DNA-Based Single-Molecule Electronics: From Concept to Function.

PubMed

Wang, Kun

2018-01-17

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I-V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed.

DNA-Based Single-Molecule Electronics: From Concept to Function

PubMed Central

2018-01-01

Beyond being the repository of genetic information, DNA is playing an increasingly important role as a building block for molecular electronics. Its inherent structural and molecular recognition properties render it a leading candidate for molecular electronics applications. The structural stability, diversity and programmability of DNA provide overwhelming freedom for the design and fabrication of molecular-scale devices. In the past two decades DNA has therefore attracted inordinate amounts of attention in molecular electronics. This review gives a brief survey of recent experimental progress in DNA-based single-molecule electronics with special focus on single-molecule conductance and I–V characteristics of individual DNA molecules. Existing challenges and exciting future opportunities are also discussed. PMID:29342091

Single Molecule Study of Metalloregulatory Protein-DNA Interactions

NASA Astrophysics Data System (ADS)

Sarkar, Susanta; Benitez, Jaime; Huang, Zhengxi; Wang, Qi; Chen, Peng

2007-03-01

Control of metal concentrations is essential for living body. Metalloregulatory proteins respond to metal concentrations by regulating transcriptions of metal resistance genes via protein-DNA interactions. It is thus necessary to understand interactions of metalloregulatory proteins with DNA. Ensemble measurements provide average behavior of a vast number of biomolecules. In contrast, single molecule spectroscopy can track single molecules individually and elucidate dynamics of processes of short time scales and intermediate structures not revealed by ensemble measurements. Here we present single molecule study of interactions between PbrR691, a MerR-family metalloregulatory protein and DNA. We presume that the dynamics of protein/DNA conformational changes and interactions are important for the transcription regulation and kinetics of these dynamic processes can provide useful information about the mechanisms of these metalloregulatory proteins.

Single-molecule analysis of DNA cross-links using nanopore technology

NASA Astrophysics Data System (ADS)

Wolna, Anna H.

The alpha-hemolysin (alpha-HL) protein ion channel is a potential next-generation sequencing platform that has been extensively used to study nucleic acids at a single-molecule level. After applying a potential across a lipid bilayer, the imbedded alpha-HL allows monitoring of the duration and current levels of DNA translocation and immobilization. Because this method does not require DNA amplification prior to sequencing, all the DNA damage present in the cell at any given time will be present during the sequencing experiment. The goal of this research is to determine if these damage sites give distinguishable current levels beyond those observed for the canonical nucleobases. Because DNA cross-links are one of the most prevalent types of DNA damage occurring in vivo, the blockage current levels were determined for thymine-dimers, guanine(C8)-thymine(N3) cross-links and platinum adducts. All of these cross-links give a different blockage current level compared to the undamaged strands when immobilized in the ion channel, and they all can easily translocate across the alpha-HL channel. Additionally, the alpha-HL nanopore technique presents a unique opportunity to study the effects of DNA cross-links, such as thymine-dimers, on the secondary structure of DNA G-quadruplexes folded from the human telomere sequence. Using this single-molecule nanopore technique we can detect subtle structural differences that cannot be easily addressed using conventional methods. The human telomere plays crucial roles in maintaining genome stability. In the presence of suitable cations, the repetitive 5'-TTAGGG human telomere sequence can fold into G-quadruplexes that adopt the hybrid fold in vivo. The telomere sequence is hypersensitive to UV-induced thymine-dimer (T=T) formation, and yet the presence of thymine dimers does not cause telomere shortening. The potential structural disruption and thermodynamic stability of the T=T-containing natural telomere sequences were studied to

Torsional mechanics of DNA are regulated by small-molecule intercalation.

PubMed

Celedon, Alfredo; Wirtz, Denis; Sun, Sean

2010-12-23

Whether the bend and twist mechanics of DNA molecules are coupled is unclear. Here, we report the direct measurement of the resistive torque of single DNA molecules to study the effect of ethidium bromide (EtBr) intercalation and pulling force on DNA twist mechanics. DNA molecules were overwound and unwound using recently developed magnetic tweezers where the molecular resistive torque was obtained from Brownian angular fluctuations. The effect of EtBr intercalation on the twist stiffness was found to be significantly different from the effect on the bend persistence length. The twist stiffness of DNA was dramatically reduced at low intercalator concentration (<10 nM); however, it did not decrease further when the intercalator concentration was increased by 3 orders of magnitude. We also determined the dependence of EtBr intercalation on the torque applied to DNA. We propose a model for the elasticity of DNA base pairs with intercalated EtBr molecules to explain the abrupt decrease of twist stiffness at low EtBr concentration. These results indicate that the bend and twist stiffnesses of DNA are independent and can be differently affected by small-molecule binding.

A Single-Molecule Barcoding System using Nanoslits for DNA Analysis

NASA Astrophysics Data System (ADS)

Jo, Kyubong; Schramm, Timothy M.; Schwartz, David C.

Single DNA molecule approaches are playing an increasingly central role in the analytical genomic sciences because single molecule techniques intrinsically provide individualized measurements of selected molecules, free from the constraints of bulk techniques, which blindly average noise and mask the presence of minor analyte components. Accordingly, a principal challenge that must be addressed by all single molecule approaches aimed at genome analysis is how to immobilize and manipulate DNA molecules for measurements that foster construction of large, biologically relevant data sets. For meeting this challenge, this chapter discusses an integrated approach for microfabricated and nanofabricated devices for the manipulation of elongated DNA molecules within nanoscale geometries. Ideally, large DNA coils stretch via nanoconfinement when channel dimensions are within tens of nanometers. Importantly, stretched, often immobilized, DNA molecules spanning hundreds of kilobase pairs are required by all analytical platforms working with large genomic substrates because imaging techniques acquire sequence information from molecules that normally exist in free solution as unrevealing random coils resembling floppy balls of yarn. However, nanoscale devices fabricated with sufficiently small dimensions fostering molecular stretching make these devices impractical because of the requirement of exotic fabrication technologies, costly materials, and poor operational efficiencies. In this chapter, such problems are addressed by discussion of a new approach to DNA presentation and analysis that establishes scaleable nanoconfinement conditions through reduction of ionic strength; stiffening DNA molecules thus enabling their arraying for analysis using easily fabricated devices that can also be mass produced. This new approach to DNA nanoconfinement is complemented by the development of a novel labeling scheme for reliable marking of individual molecules with fluorochrome labels

Methods for Identifying Ligands that Target Nucleic Acid Molecules and Nucleic Acid Structural Motifs

NASA Technical Reports Server (NTRS)

Childs-Disney, Jessica L. (Inventor); Disney, Matthew D. (Inventor)

2017-01-01

Disclosed are methods for identifying a nucleic acid (e.g., RNA, DNA, etc.) motif which interacts with a ligand. The method includes providing a plurality of ligands immobilized on a support, wherein each particular ligand is immobilized at a discrete location on the support; contacting the plurality of immobilized ligands with a nucleic acid motif library under conditions effective for one or more members of the nucleic acid motif library to bind with the immobilized ligands; and identifying members of the nucleic acid motif library that are bound to a particular immobilized ligand. Also disclosed are methods for selecting, from a plurality of candidate ligands, one or more ligands that have increased likelihood of binding to a nucleic acid molecule comprising a particular nucleic acid motif, as well as methods for identifying a nucleic acid which interacts with a ligand.

Single molecule characterization of DNA binding and strand displacement reactions on lithographic DNA origami microarrays.

PubMed

Scheible, Max B; Pardatscher, Günther; Kuzyk, Anton; Simmel, Friedrich C

2014-03-12

The combination of molecular self-assembly based on the DNA origami technique with lithographic patterning enables the creation of hierarchically ordered nanosystems, in which single molecules are positioned at precise locations on multiple length scales. Based on a hybrid assembly protocol utilizing DNA self-assembly and electron-beam lithography on transparent glass substrates, we here demonstrate a DNA origami microarray, which is compatible with the requirements of single molecule fluorescence and super-resolution microscopy. The spatial arrangement allows for a simple and reliable identification of single molecule events and facilitates automated read-out and data analysis. As a specific application, we utilize the microarray to characterize the performance of DNA strand displacement reactions localized on the DNA origami structures. We find considerable variability within the array, which results both from structural variations and stochastic reaction dynamics prevalent at the single molecule level.

[Single-molecule detection and characterization of DNA replication based on DNA origami].

PubMed

Wang, Qi; Fan, Youjie; Li, Bin

2014-08-01

To investigate single-molecule detection and characterization of DNA replication. Single-stranded DNA (ssDNA) as the template of DNA replication was attached to DNA origami by a hybridization reaction based on the complementary base-pairing principle. DNA replication catalyzed by E.coli DNA polymerase I Klenow Fragment (KF) was detected using atomic force microscopy (AFM). The height variations between the ssDNA and the double-stranded DNA (dsDNA), the distribution of KF during DNA replication and biotin-streptavidin (BA) complexes on the DNA strand after replication were detected. Agarose gel electrophoresis was employed to analyze the changes in the DNA after replication. The designed ssDNA could be anchored on the target positions of over 50% of the DNA origami. The KF was capable of binding to the ssDNA fixed on DNA origami and performing its catalytic activities, and was finally dissociated from the DNA after replication. The height of DNA strand increased by about 0.7 nm after replication. The addition of streptavidin also resulted in an DNA height increase to about 4.9 nm due to the formation of BA complexes on the biotinylated dsDNA. The resulting dsDNA and BA complex were subsequently confirmed by agarose gel electrophoresis. The combination of AFM and DNA origami allows detection and characterization of DNA replication at the single molecule level, and this approach provides better insights into the mechanism of DNA polymerase and the factors affecting DNA replication.

Nanopore detection of DNA molecules in crowded neutral polymer solutions

NASA Astrophysics Data System (ADS)

Sharma, Rajesh Kumar; Dai, Liang; Doyle, Patrick; Garaj, Slaven

Nanopore sensing is a precise technique for analysis of the structure and dynamics of individual biomolecules in different environments, and has even become a prominent technique for next-gen DNA sequencing. In the nanopore sensor, an individual DNA molecule is electrophoretically translocated through a single, nanometer-scaled pore in a solid-state membrane separating two chambers filled with electrolyte. The conformation of the molecule is deduced from modulations in the ionic current through the pore during the translocation event. Using nanopores, we investigated the dynamics of the DNA molecules in a crowded solution of neutral polymers of different sizes and concentrations. The translocation dynamics depends significantly on the size and concentration of the polymers, as different contributions to the electrophoretic and entropic forces on the DNA molecules come into play. This setup offers an excellent, tuneable model-system for probing biologically relevant questions regarding the behaviour of DNA molecules in highly confined and crowded environments. Singapore-MIT Alliance for Research and Technology.

Functional helicoidal model of DNA molecule with elastic nonlinearity

NASA Astrophysics Data System (ADS)

Tseytlin, Y. M.

2013-06-01

We constructed a functional DNA molecule model on the basis of a flexible helicoidal sensor, specifically, a pretwisted hollow nano-strip. We study in this article the helicoidal nano- sensor model with a pretwisted strip axial extension corresponding to the overstretching transition of DNA from dsDNA to ssDNA. Our model and the DNA molecule have similar geometrical and nonlinear mechanical features unlike models based on an elastic rod, accordion bellows, or an imaginary combination of "multiple soft and hard linear springs", presented in some recent publications.

Single DNA molecule detection using nanopipettes and nanoparticles.

PubMed

Karhanek, Miloslav; Kemp, Jennifer T; Pourmand, Nader; Davis, Ronald W; Webb, Chris D

2005-02-01

Single DNA molecules labeled with nanoparticles can be detected by blockades of ionic current as they are translocated through a nanopipette tip formed by a pulled glass capillary. The nanopipette detection technique can provide not only tools for detection and identification of single DNA and protein molecules but also deeper insight and understanding of stochastic interactions of various biomolecules with their environment.

Influence of DNA Lesions on Polymerase-Mediated DNA Replication at Single-Molecule Resolution.

