significant improvement when compared with dermaroller alone (P = .015 and .011 respectively). Epidermal thickness showed statistically significant increase in studied groups, mainly after dermaroller and TCA 15%. Moreover, the 3 studied groups showed more organized collagen bundles and newly formed collagen formation and markedly decreased abnormal elastic fibers. Based on the clinical, histometrical, and histochemical assessment, inspite that most volunteers showed significant improvement after treatment, however, the combined use of dermaroller and TCA 15% was more effective in postacne atrophic scars than the use of dermaroller and PRP or dermaroller only. © 2017 Wiley Periodicals, Inc.

  4. Effect on combined cycle efficiency of stack gas temperature constraints to avoid acid corrosion

    NASA Technical Reports Server (NTRS)

    Nainiger, J. J.

    1980-01-01

    To avoid condensation of sulfuric acid in the gas turbine exhaust when burning fuel oils contaning sulfur, the exhaust stack temperature and cold-end heat exchanger surfaces must be kept above the condensation temperature. Raising the exhaust stack temperature, however, results in lower combined cycle efficiency compared to that achievable by a combined cycle burning a sulfur-free fuel. The maximum difference in efficiency between the use of sulfur-free and fuels containing 0.8 percent sulfur is found to be less than one percentage point. The effect of using a ceramic thermal barrier coating (TBC) and a fuel containing sulfur is also evaluated. The combined-cycle efficiency gain using a TBC with a fuel containing sulfur compared to a sulfur-free fuel without TBC is 0.6 to 1.0 percentage points with air-cooled gas turbines and 1.6 to 1.8 percentage points with water-cooled gas turbines.

  5. Dislocation Density Reduction in Cadmium Telluride and Mercury Cadmium Telluride Grown on Silicon Using Thermal Cycle Annealing

    NASA Astrophysics Data System (ADS)

    Farrell, Stuart Bennett

    Mercury Cadmium Telluride (HgCdTe) is a material of great importance for infrared focal plane array applications. In order to produce large format detector arrays this material needs to be grown on a large area substrate, with silicon being the most mature substrate, it is the optimal choice for large format arrays. To help mitigate the effect of the lattice mismatch between the two materials, cadmium telluride (CdTe) is used as a buffer layer. The CdTe itself has nearly the same lattice mismatch (19.3%) to silicon, but due to the technological advantages it offers and compatibility with HgCdTe, it is the best buffer layer choice. The lattice mismatch between HgCdTe/CdTe and the silicon substrate leads to the formation of dislocations at densities in the mid 106 to low 107 cm-2 range in the epilayers. Such a high dislocation density greatly effects detector device performance quantities such as operability and sensitivity. Hence, the dislocation density should be brought down by at least an order of magnitude by adopting novel in situ and ex situ material processing techniques. In this work, in situ and ex situ thermal cycle annealing (TCA) methods have been used to decrease dislocation density in CdTe and HgCdTe. During the molecular beam epitaxial (MBE) growth of the CdTe buffer layer, the growth was interrupted and the layer was subjected to an annealing cycle within the growth chamber under tellurium overpressure. During the annealing cycle the temperature is raised to beyond the growth temperature (290 → 550 °C) and then allowed to cool before resuming growth again. This process was repeated several times during the growth. After growth, a portion of the material was subjected to a dislocation decoration etch in order to count the etch pit density (EPD) which has a direct correspondence with the dislocation density in the crystal. The crystalline quality was also characterized by x-ray diffraction rocking curves and photoluminescence. The in situ TCA

  6. Sodium Phenylbutyrate Decreases Plasma Branched-Chain Amino Acids in Patients with Urea Cycle Disorders

    PubMed Central

    Burrage, Lindsay C.; Jain, Mahim; Gandolfo, Laura; Lee, Brendan H.; Nagamani, Sandesh CS.

    2014-01-01

    Sodium phenylbutyrate (NaPBA) is a commonly used medication for the treatment of patients with urea cycle disorders (UCDs). Previous reports involving small numbers of patients with UCDs have shown that NaPBA treatment can result in lower plasma levels of the branched-chain amino acids (BCAA) but this has not been studied systematically. From a large cohort of patients (n=553) with UCDs enrolled in Longitudinal Study of Urea Cycle Disorders, a collaborative multicenter study of the Urea Cycle Disorders Consortium, we evaluated whether treatment with NaPBA leads to a decrease in plasma BCAA levels. Our analysis shows that NaPBA use independently affects the plasma BCAA levels even after accounting for multiple confounding covariates. Moreover, NaPBA use increases the risk for BCAA deficiency. This effect of NaPBA seems specific to plasma BCAA levels, as levels of other essential amino acids are not altered by its use. Our study, in an unselected population of UCD subjects, is the largest to analyze the effects of NaPBA on BCAA metabolism and potentially has significant clinical implications. Our results indicate that plasma BCAA levels should to be monitored in patients treated with NaPBA since patients taking the medication are at increased risk for BCAA deficiency. On a broader scale, they could open avenues to explore NaPBA as a therapy in maple syrup urine disease and other common complex disorders with dysregulation of BCAA metabolism. PMID:25042691

  7. Activation of Constitutive Androstane Receptor (CAR) in Mice Results in Maintained Biliary Excretion of Bile Acids Despite a Marked Decrease of Bile Acids in Liver.

    PubMed

    Lickteig, Andrew J; Csanaky, Iván L; Pratt-Hyatt, Matthew; Klaassen, Curtis D

    2016-06-01

    Activation of Constitutive Androstane Receptor (CAR) protects against bile acid (BA)-induced liver injury. This study was performed to determine the effect of CAR activation on bile flow, BA profile, as well as expression of BA synthesis and transport genes. Synthetic CAR ligand 1,4-bis-[2-(3,5-dichloropyridyloxy)]benzene (TCPOBOP) was administered to mice for 4 days. BAs were quantified by UPLC-MS/MS (ultraperformance liquid chromatography-tandem mass spectrometry). CAR activation decreases total BAs in livers of male (49%) and female mice (26%), largely attributable to decreases of the 12α-hydroxylated BA taurocholic acid (T-CA) (males (M) 65%, females (F) 45%). Bile flow in both sexes was increased by CAR activation, and the increases were BA-independent. CAR activation did not alter biliary excretion of total BAs, but overall BA composition changed. Excretion of muricholic (6-hydroxylated) BAs was increased in males (101%), and the 12α-OH proportion of biliary BAs was decreased in both males (37%) and females (28%). The decrease of T-CA in livers of males and females correlates with the decreased mRNA of the sterol 12α-hydroxylase Cyp8b1 in males (71%) and females (54%). As a response to restore BAs to physiologic concentrations in liver, mRNA of Cyp7a1 is upregulated following TCPOBOP (males 185%, females 132%). In ilea, mRNA of the negative feedback regulator Fgf15 was unaltered by CAR activation, indicating biliary BA excretion was sufficient to maintain concentrations of total BAs in the small intestine. In summary, the effects of CAR activation on BAs in male and female mice are quite similar, with a marked decrease in the major BA T-CA in the liver. © The Author 2016. Published by Oxford University Press on behalf of the Society of Toxicology. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  8. Unsuspected task for an old team: succinate, fumarate and other Krebs cycle acids in metabolic remodeling.

    PubMed

    Bénit, Paule; Letouzé, Eric; Rak, Malgorzata; Aubry, Laetitia; Burnichon, Nelly; Favier, Judith; Gimenez-Roqueplo, Anne-Paule; Rustin, Pierre

    2014-08-01

    Seventy years from the formalization of the Krebs cycle as the central metabolic turntable sustaining the cell respiratory process, key functions of several of its intermediates, especially succinate and fumarate, have been recently uncovered. The presumably immutable organization of the cycle has been challenged by a number of observations, and the variable subcellular location of a number of its constitutive protein components is now well recognized, although yet unexplained. Nonetheless, the most striking observations have been made in the recent period while investigating human diseases, especially a set of specific cancers, revealing the crucial role of Krebs cycle intermediates as factors affecting genes methylation and thus cell remodeling. We review here the recent advances and persisting incognita about the role of Krebs cycle acids in diverse aspects of cellular life and human pathology. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Metabolomics approach reveals metabolic disorders and potential biomarkers associated with the developmental toxicity of tetrabromobisphenol A and tetrachlorobisphenol A

    NASA Astrophysics Data System (ADS)

    Ye, Guozhu; Chen, Yajie; Wang, Hong-Ou; Ye, Ting; Lin, Yi; Huang, Qiansheng; Chi, Yulang; Dong, Sijun

    2016-10-01

    Tetrabromobisphenol A and tetrachlorobisphenol A are halogenated bisphenol A (H-BPA), and has raised concerns about their adverse effects on the development of fetuses and infants, however, the molecular mechanisms are unclear, and related metabolomics studies are limited. Accordingly, a metabolomics study based on gas chromatography-mass spectrometry was employed to elucidate the molecular developmental toxicology of H-BPA using the marine medaka (Oryzias melastigmas) embryo model. Here, we revealed decreased synthesis of nucleosides, amino acids and lipids, and disruptions in the TCA (tricarboxylic acid) cycle, glycolysis and lipid metabolism, thus inhibiting the developmental processes of embryos exposed to H-BPA. Unexpectedly, we observed enhanced neural activity accompanied by lactate accumulation and accelerated heart rates due to an increase in dopamine pathway and a decrease in inhibitory neurotransmitters following H-BPA exposure. Notably, disorders of the neural system, and disruptions in glycolysis, the TCA cycle, nucleoside metabolism, lipid metabolism, glutamate and aspartate metabolism induced by H-BPA exposure were heritable. Furthermore, lactate and dopa were identified as potential biomarkers of the developmental toxicity of H-BPA and related genetic effects. This study has demonstrated that the metabolomics approach is a useful tool for obtaining comprehensive and novel insights into the molecular developmental toxicity of environmental pollutants.

  10. Metabolic Profiling in Association with Vascular Endothelial Cell Dysfunction Following Non-Toxic Cadmium Exposure

    PubMed Central

    Li, Xiaofei; Nong, Qingjiao; Mao, Baoyu; Pan, Xue

    2017-01-01

    This study aimed to determine the metabolic profile of non-toxic cadmium (Cd)-induced dysfunctional endothelial cells using human umbilical vein endothelial cells (HUVECs). HUVECs (n = 6 per group) were treated with 0, 1, 5, or 10 μM cadmium chloride (CdCl2) for 48 h. Cell phenotypes, including nitric oxide (NO) production, the inflammatory response, and oxidative stress, were evaluated in Cd-exposed and control HUVECs. Cd-exposed and control HUVECs were analysed using gas chromatography time-of-flight/mass spectrometry. Compared to control HUVECs, Cd-exposed HUVECs were dysfunctional, exhibiting decreased NO production, a proinflammatory state, and non-significant oxidative stress. Further metabolic profiling revealed 24 significantly-altered metabolites in the dysfunctional endothelial cells. The significantly-altered metabolites were involved in the impaired tricarboxylic acid (TCA) cycle, activated pyruvate metabolism, up-regulated glucogenic amino acid metabolism, and increased pyrimidine metabolism. The current metabolic findings further suggest that the metabolic changes linked to TCA cycle dysfunction, glycosylation of the hexosamine biosynthesis pathway (HBP), and compensatory responses to genomic instability and energy deficiency may be generally associated with dysfunctional phenotypes, characterized by decreased NO production, a proinflammatory state, and non-significant oxidative stress, in endothelial cells following non-toxic Cd exposure. PMID:28872622

  11. Metabolic flux analysis of the halophilic archaeon Haladaptatus paucihalophilus.

    PubMed

    Liu, Guangxiu; Zhang, Manxiao; Mo, Tianlu; He, Lian; Zhang, Wei; Yu, Yi; Zhang, Qi; Ding, Wei

    2015-11-27

    This work reports the (13)C-assisted metabolic flux analysis of Haladaptatus paucihalophilus, a halophilic archaeon possessing an intriguing osmoadaption mechanism. We showed that the carbon flow is through the oxidative tricarboxylic acid (TCA) cycle whereas the reductive TCA cycle is not operative in H. paucihalophilus. In addition, both threonine and the citramalate pathways contribute to isoleucine biosynthesis, whereas lysine is synthesized through the diaminopimelate pathway and not through the α-aminoadipate pathway. Unexpected, the labeling patterns of glycine from the cells grown on [1-(13)C]pyruvate and [2-(13)C]pyruvate suggest that, unlike all the organisms investigated so far, in which glycine is produced exclusively from the serine hydroxymethyltransferase (SHMT) pathway, glycine biosynthesis in H. paucihalophilus involves different pathways including SHMT, threonine aldolase (TA) and the reverse reaction of glycine cleavage system (GCS), demonstrating for the first time that other pathways instead of SHMT can also make a significant contribution to the cellular glycine pool. Transcriptional analysis confirmed that both TA and GCS genes were transcribed in H. paucihalophilus, and the transcriptional level is independent of salt concentrations in the culture media. This study expands our understanding of amino acid biosynthesis and provides valuable insights into the metabolism of halophilic archaea. Copyright © 2015 Elsevier Inc. All rights reserved.

  12. Metabolic flux profiling of MDCK cells during growth and canine adenovirus vector production.

    PubMed

    Carinhas, Nuno; Pais, Daniel A M; Koshkin, Alexey; Fernandes, Paulo; Coroadinha, Ana S; Carrondo, Manuel J T; Alves, Paula M; Teixeira, Ana P

    2016-03-23

    Canine adenovirus vector type 2 (CAV2) represents an alternative to human adenovirus vectors for certain gene therapy applications, particularly neurodegenerative diseases. However, more efficient production processes, assisted by a greater understanding of the effect of infection on producer cells, are required. Combining [1,2-(13)C]glucose and [U-(13)C]glutamine, we apply for the first time (13)C-Metabolic flux analysis ((13)C-MFA) to study E1-transformed Madin-Darby Canine Kidney (MDCK) cells metabolism during growth and CAV2 production. MDCK cells displayed a marked glycolytic and ammoniagenic metabolism, and (13)C data revealed a large fraction of glutamine-derived labelling in TCA cycle intermediates, emphasizing the role of glutamine anaplerosis. (13)C-MFA demonstrated the importance of pyruvate cycling in balancing glycolytic and TCA cycle activities, as well as occurrence of reductive alphaketoglutarate (AKG) carboxylation. By turn, CAV2 infection significantly upregulated fluxes through most central metabolism, including glycolysis, pentose-phosphate pathway, glutamine anaplerosis and, more prominently, reductive AKG carboxylation and cytosolic acetyl-coenzyme A formation, suggestive of increased lipogenesis. Based on these results, we suggest culture supplementation strategies to stimulate nucleic acid and lipid biosynthesis for improved canine adenoviral vector production.

  13. The role of S1PR2 in bile acid-induced cholangiocyte proliferation and cholestasis-induced liver injury in mice

    PubMed Central

    Wang, Yongqing; Aoki, Hiroaki; Yang, Jing; Peng, Kesong; Liu, Runping; Li, Xiaojiaoyang; Qiang, Xiaoyan; Sun, Lixin; Gurley, Emily C; Lai, Guanhua; Zhang, Luyong; Liang, Guang; Nagahashi, Masayuki; Takabe, Kazuaki; Pandak, William M; Hylemon, Phillip B.; Zhou, Huiping

    2017-01-01

    Bile duct obstruction is a potent stimulus for cholangiocyte proliferation, especially for large cholangiocytes. Our previous studies reported that conjugated bile acids (CBAs) activate the AKT and ERK1/2 signaling pathways via the sphingosine 1-phosphate receptor 2 (S1PR2) in hepatocytes and cholangiocarcinoma cells. It also has been reported that taurocholate (TCA) promotes large cholangiocyte proliferation and protects cholangiocytes from bile duct ligation (BDL)-induced apoptosis. However, the role of S1PR2 in bile acid-mediated cholangiocyte proliferation and cholestatic liver injury has not been elucidated. Here we report that S1PR2 is the predominant S1PR expressed in cholangiocytes. Both TCA- and S1P-induced activation of ERK1/2 and AKT were inhibited by JTE-013, a specific antagonist of S1PR2, in cholangiocytes. In addition, TCA- and S1P-induced cell proliferation and migration were inhibited by JTE-013 and a specific shRNA of S1PR2 as well as chemical inhibitors of ERK1/2 and AKT in mouse cholangiocytes. In BDL mice, the expression of S1PR2 was upregulated in whole liver and cholangiocytes. S1PR2 deficiency significantly reduced BDL-induced cholangiocyte proliferation and cholestatic injury as indicated by significant reduction of inflammation and liver fibrosis in S1PR2−/− mice. Treatment of BDL mice with JTE-013 significantly reduced total bile acid levels in the serum and cholestatic liver injury. This study suggests that the CBA-induced activation of S1PR2-mediated signaling pathways plays a critical role in obstructive cholestasis and may represent a novel therapeutic target for cholestatic liver diseases. PMID:28120434

  14. The polyamines of Xanthium strumarium and their response to photoperiod.

    PubMed

    Hamasaki, N; Galston, A W

    1990-01-01

    Flowering plants of Xanthium strumarium L., grown in 8 h photoperiods, were analysed for polyamines. Putrescine, spermidine and spermine were found throughout the plant in three forms: (a) as free polyamines; (b) conjugates soluble in 5% trichloracetic acid (TCA); and (c) bound to the TCA-insoluble precipitate. On a fresh weight basis, total polyamines are most abundant in young leaves and buds, especially flower buds. Spermidine predominates in the free polyamine fractions, while spermine is dominant in the conjugated fraction. Transfer of vegetative plants from 16 h photoperiods to 1, 2, 3, or 4 inductive cycles (8 h light + 16 h uninterrupted dark) caused rapid and marked changes in the polyamine titer of the leaves and ultimately, floral initiation. The titer of free putrescine per mg protein declined progressively with induction in all leaf sizes, while the titers of free spermidine and spermine rose during days 2 and 3 in small and expanding leaves. Conjugated putrescine, spermidine and spermine rose sharply after only 1 inductive cycle, especially in small and expanding leaves, and maintained the higher level for at least several cycles. In plants given 4 inductive cycles, buds harvested after 4 additional days had sharply elevated levels of conjugated polyamines, especially spermine, on a protein basis.

  15. Omega-3 polyunsaturated fatty acid docosahexaenoic acid and its role in exhaustive-exercise-induced changes in female rat ovulatory cycle.

    PubMed

    Mostafa, Abeer F; Samir, Shereen M; Nagib, R M

    2018-04-01

    Exhaustive exercises can cause delayed menarche or menstrual cycle irregularities in females. Omega-3 polyunsaturated fatty acids (ω-3 PUFAs) are incorporated into a wide range of benefits in many physiological systems. Our work aimed to assess the role of ω-3 PUFA docosahexaenoic acid (DHA) on the deleterious effects of exhaustive exercise on the female reproductive system in rats. Virgin female rats were randomly divided into 4 groups (12 rats in each): control group, omega-3 group treated with DHA, exhaustive exercise group, and exhaustive exercised rats treated with DHA. Omega-3 was given orally to the rats once daily for 4 estrous cycles. Exhaustive exercises revealed lower levels in progesterone and gonadotropins together with histopathological decrease in number of growing follicles and corpora lutea. Moreover, the exercised rats showed low levels of ovarian antioxidants with high level of caspase-3 and plasma cortisol level that lead to disruption of hypothalamic-pituitary-gonadal axis. ω-3 PUFA DHA has beneficial effects on the number of newly growing follicles in both sedentary and exercised rats with decreasing the level of caspase-3 and increasing the antioxidant activity in ovaries. Exhaustive exercises can cause ovulatory problems in female rats that can be improved by ω-3 supplementation.

  16. pKa cycling of the general acid/base in glycoside hydrolase families 33 and 34.

    PubMed

    Yu, Haibo; Griffiths, Thomas M

    2014-03-28

    Glycoside hydrolase families 33 and 34 catalyse the hydrolysis of terminal sialic acid residues from sialyl oligosaccharides and glycoconjugates with a net retention of the stereochemistry at the anomeric centre. It is generally believed that the conserved aspartic acid in the active site functions as a general acid to protonate the hydroxyl group of the departing aglycone during glycosylation, and then as a general base to facilitate the nucleophilic attack of the water molecule on the intermediate state during the deglycosylation reaction. The dual role of the general acid/base places specific demands upon its protonation state, and thus pKa values. However, it is not fully understood how this catalytic residue can achieve such pKa cycling during catalysis. We present both MM and combined QM/MM simulations to characterise the pKa values of the proposed catalytic general acid/base in the glycoside hydrolase families 33 and 34. Collectively, our study suggests that the binding of anionic substrates and the local solvation properties along with the neutralisation of the nearby glutamic acid upon glycosylation modulate the electrostatic environment around the general acid/base to achieve its proper protonation states.

  17. Correlations between FAS elongation cycle genes expression and fatty acid production for improvement of long-chain fatty acids in Escherichia coli.

    PubMed

    Lee, Sunhee; Jung, Yeontae; Lee, Seunghan; Lee, Jinwon

    2013-03-01

    Microorganisms have been used for biodiesel (fatty acid methyl ester) production due to their significant environmental and economic benefits. The aim of the present research was to develop new strains of Escherichia coli K-12 MG1655 and to increase the content of long-chain fatty acids by overexpressing essential enzymes that are involved in the fatty acid synthase elongation cycle. In addition, the relationship of β-ketoacyl-acyl carrier protein (ACP) synthase (fabH), β-ketoacyl-ACP reductase (fabG), β-hydroxyacyl-ACP dehydrase (fabZ), and β-enoyl-ACP reductase (fabI) with respect to fatty acid production was investigated. The four enzymes play a unique role in fatty acid biosynthesis and elongation processes. We report the generation of recombinant E. coli strains that produced long-chain fatty acids to amounts twofold over wild type. To verify the results, NAD(+)/NADH ratios and glucose analyses were performed. We also confirmed that FabZ plays an important role in producing unsaturated fatty acids (UFAs) as E. coli SGJS25 (overexpressing the fabZ gene) produced the highest percentage of UFAs (35 % of total long-chain fatty acids), over wild type and other recombinants. Indeed, cis-9-hexadecenoic acid, a major UFA in E. coli SGJS25, was produced at levels 20-fold higher than in wild type after 20 h in culture. The biochemically engineered E. coli presented in this study is expected to be more economical for producing long-chain fatty acids in quality biodiesel production processes.

  18. Anaplerotic Triheptanoin Diet Enhances Mitochondrial Substrate Use to Remodel the Metabolome and Improve Lifespan, Motor Function, and Sociability in MeCP2-Null Mice

    PubMed Central

    Li, Qun; Degano, Alicia L.; Penati, Judith; Zhuo, Justin; Roe, Charles R.; Ronnett, Gabriele V.

    2014-01-01

    Rett syndrome (RTT) is an autism spectrum disorder (ASD) caused by mutations in the X-linked MECP2 gene that encodes methyl-CpG binding protein 2 (MeCP2). Symptoms range in severity and include psychomotor disabilities, seizures, ataxia, and intellectual disability. Symptom onset is between 6-18 months of age, a critical period of brain development that is highly energy-dependent. Notably, patients with RTT have evidence of mitochondrial dysfunction, as well as abnormal levels of the adipokines leptin and adiponectin, suggesting overall metabolic imbalance. We hypothesized that one contributor to RTT symptoms is energy deficiency due to defective nutrient substrate utilization by the TCA cycle. This energy deficit would lead to a metabolic imbalance, but would be treatable by providing anaplerotic substrates to the TCA cycle to enhance energy production. We show that dietary therapy with triheptanoin significantly increased longevity and improved motor function and social interaction in male mice hemizygous for Mecp2 knockout. Anaplerotic therapy in Mecp2 knockout mice also improved indicators of impaired substrate utilization, decreased adiposity, increased glucose tolerance and insulin sensitivity, decreased serum leptin and insulin, and improved mitochondrial morphology in skeletal muscle. Untargeted metabolomics of liver and skeletal muscle revealed increases in levels of TCA cycle intermediates with triheptanoin diet, as well as normalizations of glucose and fatty acid biochemical pathways consistent with the improved metabolic phenotype in Mecp2 knockout mice on triheptanoin. These results suggest that an approach using dietary supplementation with anaplerotic substrate is effective in improving symptoms and metabolic health in RTT. PMID:25299635

  19. Split-face comparative study of 1550 nm fractional photothermolysis and trichloroacetic acid 15% chemical peeling for facial melasma in Asian skin.

    PubMed

    Hong, Seung-Phil; Han, Seung-Seog; Choi, Seok-Joo; Kim, Myoung-Shin; Won, Chong-Hyun; Lee, Mi-Woo; Choi, Jee-Ho; Moon, Kee-Chan; Kim, Youn Jin; Chang, Sung-Eun

    2012-04-01

    Fractional photothermolysis (FP) therapy and chemical peels have been reported to be effective in patients with recalcitrant melasma. However, there is little information to compare the efficacy of single treatment session in Asian women. The aim of this study was to examine the efficacy, long-lasting outcomes and safety of a single session of 1550-nm erbium-doped FP in Asian patients, compared with trichloroacetic acid (TCA) peel with a medium depth. Eighteen Korean women (Fitzpatrick skin type III or IV) with moderate-to-severe bilateral melasma were randomly treated with a single session of 1550-nm FP on one cheek, and with a 15% TCA peel on the other cheek. Outcome measures included an objective melasma area severity index and subjective patient-rated overall improvement at 4 and 12 weeks after treatment. Melasma lesions were significantly improved 4 weeks after either treatment, but melasma recurred at 12 weeks. Post-inflammatory hyperpigmentation developed in 28% of patients at 4 weeks but resolved in all but one patient by 12 weeks. There was no difference between FP treatment and TCA peeling with respect to any outcome measure. FP laser and TCA peel treatments were equally effective and safe when used to treat moderate-to-severe melasma, but neither treatment was long-lasting. We suggest that multiple or periodic maintenance treatments and/or supplemental procedures may be required for the successful treatment of melasma in Asian women.

  20. The Viability of a Nonenzymatic Reductive Citric Acid Cycle Kinetics and Thermochemistry

    NASA Astrophysics Data System (ADS)

    Ross, David S.

    2007-02-01

    The likelihood of a functioning nonenzymatic reductive citric acid cycle, recently proposed as the precursor to biosynthesis on early Earth, is examined on the basis of the kinetics and thermochemistry of the acetate → pyruvate → oxaloacetate → malate sequence. Using data derived from studies of the Pd-catalyzed phosphinate reduction of carbonyl functions it is shown that the rate of conversion of pyruvate to malate with that system would have been much too slow to have played a role in the early chemistry of life, while naturally occurring reduction systems such as the fayalite magnetite quartz and pyrrhotite pyrite magnetite mineral assemblages would have provided even slower conversions. It is also shown that the production of pyruvate from acetate is too highly endoergic to be driven by a naturally occurring energy source such as pyrophosphate. It is thus highly doubtful that the cycle can operate at suitable rates without enzymes, and most unlikely that it could have participated in the chemistry leading to life.

  1. Sodium phenylbutyrate decreases plasma branched-chain amino acids in patients with urea cycle disorders.

    PubMed

    Burrage, Lindsay C; Jain, Mahim; Gandolfo, Laura; Lee, Brendan H; Nagamani, Sandesh C S

    2014-01-01

    Sodium phenylbutyrate (NaPBA) is a commonly used medication for the treatment of patients with urea cycle disorders (UCDs). Previous reports involving small numbers of patients with UCDs have shown that NaPBA treatment can result in lower plasma levels of the branched-chain amino acids (BCAA) but this has not been studied systematically. From a large cohort of patients (n=553) with UCDs enrolled in the Longitudinal Study of Urea Cycle Disorders, a collaborative multicenter study of the Urea Cycle Disorders Consortium, we evaluated whether treatment with NaPBA leads to a decrease in plasma BCAA levels. Our analysis shows that NaPBA use independently affects the plasma BCAA levels even after accounting for multiple confounding covariates. Moreover, NaPBA use increases the risk for BCAA deficiency. This effect of NaPBA seems specific to plasma BCAA levels, as levels of other essential amino acids are not altered by its use. Our study, in an unselected population of UCD subjects, is the largest to analyze the effects of NaPBA on BCAA metabolism and potentially has significant clinical implications. Our results indicate that plasma BCAA levels should to be monitored in patients treated with NaPBA since patients taking the medication are at increased risk for BCAA deficiency. On a broader scale, these findings could open avenues to explore NaPBA as a therapy in maple syrup urine disease and other common complex disorders with dysregulation of BCAA metabolism. Copyright © 2014 Elsevier Inc. All rights reserved.

  2. Acetate and succinate production in amoebae, helminths, diplomonads, trichomonads and trypanosomatids: common and diverse metabolic strategies used by parasitic lower eukaryotes.

    PubMed

    Bringaud, F; Ebikeme, C; Boshart, M

    2010-08-01

    Parasites that often grow anaerobically in their hosts have adopted a fermentative strategy relying on the production of partially oxidized end products, including lactate, glycerol, ethanol, succinate and acetate. This review focuses on recent progress in understanding acetate production in protist parasites, such as amoebae, diplomonads, trichomonads, trypanosomatids and in the metazoan parasites helminths, as well as the succinate production pathway(s) present in some of them. We also describe the unconventional organisation of the tricarboxylic acid cycle associated with the fermentative strategy adopted by the procyclic trypanosomes, which may resemble the probable structure of the primordial TCA cycle in prokaryotes.

  3. Self-organizing biochemical cycles

    NASA Technical Reports Server (NTRS)

    Orgel, L. E.; Bada, J. L. (Principal Investigator)

    2000-01-01

    I examine the plausibility of theories that postulate the development of complex chemical organization without requiring the replication of genetic polymers such as RNA. One conclusion is that theories that involve the organization of complex, small-molecule metabolic cycles such as the reductive citric acid cycle on mineral surfaces make unreasonable assumptions about the catalytic properties of minerals and the ability of minerals to organize sequences of disparate reactions. Another conclusion is that data in the Beilstein Handbook of Organic Chemistry that have been claimed to support the hypothesis that the reductive citric acid cycle originated as a self-organized cycle can more plausibly be interpreted in a different way.

  4. Butyrate induces apoptosis by activating PDC and inhibiting complex I through SIRT3 inactivation.

    PubMed

    Xu, Sha; Liu, Cai-Xia; Xu, Wei; Huang, Lei; Zhao, Jian-Yuan; Zhao, Shi-Min

    2017-01-01

    The underlying anticancer effects of butyrate, an end-product of the intestinal microbial fermentation of dietary fiber, remain elusive. Here, we report that butyrate promotes cancer cell apoptosis by acting as a SIRT3 inhibitor. Butyrate inhibits SIRT3 both in cultured cells and in vitro . Butyrate-induced PDHA1 hyperacetylation relieves the inhibitory phosphorylation of PDHA1 at serine 293, thereby activating an influx of glycolytic intermediates into the tricarboxylic acid (TCA) cycle and reversing the Warburg effect. Meanwhile, butyrate-induced hyperacetylation inactivates complex I of the electron transfer chain and prevents the utilization of TCA cycle intermediates. These metabolic stresses promote apoptosis in hyperglycolytic cancer cells, such as HCT116 p53 -/- cells. SIRT3 deacetylates both PDHA1 and complex I. Genetic ablation of Sirt3 in mouse hepatocytes abrogated the ability of butyrate to induce apoptosis. Our results identify a butyrate-mediated anti-tumor mechanism and indicate that the combined activation of PDC and inhibition of complex I is a novel tumor treatment strategy.

  5. Fumarate hydratase is a critical metabolic regulator of hematopoietic stem cell functions.

    PubMed

    Guitart, Amelie V; Panagopoulou, Theano I; Villacreces, Arnaud; Vukovic, Milica; Sepulveda, Catarina; Allen, Lewis; Carter, Roderick N; van de Lagemaat, Louie N; Morgan, Marcos; Giles, Peter; Sas, Zuzanna; Gonzalez, Marta Vila; Lawson, Hannah; Paris, Jasmin; Edwards-Hicks, Joy; Schaak, Katrin; Subramani, Chithra; Gezer, Deniz; Armesilla-Diaz, Alejandro; Wills, Jimi; Easterbrook, Aaron; Coman, David; So, Chi Wai Eric; O'Carroll, Donal; Vernimmen, Douglas; Rodrigues, Neil P; Pollard, Patrick J; Morton, Nicholas M; Finch, Andrew; Kranc, Kamil R

    2017-03-06

    Strict regulation of stem cell metabolism is essential for tissue functions and tumor suppression. In this study, we investigated the role of fumarate hydratase (Fh1), a key component of the mitochondrial tricarboxylic acid (TCA) cycle and cytosolic fumarate metabolism, in normal and leukemic hematopoiesis. Hematopoiesis-specific Fh1 deletion (resulting in endogenous fumarate accumulation and a genetic TCA cycle block reflected by decreased maximal mitochondrial respiration) caused lethal fetal liver hematopoietic defects and hematopoietic stem cell (HSC) failure. Reexpression of extramitochondrial Fh1 (which normalized fumarate levels but not maximal mitochondrial respiration) rescued these phenotypes, indicating the causal role of cellular fumarate accumulation. However, HSCs lacking mitochondrial Fh1 (which had normal fumarate levels but defective maximal mitochondrial respiration) failed to self-renew and displayed lymphoid differentiation defects. In contrast, leukemia-initiating cells lacking mitochondrial Fh1 efficiently propagated Meis1 / Hoxa9 -driven leukemia. Thus, we identify novel roles for fumarate metabolism in HSC maintenance and hematopoietic differentiation and reveal a differential requirement for mitochondrial Fh1 in normal hematopoiesis and leukemia propagation. © 2017 Guitart et al.

  6. Cigarette smoke induces mitochondrial metabolic reprogramming in lung cells.

    PubMed

    Solanki, Hitendra S; Babu, Niraj; Jain, Ankit P; Bhat, Mohd Younis; Puttamallesh, Vinuth N; Advani, Jayshree; Raja, Remya; Mangalaparthi, Kiran K; Kumar, Mahesh M; Prasad, T S Keshava; Mathur, Premendu Prakash; Sidransky, David; Gowda, Harsha; Chatterjee, Aditi

    2018-05-01

    Cellular transformation owing to cigarette smoking is due to chronic exposure and not acute. However, systematic studies to understand the molecular alterations in lung cells due to cigarette smoke are lacking. To understand these molecular alterations induced by chronic cigarette smoke exposure, we carried out tandem mass tag (TMT) based temporal proteomic profiling of lung cells exposed to cigarette smoke for upto 12months. We identified 2620 proteins in total, of which 671 proteins were differentially expressed (1.5-fold) after 12months of exposure. Prolonged exposure of lung cells to smoke for 12months revealed dysregulation of oxidative phosphorylation and overexpression of enzymes involved in TCA cycle. In addition, we also observed overexpression of enzymes involved in glutamine metabolism, fatty acid degradation and lactate synthesis. This could possibly explain the availability of alternative source of carbon to TCA cycle apart from glycolytic pyruvate. Our data indicates that chronic exposure to cigarette smoke induces mitochondrial metabolic reprogramming in cells to support growth and survival. Copyright © 2017 Elsevier B.V. and Mitochondria Research Society. All rights reserved.

  7. Functionalised carboxylic acids in atmospheric particles: An annual cycle revealing seasonal trends and possible sources

    NASA Astrophysics Data System (ADS)

    Teich, Monique; van Pinxteren, Dominik; Herrmann, Hartmut

    2013-04-01

    Carboxylic acids represent a major fraction of the water soluble organic carbon (WSOC) in atmospheric particles. Among the particle phase carboxylic acids, straight-chain monocarboxylic acids (MCA) and dicarboxylic acids (DCA) with 2-10 carbon atoms have extensively been studied in the past. However, only a few studies exist dealing with functionalised carboxylic acids, i.e. having additional hydroxyl-, oxo- or nitro-groups. Regarding atmospheric chemistry, these functionalised carboxylic acids are of particular interest as they are supposed to be formed during atmospheric oxidation processes, e.g. through radical reactions. Therefore they can provide insights into the tropospheric multiphase chemistry. During this work 28 carboxylic acids (4 functionalised aliphatic MCAs, 5 aromatic MCAs, 3 nitroaromatic MCAs, 6 aliphatic DCAs, 6 functionalised aliphatic DCAs, 4 aromatic DCAs) were quantitatively determined in 256 filter samples taken at the rural research station Melpitz (Saxony, Germany) with a PM10 Digitel DHA-80 filter sampler. All samples were taken in 2010 covering a whole annual cycle. The resulting dataset was examined for a possible seasonal dependency of the acid concentrations. Furthermore the influence of the air mass origin on the acid concentrations was studied based on a simple two-sector classification (western or eastern sector) using a back trajectory analysis. Regarding the annual average, adipic acid was found to be the most abundant compound with a mean concentration of 7.8 ng m-3 followed by 4-oxopimelic acid with 6.1 ng m-3. The sum of all acid concentrations showed two maxima during the seasonal cycle; one in summer and one in winter, whereas the highest overall acid concentrations were found in summer. In general the target acids could be divided into two different groups, where one group has its maximum concentration in summer and the other group during winter. The first group contains all investigated aliphatic mono- and dicarboxylic

  8. Combined NMR and GC-MS analyses revealed dynamic metabolic changes associated with the carrageenan-induced rat pleurisy.

    PubMed

    Li, Huihui; An, Yanpeng; Zhang, Lulu; Lei, Hehua; Zhang, Limin; Wang, Yulan; Tang, Huiru

    2013-12-06

    Inflammation is closely associated with pathogenesis of various metabolic disorders, cardiovascular diseases, and cancers. To understand the systems responses to localized inflammation, we analyzed the dynamic metabolic changes in rat plasma and urine associated with the carrageenan-induced self-limiting pleurisy using NMR spectroscopy in conjunction with multivariate data analysis. Fatty acids in plasma were also analyzed using GC-FID/MS with the data from clinical chemistry and histopathology as complementary information. We found that in the acute phase of inflammation rats with pleurisy had significantly lower levels in serum albumin, fatty acids, and lipoproteins but higher globulin level and larger quantity of pleural exudate than controls. The carrageenan-induced inflammation was accompanied by significant metabolic alterations involving TCA cycle, glycolysis, biosyntheses of acute phase proteins, and metabolisms of amino acids, fatty acids, ketone bodies, and choline in acute phase. The resolution process of pleurisy was heterogeneous, and two subgroups were observed for the inflammatory rats at day-6 post treatment with different metabolic features together with the quantity of pleural exudate and weights of thymus and spleen. The metabolic differences between these subgroups were reflected in the levels of albumin and acute-phase proteins, the degree of returning to normality for multiple metabolic pathways including glycolysis, TCA cycle, gut microbiota functions, and metabolisms of lipids, choline and vitamin B3. These findings provided some essential details for the dynamic metabolic changes associated with the carrageenan-induced self-limiting inflammation and demonstrated the combined NMR and GC-FID/MS analysis as a powerful approach for understanding biochemical aspects of inflammation.

  9. Role of Pterocarpus santalinus against mitochondrial dysfunction and membrane lipid changes induced by ulcerogens in rat gastric mucosa.

    PubMed

    Narayan, Shoba; Devi, R S; Devi, C S Shyamala

    2007-11-20

    Free radicals produced by ulcerogenic agents affect the TCA cycle enzymes located in the outer membrane of the mitochondria. Upon induction with ulcerogens, peroxidation of membrane lipids bring about alterations in the mitochondrial enzyme activity. This indicates an increase in the permeability levels of the mitochondrial membrane. The ability of PSE to scavenge the reactive oxygen species results in restoration of activities of TCA cycle enzymes. NSAIDs interfere with the mitochondrial beta-oxidation of fatty acids in vitro and in vivo, resulting in uncoupling of mitochondrial oxidative phosphorylation process. This usually results in diminished cellular ATP production. The recovery of gastric mucosal barrier function through maintenance of energy metabolism results in maintenance of ATP levels, as observed in this study upon treatment with PSE. Membrane integrity altered by peroxidation is known to have a modified fatty acid composition, a disruption of permeability, a decrease in electrical resistance, and increase in flip-flopping between monolayers and inactivated cross-linked proteins. The severe depletion of arachidonic acid in ulcer induced groups was prevented upon treatment with PSE. The acid inhibitory property of the herbal extract enables the maintenance of GL activity upon treatment with PSE. The ability to prevent membrane peroxidation has been traced to the presence of active constituents in the PSE. In essence, PSE has been found to prevent mitochondrial dysfunction, provide mitochondrial cell integrity, through the maintenance of lipid bilayer by its ability to provide a hydrophobic character to the gastric mucosa, further indicating its ability to reverse the action of NSAIDs and mast cell degranulators in gastric mucosa.

  10. DIBROMOACETIC ACID-INDUCED ELEVATIONS IN CIRCULATING ESTRADIOL: EFFECTS IN BOTH CYCLING AND OVARIECTOMIZED/STEROID-PRIMED FEMALE RATS

    EPA Science Inventory

    RTD-03-031
    Goldman, JM and Murr, AS. Dibromoacetic Acid-induced Elevations in Circulating Estradiol: Effects in Both Cycling and Ovariectomized/Steroid-primed Female Rats. Reproductive Toxicology (in press).

    Abstract

    Oral exposures to high concentrations of th...

  11. Enzymes in Glycolysis and the Citric Acid Cycle in the Yeast and Mycelial Forms of Paracoccidioides brasiliensis

    PubMed Central

    Kanetsuna, Fuminori; Carbonell, Luis M.

    1966-01-01

    Kanetsuna, Fuminori (Instituto Venezolano de Investigaciones Cientificas, Caracas, Venezuela), and Luis M. Carbonell. Enzymes in glycolysis and the citric acid cycle in the yeast and mycelial forms of Paracoccidioides brasiliensis. J. Bacteriol. 92:1315–1320. 1966.—Enzymatic activities in glycolysis, the hexose monophosphate shunt, and the citric acid cycle in cell-free extracts of the yeast and mycelial forms of Paracoccidioides brasiliensis were examined comparatively. Both forms have the enzymes of these pathways. Activities of glucose-6-phosphate dehydrogenase and malic dehydrogenase of the mycelial form were higher than those of the yeast form. Another 15 enzymatic activities of the mycelial form were lower than those of the yeast form. The activity of glyceraldehyde-3-phosphate dehydrogenase showed the most marked difference between the two forms, its activity in the mycelial form being about 20% of that in the yeast form. PMID:5924267

  12. A reverse KREBS cycle in photosynthesis: consensus at last

    NASA Technical Reports Server (NTRS)

    Buchanan, B. B.; Arnon, D. I.

    1990-01-01

    The Krebs cycle (citric acid or tricarboxylic acid cycle), the final common pathway in aerobic metabolism for the oxidation of carbohydrates, fatty acids and amino acids, is known to be irreversible. It liberates CO2 and generates NADH whose aerobic oxidation yields ATP but it does not operate in reverse as a biosynthetic pathway for CO2 assimilation. In 1966, our laboratory described a cyclic pathway for CO2 assimilation (Evans, Buchanan and Arnon 1966) that was unusual in two respects: (i) it provided the first instance of an obligate photoautotroph that assimilated CO2 by a pathway different from Calvin's reductive pentose phosphate cycle (Calvin 1962) and (ii) in its overall effect the new cycle was a reversal of the Krebs cycle. Named the 'reductive carboxylic acid cycle' (sometimes also called the reductive tricarboxylic acid cycle) the new cycle appeared to be the sole CO2 assimilation pathway in Chlorobium thiosulfatophilum (Evans et al. 1966) (now known as Chlorobium limicola forma thiosulfatophilum). Chlorobium is a photosynthetic green sulfur bacterium that grows anaerobically in an inorganic medium with sulfide and thiosulfate as electron donors and CO2 as an obligatory carbon source. In the ensuing years, the new cycle was viewed with skepticism. Not only was it in conflict with the prevailing doctrine that the 'one important property ... shared by all (our emphasis) autotrophic species is the assimilation of CO2 via the Calvin cycle' (McFadden 1973) but also some of its experimental underpinnings were challenged. It is only now that in the words of one of its early skeptics (Tabita 1988) 'a long and tortuous controversy' has ended with general acceptance of the reductive carboxylic acid cycle as a photosynthetic CO2 assimilation pathway distinct from the pentose cycle. (Henceforth, to minimize repetitiveness, the reductive pentose phosphate cycle will often be referred to as the pentose cycle and the reductive carboxylic acid cycle as the carboxylic

  13. A reverse KREBS cycle in photosynthesis: consensus at last.

    PubMed

    Buchanan, B B; Arnon, D I

    1990-01-01

    The Krebs cycle (citric acid or tricarboxylic acid cycle), the final common pathway in aerobic metabolism for the oxidation of carbohydrates, fatty acids and amino acids, is known to be irreversible. It liberates CO2 and generates NADH whose aerobic oxidation yields ATP but it does not operate in reverse as a biosynthetic pathway for CO2 assimilation. In 1966, our laboratory described a cyclic pathway for CO2 assimilation (Evans, Buchanan and Arnon 1966) that was unusual in two respects: (i) it provided the first instance of an obligate photoautotroph that assimilated CO2 by a pathway different from Calvin's reductive pentose phosphate cycle (Calvin 1962) and (ii) in its overall effect the new cycle was a reversal of the Krebs cycle. Named the 'reductive carboxylic acid cycle' (sometimes also called the reductive tricarboxylic acid cycle) the new cycle appeared to be the sole CO2 assimilation pathway in Chlorobium thiosulfatophilum (Evans et al. 1966) (now known as Chlorobium limicola forma thiosulfatophilum). Chlorobium is a photosynthetic green sulfur bacterium that grows anaerobically in an inorganic medium with sulfide and thiosulfate as electron donors and CO2 as an obligatory carbon source. In the ensuing years, the new cycle was viewed with skepticism. Not only was it in conflict with the prevailing doctrine that the 'one important property ... shared by all (our emphasis) autotrophic species is the assimilation of CO2 via the Calvin cycle' (McFadden 1973) but also some of its experimental underpinnings were challenged. It is only now that in the words of one of its early skeptics (Tabita 1988) 'a long and tortuous controversy' has ended with general acceptance of the reductive carboxylic acid cycle as a photosynthetic CO2 assimilation pathway distinct from the pentose cycle. (Henceforth, to minimize repetitiveness, the reductive pentose phosphate cycle will often be referred to as the pentose cycle and the reductive carboxylic acid cycle as the carboxylic

  14. Detection of endogenous DNA adducts, O-carboxymethyl-2'-deoxyguanosine and 3-ethanesulfonic acid-2'-deoxycytidine, in the rat stomach after duodenal reflux.

    PubMed

    Terasaki, Masaru; Totsuka, Yukari; Nishimura, Koichi; Mukaisho, Ken-Ichi; Chen, Kuan-Hao; Hattori, Takanori; Takamura-Enya, Takeji; Sugimura, Takashi; Wakabayashi, Keiji

    2008-09-01

    The endogenous DNA adducts O(6)-carboxymethyl-deoxyguanosine (O(6)-CM-dG) and 3-ethanesulfonic acid-deoxycytidine (3-ESA-dC) are produced from N-nitroso bile acid conjugates, such as N-nitrosoglycocholic acid (NO-GCA) and N-nitrosotaurocholic acid (NO-TCA), respectively. Formation of these DNA adducts in vivo was here analyzed by 32P-postlabeling in the glandular stomach of rats subjected to duodenal content reflux surgery. In this model, all duodenal contents, including bile acid conjugates, flow back from the jejunum into the gastric corpus. The levels of O(6)-CM-dG found at 4 and 8 weeks after surgery were 40.9 +/- 9.4 and 56.3 +/- 3.2 per 10(8) nucleotides, respectively, whereas the sham operation groups had values of 5.8 +/- 2.3 and 5.9 +/- 0.5 per 10(8) nucleotides. Moreover, adduct spots corresponding to 3-ESA-dC were detected in both duodenal reflux and sham operation groups and levels in the duodenal reflux groups were around four-fold elevated at 11.2 +/- 1.0 and 8.9 +/- 1.0 per 10(8) nucleotides after 4 and 8 weeks, respectively. When the duodenal reflux animals were treated with a nitrite trapping agent, thiazolidine- 4-carboxylic acid (thioproline, TPRO), the levels of O(6)-CM-dG and 3-ESA-dC were reduced to the same levels as in the sham operation animals. These observations suggest that NO-TCA and NO-GCA are formed by nitrosation of glycocholic acid and taurocholic acid, respectively, and these nitroso compounds produce DNA adducts in the glandular stomach of rats subjected to duodenal content reflux surgery.

  15. Impaired hippocampal glucose metabolism during and after flurothyl-induced seizures in mice: Reduced phosphorylation coincides with reduced activity of pyruvate dehydrogenase.

    PubMed

    McDonald, Tanya S; Borges, Karin

    2017-07-01

    To determine changes in glucose metabolism and the enzymes involved in the hippocampus ictally and postictally in the acute mouse flurothyl seizure model. [U- 13 C]-Glucose was injected (i.p.) prior to, or following a 5 min flurothyl-induced seizure. Fifteen minutes later, mice were killed and the total metabolite levels and % 13 C enrichment were analyzed in the hippocampal formation using gas chromatography-mass spectrometry. Activities of key metabolic and antioxidant enzymes and the phosphorylation status of pyruvate dehydrogenase were measured, along with lipid peroxidation. During seizures, total lactate levels increased 1.7-fold; however, [M + 3] enrichment of both lactate and alanine were reduced by 30% and 43%, respectively, along with a 28% decrease in phosphofructokinase activity. Postictally the % 13 C enrichments of all measured tricarboxylic acid (TCA) cycle intermediates and the amino acids were reduced by 46-93%. At this time, pyruvate dehydrogenase (PDH) activity was 56% of that measured in controls, and there was a 1.9-fold increase in the phosphorylation of PDH at ser232. Phosphorylation of PDH is known to decrease its activity. Here, we show that the increase of lactate levels during flurothyl seizures is from a source other than [U- 13 C]-glucose, such as glycogen. Surprisingly, although we saw a reduction in phosphofructokinase activity during the seizure, metabolism of [U- 13 C]-glucose into the TCA cycle seemed unaffected. Similar to our recent findings in the chronic phase of the pilocarpine model, postictally the metabolism of glucose by glycolysis and the TCA cycle was impaired along with reduced PDH activity. Although this decrease in activity may be a protective mechanism to reduce oxidative stress, which is observed in the flurothyl model, ATP is critical to the recovery of ion and neurotransmitter balance and return to normal brain function. Thus we identified promising novel strategies to enhance energy metabolism and recovery from

  16. Differential effects of ethanol on regional glutamatergic and GABAergic neurotransmitter pathways in mouse brain.

    PubMed

    Tiwari, Vivek; Veeraiah, Pandichelvam; Subramaniam, Vaidyanathan; Patel, Anant Bahadur

    2014-03-01

    This study investigates the effects of ethanol on neuronal and astroglial metabolism using (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of [1,6-(13)C2]/[1-(13)C]glucose or [2-(13)C]acetate, respectively. A three-compartment metabolic model was fitted to the (13)C turnover of GluC3 , GluC4, GABAC 2, GABAC 3, AspC3 , and GlnC4 from [1,6-(13)C2 ]glucose to determine the rates of tricarboxylic acid (TCA) and neurotransmitter cycle associated with glutamatergic and GABAergic neurons. The ratio of neurotransmitter cycle to TCA cycle fluxes for glutamatergic and GABAegic neurons was obtained from the steady-state [2-(13)C]acetate experiment and used as constraints during the metabolic model fitting. (1)H MRS measurement suggests that depletion of ethanol from cerebral cortex follows zero order kinetics with rate 0.18 ± 0.04 μmol/g/min. Acute exposure of ethanol reduces the level of glutamate and aspartate in cortical region. GlnC4 labeling was found to be unchanged from a 15 min infusion of [2-(13)C]acetate suggesting that acute ethanol exposure does not affect astroglial metabolism in naive mice. Rates of TCA and neurotransmitter cycle associated with glutamatergic and GABAergic neurons were found to be significantly reduced in cortical and subcortical regions. Acute exposure of ethanol perturbs the level of neurometabolites and decreases the excitatory and inhibitory activity differentially across the regions of brain. Depletion of ethanol and its effect on brain functions were measured using (1)H and (1)H-[(13)C]-NMR spectroscopy in conjunction with infusion of (13)C-labeled substrates. Ethanol depletion from brain follows zero order kinetics. Ethanol perturbs level of glutamate, and the excitatory and inhibitory activity in mice brain. © 2013 International Society for Neurochemistry.

  17. High-density natural luffa sponge as anaerobic microorganisms carrier for degrading 1,1,1-TCA in groundwater.

    PubMed

    Wang, Wenbing; Wu, Yanqing; Zhang, Chi

    2017-03-01

    Anaerobic microorganisms were applied to degrade organic contaminants in groundwater with permeable reactive barriers (PRBs). However, anaerobic microorganisms need to select optimal immobilizing material as carrier. The potential of high-density natural luffa sponge (HDLS) (a new variety of luffa) for the immobilization and protection of anaerobic microorganisms was investigated. The HDLS has a dense structure composed of a complicated interwoven fibrous network. Therefore, the abrasion rate of HDLS (0.0068 g s -1 ) was the smallest among the four carriers [HDLS, ordinary natural luffa sponge (OLS), polyurethane sponge (PS), and gel carrier AQUAPOROUSGEL (APG)]. The results suggest that it also had the greatest water retention (10.26 H 2 O-g dry carrier-g -1 ) and SS retention (0.21 g dry carrier-g -1 ). In comparison to well-established commercialized gel carrier APG, HDLS was of much better mechanical strength, hydrophilicity and stability. Microbial-immobilized HDLS also had the best performance for the remediation of 1,1,1-TCA simulated groundwater. Analysis of the clone libraries from microorganism-immobilized HDLS showed the HDLS could protect microorganisms from the toxicity of 1,1,1-TCA and maintain the stability of microbial community diversity. The mechanism of HDLS immobilizing and protecting microorganisms was proposed as follows. The HDLS had a micron-scale honeycomb structure (30-40 μm) and an irregular ravine structure (4-20 μm), which facilitate the immobilization of anaerobic microorganisms and protect the anaerobic microorganisms.

  18. Correlation between citric acid and nitrate metabolisms during CAM cycle in the atmospheric bromeliad Tillandsia pohliana.

    PubMed

    Freschi, Luciano; Rodrigues, Maria Aurineide; Tiné, Marco Aurélio Silva; Mercier, Helenice

    2010-12-15

    Crassulacean acid metabolism (CAM) confers crucial adaptations for plants living under frequent environmental stresses. A wide metabolic plasticity can be found among CAM species regarding the type of storage carbohydrate, organic acid accumulated at night and decarboxylating system. Consequently, many aspects of the CAM pathway control are still elusive while the impact of this photosynthetic adaptation on nitrogen metabolism has remained largely unexplored. In this study, we investigated a possible link between the CAM cycle and the nitrogen assimilation in the atmospheric bromeliad Tillandsia pohliana by simultaneously characterizing the diel changes in key enzyme activities and metabolite levels of both organic acid and nitrate metabolisms. The results revealed that T. pohliana performed a typical CAM cycle in which phosphoenolpyruvate carboxylase and phosphoenolpyruvate carboxykinase phosphorylation seemed to play a crucial role to avoid futile cycles of carboxylation and decarboxylation. Unlike all other bromeliads previously investigated, almost equimolar concentrations of malate and citrate were accumulated at night. Moreover, a marked nocturnal depletion in the starch reservoirs and an atypical pattern of nitrate reduction restricted to the nighttime were also observed. Since reduction and assimilation of nitrate requires a massive supply of reducing power and energy and considering that T. pohliana lives overexposed to the sunlight, we hypothesize that citrate decarboxylation might be an accessory mechanism to increase internal CO₂ concentration during the day while its biosynthesis could provide NADH and ATP for nocturnal assimilation of nitrate. Therefore, besides delivering photoprotection during the day, citrate might represent a key component connecting both CAM pathway and nitrogen metabolism in T. pohliana; a scenario that certainly deserves further study not only in this species but also in other CAM plants that nocturnally accumulate citrate

  19. Diel cycling of zinc in a stream impacted by acid rock drainage: Initial results from a new in situ Zn analyzer

    USGS Publications Warehouse

    Chapin, T.P.; Nimick, D.A.; Gammons, C.H.; Wanty, R.B.

    2007-01-01

    Recent work has demonstrated that many trace metals undergo dramatic diel (24-h) cycles in near neutral pH streams with metal concentrations reproducibly changing up to 500% during the diel period (Nimick et al., 2003). To examine diel zinc cycles in streams affected by acid rock drainage, we have developed a novel instrument, the Zn-DigiScan, to continuously monitor in situ zinc concentrations in near real-time. Initial results from a 3-day deployment at Fisher Creek, Montana have demonstrated the ability of the Zn-DigiScan to record diel Zn cycling at levels below 100 ??g/l. Longer deployments of this instrument could be used to examine the effects of episodic events such as rainstorms and snowmelt pulses on zinc loading in streams affected by acid rock drainage. ?? Springer Science+Business Media B.V. 2006.

  20. Tandem dissolution of UO 3 in amide-based acidic ionic liquid and in situ electrodeposition of UO 2 with regeneration of the ionic liquid: a closed cycle

    DOE PAGES

    Wanigasekara, Eranda; Freiderich, John W.; Sun, Xiao-Guang; ...

    2016-05-19

    A closed cycle is demonstrated for the tandem dissolution and electroreduction of UO 3 to UO 2 with regeneration of the acidic ionic liquid. The dissolution is achieved by use of the acidic ionic liquid N,N-dimethylacetimidium bis(trifluoromethanesulfonimide) in 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonimide) serving as the diluent. Bulk electrolysis performed at 1.0 V vs. Ag reference yields a dark brown-black uranium deposit (UO 2) on the cathode. Anodic oxidation of water in the presence of dimethylacetamide regenerates the acidic ionic liquid. We have demonstrated the individual steps in the cycle together with a sequential dissolution, electroreduction, and regeneration cycle.

  1. Tandem dissolution of UO 3 in amide-based acidic ionic liquid and in situ electrodeposition of UO 2 with regeneration of the ionic liquid: a closed cycle

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wanigasekara, Eranda; Freiderich, John W.; Sun, Xiao-Guang

    A closed cycle is demonstrated for the tandem dissolution and electroreduction of UO 3 to UO 2 with regeneration of the acidic ionic liquid. The dissolution is achieved by use of the acidic ionic liquid N,N-dimethylacetimidium bis(trifluoromethanesulfonimide) in 1-ethyl-3-methylimidazolium bis(trifluoromethanesulfonimide) serving as the diluent. Bulk electrolysis performed at 1.0 V vs. Ag reference yields a dark brown-black uranium deposit (UO 2) on the cathode. Anodic oxidation of water in the presence of dimethylacetamide regenerates the acidic ionic liquid. We have demonstrated the individual steps in the cycle together with a sequential dissolution, electroreduction, and regeneration cycle.

  2. Optimized Extraction Method To Remove Humic Acid Interferences from Soil Samples Prior to Microbial Proteome Measurements.

    PubMed

    Qian, Chen; Hettich, Robert L

    2017-07-07

    The microbial composition and their activities in soil environments play a critical role in organic matter transformation and nutrient cycling. Liquid chromatography coupled to high-performance mass spectrometry provides a powerful approach to characterize soil microbiomes; however, the limited microbial biomass and the presence of abundant interferences in soil samples present major challenges to proteome extraction and subsequent MS measurement. To this end, we have designed an experimental method to improve microbial proteome measurement by removing the soil-borne humic substances coextraction from soils. Our approach employs an in situ detergent-based microbial lysis/TCA precipitation coupled to an additional cleanup step involving acidified precipitation and filtering at the peptide level to remove most of the humic acid interferences prior to proteolytic peptide measurement. The novelty of this approach is an integration to exploit two different characteristics of humic acids: (1) Humic acids are insoluble in acidic solution but should not be removed at the protein level, as undesirable protein removal may also occur. Rather it is better to leave the humics acids in the samples until the peptide level, at which point the significant differential solubility of humic acids versus peptides at low pH can be exploited very efficiently. (2) Most of the humic acids have larger molecule weights than the peptides. Therefore, filtering a pH 2 to 3 peptide solution with a 10 kDa filter will remove most of the humic acids. This method is easily interfaced with normal proteolytic processing approaches and provides a reliable and straightforward protein extraction method that efficiently removes soil-borne humic substances without inducing proteome sample loss or biasing protein identification in mass spectrometry. In general, this humic acid removal step is universal and can be adopted by any workflow to effectively remove humic acids to avoid them negatively competing

  3. Quantitative assessment of brain glucose metabolic rates using in vivo deuterium magnetic resonance spectroscopy.

    PubMed

    Lu, Ming; Zhu, Xiao-Hong; Zhang, Yi; Mateescu, Gheorghe; Chen, Wei

    2017-11-01

    Quantitative assessment of cerebral glucose consumption rate (CMR glc ) and tricarboxylic acid cycle flux (V TCA ) is crucial for understanding neuroenergetics under physiopathological conditions. In this study, we report a novel in vivo Deuterium ( 2 H) MRS (DMRS) approach for simultaneously measuring and quantifying CMR glc and V TCA in rat brains at 16.4 Tesla. Following a brief infusion of deuterated glucose, dynamic changes of isotope-labeled glucose, glutamate/glutamine (Glx) and water contents in the brain can be robustly monitored from their well-resolved 2 H resonances. Dynamic DMRS glucose and Glx data were employed to determine CMR glc and V TCA concurrently. To test the sensitivity of this method in response to altered glucose metabolism, two brain conditions with different anesthetics were investigated. Increased CMR glc (0.46 vs. 0.28 µmol/g/min) and V TCA (0.96 vs. 0.6 µmol/g/min) were found in rats under morphine as compared to deeper anesthesia using 2% isoflurane. This study demonstrates the feasibility and new utility of the in vivo DMRS approach to assess cerebral glucose metabolic rates at high/ultrahigh field. It provides an alternative MRS tool for in vivo study of metabolic coupling relationship between aerobic and anaerobic glucose metabolisms in brain under physiopathological states.

  4. The viability of a nonenzymatic reductive citric acid cycle - Kinetics and thermochemistry

    USGS Publications Warehouse

    Ross, D.S.

    2007-01-01

    The likelihood of a functioning nonenzymatic reductive citric acid cycle, recently proposed as the precursor to biosynthesis on early Earth, is examined on the basis of the kinetics and thermochemistry of the acetate ??? pyruvate ??? oxaloacetate ??? malate sequence. Using data derived from studies of the Pd-catalyzed phosphinate reduction of carbonyl functions it is shown that the rate of conversion of pyruvate to malate with that system would have been much too slow to have played a role in the early chemistry of life, while naturally occurring reduction systems such as the fayalite-magnetite-quartz and pyrrhotite-pyrite-magnetite mineral assemblages would have provided even slower conversions. It is also shown that the production of pyruvate from acetate is too highly endoergic to be driven by a naturally occurring energy source such as pyrophosphate. It is thus highly doubtful that the cycle can operate at suitable rates without enzymes, and most unlikely that it could have participated in the chemistry leading to life. ?? 2006 Springer Science + Business Media B.V.

  5. Therapeutic value of trichloroacetic acid in the treatment of isolated genital warts on the external female genitalia.

    PubMed

    Taner, Zeki M; Taskiran, Cagatay; Onan, Anil M; Gursoy, Rifat; Himmetoglu, Ozdemir

    2007-06-01

    To evaluate the value of 85% trichloroacetic acid (TCA) in the treatment of human papillomavirus (HPV)-associated genital warts of the external genitalia and to detect the recurrence rate and side effects of this therapeutic regimen. All patients with a suspected HPV-related papillary vulvar lesion after initial examination underwent vulvoscopic evaluation with a magnification of 8-20x using acetic acid and toluidine blue. Under local anesthesia, biopsies were taken from acuminate or papillary warts for histopathologic confirmation and from suspicious areas to exclude preinvasive or invasive diseases. Following histopathologic diagnosis, patients were treated with 85% TCA. Overall, 51 patients with isolated vulvar and/or perianal genital warts were included. Of those patients, 11 (21.5%) had acuminate and 40 (78.5%) had papular genital warts. All the women had lesions of the labia minora. The other localizations were as follows: labia majora, 18 (35.3%); lateral vulva, 5 (9.8%); clitoris, 9 (17.6%); fourchette, 16 (31.3%); and perianal area, 7 (13.7%). All lesions were successfully treated by the end of the treatment period (median, 4; range 2-5). None of the patients had recurrence or new lesions during the 6-month follow-up period. In the second 6 months, 9 patients (17.6%) were diagnosed with recurrent lesions. Although all the patients experienced transient burning pain during therapy, none of them discontinued the therapy. Ulceration was observed in 8 patients (15.6%). Of those patients only 3 had permanent scarring (5.8%). We recommend the use of TCA in patients with external genital warts, especially for mild to moderate cases. It is associated with a high success rate and low morbidity if sufficient care is taken during application.

  6. Differential effects of safflower oil versus fish oil feeding on insulin-stimulated glycogen synthesis, glycolysis, and pyruvate dehydrogenase flux in skeletal muscle: a 13C nuclear magnetic resonance study.

    PubMed

    Jucker, B M; Cline, G W; Barucci, N; Shulman, G I

    1999-01-01

    To examine the effects of safflower oil versus fish oil feeding on in vivo intramuscular glucose metabolism and relative pyruvate dehydrogenase (PDH) versus tricarboxylic acid (TCA) cycle flux, rats were pair-fed on diets consisting of 1) 59% safflower oil, 2) 59% menhaden fish oil, or 3) 59% carbohydrate (control) in calories. Rates of glycolysis and glycogen synthesis were assessed by monitoring [1-(13)C]glucose label incorporation into [1-(13)C]glycogen, [3-(13)C]lactate, and [3-(13)C]alanine in the hindlimb of awake rats via 13C nuclear magnetic resonance (NMR) spectroscopy during a euglycemic (approximately 6 mmol/l) hyperinsulinemic (approximately 180 microU/ml) clamp. A steady-state isotopic analysis of lactate, alanine, and glutamate was used to determine the relative PDH versus TCA cycle flux present in muscle under these conditions. The safflower oil-fed rats were insulin resistant compared with control and fish oil-fed rats, as reflected by a markedly reduced glucose infusion rate (Ginf) during the clamp (21.4 +/- 2.3 vs. 31.6 +/- 2.8 and 31.7 +/- 1.9 mg x kg(-1) x min(-1) in safflower oil versus control and fish oil groups, respectively, P < 0.006). This decrease in insulin-stimulated glucose disposal in the safflower oil group was associated with a lower rate of glycolysis (21.7 +/- 2.2 nmol x g(-1) x min(-1)) versus control (62.1 +/- 10.3 nmol x g(-1) x min(-1), P < 0.001) and versus fish oil (45.7 +/- 6.7 nmol x g(-1) x min(-1), P < 0.04), as no change in glycogen synthesis (103 +/- 15, 133 +/- 19, and 125 +/- 14 nmol x g(-1) x min(-1) in safflower oil, fish oil, and control, respectively) was detected. The intramuscular triglyceride (TG) content was increased in the safflower oil group (7.3 +/- 0.8 micromol/g) compared with the control group (5.2 +/- 0.8 micromol/g, P < 0.05) and the fish oil group (3.6 +/- 1.1 micromol/g, P < 0.01). Conversely, the percent PDH versus TCA cycle flux was decreased in the safflower oil (43 +/- 8%) versus the control

  7. Rewiring the reductive tricarboxylic acid pathway and L-malate transport pathway of Aspergillus oryzae for overproduction of L-malate.