PubMed

Gahlon, Hailey L; Romano, Louis J; Rueda, David

2017-11-20

Faithful replication of DNA is a critical aspect in maintaining genome integrity. DNA polymerases are responsible for replicating DNA, and high-fidelity polymerases do this rapidly and at low error rates. Upon exposure to exogenous or endogenous substances, DNA can become damaged and this can alter the speed and fidelity of a DNA polymerase. In this instance, DNA polymerases are confronted with an obstacle that can result in genomic instability during replication, for example, by nucleotide misinsertion or replication fork collapse. It is important to know how DNA polymerases respond to damaged DNA substrates to understand the mechanism of mutagenesis and chemical carcinogenesis. Single-molecule techniques have helped to improve our current understanding of DNA polymerase-mediated DNA replication, as they enable the dissection of mechanistic details that can otherwise be lost in ensemble-averaged experiments. These techniques have also been used to gain a deeper understanding of how single DNA polymerases behave at the site of the damage in a DNA substrate. In this review, we evaluate single-molecule studies that have examined the interaction between DNA polymerases and damaged sites on a DNA template.

Small-Molecule Inhibitors Targeting DNA Repair and DNA Repair Deficiency in Research and Cancer Therapy.

PubMed

Hengel, Sarah R; Spies, M Ashley; Spies, Maria

2017-09-21

To maintain stable genomes and to avoid cancer and aging, cells need to repair a multitude of deleterious DNA lesions, which arise constantly in every cell. Processes that support genome integrity in normal cells, however, allow cancer cells to develop resistance to radiation and DNA-damaging chemotherapeutics. Chemical inhibition of the key DNA repair proteins and pharmacologically induced synthetic lethality have become instrumental in both dissecting the complex DNA repair networks and as promising anticancer agents. The difficulty in capitalizing on synthetically lethal interactions in cancer cells is that many potential targets do not possess well-defined small-molecule binding determinates. In this review, we discuss several successful campaigns to identify and leverage small-molecule inhibitors of the DNA repair proteins, from PARP1, a paradigm case for clinically successful small-molecule inhibitors, to coveted new targets, such as RAD51 recombinase, RAD52 DNA repair protein, MRE11 nuclease, and WRN DNA helicase. Copyright © 2017 Elsevier Ltd. All rights reserved.

DNA molecules on periodically microstructured lipid membranes: Localization and coil stretching

NASA Astrophysics Data System (ADS)

Hochrein, Marion B.; Leierseder, Judith A.; Golubović, Leonardo; Rädler, Joachim O.

2007-02-01

We explore large scale conformations of DNA molecules adsorbed on curved surfaces. For that purpose, we investigate the behavior of DNA adsorbed on periodically shaped cationic lipid membranes. These unique membrane morphologies are supported on grooved, one-dimensionally periodic microstructured surfaces. Strikingly, we find that these periodically structured membranes are capable to stretch DNA coils. We elucidate this phenomenon in terms of surface curvature dependent potential energy attained by the adsorbed DNA molecules. Due to it, DNA molecules undergo a localization transition causing them to stretch by binding to highly curved sections (edges) of the supported membranes. This effect provides a new venue for controlling conformations of semiflexible polymers such as DNA by employing their interactions with specially designed biocompatible surfaces. We report the first experimental observation of semiflexible polymers unbinding transition in which DNA molecules unbind from one-dimensional manifolds (edges) while remaining bound to two-dimensional manifolds (cationic membranes).

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-06-06

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Method for sequencing nucleic acid molecules

DOEpatents

Korlach, Jonas; Webb, Watt W.; Levene, Michael; Turner, Stephen; Craighead, Harold G.; Foquet, Mathieu

2006-05-30

The present invention is directed to a method of sequencing a target nucleic acid molecule having a plurality of bases. In its principle, the temporal order of base additions during the polymerization reaction is measured on a molecule of nucleic acid, i.e. the activity of a nucleic acid polymerizing enzyme on the template nucleic acid molecule to be sequenced is followed in real time. The sequence is deduced by identifying which base is being incorporated into the growing complementary strand of the target nucleic acid by the catalytic activity of the nucleic acid polymerizing enzyme at each step in the sequence of base additions. A polymerase on the target nucleic acid molecule complex is provided in a position suitable to move along the target nucleic acid molecule and extend the oligonucleotide primer at an active site. A plurality of labelled types of nucleotide analogs are provided proximate to the active site, with each distinguishable type of nucleotide analog being complementary to a different nucleotide in the target nucleic acid sequence. The growing nucleic acid strand is extended by using the polymerase to add a nucleotide analog to the nucleic acid strand at the active site, where the nucleotide analog being added is complementary to the nucleotide of the target nucleic acid at the active site. The nucleotide analog added to the oligonucleotide primer as a result of the polymerizing step is identified. The steps of providing labelled nucleotide analogs, polymerizing the growing nucleic acid strand, and identifying the added nucleotide analog are repeated so that the nucleic acid strand is further extended and the sequence of the target nucleic acid is determined.

Quantitative analysis of small molecule-nucleic acid interactions with a biosensor surface and surface plasmon resonance detection.

PubMed

Liu, Yang; Wilson, W David

2010-01-01

Surface plasmon resonance (SPR) technology with biosensor surfaces has become a widely-used tool for the study of nucleic acid interactions without any labeling requirements. The method provides simultaneous kinetic and equilibrium characterization of the interactions of biomolecules as well as small molecule-biopolymer binding. SPR monitors molecular interactions in real time and provides significant advantages over optical or calorimetic methods for systems with strong binding coupled to small spectroscopic signals and/or reaction heats. A detailed and practical guide for nucleic acid interaction analysis using SPR-biosensor methods is presented. Details of the SPR technology and basic fundamentals are described with recommendations on the preparation of the SPR instrument, sensor chips, and samples, as well as extensive information on experimental design, quantitative and qualitative data analysis and presentation. A specific example of the interaction of a minor-groove-binding agent with DNA is evaluated by both kinetic and steady-state SPR methods to illustrate the technique. Since the molecules that bind cooperatively to specific DNA sequences are attractive for many applications, a cooperative small molecule-DNA interaction is also presented.

Single-Molecule Interactions of a Monoclonal Anti-DNA Antibody with DNA

PubMed Central

Nevzorova, Tatiana A.; Zhao, Qingze; Lomakin, Yakov A.; Ponomareva, Anastasia A.; Mukhitov, Alexander R.; Purohit, Prashant K.; Weisel, John W.; Litvinov, Rustem I.

2017-01-01

Interactions of DNA with proteins are essential for key biological processes and have both a fundamental and practical significance. In particular, DNA binding to anti-DNA antibodies is a pathogenic mechanism in autoimmune pathology, such as systemic lupus erythematosus. Here we measured at the single-molecule level binding and forced unbinding of surface-attached DNA and a monoclonal anti-DNA antibody MRL4 from a lupus erythematosus mouse. In optical trap-based force spectroscopy, a microscopic antibodycoated latex bead is trapped by a focused laser beam and repeatedly brought into contact with a DNA-coated surface. After careful discrimination of non-specific interactions, we showed that the DNA-antibody rupture force spectra had two regimes, reflecting formation of weaker (20–40 pN) and stronger (>40 pN) immune complexes that implies the existence of at least two bound states with different mechanical stability. The two-dimensional force-free off-rate for the DNA-antibody complexes was ~2.2 × 10−3 s−1, the transition state distance was ~0.94 nm, the apparent on-rate was ~5.26 s−1, and the stiffness of the DNA-antibody complex was characterized by a spring constant of 0.0021 pN/nm, suggesting that the DNA-antibody complex is a relatively stable, but soft and deformable macromolecular structure. The stretching elasticity of the DNA molecules was characteristic of single-stranded DNA, suggesting preferential binding of the MRL4 antibody to one strand of DNA. Collectively, the results provide fundamental characteristics of formation and forced dissociation of DNA-antibody complexes that help to understand principles of DNA-protein interactions and shed light on the molecular basis of autoimmune diseases accompanied by formation of anti-DNA antibodies. PMID:29104846

DNA origami as biocompatible surface to match single-molecule and ensemble experiments

PubMed Central

Gietl, Andreas; Holzmeister, Phil; Grohmann, Dina; Tinnefeld, Philip

2012-01-01

Single-molecule experiments on immobilized molecules allow unique insights into the dynamics of molecular machines and enzymes as well as their interactions. The immobilization, however, can invoke perturbation to the activity of biomolecules causing incongruities between single molecule and ensemble measurements. Here we introduce the recently developed DNA origami as a platform to transfer ensemble assays to the immobilized single molecule level without changing the nano-environment of the biomolecules. The idea is a stepwise transfer of common functional assays first to the surface of a DNA origami, which can be checked at the ensemble level, and then to the microscope glass slide for single-molecule inquiry using the DNA origami as a transfer platform. We studied the structural flexibility of a DNA Holliday junction and the TATA-binding protein (TBP)-induced bending of DNA both on freely diffusing molecules and attached to the origami structure by fluorescence resonance energy transfer. This resulted in highly congruent data sets demonstrating that the DNA origami does not influence the functionality of the biomolecule. Single-molecule data collected from surface-immobilized biomolecule-loaded DNA origami are in very good agreement with data from solution measurements supporting the fact that the DNA origami can be used as biocompatible surface in many fluorescence-based measurements. PMID:22523083

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed

Horn, T; Chang, C A; Urdea, M S

1997-12-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.

Chemical synthesis and characterization of branched oligodeoxyribonucleotides (bDNA) for use as signal amplifiers in nucleic acid quantification assays.

PubMed Central

Horn, T; Chang, C A; Urdea, M S

1997-01-01

The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266

SINGLE STRAND-CONTAINING REPLICATING MOLECULES OF CIRCULAR MITOCHONDRIAL DNA

PubMed Central

Wolstenholme, David R.; Koike, Katsuro; Cochran-Fouts, Patricia

1973-01-01

Mitochondrial DNAs (mtDNAs) from Chang rat solid hepatomas and Novikoff rat ascites hepatomas were examined in the electron microscope after preparation by the aqueous and by the formamide protein monolayer techniques. MtDNAs from both tumors were found to include double-forked circular molecules with a form and size suggesting they were replicative intermediates. These molecules were of two classes. In molecules of one class, all three segments were apparently totally double stranded. Molecules of the second class were distinguished by the fact that one of the segments spanning the region between the forks in which replication had occurred (the daughter segments) was either totally single stranded, or contained a single-stranded region associated with one of the forks. Daughter segments of both totally double-stranded and single strand-containing replicating molecules varied in length from about 3 to about 80% of the circular contour length of the molecule. Similar classes of replicating molecules were found in mtDNA from regenerating rat liver and chick embryos, indicating them to be normal intermediates in the replication of mtDNA All of the mtDNAs examined included partially single-stranded simple (nonforked) circular molecules. A possible scheme for the replication of mtDNA is presented, based on the different molecular forms observed PMID:4345165

Developing DNA nanotechnology using single-molecule fluorescence.

PubMed

Tsukanov, Roman; Tomov, Toma E; Liber, Miran; Berger, Yaron; Nir, Eyal

2014-06-17

CONSPECTUS: An important effort in the DNA nanotechnology field is focused on the rational design and manufacture of molecular structures and dynamic devices made of DNA. As is the case for other technologies that deal with manipulation of matter, rational development requires high quality and informative feedback on the building blocks and final products. For DNA nanotechnology such feedback is typically provided by gel electrophoresis, atomic force microscopy (AFM), and transmission electron microscopy (TEM). These analytical tools provide excellent structural information; however, usually they do not provide high-resolution dynamic information. For the development of DNA-made dynamic devices such as machines, motors, robots, and computers this constitutes a major problem. Bulk-fluorescence techniques are capable of providing dynamic information, but because only ensemble averaged information is obtained, the technique may not adequately describe the dynamics in the context of complex DNA devices. The single-molecule fluorescence (SMF) technique offers a unique combination of capabilities that make it an excellent tool for guiding the development of DNA-made devices. The technique has been increasingly used in DNA nanotechnology, especially for the analysis of structure, dynamics, integrity, and operation of DNA-made devices; however, its capabilities are not yet sufficiently familiar to the community. The purpose of this Account is to demonstrate how different SMF tools can be utilized for the development of DNA devices and for structural dynamic investigation of biomolecules in general and DNA molecules in particular. Single-molecule diffusion-based Förster resonance energy transfer and alternating laser excitation (sm-FRET/ALEX) and immobilization-based total internal reflection fluorescence (TIRF) techniques are briefly described and demonstrated. To illustrate the many applications of SMF to DNA nanotechnology, examples of SMF studies of DNA hairpins and

Pulsed IR Heating Studies of Single-Molecule DNA Duplex Dissociation Kinetics and Thermodynamics

PubMed Central

Holmstrom, Erik D.; Dupuis, Nicholas F.; Nesbitt, David J.

2014-01-01

Single-molecule fluorescence spectroscopy is a powerful technique that makes it possible to observe the conformational dynamics associated with biomolecular processes. The addition of precise temperature control to these experiments can yield valuable thermodynamic information about equilibrium and kinetic rate constants. To accomplish this, we have developed a microscopy technique based on infrared laser overtone/combination band absorption to heat small (≈10−11 liter) volumes of water. Detailed experimental characterization of this technique reveals three major advantages over conventional stage heating methods: 1), a larger range of steady-state temperatures (20–100°C); 2), substantially superior spatial (≤20 μm) control; and 3), substantially superior temporal (≈1 ms) control. The flexibility and breadth of this spatial and temporally resolved laser-heating approach is demonstrated in single-molecule fluorescence assays designed to probe the dissociation of a 21 bp DNA duplex. These studies are used to support a kinetic model based on nucleic acid end fraying that describes dissociation for both short (<10 bp) and long (>10 bp) DNA duplexes. These measurements have been extended to explore temperature-dependent kinetics for the 21 bp construct, which permit determination of single-molecule activation enthalpies and entropies for DNA duplex dissociation. PMID:24411254

Single Molecule Visualization of Protein-DNA Complexes: Watching Machines at Work

NASA Astrophysics Data System (ADS)

Kowalczykowski, Stephen

2013-03-01

We can now watch individual proteins acting on single molecules of DNA. Such imaging provides unprecedented interrogation of fundamental biophysical processes. Visualization is achieved through the application of two complementary procedures. In one, single DNA molecules are attached to a polystyrene bead and are then captured by an optical trap. The DNA, a worm-like coil, is extended either by the force of solution flow in a micro-fabricated channel, or by capturing the opposite DNA end in a second optical trap. In the second procedure, DNA is attached by one end to a glass surface. The coiled DNA is elongated either by continuous solution flow or by subsequently tethering the opposite end to the surface. Protein action is visualized by fluorescent reporters: fluorescent dyes that bind double-stranded DNA (dsDNA), fluorescent biosensors for single-stranded DNA (ssDNA), or fluorescently-tagged proteins. Individual molecules are imaged using either epifluorescence microscopy or total internal reflection fluorescence (TIRF) microscopy. Using these approaches, we imaged the search for DNA sequence homology conducted by the RecA-ssDNA filament. The manner by which RecA protein finds a single homologous sequence in the genome had remained undefined for almost 30 years. Single-molecule imaging revealed that the search occurs through a mechanism termed ``intersegmental contact sampling,'' in which the randomly coiled structure of DNA is essential for reiterative sampling of DNA sequence identity: an example of parallel processing. In addition, the assembly of RecA filaments on single molecules of single-stranded DNA was visualized. Filament assembly requires nucleation of a protein dimer on DNA, and subsequent growth occurs via monomer addition. Furthermore, we discovered a class of proteins that catalyzed both nucleation and growth of filaments, revealing how the cell controls assembly of this protein-DNA complex.

Enhanced post wash retention of combed DNA molecules by varying multiple combing parameters.

PubMed

Yadav, Hemendra; Sharma, Pulkit

2017-11-01

Recent advances in genomics have created a need for efficient techniques for deciphering information hidden in various genomes. Single molecule analysis is one such technique to understand molecular processes at single molecule level. Fiber- FISH performed with the help of DNA combing can help us in understanding genetic rearrangements and changes in genome at single DNA molecule level. For performing Fiber-FISH we need high retention of combed DNA molecules post wash as Fiber-FISH requires profuse washing. We optimized combing process involving combing solution, method of DNA mounting on glass slides and coating of glass slides to enhance post-wash retention of DNA molecules. It was found that average number of DNA molecules observed post-wash per field of view was maximum with our optimized combing solution. APTES coated glass slides showed lesser retention than PEI surface but fluorescent intensity was higher in case of APTES coated surface. Capillary method used to mount DNA on glass slides also showed lesser retention but straight DNA molecules were observed as compared to force flow method. Copyright © 2017 Elsevier Inc. All rights reserved.

Observation of DNA Molecules Using Fluorescence Microscopy and Atomic Force Microscopy

ERIC Educational Resources Information Center

Ito, Takashi

2008-01-01

This article describes experiments for an undergraduate instrumental analysis laboratory that aim to observe individual double-stranded DNA (dsDNA) molecules using fluorescence microscopy and atomic force microscopy (AFM). dsDNA molecules are observed under several different conditions to discuss their chemical and physical properties. In…

How to read and write mechanical information in DNA molecules

NASA Astrophysics Data System (ADS)

Schiessel, Helmut

In this talk I will show that DNA molecules contain another layer of information on top of the classical genetic information. This different type of information is of mechanical nature and guides the folding of DNA molecules inside cells. With the help of a new Monte Carlo technique, the Mutation Monte Carlo method, we demonstrate that the two layers of information can be multiplexed (as one can have two phone conversations on the same wire). For instance, we can guide on top of genes with single base-pair precision the packaging of DNA into nucleosomes. Finally, we study the mechanical properties of DNA molecules belonging to organisms all across the tree of life. From this we learn that in multicellular organisms the stiffness of DNA around transcription start sites differs dramatically from that of unicellular life. The reason for this difference is surprising.

DNA curtains for high-throughput single-molecule optical imaging.

PubMed

Greene, Eric C; Wind, Shalom; Fazio, Teresa; Gorman, Jason; Visnapuu, Mari-Liis

2010-01-01

Single-molecule approaches provide a valuable tool in the arsenal of the modern biologist, and new discoveries continue to be made possible through the use of these state-of-the-art technologies. However, it can be inherently difficult to obtain statistically relevant data from experimental approaches specifically designed to probe individual reactions. This problem is compounded with more complex biochemical reactions, heterogeneous systems, and/or reactions requiring the use of long DNA substrates. Here we give an overview of a technology developed in our laboratory, which relies upon simple micro- or nanofabricated structures in combination with "bio-friendly" lipid bilayers, to align thousands of long DNA molecules into defined patterns on the surface of a microfluidic sample chamber. We call these "DNA curtains," and we have developed several different versions varying in complexity and DNA substrate configuration, which are designed to meet different experimental needs. This novel approach to single-molecule imaging provides a powerful experimental platform that offers the potential for concurrent observation of hundreds or even thousands of protein-DNA interactions in real time. Copyright 2010 Elsevier Inc. All rights reserved.

Single-Molecule Denaturation Mapping of Genomic DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Kristensen, Anders; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2009-03-01

We have developed a new DNA barcoding technique based on the partial denaturation of extended fluorescently labeled DNA molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions and can be explained by calculations of sequence-dependent melting probability. We believe this melting mapping technology is the first optically based single molecule technique sensitive to genome wide sequence variation that does not require an additional enzymatic labeling or restriction scheme.

Selection and Characterization of Single Stranded DNA Aptamers for the Hormone Abscisic Acid

PubMed Central

Gonzalez, Victor M.; Millo, Enrico; Sturla, Laura; Vigliarolo, Tiziana; Bagnasco, Luca; Guida, Lucrezia; D'Arrigo, Cristina; De Flora, Antonio; Salis, Annalisa; Martin, Elena M.; Bellotti, Marta; Zocchi, Elena

2013-01-01

The hormone abscisic acid (ABA) is a small molecule involved in pivotal physiological functions in higher plants. Recently, ABA has been also identified as an endogenous hormone in mammals, regulating different cell functions including inflammatory processes, stem cell expansion, insulin release, and glucose uptake. Aptamers are short, single-stranded (ss) oligonucleotidesable to recognize target molecules with high affinity. The small size of the ABA molecule represented a challenge for aptamer development and the aim of this study was to develop specific anti-ABA DNA aptamers. Biotinylated abscisic acid (bio-ABA) was immobilized on streptavidin-coated magnetic beads. DNA aptamers against bio-ABA were selected with 7 iterative rounds of the systematic evolution of ligands by exponential enrichment method (SELEX), each round comprising incubation of the ABA-binding beads with the ssDNA sequences, DNA elution, electrophoresis, and polymerase chain reaction (PCR) amplification. The PCR product was cloned and sequenced. The binding affinity of several clones was determined using bio-ABA immobilized on streptavidin-coated plates. Aptamer 2 and aptamer 9 showed the highest binding affinity, with dissociation constants values of 0.98±0.14 μM and 0.80±0.07 μM, respectively. Aptamers 2 and 9 were also able to bind free, unmodified ABA and to discriminate between different ABA enantiomers and isomers. Our findings indicate that ssDNA aptamers can selectively bind ABA and could be used for the development of ABA quantitation assays. PMID:23971905

Optoelectronic studies on heterocyclic bases of deoxyribonucleic acid for DNA photonics.

PubMed

El-Diasty, Fouad; Abdel-Wahab, Fathy

2015-10-01

The optoelectronics study of large molecules, particularly π-stacking molecules, such as DNA is really an extremely difficult task. We perform first electronic structure calculations on the heterocyclic bases of 2'-deoxyribonucleic acid based on Lorentz-Fresnel dispersion theory. In the UV-VIS range of spectrum, many of the optoelectronic parameters for DNA four bases namely adenine, guanine, cytosine and thymine are calculated and discussed. The results demonstrate that adenine has the highest hyperpolarizability, whereas thymine has the lowest hyperpolarizability. Cytosine has the lower average oscillator energy and the higher lattice energy. Thymine infers the most stable nucleic base with the lower phonon energy. Thymine also has the highest average oscillator energy and the lower lattice energy. Moreover, the four nucleic acid bases have large band gap energies less than 5 eV with a semiconducting behavior. Guanine shows the smallest band gap and the highest Fermi level energy, whereas adenine elucidates the highest band gap energy. Copyright © 2015. Published by Elsevier B.V.

Model of DNA topology simplification has come full (supercoiled) circle after two decades of research. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Stasiak, Andrzej

2016-09-01

Being a geek of DNA topology, I remember very well the stir caused by 1997 Science paper showing that DNA topoisomerases have the ability to simplify DNA topology below the topological equilibrium values [1]. In their seminal experiments Rybenkov et al. [1] started with linear double-stranded DNA molecules with cohesive ends. The mutual cohesiveness of DNA ends was due to mutual complementarity of single-stranded extensions at both ends of linear double-stranded DNA molecules. When such DNA molecules were heated up and then slowly cooled down the single-stranded ends eventually annealed with each other causing DNA circularization. This experimental protocol permitted the authors to establish topological/thermodynamic equilibrium within samples of circularized DNA molecules. Among simple unknotted circles one also observed knotted and catenated DNA molecules. The fraction of knotted molecules in DNA samples at topological equilibrium was increasing with the length of DNA molecules undergoing slow circularization. The fraction of catenated molecules was increasing with the length and the concentration of the molecules undergoing slow circularization. Rybenkov et al. incubated then such equilibrated DNA samples with type II DNA topoisomerases, which pass DNA duplex regions through each other, and observed that as the result of it the fraction of knotted and catenated DNA molecules was dramatically decreased (up to 80-fold). This elegant experiment indicated for the first time that type II DNA topoisomerases acting on knotted or catenated DNA molecules have the ability to select among many potential sites of DNA-DNA passages these that result in DNA unknotting or decatenation. Without such a selection topoisomerases could only maintain the original topological equilibrium obtained during the slow cyclization. The big question was how DNA topoisomerases can be directed to do DNA-DNA passages that preferentially result in DNA unknotting and decatenation.

Single-Molecule Denaturation Mapping of DNA in Nanofluidic Channels

NASA Astrophysics Data System (ADS)

Reisner, Walter; Larsen, Niels; Silahtaroglu, Asli; Kristensen, Anders; Tommerup, Niels; Tegenfeldt, Jonas O.; Flyvbjerg, Henrik

2010-03-01

Nanochannel based DNA stretching can serve as a platform for a new optical mapping technique based on measuring the pattern of partial melting along the extended molecules. We partially melt DNA extended in nanofluidic channels via a combination of local heating and added chemical denaturants. The melted molecules, imaged via a standard fluorescence videomicroscopy setup, exhibit a nonuniform fluorescence profile corresponding to a series of local dips and peaks in the intensity trace along the stretched molecule. We show that this barcode is consistent with the presence of locally melted regions along the molecule and can be explained by calculations of sequence-dependent melting probability. Specifically, we obtain experimental melting profiles for T4, T7, lambda-phage and bacterial artificial chromosome DNA (from human chromosome 12) and compare these profiles to theory. In addition, we demonstrate that the BAC melting profile can be used to align the BAC to its correct position on chromosome 12.