    PubMed

    Liu, Jingjing; Xie, Zhipeng; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Chen, Jian; Liu, Long

    2017-07-10

    Aspergillus oryzae finds wide application in the food, feed, and wine industries, and is an excellent cell factory platform for production of organic acids. In this work, we achieved the overproduction of L-malate by rewiring the reductive tricarboxylic acid (rTCA) pathway and L-malate transport pathway of A. oryzae NRRL 3488. First, overexpression of native pyruvate carboxylase and malate dehydrogenase in the rTCA pathway improved the L-malate titer from 26.1gL -1 to 42.3gL -1 in shake flask culture. Then, the oxaloacetate anaplerotic reaction was constructed by heterologous expression of phosphoenolpyruvate carboxykinase and phosphoenolpyruvate carboxylase from Escherichia coli, increasing the L-malate titer to 58.5gL -1 . Next, the export of L-malate from the cytoplasm to the external medium was strengthened by overexpression of a C4-dicarboxylate transporter gene from A. oryzae and an L-malate permease gene from Schizosaccharomyces pombe, improving the L-malate titer from 58.5gL -1 to 89.5gL -1 . Lastly, guided by transcription analysis of the expression profile of key genes related to L-malate synthesis, the 6-phosphofructokinase encoded by the pfk gene was identified as a potential limiting step for L-malate synthesis. Overexpression of pfk with the strong sodM promoter increased the L-malate titer to 93.2gL -1 . The final engineered A. oryzae strain produced 165gL -1 L-malate with a productivity of 1.38gL -1 h -1 in 3-L fed-batch culture. Overall, we constructed an efficient L-malate producer by rewiring the rTCA pathway and L-malate transport pathway of A. oryzae NRRL 3488, and the engineering strategy adopted here may be useful for the construction of A. oryzae cell factories to produce other organic acids. Copyright © 2017 Elsevier B.V. All rights reserved.

  8. Pretreatment with oleic acid accelerates the entrance into the mitotic cycle of EGF-stimulated fibroblasts.

    PubMed

    Zugaza, J L; Casabiell, X A; Bokser, L; Eiras, A; Beiras, A; Casanueva, F F

    1995-07-01

    We have previously demonstrated that pretreatment of several cell lines with cis-unsaturated fatty acids, like oleic acid, blocks epidermal growth factor (EGF)-induced early ionic signals, and in particular the [Ca2+]i rise. In the present work we show that this blockade does not alter EGF-stimulated cellular proliferation evaluated by direct cell counting, but induces a powerful enhancement in the pulsed thymidine incorporation assay. The lack of effect of oleic acid on EGF-stimulated cellular proliferation was confirmed by repeated cell counts, cumulative thymidine incorporation, and protein synthesis, but a clear synergistic effect between oleic acid and EGF was again obtained by means of time course experiments with pulsed thymidine. Combined flow cytometry analysis and cell counts at earlier times in EGF-stimulated cells showed that oleic acids accelerates the entrance of cells into the replicative cycle leading to an earlier cell division. Afterward, these oleic acid-pretreated cells became delayed by an unknown compensatory mechanism in such a way that at 48 h post-EGF, the cell count in control and oleic acid-pretreated cells was equal. In conclusion (a) oleic acid accelerates or enhances the EGF mitogenic action and (b) in the long term cells compensate the initial perturbation with respect to untreated cells. As a side observation, the widely employed pulsed thymidine incorporation method as a measure of cell division could be extremely misleading unless experimental conditions are well controlled.

  9. Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis

    PubMed Central

    Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F.; Lane, Andrew N.; Romick-Rosendale, Lindsey E.; Wells, Susanne I.

    2017-01-01

    The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth. PMID:28558019

  10. Dysfunctional BMPR2 signaling drives an abnormal endothelial requirement for glutamine in pulmonary arterial hypertension.

    PubMed

    Egnatchik, Robert A; Brittain, Evan L; Shah, Amy T; Fares, Wassim H; Ford, H James; Monahan, Ken; Kang, Christie J; Kocurek, Emily G; Zhu, Shijun; Luong, Thong; Nguyen, Thuy T; Hysinger, Erik; Austin, Eric D; Skala, Melissa C; Young, Jamey D; Roberts, L Jackson; Hemnes, Anna R; West, James; Fessel, Joshua P

    2017-03-01

    Pulmonary arterial hypertension (PAH) is increasingly recognized as a systemic disease driven by alteration in the normal functioning of multiple metabolic pathways affecting all of the major carbon substrates, including amino acids. We found that human pulmonary hypertension patients (WHO Group I, PAH) exhibit systemic and pulmonary-specific alterations in glutamine metabolism, with the diseased pulmonary vasculature taking up significantly more glutamine than that of controls. Using cell culture models and transgenic mice expressing PAH-causing BMPR2 mutations, we found that the pulmonary endothelium in PAH shunts significantly more glutamine carbon into the tricarboxylic acid (TCA) cycle than wild-type endothelium. Increased glutamine metabolism through the TCA cycle is required by the endothelium in PAH to survive, to sustain normal energetics, and to manifest the hyperproliferative phenotype characteristic of disease. The strict requirement for glutamine is driven by loss of sirtuin-3 (SIRT3) activity through covalent modification by reactive products of lipid peroxidation. Using 2-hydroxybenzylamine, a scavenger of reactive lipid peroxidation products, we were able to preserve SIRT3 function, to normalize glutamine metabolism, and to prevent the development of PAH in BMPR2 mutant mice. In PAH, targeting glutamine metabolism and the mechanisms that underlie glutamine-driven metabolic reprogramming represent a viable novel avenue for the development of potentially disease-modifying therapeutics that could be rapidly translated to human studies.

  11. Overexpression of the human DEK oncogene reprograms cellular metabolism and promotes glycolysis.

    PubMed

    Matrka, Marie C; Watanabe, Miki; Muraleedharan, Ranjithmenon; Lambert, Paul F; Lane, Andrew N; Romick-Rosendale, Lindsey E; Wells, Susanne I

    2017-01-01

    The DEK oncogene is overexpressed in many human malignancies including at early tumor stages. Our reported in vitro and in vivo models of squamous cell carcinoma have demonstrated that DEK contributes functionally to cellular and tumor survival and to proliferation. However, the underlying molecular mechanisms remain poorly understood. Based on recent RNA sequencing experiments, DEK expression was necessary for the transcription of several metabolic enzymes involved in anabolic pathways. This identified a possible mechanism whereby DEK may drive cellular metabolism to enable cell proliferation. Functional metabolic Seahorse analysis demonstrated increased baseline and maximum extracellular acidification rates, a readout of glycolysis, in DEK-overexpressing keratinocytes and squamous cell carcinoma cells. DEK overexpression also increased the maximum rate of oxygen consumption and therefore increased the potential for oxidative phosphorylation (OxPhos). To detect small metabolites that participate in glycolysis and the tricarboxylic acid cycle (TCA) that supplies substrate for OxPhos, we carried out NMR-based metabolomics studies. We found that high levels of DEK significantly reprogrammed cellular metabolism and altered the abundances of amino acids, TCA cycle intermediates and the glycolytic end products lactate, alanine and NAD+. Taken together, these data support a scenario whereby overexpression of the human DEK oncogene reprograms keratinocyte metabolism to fulfill energy and macromolecule demands required to enable and sustain cancer cell growth.

  12. Mycobacterium avium Genes Associated with the Ability To Form a Biofilm

    PubMed Central

    Yamazaki, Yoshitaka; Danelishvili, Lia; Wu, Martin; MacNab, Molly; Bermudez, Luiz E.

    2006-01-01

    Mycobacterium avium is widely distributed in the environment, and it is chiefly found in water and soil. M. avium, as well as Mycobacterium smegmatis, has been recognized to produce a biofilm or biofilm-like structure. We screened an M. avium green fluorescent protein (GFP) promoter library in M. smegmatis for genes involved in biofilm formation on polyvinyl chloride (PVC) plates. Clones associated with increased GFP expression ≥2.0-fold over the baseline were sequenced. Seventeen genes, most encoding proteins of the tricarboxylic acid (TCA) cycle and GDP-mannose and fatty acid biosynthesis, were identified. Their regulation in M. avium was confirmed by examining the expression of a set of genes by real-time PCR after incubation on PVC plates. In addition, screening of 2,000 clones of a transposon mutant bank constructed using M. avium strain A5, a mycobacterial strain with the ability to produce large amounts of biofilm, revealed four mutants with an impaired ability to form biofilm. Genes interrupted by transposons were homologues of M. tuberculosis 6-oxodehydrogenase (sucA), enzymes of the TCA cycle, protein synthetase (pstB), enzymes of glycopeptidolipid (GPL) synthesis, and Rv1565c (a hypothetical membrane protein). In conclusion, it appears that GPL biosynthesis, including the GDP-mannose biosynthesis pathway, is the most important pathway involved in the production of M. avium biofilm. PMID:16391123

  13. TCA precipitation and ethanol/HCl single-step purification evaluation: One-dimensional gel electrophoresis, bradford assays, spectrofluorometry and Raman spectroscopy data on HSA, Rnase, lysozyme - Mascots and Skyline data.

    PubMed

    Eddhif, Balkis; Guignard, Nadia; Batonneau, Yann; Clarhaut, Jonathan; Papot, Sébastien; Geffroy-Rodier, Claude; Poinot, Pauline

    2018-04-01

    The data presented here are related to the research paper entitled "Study of a Novel Agent for TCA Precipitated Proteins Washing - Comprehensive Insights into the Role of Ethanol/HCl on Molten Globule State by Multi-Spectroscopic Analyses" (Eddhif et al., submitted for publication) [1]. The suitability of ethanol/HCl for the washing of TCA-precipitated proteins was first investigated on standard solution of HSA, cellulase, ribonuclease and lysozyme. Recoveries were assessed by one-dimensional gel electrophoresis, Bradford assays and UPLC-HRMS. The mechanistic that triggers protein conformational changes at each purification stage was then investigated by Raman spectroscopy and spectrofluorometry. Finally, the efficiency of the method was evaluated on three different complex samples (mouse liver, river biofilm, loamy soil surface). Proteins profiling was assessed by gel electrophoresis and by UPLC-HRMS.

  14. Diversity of Total Bacterial Communities and Chemoautotrophic Populations in Sulfur-Rich Sediments of Shallow-Water Hydrothermal Vents off Kueishan Island, Taiwan.

    PubMed

    Wang, Li; Cheung, Man Kit; Liu, Rulong; Wong, Chong Kim; Kwan, Hoi Shan; Hwang, Jiang-Shiou

    2017-04-01

    Shallow-water hydrothermal vents (HTVs) are an ecologically important habitat with a geographic origin similar to that of deep-sea HTVs. Studies on shallow-water HTVs have not only facilitated understanding of the influences of vents on local ecosystems but also helped to extend the knowledge on deep-sea vents. In this study, the diversity of bacterial communities in the sediments of shallow-water HTVs off Kueishan Island, Taiwan, was investigated by examining the 16S ribosomal RNA gene as well as key functional genes involved in chemoautotrophic carbon fixation (aclB, cbbL and cbbM). In the vent area, Sulfurovum and Sulfurimonas of Epsilonproteobacteria appeared to dominate the benthic bacterial community. Results of aclB gene analysis also suggested involvement of these bacteria in carbon fixation using the reductive tricarboxylic acid (rTCA) cycle. Analysis of the cbbM gene showed that Alphaproteobacterial members such as the purple non-sulfur bacteria were the major chemoautotrophic bacteria involving in carbon fixation via the Calvin-Benson-Bassham (CBB) cycle. However, they only accounted for <2% of the total bacterial community in the vent area. These findings suggest that the rTCA cycle is the major chemoautotrophic carbon fixation pathway in sediments of the shallow-water HTVs off Kueishan Island.

  15. A reverse glyoxylate shunt to build a non-native route from C4 to C2 in Escherichia coli.

    PubMed

    Mainguet, Samuel E; Gronenberg, Luisa S; Wong, Sio Si; Liao, James C

    2013-09-01

    Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C4 carboxylates into two molecules of acetyl-CoA without loss of CO2. Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. © 2013 Elsevier Inc. All rights reserved.

  16. Dietary Deficiency of Essential Amino Acids Rapidly Induces Cessation of the Rat Estrous Cycle

    PubMed Central

    Bannai, Makoto; Ichimaru, Toru; Nakano, Sayako; Murata, Takuya; Higuchi, Takashi; Takahashi, Michio

    2011-01-01

    Reproductive functions are regulated by the sophisticated coordination between the neuronal and endocrine systems and are sustained by a proper nutritional environment. Female reproductive function is vulnerable to effects from dietary restrictions, suggesting a transient adaptation that prioritizes individual survival over reproduction until a possible future opportunity for satiation. This adaptation could also partially explain the existence of amenorrhea in women with anorexia nervosa. Because amino acid nutritional conditions other than caloric restriction uniquely alters amino acid metabolism and affect the hormonal levels of organisms, we hypothesized that the supply of essential amino acids in the diet plays a pivotal role in the maintenance of the female reproductive system. To test this hypothesis, we examined ovulatory cyclicity in female rats under diets that were deficient in threonine, lysine, tryptophan, methionine or valine. Ovulatory cyclicity was monitored by daily cytological evaluations of vaginal smears. After continuous feeding of the deficient diet, a persistent diestrus or anovulatory state was induced most quickly by the valine-deficient diet and most slowly by the lysine-deficient diet. A decline in the systemic insulin-like growth factor 1 level was associated with a dietary amino acid deficiency. Furthermore, a paired group of rats that were fed an isocaloric diet with balanced amino acids maintained normal estrous cyclicity. These disturbances of the estrous cycle by amino acid deficiency were quickly reversed by the consumption of a normal diet. The continuous anovulatory state in this study is not attributable to a decrease in caloric intake but to an imbalance in the dietary amino acid composition. With a shortage of well-balanced amino acid sources, reproduction becomes risky for both the mother and the fetus. It could be viewed as an adaptation to the diet, diverting resources away from reproduction and reallocating them to

  17. Citric acid induces cell-cycle arrest and apoptosis of human immortalized keratinocyte cell line (HaCaT) via caspase- and mitochondrial-dependent signaling pathways.

    PubMed

    Ying, Tsung-Ho; Chen, Chia-Wei; Hsiao, Yu-Ping; Hung, Sung-Jen; Chung, Jing-Gung; Yang, Jen-Hung

    2013-10-01

    Citric acid is an alpha-hydroxyacid (AHA) widely used in cosmetic dermatology and skincare products. However, there is concern regarding its safety for the skin. In this study, we investigated the cytotoxic effects of citric acid on the human keratinocyte cell line HaCaT. HaCaT cells were treated with citric acid at 2.5-12.5 mM for different time periods. Cell-cycle arrest and apoptosis were investigated by 4,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining, flow cytometry, western blot and confocal microscopy. Citric acid not only inhibited proliferation of HaCaT cells in a dose-dependent manner, but also induced apoptosis and cell cycle-arrest at the G2/M phase (before 24 h) and S phase (after 24 h). Citric acid increased the level of Bcl-2-associated X protein (BAX) and reduced the levels of B-cell lymphoma-2 (BCL-2), B-cell lymphoma-extra large (BCL-XL) and activated caspase-9 and caspase-3, which subsequently induced apoptosis via caspase-dependent and caspase-independent pathways. Citric acid also activated death receptors and increased the levels of caspase-8, activated BH3 interacting-domain death agonist (BID) protein, Apoptosis-inducing factor (AIF), and Endonuclease G (EndoG). Therefore, citric acid induces apoptosis through the mitochondrial pathway in the human keratinocyte cell line HaCaT. The study results suggest that citric acid is cytotoxic to HaCaT cells via induction of apoptosis and cell-cycle arrest in vitro.

  18. Genetic variations in IDH gene as prognosis predictors in TACE-treated hepatocellular carcinoma patients.

    PubMed

    Zhang, Huiqing; Guo, Xu; Dai, Jingyao; Wu, Yousheng; Ge, Naijian; Yang, Yefa; Ji, Jiansong; Zhang, Hongxin

    2014-11-01

    Metabolic reprogramming is an important hallmark of cancer cells, including the alterations of activity and expression in tricarboxylic acid (TCA) cycle key enzymes. Previous studies have reported the associations between tumor formation and three core enzymes involved in the TCA cycle. However, the association between functional single nucleotide polymorphisms (SNPs) in one of TCA cycle key gene isocitrate dehydrogenase (IDH) and the overall survival of hepatocellular carcinoma (HCC) patients treated with transcatheter arterial chemoembolization (TACE) has never been investigated. Five functional SNPs in IDH1 and IDH2 genes were genotyped using the Sequenom iPLEX genotyping system in a cohort of 419 unresectable Chinese HCC patients treated with TACE. Multivariate Cox proportional hazards model and Kaplan-Meier curve were used for the prognosis analysis. We found that SNPs rs12478635 in IDH1 and rs11632348 in IDH2 gene exhibited significant associations with death risk in HCC patients in the dominant model (HR 1.33; 95 % CI 1.02-1.73; P = 0.037) and in recessive model (HR 1.87; 95 % CI 1.27-2.75; P = 0.001), respectively. Moreover, we observed a cumulative effect of these two SNPs on HCC overall survival, indicating a significant trend of death risk increase with increasing number of unfavorable genotypes (P for trend = 0.001). Additionally, our data suggest that unfavorable genotypes of two SNPs may be used as an independent prognostic marker in those with advanced stage and patients with serum AFP <200 μg/L. Our results for the first time suggest that IDH gene polymorphisms may serve as an independent prognostic marker for HCC patients treated with TACE.

  19. Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr.

    PubMed

    Datta, Prasun K; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C; Fecchio, Chiara; Barrero, Carlos A

    2016-09-01

    HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS.

  20. Inhibition of oxidative phosphorylation for enhancing citric acid production by Aspergillus niger.

    PubMed

    Wang, Lu; Zhang, Jianhua; Cao, Zhanglei; Wang, Yajun; Gao, Qiang; Zhang, Jian; Wang, Depei

    2015-01-16

    intracellular ATP can accelerate glycolysis and the TCA cycle to enhance citric acid yield.

  1. Beta-oxidation as channeled reaction linked to citric acid cycle: evidence from measurements of mitochondrial pyruvate oxidation during fatty acid degradation.

    PubMed

    Förster, M E; Staib, W

    1992-07-01

    1. The kinetics of mitochondrial mammalian pyruvate dehydrogenase multienzyme complex (PDHC) is studied by the formation of CO2 using tracer amounts of [1-14C]pyruvate. It is found that the Hill plot results in a (pseudo-)cooperativity with a transition of n-1----3 at a pyruvate concentration about Ks. 2. Addition of L-carnitine, octanoate, palmitoyl-CoA or palmitate + L-carnitine + fatty acid-binding protein results in a Hill coefficient of n = 2 following the kinetics of pyruvate oxidation. 3. Addition of fatty acid-binding protein to an assay system oxidizing palmitate in presence of L-carnitine alters the pattern of the kinetics in the Hill plot so that an apparently lower level of L-carnitine is necessary for the reaction course of beta-degradation. 4. It is concluded that beta-degradation is a coordinated, multienzyme-complex based mechanism tightly linked to citric acid cycle and it is proposed that L-carnitine is actively involved into the reaction and not only functioning as carrier-molecule for transmembrane transport.

  2. FabQ, a Dual-Function Dehydratase/Isomerase, Circumvents the Last Step of the Classical Fatty Acid Synthesis Cycle

    PubMed Central

    Bi, Hongkai; Wang, Haihong; Cronan, John E.

    2015-01-01

    SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938

  3. Biochemistry and control of the reductive tricarboxylic acid pathway of CO 2 fixation and physiological role of the Rubis CO-like protein

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tabita, F. Robert

    2008-12-04

    During the past years of this project we have made progress relative to the two major goals of the proposal: (1) to study the biochemistry and regulation of the reductive TCA cycle of CO 2 fixation and (2) to probe the physiological role of a RubisCO-like protein (RLP). Both studies primarily employ the green sulfur bacterium Chlorobium tepidum as well as other photosynthetic bacteria including Rhodospirillum rubrum and Rhodopseudomonas palustris.

  4. Sulfide oxidation, nitrate respiration, carbon acquisition, and electron transport pathways suggested by the draft genome of a single orange Guaymas Basin Beggiatoa (Cand. Maribeggiatoa) sp. filament.

    PubMed

    MacGregor, Barbara J; Biddle, Jennifer F; Harbort, Christopher; Matthysse, Ann G; Teske, Andreas

    2013-09-01

    A near-complete draft genome has been obtained for a single vacuolated orange Beggiatoa (Cand. Maribeggiatoa) filament from a Guaymas Basin seafloor microbial mat, the third relatively complete sequence for the Beggiatoaceae. Possible pathways for sulfide oxidation; nitrate respiration; inorganic carbon fixation by both Type II RuBisCO and the reductive tricarboxylic acid cycle; acetate and possibly formate uptake; and energy-generating electron transport via both oxidative phosphorylation and the Rnf complex are discussed here. A role in nitrite reduction is suggested for an abundant orange cytochrome produced by the Guaymas strain; this has a possible homolog in Beggiatoa (Cand. Isobeggiatoa) sp. PS, isolated from marine harbor sediment, but not Beggiatoa alba B18LD, isolated from a freshwater rice field ditch. Inferred phylogenies for the Calvin-Benson-Bassham (CBB) cycle and the reductive (rTCA) and oxidative (TCA) tricarboxylic acid cycles suggest that genes encoding succinate dehydrogenase and enzymes for carboxylation and/or decarboxylation steps (including RuBisCO) may have been introduced to (or exported from) one or more of the three genomes by horizontal transfer, sometimes by different routes. Sequences from the two marine strains are generally more similar to each other than to sequences from the freshwater strain, except in the case of RuBisCO: only the Guaymas strain encodes a Type II enzyme, which (where studied) discriminates less against oxygen than do Type I RuBisCOs. Genes subject to horizontal transfer may represent key steps for adaptation to factors such as oxygen and carbon dioxide concentration, organic carbon availability, and environmental variability. © 2013.

  5. A Critical Review on the Effect of Docosahexaenoic Acid (DHA) on Cancer Cell Cycle Progression.

    PubMed

    Newell, Marnie; Baker, Kristi; Postovit, Lynne M; Field, Catherine J

    2017-08-17

    Globally, there were 14.1 million new cancer diagnoses and 8.2 million cancer deaths in 2012. For many cancers, conventional therapies are limited in their successes and an improved understanding of disease progression is needed in conjunction with exploration of alternative therapies. The long chain polyunsaturated fatty acid, docosahexaenoic acid (DHA), has been shown to enhance many cellular responses that reduce cancer cell viability and decrease proliferation both in vitro and in vivo. A small number of studies suggest that DHA improves chemotherapy outcomes in cancer patients. It is readily incorporated into cancer cell membranes and, as a result there has been considerable research regarding cell membrane initiated events. For example, DHA has been shown to mediate the induction of apoptosis/reduction of proliferation in vitro and in vivo. However, there is limited research into the effect of DHA on cell cycle regulation in cancer cells and the mechanism(s) by which DHA acts are not fully understood. The purpose of the current review is to provide a critical examination of the literature investigating the ability of DHA to stall progression during different cell cycle phases in cancer cells, as well as the consequences that these changes may have on tumour growth, independently and in conjunction with chemotherapy.

  6. An Oral Load of [13C3]Glycerol and Blood NMR Analysis Detect Fatty Acid Esterification, Pentose Phosphate Pathway, and Glycerol Metabolism through the Tricarboxylic Acid Cycle in Human Liver.

    PubMed

    Jin, Eunsook S; Sherry, A Dean; Malloy, Craig R

    2016-09-02

    Drugs and other interventions for high impact hepatic diseases often target biochemical pathways such as gluconeogenesis, lipogenesis, or the metabolic response to oxidative stress. However, traditional liver function tests do not provide quantitative data about these pathways. In this study, we developed a simple method to evaluate these processes by NMR analysis of plasma metabolites. Healthy subjects ingested [U-(13)C3]glycerol, and blood was drawn at multiple times. Each subject completed three visits under differing nutritional states. High resolution (13)C NMR spectra of plasma triacylglycerols and glucose provided new insights into a number of hepatic processes including fatty acid esterification, the pentose phosphate pathway, and gluconeogenesis through the tricarboxylic acid cycle. Fasting stimulated pentose phosphate pathway activity and metabolism of [U-(13)C3]glycerol in the tricarboxylic acid cycle prior to gluconeogenesis or glyceroneogenesis. Fatty acid esterification was transient in the fasted state but continuous under fed conditions. We conclude that a simple NMR analysis of blood metabolites provides an important biomarker of pentose phosphate pathway activity, triacylglycerol synthesis, and flux through anaplerotic pathways in mitochondria of human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. A new MicroTCA-based waveform digitizer for the Muon g-2 experiment

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Sweigart, David A.

    We present the design of a newmore » $$\\mu$$TCA-based waveform digitizer, which will be deployed in the Muon g-2 experiment at Fermilab and will allow our pileup identification requirement to be met. This digitizer features five independent channels, each with 12-bit, 800-MSPS digitization and a 1-Gbit memory buffer. The data storage and readout along with configuration are handled by six Xilinx Kintex-7 FPGAs. In addition, the digitizer is equipped with a mezzanine card for analog signal conditioning prior to digitization, further widening its range of possible applications. The performance results of this design are also presented, highlighting its $$0.51 \\pm 0.13$$ mV intrinsic noise level and $< 22$ ps intrinsic timing resolution between channels. We believe that its performance, together with its flexible design, could be of interest to future experiments in search of a cost-effective waveform digitizer.« less

  8. Fermentable soluble fibres spare amino acids in healthy dogs fed a low-protein diet.

    PubMed

    Wambacq, Wendy; Rybachuk, Galena; Jeusette, Isabelle; Rochus, Kristel; Wuyts, Brigitte; Fievez, Veerle; Nguyen, Patrick; Hesta, Myriam

    2016-06-28

    that guar gum and sugar beet pulp supplementation diminishes postprandial use of amino acids favoring instead the use of short-chain fatty acids as substrate for the tricarboxylic acid (TCA) cycle. Further research is warranted to investigate the amino acid sparing effect of fermentable fibres in dogs with kidney/liver disease.

  9. Effects of nicotine on cellular proliferation, macromolecular synthesis and cell cycle phase distribution in human and murine cells

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Konno, S.; Chiao, J.; Rossi, J.

    1986-05-01

    Addition of nicotine causes a dose- and time-dependent inhibition of cell growth in established human and murine cells. In the human promyelocytic HL-60 leukemic cells, 3 mM nicotine results in a 50% inhibition of cellular proliferation after 80 h. Nicotine was also found to affect the cell cycle distribution of HL-60 cells. Treatment with 4 mM nicotine for 20 h causes an increase in proportion of Gl-phase cells (from 49% to 57%) and a significant decrease in the proportion of S-phase cells (from 41% to 32%). These results suggest that nicotine causes cell arrest in the Gl-phase which may inmore » part account for its effects on cell growth. To determine whether nicotine has a primary effect on the uptake/transport of macromolecular precursors into cells, HL-60 cells were treated with 2-6 mM nicotine for 30 h/sub 3/ at the end of which time cells were labeled with (/sup 3/H)thymidine, (/sup 3/H)uridine, (/sup 14/C)lysine and (/sup 35/S)methionine, the trichloroacetic acid (TCA) soluble and insoluble radioactivities from each of the labeling conditions were determined. These studies show that nicotine primarily affect the synthesis of proteins.« less

  10. Plasma acylcarnitine profiling indicates increased fatty acid oxidation relative to tricarboxylic acid cycle capacity in young, healthy low birth weight men.

    PubMed

    Ribel-Madsen, Amalie; Ribel-Madsen, Rasmus; Brøns, Charlotte; Newgard, Christopher B; Vaag, Allan A; Hellgren, Lars I

    2016-10-01

    We hypothesized that an increased, incomplete fatty acid beta-oxidation in mitochondria could be part of the metabolic events leading to insulin resistance and thereby an increased type 2 diabetes risk in low birth weight (LBW) compared with normal birth weight (NBW) individuals. Therefore, we measured fasting plasma levels of 45 acylcarnitine species in 18 LBW and 25 NBW men after an isocaloric control diet and a 5-day high-fat, high-calorie diet. We demonstrated that LBW men had higher C2 and C4-OH levels after the control diet compared with NBW men, indicating an increased fatty acid beta-oxidation relative to the tricarboxylic acid cycle flux. Also, they had higher C6-DC, C10-OH/C8-DC, and total hydroxyl-/dicarboxyl-acylcarnitine levels, which may suggest an increased fatty acid omega-oxidation in the liver. Furthermore, LBW and NBW men decreased several acylcarnitine levels in response to overfeeding, which is likely a result of an upregulation of fatty acid oxidation due to the dietary challenge. Moreover, C10-OH/C8-DC and total hydroxyl-/dicarboxyl-acylcarnitine levels tended to be negatively associated with the serum insulin level, and the total hydroxyl-/dicarboxyl-acylcarnitine level additionally tended to be negatively associated with the hepatic insulin resistance index. This indicates that an increased fatty acid omega-oxidation could be a compensatory mechanism to prevent an accumulation of lipid species that impair insulin signaling. © 2016 The Authors. Physiological Reports published by Wiley Periodicals, Inc. on behalf of the American Physiological Society and The Physiological Society.

  11. Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats☆

    PubMed Central

    Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.; Ward, William O.; Vallanat, Beena D.; Andrews, Debora L.; Schladweiler, Mette C.; Snow, Samantha J.; Bass, Virginia L.; Richards, Judy E.; Ghio, Andrew J.; Cascio, Wayne E.; Ledbetter, Allen D.; Kodavanti, Urmila P.

    2016-01-01

    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0 ppm O3, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. PMID:25838073

  12. Inhaled ozone (O3)-induces changes in serum metabolomic and liver transcriptomic profiles in rats.

    PubMed

    Miller, Desinia B; Karoly, Edward D; Jones, Jan C; Ward, William O; Vallanat, Beena D; Andrews, Debora L; Schladweiler, Mette C; Snow, Samantha J; Bass, Virginia L; Richards, Judy E; Ghio, Andrew J; Cascio, Wayne E; Ledbetter, Allen D; Kodavanti, Urmila P

    2015-07-15

    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O3) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O3 exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O3 at 0.25, 0.50, or 1.0ppm, 6h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a second experiment, rats were exposed to FA or 1.0ppm O3, 6h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18h post-exposure. O3 increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18h-post second exposure. O3 increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O3. In conclusion, short-term O3 exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress-response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. Published by Elsevier Inc.

  13. Diffusion of tricarboxylic acid cycle enzymes in the mitochondrial matrix in vivo. Evidence for restricted mobility of a multienzyme complex.

    PubMed

    Haggie, Peter M; Verkman, A S

    2002-10-25

    It has been proposed that enzymes in many metabolic pathways, including the tricarboxylic acid cycle in the mitochondrial matrix, are physically associated to facilitate substrate channeling and overcome diffusive barriers. We have used fluorescence recovery after photobleaching to measure the diffusional mobilities of chimeras consisting of green fluorescent protein (GFP) fused to the C terminus of four tricarboxylic acid cycle enzymes: malate dehydrogenase, citrate synthase, isocitrate dehydrogenase, and succinyl-CoA synthetase. The GFP-enzyme chimeras were localized selectively in the mitochondrial matrix in transfected Chinese hamster ovary (CHO) and COS7 cells. Laser photobleaching using a 0.7-microm diameter spot demonstrated restricted diffusion of the GFP-enzyme chimeras. Interestingly, all four chimeras had similar diffusional characteristics, approximately 45% of each chimera was mobile and had a diffusion coefficient of 4 x 10(-8) cm(2)/s. In contrast, unconjugated GFP in the mitochondrial matrix (targeted using COX8 leader sequence) diffused freely (nearly 100% mobility) with a greater diffusion coefficient of 20 x 10(-8) cm(2)/s. The mobility of the GFP-enzyme chimeras was insensitive to substrate source, ATP depletion, or inhibition of the adenine nucleotide translocase. These results indicate similar mobility characteristics of unrelated tricarboxylic acid cycle enzymes having different sizes and physical properties, providing biophysical evidence for a diffusible multienzyme complex in the mitochondrial matrix.

  14. Life cycle, techno-economic and dynamic simulation assessment of bioelectrochemical systems: A case of formic acid synthesis.