The study of electrical conductivity of DNA molecules by scanning tunneling spectroscopy

NASA Astrophysics Data System (ADS)

Sharipov, T. I.; Bakhtizin, R. Z.

2017-10-01

An interest to the processes of charge transport in DNA molecules is very high, due to perspective of their using in nanoelectronics. The original sample preparation for studying electrical conductivity of DNA molecules by scanning tunneling spectroscopy has been proposed and tested. The DNA molecules immobilized on gold surface have been imaged clearly and their current-voltage curves have been measured.

Topological events in single molecules of E. coli DNA confined in nanochannels

PubMed Central

Reifenberger, Jeffrey G.; Dorfman, Kevin D.; Cao, Han

2015-01-01

We present experimental data concerning potential topological events such as folds, internal backfolds, and/or knots within long molecules of double-stranded DNA when they are stretched by confinement in a nanochannel. Genomic DNA from E. coli was labeled near the ‘GCTCTTC’ sequence with a fluorescently labeled dUTP analog and stained with the DNA intercalator YOYO. Individual long molecules of DNA were then linearized and imaged using methods based on the NanoChannel Array technology (Irys® System) available from BioNano Genomics. Data were collected on 189,153 molecules of length greater than 50 kilobases. A custom code was developed to search for abnormal intensity spikes in the YOYO backbone profile along the length of individual molecules. By correlating the YOYO intensity spikes with the aligned barcode pattern to the reference, we were able to correlate the bright intensity regions of YOYO with abnormal stretching in the molecule, which suggests these events were either a knot or a region of internal backfolding within the DNA. We interpret the results of our experiments involving molecules exceeding 50 kilobases in the context of existing simulation data for relatively short DNA, typically several kilobases. The frequency of these events is lower than the predictions from simulations, while the size of the events is larger than simulation predictions and often exceeds the molecular weight of the simulated molecules. We also identified DNA molecules that exhibit large, single folds as they enter the nanochannels. Overall, topological events occur at a low frequency (~7% of all molecules) and pose an easily surmountable obstacle for the practice of genome mapping in nanochannels. PMID:25991508

Theoretical electrical conductivity of hydrogen-bonded benzamide-derived molecules and single DNA bases.

PubMed

Chen, Xiang

2013-09-01

A benzamide molecule is used as a "reader" molecule to form hydrogen bonds with five single DNA bases, i.e., four normal single DNA bases A,T,C,G and one for 5methylC. The whole molecule is then attached to the gold surface so that a meta-molecule junction is formed. We calculate the transmission function and conductance for the five metal-molecule systems, with the implementation of density functional theory-based non-equilibrium Green function method. Our results show that each DNA base exhibits a unique conductance and most of them are on the pS level. The distinguishable conductance of each DNA base provides a way for the fast sequencing of DNA. We also investigate the dependence of conductivity of such a metal-molecule system on the hydrogen bond length between the "reader" molecule and DNA base, which shows that conductance follows an exponential decay as the hydrogen bond length increases, i.e., the conductivity is highly sensitive to the change in hydrogen bond length.

Drug-DNA interactions at single molecule level: A view with optical tweezers

NASA Astrophysics Data System (ADS)

Paramanathan, Thayaparan

Studies of small molecule--DNA interactions are essential for developing new drugs for challenging diseases like cancer and HIV. The main idea behind developing these molecules is to target and inhibit the reproduction of the tumor cells and infected cells. We mechanically manipulate single DNA molecule using optical tweezers to investigate two molecules that have complex and multiple binding modes. Mononuclear ruthenium complexes have been extensively studied as a test for rational drug design. Potential drug candidates should have high affinity to DNA and slow dissociation kinetics. To achieve this, motifs of the ruthenium complexes are altered. Our collaborators designed a dumb-bell shaped binuclear ruthenium complex that can only intercalate DNA by threading through its bases. Studying the binding properties of this complex in bulk studies took hours. By mechanically manipulating a single DNA molecule held with optical tweezers, we lower the barrier to thread and make it fast compared to the bulk experiments. Stretching single DNA molecules with different concentration of drug molecules and holding it at a constant force allows the binding to reach equilibrium. By this we can obtain the equilibrium fractional ligand binding and length of DNA at saturated binding. Fitting these results yields quantitative measurements of the binding thermodynamics and kinetics of this complex process. The second complex discussed in this study is Actinomycin D (ActD), a well studied anti-cancer agent that is used as a prototype for developing new generations of drugs. However, the biophysical basis of its activity is still unclear. Because ActD is known to intercalate double stranded DNA (dsDNA), it was assumed to block replication by stabilizing dsDNA in front of the replication fork. However, recent studies have shown that ActD binds with even higher affinity to imperfect duplexes and some sequences of single stranded DNA (ssDNA). We directly measure the on and off rates by

Winding single-molecule double-stranded DNA on a nanometer-sized reel

PubMed Central

You, Huijuan; Iino, Ryota; Watanabe, Rikiya; Noji, Hiroyuki

2012-01-01

A molecular system of a nanometer-sized reel was developed from F1–ATPase, a rotary motor protein. By combination with magnetic tweezers and optical tweezers, single-molecule double-stranded DNA (dsDNA) was wound around the molecular reel. The bending stiffness of dsDNA was determined from the winding tension (0.9–6.0 pN) and the diameter of the wound loop (21.4–8.5 nm). Our results were in good agreement with the conventional worm-like chain model and a persistence length of 54 ± 9 nm was estimated. This molecular reel system offers a new platform for single-molecule study of micromechanics of sharply bent DNA molecules and is expected to be applicable to the elucidation of the molecular mechanism of DNA-associating proteins on sharply bent DNA strands. PMID:22772992

Direct observation of λ-DNA molecule reversal movement within microfluidic channels under electric field with single molecule imaging technique

NASA Astrophysics Data System (ADS)

Fengyun, Yang; Kaige, Wang; Dan, Sun; Wei, Zhao; Hai-qing, Wang; Xin, He; Gui-ren, Wang; Jin-tao, Bai

2016-07-01

The electrodynamic characteristics of single DNA molecules moving within micro-/nano-fluidic channels are important in the design of biomedical chips and bimolecular sensors. In this study, the dynamic properties of λ-DNA molecules transferring along the microchannels driven by the external electrickinetic force were systemically investigated with the single molecule fluorescence imaging technique. The experimental results indicated that the velocity of DNA molecules was strictly dependent on the value of the applied electric field and the diameter of the channel. The larger the external electric field, the larger the velocity, and the more significant deformation of DNA molecules. More meaningfully, it was found that the moving directions of DNA molecules had two completely different directions: (i) along the direction of the external electric field, when the electric field intensity was smaller than a certain threshold value; (ii) opposite to the direction of the external electric field, when the electric field intensity was greater than the threshold electric field intensity. The reversal movement of DNA molecules was mainly determined by the competition between the electrophoresis force and the influence of electro-osmosis flow. These new findings will theoretically guide the practical application of fluidic channel sensors and lab-on-chips for precisely manipulating single DNA molecules. Project supported by the National Natural Science Foundation of China (Grant No. 61378083), the International Cooperation Foundation of the National Science and Technology Major Project of the Ministry of Science and Technology of China (Grant No. 2011DFA12220), the Major Research Plan of National Natural Science Foundation of China (Grant No. 91123030), and the Natural Science Foundation of Shaanxi Province of China (Grant Nos. 2010JS110 and 2013SZS03-Z01).

Single-molecule analysis of DNA uncoiling by a type II topoisomerase

NASA Astrophysics Data System (ADS)

Strick, Terence R.; Croquette, Vincent; Bensimon, David

2000-04-01

Type II DNA topoisomerases are ubiquitous ATP-dependent enzymes capable of transporting a DNA through a transient double-strand break in a second DNA segment. This enables them to untangle DNA and relax the interwound supercoils (plectonemes) that arise in twisted DNA. In vivo, they are responsible for untangling replicated chromosomes and their absence at mitosis or meiosis ultimately causes cell death. Here we describe a micromanipulation experiment in which we follow in real time a single Drosophila melanogaster topoisomerase II acting on a linear DNA molecule which is mechanically stretched and supercoiled. By monitoring the DNA's extension in the presence of ATP, we directly observe the relaxation of two supercoils during a single catalytic turnover. By controlling the force pulling on the molecule, we determine the variation of the reaction rate with the applied stress. Finally, in the absence of ATP, we observe the clamping of a DNA crossover by a single topoisomerase on at least two different timescales (configurations). These results show that single molecule experiments are a powerful new tool for the study of topoisomerases.

Molecular Recognition of Azelaic Acid and Related Molecules with DNA Polymerase I Investigated by Molecular Modeling Calculations.

PubMed

Shawon, Jakaria; Khan, Akib Mahmud; Rahman, Adhip; Hoque, Mohammad Mazharol; Khan, Mohammad Abdul Kader; Sarwar, Mohammed G; Halim, Mohammad A

2016-10-01

Molecular recognition has central role on the development of rational drug design. Binding affinity and interactions are two key components which aid to understand the molecular recognition in drug-receptor complex and crucial for structure-based drug design in medicinal chemistry. Herein, we report the binding affinity and the nonbonding interactions of azelaic acid and related compounds with the receptor DNA polymerase I (2KFN). Quantum mechanical calculation was employed to optimize the modified drugs using B3LYP/6-31G(d,p) level of theory. Charge distribution, dipole moment and thermodynamic properties such as electronic energy, enthalpy and free energy of these optimized drugs are also explored to evaluate how modifications impact the drug properties. Molecular docking calculation was performed to evaluate the binding affinity and nonbonding interactions between designed molecules and the receptor protein. We notice that all modified drugs are thermodynamically more stable and some of them are more chemically reactive than the unmodified drug. Promise in enhancing hydrogen bonds is found in case of fluorine-directed modifications as well as in the addition of trifluoroacetyl group. Fluorine participates in forming fluorine bonds and also stimulates alkyl, pi-alkyl interactions in some drugs. Designed drugs revealed increased binding affinity toward 2KFN. A1, A2 and A3 showed binding affinities of -8.7, -8.6 and -7.9 kcal/mol, respectively against 2KFN compared to the binding affinity -6.7 kcal/mol of the parent drug. Significant interactions observed between the drugs and Thr358 and Asp355 residues of 2KFN. Moreover, designed drugs demonstrated improved pharmacokinetic properties. This study disclosed that 9-octadecenoic acid and drugs containing trifluoroacetyl and trifluoromethyl groups are the best 2KFN inhibitors. Overall, these results can be useful for the design of new potential candidates against DNA polymerase I.

Single Molecule Spectroscopy of Amino Acids and Peptides by Recognition Tunneling

PubMed Central

Zhao, Yanan; Ashcroft, Brian; Zhang, Peiming; Liu, Hao; Sen, Suman; Song, Weisi; Im, JongOne; Gyarfas, Brett; Manna, Saikat; Biswas, Sovan; Borges, Chad; Lindsay, Stuart

2014-01-01

The human proteome has millions of protein variants due to alternative RNA splicing and post-translational modifications, and variants that are related to diseases are frequently present in minute concentrations. For DNA and RNA, low concentrations can be amplified using the polymerase chain reaction, but there is no such reaction for proteins. Therefore, the development of single molecule protein sequencing is a critical step in the search for protein biomarkers. Here we show that single amino acids can be identified by trapping the molecules between two electrodes that are coated with a layer of recognition molecules and measuring the electron tunneling current across the junction. A given molecule can bind in more than one way in the junction, and we therefore use a machine-learning algorithm to distinguish between the sets of electronic ‘fingerprints’ associated with each binding motif. With this recognition tunneling technique, we are able to identify D, L enantiomers, a methylated amino acid, isobaric isomers, and short peptides. The results suggest that direct electronic sequencing of single proteins could be possible by sequentially measuring the products of processive exopeptidase digestion, or by using a molecular motor to pull proteins through a tunnel junction integrated with a nanopore. PMID:24705512

Tethered particle analysis of supercoiled circular DNA using peptide nucleic acid handles.