    PubMed

    Shemfe, Mobolaji; Gadkari, Siddharth; Yu, Eileen; Rasul, Shahid; Scott, Keith; Head, Ian M; Gu, Sai; Sadhukhan, Jhuma

    2018-05-01

    A novel framework, integrating dynamic simulation (DS), life cycle assessment (LCA) and techno-economic assessment (TEA) of a bioelectrochemical system (BES), has been developed to study for the first time wastewater treatment by removal of chemical oxygen demand (COD) by oxidation in anode and thereby harvesting electron and proton for carbon dioxide reduction reaction or reuse to produce products in cathode. Increases in initial COD and applied potential increase COD removal and production (in this case formic acid) rates. DS correlations are used in LCA and TEA for holistic performance analyses. The cost of production of HCOOH is €0.015-0.005 g -1 for its production rate of 0.094-0.26 kg yr -1 and a COD removal rate of 0.038-0.106 kg yr -1 . The life cycle (LC) benefits by avoiding fossil-based formic acid production (93%) and electricity for wastewater treatment (12%) outweigh LC costs of operation and assemblage of BES (-5%), giving a net 61MJkg -1 HCOOH saving. Copyright © 2018 The Authors. Published by Elsevier Ltd.. All rights reserved.

  15. Kinetic characterization of bile salt transport by human NTCP (SLC10A1).

    PubMed

    Jani, Márton; Beéry, Erzsébet; Heslop, Teresa; Tóth, Beáta; Jagota, Bhavana; Kis, Emese; Kevin Park, B; Krajcsi, Peter; Weaver, Richard J

    2018-02-01

    The transport of bile acids facilitated by NTCP is an important factor in establishing bile flow. In this study, we examine the kinetics associated with human NTCP-dependent transport of two quantitatively important bile acids comprising the human bile acid pool, chenodeoxycholic acid and glycine-chenodeoxycholate, and secondary bile salt, 3-sulfo-glycolithocholate of potential toxicological significance. The study employed human NTCP overexpressing Chinese Hamster Ovary cells and results compared with taurocholate, a prototypical bile salt commonly used in transporter studies. GCDC and 3S-GLC but not CDCA were transported by NTCP. The efficient uptake of GCDC, TCA and 3S-GLC by NTCP enabled the determination of kinetics. GCDC displayed a lower K M (0.569±0.318μM) than TCA (6.44±3.83μM) and 3S-GLC (3.78±1.17μM). The apparent CL int value for GCDC was 20-fold greater (153±53μl/mg protein/min) than the apparent CL int for TCA (6.92±4.72μl/mg protein/min) and apparent CL int for 3S-GLC (8.05±1.33μl/mg protein/min). These kinetic results provide important complementary data on the substrate selectivity and specificity of NTCP to transport bile acids. NTCP transports GCDC with greater efficiency than TCA and has the same efficacy for 3S-GLC and TCA. Copyright © 2017. Published by Elsevier Ltd.

  16. Cell cycle arrest and induction of apoptosis by cajanin stilbene acid from Cajanus cajan in breast cancer cells.

    PubMed

    Fu, Yujie; Kadioglu, Onat; Wiench, Benjamin; Wei, Zuofu; Gao, Chang; Luo, Meng; Gu, Chengbo; Zu, Yuangang; Efferth, Thomas

    2015-04-15

    The low abundant cajanin stilbene acid (CSA) from Pigeon Pea (Cajanus cajan) has been shown to kill estrogen receptor α positive cancer cells in vitro and in vivo. Downstream effects such as cell cycle and apoptosis-related mechanisms have not been analyzed yet. We analyzed the activity of CSA by means of flow cytometry (cell cycle distribution, mitochondrial membrane potential, MMP), confocal laser scanning microscopy (MMP), DNA fragmentation assay (apoptosis), Western blotting (Bax and Bcl-2 expression, caspase-3 activation) as well as mRNA microarray hybridization and Ingenuity pathway analysis. CSA induced G2/M arrest and apoptosis in a concentration-dependent manner from 8.88 to 14.79 µM. The MMP broke down, Bax was upregulated, Bcl-2 downregulated and caspase-3 activated. Microarray profiling revealed that CSA affected BRCA-related DNA damage response and cell cycle-regulated chromosomal replication pathways. CSA inhibited breast cancer cells by DNA damage and cell cycle-related signaling pathways leading to cell cycle arrest and apoptosis. Copyright © 2015 Elsevier GmbH. All rights reserved.

  17. The mechanisms of citrate on regulating the distribution of carbon flux in the biosynthesis of uridine 5'-monophosphate by Saccharomyces cerevisiae.

    PubMed

    Chen, Yong; Li, Shuya; Xiong, Jian; Li, Zhenjiang; Bai, Jianxin; Zhang, Lei; Ye, Qi; Ouyang, Pingkai; Ying, Hanjie

    2010-03-01

    A whole cell biocatalytic process for uridine 5'-monophosphate (UMP) production from orotic acid by Saccharomyces cerevisiae was developed. The concentration of UMP was increased by 23% when 1 g l(-1) sodium citrate was fed into the broth. Effects of citrate addition on UMP production were investigated. Glucose-6-phosphate pool was elevated by onefold, while FBP and pyruvate were decreased by 42% and 40%, respectively. Organic acid pools such as acetate and succinate were averagely decreased by 30% and 49%. The results demonstrated that manipulation of citrate levels could be used as a novel tool to regulate the metabolic fluxes distribution among glycolysis, pentose phosphate pathway, and TCA cycle.

  18. Resin-dentin bonds to EDTA-treated vs. acid-etched dentin using ethanol wet-bonding. Part II: Effects of mechanical cycling load on microtensile bond strengths.

    PubMed

    Sauro, Salvatore; Toledano, Manuel; Aguilera, Fatima Sánchez; Mannocci, Francesco; Pashley, David H; Tay, Franklin R; Watson, Timothy F; Osorio, Raquel

    2011-06-01

    To compare microtensile bond strengths (MTBS) subsequent to load cycling of resin bonded acid-etched or EDTA-treated dentin using a modified ethanol wet-bonding technique. Flat dentin surfaces were obtained from extracted human molars and conditioned using 37% H(3)PO(4) (PA) (15s) or 0.1M EDTA (60s). Five experimental adhesives and one commercial bonding agent were applied to the dentin and light-cured. Solvated experimental resins (50% ethanol/50% comonomers) were used as primers and their respective neat resins were used as the adhesives. The resin-bonded teeth were stored in distilled water (24h) or submitted to 5000 loading cycles of 90N. The bonded teeth were then sectioned in beams for MTBS. Modes of failure were examined by scanning electron microscopy. The most hydrophobic resin 1 gave the lowest bond strength values to both acid and EDTA-treated dentin. The hydrophobic resin 2 applied to EDTA-treated dentin showed lower bond strengths after cycling load but this did not occur when it was bonded to PA-etched dentin. Resins 3 and 4, which contained hydrophilic monomers, gave higher bond strengths to both EDTA-treated or acid-etched dentin and showed no significant difference after load cycling. The most hydrophilic resin 5 showed no significant difference in bond strengths after cycling loading when bonded to EDTA or phosphoric acid treated dentin but exhibited low bond strengths. The presence of different functional monomers influences the MTBS of the adhesive systems when submitted to cyclic loads. Adhesives containing hydrophilic comonomers are not affected by cycling load challenge especially when applied on EDTA-treated dentin followed by ethanol wet bonding. Copyright © 2011 Academy of Dental Materials. Published by Elsevier Ltd. All rights reserved.

  19. Simulating Metabolism with Statistical Thermodynamics

    PubMed Central

    Cannon, William R.

    2014-01-01

    New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed. PMID:25089525

  20. Simulating metabolism with statistical thermodynamics.

    PubMed

    Cannon, William R

    2014-01-01

    New methods are needed for large scale modeling of metabolism that predict metabolite levels and characterize the thermodynamics of individual reactions and pathways. Current approaches use either kinetic simulations, which are difficult to extend to large networks of reactions because of the need for rate constants, or flux-based methods, which have a large number of feasible solutions because they are unconstrained by the law of mass action. This report presents an alternative modeling approach based on statistical thermodynamics. The principles of this approach are demonstrated using a simple set of coupled reactions, and then the system is characterized with respect to the changes in energy, entropy, free energy, and entropy production. Finally, the physical and biochemical insights that this approach can provide for metabolism are demonstrated by application to the tricarboxylic acid (TCA) cycle of Escherichia coli. The reaction and pathway thermodynamics are evaluated and predictions are made regarding changes in concentration of TCA cycle intermediates due to 10- and 100-fold changes in the ratio of NAD+:NADH concentrations. Finally, the assumptions and caveats regarding the use of statistical thermodynamics to model non-equilibrium reactions are discussed.

  1. (13)C-metabolic flux analysis in S-adenosyl-L-methionine production by Saccharomyces cerevisiae.

    PubMed

    Hayakawa, Kenshi; Kajihata, Shuichi; Matsuda, Fumio; Shimizu, Hiroshi

    2015-11-01

    S-Adenosyl-L-methionine (SAM) is a major biological methyl group donor, and is used as a nutritional supplement and prescription drug. Yeast is used for the industrial production of SAM owing to its high intracellular SAM concentrations. To determine the regulation mechanisms responsible for such high SAM production, (13)C-metabolic flux analysis ((13)C-MFA) was conducted to compare the flux distributions in the central metabolism between Kyokai no. 6 (high SAM-producing) and S288C (control) strains. (13)C-MFA showed that the levels of tricarboxylic acid (TCA) cycle flux in SAM-overproducing strain were considerably increased compared to those in the S228C strain. Analysis of ATP balance also showed that a larger amount of excess ATP was produced in the Kyokai 6 strain because of increased oxidative phosphorylation. These results suggest that high SAM production in Kyokai 6 strains could be attributed to enhanced ATP regeneration with high TCA cycle fluxes and respiration activity. Thus, maintaining high respiration efficiency during cultivation is important for improving SAM production. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  2. Comparative studies of the structure, morphology and electrical conductivity of polyaniline weakly doped with chlorocarboxylic acids

    NASA Astrophysics Data System (ADS)

    Gmati, Fethi; Fattoum, Arbi; Bohli, Nadra; Dhaoui, Wadia; Belhadj Mohamed, Abdellatif

    2007-08-01

    We report the results of studies on two series of polyaniline (PANI), doped with dichloroacetic (DCA) and trichloroacetic (TCA) acids, respectively, at various doping rates and obtained by the in situ polymerization method. Samples were characterized by x-ray diffraction, scanning electron microscopy and conductivity measurements. The direct current (dc) and alternating current (ac) electrical conductivities of PANI salts have been investigated in the temperature range 100-310 K and frequency range 7-106 Hz. The results of this study indicate better chain ordering and higher conductivity for PANI doped with TCA. The dc conductivity of all samples is suitably fitted to Mott's three-dimensional variable-range hopping (VRH) model. Different Mott parameters such as characteristic temperature T0, density of states at the Fermi level (N(EF)), average hopping energy (W) and the average hopping distance (R) have been evaluated. The dependence of such values on the dopant acid used is discussed. At high frequencies, the ac conductivity follows the power law σac(ω,T) = A(T)ωs(T,ω), which is characteristic for charge transport in disordered materials by hopping or tunnelling processes. The observed increase in the frequency exponent s with temperature suggests that the small-polaron tunnelling model best describes the dominant ac conduction mechanism. A direct correlation between conductivity, structure and morphology was obtained in our systems.

  3. Biochemical Validation of the Glyoxylate Cycle in the Cyanobacterium Chlorogloeopsis fritschii Strain PCC 9212.

    PubMed

    Zhang, Shuyi; Bryant, Donald A

    2015-05-29

    Cyanobacteria are important photoautotrophic bacteria with extensive but variable metabolic capacities. The existence of the glyoxylate cycle, a variant of the TCA cycle, is still poorly documented in cyanobacteria. Previous studies reported the activities of isocitrate lyase and malate synthase, the key enzymes of the glyoxylate cycle in some cyanobacteria, but other studies concluded that these enzymes are missing. In this study the genes encoding isocitrate lyase and malate synthase from Chlorogloeopsis fritschii PCC 9212 were identified, and the recombinant enzymes were biochemically characterized. Consistent with the presence of the enzymes of the glyoxylate cycle, C. fritschii could assimilate acetate under both light and dark growth conditions. Transcript abundances for isocitrate lyase and malate synthase increased, and C. fritschii grew faster, when the growth medium was supplemented with acetate. Adding acetate to the growth medium also increased the yield of poly-3-hydroxybutyrate. When the genes encoding isocitrate lyase and malate synthase were expressed in Synechococcus sp. PCC 7002, the acetate assimilation capacity of the resulting strain was greater than that of wild type. Database searches showed that the genes for the glyoxylate cycle exist in only a few other cyanobacteria, all of which are able to fix nitrogen. This study demonstrates that the glyoxylate cycle exists in a few cyanobacteria, and that this pathway plays an important role in the assimilation of acetate for growth in one of those organisms. The glyoxylate cycle might play a role in coordinating carbon and nitrogen metabolism under conditions of nitrogen fixation. © 2015 by The American Society for Biochemistry and Molecular Biology, Inc.

  4. Fiat lux! Phylogeny and bioinformatics shed light on GABA functions in plants.

    PubMed

    Renault, Hugues

    2013-06-01

    The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants.

  5. Fiat lux!

    PubMed Central

    Renault, Hugues

    2013-01-01

    The non-protein amino acid γ-aminobutyric acid (GABA) accumulates in plants in response to a wide variety of environmental cues. Recent data point toward an involvement of GABA in tricarboxylic acid (TCA) cycle activity and respiration, especially in stressed roots. To gain further insights into potential GABA functions in plants, phylogenetic and bioinformatic approaches were undertaken. Phylogenetic reconstruction of the GABA transaminase (GABA-T) protein family revealed the monophyletic nature of plant GABA-Ts. However, this analysis also pointed to the common origin of several plant aminotransferases families, which were found more similar to plant GABA-Ts than yeast and human GABA-Ts. A computational analysis of AtGABA-T co-expressed genes was performed in roots and in stress conditions. This second approach uncovered a strong connection between GABA metabolism and glyoxylate cycle during stress. Both in silico analyses open new perspectives and hypotheses for GABA metabolic functions in plants. PMID:23518583

  6. [A case report: anomaly of the fourth branchial pouch with recurring cervical abscesses. Cauterization with trichloroacetic acid closed the fistula opening and cured the patient].

    PubMed

    Stenquist, Monika; Juhlin, Claes; Aström, Gunnar; Friberg, Ulla

    2003-04-24

    A fourth branchial pouch sinus is a rare congenital anomaly, which in a 13-year-old girl presented clinically as recurrent deep cervical abscesses. The location of the majority of these anomalies is the left side of the neck (90%). Radiological and endoscopic investigations verified the diagnosis. The internal orifice located at the apex of the pyriform sinus could facilitate contamination by infectious pharyngeal secretions and lead to abscess recurrence. Traditionally, the recommended treatment is radical surgery. It can, however, be technically difficult to excise the whole fistula tract. In this patient we used a non-invasive treatment modality; chemocauterization with 40% trichloroacetic acid (TCA). After three treatments the fistula was closed. To date (month no. 15) there has been no abscess recurrence. TCA chemocauterization seems to be a safe first-line treatment for patients with pyriform sinus fistulas.

  7. Protein precipitation of diluted samples in SDS-containing buffer with acetone leads to higher protein recovery and reproducibility in comparison with TCA/acetone approach.

    PubMed

    Santa, Cátia; Anjo, Sandra I; Manadas, Bruno

    2016-07-01

    Proteomic approaches are extremely valuable in many fields of research, where mass spectrometry methods have gained an increasing interest, especially because of the ability to perform quantitative analysis. Nonetheless, sample preparation prior to mass spectrometry analysis is of the utmost importance. In this work, two protein precipitation approaches, widely used for cleaning and concentrating protein samples, were tested and compared in very diluted samples solubilized in a strong buffer (containing SDS). The amount of protein recovered after acetone and TCA/acetone precipitation was assessed, as well as the protein identification and relative quantification by SWATH-MS yields were compared with the results from the same sample without precipitation. From this study, it was possible to conclude that in the case of diluted samples in denaturing buffers, the use of cold acetone as precipitation protocol is more favourable than the use of TCA/acetone in terms of reproducibility in protein recovery and number of identified and quantified proteins. Furthermore, the reproducibility in relative quantification of the proteins is even higher in samples precipitated with acetone compared with the original sample. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  8. Glutamate metabolism in HIV-1 infected macrophages: Role of HIV-1 Vpr

    PubMed Central

    Datta, Prasun K.; Deshmane, Satish; Khalili, Kamel; Merali, Salim; Gordon, John C.; Fecchio, Chiara; Barrero, Carlos A.

    2016-01-01

    ABSTRACT HIV-1 infected macrophages play a significant role in the neuropathogenesis of AIDS. HIV-1 viral protein R (Vpr) not only facilitates HIV-1 infection but also contribute to long-lived persistence in macrophages. Our previous studies using SILAC-based proteomic analysis showed that the expression of critical metabolic enzymes in the glycolytic pathway and tricarboxylic acid (TCA) cycle were altered in response to Vpr expression in macrophages. We hypothesized that Vpr-induced modulation of glycolysis and TCA cycle regulates glutamate metabolism and release in HIV-1 infected macrophages. We assessed the amount of specific metabolites induced by Vpr and HIV-1 in macrophages at the intracellular and extracellular level in a time-dependent manner utilizing multiple reaction monitoring (MRM) targeted metabolomics. In addition, stable isotope-labeled glucose and an MRM targeted metabolomics assay were used to evaluate the de novo synthesis and release of glutamate in Vpr overexpressing macrophages and HIV-1 infected macrophages, throughout the metabolic flux of glycolytic pathway and TCA cycle activation. The metabolic flux studies demonstrated an increase in glucose uptake, glutamate release and accumulation of α-ketoglutarate (α-KG) and glutamine in the extracellular milieu in Vpr expressing and HIV-1 infected macrophages. Interestingly, glutamate pools and other intracellular intermediates (glucose-6-phosphate (G6P), fructose-6-phosphate (F6P), citrate, malate, α-KG, and glutamine) showed a decreased trend except for fumarate, in contrast to the glutamine accumulation observed in the extracellular space in Vpr overexpressing macrophages. Our studies demonstrate that dysregulation of mitochondrial glutamate metabolism induced by Vpr in HIV-1 infected macrophages commonly seen, may contribute to neurodegeneration via excitotoxic mechanisms in the context of NeuroAIDS. PMID:27245560

  9. Proteomics and genetic analyses reveal the effects of arsenite oxidation on metabolic pathways and the roles of AioR in Agrobacterium tumefaciens GW4.

    PubMed

    Shi, Kaixiang; Wang, Qian; Fan, Xia; Wang, Gejiao

    2018-04-01

    A heterotrophic arsenite [As(III)]-oxidizing bacterium Agrobacterium tumefaciens GW4 isolated from As(III)-rich groundwater sediment showed high As(III) resistance and could oxidize As(III) to As(V). The As(III) oxidation could generate energy and enhance growth, and AioR was the regulator for As(III) oxidase. To determine the related metabolic pathways mediated by As(III) oxidation and whether AioR regulated other cellular responses to As(III), isobaric tags for relative and absolute quantitation (iTRAQ) was performed in four treatments, GW4 (+AsIII)/GW4 (-AsIII), GW4-ΔaioR (+AsIII)/GW4-ΔaioR (-AsIII), GW4-ΔaioR (-AsIII)/GW4 (-AsIII) and GW4-ΔaioR (+AsIII)/GW4 (+AsIII). A total of 41, 71, 82 and 168 differentially expressed proteins were identified, respectively. Using electrophoretic mobility shift assay (EMSA) and qRT-PCR, 12 genes/operons were found to interact with AioR. These results indicate that As(III) oxidation alters several cellular processes related to arsenite, such as As resistance (ars operon), phosphate (Pi) metabolism (pst/pho system), TCA cycle, cell wall/membrane, amino acid metabolism and motility/chemotaxis. In the wild type with As(III), TCA cycle flow is perturbed, and As(III) oxidation and fermentation are the main energy resources. However, when strain GW4-ΔaioR lost the ability of As(III) oxidation, the TCA cycle is the main way to generate energy. A regulatory cellular network controlled by AioR is constructed and shows that AioR is the main regulator for As(III) oxidation, besides, several other functions related to As(III) are regulated by AioR in parallel. Copyright © 2018 Elsevier Ltd. All rights reserved.

  10. The depressed central carbon and energy metabolisms is associated to the acquisition of levofloxacin resistance in Vibrio alginolyticus.

    PubMed

    Cheng, Zhi-Xue; Yang, Man-Jun; Peng, Bo; Peng, Xuan-Xian; Lin, Xiang-Min; Li, Hui

    2018-06-15

    The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. It is especially required to understand for the mechanism of antibiotic resistance to control antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus with the most advanced iTRAQ quantitative proteomics technology. A total of 160 proteins of differential abundance were identified, where 70 were decreased and 90 were increased. Further analysis demonstrated that crucial metabolic pathways like TCA cycle were significantly down-regulated. qRT-PCR analysis demonstrated the decreased gene expression of glycolysis/gluconeogenesis, the TCA cycle, and fatty acid biosynthesis. Moreover, Na(+)-NQR complex gene expression, membrane potential and the adenylate energy charge ratio were decreased, indicating that the decreased central carbon metabolism is associated to the acquisition of levofloxacin resistance. Therefore, the reduced central carbon and energy metabolisms form a characteristic feature as fitness costs of V. alginolyticus in resistance to levofloxacin. The overuse and misuse of antibiotics lead to bacterial antibiotic resistance, challenging human health and intensive cultivation. Understanding for the antibiotic resistance mechanisms is especially required to control these antibiotic-resistant pathogens. The present study characterized the differential proteome of levofloxacin-resistant Vibrio alginolyticus using the most advanced iTRAQ quantitative proteomics technology. A total of 160 differential abundance of proteins were identified with 70 decreases and 90 increases by liquid chromatography matrix assisted laser desorption ionization mass spectrometry. Most interestingly, crucial metabolic pathways such as the TCA cycle sharply fluctuated. This is the first report that the reduced central carbon and energy metabolisms form a characteristic feature

  11. Effects of visceral adiposity on glycerol pathways in gluconeogenesis.

    PubMed

    Neeland, Ian J; Hughes, Connor; Ayers, Colby R; Malloy, Craig R; Jin, Eunsook S

    2017-02-01

    To determine the feasibility of using oral 13 C labeled glycerol to assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Obese (BMI ≥30kg/m 2 ) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U- 13 C 3 ] glycerol and blood samples were subsequently analyzed at multiple time points over 3h by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U- 13 C 3 ] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13 C NMR analysis of glucose. Mixed linear models were used to compare 13 C enrichment in glucose between groups. Mean age, BMI, and baseline glucose were 49years, 40.1kg/m 2 , and 98mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13 C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13 C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2- 13 C 2 ] (via PPP) and [5,6- 13 C 2 ]/[4,5,6- 13 C 3 ] (via TCA cycle) glucose in high VAT versus low VAT groups. We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Effects of Visceral Adiposity on Glycerol Pathways in Gluconeogenesis

    PubMed Central

    Neeland, Ian J.; Hughes, Connor; Ayers, Colby R.; Malloy, Craig R.; Jin, Eunsook S.

    2016-01-01

    Objective To determine the feasibility of using oral 13C labeled glycerol at assess effects of visceral adiposity on gluconeogenic pathways in obese humans. Research Design and Methods Obese (BMI ≥30 kg/m2) participants without type 2 diabetes underwent visceral adipose tissue (VAT) assessment and stratification by median VAT into high VAT-fasting (n=3), low VAT-fasting (n=4), and high VAT-refed (n=2) groups. Participants ingested [U-13C3] glycerol and blood samples were subsequently analyzed at multiple time points over 3 hours by NMR spectroscopy. The fractions of plasma glucose (enrichment) derived from [U-13C3] glycerol via hepatic gluconeogenesis, pentose phosphate pathway (PPP), and tricarboxylic acid (TCA) cycle were assessed using 13C NMR analysis of glucose. Mixed linear models were used to compare 13C enrichment in glucose between groups. Results Mean age, BMI, and baseline glucose were 49 years, 40.1 kg/m2, and 98 mg/dl, respectively. Up to 20% of glycerol was metabolized in the TCA cycle prior to gluconeogenesis and PPP activity was minor (<1% of total glucose) in all participants. There was a 21% decrease in 13C enrichment in plasma glucose in the high VAT-fasting compared with low VAT-fasting group (p=0.03), suggesting dilution by endogenous glycerol. High VAT-refed participants had 37% less 13C enrichment in glucose compared with high VAT-fasting (p=0.02). There was a trend toward lower [1,2-13C2] (via PPP) and [5,6-13C2]/[4,5,6-13C3] (via TCA cycle) glucose in high VAT versus low VAT groups. Conclusions We applied a simple method to detect gluconeogenesis from glycerol in obese humans. Our findings provide preliminary evidence that excess visceral fat disrupts multiple pathways in hepatic gluconeogenesis from glycerol. PMID:28081781

  13. Environmental Life Cycle Assessment of Diets with Improved Omega-3 Fatty Acid Profiles

    PubMed Central

    Coelho, Carla R. V.; Pernollet, Franck; van der Werf, Hayo M. G.

    2016-01-01

    A high incidence of cardiovascular disease is observed worldwide, and dietary habits are one of the risk factors for these diseases. Omega-3 polyunsaturated fatty acids in the diet help to prevent cardiovascular disease. We used life cycle assessment to analyse the potential of two strategies to improve the nutritional and environmental characteristics of French diets: 1) modifying diets by changing the quantities and proportions of foods and 2) increasing the omega-3 contents in diets by replacing mainly animal foods with equivalent animal foods having higher omega-3 contents. We also investigated other possibilities for reducing environmental impacts. Our results showed that a diet compliant with nutritional recommendations for macronutrients had fewer environmental impacts than the current average French diet. Moving from an omnivorous to a vegetarian diet further reduced environmental impacts. Increasing the omega-3 contents in animal rations increased Eicosapentaenoic Acid (EPA) and Docosahexaenoic Acid (DHA) in animal food products. Providing these enriched animal foods in human diets increased their EPA and DHA contents without affecting their environmental impacts. However, in diets that did not contain fish, EPA and DHA contents were well below the levels recommended by health authorities, despite the inclusion of animal products enriched in EPA and DHA. Reducing meat consumption and avoidable waste at home are two main avenues for reducing environmental impacts of diets. PMID:27504959

  14. Environmental Life Cycle Assessment of Diets with Improved Omega-3 Fatty Acid Profiles.

    PubMed

    Coelho, Carla R V; Pernollet, Franck; van der Werf, Hayo M G

    2016-01-01

    A high incidence of cardiovascular disease is observed worldwide, and dietary habits are one of the risk factors for these diseases. Omega-3 polyunsaturated fatty acids in the diet help to prevent cardiovascular disease. We used life cycle assessment to analyse the potential of two strategies to improve the nutritional and environmental characteristics of French diets: 1) modifying diets by changing the quantities and proportions of foods and 2) increasing the omega-3 contents in diets by replacing mainly animal foods with equivalent animal foods having higher omega-3 contents. We also investigated other possibilities for reducing environmental impacts. Our results showed that a diet compliant with nutritional recommendations for macronutrients had fewer environmental impacts than the current average French diet. Moving from an omnivorous to a vegetarian diet further reduced environmental impacts. Increasing the omega-3 contents in animal rations increased Eicosapentaenoic Acid (EPA) and Docosahexaenoic Acid (DHA) in animal food products. Providing these enriched animal foods in human diets increased their EPA and DHA contents without affecting their environmental impacts. However, in diets that did not contain fish, EPA and DHA contents were well below the levels recommended by health authorities, despite the inclusion of animal products enriched in EPA and DHA. Reducing meat consumption and avoidable waste at home are two main avenues for reducing environmental impacts of diets.

  15. Glutamate and asparagine cataplerosis underlie glutamine addiction in melanoma

    PubMed Central

    Ratnikov, Boris; Aza-Blanc, Pedro; Ronai, Ze'ev A.; Smith, Jeffrey W.; Osterman, Andrei L.; Scott, David A.

    2015-01-01

    Glutamine dependence is a prominent feature of cancer metabolism, and here we show that melanoma cells, irrespective of their oncogenic background, depend on glutamine for growth. A quantitative audit of how carbon from glutamine is used showed that TCA-cycle-derived glutamate is, in most melanoma cells, the major glutamine-derived cataplerotic output and product of glutaminolysis. In the absence of glutamine, TCA cycle metabolites were liable to depletion through aminotransferase-mediated α-ketoglutarate-to-glutamate conversion and glutamate secretion. Aspartate was an essential cataplerotic output, as melanoma cells demonstrated a limited capacity to salvage external aspartate. Also, the absence of asparagine increased the glutamine requirement, pointing to vulnerability in the aspartate-asparagine biosynthetic pathway within melanoma metabolism. In contrast to melanoma cells, melanocytes could grow in the absence of glutamine. Melanocytes use more glutamine for protein synthesis rather than secreting it as glutamate and are less prone to loss of glutamate and TCA cycle metabolites when starved of glutamine. PMID:25749035

  16. Early metabolic adaptation in C57BL/6 mice resistant to high fat diet induced weight gain involves an activation of mitochondrial oxidative pathways.

    PubMed

    Boulangé, Claire L; Claus, Sandrine P; Chou, Chieh J; Collino, Sebastiano; Montoliu, Ivan; Kochhar, Sunil; Holmes, Elaine; Rezzi, Serge; Nicholson, Jeremy K; Dumas, Marc E; Martin, François-Pierre J

    2013-04-05

    We investigated the short-term (7 days) and long-term (60 days) metabolic effect of high fat diet induced obesity (DIO) and weight gain in isogenic C57BL/6 mice and examined the specific metabolic differentiation between mice that were either strong-responders (SR), or non-responders (NR) to weight gain. Mice (n = 80) were fed a standard chow diet for 7 days prior to randomization into a high-fat (HF) (n = 56) or a low-fat (LF) (n = 24) diet group. The (1)H NMR urinary metabolic profiles of LF and HF mice were recorded 7 and 60 days after the diet switch. On the basis of the body weight gain (BWG) distribution of HF group, we identified NR mice (n = 10) and SR mice (n = 14) to DIO. Compared with LF, HF feeding increased urinary excretion of glycine conjugates of β-oxidation intermediate (hexanoylglycine), branched chain amino acid (BCAA) catabolism intermediates (isovalerylglycine, α-keto-β-methylvalerate and α-ketoisovalerate) and end-products of nicotinamide adenine dinucleotide (NAD) metabolism (N1-methyl-2-pyridone-5-carboxamide, N1-methyl-4-pyridone-3-carboxamide) suggesting up-regulation of mitochondrial oxidative pathways. In the HF group, NR mice excreted relatively more hexanoylglycine, isovalerylglycine, and fewer tricarboxylic acid (TCA) cycle intermediate (succinate) in comparison to SR mice. Thus, subtle regulation of ketogenic pathways in DIO may alleviate the saturation of the TCA cycle and mitochondrial oxidative metabolism.

  17. Nutrient Dependence of RNase E Essentiality in Escherichia coli

    PubMed Central

    Tamura, Masaru; Moore, Christopher J.

    2013-01-01

    Escherichia coli cells normally require RNase E activity to form colonies (colony-forming ability [CFA]). The CFA-defective phenotype of cells lacking RNase E is partly reversed by overexpression of the related endoribonuclease RNase G or by mutation of the gene encoding the RNA helicase DeaD. We found that the carbon source utilization by rne deaD doubly mutant bacteria differs from that of rne+ cells and from that of cells mutated in deaD alone and that the loss of rne function in these bacteria limits conversion of the glycolytic pathway product phosphoenolpyruvate to the tricarboxylic acid (TCA) cycle intermediate oxaloacetic acid. We show that the mechanism underlying this effect is reduced production of the enzyme phosphoenolpyruvate carboxylase (PPC) and that adventitious overexpression of PPC, which facilitates phosphoenolpyruvate utilization and connects the glycolytic pathway with the TCA cycle, restored CFA to rne deaD mutant bacteria cultured on carbon sources that otherwise were unable to sustain growth. We further show that bacteria producing full-length RNase E, which allows formation of degradosomes, have nutritional requirements different from those of cells supplied with only the N-terminal catalytic region of RNase E and that mitigation of RNase E deficiency by overexpression of a related RNase, RNase G, is also affected by carbon source. Our results reveal previously unsuspected effects of RNase E deficiency and degradosome formation on nutrient utilization by E. coli cells. PMID:23275245

  18. Phosphonate Analogs of 2-Oxoglutarate Perturb Metabolism and Gene Expression in Illuminated Arabidopsis Leaves

    PubMed Central

    Araújo, Wagner L.; Tohge, Takayuki; Nunes-Nesi, Adriano; Daloso, Danilo M.; Nimick, Mhairi; Krahnert, Ina; Bunik, Victoria I.; Moorhead, Greg B. G.; Fernie, Alisdair R.

    2012-01-01

    Although the role of the 2-oxoglutarate dehydrogenase complex (2-OGDHC) has previously been demonstrated in plant heterotrophic tissues its role in photosynthetically active tissues remains poorly understood. By using a combination of metabolite and transcript profiles we here investigated the function of 2-OGDHC in leaves of Arabidopsis thaliana via use of specific phosphonate inhibitors of the enzyme. Incubation of leaf disks with the inhibitors revealed that they produced the anticipated effects on the in situ enzyme activity. In vitro experiments revealed that succinyl phosphonate (SP) and a carboxy ethyl ester of SP are slow-binding inhibitors of the 2-OGDHC. Our results indicate that the reduced respiration rates are associated with changes in the regulation of metabolic and signaling pathways leading to an imbalance in carbon-nitrogen metabolism and cell homeostasis. The inducible alteration of primary metabolism was associated with altered expression of genes belonging to networks of amino acids, plant respiration, and sugar metabolism. In addition, by using isothermal titration calorimetry we excluded the possibility that the changes in gene expression resulted from an effect on 2-oxoglutarate (2OG) binding to the carbon/ATP sensing protein PII. We also demonstrated that the 2OG degradation by the 2-oxoglutarate dehydrogenase strongly influences the distribution of intermediates of the tricarboxylic acid (TCA) cycle and the GABA shunt. Our results indicate that the TCA cycle activity is clearly working in a non-cyclic manner upon 2-OGDHC inhibition during the light period. PMID:22876250

  19. The contribution of ketone bodies to basal and activity-dependent neuronal oxidation in vivo.

    PubMed

    Chowdhury, Golam M I; Jiang, Lihong; Rothman, Douglas L; Behar, Kevin L

    2014-07-01

    The capacity of ketone bodies to replace glucose in support of neuronal function is unresolved. Here, we determined the contributions of glucose and ketone bodies to neocortical oxidative metabolism over a large range of brain activity in rats fasted 36 hours and infused intravenously with [2,4-(13)C₂]-D-β-hydroxybutyrate (BHB). Three animal groups and conditions were studied: awake ex vivo, pentobarbital-induced isoelectricity ex vivo, and halothane-anesthetized in vivo, the latter data reanalyzed from a recent study. Rates of neuronal acetyl-CoA oxidation from ketone bodies (V(acCoA-kbN)) and pyruvate (V(pdhN)), and the glutamate-glutamine cycle (V(cyc)) were determined by metabolic modeling of (13)C label trapped in major brain amino acid pools. V(acCoA-kbN) increased gradually with increasing activity, as compared with the steeper change in tricarboxylic acid (TCA) cycle rate (V(tcaN)), supporting a decreasing percentage of neuronal ketone oxidation: ∼100% (isoelectricity), 56% (halothane anesthesia), 36% (awake) with the BHB plasma levels achieved in our experiments (6 to 13 mM). In awake animals ketone oxidation reached saturation for blood levels >17 mM, accounting for 62% of neuronal substrate oxidation, the remainder (38%) provided by glucose. We conclude that ketone bodies present at sufficient concentration to saturate metabolism provides full support of basal (housekeeping) energy needs and up to approximately half of the activity-dependent oxidative needs of neurons.

  20. GABA Pathway Rate-Limit Citrate Degradation in Postharvest Citrus Fruit Evidence from HB Pumelo (Citrus grandis) × Fairchild (Citrus reticulata) Hybrid Population.

    PubMed

    Sheng, Ling; Shen, Dandan; Yang, Wei; Zhang, Mingfei; Zeng, Yunliu; Xu, Juan; Deng, Xiuxin; Cheng, Yunjiang

    2017-03-01

    Organic acids are a major index of fresh fruit marketing properties. However, the genetic effects on the organic acid level in postharvest citrus fruit still remain unknown. Here, we used the fruits of about 40 lines in a hybrid population (high-acid "HB Pumelo" × low-acid "Fairchild") to analyze the organic acid metabolism of postharvest citrus fruit. A transgressive content of titratable acid (TA) was observed, which was attributed to citrate accumulation. High- and low-acid fruits (No. 130, 168 and No. 080, 181, respectively) were chosen for further study. Gene expression analysis on citrate metabolism showed that the high accumulation of citrate could be attributed to the low activity of γ-aminobutyric acid (GABA) shunt, and was partially due to the block of tricarboxylic acid (TCA) cycle by low mitochondrial aconitase (m-ACO) expression. TA level was significantly negatively correlated with weight loss in fruits during postharvest storage, implying a close relationship between organic acid and water metabolism.

  1. Ethanol-Induced Changes in Trichloroethylene Toxicity

    DTIC Science & Technology

    1988-09-30

    DCA or TCA. METHODS Chei .Ls. [l-14C]palmitoyl-CoA was purchased from New England Nuclear Products (Boston, MA); clofibrate , dichloroacetic acid (DCA...CLASSIFICATION OF _*NIS PAGE All other 04itions are obsolete. UCASFE UNLSSFE 0 . ( 1(A0~, AYOS-Th ච-1 173 .6. Aid (D,’Al and Trichlo’u,:eti: Acid ...published in 1231gj1gg 94 A221i2d EhabgnSggg 21:45-54 1088. Copy of manuscript "Dichloroacetic acid (DCA) and Trichloroacetic Acid (TCA) induced DNA

  2. Highly selective solid-phase extraction and large volume injection for the robust gas chromatography-mass spectrometric analysis of TCA and TBA in wines.

    PubMed

    Insa, S; Anticó, E; Ferreira, V

    2005-09-30

    A reliable solid-phase extraction (SPE) method for the simultaneous determination of 2,4,6-trichloroanisole (TCA) and 2,4,6-tribromoanisole (TBA) in wines has been developed. In the proposed procedure 50 mL of wine are extracted in a 1 mL cartridge filled with 50 mg of LiChrolut EN resins. Most wine volatiles are washed up with 12.5 mL of a water:methanol solution (70%, v/v) containing 1% of NaHCO3. Analytes are further eluted with 0.6 mL of dichloromethane. A 40 microL aliquot of this extract is directly injected into a PTV injector operated in the solvent split mode, and analysed by gas chromatography (GC)-ion trap mass spectrometry using the selected ion storage mode. The solid-phase extraction, including sample volume and rinsing and elution solvents, and the large volume GC injection have been carefully evaluated and optimized. The resulting method is precise (RSD (%) < 6% at 100 ng L(-1)), sensitive (LOD were 0.2 and 0.4 ng/L for TCA and TBA, respectively), robust (the absolute recoveries of both analytes are higher than 80% and consistent wine to wine) and friendly to the GC-MS system (the extract is clean, simple and free from non-volatiles).

  3. Integration between Glycolysis and Glutamate-Glutamine Cycle Flux May Explain Preferential Glycolytic Increase during Brain Activation, Requiring Glutamate

    PubMed Central

    Hertz, Leif; Chen, Ye

    2017-01-01

    oxidative metabolism occurs during glutamate formation it is only one half of that during normal tricarboxylic acid (TCA) cycle function. Glutamate’s receptor stimulation leads to potassium ion (K+) release and astrocytic uptake, preferentially fueled by glycolysis and followed by release and neuronal re-accumulation. The activation-induced preferential glycolysis diminishes with continued activation and is followed by an increased ratio between oxidative metabolism and glycolysis, reflecting oxidation of generated glutamate and accumulated lactate. PMID:28890689

  4. Studies of yeast cell oxygenation and energetics by laser fluorometry of reduced nicotinamide adenine dinucleotide

    NASA Astrophysics Data System (ADS)

    Pan, Fu-shih; Chen, Stephen; Mintzer, Robert A.; Chen, Chin-Tu; Schumacker, Paul

    1991-03-01

    It is of fundamental importance for biological scientists to assess cellular energetics. Under aerobic conditions, the tricarboxylic acid cycle (TCA cycle) is coupled with the mitochondrial electron cascade pathway to provide the cell with energy. The nicotinamide adenine dinucleotide-conjugated pair (NAD and NADH) is the coenzyme in numerous important biomedical reactions which include several important dehydrogenase reactions in the TCA cycle. Based on Le Chatelier's principle, NADH will accumulate when this energy production mechanism is impaired. The relative amounts of NAD and NADH in a cell are defined as the redox state of the cell (Williamson et.al. 1967) which provides a valuable index of cellular energetics. The sum of the amounts of NAD and NADH in a cell may be assumed to be constant during a finite time; therefore, a reliable means of measuring the NADH concentration would provide us with a useful indicator of tissue viability. Traditionally, the quantities of NADH and NAD may be measured by chemical assay methods. We can avoid these tediois analyses by exploiting the significant difference between the ultraviolet absorption spectra of this redox pair. However, because of the opacity of biological samples and the interference of other biochemicals that also absorb ultraviolet radiation, measurement of NADH and NAD+ concentrations in vivo by absorption spectroscopy is not feasible.

  5. A reverse glyoxylate shunt to build a non-native route from C-4 to C-2 in Escherichia coli

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Mainguet, SE; Gronenberg, LS; Wong, SS

    2013-09-01

    Most central metabolic pathways such as glycolysis, fatty acid synthesis, and the TCA cycle have complementary pathways that run in the reverse direction to allow flexible storage and utilization of resources. However, the glyoxylate shunt, which allows for the synthesis of four-carbon TCA cycle intermediates from acetyl-CoA, has not been found to be reversible to date. As a result, glucose can only be converted to acetyl-CoA via the decarboxylation of the three-carbon molecule pyruvate in heterotrophs. A reverse glyoxylate shunt (rGS) could be extended into a pathway that converts C-4 carboxylates into two molecules of acetyl-CoA without loss of CO2.more » Here, as a proof of concept, we engineered in Escherichia coli such a pathway to convert malate and succinate to oxaloacetate and two molecules of acetyl-CoA. We introduced ATP-coupled heterologous enzymes at the thermodynamically unfavorable steps to drive the pathway in the desired direction. This synthetic pathway in essence reverses the glyoxylate shunt at the expense of ATP. When integrated with central metabolism, this pathway has the potential to increase the carbon yield of acetate and biofuels from many carbon sources in heterotrophic microorganisms, and could be the basis of novel carbon fixation cycles. (C) 2013 Elsevier Inc. All rights reserved.« less

  6. Metabolic Remodeling in Moderate Synchronous versus Dyssynchronous Pacing-Induced Heart Failure: Integrated Metabolomics and Proteomics Study

    PubMed Central

    Shibayama, Junko; Yuzyuk, Tatiana N.; Cox, James; Makaju, Aman; Miller, Mickey; Lichter, Justin; Li, Hui; Leavy, Jane D.; Franklin, Sarah; Zaitsev, Alexey V.

    2015-01-01

    Heart failure (HF) is accompanied by complex alterations in myocardial energy metabolism. Up to 40% of HF patients have dyssynchronous ventricular contraction, which is an independent indicator of mortality. We hypothesized that electromechanical dyssynchrony significantly affects metabolic remodeling in the course of HF. We used a canine model of tachypacing-induced HF. Animals were paced at 200 bpm for 6 weeks either in the right atrium (synchronous HF, SHF) or in the right ventricle (dyssynchronous HF, DHF). We collected biopsies from left ventricular apex and performed comprehensive metabolic pathway analysis using multi-platform metabolomics (GC/MS; MS/MS; HPLC) and LC-MS/MS label-free proteomics. We found important differences in metabolic remodeling between SHF and DHF. As compared to Control, ATP, phosphocreatine (PCr), creatine, and PCr/ATP (prognostic indicator of mortality in HF patients) were all significantly reduced in DHF, but not SHF. In addition, the myocardial levels of carnitine (mitochondrial fatty acid carrier) and fatty acids (12:0, 14:0) were significantly reduced in DHF, but not SHF. Carnitine parmitoyltransferase I, a key regulatory enzyme of fatty acid ß-oxidation, was significantly upregulated in SHF but was not different in DHF, as compared to Control. Both SHF and DHF exhibited a reduction, but to a different degree, in creatine and the intermediates of glycolysis and the TCA cycle. In contrast to this, the enzymes of creatine kinase shuttle were upregulated, and the enzymes of glycolysis and the TCA cycle were predominantly upregulated or unchanged in both SHF and DHF. These data suggest a systemic mismatch between substrate supply and demand in pacing-induced HF. The energy deficit observed in DHF, but not in SHF, may be associated with a critical decrease in fatty acid delivery to the ß-oxidation pipeline, primarily due to a reduction in myocardial carnitine content. PMID:25790351

  7. Glycerol-3-phosphate Acyltransferase Isoform-4 (GPAT4) Limits Oxidation of Exogenous Fatty Acids in Brown Adipocytes*

    PubMed Central

    Cooper, Daniel E.; Grevengoed, Trisha J.; Klett, Eric L.; Coleman, Rosalind A.

    2015-01-01

    Glycerol-3-phosphate acyltransferase-4 (GPAT4) null pups grew poorly during the suckling period and, as adults, were protected from high fat diet-induced obesity. To determine why Gpat4−/− mice failed to gain weight during these two periods of high fat feeding, we examined energy metabolism. Compared with controls, the metabolic rate of Gpat4−/− mice fed a 45% fat diet was 12% higher. Core body temperature was 1 ºC higher after high fat feeding. Food intake, fat absorption, and activity were similar in both genotypes. Impaired weight gain in Gpat4−/− mice did not result from increased heat loss, because both cold tolerance and response to a β3-adrenergic agonist were similar in both genotypes. Because GPAT4 comprises 65% of the total GPAT activity in brown adipose tissue (BAT), we characterized BAT function. A 45% fat diet increased the Gpat4−/− BAT expression of peroxisome proliferator-activated receptor α (PPAR) target genes, Cpt1α, Pgc1α, and Ucp1, and BAT mitochondria oxidized oleate and pyruvate at higher rates than controls, suggesting that fatty acid signaling and flux through the TCA cycle were enhanced. To assess the role of GPAT4 directly, neonatal BAT preadipocytes were differentiated to adipocytes. Compared with controls, Gpat4−/− brown adipocytes incorporated 33% less fatty acid into triacylglycerol and 46% more into the pathway of β-oxidation. The increased oxidation rate was due solely to an increase in the oxidation of exogenous fatty acids. These data suggest that in the absence of cold exposure, GPAT4 limits excessive fatty acid oxidation and the detrimental induction of a hypermetabolic state. PMID:25918168

  8. NOK mediates glycolysis and nuclear PDC associated histone acetylation.

    PubMed

    Shi, Wei-Ye; Yang, Xiao; Huang, Bo; Shen, Wen H; Liu, Li

    2017-06-01

    NOK is a potent oncogene that can transform normal cells to cancer cells. We hypothesized that NOK might impact cancer cell metabolism and histone acetylation. We show that NOK localizes in the mitochondria, and while it minimally impacts tricarboxylic acid (TCA) cycle, it markedly inhibits the process of electron transport and oxidative phosphorylation processes and dramatically enhances aerobic glycolysis in cancer cells. NOK promotes the mitochondrial-nuclear translocation of pyruvate dehydrogenase complex (PDC), and enhances histone acetylation in the nucleus. Together, these findings show that NOK mediates glycolysis and nuclear PDC associated histone acetylation.

  9. Biomedical research of novel biodegradable copoly(amino acid)s based on 6-aminocaproic acid and L-proline.

    PubMed

    Zhang, Weipeng; Shao, Jianmin

    2010-08-01

    The biomedical properties of novel biodegradable copoly(amino acid)s based on 6-aminocaproic acid and L-proline were analyzed in this article. The cytotoxicity of the copolymer films was tested in vitro using human embryonic kidney (HEK) 293 cells. The cell proliferation, cell cycle, cell apoptosis, and hemolysis of the polymers were also investigated. No significant cytotoxic response was detected statistically by cytotoxicity assay, and the results of cell apoptosis and cell cycle showed that there were no statistically significant differences in them. Generally, the cells spread and grew well on polymer film. Meanwhile, the extent of hemolysis on the polymers was acceptable. Evaluation of cytotoxicity by cell cycle and apoptosis as a supplementary assay is correspondingly discussed in this article. (c) 2010 Wiley Periodicals, Inc.

  10. Testing of sealed lead-acid batteries

    NASA Astrophysics Data System (ADS)

    Bush, D. M.; Sealey, J. D.; Miller, D. W.

    1984-02-01

    Sealed lead acid batteries under development were tested. The goal was to develop a totally maintenance free sealed lead acid battery capable of deep discharge operation in a photovoltaic power system. Sealed lead acid batteries and a group of conventional, flooded lead acid batteries were exposed to a matrix test plan, with some approaching 1000 cycles. This performance was achieved with the standard National Electrical Manufacturers' Association cycle test, and the partial state of charge cycle test. Modes of failure are investigated.

  11. A diet rich in high-glucoraphanin broccoli interacts with genotype to reduce discordance in plasma metabolite profiles by modulating mitochondrial function123

    PubMed Central

    Armah, Charlotte N; Traka, Maria H; Dainty, Jack R; Defernez, Marianne; Janssens, Astrid; Leung, Wing; Doleman, Joanne F; Potter, John F

    2013-01-01

    Background: Observational and experimental studies suggest that diets rich in cruciferous vegetables and glucosinolates may reduce the risk of cancer and cardiovascular disease (CVD). Objective: We tested the hypothesis that a 12-wk dietary intervention with high-glucoraphanin (HG) broccoli would modify biomarkers of CVD risk and plasma metabolite profiles to a greater extent than interventions with standard broccoli or peas. Design: Subjects were randomly assigned to consume 400 g standard broccoli, 400 g HG broccoli, or 400 g peas each week for 12 wk, with no other dietary restrictions. Biomarkers of CVD risk and 347 plasma metabolites were quantified before and after the intervention. Results: No significant differences in the effects of the diets on biomarkers of CVD risk were found. Multivariate analyses of plasma metabolites identified 2 discrete phenotypic responses to diet in individuals within the HG broccoli arm, differentiated by single nucleotide polymorphisms associated with the PAPOLG gene. Univariate analysis showed effects of sex (P < 0.001), PAPOLG genotype (P < 0.001), and PAPOLG genotype × diet (P < 0.001) on the plasma metabolic profile. In the HG broccoli arm, the consequence of the intervention was to reduce variation in lipid and amino acid metabolites, tricarboxylic acid (TCA) cycle intermediates, and acylcarnitines between the 2 PAPOLG genotypes. Conclusions: The metabolic changes observed with the HG broccoli diet are consistent with a rebalancing of anaplerotic and cataplerotic reactions and enhanced integration of fatty acid β-oxidation with TCA cycle activity. These modifications may contribute to the reduction in cancer risk associated with diets that are rich in cruciferous vegetables. This trial was registered at clinicaltrials.gov as NCT01114399. PMID:23964055

  12. BABA and Phytophthora nicotianae Induce Resistance to Phytophthora capsici in Chile Pepper (Capsicum annuum)

    PubMed Central

    Stamler, Rio A.; Holguin, Omar; Dungan, Barry; Schaub, Tanner; Sanogo, Soumaila; Goldberg, Natalie; Randall, Jennifer J.

    2015-01-01

    Induced resistance in plants is a systemic response to certain microorganisms or chemicals that enhances basal defense responses during subsequent plant infection by pathogens. Inoculation of chile pepper with zoospores of non-host Phytophthora nicotianae or the chemical elicitor beta-aminobutyric acid (BABA) significantly inhibited foliar blight caused by Phytophthora capsici. Tissue extract analyses by GC/MS identified conserved change in certain metabolite concentrations following P. nicotianae or BABA treatment. Induced chile pepper plants had reduced concentrations of sucrose and TCA cycle intermediates and increased concentrations of specific hexose-phosphates, hexose-disaccharides and amino acids. Galactose, which increased significantly in induced chile pepper plants, was shown to inhibit growth of P. capsici in a plate assay. PMID:26020237

  13. BABA and Phytophthora nicotianae Induce Resistance to Phytophthora capsici in Chile Pepper (Capsicum annuum).

    PubMed

    Stamler, Rio A; Holguin, Omar; Dungan, Barry; Schaub, Tanner; Sanogo, Soumaila; Goldberg, Natalie; Randall, Jennifer J

    2015-01-01

    Induced resistance in plants is a systemic response to certain microorganisms or chemicals that enhances basal defense responses during subsequent plant infection by pathogens. Inoculation of chile pepper with zoospores of non-host Phytophthora nicotianae or the chemical elicitor beta-aminobutyric acid (BABA) significantly inhibited foliar blight caused by Phytophthora capsici. Tissue extract analyses by GC/MS identified conserved change in certain metabolite concentrations following P. nicotianae or BABA treatment. Induced chile pepper plants had reduced concentrations of sucrose and TCA cycle intermediates and increased concentrations of specific hexose-phosphates, hexose-disaccharides and amino acids. Galactose, which increased significantly in induced chile pepper plants, was shown to inhibit growth of P. capsici in a plate assay.

  14. Metabolic effects of elevated temperature on organic acid degradation in ripening Vitis vinifera fruit.

    PubMed

    Sweetman, C; Sadras, V O; Hancock, R D; Soole, K L; Ford, C M

    2014-11-01

    Berries of the cultivated grapevine Vitis vinifera are notably responsive to temperature, which can influence fruit quality and hence the future compatibility of varieties with their current growing regions. Organic acids represent a key component of fruit organoleptic quality and their content is significantly influenced by temperature. The objectives of this study were to (i) manipulate thermal regimes to realistically capture warming-driven reduction of malate content in Shiraz berries, and (ii) investigate the mechanisms behind temperature-sensitive malate loss and the potential downstream effects on berry metabolism. In the field we compared untreated controls at ambient temperature with longer and milder warming (2-4 °C differential for three weeks; Experiment 1) or shorter and more severe warming (4-6 °C differential for 11 days; Experiment 2). We complemented field trials with control (25/15 °C) and elevated (35/20 °C) day/night temperature controlled-environment trials using potted vines (Experiment 3). Elevating maximum temperatures (4-10 °C above controls) during pre-véraison stages led to higher malate content, particularly with warmer nights. Heating at véraison and ripening stages reduced malate content, consistent with effects typically seen in warm vintages. However, when minimum temperatures were also raised by 4-6 °C, malate content was not reduced, suggesting that the regulation of malate metabolism differs during the day and night. Increased NAD-dependent malic enzyme activity and decreased phosphoenolpyruvate carboxylase and pyruvate kinase activities, as well as the accumulation of various amino acids and γ-aminobutyric acid, suggest enhanced anaplerotic capacity of the TCA cycle and a need for coping with decreased cytosolic pH in heated fruit. © The Author 2014. Published by Oxford University Press on behalf of the Society for Experimental Biology.

  15. Metabolic effects of elevated temperature on organic acid degradation in ripening Vitis vinifera fruit

    PubMed Central

    Sweetman, C.; Sadras, V. O.; Hancock, R. D.; Soole, K. L.; Ford, C. M.

    2014-01-01

    Berries of the cultivated grapevine Vitis vinifera are notably responsive to temperature, which can influence fruit quality and hence the future compatibility of varieties with their current growing regions. Organic acids represent a key component of fruit organoleptic quality and their content is significantly influenced by temperature. The objectives of this study were to (i) manipulate thermal regimes to realistically capture warming-driven reduction of malate content in Shiraz berries, and (ii) investigate the mechanisms behind temperature-sensitive malate loss and the potential downstream effects on berry metabolism. In the field we compared untreated controls at ambient temperature with longer and milder warming (2–4 °C differential for three weeks; Experiment 1) or shorter and more severe warming (4–6 °C differential for 11 days; Experiment 2). We complemented field trials with control (25/15 °C) and elevated (35/20 °C) day/night temperature controlled-environment trials using potted vines (Experiment 3). Elevating maximum temperatures (4–10 °C above controls) during pre-véraison stages led to higher malate content, particularly with warmer nights. Heating at véraison and ripening stages reduced malate content, consistent with effects typically seen in warm vintages. However, when minimum temperatures were also raised by 4–6 °C, malate content was not reduced, suggesting that the regulation of malate metabolism differs during the day and night. Increased NAD-dependent malic enzyme activity and decreased phosphoenolpyruvate carboxylase and pyruvate kinase activities, as well as the accumulation of various amino acids and γ-aminobutyric acid, suggest enhanced anaplerotic capacity of the TCA cycle and a need for coping with decreased cytosolic pH in heated fruit. PMID:25180109

  16. Iterative algorithm-guided design of massive strain libraries, applied to itaconic acid production in yeast.

    PubMed

    Young, Eric M; Zhao, Zheng; Gielesen, Bianca E M; Wu, Liang; Benjamin Gordon, D; Roubos, Johannes A; Voigt, Christopher A

    2018-05-09

    Metabolic engineering requires multiple rounds of strain construction to evaluate alternative pathways and enzyme concentrations. Optimizing multigene pathways stepwise or by randomly selecting enzymes and expression levels is inefficient. Here, we apply methods from design of experiments (DOE) to guide the construction of strain libraries from which the maximum information can be extracted without sampling every possible combination. We use Saccharomyces cerevisiae as a host for a novel six-gene pathway to itaconic acid, selected by comparing alternative shunt pathways that bypass the mitochondrial TCA cycle. The pathway is distinctive for the use of acetylating acetaldehyde dehydrogenase to increase cytosolic acetyl-CoA pools, a bacterial enzyme to synthesize citrate in the cytosol, and an itaconic acid exporter. Precise control over the expression of each gene is enabled by a set of promoter-terminator pairs that span a 174-fold range. Two large combinatorial libraries (160 variants, 2.4Mb and 32 variants, 0.6Mb) are designed where the expression levels are selected by statistical methods (I-optimal response surface methodology, full factorial, or Plackett-Burman) with the intent of extracting different types of guiding information after the screen. This is applied to the design of a third library (24 variants, 0.5Mb) intended to alleviate a bottleneck in cis-aconitate decarboxylase (CAD) expression. The top strain produces 815mg/l itaconic acid, a 4-fold improvement over the initial strain achieved by iteratively balancing pathway expression. Including a methylated product in the total, the strain produces 1.3g/l combined itaconic acids. Further, a regression analysis of the libraries reveals the optimal expression level of CAD as well as pairwise interdependencies between genes that result in increased titer and purity of itaconic acid. This work demonstrates adapting algorithmic design strategies to guide automated yeast strain construction and learn

  17. Effect of glycine nitrogen on lettuce growth under soilless culture: a metabolomics approach to identify the main changes occurred in plant primary and secondary metabolism.

    PubMed

    Yang, Xiao; Feng, Lei; Zhao, Li; Liu, Xiaosong; Hassani, Danial; Huang, Danfeng

    2018-01-01

    Lettuce is a significant source of antioxidants and bioactive compounds. Nitrate is a cardinal fertilizer in horticulture and influences vegetable yield and quality; however, the negative effects of nitrate on the biosynthesis of flavonoids require further study. It is expected that using fertilizers containing organic nitrogen (N) could promote the synthesis of health-promoting compounds. Lettuces were hydroponically cultured in media containing 9 mmol L -1 nitrate or 9 mmol L -1 glycine for 4 weeks. Primary and secondary metabolites were analyzed using gas chromatography/mass spectrometry (GC/MS) and ultra-performance liquid chromatography/ion mobility spectrometry/quadrupole time-of-flight mass spectrometry (UPLC/IMS/QTOF-MS). Data analysis revealed that 29 metabolites were significantly altered between nitrate and glycine treatments. Metabolites were tentatively identified by comparison with online databases, literature and standards and using collision cross-section values. Significant differences in flavonoid biosynthesis, phenolic biosynthesis and the tricarboxylic acid (TCA) cycle response were observed between N sources. Compared with nitrate, glycine promoted accumulation of glycosylated flavonoids (quercetin 3-glucoside, quercetin 3-(6″-malonyl-glucoside), luteolin 7-glucuronide, luteolin 7-glucoside), ascorbic acid and amino acids (l-valine, l-leucine, l-glutamine, asparagine, l-serine, l-ornithine, 4-aminobutanoic acid, l-phenylalanine) but reduced phenolic acids (dihydroxybenzoic acid hexose isomers 1 and 2, chicoric acid, chicoric acid isomer 1) and TCA intermediates (fumaric, malic, citric and succinic acids). The novel methodology applied in this study can be used to characterize metabolites in lettuce. Accumulation of glycosylated flavonoids, amino acids and ascorbic acid in response to glycine supply provides strong evidence supporting the idea that using amino acids as an N source alters the nutritional value of vegetable crops. © 2017

  18. Analysis of trace inorganic anions in weak acid salts by single pump cycling-column-switching ion chromatography.

    PubMed

    Huang, Zhongping; Ni, Chengzhu; Zhu, Zhuyi; Pan, Zaifa; Wang, Lili; Zhu, Yan

    2015-05-01

    The application of ion chromatography with the single pump cycling-column-switching technique was described for the analysis of trace inorganic anions in weak acid salts within a single run. Due to the hydrogen ions provided by an anion suppressor electrolyzing water, weak acid anions could be transformed into weak acids, existing as molecules, after passing through the suppressor. Therefore, an anion suppressor and ion-exclusion column were adopted to achieve on-line matrix elimination of weak acid anions with high concentration for the analysis of trace inorganic anions in weak acid salts. A series of standard solutions consisting of target anions of various concentrations from 0.005 to 10 mg/L were analyzed, with correlation coefficients r ≥ 0.9990. The limits of detection were in the range of 0.67 to 1.51 μg/L, based on the signal-to-noise ratio of 3 and a 25 μL injection volume. Relative standard deviations for retention time, peak area, and peak height were all less than 2.01%. A spiking study was performed with satisfactory recoveries between 90.3 and 104.4% for all anions. The chromatographic system was successfully applied to the analysis of trace inorganic anions in five weak acid salts. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  19. Levels of Arabidopsis thaliana Leaf Phosphatidic Acids, Phosphatidylserines, and Most Trienoate-Containing Polar Lipid Molecular Species Increase during the Dark Period of the Diurnal Cycle.

    PubMed

    Maatta, Sara; Scheu, Brad; Roth, Mary R; Tamura, Pamela; Li, Maoyin; Williams, Todd D; Wang, Xuemin; Welti, Ruth

    2012-01-01

    Previous work has demonstrated that plant leaf polar lipid fatty acid composition varies during the diurnal (dark-light) cycle. Fatty acid synthesis occurs primarily during the light, but fatty acid desaturation continues in the absence of light, resulting in polyunsaturated fatty acids reaching their highest levels toward the end of the dark period. In this work, Arabidopsis thaliana were grown at constant (21°C) temperature with 12-h light and 12-h dark periods. Collision induced dissociation time-of-flight mass spectrometry (MS) demonstrated that 16:3 and 18:3 fatty acid content in membrane lipids of leaves are higher at the end of the dark than at the end of the light period, while 16:1, 16:2, 18:0, and 18:1 content are higher at the end of the light period. Lipid profiling of membrane galactolipids, phospholipids, and lysophospholipids by electrospray ionization triple quadrupole MS indicated that the monogalactosyldiacylglycerol, phosphatidylglycerol, and phosphatidylcholine classes include molecular species whose levels are highest at end of the light period and others that are highest at the end of the dark period. The levels of phosphatidic acid (PA) and phosphatidylserine classes were higher at the end of the dark period, and molecular species within these classes either followed the class pattern or were not significantly changed in the diurnal cycle. Phospholipase D (PLD) is a family of enzymes that hydrolyzes phospholipids to produce PA. Analysis of several PLD mutant lines suggests that PLDζ2 and possibly PLDα1 may contribute to diurnal cycling of PA. The polar lipid compositional changes are considered in relation to recent data that demonstrate phosphatidylcholine acyl editing.

  20. Free fatty acids block glucose-induced β-cell proliferation in mice by inducing cell cycle inhibitors p16 and p18.

    PubMed

    Pascoe, Jordan; Hollern, Douglas; Stamateris, Rachel; Abbasi, Munira; Romano, Lia C; Zou, Baobo; O'Donnell, Christopher P; Garcia-Ocana, Adolfo; Alonso, Laura C

    2012-03-01

    Pancreatic β-cell proliferation is infrequent in adult humans and is not increased in type 2 diabetes despite obesity and insulin resistance, suggesting the existence of inhibitory factors. Free fatty acids (FFAs) may influence proliferation. In order to test whether FFAs restrict β-cell proliferation in vivo, mice were intravenously infused with saline, Liposyn II, glucose, or both, continuously for 4 days. Lipid infusion did not alter basal β-cell proliferation, but blocked glucose-stimulated proliferation, without inducing excess β-cell death. In vitro exposure to FFAs inhibited proliferation in both primary mouse β-cells and in rat insulinoma (INS-1) cells, indicating a direct effect on β-cells. Two of the fatty acids present in Liposyn II, linoleic acid and palmitic acid, both reduced proliferation. FFAs did not interfere with cyclin D2 induction or nuclear localization by glucose, but increased expression of inhibitor of cyclin dependent kinase 4 (INK4) family cell cycle inhibitors p16 and p18. Knockdown of either p16 or p18 rescued the antiproliferative effect of FFAs. These data provide evidence for a novel antiproliferative form of β-cell glucolipotoxicity: FFAs restrain glucose-stimulated β-cell proliferation in vivo and in vitro through cell cycle inhibitors p16 and p18. If FFAs reduce proliferation induced by obesity and insulin resistance, targeting this pathway may lead to new treatment approaches to prevent diabetes.

  1. Ames Optimized TCA Configuration

    NASA Technical Reports Server (NTRS)

    Cliff, Susan E.; Reuther, James J.; Hicks, Raymond M.