PubMed

Norregaard, Kamilla; Andersson, Magnus; Nielsen, Peter Eigil; Brown, Stanley; Oddershede, Lene B

2014-09-01

This protocol describes how to monitor individual naturally supercoiled circular DNA plasmids bound via peptide nucleic acid (PNA) handles between a bead and a surface. The protocol was developed for single-molecule investigation of the dynamics of supercoiled DNA, and it allows the investigation of both the dynamics of the molecule itself and of its interactions with a regulatory protein. Two bis-PNA clamps designed to bind with extremely high affinity to predetermined homopurine sequence sites in supercoiled DNA are prepared: one conjugated with digoxigenin for attachment to an anti-digoxigenin-coated glass cover slide, and one conjugated with biotin for attachment to a submicron-sized streptavidin-coated polystyrene bead. Plasmids are constructed, purified and incubated with the PNA handles. The dynamics of the construct is analyzed by tracking the tethered bead using video microscopy: less supercoiling results in more movement, and more supercoiling results in less movement. In contrast to other single-molecule methodologies, the current methodology allows for studying DNA in its naturally supercoiled state with constant linking number and constant writhe. The protocol has potential for use in studying the influence of supercoils on the dynamics of DNA and its associated proteins, e.g., topoisomerase. The procedure takes ~4 weeks.

Directional rolling of positively charged nanoparticles along a flexibility gradient on long DNA molecules.

PubMed

Park, Suehyun; Joo, Heesun; Kim, Jun Soo

2018-01-31

Directing the motion of molecules/colloids in any specific direction is of great interest in many applications of chemistry, physics, and biological sciences, where regulated positioning or transportation of materials is highly desired. Using Brownian dynamics simulations of coarse-grained models of a long, double-stranded DNA molecule and positively charged nanoparticles, we observed that the motion of a single nanoparticle bound to and wrapped by the DNA molecule can be directed along a gradient of DNA local flexibility. The flexibility gradient is constructed along a 0.8 kilobase-pair DNA molecule such that local persistence length decreases gradually from 50 nm to 40 nm, mimicking a gradual change in sequence-dependent flexibility. Nanoparticles roll over a long DNA molecule from less flexible regions towards more flexible ones as a result of the decreasing energetic cost of DNA bending and wrapping. In addition, the rolling becomes slightly accelerated as the positive charge of nanoparticles decreases due to a lower free energy barrier of DNA detachment from charged nanoparticle for processive rolling. This study suggests that the variation in DNA local flexibility can be utilized in constructing and manipulating supramolecular assemblies of DNA molecules and nanoparticles in structural DNA nanotechnology.

Like-charge attraction and opposite-charge decomplexation between polymers and DNA molecules

NASA Astrophysics Data System (ADS)

Buyukdagli, Sahin

2017-02-01

We scrutinize the effect of polyvalent ions on polymer-DNA interactions. We extend a recently developed test-charge theory [S. Buyukdagli et al., Phys. Rev. E 94, 042502 (2016), 10.1103/PhysRevE.94.042502] to the case of a stiff polymer interacting with a DNA molecule in an electrolyte mixture. The theory accounts for one-loop level electrostatic correlation effects such as the ionic cloud deformation around the strongly charged DNA molecule as well as image-charge forces induced by the low DNA permittivity. Our model can reproduce and explain various characteristics of the experimental phase diagrams for polymer solutions. First, the addition of polyvalent cations to the electrolyte solution results in the attraction of the negatively charged polymer by the DNA molecule. The glue of the like-charge attraction is the enhanced shielding of the polymer charges by the dense counterion layer at the DNA surface. Second, through the shielding of the DNA-induced electrostatic potential, mono- and polyvalent cations of large concentration both suppress the like-charge attraction. Within the same formalism, we also predict a new opposite-charge repulsion effect between the DNA molecule and a positively charged polymer. In the presence of polyvalent anions such as sulfate or phosphate, their repulsion by the DNA charges leads to the charge screening deficiency of the region around the DNA molecule. This translates into a repulsive force that results in the decomplexation of the polymer from DNA. This opposite-charge repulsion phenomenon can be verified by current experiments and the underlying mechanism can be beneficial to gene therapeutic applications where the control over polymer-DNA interactions is the key factor.

Application of differential scanning calorimetry to measure the differential binding of ions, water and protons in the unfolding of DNA molecules.

PubMed

Olsen, Chris M; Shikiya, Ronald; Ganugula, Rajkumar; Reiling-Steffensmeier, Calliste; Khutsishvili, Irine; Johnson, Sarah E; Marky, Luis A

2016-05-01

The overall stability of DNA molecules globally depends on base-pair stacking, base-pairing, polyelectrolyte effect and hydration contributions. In order to understand how they carry out their biological roles, it is essential to have a complete physical description of how the folding of nucleic acids takes place, including their ion and water binding. To investigate the role of ions, water and protons in the stability and melting behavior of DNA structures, we report here an experimental approach i.e., mainly differential scanning calorimetry (DSC), to determine linking numbers: the differential binding of ions (Δnion), water (ΔnW) and protons (ΔnH(+)) in the helix-coil transition of DNA molecules. We use DSC and temperature-dependent UV spectroscopic techniques to measure the differential binding of ions, water, and protons for the unfolding of a variety of DNA molecules: salmon testes DNA (ST-DNA), one dodecamer, one undecamer and one decamer duplexes, nine hairpin loops, and two triplexes. These methods can be applied to any conformational transition of a biomolecule. We determined complete thermodynamic profiles, including all three linking numbers, for the unfolding of each molecule. The favorable folding of a DNA helix results from a favorable enthalpy-unfavorable entropy compensation. DSC thermograms and UV melts as a function of salt, osmolyte and proton concentrations yielded releases of ions and water. Therefore, the favorable folding of each DNA molecule results from the formation of base-pair stacks and uptake of both counterions and water molecules. In addition, the triplex with C(+)GC base triplets yielded an uptake of protons. Furthermore, the folding of a DNA duplex is accompanied by a lower uptake of ions and a similar uptake of four water molecules as the DNA helix gets shorter. In addition, the oligomer duplexes and hairpin thermodynamic data suggest ion and water binding depends on the DNA sequence rather than DNA composition. Copyright �

Nanofabricated Racks of Aligned and Anchored DNA Substrates for Single-Molecule Imaging

PubMed Central

2009-01-01

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This “double-tethered” DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein−DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA. PMID:19736980

Nanofabricated racks of aligned and anchored DNA substrates for single-molecule imaging.

PubMed

Gorman, Jason; Fazio, Teresa; Wang, Feng; Wind, Shalom; Greene, Eric C

2010-01-19

Single-molecule studies of biological macromolecules can benefit from new experimental platforms that facilitate experimental design and data acquisition. Here we develop new strategies to construct curtains of DNA in which the molecules are aligned with respect to one another and maintained in an extended configuration by anchoring both ends of the DNA to the surface of a microfluidic sample chamber that is otherwise coated with an inert lipid bilayer. This "double-tethered" DNA substrate configuration is established through the use of nanofabricated rack patterns comprised of two distinct functional elements: linear barriers to lipid diffusion that align DNA molecules anchored by one end to the bilayer and antibody-coated pentagons that provide immobile anchor points for the opposite ends of the DNA. These devices enable the alignment and anchoring of thousands of individual DNA molecules, which can then be visualized using total internal reflection fluorescence microscopy under conditions that do not require continuous application of buffer flow to stretch the DNA. This unique strategy offers the potential for studying protein-DNA interactions on large DNA substrates without compromising measurements through application of hydrodynamic force. We provide a proof-of-principle demonstration that double-tethered DNA curtains made with nanofabricated rack patterns can be used in a one-dimensional diffusion assay that monitors the motion of quantum dot-tagged proteins along DNA.

Single molecule fluorescence burst detection of DNA fragments separated by capillary electrophoresis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haab, B.B.; Mathies, R.A.

A method has been developed for detecting DNA separated by capillary gel electrophoresis (CGE) using single molecule photon burst counting. A confocal fluorescence microscope was used to observe the fluorescence bursts from single molecules of DNA multiply labeled with the thiazole orange derivative TO6 as they passed through the nearly 2-{mu}m diameter focused laser beam. Amplified photo-electron pulses from the photomultiplier are grouped into bins of 360-450 {mu}s in duration, and the resulting histogram is stored in a computer for analysis. Solutions of M13 DNA were first flowed through the capillary at various concentrations, and the resulting data were usedmore » to optimize the parameters for digital filtering using a low-pass Fourier filter, selecting a discriminator level for peak detection, and applying a peak-calling algorithm. The optimized single molecule counting method was then applied to an electrophoretic separation of M13 DNA and to a separation of pBR 322 DNA from pRL 277 DNA. Clusters of discreet fluorescence bursts were observed at the expected appearance time of each DNA band. The auto-correlation function of these data indicated transit times that were consistent with the observed electrophoretic velocity. These separations were easily detected when only 50-100 molecules of DNA per band traveled through the detection region. This new detection technology should lead to the routine analysis of DNA in capillary columns with an on-column sensitivity of nearly 100 DNA molecules/band or better. 45 refs., 10 figs.« less

Single-molecule imaging of DNA polymerase I (Klenow fragment) activity by atomic force microscopy

NASA Astrophysics Data System (ADS)

Chao, J.; Zhang, P.; Wang, Q.; Wu, N.; Zhang, F.; Hu, J.; Fan, C. H.; Li, B.

2016-03-01

We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA.We report a DNA origami-facilitated single-molecule platform that exploits atomic force microscopy to study DNA replication. We imaged several functional activities of the Klenow fragment of E. coli DNA polymerase I (KF) including binding, moving, and dissociation from the template DNA. Upon completion of these actions, a double-stranded DNA molecule was formed. Furthermore, the direction of KF activities was captured and then confirmed by shifting the KF binding sites on the template DNA. Electronic supplementary information (ESI) available. See DOI: 10.1039/c5nr06544e

DNA Binding Peptide Directed Synthesis of Continuous DNA Nanowires for Analysis of Large DNA Molecules by Scanning Electron Microscope.

PubMed

Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon

2017-01-01

Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Studying DNA Looping by Single-Molecule FRET

PubMed Central

Le, Tung T.; Kim, Harold D.

2014-01-01

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA. PMID:24998459

Studying DNA looping by single-molecule FRET.

PubMed

Le, Tung T; Kim, Harold D

2014-06-28

Bending of double-stranded DNA (dsDNA) is associated with many important biological processes such as DNA-protein recognition and DNA packaging into nucleosomes. Thermodynamics of dsDNA bending has been studied by a method called cyclization which relies on DNA ligase to covalently join short sticky ends of a dsDNA. However, ligation efficiency can be affected by many factors that are not related to dsDNA looping such as the DNA structure surrounding the joined sticky ends, and ligase can also affect the apparent looping rate through mechanisms such as nonspecific binding. Here, we show how to measure dsDNA looping kinetics without ligase by detecting transient DNA loop formation by FRET (Fluorescence Resonance Energy Transfer). dsDNA molecules are constructed using a simple PCR-based protocol with a FRET pair and a biotin linker. The looping probability density known as the J factor is extracted from the looping rate and the annealing rate between two disconnected sticky ends. By testing two dsDNAs with different intrinsic curvatures, we show that the J factor is sensitive to the intrinsic shape of the dsDNA.

Biosensing via light scattering from plasmonic core-shell nanospheres coated with DNA molecules

NASA Astrophysics Data System (ADS)

Xie, Huai-Yi; Chen, Minfeng; Chang, Yia-Chung; Moirangthem, Rakesh Singh

2017-05-01

We present both experimental and theoretical studies for investigating DNA molecules attached on metallic nanospheres. We have developed an efficient and accurate numerical method to investigate light scattering from plasmonic nanospheres on a substrate covered by a shell, based on the Green's function approach with suitable spherical harmonic basis. Next, we use this method to study optical scattering from DNA molecules attached to metallic nanoparticles placed on a substrate and compare with experimental results. We obtain fairly good agreement between theoretical predictions and the measured ellipsometric spectra. The metallic nanoparticles were used to detect the binding with DNA molecules in a microfluidic setup via spectroscopic ellipsometry (SE), and a detectable change in ellipsometric spectra was found when DNA molecules are captured on Au nanoparticles. Our theoretical simulation indicates that the coverage of Au nanosphere by a submonolayer of DNA molecules, which is modeled by a thin layer of dielectric material (which may absorb light), can lead to a small but detectable spectroscopic shift in both the Ψ and Δ spectra with more significant change in Δ spectra in agreement with experimental results. Our studies demonstrated the ultrasensitive capability of SE for sensing submonolayer coverage of DNA molecules on Au nanospheres. Hence the spectroscopic ellipsometric measurements coupled with theoretical analysis via an efficient computation method can be an effective tool for detecting DNA molecules attached on Au nanoparticles, thus achieving label-free, non-destructive, and high-sensitivity biosensing with nanoscale resolution.

Current-voltage characteristics of double stranded versus single stranded DNA molecules

NASA Astrophysics Data System (ADS)

Hartzell, B.; Chen, Hong; Heremans, J. J.; McCord, B.; Soghomonian, V.

2004-03-01

Investigation of DNA conductivity has focused on the native, duplex structure, with controversial results. Here, we present the influence of the double-helical structure on charge transport through lambda DNA molecules. The current-voltage (I-V) characteristics of both disulfide-labeled double stranded DNA (dsDNA) and disulfide-labeled single stranded DNA (ssDNA) were measured. The ssDNA was formed from the dsDNA using two different methods for comparison purposes: a thermal/chemical denaturation and enzymatic digestion utilizing lambda exonuclease. Resulting I-V characteristics of both the double stranded and single stranded samples were close-to-linear when measured at room temperature. However, the ssDNA samples consistently gave conductivity values about two orders of magnitude smaller in amplitude. Our results suggest an integral relationship between the native structure of DNA with its stacked base pairs and the molecule's ability to support charge transport.(NSF NIRT 0103034)

DNA Molecules Adsorbed on Rippled Supported Cationic Lipid Membranes -- A new way to stretch DNAs

NASA Astrophysics Data System (ADS)

Golubovic, Leonardo

2005-03-01

We discuss a novel approach to control to shapes of DNA molecules. We elucidate the recent experimental work of M. Hochrein, L. Golubovic and J. Raedler, on the conformational behavior of DNA molecules adsorbed on lipid membranes that are supported on grooved micro-structured surfaces. We explain the striking ability of the edges formed on these supported membranes to adsorb and completely orient (stretch) very long DNA molecules. Here we explain the experimentally observed DNA stretching effect in terms of the surface curvature dependent electrostatic potential seen by the adsorbed DNA molecules. On the curved, rippled membrane, we show that the DNA molecules undergo localization transitions causing them to stretch by binding to the ripple edges of the supported membrane. In the future, this stretching will allow to directly image, by the common fluorescence microscopy, fundamental biological processes of the interactions between DNA and single protein molecules.

Gating electrical transport through DNA molecules that bridge between silicon nanogaps.

PubMed

Takagi, Shogo; Takada, Tadao; Matsuo, Naoto; Yokoyama, Shin; Nakamura, Mitsunobu; Yamana, Kazushige

2012-03-21

DNA electronic devices were prepared on silicon-based three-terminal electrodes. Both ends of DNA molecules (400 bp long, mixed sequences) were bridged via chemical bonds between the source-drain nanogap (120 nm) electrodes. S-Shaped I-V curves were obtained and the electric current can be modulated by the gate voltage. The DNA molecules act as semiconducting p-type nanowires in the three-terminal device. This journal is © The Royal Society of Chemistry 2012

Polymer physics experiments with single DNA molecules

NASA Astrophysics Data System (ADS)

Smith, Douglas E.

1999-11-01

Bacteriophage DNA molecules were taken as a model flexible polymer chain for the experimental study of polymer dynamics at the single molecule level. Video fluorescence microscopy was used to directly observe the conformational dynamics of fluorescently labeled molecules, optical tweezers were used to manipulate individual molecules, and micro-fabricated flow cells were used to apply controlled hydrodynamic strain to molecules. These techniques constitute a powerful new experimental approach in the study of basic polymer physics questions. I have used these techniques to study the diffusion and relaxation of isolated and entangled polymer molecules and the hydrodynamic deformation of polymers in elongational and shear flows. These studies revealed a rich, and previously unobserved, ``molecular individualism'' in the dynamical behavior of single molecules. Individual measurements on ensembles of identical molecules allowed the average conformation to be determined as well as the underlying probability distributions for molecular conformation. Scaling laws, that predict the dependence of properties on chain length and concentration, were also tested. The basic assumptions of the reptation model were directly confirmed by visualizing the dynamics of entangled chains.

DNA molecule stretching through thermo-electrophoresis and thermal convection in a heated converging-diverging microchannel.

PubMed

Hsieh, Shou-Shing; Chen, Jyun-Hong; Tsai, Cheng-Fung

2013-02-18

A novel DNA molecule stretching technique is developed and tested herein. Through a heated converging-diverging microchannel, thermal convection and thermophoresis induced by regional heating are shown to significantly elongate single DNA molecules; they are visualized via a confocal laser scanning microscopy. In addition, electrophoretic stretching is also implemented to examine the hybrid effect on the conformation and dynamics of single DNA molecules. The physical properties of the DNA molecules are secured via experimental measurements.

A 3D-DNA Molecule Made of PlayMais

ERIC Educational Resources Information Center

Caine, Massimo; Horié, Ninon; Zuchuat, Sandrine; Weber, Aurélia; Ducret, Verena; Linder, Patrick; Perron, Karl

2015-01-01

More than 60 years have passed since the work of Rosalind Franklin, James Watson, and Francis Crick led to the discovery of the 3D-DNA double-helix structure. Nowadays, due to the simple and elegant architecture of its double helix, the structure of DNA is widely known. The biological role of the DNA molecule (e.g., genetic information), however,…

Internal twisting motion dependent conductance of an aperiodic DNA molecule

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wiliyanti, Vandan, E-mail: vandan.wiliyanti@ui.ac.id; Yudiarsah, Efta

The influence of internal twisting motion of base-pair on conductance of an aperiodic DNA molecule has been studied. Double-stranded DNA molecule with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. The molecule is modeled using Hamiltonian Tight Binding, in which the effect of twisting motion on base onsite energy and between bases electron hopping constant was taking into account. Semi-empirical theory of Slater-Koster is employed in bringing the twisting motion effect on the hopping constants. In addition to the ability to hop from one base to other base, electron can also hop from amore » base to sugar-phosphate backbone and vice versa. The current flowing through DNA molecule is calculated using Landauer–Büttiker formula from transmission probability, which is calculated using transfer matrix technique and scattering matrix method, simultaneously. Then, the differential conductance is calculated from the I-V curve. The calculation result shows at some region of voltages, the conductance increases as the frequency increases, but in other region it decreases with the frequency.« less

CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules

NASA Astrophysics Data System (ADS)

Sarangi, S. N.; Sahu, S. N.; Nozaki, S.

2018-03-01

CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.

Cell-targetable DNA nanocapsules for spatiotemporal release of caged bioactive small molecules

NASA Astrophysics Data System (ADS)

Veetil, Aneesh T.; Chakraborty, Kasturi; Xiao, Kangni; Minter, Myles R.; Sisodia, Sangram S.; Krishnan, Yamuna

2017-12-01

Achieving triggered release of small molecules with spatial and temporal precision at designated cells within an organism remains a challenge. By combining a cell-targetable, icosahedral DNA-nanocapsule loaded with photoresponsive polymers, we show cytosolic delivery of small molecules with the spatial resolution of single endosomes in specific cells in Caenorhabditis elegans. Our technology can report on the extent of small molecules released after photoactivation as well as pinpoint the location at which uncaging of the molecules occurred. We apply this technology to release dehydroepiandrosterone (DHEA), a neurosteroid that promotes neurogenesis and neuron survival, and determined the timescale of neuronal activation by DHEA, using light-induced release of DHEA from targeted DNA nanocapsules. Importantly, sequestration inside the DNA capsule prevents photocaged DHEA from activating neurons prematurely. Our methodology can in principle be generalized to diverse neurostimulatory molecules.

Amino acids 16-275 of minute virus of mice NS1 include a domain that specifically binds (ACCA)2-3-containing DNA.

PubMed

Mouw, M; Pintel, D J

1998-11-10

GST-NS1 purified from Escherichia coli and insect cells binds double-strand DNA in an (ACCA)2-3-dependent fashion under similar ionic conditions, independent of the presence of anti-NS1 antisera or exogenously supplied ATP and interacts with single-strand DNA and RNA in a sequence-independent manner. An amino-terminal domain (amino acids 1-275) of NS1 [GST-NS1(1-275)], representing 41% of the full-length NS1 molecule, includes a domain that binds double-strand DNA in a sequence-specific manner at levels comparable to full-length GST-NS1, as well as single-strand DNA and RNA in a sequence-independent manner. The deletion of 15 additional amino-terminal amino acids yielded a molecule [GST-NS1(1-275)] that maintained (ACCA)2-3-specific double-strand DNA binding; however, this molecule was more sensitive to increasing ionic conditions than full-length GST-NS1 and GST-NS1(1-275) and could not be demonstrated to bind single-strand nucleic acids. A quantitative filter binding assay showed that E. coli- and baculovirus-expressed GST-NS1 and E. coli GST-NS1(1-275) specifically bound double-strand DNA with similar equilibrium kinetics [as measured by their apparent equilibrium DNA binding constants (KD)], whereas GST-NS1(16-275) bound 4- to 8-fold less well. Copyright 1998 Academic Press.

Imaging and sizing of single DNA molecules on a mobile phone.

PubMed

Wei, Qingshan; Luo, Wei; Chiang, Samuel; Kappel, Tara; Mejia, Crystal; Tseng, Derek; Chan, Raymond Yan Lok; Yan, Eddie; Qi, Hangfei; Shabbir, Faizan; Ozkan, Haydar; Feng, Steve; Ozcan, Aydogan

2014-12-23

DNA imaging techniques using optical microscopy have found numerous applications in biology, chemistry and physics and are based on relatively expensive, bulky and complicated set-ups that limit their use to advanced laboratory settings. Here we demonstrate imaging and length quantification of single molecule DNA strands using a compact, lightweight and cost-effective fluorescence microscope installed on a mobile phone. In addition to an optomechanical attachment that creates a high contrast dark-field imaging setup using an external lens, thin-film interference filters, a miniature dovetail stage and a laser-diode for oblique-angle excitation, we also created a computational framework and a mobile phone application connected to a server back-end for measurement of the lengths of individual DNA molecules that are labeled and stretched using disposable chips. Using this mobile phone platform, we imaged single DNA molecules of various lengths to demonstrate a sizing accuracy of <1 kilobase-pairs (kbp) for 10 kbp and longer DNA samples imaged over a field-of-view of ∼2 mm2.

Mechanisms of small molecule–DNA interactions probed by single-molecule force spectroscopy

PubMed Central

Almaqwashi, Ali A.; Paramanathan, Thayaparan; Rouzina, Ioulia; Williams, Mark C.

2016-01-01

There is a wide range of applications for non-covalent DNA binding ligands, and optimization of such interactions requires detailed understanding of the binding mechanisms. One important class of these ligands is that of intercalators, which bind DNA by inserting aromatic moieties between adjacent DNA base pairs. Characterizing the dynamic and equilibrium aspects of DNA-intercalator complex assembly may allow optimization of DNA binding for specific functions. Single-molecule force spectroscopy studies have recently revealed new details about the molecular mechanisms governing DNA intercalation. These studies can provide the binding kinetics and affinity as well as determining the magnitude of the double helix structural deformations during the dynamic assembly of DNA–ligand complexes. These results may in turn guide the rational design of intercalators synthesized for DNA-targeted drugs, optical probes, or integrated biological self-assembly processes. Herein, we survey the progress in experimental methods as well as the corresponding analysis framework for understanding single molecule DNA binding mechanisms. We discuss briefly minor and major groove binding ligands, and then focus on intercalators, which have been probed extensively with these methods. Conventional mono-intercalators and bis-intercalators are discussed, followed by unconventional DNA intercalation. We then consider the prospects for using these methods in optimizing conventional and unconventional DNA-intercalating small molecules. PMID:27085806

Single molecule analysis of Trypanosoma brucei DNA replication dynamics.

PubMed

Calderano, Simone Guedes; Drosopoulos, William C; Quaresma, Marina Mônaco; Marques, Catarina A; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L; Elias, Maria Carolina

2015-03-11

Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5' extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

DNA.