    1999-01-01

    Configuration design at Ames was carried out with the SYN87-SB (single block) Euler code using a 193 x 49 x 65 C-H grid. The Euler solver is coupled to the constrained (NPSOL) and the unconstrained (QNMDIF) optimization packages. Since the single block grid is able to model only wing-body configurations, the nacelle/diverter effects were included in the optimization process by SYN87's option to superimpose the nacelle/diverter interference pressures on the wing. These interference pressures were calculated using the AIRPLANE code. AIRPLANE is an Euler solver that uses a unstructured tetrahedral mesh and is capable of computations about arbitrary complete configurations. In addition, the buoyancy effects of the nacelle/diverters were also included in the design process by imposing the pressure field obtained during the design process onto the triangulated surfaces of the nacelle/diverter mesh generated by AIRPLANE. The interference pressures and nacelle buoyancy effects are added to the final forces after each flow field calculation. Full details of the (recently enhanced) ghost nacelle capability are given in a related talk. The pseudo nacelle corrections were greatly improved during this design cycle. During the Ref H and Cycle 1 design activities, the nacelles were only translated and pitched. In the cycle 2 design effort the nacelles can translate vertically, and pitch to accommodate the changes in the lower surface geometry. The diverter heights (between their leading and trailing edges) were modified during design as the shape of the lower wing changed, with the drag of the diverter changing accordingly. Both adjoint and finite difference gradients were used during optimization. The adjoint-based gradients were found to give good direction in the design space for configurations near the starting point, but as the design approached a minimum, the finite difference gradients were found to be more accurate. Use of finite difference gradients was limited by the

  2. Interplay between cell cycle and autophagy induced by boswellic acid analog

    PubMed Central

    Pathania, Anup S.; Guru, Santosh K.; Kumar, Suresh; Kumar, Ashok; Ahmad, Masroor; Bhushan, Shashi; Sharma, Parduman R.; Mahajan, Priya; Shah, Bhahwal A.; Sharma, Simmi; Nargotra, Amit; Vishwakarma, Ram; Korkaya, Hasan; Malik, Fayaz

    2016-01-01

    In this study, we investigated the role of autophagy induced by boswellic acid analog BA145 on cell cycle progression in pancreatic cancer cells. BA145 induced robust autophagy in pancreatic cancer cell line PANC-1 and exhibited cell proliferation inhibition by inducing cells to undergo G2/M arrest. Inhibition of G2/M progression was associated with decreased expression of cyclin A, cyclin B, cyclin E, cdc2, cdc25c and CDK-1. Pre-treatment of cells with autophagy inhibitors or silencing the expression of key autophagy genes abrogated BA145 induced G2/M arrest and downregulation of cell cycle regulatory proteins. It was further observed that BA145 induced autophagy by targeting mTOR kinase (IC50 1 μM), leading to reduced expression of p-mTOR, p-p70S6K (T389), p-4EBP (T37/46) and p-S6 (S240/244). Notably, inhibition of mTOR signalling by BA145 was followed by attendant activation of AKT and its membrane translocation. Inhibition of Akt through pharmacological inhibitors or siRNAs enhanced BA145 mediated autophagy, G2/M arrest and reduced expression of G2/M regulators. Further studies revealed that BA145 arbitrated inhibition of mTOR led to the activation of Akt through IGFR/PI3k/Akt feedback loop. Intervention in IGFR/PI3k/Akt loop further depreciated Akt phosphorylation and its membrane translocation that culminates in augmented autophagy with concomitant G2/M arrest and cell death. PMID:27680387

  3. Fumarate Reductase Activity Maintains an Energized Membrane in Anaerobic Mycobacterium tuberculosis

    PubMed Central

    Watanabe, Shinya; Zimmermann, Michael; Goodwin, Michael B.; Sauer, Uwe; Barry, Clifton E.; Boshoff, Helena I.

    2011-01-01

    Oxygen depletion of Mycobacterium tuberculosis engages the DosR regulon that coordinates an overall down-regulation of metabolism while up-regulating specific genes involved in respiration and central metabolism. We have developed a chemostat model of M. tuberculosis where growth rate was a function of dissolved oxygen concentration to analyze metabolic adaptation to hypoxia. A drop in dissolved oxygen concentration from 50 mmHg to 0.42 mmHg led to a 2.3 fold decrease in intracellular ATP levels with an almost 70-fold increase in the ratio of NADH/NAD+. This suggests that re-oxidation of this co-factor becomes limiting in the absence of a terminal electron acceptor. Upon oxygen limitation genes involved in the reverse TCA cycle were upregulated and this upregulation was associated with a significant accumulation of succinate in the extracellular milieu. We confirmed that this succinate was produced by a reversal of the TCA cycle towards the non-oxidative direction with net CO2 incorporation by analysis of the isotopomers of secreted succinate after feeding stable isotope (13C) labeled precursors. This showed that the resulting succinate retained both carbons lost during oxidative operation of the TCA cycle. Metabolomic analyses of all glycolytic and TCA cycle intermediates from 13C-glucose fed cells under aerobic and anaerobic conditions showed a clear reversal of isotope labeling patterns accompanying the switch from normoxic to anoxic conditions. M. tuberculosis encodes three potential succinate-producing enzymes including a canonical fumarate reductase which was highly upregulated under hypoxia. Knockout of frd, however, failed to reduce succinate accumulation and gene expression studies revealed a compensatory upregulation of two homologous enzymes. These major realignments of central metabolism are consistent with a model of oxygen-induced stasis in which an energized membrane is maintained by coupling the reductive branch of the TCA cycle to succinate

  4. Heteromeric amino acid transporters. In search of the molecular bases of transport cycle mechanisms.

    PubMed

    Palacín, Manuel; Errasti-Murugarren, Ekaitz; Rosell, Albert

    2016-06-15

    Heteromeric amino acid transporters (HATs) are relevant targets for structural studies. On the one hand, HATs are involved in inherited and acquired human pathologies. On the other hand, these molecules are the only known examples of solute transporters composed of two subunits (heavy and light) linked by a disulfide bridge. Unfortunately, structural knowledge of HATs is scarce and limited to the atomic structure of the ectodomain of a heavy subunit (human 4F2hc-ED) and distant prokaryotic homologues of the light subunits that share a LeuT-fold. Recent data on human 4F2hc/LAT2 at nanometer resolution revealed 4F2hc-ED positioned on top of the external loops of the light subunit LAT2. Improved resolution of the structure of HATs, combined with conformational studies, is essential to establish the structural bases for light subunit recognition and to evaluate the functional relevance of heavy and light subunit interactions for the amino acid transport cycle. © 2016 Authors; published by Portland Press Limited.

  5. Obeticholic acid, a selective farnesoid X receptor agonist, regulates bile acid homeostasis in sandwich-cultured human hepatocytes.

    PubMed

    Zhang, Yuanyuan; Jackson, Jonathan P; St Claire, Robert L; Freeman, Kimberly; Brouwer, Kenneth R; Edwards, Jeffrey E

    2017-08-01

    Farnesoid X receptor (FXR) is a master regulator of bile acid homeostasis through transcriptional regulation of genes involved in bile acid synthesis and cellular membrane transport. Impairment of bile acid efflux due to cholangiopathies results in chronic cholestasis leading to abnormal elevation of intrahepatic and systemic bile acid levels. Obeticholic acid (OCA) is a potent and selective FXR agonist that is 100-fold more potent than the endogenous ligand chenodeoxycholic acid (CDCA). The effects of OCA on genes involved in bile acid homeostasis were investigated using sandwich-cultured human hepatocytes. Gene expression was determined by measuring mRNA levels. OCA dose-dependently increased fibroblast growth factor-19 (FGF-19) and small heterodimer partner (SHP) which, in turn, suppress mRNA levels of cholesterol 7-alpha-hydroxylase (CYP7A1), the rate-limiting enzyme for de novo synthesis of bile acids. Consistent with CYP7A1 suppression, total bile acid content was decreased by OCA (1 μmol/L) to 42.7 ± 20.5% relative to control. In addition to suppressing de novo bile acids synthesis, OCA significantly increased the mRNA levels of transporters involved in bile acid homeostasis. The bile salt excretory pump (BSEP), a canalicular efflux transporter, increased by 6.4 ± 0.8-fold, and the basolateral efflux heterodimer transporters, organic solute transporter α (OST α ) and OST β increased by 6.4 ± 0.2-fold and 42.9 ± 7.9-fold, respectively. The upregulation of BSEP and OST α and OST β, by OCA reduced the intracellular concentrations of d 8 -TCA, a model bile acid, to 39.6 ± 8.9% relative to control. These data demonstrate that OCA does suppress bile acid synthesis and reduce hepatocellular bile acid levels, supporting the use of OCA to treat bile acid-induced toxicity observed in cholestatic diseases. © 2017 Intercept Pharmaceuticals. Pharmacology Research & Perspectives published by John Wiley & Sons Ltd, British Pharmacological Society and

  6. Shifting patterns of nitrogen excretion and amino acid catabolism capacity during the life cycle of the sea lamprey (Petromyzon marinus).

    PubMed

    Wilkie, Michael P; Claude, Jaime F; Cockshutt, Amanda; Holmes, John A; Wang, Yuxiang S; Youson, John H; Walsh, Patrick J

    2006-01-01

    The jawless fish, the sea lamprey (Petromyzon marinus), spends part of its life as a burrow-dwelling, suspension-feeding larva (ammocoete) before undergoing a metamorphosis into a free swimming, parasitic juvenile that feeds on the blood of fishes. We predicted that animals in this juvenile, parasitic stage have a great capacity for catabolizing amino acids when large quantities of protein-rich blood are ingested. The sixfold to 20-fold greater ammonia excretion rates (J(Amm)) in postmetamorphic (nonfeeding) and parasitic lampreys compared with ammocoetes suggested that basal rates of amino acid catabolism increased following metamorphosis. This was likely due to a greater basal amino acid catabolizing capacity in which there was a sixfold higher hepatic glutamate dehydrogenase (GDH) activity in parasitic lampreys compared with ammocoetes. Immunoblotting also revealed that GDH quantity was 10-fold and threefold greater in parasitic lampreys than in ammocoetes and upstream migrant lampreys, respectively. Higher hepatic alanine and aspartate aminotransferase activities in the parasitic lampreys also suggested an enhanced amino acid catabolizing capacity in this life stage. In contrast to parasitic lampreys, the twofold larger free amino acid pool in the muscle of upstream migrant lampreys confirmed that this period of natural starvation is accompanied by a prominent proteolysis. Carbamoyl phosphate synthetase III was detected at low levels in the liver of parasitic and upstream migrant lampreys, but there was no evidence of extrahepatic (muscle, intestine) urea production via the ornithine urea cycle. However, detection of arginase activity and high concentrations of arginine in the liver at all life stages examined infers that arginine hydrolysis is an important source of urea. We conclude that metamorphosis is accompanied by a metabolic reorganization that increases the capacity of parasitic sea lampreys to catabolize intermittently large amino acid loads arising

  7. MicroTCA-based Global Trigger Upgrade project for the CMS experiment at LHC

    NASA Astrophysics Data System (ADS)

    Rahbaran, B.; Arnold, B.; Bergauer, H.; Eichberger, M.; Rabady, D.

    2011-12-01

    The electronics of the first Level Global Trigger (GT) of CMS is the last stage of the Level-1 trigger system [1]. At LHC up to 40 million collisions of proton bunches occur every second, resulting in about 800 million proton collisions. The CMS Level-1 Global Trigger [1], a custom designed electronics system based on FPGA technology and the VMEbus system, performs a quick on-line analysis of each collision every 25 ns and decides whether to reject or to accept it for further analysis. The CMS trigger group of the Institute of High Energy Physics in Vienna (HEPHY) is involved in the Level-1 trigger of the CMS experiment at CERN. As part of the Trigger Upgrade, the Level-1 Global Trigger will be redesigned and implemented in MicroTCA based technology, which allows engineers to detect all possible faults on plug-in boards, in the power supply and in the cooling system. The upgraded Global Trigger will be designed to have the same basic categories of functions as the present GT, but will have more algorithms and more possibilities for combining trigger candidates. Additionally, reconfigurability and testability will be supported based on the next system generation.

  8. Cellular metabolic energy modulation by tangeretin in 7,12-dimethylbenz(a) anthracene-induced breast cancer.

    PubMed

    Periyasamy, Kuppusamy; Sivabalan, Venkatachalam; Baskaran, Kuppusamy; Kasthuri, Kannayiram; Sakthisekaran, Dhanapal

    2016-03-01

    Breast cancer is the leading cause of death among women worldwide. Chemoprevention and chemotherapy play beneficial roles in reducing the incidence and mortality of cancer. Epidemiological and experimental studies showed that naturally-occurring antioxidants present in the diet may act as anticancer agents. Identifying the abnormalities of cellular energy metabolism facilitates early detection and management of breast cancer. The present study evaluated the effect of tangeretin on cellular metabolic energy fluxes in 7,12-dimethylbenz(a) anthracene (DMBA)-induced proliferative breast cancer. The results showed that the activities of glycolytic enzymes significantly increased in mammary tissues of DMBA-induced breast cancer bearing rats. The gluconeogenic tricarboxylic acid (TCA) cycle and respiratory chain enzyme activities significantly decreased in breast cancer-bearing rats. In addition, proliferating cell nuclear antigen (PCNA) was highly expressed in breast cancer tissues. However, the activities of glycolytic enzymes were significantly normalized in the tangeretin pre- and post-treated rats and the TCA cycle and respiratory chain enzyme activities were significantly increased in tangeretin treated rats. Furthermore, tangeretin down-regulated PCNA expression on breast cancer-bearing rats. Our study demonstrates that tangeretin specifically regulates cellular metabolic energy fluxes in DMBA-induced breast cancer-bearing rats. © 2016 by the Journal of Biomedical Research. All rights reserved.

  9. IKKβ promotes metabolic adaptation to glutamine deprivation via phosphorylation and inhibition of PFKFB3

    PubMed Central

    Reid, Michael A.; Lowman, Xazmin H.; Pan, Min; Tran, Thai Q.; Warmoes, Marc O.; Ishak Gabra, Mari B.; Yang, Ying; Locasale, Jason W.; Kong, Mei

    2016-01-01

    Glutamine is an essential nutrient for cancer cell survival and proliferation. Enhanced utilization of glutamine often depletes its local supply, yet how cancer cells adapt to low glutamine conditions is largely unknown. Here, we report that IκB kinase β (IKKβ) is activated upon glutamine deprivation and is required for cell survival independently of NF-κB transcription. We demonstrate that IKKβ directly interacts with and phosphorylates 6-phosphofructo-2-kinase/fructose-2,6-biphosphatase isoform 3 (PFKFB3), a major driver of aerobic glycolysis, at Ser269 upon glutamine deprivation to inhibit its activity, thereby down-regulating aerobic glycolysis when glutamine levels are low. Thus, due to lack of inhibition of PFKFB3, IKKβ-deficient cells exhibit elevated aerobic glycolysis and lactate production, leading to less glucose carbons contributing to tricarboxylic acid (TCA) cycle intermediates and the pentose phosphate pathway, which results in increased glutamine dependence for both TCA cycle intermediates and reactive oxygen species suppression. Therefore, coinhibition of IKKβ and glutamine metabolism results in dramatic synergistic killing of cancer cells both in vitro and in vivo. In all, our results uncover a previously unidentified role of IKKβ in regulating glycolysis, sensing low-glutamine-induced metabolic stress, and promoting cellular adaptation to nutrient availability. PMID:27585591

  10. Cortex and hippocampus DNA epigenetic response to a long-term arsenic exposure via drinking water.

    PubMed

    Du, Xiaoyan; Tian, Meiping; Wang, Xiaoxue; Zhang, Jie; Huang, Qingyu; Liu, Liangpo; Shen, Heqing

    2018-03-01

    The neurotoxicity of arsenic is a serious health problem, especially for children. DNA epigenetic change may be an important pathogenic mechanism, but the molecular pathway remains obscure. In this study, the weaned male Sprague-Dawly (SD) rats were treated with arsenic trioxide via drinking water for 6 months, simulating real developmental exposure situation of children. Arsenic exposure impaired the cognitive abilities, and altered the expression of neuronal activity-regulated genes. Total arsenic concentrations of cortex and hippocampus tissues were significantly increased in a dose-dependent manner. The reduction in 5-methylcytosine (5 mC) and 5-hydroxymethylcytosine (5hmC) levels as well as the down-regulation of DNA methyltransferases (DNMTs) and ten-eleven translocations (TETs) expression suggested that DNA methylation/demethylation processes were significantly suppressed in brain tissues. S-adenosylmethionine (SAM) level wasn't changed, but the expression of the important indicators of oxidative/anti-oxidative balance and tricarboxylic acid (TCA) cycle was significantly deregulated. Overall, arsenic can disrupt oxidative/anti-oxidative balance, further inhibit TETs expression through TCA cycle and alpha-ketoglutarate (α-KG) pathway, and consequently cause DNA methylation/demethylation disruption. The present study implies oxidative stress but not SAM depletion may lead to DNA epigenetic alteration and arsenic neurotoxicity. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Cyanobacterial carbon metabolism: Fluxome plasticity and oxygen dependence: Cyanobacterial Carbon Metabolism

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Wan, Ni; DeLorenzo, Drew M.; He, Lian

    Synechocystis sp. strain PCC 6803 has been widely used as a photo-biorefinery chassis. Based on its genome annotation, this species contains a complete TCA cycle, an Embden-Meyerhof-Parnas pathway (EMPP), an oxidative pentose phosphate pathway (OPPP), and an Entner–Doudoroff pathway (EDP). To evaluate how Synechocystis 6803 catabolizes glucose under heterotrophic conditions, we performed 13C metabolic flux analysis, metabolite pool size analysis, gene knockouts, and heterologous expressions. The results revealed a cyclic mode of flux through the OPPP. Small, but non-zero, fluxes were observed through the TCA cycle and the malic shunt. Independent knockouts of 6-phosphogluconate dehydrogenase (gnd) and malic enzyme (me)more » corroborated these results, as neither mutant could grow under dark heterotrophic conditions. Our data also indicate that Synechocystis 6803 metabolism relies upon oxidative phosphorylation to generate ATP from NADPH under dark or insufficient light conditions. The pool sizes of intermediates in the TCA cycle, particularly acetyl-CoA, were found to be several fold lower in Synechocystis 6803 (compared to E. coli metabolite pool sizes), while its sugar phosphate intermediates were several-fold higher. Moreover, negligible flux was detected through the native, or heterologous, EDP in the wild type or Δgnd strains under heterotrophic conditions. Comparing photoautotrophic, photomixotrophic, and heterotrophic conditions, the Calvin cycle, OPPP, and EMPP in Synechocystis 6803 possess the ability to regulate their fluxes under various growth conditions (plastic), whereas its TCA cycle always maintains at low levels (rigid). This work also demonstrates how genetic profiles do not always reflect actual metabolic flux through native or heterologous pathways. Biotechnol. Bioeng. 2017;114: 1593–1602. © 2017 Wiley Periodicals, Inc.« less

  12. In silico gene expression analysis reveals glycolysis and acetate anaplerosis in IDH1 wild-type glioma and lactate and glutamate anaplerosis in IDH1-mutated glioma.

    PubMed

    Khurshed, Mohammed; Molenaar, Remco J; Lenting, Krissie; Leenders, William P; van Noorden, Cornelis J F

    2017-07-25

    Hotspot mutations in isocitrate dehydrogenase 1 (IDH1) initiate low-grade glioma and secondary glioblastoma and induce a neomorphic activity that converts α-ketoglutarate (α-KG) to the oncometabolite D-2-hydroxyglutarate (D-2-HG). It causes metabolic rewiring that is not fully understood. We investigated the effects of IDH1 mutations (IDH1MUT) on expression of genes that encode for metabolic enzymes by data mining The Cancer Genome Atlas. We analyzed 112 IDH1 wild-type (IDH1WT) versus 399 IDH1MUT low-grade glioma and 157 IDH1WT versus 9 IDH1MUT glioblastoma samples. In both glioma types, IDH1WT was associated with high expression levels of genes encoding enzymes that are involved in glycolysis and acetate anaplerosis, whereas IDH1MUT glioma overexpress genes encoding enzymes that are involved in the oxidative tricarboxylic acid (TCA) cycle. In vitro, we observed that IDH1MUT cancer cells have a higher basal respiration compared to IDH1WT cancer cells and inhibition of the IDH1MUT shifts the metabolism by decreasing oxygen consumption and increasing glycolysis. Our findings indicate that IDH1WT glioma have a typical Warburg phenotype whereas in IDH1MUT glioma the TCA cycle, rather than glycolytic lactate production, is the predominant metabolic pathway. Our data further suggest that the TCA in IDH1MUT glioma is driven by lactate and glutamate anaplerosis to facilitate production of α-KG, and ultimately D-2-HG. This metabolic rewiring may be a basis for novel therapies for IDH1MUT and IDH1WT glioma.

  13. Transport and cycling of iron and hydrogen peroxide in a freshwater stream: Influence of organic acids

    USGS Publications Warehouse

    Scott, Durelle T.; Runkel, Robert L.; McKnight, Diane M.; Voelker, Bettina M.; Kimball, Briant A.; Carraway, Elizabeth R.

    2003-01-01

    An in-stream injection of two dissolved organic acids (phthalic and aspartic acids) was performed in an acidic mountain stream to assess the effects of organic acids on Fe photoreduction and H2O2 cycling. Results indicate that the fate of Fe is dependent on a net balance of oxidative and reductive processes, which can vary over a distance of several meters due to changes in incident light and other factors. Solution phase photoreduction rates were high in sunlit reaches and were enhanced by the organic acid addition but were also limited by the amount of ferric iron present in the water column. Fe oxide photoreduction from the streambed and colloids within the water column resulted in an increase in the diurnal load of total filterable Fe within the experimental reach, which also responded to increases in light and organic acids. Our results also suggest that Fe(II) oxidation increased in response to the organic acids, with the result of offsetting the increase in Fe(II) from photoreductive processes. Fe(II) was rapidly oxidized to Fe(III) after sunset and during the day within a well-shaded reach, presumably through microbial oxidation. H2O 2, a product of dissolved organic matter photolysis, increased downstream to maximum concentrations of 0.25 ??M midday. Kinetic calculations show that the buildup of H2O2 is controlled by reaction with Fe(III), but this has only a small effect on Fe(II) because of the small formation rates of H2O2 compared to those of Fe(II). The results demonstrate the importance of incorporating the effects of light and dissolved organic carbon into Fe reactive transport models to further our understanding of the fate of Fe in streams and lakes.

  14. NUCLEIC ACID AND PROTEIN METABOLISM DURING THE MITOTIC CYCLE IN VICIA FABA

    PubMed Central

    Woodard, John; Rasch, Ellen; Swift, Hewson

    1961-01-01

    In order to investigate some of the cytochemical processes involved in interphase growth and culminating in cell division, a combined autoradiographic and microphotometric study of nucleic acids and proteins was undertaken on statistically seriated cells of Vicia faba root meristems. Adenine-8-C14 and uridine-H3 were used as ribonucleic acid (RNA) precursors, thymidine-H3 as a deoxyribonucleic acid (DNA) precursor, and phenylalanine-3-C14 as a protein precursor. Stains used in microphotometry were Feulgen (DNA), azure B (RNA), pH 2.0 fast green (total protein), and pH 8.1 fast green (histone). The autoradiographic data (representing rate of incorporation per organelle) and the microphotometric data (representing changes in amounts of the various components) indicate that the mitotic cycle may be divided into several metabolic phases, three predominantly anabolic (net increase), and a fourth phase predominantly catabolic (net decrease). The anabolic periods are: 1. Telophase to post-telophase during which there are high rates of accumulation of cytoplasmic and nucleolar RNA and nucleolar and chromosomal total protein. 2. Post-telophase to preprophase characterized by histone synthesis and a diphasic synthesis of DNA with the peak of synthesis at mid-interphase and a minor peak just preceding prophase. The minor peak is coincident with a relatively localized DNA synthesis in several chromosomal regions. This period is also characterized by minimal accumulations of cytoplasmic RNA and chromosomal and nucleolar total protein and RNA. 3. Preprophase to prophase in which there are again high rates of accumulation of cytoplasmic RNA, and nucleolar and chromosomal total protein and RNA. The catabolic phase is: 4. The mitotic division during which there are marked losses of cytoplasmic RNA and chromosomal and nucleolar total protein and RNA. PMID:13786522

  15. Metabolic and physiological adjustment of Suaeda maritima to combined salinity and hypoxia

    PubMed Central

    Behr, Jan H.; Bouchereau, Alain; Berardocco, Solenne; Seal, Charlotte E.; Flowers, Timothy J.

    2017-01-01

    Background and Aims Suaeda maritima is a halophyte commonly found on coastal wetlands in the intertidal zone. Due to its habitat S. maritima has evolved tolerance to high salt concentrations and hypoxic conditions in the soil caused by periodic flooding. In the present work, the adaptive mechanisms of S. maritima to salinity combined with hypoxia were investigated on a physiological and metabolic level. Methods To compare the adaptive mechanisms to deficient, optimal and stressful salt concentrations, S. maritima plants were grown in a hydroponic culture under low, medium and high salt concentrations. Additionally, hypoxic conditions were applied to investigate the impact of hypoxia combined with different salt concentrations. A non-targeted metabolic approach was used to clarify the biochemical pathways underlying the metabolic and physiological adaptation mechanisms of S. maritima. Key Results Roots exposed to hypoxic conditions showed an increased level of tricarboxylic acid (TCA)-cycle intermediates such as succinate, malate and citrate. During hypoxia, the concentration of free amino acids increased in shoots and roots. Osmoprotectants such as proline and glycine betaine increased in concentrations as the external salinity was increased under hypoxic conditions. Conclusions The combination of high salinity and hypoxia caused an ionic imbalance and an increase of metabolites associated with osmotic stress and photorespiration, indicating a severe physiological and metabolic response under these conditions. Disturbed proline degradation in the roots induced an enhanced proline accumulation under hypoxia. The enhanced alanine fermentation combined with a partial flux of the TCA cycle might contribute to the tolerance of S. maritima to hypoxic conditions. PMID:28110268

  16. Alterations in Cytosolic and Mitochondrial [U-13C]Glucose Metabolism in a Chronic Epilepsy Mouse Model

    PubMed Central

    Carrasco-Pozo, Catalina

    2017-01-01

    Abstract Temporal lobe epilepsy is a common form of adult epilepsy and shows high resistance to treatment. Increasing evidence has suggested that metabolic dysfunction contributes to the development of seizures, with previous studies indicating impairments in brain glucose metabolism. Here we aim to elucidate which pathways involved in glucose metabolism are impaired, by tracing the hippocampal metabolism of injected [U-13C]glucose (i.p.) during the chronic stage of the pilocarpine-status epilepticus mouse model of epilepsy. The enrichment of 13C in the intermediates of glycolysis and the TCA cycle were quantified in hippocampal extracts using liquid chromatography–tandem mass spectroscopy, along with the measurement of the activities of enzymes in each pathway. We show that there is reduced incorporation of 13C in the intermediates of glycolysis, with the percentage enrichment of all downstream intermediates being highly correlated with those of glucose 6-phosphate. Furthermore, the activities of all enzymes in this pathway including hexokinase and phosphofructokinase were unaltered, suggesting that glucose uptake is reduced in this model without further impairments in glycolysis itself. The key findings were 33% and 55% losses in the activities of pyruvate dehydrogenase and 2-oxoglutarate dehydrogenase, respectively, along with reduced 13C enrichment in TCA cycle intermediates. This lower 13C enrichment is best explained in part by the reduced enrichment in glycolytic intermediates, whereas the reduction of key TCA cycle enzyme activity indicates that TCA cycling is also impaired in the hippocampal formation. Together, these data suggest that multitarget approaches may be necessary to restore metabolism in the epileptic brain. PMID:28303258

  17. Characteristics of NO cycle coupling with urea cycle in non-hyperammonemic carriers of ornithine transcarbamylase deficiency.

    PubMed

    Nagasaka, Hironori; Yorifuji, Tohru; Egawa, Hiroto; Inui, Ayano; Fujisawa, Tomoo; Komatsu, Haruki; Tsukahara, Hirokazu; Uemoto, Shinji; Inomata, Yukihiro

    2013-07-01

    Urea cycle deficient patients with prominent hyperammonemic often exhibit abnormal production of nitric oxide (NO), which reduces vascular tone, along with amino acid abnormalities. However, information related to the metabolic changes in heterozygotes of ornithine transcarbamylase deficiency (OTCD) lacking overt hyperammonemia is quite limited. We examined vascular mediators and amino acids in non-hyperammonemic heterozygotes. Twenty-four heterozygous OTCD adult females without hyperammonemic bouts, defined as non-hyperammonemic carriers, were enrolled. We measured blood amino acids constituting urea cycle and nitric oxide (NO) cycle. Blood concentrations of nitrate/nitrite (NOx) as stable NO-metabolites, asymmetric dimethylarginine (ADMA) inhibiting NO synthesis, and endothelin-1 (ET-1) raising vascular tone were also determined. NOx concentrations were significantly lower in non-hyperammonemic carriers (p < 0.01). However, ADMA and ET-1 levels in this group were comparable to those in the age-matched control group. Arginine and citrulline levels were also significantly lower in non-hyperammonemic carriers than in controls (p < 0.01). Of the 24 non-hyperammonemic carriers, 10 often developed headaches. Their daily NOx and arginine levels were significantly lower than those in headache-free carriers (p < 0.05). In three carriers receiving oral l-arginine, blood NOx concentrations were significantly higher. In two of those three, the occurrence of headaches was decreased. These results suggest that NO cycle coupling with the urea cycle is altered substantially even in non-hyperammonemic OTCD carriers, predisposing them to headaches. Copyright © 2013 Elsevier Inc. All rights reserved.

  18. The reductive degradation of 1,1,1-trichloroethane by Fe(0) in a soil slurry system.

    PubMed

    Wu, Xiaoliang; Lu, Shuguang; Qiu, Zhaofu; Sui, Qian; Lin, Kuangfei; Du, Xiaoming; Luo, Qishi

    2014-01-01

    Most studies on the treatment of chlorinated contaminants by Fe(0) focus on aqueous system tests. However, few is known about the effectiveness of these tests for degrading chlorinated contaminants such as 1,1,1-trichloroethane (TCA) in soil. In this work, the reductive degradation performance of 1,1,1-TCA by Fe(0) was thoroughly investigated in a soil slurry system. The effects of various factors including acid-washed iron, the initial 1,1,1-TCA concentration, Fe(0) dosage, slurry pH, and common constituents in groundwater and soil such as Cl(-), HCO3 (-), SO4 (2-), and NO3 (-) anions and humic acid (HA) were evaluated. The experimental results showed that 1,1,1-TCA could be effectively degraded in 12 h for an initial Fe(0) dosage of 10 g L(-1) and a soil/water mass ratio of 1:5. The soil slurry experiments showed two-stage degradation kinetics: a slow reaction in the first stage and a fast reductive degradation of 1,1,1-TCA in the second stage. The reductive degradation of 1,1,1-TCA was expedited as the mass concentration of Fe(0) increased. In addition, high pHs adversely affected the degradation of 1,1,1-TCA over a pH range of 5.4-8.0 and the reductive degradation efficiency decreased with increasing slurry pH. The initial 1,1,1-TCA concentration and the presence of Cl(-) and SO4(2-) anions had negligible effects. HCO3(-) anions had a accelerative effect on 1,1,1-TCA removal, and both NO3(-) and HA had inhibitory effects. A Cl(-) mass balance showed that the amount of Cl(-) ions released into the soil slurry system during the 1,1,1-TCA degradation increased with increasing reaction time, suggesting that the main degradation mechanism of 1,1,1-TCA by Fe(0) in a soil slurry system was reductive dechlorination with 1,1-DCA as the main intermediate. In conclusion, this study provides a theoretical basis for the practical application of the remediation of contaminated sites containing chlorinated solvent.

  19. NMR- and GC/MS-based metabolomics of sulfur mustard exposed individuals: a pilot study.

    PubMed

    Nobakht, B Fatemeh; Aliannejad, Rasoul; Rezaei-Tavirani, Mostafa; Arefi Oskouie, Afsaneh; Naseri, Mohammad Taghi; Parastar, Hadi; Aliakbarzadeh, Ghazaleh; Fathi, Fariba; Taheri, Salman

    2016-09-01

    Sulfur mustard (SM) is a potent alkylating agent and its effects on cells and tissues are varied and complex. Due to limitations in the diagnostics of sulfur mustard exposed individuals (SMEIs) by noninvasive approaches, there is a great necessity to develop novel techniques and biomarkers for this condition. We present here the first nuclear magnetic resonance (NMR) and gas chromatography-mass spectrometry (GC/MS) metabolic profiling of serum from and healthy controls to identify novel biomarkers in blood serum for better diagnostics. Of note, SMEIs were exposed to SM 30 years ago and that differences between two groups could still be found. Pathways in which differences between SMEIs and healthy controls are observed are related to lipid metabolism, ketogenesis, tricarboxylic acid (TCA) cycle and amino acid metabolism.

  20. Accumulation of 5-Oxoproline in Mouse Tissues After Inhibition of 5-Oxoprolinase and Administration of Amino Acids: Evidence for Function of the γ-Glutamyl Cycle*

    PubMed Central

    Van Der Werf, Paul; Stephani, Ralph A.; Meister, Alton

    1974-01-01

    5-Oxoprolinase catalyzes the conversion of 5-oxo-L-proline (L-pyroglutamate, L-2-pyrrolidone-5-carboxylate) to L-glutamate with concomitant stoichiometric cleavage of ATP to ADP and inorganic orthophosphate. In this reaction, a step in the γ-glutamyl cycle, 5-oxoproline (formed by the action of γ-glutamylcyclotransferase on γ-glutamyl amino acids, which are in turn formed by transpeptidation of amino acids with glutathione), is made available for glutathione synthesis. When mice are injected with L-2-imidazolidone-4-carboxylate, a competitive inhibitor of 5-oxoprolinase, they accumulate 5-oxoproline in their tissues (kidney, liver, brain, and eye) and excrete it in the urine. Mice given the inhibitor together with one of several L-amino acids accumulate and excrete much more 5-oxoproline than when they are given the inhibitor alone. Such augmentation of 5-oxoproline accumulation offers evidence for the function of the γ-glutamyl cycle in vivo and supports the view that 5-oxoproline is a quantitatively significant metabolite. Images PMID:4151516

  1. Global Metabolic Regulation of the Snow Alga Chlamydomonas nivalis in Response to Nitrate or Phosphate Deprivation by a Metabolome Profile Analysis.