ERIC Educational Resources Information Center

Felsenfeld, Gary

1985-01-01

Structural form, bonding scheme, and chromatin structure of and gene-modification experiments with deoxyribonucleic acid (DNA) are described. Indicates that DNA's double helix is variable and also flexible as it interacts with regulatory and other molecules to transfer hereditary messages. (DH)

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

NASA Astrophysics Data System (ADS)

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-04-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ~10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level.

DNA origami-based shape IDs for single-molecule nanomechanical genotyping

PubMed Central

Zhang, Honglu; Chao, Jie; Pan, Dun; Liu, Huajie; Qiang, Yu; Liu, Ke; Cui, Chengjun; Chen, Jianhua; Huang, Qing; Hu, Jun; Wang, Lianhui; Huang, Wei; Shi, Yongyong; Fan, Chunhai

2017-01-01

Variations on DNA sequences profoundly affect how we develop diseases and respond to pathogens and drugs. Atomic force microscopy (AFM) provides a nanomechanical imaging approach for genetic analysis with nanometre resolution. However, unlike fluorescence imaging that has wavelength-specific fluorophores, the lack of shape-specific labels largely hampers widespread applications of AFM imaging. Here we report the development of a set of differentially shaped, highly hybridizable self-assembled DNA origami nanostructures serving as shape IDs for magnified nanomechanical imaging of single-nucleotide polymorphisms. Using these origami shape IDs, we directly genotype single molecules of human genomic DNA with an ultrahigh resolution of ∼10 nm and the multiplexing ability. Further, we determine three types of disease-associated, long-range haplotypes in samples from the Han Chinese population. Single-molecule analysis allows robust haplotyping even for samples with low labelling efficiency. We expect this generic shape ID-based nanomechanical approach to hold great potential in genetic analysis at the single-molecule level. PMID:28382928

DNA Physical Mapping via the Controlled Translocation of Single Molecules through a 5-10nm Silicon Nitride Nanopore

NASA Astrophysics Data System (ADS)

Stein, Derek; Reisner, Walter; Jiang, Zhijun; Hagerty, Nick; Wood, Charles; Chan, Jason

2009-03-01

The ability to map the binding position of sequence-specific markers, including transcription-factors, protein-nucleic acids (PNAs) or deactivated restriction enzymes, along a single DNA molecule in a nanofluidic device would be of key importance for the life-sciences. Such markers could give an indication of the active genes at particular stage in a cell's transcriptional cycle, pinpoint the location of mutations or even provide a DNA barcode that could aid in genomics applications. We have developed a setup consisting of a 5-10 nm nanopore in a 20nm thick silicon nitride film coupled to an optical tweezer setup. The translocation of DNA across the nanopore can be detected via blockades in the electrical current through the pore. By anchoring one end of the translocating DNA to an optically trapped microsphere, we hope to stretch out the molecule in the nanopore and control the translocation speed, enabling us to slowly scan across the genome and detect changes in the baseline current due to the presence of bound markers.

Generation of Gene-Engineered Chimeric DNA Molecules for Specific Therapy of Autoimmune Diseases

PubMed Central

Gesheva, Vera; Szekeres, Zsuzsanna; Mihaylova, Nikolina; Dimitrova, Iliyana; Nikolova, Maria; Erdei, Anna; Prechl, Jozsef

2012-01-01

Abstract Systemic lupus erythematosus (SLE) is an autoimmune disease characterized by the development of self-reactive B and T cells and autoantibody production. In particular, double-stranded DNA-specific B cells play an important role in lupus progression, and their selective elimination is a reasonable approach for effective therapy of SLE. DNA-based vaccines aim at the induction of immune response against the vector-encoded antigen. Here, we are exploring, as a new DNA-based therapy of SLE, a chimeric DNA molecule encoding a DNA-mimotope peptide, and the Fv but not the immunogenic Fc fragment of an FcγRIIb-specific monoclonal antibody. This DNA construct was inserted in the expression vector pNut and used as a naked DNA vaccine in a mouse model of lupus. The chimeric DNA molecule can be expressed in eukaryotic cells and cross-links cell surface receptors on DNA-specific B cells, delivering an inhibitory intracellular signal. Intramuscular administration of the recombinant DNA molecule to lupus-prone MRL/lpr mice prevented increase in IgG anti-DNA antibodies and was associated with a low degree of proteinuria, modulation of cytokine profile, and suppression of lupus nephritis. PMID:23075110

Second-generation DNA-templated macrocycle libraries for the discovery of bioactive small molecules.

PubMed

Usanov, Dmitry L; Chan, Alix I; Maianti, Juan Pablo; Liu, David R

2018-07-01

DNA-encoded libraries have emerged as a widely used resource for the discovery of bioactive small molecules, and offer substantial advantages compared with conventional small-molecule libraries. Here, we have developed and streamlined multiple fundamental aspects of DNA-encoded and DNA-templated library synthesis methodology, including computational identification and experimental validation of a 20 × 20 × 20 × 80 set of orthogonal codons, chemical and computational tools for enhancing the structural diversity and drug-likeness of library members, a highly efficient polymerase-mediated template library assembly strategy, and library isolation and purification methods. We have integrated these improved methods to produce a second-generation DNA-templated library of 256,000 small-molecule macrocycles with improved drug-like physical properties. In vitro selection of this library for insulin-degrading enzyme affinity resulted in novel insulin-degrading enzyme inhibitors, including one of unusual potency and novel macrocycle stereochemistry (IC 50  = 40 nM). Collectively, these developments enable DNA-templated small-molecule libraries to serve as more powerful, accessible, streamlined and cost-effective tools for bioactive small-molecule discovery.

Voltage dependency of transmission probability of aperiodic DNA molecule

NASA Astrophysics Data System (ADS)

Wiliyanti, V.; Yudiarsah, E.

2017-07-01

Characteristics of electron transports in aperiodic DNA molecules have been studied. Double stranded DNA model with the sequences of bases, GCTAGTACGTGACGTAGCTAGGATATGCCTGA, in one chain and its complements on the other chains has been used. Tight binding Hamiltonian is used to model DNA molecules. In the model, we consider that on-site energy of the basis has a linearly dependency on the applied electric field. Slater-Koster scheme is used to model electron hopping constant between bases. The transmission probability of electron from one electrode to the next electrode is calculated using a transfer matrix technique and scattering matrix method simultaneously. The results show that, generally, higher voltage gives a slightly larger value of the transmission probability. The applied voltage seems to shift extended states to lower energy. Meanwhile, the value of the transmission increases with twisting motion frequency increment.

Multiplex single-molecule interaction profiling of DNA-barcoded proteins.

PubMed

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E; Vidal, Marc; Church, George M

2014-11-27

In contrast with advances in massively parallel DNA sequencing, high-throughput protein analyses are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule protein detection using optical methods is limited by the number of spectrally non-overlapping chromophores. Here we introduce a single-molecular-interaction sequencing (SMI-seq) technology for parallel protein interaction profiling leveraging single-molecule advantages. DNA barcodes are attached to proteins collectively via ribosome display or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide thin film to construct a random single-molecule array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies) and analysed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimetre. Furthermore, protein interactions can be measured on the basis of the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor and antibody-binding profiling, are demonstrated. SMI-seq enables 'library versus library' screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, Maria DeFatima; Soares, Marcelo Bento

1997-01-01

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library.

Procedure for normalization of cDNA libraries

DOEpatents

Bonaldo, M.D.; Soares, M.B.

1997-12-30

This invention provides a method to normalize a cDNA library constructed in a vector capable of being converted to single-stranded circles and capable of producing complementary nucleic acid molecules to the single-stranded circles comprising: (a) converting the cDNA library in single-stranded circles; (b) generating complementary nucleic acid molecules to the single-stranded circles; (c) hybridizing the single-stranded circles converted in step (a) with complementary nucleic acid molecules of step (b) to produce partial duplexes to an appropriate Cot; (e) separating the unhybridized single-stranded circles from the hybridized single-stranded circles, thereby generating a normalized cDNA library. 1 fig.

Global structure of forked DNA in solution revealed by high-resolution single-molecule FRET.

PubMed

Sabir, Tara; Schröder, Gunnar F; Toulmin, Anita; McGlynn, Peter; Magennis, Steven W

2011-02-09

Branched DNA structures play critical roles in DNA replication, repair, and recombination in addition to being key building blocks for DNA nanotechnology. Here we combine single-molecule multiparameter fluorescence detection and molecular dynamics simulations to give a general approach to global structure determination of branched DNA in solution. We reveal an open, planar structure of a forked DNA molecule with three duplex arms and demonstrate an ion-induced conformational change. This structure will serve as a benchmark for DNA-protein interaction studies.

Attomole-level Genomics with Single-molecule Direct DNA, cDNA and RNA Sequencing Technologies.

PubMed

Ozsolak, Fatih

2016-01-01

With the introduction of next-generation sequencing (NGS) technologies in 2005, the domination of microarrays in genomics quickly came to an end due to NGS's superior technical performance and cost advantages. By enabling genetic analysis capabilities that were not possible previously, NGS technologies have started to play an integral role in all areas of biomedical research. This chapter outlines the low-quantity DNA and cDNA sequencing capabilities and applications developed with the Helicos single molecule DNA sequencing technology.

The Dynamics of Entangled DNA Networks using Single-Molecule Methods

NASA Astrophysics Data System (ADS)

Chapman, Cole David

Single molecule experiments were performed on DNA, a model polymer, and entangled DNA networks to explore diffusion within complex polymeric fluids and their linear and non-linear viscoelasticity. DNA molecules of varying length and topology were prepared using biological methods. An ensemble of individual molecules were then fluorescently labeled and tracked in blends of entangled linear and circular DNA to examine the dependence of diffusion on polymer length, topology, and blend ratio. Diffusion was revealed to possess a non-monotonic dependence on the blend ratio, which we believe to be due to a second-order effect where the threading of circular polymers by their linear counterparts greatly slows the mobility of the system. Similar methods were used to examine the diffusive and conformational behavior of DNA within highly crowded environments, comparable to that experienced within the cell. A previously unseen gamma distributed elongation of the DNA in the presence of crowders, proposed to be due to entropic effects and crowder mobility, was observed. Additionally, linear viscoelastic properties of entangled DNA networks were explored using active microrheology. Plateau moduli values verified for the first time the predicted independence from polymer length. However, a clear bead-size dependence was observed for bead radii less than ~3x the tube radius, a newly discovered limit, above which microrheology results are within the continuum limit and may access the bulk properties of the fluid. Furthermore, the viscoelastic properties of entangled DNA in the non-linear regime, where the driven beads actively deform the network, were also examined. By rapidly driving a bead through the network utilizing optical tweezers, then removing the trap and tracking the bead's subsequent motion we are able to model the system as an over-damped harmonic oscillator and find the elasticity to be dominated by stress-dependent entanglements.

DNA combing on low-pressure oxygen plasma modified polysilsesquioxane substrates for single-molecule studies

PubMed Central

Sriram, K. K.; Chang, Chun-Ling; Rajesh Kumar, U.; Chou, Chia-Fu

2014-01-01

Molecular combing and flow-induced stretching are the most commonly used methods to immobilize and stretch DNA molecules. While both approaches require functionalization steps for the substrate surface and the molecules, conventionally the former does not take advantage of, as the latter, the versatility of microfluidics regarding robustness, buffer exchange capability, and molecule manipulation using external forces for single molecule studies. Here, we demonstrate a simple one-step combing process involving only low-pressure oxygen (O2) plasma modified polysilsesquioxane (PSQ) polymer layer to facilitate both room temperature microfluidic device bonding and immobilization of stretched single DNA molecules without molecular functionalization step. Atomic force microscopy and Kelvin probe force microscopy experiments revealed a significant increase in surface roughness and surface potential on low-pressure O2 plasma treated PSQ, in contrast to that with high-pressure O2 plasma treatment, which are proposed to be responsible for enabling effective DNA immobilization. We further demonstrate the use of our platform to observe DNA-RNA polymerase complexes and cancer drug cisplatin induced DNA condensation using wide-field fluorescence imaging. PMID:25332730

Electronic Transport in Single-Stranded DNA Molecule Related to Huntington's Disease

NASA Astrophysics Data System (ADS)

Sarmento, R. G.; Silva, R. N. O.; Madeira, M. P.; Frazão, N. F.; Sousa, J. O.; Macedo-Filho, A.