    PubMed

    Lu, Na; Chen, Jun-Hui; Wei, Dong; Chen, Feng; Chen, Gu

    2016-05-10

    In the present work, Chlamydomonas nivalis, a model species of snow algae, was used to illustrate the metabolic regulation mechanism of microalgae under nutrient deprivation stress. The seed culture was inoculated into the medium without nitrate or phosphate to reveal the cell responses by a metabolome profile analysis using gas chromatography time-of-flight mass spectrometry (GC/TOF-MS). One hundred and seventy-one of the identified metabolites clustered into five groups by the orthogonal partial least squares discriminant analysis (OPLS-DA) model. Among them, thirty of the metabolites in the nitrate-deprived group and thirty-nine of the metabolites in the phosphate-deprived group were selected and identified as "responding biomarkers" by this metabolomic approach. A significant change in the abundance of biomarkers indicated that the enhanced biosynthesis of carbohydrates and fatty acids coupled with the decreased biosynthesis of amino acids, N-compounds and organic acids in all the stress groups. The up- or down-regulation of these biomarkers in the metabolic network provides new insights into the global metabolic regulation and internal relationships within amino acid and fatty acid synthesis, glycolysis, the tricarboxylic acid cycle (TCA) and the Calvin cycle in the snow alga under nitrate or phosphate deprivation stress.

  2. Aircraft Emission Scenarios Projected in Year 2015 for the NASA Technology Concept Aircraft (TCA) High Speed Civil Transport

    NASA Technical Reports Server (NTRS)

    Baughcum, Steven L.; Henderson, Stephen C.

    1998-01-01

    This report describes the development of a three-dimensional database of aircraft fuel burn and emissions (fuel burned, NOx, CO, and hydrocarbons) from projected fleets of high speed civil transports (HSCTs) on a universal airline network. Inventories for 500 and 1000 HSCT fleets, as well as the concurrent subsonic fleets, were calculated. The HSCT scenarios are calculated using the NASA technology concept airplane (TCA) and update an earlier report. These emissions inventories are available for use by atmospheric scientists conducting the Atmospheric Effects of Stratospheric Aircraft (AESA) modeling studies. Fuel burned and emissions of nitrogen oxides (NOx as NO2), carbon monoxide, and hydrocarbons have been calculated on a 1 degree latitude x 1 degree longitude x 1 kilometer pressure altitude grid and delivered to NASA as electronic files.

  3. Chemolithoautotrophy and its Relation to Magnetism and Biomineralization in Marine Magnetotactic Bacteria

    NASA Astrophysics Data System (ADS)

    Bazylinski, D. A.; Williams, T. J.; Zhang, C. L.; Scott, J. H.

    2005-12-01

    All cultured, marine, magnetite-producing, magnetotactic bacteria (MB) are capable of chemolithoautotrophy and use a number of electron donors to support this mode of growth including reduced sulfur compounds. Several vibrioid strains are known to rely on the Calvin-Benson-Bassham (CBB) cycle for autotrophy. An obligately microaerophilic, magnetite-producing, coccoid strain (MC-1) grew with sulfide and thiosulfate as electron donors and 14C-labelling experiments showed that virtually all cell C was derived from H14CO3-/14CO2 confirming autotrophy in this strain. Cell-free extracts of strain MC-1 did not exhibit ribulose-1,5-bisphosphate carboxylase-oxygenase (RubisCO) activity and nor were RubisCO genes found in the draft genome of the organism. Cell extracts also did not exhibit carbon monoxide dehydrogenase activity indicating that the acetyl-CoA pathway also does not function in strain MC-1. The 13C content of whole cells of strain MC-1 relative to the 13C content of the H14CO3-/14CO2 used for growth (Δδ13C) was -11.4 ppt. Cellular fatty acids showed enrichment of 13C relative to biomass. Activities for three key enzymes of the reverse or reductive tricarboxylic acid (rTCA) cycle were demonstrated for MC-1: fumarate reductase, pyruvate: acceptor oxidoreductase and 2-oxoglutarate: acceptor oxidoreductase. Although ATP citrate lyase (another key enzyme of the rTCA cycle) activity was not detected in cell-free extracts of strain MC-1 using commonly used assays for this enzyme, cell-free extract was found to rapidly cleave citrate, and the reaction was dependent upon the presence of ATP, coenzyme A and NADH. Thus, we infer the presence of an ATP-dependent citrate-cleaving enzyme or enzymes. The Δδ13C value and results from enzyme studies are consistent with the operation of the rTCA cycle for autotrophy in strain MC-1. Strain MC-1 appears to be the first known member of the alpha-Proteobacteria to assimilate CO2 during autotrophic growth using the rTCA cycle

  4. Glutamine fuels a vicious cycle of autophagy in the tumor stroma and oxidative mitochondrial metabolism in epithelial cancer cells

    PubMed Central

    Ko, Ying-Hui; Lin, Zhao; Flomenberg, Neal; Pestell, Richard G; Howell, Anthony; Sotgia, Federica

    2011-01-01

    Glutamine metabolism is crucial for cancer cell growth via the generation of intermediate molecules in the tricarboxylic acid (TCA) cycle, antioxidants and ammonia. The goal of the current study was to evaluate the effects of glutamine on metabolism in the breast cancer tumor microenvironment, with a focus on autophagy and cell death in both epithelial and stromal compartments. For this purpose, MCF7 breast cancer cells were cultured alone or co-cultured with nontransformed fibroblasts in media containing high glutamine and low glucose (glutamine +) or under control conditions, with no glutamine and high glucose (glutamine −). Here, we show that MCF7 cells maintained in co-culture with glutamine display increased mitochondrial mass, as compared with control conditions. Importantly, treatment with the autophagy inhibitor chloroquine abolishes the glutamine-induced augmentation of mitochondrial mass. It is known that loss of caveolin-1 (Cav-1) expression in fibroblasts is associated with increased autophagy and an aggressive tumor microenvironment. Here, we show that Cav-1 downregulation which occurs in fibroblasts maintained in co-culture specifically requires glutamine. Interestingly, glutamine increases the expression of autophagy markers in fibroblasts, but decreases expression of autophagy markers in MCF7 cells, indicating that glutamine regulates the autophagy program in a compartment-specific manner. Functionally, glutamine protects MCF7 cells against apoptosis, via the upregulation of the anti-apoptotic and anti-autophagic protein TIGAR. Also, we show that glutamine cooperates with stromal fibroblasts to confer tamoxifen-resistance in MCF7 cancer cells. Finally, we provide evidence that co-culture with fibroblasts (1) promotes glutamine catabolism, and (2) decreases glutamine synthesis in MCF7 cancer cells. Taken together, our findings suggest that autophagic fibroblasts may serve as a key source of energy-rich glutamine to fuel cancer cell mitochondrial

  5. Preventive effect of chemical peeling on ultraviolet induced skin tumor formation.

    PubMed

    Abdel-Daim, Mohamed; Funasaka, Yoko; Kamo, Tsuneyoshi; Ooe, Masahiko; Matsunaka, Hiroshi; Yanagita, Emmy; Itoh, Tomoo; Nishigori, Chikako

    2010-10-01

    Chemical peeling is one of the dermatological treatments available for certain cutaneous diseases and conditions or improvement of cosmetic appearance of photoaged skin. We assessed the photochemopreventive effect of several clinically used chemical peeling agents on the ultraviolet (UV)-irradiated skin of hairless mice. Chemical peeling was done using 35% glycolic acid dissolved in distilled water, 30% salicylic acid in ethanol, 10% or 35% trichloroacetic acid (TCA) in distilled water at the right back of UV-irradiated hairless mice every 2 weeks in case of glycolic acid, salicylic acid, and 10% TCA and every 4 weeks in case of 35% TCA for totally 18 weeks after the establishment of photoaged mice by irradiation with UVA+B range light three times a week for 10 weeks at a total dose of 420 J/cm(2) at UVA and 9.6 J/cm(2) at UVB. Tumor formation was assessed every week. Skin specimens were taken from treated and non-treated area for evaluation under microscopy, evaluation of P53 expression, and mRNA expression of cyclooxygenase (COX)-2. Serum level of prostaglandin E(2) was also evaluated. All types of chemical peeling reduced tumor formation in treated mice, mostly in the treated area but also non-treated area. Peeling suppressed clonal retention of p53 positive abnormal cells and reduced mRNA expression of COX-2 in treated skin. Further, serum prostaglandin E(2) level was decreased in chemical peeling treated mice. These results indicate that chemical peeling with glycolic acid, salicylic acid, and TCA could serve tumor prevention by removing photodamaged cells. Copyright © 2010 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.

  6. Tumor growth affects the metabonomic phenotypes of multiple mouse non-involved organs in an A549 lung cancer xenograft model.

    PubMed

    Xu, Shan; Tian, Yuan; Hu, Yili; Zhang, Nijia; Hu, Sheng; Song, Dandan; Wu, Zhengshun; Wang, Yulan; Cui, Yanfang; Tang, Huiru

    2016-06-22

    The effects of tumorigenesis and tumor growth on the non-involved organs remain poorly understood although many research efforts have already been made for understanding the metabolic phenotypes of various tumors. To better the situation, we systematically analyzed the metabolic phenotypes of multiple non-involved mouse organ tissues (heart, liver, spleen, lung and kidney) in an A549 lung cancer xenograft model at two different tumor-growth stages using the NMR-based metabonomics approaches. We found that tumor growth caused significant metabonomic changes in multiple non-involved organ tissues involving numerous metabolic pathways, including glycolysis, TCA cycle and metabolisms of amino acids, fatty acids, choline and nucleic acids. Amongst these, the common effects are enhanced glycolysis and nucleoside/nucleotide metabolisms. These findings provided essential biochemistry information about the effects of tumor growth on the non-involved organs.

  7. Studies of thermochemical water-splitting cycles

    NASA Technical Reports Server (NTRS)

    Remick, R. J.; Foh, S. E.

    1980-01-01

    Higher temperatures and more isothermal heat profiles of solar heat sources are developed. The metal oxide metal sulfate class of cycles were suited for solar heat sources. Electrochemical oxidation of SO2 and thermochemical reactions are presented. Electrolytic oxidation of sulfur dioxide in dilute sulfuric acid solutions were appropriate for metal oxide metal sulfate cycles. The cell voltage at workable current densities required for the oxidation of SO2 was critical to the efficient operation of any metal oxide metal sulfate cycle. A sulfur dioxide depolarized electrolysis cell for the splitting of water via optimization of the anode reaction is discussed. Sulfuric acid concentrations of 30 to 35 weight percent are preferred. Platinized platinum or smooth platinum gave the best anode kinetics at a given potential of the five materials examined.

  8. Novel insights into the bioenergetics of mixed-acid fermentation: can hydrogen and proton cycles combine to help maintain a proton motive force?

    PubMed

    Trchounian, Armen; Gary Sawers, R

    2014-01-01

    Escherichia coli possesses four [NiFe]-hydrogenases that catalyze the reversible redox reaction of 2H(+) + 2e(-) ↔ H2. These enzymes together have the potential to form a hydrogen cycle across the membrane. Their activity, operational direction, and interaction with each other depend on the fermentation substrate and particularly pH. The enzymes producing H2 are likely able to translocate protons through the membrane. Moreover, the activity of some of these enzymes is dependent on the F0 F1 -ATPase, thus linking a proton cycle with the cycling of hydrogen. These two cycles are suggested to have a primary basic role in modulating the cell's energetics during mixed-acid fermentation, particularly in response to pH. Nevertheless, the mechanisms underlying the physical interactions between these enzyme complexes, as well as how this is controlled, are still not clearly understood. Here, we present a synopsis of the potential impact of proton-hydrogen cycling in fermentative bioenergetics. © 2013 International Union of Biochemistry and Molecular Biology.

  9. Triheptanoin Protects Motor Neurons and Delays the Onset of Motor Symptoms in a Mouse Model of Amyotrophic Lateral Sclerosis

    PubMed Central

    Barkl-Luke, Mallory E.; Ngo, Shyuan T.; Thomas, Nicola K.; McDonald, Tanya S.; Borges, Karin

    2016-01-01

    There is increasing evidence that energy metabolism is disturbed in Amyotrophic Lateral Sclerosis (ALS) patients and animal models. Treatment with triheptanoin, the triglyceride of heptanoate, is a promising approach to provide alternative fuel to improve oxidative phosphorylation and aid ATP generation. Heptanoate can be metabolized to propionyl-CoA, which after carboxylation can produce succinyl-CoA and thereby re-fill the tricarboxylic acid (TCA) cycle (anaplerosis). Here we tested the hypothesis that treatment with triheptanoin prevents motor neuron loss and delays the onset of disease symptoms in female mice overexpressing the mutant human SOD1G93A (hSOD1G93A) gene. When oral triheptanoin (35% of caloric content) was initiated at P35, motor neuron loss at 70 days of age was attenuated by 33%. In untreated hSOD1G93A mice, the loss of hind limb grip strength began at 16.7 weeks. Triheptanoin maintained hind limb grip strength for 2.8 weeks longer (p<0.01). Loss of balance on the rotarod and reduction of body weight were delayed by 13 and 11 days respectively (both p<0.01). Improved motor function occurred in parallel with alterations in the expression of genes associated with muscle metabolism. In gastrocnemius muscles, the mRNA levels of pyruvate, 2-oxoglutarate and succinate dehydrogenases and methyl-malonyl mutase were reduced by 24–33% in 10 week old hSOD1G93A mice when compared to wild-type mice, suggesting that TCA cycling in skeletal muscle may be slowed in this ALS mouse model at a stage when muscle strength is still normal. At 25 weeks of age, mRNA levels of succinate dehydrogenases, glutamic pyruvic transaminase 2 and the propionyl carboxylase β subunit were reduced by 69–84% in control, but not in triheptanoin treated hSOD1G93A animals. Taken together, our results suggest that triheptanoin slows motor neuron loss and the onset of motor symptoms in ALS mice by improving TCA cycling. PMID:27564703

  10. Use of a Bacterial Luciferase Monitoring System To Estimate Real-Time Dynamics of Intracellular Metabolism in Escherichia coli.

    PubMed

    Shimada, Tomohiro; Tanaka, Kan

    2016-10-01

    Regulation of central carbon metabolism has long been an important research subject in every organism. While the dynamics of metabolic flows during changes in available carbon sources have been estimated based on changes in metabolism-related gene expression, as well as on changes in the metabolome, the flux change itself has scarcely been measured because of technical difficulty, which has made conclusions elusive in many cases. Here, we used a monitoring system employing Vibrio fischeri luciferase to probe the intracellular metabolic condition in Escherichia coli Using a batch culture provided with a limited amount of glucose, we performed a time course analysis, where the predominant carbon source shifts from glucose to acetate, and identified a series of sequential peaks in the luciferase activity (peaks 1 to 4). Two major peaks, peaks 1 and 3, were considered to correspond to the glucose and acetate consuming phases, respectively, based on the glucose, acetate, and dissolved oxygen concentrations in the medium. The pattern of these peaks was changed by the addition of a different carbon source or by an increasing concentration of glucose, which was consistent with the present model. Genetically, mutations involved in glycolysis or the tricarboxylic acid (TCA) cycle/gluconeogenesis specifically affected peak 1 or peak 3, respectively, as expected from the corresponding metabolic phase. Intriguingly, mutants for the acetate excretion pathway showed a phenotype of extended peak 2 and delayed transition to the TCA cycle/gluconeogenesis phase, which suggests that peak 2 represents the metabolic transition phase. These results indicate that the bacterial luciferase monitoring system is useful to understand the real-time dynamics of metabolism in living bacterial cells. Intracellular metabolic flows dynamically change during shifts in available carbon sources. However, because of technical difficulty, the flux change has scarcely been measured in living cells. Here

  11. Identification of the Bile Acid Transporter Slco1a6 as a Candidate Gene That Broadly Affects Gene Expression in Mouse Pancreatic Islets

    PubMed Central

    Tian, Jianan; Keller, Mark P.; Oler, Angie T.; Rabaglia, Mary E.; Schueler, Kathryn L.; Stapleton, Donald S.; Broman, Aimee Teo; Zhao, Wen; Kendziorski, Christina; Yandell, Brian S.; Hagenbuch, Bruno; Broman, Karl W.; Attie, Alan D.

    2015-01-01

    We surveyed gene expression in six tissues in an F2 intercross between mouse strains C57BL/6J (abbreviated B6) and BTBR T+ tf/J (abbreviated BTBR) made genetically obese with the Leptinob mutation. We identified a number of expression quantitative trait loci (eQTL) affecting the expression of numerous genes distal to the locus, called trans-eQTL hotspots. Some of these trans-eQTL hotspots showed effects in multiple tissues, whereas some were specific to a single tissue. An unusually large number of transcripts (∼8% of genes) mapped in trans to a hotspot on chromosome 6, specifically in pancreatic islets. By considering the first two principal components of the expression of genes mapping to this region, we were able to convert the multivariate phenotype into a simple Mendelian trait. Fine mapping the locus by traditional methods reduced the QTL interval to a 298-kb region containing only three genes, including Slco1a6, one member of a large family of organic anion transporters. Direct genomic sequencing of all Slco1a6 exons identified a nonsynonymous coding SNP that converts a highly conserved proline residue at amino acid position 564 to serine. Molecular modeling suggests that Pro564 faces an aqueous pore within this 12-transmembrane domain-spanning protein. When transiently overexpressed in HEK293 cells, BTBR organic anion transporting polypeptide (OATP)1A6-mediated cellular uptake of the bile acid taurocholic acid (TCA) was enhanced compared to B6 OATP1A6. Our results suggest that genetic variation in Slco1a6 leads to altered transport of TCA (and potentially other bile acids) by pancreatic islets, resulting in broad gene regulation. PMID:26385979

  12. The Effect of Limited Diffusion and Wet–Dry Cycling on Reversible Polymerization Reactions: Implications for Prebiotic Synthesis of Nucleic Acids

    PubMed Central

    Higgs, Paul G.

    2016-01-01

    A long-standing problem for the origins of life is that polymerization of many biopolymers, including nucleic acids and peptides, is thermodynamically unfavourable in aqueous solution. If bond making and breaking is reversible, monomers and very short oligomers predominate. Recent experiments have shown that wetting and drying cycles can overcome this problem and drive the formation of longer polymers. In the dry phase, bond formation is favourable, but diffusion is restricted, and bonds only form between monomers that are initially close together. In the wet phase, some of the bonds are hydrolyzed. However, repositioning of the molecules allows new bonds to form in the next dry phase, leading to an increase in mean polymer length. Here, we consider a simple theoretical model that explains the effect of cycling. There is an equilibrium length distribution with a high mean length that could be achieved if diffusion occurred freely in the dry phase. This equilibrium is inaccessible without diffusion. A single dry cycle without diffusion leads to mean lengths much shorter than this. Repeated cycling leads to a significant increase in polymerization relative to a single cycle. In the most favourable case, cycling leads to the same equilibrium length distribution as would be achieved if free diffusion were possible in the dry phase. These results support the RNA World scenario by explaining a potential route to synthesis of long RNAs; however, they also imply that cycling would be beneficial to the synthesis of other kinds of polymers, including peptides, where bond formation involves a condensation reaction. PMID:27338479

  13. The Effect of Limited Diffusion and Wet-Dry Cycling on Reversible Polymerization Reactions: Implications for Prebiotic Synthesis of Nucleic Acids.

    PubMed

    Higgs, Paul G

    2016-06-08

    A long-standing problem for the origins of life is that polymerization of many biopolymers, including nucleic acids and peptides, is thermodynamically unfavourable in aqueous solution. If bond making and breaking is reversible, monomers and very short oligomers predominate. Recent experiments have shown that wetting and drying cycles can overcome this problem and drive the formation of longer polymers. In the dry phase, bond formation is favourable, but diffusion is restricted, and bonds only form between monomers that are initially close together. In the wet phase, some of the bonds are hydrolyzed. However, repositioning of the molecules allows new bonds to form in the next dry phase, leading to an increase in mean polymer length. Here, we consider a simple theoretical model that explains the effect of cycling. There is an equilibrium length distribution with a high mean length that could be achieved if diffusion occurred freely in the dry phase. This equilibrium is inaccessible without diffusion. A single dry cycle without diffusion leads to mean lengths much shorter than this. Repeated cycling leads to a significant increase in polymerization relative to a single cycle. In the most favourable case, cycling leads to the same equilibrium length distribution as would be achieved if free diffusion were possible in the dry phase. These results support the RNA World scenario by explaining a potential route to synthesis of long RNAs; however, they also imply that cycling would be beneficial to the synthesis of other kinds of polymers, including peptides, where bond formation involves a condensation reaction.

  14. Lactic Acid Bacteria in Durum Wheat Flour Are Endophytic Components of the Plant during Its Entire Life Cycle.

    PubMed

    Minervini, Fabio; Celano, Giuseppe; Lattanzi, Anna; Tedone, Luigi; De Mastro, Giuseppe; Gobbetti, Marco; De Angelis, Maria

    2015-10-01

    This study aimed at assessing the dynamics of lactic acid bacteria and other Firmicutes associated with durum wheat organs and processed products. 16S rRNA gene-based high-throughput sequencing showed that Lactobacillus, Streptococcus, Enterococcus, and Lactococcus were the main epiphytic and endophytic genera among lactic acid bacteria. Bacillus, Exiguobacterium, Paenibacillus, and Staphylococcus completed the picture of the core genus microbiome. The relative abundance of each lactic acid bacterium genus was affected by cultivars, phenological stages, other Firmicutes genera, environmental temperature, and water activity (aw) of plant organs. Lactobacilli, showing the highest sensitivity to aw, markedly decreased during milk development (Odisseo) and physiological maturity (Saragolla). At these stages, Lactobacillus was mainly replaced by Streptococcus, Lactococcus, and Enterococcus. However, a key sourdough species, Lactobacillus plantarum, was associated with plant organs during the life cycle of Odisseo and Saragolla wheat. The composition of the sourdough microbiota and the overall quality of leavened baked goods are also determined throughout the phenological stages of wheat cultivation, with variations depending on environmental and agronomic factors. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  15. Lactic Acid Bacteria in Durum Wheat Flour Are Endophytic Components of the Plant during Its Entire Life Cycle

    PubMed Central

    Minervini, Fabio; Celano, Giuseppe; Lattanzi, Anna; Tedone, Luigi; De Mastro, Giuseppe; De Angelis, Maria

    2015-01-01

    This study aimed at assessing the dynamics of lactic acid bacteria and other Firmicutes associated with durum wheat organs and processed products. 16S rRNA gene-based high-throughput sequencing showed that Lactobacillus, Streptococcus, Enterococcus, and Lactococcus were the main epiphytic and endophytic genera among lactic acid bacteria. Bacillus, Exiguobacterium, Paenibacillus, and Staphylococcus completed the picture of the core genus microbiome. The relative abundance of each lactic acid bacterium genus was affected by cultivars, phenological stages, other Firmicutes genera, environmental temperature, and water activity (aw) of plant organs. Lactobacilli, showing the highest sensitivity to aw, markedly decreased during milk development (Odisseo) and physiological maturity (Saragolla). At these stages, Lactobacillus was mainly replaced by Streptococcus, Lactococcus, and Enterococcus. However, a key sourdough species, Lactobacillus plantarum, was associated with plant organs during the life cycle of Odisseo and Saragolla wheat. The composition of the sourdough microbiota and the overall quality of leavened baked goods are also determined throughout the phenological stages of wheat cultivation, with variations depending on environmental and agronomic factors. PMID:26187970

  16. Growth inhibitory effect of 4-phenyl butyric acid on human gastric cancer cells is associated with cell cycle arrest.

    PubMed

    Li, Long-Zhu; Deng, Hong-Xia; Lou, Wen-Zhu; Sun, Xue-Yan; Song, Meng-Wan; Tao, Jing; Xiao, Bing-Xiu; Guo, Jun-Ming

    2012-01-07

    To investigate the growth effects of 4-phenyl butyric acid (PBA) on human gastric carcinoma cells and their mechanisms. Moderately-differentiated human gastric carcinoma SGC-7901 and lowly-differentiated MGC-803 cells were treated with 5, 10, 20, 40, and 60 μmol/L PBA for 1-4 d. Cell proliferation was detected using the MTT colorimetric assay. Cell cycle distributions were examined using flow cytometry. The proliferation of gastric carcinoma cells was inhibited by PBA in a dose- and time-dependent fashion. Flow cytometry showed that SGC-7901 cells treated with low concentrations of PBA were arrested at the G₀/G₁ phase, whereas cells treated with high concentrations of PBA were arrested at the G₂/M phase. Although MGC-803 cells treated with low concentrations of PBA were also arrested at the G₀/ G₁ phase, cells treated with high concentrations of PBA were arrested at the S phase. The growth inhibitory effect of PBA on gastric cancer cells is associated with alteration of the cell cycle. For moderately-differentiated gastric cancer cells, the cell cycle was arrested at the G₀ /G₁ and G₂/M phases. For lowly-differentiated gastric cancer cells, the cell cycle was arrested at the G₀/G₁ and S phases.

  17. Quantification of 15 bile acids in lake charr feces by ultra-high performance liquid chromatography–tandem mass spectrometry

    USGS Publications Warehouse

    Li, Ke; Buchinger, Tyler J.; Bussy, Ugo; Fissette, Skye D.; Johnson, Nicholas; Li, Weiming

    2015-01-01

    Many fishes are hypothesized to use bile acids (BAs) as chemical cues, yet quantification of BAs in biological samples and the required methods remain limited. Here, we present an UHPLC–MS/MS method for simultaneous, sensitive, and rapid quantification of 15 BAs, including free, taurine, and glycine conjugated BAs, and application of the method to fecal samples from lake charr (Salvelinus namaycush). The analytes were separated on a C18 column with acetonitrile–water (containing 7.5 mM ammonium acetate and 0.1% formic acid) as mobile phase at a flow rate of 0.25 mL/min for 12 min. BAs were monitored with a negative electrospray triple quadrupole mass spectrometer (Xevo TQ-S™). Calibration curves of 15 BAs were linear over the concentration range of 1.00–5,000 ng/mL. Validation revealed that the method was specific, accurate, and precise. The method was applied to quantitative analysis of feces extract of fry lake charr and the food they were eating. The concentrations of analytes CA, TCDCA, TCA, and CDCA were 242.3, 81.2, 60.7, and 36.2 ng/mg, respectively. However, other taurine conjugated BAs, TUDCA, TDCA, and THDCA, were not detected in feces of lake charr. Interestingly, TCA and TCDCA were detected at high concentrations in food pellets, at 71.9 and 38.2 ng/mg, respectively. Application of the method to feces samples from lake charr supported a role of BAs as chemical cues, and will enhance further investigation of BAs as chemical cues in other fish species.

  18. Annual cycle and spatial trends in fatty acid composition of suspended particulate organic matter across the Beaufort Sea shelf

    NASA Astrophysics Data System (ADS)

    Connelly, Tara L.; Businski, Tara N.; Deibel, Don; Parrish, Christopher C.; Trela, Piotr

    2016-11-01

    Fatty acid profiles of suspended particulate organic matter (POM) were determined over an annual cycle (September 2003 to August 2004) on the Beaufort Sea shelf, Canadian Arctic. Special emphasis was placed on the nutritional quality of the fatty acid pool available to zooplankton by examining spatial and temporal patterns in the proportions of total polyunsaturated fatty acids (PUFA) and the essential fatty acids 22:6n-3 (DHA) and 20:5n-3 (EPA). EPA and DHA were the two most abundant PUFA throughout the study period. A log-ratio multivariate (LRA) analysis revealed strong structure in fatty acid profiles related to season and depth. Dominant fatty acids accounting for the observed trend included 18:5n-3, 18:4n-3, 16:1n-7, 20:5n-3, 18:0 and 20:3n-3. We observed a shift in fatty acid profiles from summer to autumn (e.g., from 16:1n-7 and EPA to 18:5n-3 and 18:4n-3) that likely corresponded to a shift in the relative importance of diatoms versus dinoflagellates, prymnesiophytes and/or prasinophytes to the POM pool. Fatty acid composition during winter was dominated by more refractory saturated fatty acids. A surprising finding was the depth and seasonal trend of 20:3n-3, which was higher in winter, aligned with 18:0 in the LRA, but behaved differently than other n-3 PUFA. We interpret fatty acid profiles during summer to be predominantly driven by phytoplankton inputs, whereas fatty acid profiles in winter were dominated by fatty acids that were left over after consumption and/or were generated by heterotrophs. The highest diatom inputs (EPA, the diatom fatty acid marker), n-3/n-6 ratios, and C16 PUFA index were located in an upwelling region off Cape Bathurst. This study is the first annual time series of fatty acid profiles of POM in Arctic seas, expanding our knowledge of the composition of POM throughout the dark season.

  19. Effect of pre-treatment with dichloroacetic or trichloroacetic acid in drinking water on the pharmacokinetics of a subsequent challenge dose in B6C3F1 mice.

    PubMed

    Gonzalez-Leon, A; Merdink, J L; Bull, R J; Schultz, I R

    1999-12-15

    Dichloroacetate (DCA) and trichloroacetate (TCA) are prominent by-products of chlorination of drinking water. Both chemicals have been shown to be hepatic carcinogens in mice. Prior work has demonstrated that DCA inhibits its own metabolism in rats and humans. This study focuses on the effect of prior administration of DCA or TCA in drinking water on the pharmacokinetics of a subsequent challenge dose of DCA or TCA in male B6C3F1 mice. Mice were provided with DCA or TCA in their drinking water at 2 g/l for 14 days and then challenged with a 100 mg/kg i.v. (non-labeled) or gavage (14C-labeled) dose of DCA or TCA. The challenge dose was administered after 16 h fasting and removal of the haloacetate pre-treatment. The haloacetate blood concentration-time profile and the disposition of 14C were characterized and compared with controls. The effect of pre-treatment on the in vitro metabolism of DCA in hepatic S9 was also evaluated. Pre-treatment with DCA caused a significant increase in the blood concentration-time profiles of the challenge dose of DCA. No effect on the blood concentration-time profile of DCA was observed after pre-treatment with TCA. Pre-treatment with TCA had no effect on subsequent doses of DCA. Pre-treatment with DCA did not have a significant effect on the formation of 14CO2 from radiolabeled DCA. In vitro experiments with liver S9 from DCA-pre-treated mice demonstrated that DCA inhibits it own metabolism. These results indicate that DCA metabolism in mice is also susceptible to inhibition by prior treatment with DCA, however the impact on clearance is less marked in mice than in F344 rats. In contrast, the metabolism and pharmacokinetics of TCA is not affected by pre-treatment with either DCA or TCA.

  20. Histopathological analysis of aggressive renal cell carcinoma harboring a unique germline mutation in fumarate hydratase.

    PubMed

    Matsumoto, Kana; Udaka, Naoko; Hasumi, Hisashi; Nakaigawa, Noboru; Nagashima, Yoji; Tanaka, Reiko; Kato, Ikuma; Yao, Masahiro; Furuya, Mitsuko

    2018-05-24

    Hereditary leiomyomatosis and renal cell cancer (HLRCC) is a rare genetic disorder characterized by cutaneous and uterine leiomyomatosis with RCC. This disorder is caused by a germline mutation in the fumarate hydratase (FH) gene, which encodes an important enzyme of the tricarboxylic acid (TCA) cycle. This mutation distinguishes HLRCC from sporadic RCCs. Herein, we investigated a case of HLRCC in a 32-year-old man who underwent nephrectomy for treatment of a solid-cystic tumor in the left kidney. Histopathology demonstrated a variegated architecture of papillary, tubulocystic and cribriform patterns composed of high-grade tumor cells with enlarged nuclei and eosinophilic nucleoli. Immunostaining and western blotting revealed no FH expression in the tumor. Genomic DNA sequencing identified a heterozygous mutation involving deletion of the 3' end of exon 2 and intron 2 of the FH gene (c.251_267+7delTGACAGAACGCATGCCAGTAAGTG), and RT-PCR confirmed exon 2 skipping in FH mRNA. The somatic FH gene status of the tumor showed only the mutated allele, indicating loss of heterozygosity as the "second hit" of tumor suppressor gene inactivation. These data support that an FH mutation involving the splice site causes exon skipping, changing the conformation of the protein and accelerating carcinogenic cascades under impaired FH functioning in the TCA cycle. © 2018 Japanese Society of Pathology and John Wiley & Sons Australia, Ltd.

  1. 13C-labelled microdialysis studies of cerebral metabolism in TBI patients☆

    PubMed Central

    Carpenter, Keri L.H.; Jalloh, Ibrahim; Gallagher, Clare N.; Grice, Peter; Howe, Duncan J.; Mason, Andrew; Timofeev, Ivan; Helmy, Adel; Murphy, Michael P.; Menon, David K.; Kirkpatrick, Peter J.; Carpenter, T. Adrian; Sutherland, Garnette R.; Pickard, John D.; Hutchinson, Peter J.

    2014-01-01

    Human brain chemistry is incompletely understood and better methodologies are needed. Traumatic brain injury (TBI) causes metabolic perturbations, one result of which includes increased brain lactate levels. Attention has largely focussed on glycolysis, whereby glucose is converted to pyruvate and lactate, and is proposed to act as an energy source by feeding into neurons’ tricarboxylic acid (TCA) cycle, generating ATP. Also reportedly upregulated by TBI is the pentose phosphate pathway (PPP) that does not generate ATP but produces various molecules that are putatively neuroprotective, antioxidant and reparative, in addition to lactate among the end products. We have developed a novel combination of 13C-labelled cerebral microdialysis both to deliver 13C-labelled substrates into brains of TBI patients and recover the 13C-labelled metabolites, with high-resolution 13C NMR analysis of the microdialysates. This methodology has enabled us to achieve the first direct demonstration in humans that the brain can utilise lactate via the TCA cycle. We are currently using this methodology to make the first direct comparison of glycolysis and the PPP in human brain. In this article, we consider the application of 13C-labelled cerebral microdialysis for studying brain energy metabolism in patients. We set this methodology within the context of metabolic pathways in the brain, and 13C research modalities addressing them. PMID:24361470

  2. Bactericidal peptidoglycan recognition protein induces oxidative stress in Escherichia coli through a block in respiratory chain and increase in central carbon catabolism.

    PubMed

    Kashyap, Des R; Kuzma, Marcin; Kowalczyk, Dominik A; Gupta, Dipika; Dziarski, Roman

    2017-09-01

    Mammalian Peptidoglycan Recognition Proteins (PGRPs) kill both Gram-positive and Gram-negative bacteria through simultaneous induction of oxidative, thiol and metal stress responses in bacteria. However, metabolic pathways through which PGRPs induce these bactericidal stress responses are unknown. We screened Keio collection of Escherichia coli deletion mutants and revealed that deleting genes for respiratory chain flavoproteins or for tricarboxylic acid (TCA) cycle resulted in increased resistance of E. coli to PGRP killing. PGRP-induced killing depended on the production of hydrogen peroxide, which required increased supply of NADH for respiratory chain oxidoreductases from central carbon catabolism (glycolysis and TCA cycle), and was controlled by cAMP-Crp. Bactericidal PGRP induced a rapid decrease in respiration, which suggested that the main source of increased production of hydrogen peroxide was a block in respiratory chain and diversion of electrons from NADH oxidoreductases to oxygen. CpxRA two-component system was a negative regulator of PGRP-induced oxidative stress. By contrast, PGRP-induced thiol stress (depletion of thiols) and metal stress (increase in intracellular free Zn 2+ through influx of extracellular Zn 2+ ) were mostly independent of oxidative stress. Thus, manipulating pathways that induce oxidative, thiol and metal stress in bacteria could be a useful strategy to design new approaches to antibacterial therapy. © 2017 John Wiley & Sons Ltd.

  3. DOE Office of Scientific and Technical Information (OSTI.GOV)

    Cohen, S.M.

    /sup 13/C NMR has been used to study the competition of pyruvate dehydrogenase with pyruvate carboxylase for entry of pyruvate into the tricarboxylic acid (TCA) cycle in perfused liver from streptozotocin-diabetic and normal donor rats. The relative proportion of pyruvate entering the TCA cycle by these two routes was estimated from the /sup 13/C enrichments at the individual carbons of glutamate when (3-/sup 13/C)alanine was the only exogenous substrate present. In this way, the proportion of pyruvate entering by the pyruvate dehydrogenase route relative to the pyruvate carboxylase route was determined to be 1:1.2 +/- 0.1 in liver from fedmore » controls, 1:7.7 +/- 2 in liver from 24-fasted controls, and 1:2.6 +/- 0.3 in diabetic liver. Pursuant to this observation that conversion of pyruvate to acetyl coenzyme A (acetyl-CoA) was greatest in perfused liver from fed controls, the incorporation of /sup 13/C label into fatty acids was monitored in this liver preparation. With the exception of the repeating methylene carbons, fatty acyl carbons labeled by (1-/sup 13/C)acetyl-CoA (from (2-/sup 13/C)pyruvate) gave rise to resonances distinguishable on the basis of chemical shift from those observed when label was introduced by (3-/sup 13/C)alanine plus (2-/sup 13/C)ethanol, which are converted to (2-/sup 13/C)acetyl-CoA. Thus, measurement of /sup 13/C enrichment at several specific sites in the fatty acyl chains in time-resolved spectra of perfused liver offers a novel way of monitoring the kinetics of the biosynthesis of fatty acids. In addition to obtaining the rate of lipogenesis, it was possible to distinguish the contributions of chain elongation from those of the de novo synthesis pathway and to estimate the average chain length of the /sup 13/C-labeled fatty acids produced.« less

  4. Effects of continuous triiodothyronine infusion on the tricarboxylic acid cycle in the normal immature swine heart under extracorporeal membrane oxygenation in vivo

    PubMed Central

    Kajimoto, Masaki; O'Kelly Priddy, Colleen M.; Ledee, Dolena R.; Xu, Chun; Isern, Nancy; Olson, Aaron K.

    2014-01-01

    Extracorporeal membrane oxygenation (ECMO) is frequently used in infants with postoperative cardiopulmonary failure. ECMO also suppresses circulating triiodothyronine (T3) levels and modifies myocardial metabolism. We assessed the hypothesis that T3 supplementation reverses ECMO-induced metabolic abnormalities in the immature heart. Twenty-two male Yorkshire pigs (age: 25–38 days) with ECMO received [2-13C]lactate, [2,4,6,8-13C4]octanoate (medium-chain fatty acid), and [U-13C]long-chain fatty acids as metabolic tracers either systemically (totally physiological intracoronary concentration) or directly into the coronary artery (high substrate concentration) for the last 60 min of each protocol. NMR analysis of left ventricular tissue determined the fractional contribution of these substrates to the tricarboxylic acid cycle. Fifty percent of the pigs in each group received intravenous T3 supplement (bolus at 0.6 μg/kg and then continuous infusion at 0.2 μg·kg−1·h−1) during ECMO. Under both substrate loading conditions, T3 significantly increased the fractional contribution of lactate with a marginal increase in the fractional contribution of octanoate. Both T3 and high substrate provision increased the myocardial energy status, as indexed by phosphocreatine concentration/ATP concentration. In conclusion, T3 supplementation promoted lactate metabolism to the tricarboxylic acid cycle during ECMO, suggesting that T3 releases the inhibition of pyruvate dehydrogenase. Manipulation of substrate utilization by T3 may be used therapeutically during ECMO to improve the resting energy state and facilitate weaning. PMID:24531815

  5. Effects of continuous triiodothyronine infusion on the tricarboxylic acid cycle in the normal immature swine heart under extracorporeal membrane oxygenation in vivo.

    PubMed

    Kajimoto, Masaki; Priddy, Colleen M O'Kelly; Ledee, Dolena R; Xu, Chun; Isern, Nancy; Olson, Aaron K; Portman, Michael A

    2014-04-15

    Extracorporeal membrane oxygenation (ECMO) is frequently used in infants with postoperative cardiopulmonary failure. ECMO also suppresses circulating triiodothyronine (T3) levels and modifies myocardial metabolism. We assessed the hypothesis that T3 supplementation reverses ECMO-induced metabolic abnormalities in the immature heart. Twenty-two male Yorkshire pigs (age: 25-38 days) with ECMO received [2-(13)C]lactate, [2,4,6,8-(13)C4]octanoate (medium-chain fatty acid), and [U-(13)C]long-chain fatty acids as metabolic tracers either systemically (totally physiological intracoronary concentration) or directly into the coronary artery (high substrate concentration) for the last 60 min of each protocol. NMR analysis of left ventricular tissue determined the fractional contribution of these substrates to the tricarboxylic acid cycle. Fifty percent of the pigs in each group received intravenous T3 supplement (bolus at 0.6 μg/kg and then continuous infusion at 0.2 μg·kg(-1)·h(-1)) during ECMO. Under both substrate loading conditions, T3 significantly increased the fractional contribution of lactate with a marginal increase in the fractional contribution of octanoate. Both T3 and high substrate provision increased the myocardial energy status, as indexed by phosphocreatine concentration/ATP concentration. In conclusion, T3 supplementation promoted lactate metabolism to the tricarboxylic acid cycle during ECMO, suggesting that T3 releases the inhibition of pyruvate dehydrogenase. Manipulation of substrate utilization by T3 may be used therapeutically during ECMO to improve the resting energy state and facilitate weaning.

  6. Focal high-concentration trichloroacetic acid peeling for treatment of atrophic facial chickenpox scar: an open-label study.

    PubMed

    Barikbin, Behrooz; Saadat, Nelda; Akbari, Zahra; Yousefi, Maryam; Toossi, Parviz

    2012-10-01

    Despite their prevalence, there is a paucity of information in the medical literature on the treatment of atrophic chickenpox scars. To evaluate the efficacy and safety of using the chemical reconstruction of skin scar technique for the treatment of atrophic facial chickenpox scars. One hundred patients (mean age 23 years; Fitzpatrick skin types II-IV) were treated with focal chemical peeling with 70% trichloroacetic acid (TCA) for a maximum of six sessions. Improvement rate, frequency of adverse events and patient satisfaction were assessed. Five hundred thirty-three peeling sessions in 100 consecutive patients were performed. Final assessment at 12-week follow-up visit after the last treatment revealed improvement in 95% of patients: mild improvement in 12 cases, moderate improvement in 42 cases, and marked improvement in 41 cases. The appearance of scars did not change in five patients. Seventy-nine patients expressed moderate to high satisfaction with the results. Post-treatment side effects were mild and transient, resolving gradually within the study period. Focal peeling with high-concentration TCA appears to be a safe and effective alternative in the treatment of atrophic facial chickenpox scars. © 2012 by the American Society for Dermatologic Surgery, Inc. Published by Wiley Periodicals, Inc.

  7. Glycyrrhizin and glycyrrhetinic acid inhibits alpha-naphthyl isothiocyanate-induced liver injury and bile acid cycle disruption.

    PubMed

    Wang, Haina; Fang, Zhong-Ze; Meng, Ran; Cao, Yun-Feng; Tanaka, Naoki; Krausz, Kristopher W; Gonzalez, Frank J

    2017-07-01

    Alpha-naphthyl isothiocyanate (ANIT) is a common hepatotoxicant experimentally used to reproduce the pathologies of drug-induced liver injury in humans, but the mechanism of its toxicity remains unclear. To determine the metabolic alterations following ANIT exposure, metabolomic analyses was performed by use of liquid chromatography-mass spectrometry. Partial least squares discriminant analysis (PLS-DA) of liver, serum, bile, ileum, and cecum of vehicle- and ANIT-treated mice revealed significant alterations of individual bile acids, including increased tauroursodeoxycholic acid, taurohydrodeoxycholic acid, taurochenodeoxycholic acid, and taurodeoxycholic acid, and decreased ω-, β- and tauro-α/β- murideoxycholic acid, cholic acid, and taurocholic acid in the ANIT-treated groups. In accordance with these changes, ANIT treatment altered the expression of mRNAs encoded by genes responsible for the metabolism and transport of bile acids and cholesterol. Pre-treatment of glycyrrhizin (GL) and glycyrrhetinic acid (GA) prevented ANIT-induced liver damage and reversed the alteration of bile acid metabolites and Cyp7a1, Npc1l1, Mttp, and Acat2 mRNAs encoding bile acid transport and metabolism proteins. These results suggested that GL/GA could prevent drug-induced liver injury and ensuing disruption of bile acid metabolism in humans. Published by Elsevier B.V.

  8. Analysis of Metabolic Pathways and Fluxes in a Newly Discovered Thermophilic and Ethanol-Tolerant Geobacillus Strain

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Tang, Yinjie J.; Sapra, Rajat; Joyner, Dominique

    2009-01-20

    A recently discovered thermophilic bacterium, Geobacillus thermoglucosidasius M10EXG, ferments a range of C5 (e.g., xylose) and C6 sugars (e.g., glucose) and istolerant to high ethanol concentrations (10percent, v/v). We have investigated the central metabolism of this bacterium using both in vitro enzyme assays and 13C-based flux analysis to provide insights into the physiological properties of this extremophile and explore its metabolism for bio-ethanol or other bioprocess applications. Our findings show that glucose metabolism in G. thermoglucosidasius M10EXG proceeds via glycolysis, the pentose phosphate pathway, and the TCA cycle; the Entner?Doudoroff pathway and transhydrogenase activity were not detected. Anaplerotic reactions (includingmore » the glyoxylate shunt, pyruvate carboxylase, and phosphoenolpyruvate carboxykinase) were active, but fluxes through those pathways could not be accuratelydetermined using amino acid labeling. When growth conditions were switched from aerobic to micro-aerobic conditions, fluxes (based on a normalized glucose uptake rate of 100 units (g DCW)-1 h-1) through the TCA cycle and oxidative pentose phosphate pathway were reduced from 64+-3 to 25+-2 and from 30+-2 to 19+-2, respectively. The carbon flux under micro-aerobic growth was directed formate. Under fully anerobic conditions, G. thermoglucosidasius M10EXG used a mixed acid fermentation process and exhibited a maximum ethanol yield of 0.38+-0.07 mol mol-1 glucose. In silico flux balance modeling demonstrates that lactate and acetate production from G. thermoglucosidasius M10EXG reduces the maximum ethanol yieldby approximately threefold, thus indicating that both pathways should be modified to maximize ethanol production.« less

  9. Palladium alpha-lipoic acid complex formulation enhances activities of Krebs cycle dehydrogenases and respiratory complexes I-IV in the heart of aged rats.

    PubMed

    Sudheesh, N P; Ajith, T A; Janardhanan, K K; Krishnan, C V

    2009-08-01

    Age-related decline in the capacity to withstand stress, such as ischemia and reperfusion, results in congestive heart failure. Though the mechanisms underlying cardiac decay are not clear, age dependent somatic damages to mitochondrial DNA (mtDNA), loss of mitochondrial function, and a resultant increase in oxidative stress in heart muscle cells may be responsible for the increased risk for cardiovascular diseases. The effect of a safe nutritional supplement, POLY-MVA, containing the active ingredient palladium alpha-lipoic acid complex, was evaluated on the activities of the Krebs cycle enzymes such as isocitrate dehydrogenase, alpha-ketoglutarate dehydrogenase, succinate dehydrogenase, and malate dehydrogenase as well as mitochondrial complexes I, II, III, and IV in heart mitochondria of aged male albino rats of Wistar strain. Administration of 0.05 ml/kg of POLY-MVA (which is equivalent to 0.38 mg complexed alpha-lipoic acid/kg, p.o), once daily for 30 days, was significantly (p<0.05) effective to enhance the Krebs cycle dehydrogenases, and mitochondrial electron transport chain complexes. The unique electronic and redox properties of palladium alpha-lipoic acid complex appear to be a key to this physiological effectiveness. The results strongly suggest that this formulation might be effective to protect the aging associated risk of cardiovascular and neurodegenerative diseases.

  10. Inhaled ozone (O{sub 3})-induces changes in serum metabolomic and liver transcriptomic profiles in rats

    DOE Office of Scientific and Technical Information (OSTI.GOV)

    Miller, Desinia B.; Karoly, Edward D.; Jones, Jan C.

    Air pollution has been linked to increased incidence of diabetes. Recently, we showed that ozone (O{sub 3}) induces glucose intolerance, and increases serum leptin and epinephrine in Brown Norway rats. In this study, we hypothesized that O{sub 3} exposure will cause systemic changes in metabolic homeostasis and that serum metabolomic and liver transcriptomic profiling will provide mechanistic insights. In the first experiment, male Wistar Kyoto (WKY) rats were exposed to filtered air (FA) or O{sub 3} at 0.25, 0.50, or 1.0 ppm, 6 h/day for two days to establish concentration-related effects on glucose tolerance and lung injury. In a secondmore » experiment, rats were exposed to FA or 1.0 ppm O{sub 3}, 6 h/day for either one or two consecutive days, and systemic metabolic responses were determined immediately after or 18 h post-exposure. O{sub 3} increased serum glucose and leptin on day 1. Glucose intolerance persisted through two days of exposure but reversed 18 h-post second exposure. O{sub 3} increased circulating metabolites of glycolysis, long-chain free fatty acids, branched-chain amino acids and cholesterol, while 1,5-anhydroglucitol, bile acids and metabolites of TCA cycle were decreased, indicating impaired glycemic control, proteolysis and lipolysis. Liver gene expression increased for markers of glycolysis, TCA cycle and gluconeogenesis, and decreased for markers of steroid and fat biosynthesis. Genes involved in apoptosis and mitochondrial function were also impacted by O{sub 3}. In conclusion, short-term O{sub 3} exposure induces global metabolic derangement involving glucose, lipid, and amino acid metabolism, typical of a stress–response. It remains to be examined if these alterations contribute to insulin resistance upon chronic exposure. - Highlights: • Ozone, an ubiquitous air pollutant induces acute systemic metabolic derangement. • Serum metabolomic approach provides novel insights in ozone-induced changes. • Ozone exposure induces

  11. Anaerobic Carbon Metabolism by the Tricarboxylic Acid Cycle : Evidence for Partial Oxidative and Reductive Pathways during Dark Ammonium Assimilation.

    PubMed

    Vanlerberghe, G C; Horsey, A K; Weger, H G; Turpin, D H

    1989-12-01

    Nitrogen-limited cells of Selenastrum minutum (Naeg.) Collins are able to assimilate NH(4) (+) in the dark under anaerobic conditions. Addition of NH(4) (+) to anaerobic cells results in a threefold increase in tricarboxylic acid cycle (TCAC) CO(2) efflux and an eightfold increase in the rate of anaplerotic carbon fixation via phosphoenolpyruvate carboxylase. Both of these observations are consistent with increased TCAC carbon flow to supply intermediates for amino acid biosynthesis. Addition of H(14)CO(3) (-) to anaerobic cells assimilating NH(4) (+) results in the incorporation of radiolabel into the alpha-carboxyl carbon of glutamic acid. Incorporation of radiolabel into glutamic acid is not simply a short-term phenomenon following NH(4) (+) addition as the specific activity of glutamic acid increases over time. This indicates that this alga is able to maintain partial oxidative TCAC carbon flow while under anoxia to supply alpha-ketoglutarate for glutamate production. During dark aerobic NH(4) (+) assimilation, no radiolabel appears in fumarate or succinate and only a small amount occurs in malate. During anaerobic NH(4) (+) assimilation, these metabolites contain a large proportion of the total radiolabel and radiolabel accumulates in succinate over time. Also, the ratio of dark carbon fixation to NH(4) (+) assimilation is much higher under anaerobic than aerobic conditions. These observations suggest the operation of a partial reductive TCAC from oxaloacetic acid to malate, fumarate, and succinate. Such a pathway might contribute to redox balance in an anaerobic cell maintaining partial oxidative TCAC activity.

  12. Differential Sensitivities of Fast- and Slow-Cycling Cancer Cells to Inosine Monophosphate Dehydrogenase 2 Inhibition by Mycophenolic Acid

    PubMed Central

    Chen, Kan; Cao, Wanlu; Li, Juan; Sprengers, Dave; Hernanda, Pratika Y; Kong, Xiangdong; van der Laan, Luc JW; Man, Kwan; Kwekkeboom, Jaap; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei

    2015-01-01

    As uncontrolled cell proliferation requires nucleotide biosynthesis, inhibiting enzymes that mediate nucleotide biosynthesis constitutes a rational approach to the management of oncological diseases. In practice, however, results of this strategy are mixed and thus elucidation of the mechanisms by which cancer cells evade the effect of nucleotide biosynthesis restriction is urgently needed. Here we explored the notion that intrinsic differences in cancer cell cycle velocity are important in the resistance toward inhibition of inosine monophosphate dehydrogenase (IMPDH) by mycophenolic acid (MPA). In short-term experiments, MPA treatment of fast-growing cancer cells effectively elicited G0/G1 arrest and provoked apoptosis, thus inhibiting cell proliferation and colony formation. Forced expression of a mutated IMPDH2, lacking a binding site for MPA but retaining enzymatic activity, resulted in complete resistance of cancer cells to MPA. In nude mice subcutaneously engrafted with HeLa cells, MPA moderately delayed tumor formation by inhibiting cell proliferation and inducing apoptosis. Importantly, we developed a lentiviral vector–based Tet-on label-retaining system that enables to identify, isolate and functionally characterize slow-cycling or so-called label-retaining cells (LRCs) in vitro and in vivo. We surprisingly found the presence of LRCs in fast-growing tumors. LRCs were superior in colony formation, tumor initiation and resistance to MPA as compared with fast-cycling cells. Thus, the slow-cycling compartment of cancer seems predominantly responsible for resistance to MPA. PMID:26467706

  13. Salmonella enterica serovar Typhimurium mutants unable to convert malate to pyruvate and oxaloacetate are avirulent and immunogenic in BALB/c mice.

    PubMed

    Mercado-Lubo, Regino; Leatham, Mary P; Conway, Tyrrell; Cohen, Paul S

    2009-04-01

    Previously, we showed that the Salmonella enterica serovar Typhimurium SR-11 tricarboxylic acid (TCA) cycle must operate as a complete cycle for full virulence after oral infection of BALB/c mice (M. Tchawa Yimga, M. P. Leatham, J. H. Allen, D. C. Laux, T. Conway, and P. S. Cohen, Infect. Immun. 74:1130-1140, 2006). In the same study, we showed that for full virulence, malate must be converted to both oxaloacetate and pyruvate. Moreover, it was recently demonstrated that blocking conversion of succinyl-coenzyme A to succinate attenuates serovar Typhimurium SR-11 but does not make it avirulent; however, blocking conversion of succinate to fumarate renders it completely avirulent and protective against subsequent oral infection with the virulent serovar Typhimurium SR-11 wild-type strain (R. Mercado-Lubo, E. J. Gauger, M. P. Leatham, T. Conway, and P. S. Cohen, Infect. Immun. 76:1128-1134, 2008). Furthermore, the ability to convert succinate to fumarate appeared to be required only after serovar Typhimurium SR-11 became systemic. In the present study, evidence is presented that serovar Typhimurium SR-11 mutants that cannot convert fumarate to malate or that cannot convert malate to both oxaloacetate and pyruvate are also avirulent and protective in BALB/c mice. These results suggest that in BALB/c mice, the malate that is removed from the TCA cycle in serovar Typhimurium SR-11 for conversion to pyruvate must be replenished by succinate or one of its precursors, e.g., arginine or ornithine, which might be available in mouse phagocytes.

  14. Octyl gallate and gallic acid isolated from Terminalia bellarica regulates normal cell cycle in human breast cancer cell lines.

    PubMed

    Sales, Mary Selesty; Roy, Anita; Antony, Ludas; Banu, Sakhila K; Jeyaraman, Selvaraj; Manikkam, Rajalakshmi

    2018-07-01

    Herbal medicines stand unique and effective in treating human diseases. Terminalia bellarica (T. bellarica) is a potent medicinal herb, with a wide range of pharmacological activities. The present study was aimed to evaluate the effect of octyl gallate (OG) and gallic acid (GA) isolated from methanolic fruit extract of T. bellirica to inhibit the survival of breast cancer cells (MCF-7 & MDA-MB-231). Both OG & GA exhibited decreased MCF-7 & MDA-MB-231 survival and induced apoptosis, with IC 50 value of OG and GA as 40 μM and 80 μM respectively. No toxic effect was observed on normal breast cells (MCF-10A). The compounds inhibited cell cycle progression by altering the expression of the cell cycle regulators (Cyclin D1, D3, CDK-4, CDK-6, p18 INK4, p21Waf-1 and p27 KIP). Octyl gallate was more effective at low concentrations than GA. In-silico results provided stable interactions between the compounds and target proteins. The present investigation proved the downregulation of positive cell cycle regulators and upregulation of negative cell cycle regulators inducing apoptosis in compound-treated breast cancer cells. Hence, both the compounds may serve as potential anticancer agents and could be developed as breast cancer drugs, with further explorations. Copyright © 2018 Elsevier Masson SAS. All rights reserved.

  15. 13C-MFA delineates the photomixotrophic metabolism of Synechocystis sp. PCC 6803 under light- and carbon-sufficient conditions.

    PubMed

    You, Le; Berla, Bert; He, Lian; Pakrasi, Himadri B; Tang, Yinjie J

    2014-05-01

    The central carbon metabolism of cyanobacteria is under debate. For over 50 years, the lack of α-ketoglutarate dehydrogenase has led to the belief that cyanobacteria have an incomplete TCA cycle. Recent in vitro enzymatic experiments suggest that this cycle may in fact be closed. The current study employed (13) C isotopomers to delineate pathways in the cyanobacterium Synechocystis sp. PCC 6803. By tracing the incorporation of supplemented glutamate into the downstream metabolites in the TCA cycle, we observed a direct in vivo transformation of α-ketoglutarate to succinate. Additionally, isotopic tracing of glyoxylate did not show a functional glyoxylate shunt and glyoxylate was used for glycine synthesis. The photomixotrophic carbon metabolism was then profiled with (13) C-MFA under light and carbon-sufficient conditions. We observed that: (i) the in vivo flux through the TCA cycle reactions (α-ketoglutarate → succinate) was minimal (<2%); (ii) the flux ratio of CO2 fixation was six times higher than that of glucose utilization; (iii) the relative flux through the oxidative pentose phosphate pathway was low (<2%); (iv) high flux through malic enzyme served as a main route for pyruvate synthesis. Our results improve the understanding of the versatile metabolism in cyanobacteria and shed light on their application for photo-biorefineries. Copyright © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  16. PEPCK-M expression in mouse liver potentiates, not replaces, PEPCK-C mediated gluconeogenesis

    PubMed Central

    Méndez-Lucas, Andrés; Duarte, João; Sunny, Nishanth E.; Satapati, Santhosh; He, TianTeng; Fu, Xiaorong; Bermúdez, Jordi; Burgess, Shawn C.; Perales, Jose C.

    2013-01-01

    Background & Aims Hepatic gluconeogenesis helps maintain systemic energy homeostasis by compensating for discontinuities in nutrient supply. Liver specific deletion of cytosolic phosphoenolpyruvate carboxykinase (PEPCK-C) abolishes gluconeogenesis from mitochondrial substrates, deregulates lipid metabolism and affects TCA cycle. While, mouse liver almost exclusively expresses PEPCK-C, humans equally present a mitochondrial isozyme (PEPCK-M). Despite clear relevance to human physiology, the role of PEPCK-M and its gluconeogenic potential remain unknown. Here, we test the significance of PEPCK-M in gluconeogenesis and TCA cycle function in liver-specific PEPCK-C knockout and WT mice. Methods The effects of the overexpression of PEPCK-M were examined by a combination of tracer studies and molecular biology techniques. Partial PEPCK-C re-expression was used as a positive control. Metabolic fluxes were evaluated in isolated livers by NMR using 2H and 13C tracers. Gluconeogenic potential, together with metabolic profiling, were investigated in vivo and in primary hepatocytes. Results PEPCK-M expression partially rescued defects in lipid metabolism, gluconeogenesis and TCA cycle function impaired by PEPCK-C deletion, while ~10% re-expression of PEPCK-C normalized most parameters. When PEPCK-M was expressed in the presence of PEPCK-C, the mitochondrial isozyme amplified total gluconeogenic capacity, suggesting autonomous regulation of oxaloacetate to phosphoenolpyruvate fluxes by the individual isoforms. Conclusions We conclude that PEPCK-M has gluconeogenic potential per se, and cooperates with PEPCK-C to adjust gluconeogenic/TCA flux to changes in substrate or energy availability, hinting at a role in the regulation of glucose and lipid metabolism in human liver. PMID:23466304

  17. Detection of the CLOCK/BMAL1 heterodimer using a nucleic acid probe with cycling probe technology.

    PubMed

    Nakagawa, Kazuhiro; Yamamoto, Takuro; Yasuda, Akio

    2010-09-15

    An isothermal signal amplification technique for specific DNA sequences, known as cycling probe technology (CPT), has enabled rapid acquisition of genomic information. Here we report an analogous technique for the detection of an activated transcription factor, a transcription element-binding assay with fluorescent amplification by apurinic/apyrimidinic (AP) site lysis cycle (TEFAL). This simple amplification assay can detect activated transcription factors by using a unique nucleic acid probe containing a consensus binding sequence and an AP site, which enables the CPT reaction with AP endonuclease. In this article, we demonstrate that this method detects the functional CLOCK/BMAL1 heterodimer via the TEFAL probe containing the E-box consensus sequence to which the CLOCK/BMAL1 heterodimer binds. Using TEFAL combined with immunoassays, we measured oscillations in the amount of CLOCK/BMAL1 heterodimer in serum-stimulated HeLa cells. Furthermore, we succeeded in measuring the circadian accumulation of the functional CLOCK/BMAL1 heterodimer in human buccal mucosa cells. TEFAL contributes greatly to the study of transcription factor activation in mammalian tissues and cell extracts and is a powerful tool for less invasive investigation of human circadian rhythms. 2010 Elsevier Inc. All rights reserved.

  18. Hydrogen-bonding dynamics of free flavins in benzene and FAD in electron-transferring flavoprotein upon excitation.

    PubMed

    Sato, Kyousuke; Nishina, Yasuzou; Shiga, Kiyoshi; Tanaka, Fumio

    2003-01-01

    The dynamic natures of two hydrogen-bonding model systems, riboflavin tetrabutylate (RFTB)-trichloroacetic acid (TCA) and RFTB-phenol in benzene, and of electron-transferring flavoprotein (ETF) from pig kidney upon excitation of flavins was investigated by means of steady state and time-resolved fluorescence spectroscopy. In both model systems fluorescence intensities of RFTB decreased as TCA or phenol was added. The spectral characteristics of ETF under steady state excitation were quite similar to those of the RFTB-TCA system, but not to those of the RFTB-phenol system. The observed fluorescence decay curves of ETF fit well with the calculated decay curves with two lifetime components, as in the model systems. Averaged lifetime was 0.9 ns. The time-resolved fluorescence spectrum of ETF shifted toward longer wavelength with time after pulsed excitation, which was also observed in the RFTB-TCA system. In the RFTB-phenol system the emission spectrum did not shift at all with time. These results reveal that the dynamic nature of ETF can be ascribed to aliphatic hydrogen-bonding(s) of the isoalloxazine ring with surrounding amino acid(s). From the fluorescence characteristics of ETF in comparison with the model systems, human ETF and other flavoproteins, it was suggested that ETF from pig kidney does not contain Tyr-16 in the beta subunit, unlike human ETF.

  19. Isotopically Nonstationary Metabolic Flux Analysis (INST-MFA) of Photosynthesis and Photorespiration in Plants.

    PubMed

    Ma, Fangfang; Jazmin, Lara J; Young, Jamey D; Allen, Doug K

    2017-01-01

    Photorespiration is a central component of photosynthesis; however to better understand its role it should be viewed in the context of an integrated metabolic network rather than a series of individual reactions that operate independently. Isotopically nonstationary 13 C metabolic flux analysis (INST-MFA), which is based on transient labeling studies at metabolic steady state, offers a comprehensive platform to quantify plant central metabolism. In this chapter, we describe the application of INST-MFA to investigate metabolism in leaves. Leaves are an autotrophic tissue, assimilating CO 2 over a diurnal period implying that the metabolic steady state is limited to less than 12 h and thus requiring an INST-MFA approach. This strategy results in a comprehensive unified description of photorespiration, Calvin cycle, sucrose and starch synthesis, tricarboxylic acid (TCA) cycle, and amino acid biosynthetic fluxes. We present protocols of the experimental aspects for labeling studies: transient 13 CO 2 labeling of leaf tissue, sample quenching and extraction, mass spectrometry (MS) analysis of isotopic labeling data, measurement of sucrose and amino acids in vascular exudates, and provide details on the computational flux estimation using INST-MFA.

  20. Stereometric parameters change vs. Topographic Change Analysis (TCA) agreement in Heidelberg Retina Tomography III (HRT-3) early detection of clinical significant glaucoma progression.

    PubMed

    Dascalu, A M; Cherecheanu, A P; Stana, D; Voinea, L; Ciuluvica, R; Savlovschi, C; Serban, D

    2014-01-01

    to investigate the sensitivity and specificity of the stereometric parameters change analysis vs. Topographic Change Analysis in early detection of glaucoma progression. 81 patients with POAG were monitored for 4 years (GAT monthly, SAP at every 6 months, optic disc photographs and HRT3 yearly). The exclusion criteria were other optic disc or retinal pathology; topographic standard deviation (TSD>30; inter-test variation of reference height>25 μm. The criterion for structural progression was the following: at least 20 adjacent super-pixels with a clinically significant decrease in height (>5%). 16 patients of the total 81 presented structural progression on TCA. The most useful stereometric parameters for the early detection of glaucoma progression were the following: Rim Area change (sensitivity 100%, specificity 74.2% for a "cut-off " value of -0.05), C/D Area change (sensitivity 85.7%, specificity 71.5% for a "cut off " value of 0.02), C/D linear change (sensitivity 85.7%, specificity 71.5% for a "cut-off " value of 0.02), Rim Volume change (sensitivity 71.4%, specificity 88.8% for a "cut-off " value of -0.04). RNFL Thickness change (<0) was highly sensitive (82%), but less specific for glaucoma progression (45,2%). Changes of the other stereometric parameters have a limited diagnostic value for the early detection of glaucoma progression. TCA is a valuable tool for the assessment of the structural progression in glaucoma patients and its inter-test variability is low. On long-term, the quantitative analysis according to stereometric parameters change is also very important. The most relevant parameters to detect progression are RA, C/D Area, Linear C/D and RV.