2018-04-01

We report a numerical analysis of the electronic transport in single chain DNA molecule consisting of 182 nucleotides. The DNA chains studied were extracted from a segment of the human chromosome 4p16.3, which were modified by expansion of CAG (cytosine-adenine-guanine) triplet repeats to mimics Huntington's disease. The mutated DNA chains were connected between two platinum electrodes to analyze the relationship between charge propagation in the molecule and Huntington's disease. The computations were performed within a tight-binding model, together with a transfer matrix technique, to investigate the current-voltage (I-V) of 23 types of DNA sequence and compare them with the distributions of the related CAG repeat numbers with the disease. All DNA sequences studied have a characteristic behavior of a semiconductor. In addition, the results showed a direct correlation between the current-voltage curves and the distributions of the CAG repeat numbers, suggesting possible applications in the development of DNA-based biosensors for molecular diagnostics.

A single molecule study of G-quadruplex and short duplex DNA structures

NASA Astrophysics Data System (ADS)

Roy, William A., Jr.

Given that certain conditions are met, a single stranded DNA/RNA (ssDNA/RNA) structure called G-quadruplex (GQ) can form in regions throughout the genome, including at the telomeres and internal regions of the chromosomes. These structures serve various functions depending on the region in which they form which include protecting the chromosome ends, interfering with telomere elongation in cancer cells, and regulating transcription and translation level gene expression. Due to their high stability, various cellular mechanisms, such as GQ destabilizing proteins, are employed to unfold these structures during DNA replication or repair. Yet, their distinct layered structure has made GQs an attractive drug target in cancer treatment as GQ stabilizing molecules could inhibit telomerase dependent telomere elongation, a mechanism occurring in the majority of cancer cells to avoid senescence and apoptosis. However, proteins or small molecules interact with GQ that is under the influence of various cellular tension mechanisms, including the tension applied by other nearby molecules or the tension due to DNA structure within the chromatin context. Therefore, it is important to characterize the stability of various GQs and their response to interacting molecules when subjected to a tensile force. We employed a novel DNA-based nano tension generator that utilizes the elastic properties of circularized short double-stranded DNA (dsDNA) oligonucleotides to apply tension on the GQ. Since this is a completely new approach, the majority of this thesis was dedicated to proof-of-principle studies that demonstrated the feasibility and functionality of the method.

Ordered Self-Assembled Monolayers of Peptide Nucleic Acids with DNA Recognition Capability

NASA Astrophysics Data System (ADS)

Briones, C.; Mateo-Marti, E.; Gómez-Navarro, C.; Parro, V.; Román, E.; Martín-Gago, J. A.

2004-11-01

We report on the formation of ordered self-assembled monolayers (SAMs) of single-stranded peptide nucleic acids (ssPNA). In spite of their remarkable length (7nm) thiolated PNAs assemble standing up on gold surfaces similarly to the SAMs of short alkanethiols. SAMs of ssPNA recognize complementary nucleic acids, acting as specific biosensors that discriminate even a point mutation in target ssDNA. These results are obtained by surface characterization techniques that avoid labeling of the target molecule: x-ray photoemission, x-ray absorption and atomic force microscopy.

Reading Out Single-Molecule Digital RNA and DNA Isothermal Amplification in Nanoliter Volumes with Unmodified Camera Phones

PubMed Central

2016-01-01

Digital single-molecule technologies are expanding diagnostic capabilities, enabling the ultrasensitive quantification of targets, such as viral load in HIV and hepatitis C infections, by directly counting single molecules. Replacing fluorescent readout with a robust visual readout that can be captured by any unmodified cell phone camera will facilitate the global distribution of diagnostic tests, including in limited-resource settings where the need is greatest. This paper describes a methodology for developing a visual readout system for digital single-molecule amplification of RNA and DNA by (i) selecting colorimetric amplification-indicator dyes that are compatible with the spectral sensitivity of standard mobile phones, and (ii) identifying an optimal ratiometric image-process for a selected dye to achieve a readout that is robust to lighting conditions and camera hardware and provides unambiguous quantitative results, even for colorblind users. We also include an analysis of the limitations of this methodology, and provide a microfluidic approach that can be applied to expand dynamic range and improve reaction performance, allowing ultrasensitive, quantitative measurements at volumes as low as 5 nL. We validate this methodology using SlipChip-based digital single-molecule isothermal amplification with λDNA as a model and hepatitis C viral RNA as a clinically relevant target. The innovative combination of isothermal amplification chemistry in the presence of a judiciously chosen indicator dye and ratiometric image processing with SlipChip technology allowed the sequence-specific visual readout of single nucleic acid molecules in nanoliter volumes with an unmodified cell phone camera. When paired with devices that integrate sample preparation and nucleic acid amplification, this hardware-agnostic approach will increase the affordability and the distribution of quantitative diagnostic and environmental tests. PMID:26900709

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory.

PubMed

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-Ichi; Sugimoto, Naoki

2015-12-02

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water-water interactions, (ii) ethylene glycol more effectively disrupted water-water interactions around Watson-Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson-Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. © The Author(s) 2015. Published by Oxford University Press on behalf of Nucleic Acids Research.

Logical NAND and NOR Operations Using Algorithmic Self-assembly of DNA Molecules

NASA Astrophysics Data System (ADS)

Wang, Yanfeng; Cui, Guangzhao; Zhang, Xuncai; Zheng, Yan

DNA self-assembly is the most advanced and versatile system that has been experimentally demonstrated for programmable construction of patterned systems on the molecular scale. It has been demonstrated that the simple binary arithmetic and logical operations can be computed by the process of self assembly of DNA tiles. Here we report a one-dimensional algorithmic self-assembly of DNA triple-crossover molecules that can be used to execute five steps of a logical NAND and NOR operations on a string of binary bits. To achieve this, abstract tiles were translated into DNA tiles based on triple-crossover motifs. Serving as input for the computation, long single stranded DNA molecules were used to nucleate growth of tiles into algorithmic crystals. Our method shows that engineered DNA self-assembly can be treated as a bottom-up design techniques, and can be capable of designing DNA computer organization and architecture.

Torsional stress in DNA limits collaboration among reverse gyrase molecules.

PubMed

Ogawa, Taisaku; Sutoh, Kazuo; Kikuchi, Akihiko; Kinosita, Kazuhiko

2016-04-01

Reverse gyrase is an enzyme that can overwind (introduce positive supercoils into) DNA using the energy obtained from ATP hydrolysis. The enzyme is found in hyperthermophiles, and the overwinding reaction generally requires a temperature above 70 °C. In a previous study using microscopy, we have shown that 30 consecutive mismatched base pairs (a bubble) in DNA serve as a well-defined substrate site for reverse gyrase, warranting the processive overwinding activity down to 50 °C. Here, we inquire how multiple reverse gyrase molecules may collaborate with each other in overwinding one DNA molecule. We introduced one, two, or four bubbles in a linear DNA that tethered a magnetic bead to a coverslip surface. At 40-71 °C in the presence of reverse gyrase, the bead rotated clockwise as viewed from above, to relax the DNA twisted by reverse gyrase. Dependence on the enzyme concentration indicated that each bubble binds reverse gyrase tightly (dissociation constant < 0.1 nm) and that bound enzyme continuously overwinds DNA for > 5 min. Rotation with two bubbles was significantly faster compared with one bubble, indicating that overwinding actions are basically additive, but four bubbles did not show further acceleration except at 40 °C where the activity was very low. The apparent saturation is due to the hydrodynamic friction against the rotating bead, as confirmed by increasing the medium viscosity. When torsional stress in the DNA, determined by the friction, approaches ~ 7 pN·nm (at 71 °C), the overwinding activity of reverse gyrase drops sharply. Multiple molecules of reverse gyrase collaborate additively within this limit. © 2016 The Authors. The FEBS Journal published by John Wiley & Sons Ltd on behalf of Federation of European Biochemical Societies.

Controlled enzymatic cutting of DNA molecules adsorbed on surfaces using soft lithography

NASA Astrophysics Data System (ADS)

Auerbach, Alyssa; Budassi, Julia; Shea, Emily; Zhu, Ke; Sokolov, Jonathan

2013-03-01

The enzyme DNase I was applied to adsorbed and aligned DNA molecules (Lamda, 48.5 kilobase pairs (kbp), and T4, 165.6 kbp), stretched linearly on a surface, by stamping with a polydimethylsiloxane (PDMS) grating. The DNAs were cut by the enzyme into separated, micron-sized segments along the length of the molecules at positions determined by the grating dimensions (3-20 microns). Ozone-treated PDMS stamps were coated with DNase I solutions and placed in contact with surface-adsorbed DNA molecules deposited on a 750 polymethylmethacrylate (PMMA) film spun-cast onto a silicon substrate. The stamps were applied under pressure for times up to 15 minutes at 37 C. The cutting was observed by fluorescence microscopy imaging of DNA labeled with YOYO dye. Cutting was found to be efficient despite the steric hindrance due to surface attachment of the molecules. Methods for detaching and separating the cut segments for sequencing applications will be discussed. Supported by NSF-DMR program.

Single-molecule live-cell imaging of bacterial DNA repair and damage tolerance.

PubMed

Ghodke, Harshad; Ho, Han; van Oijen, Antoine M

2018-02-19

Genomic DNA is constantly under threat from intracellular and environmental factors that damage its chemical structure. Uncorrected DNA damage may impede cellular propagation or even result in cell death, making it critical to restore genomic integrity. Decades of research have revealed a wide range of mechanisms through which repair factors recognize damage and co-ordinate repair processes. In recent years, single-molecule live-cell imaging methods have further enriched our understanding of how repair factors operate in the crowded intracellular environment. The ability to follow individual biochemical events, as they occur in live cells, makes single-molecule techniques tremendously powerful to uncover the spatial organization and temporal regulation of repair factors during DNA-repair reactions. In this review, we will cover practical aspects of single-molecule live-cell imaging and highlight recent advances accomplished by the application of these experimental approaches to the study of DNA-repair processes in prokaryotes. © 2018 The Author(s). Published by Portland Press Limited on behalf of the Biochemical Society.

DNA Translator and Aligner: HyperCard utilities to aid phylogenetic analysis of molecules.

PubMed

Eernisse, D J

1992-04-01

DNA Translator and Aligner are molecular phylogenetics HyperCard stacks for Macintosh computers. They manipulate sequence data to provide graphical gene mapping, conversions, translations and manual multiple-sequence alignment editing. DNA Translator is able to convert documented GenBank or EMBL documented sequences into linearized, rescalable gene maps whose gene sequences are extractable by clicking on the corresponding map button or by selection from a scrolling list. Provided gene maps, complete with extractable sequences, consist of nine metazoan, one yeast, and one ciliate mitochondrial DNAs and three green plant chloroplast DNAs. Single or multiple sequences can be manipulated to aid in phylogenetic analysis. Sequences can be translated between nucleic acids and proteins in either direction with flexible support of alternate genetic codes and ambiguous nucleotide symbols. Multiple aligned sequence output from diverse sources can be converted to Nexus, Hennig86 or PHYLIP format for subsequent phylogenetic analysis. Input or output alignments can be examined with Aligner, a convenient accessory stack included in the DNA Translator package. Aligner is an editor for the manual alignment of up to 100 sequences that toggles between display of matched characters and normal unmatched sequences. DNA Translator also generates graphic displays of amino acid coding and codon usage frequency relative to all other, or only synonymous, codons for approximately 70 select organism-organelle combinations. Codon usage data is compatible with spreadsheet or UWGCG formats for incorporation of additional molecules of interest. The complete package is available via anonymous ftp and is free for non-commercial uses.

Single-Molecule Counting of Point Mutations by Transient DNA Binding

NASA Astrophysics Data System (ADS)

Su, Xin; Li, Lidan; Wang, Shanshan; Hao, Dandan; Wang, Lei; Yu, Changyuan

2017-03-01

High-confidence detection of point mutations is important for disease diagnosis and clinical practice. Hybridization probes are extensively used, but are hindered by their poor single-nucleotide selectivity. Shortening the length of DNA hybridization probes weakens the stability of the probe-target duplex, leading to transient binding between complementary sequences. The kinetics of probe-target binding events are highly dependent on the number of complementary base pairs. Here, we present a single-molecule assay for point mutation detection based on transient DNA binding and use of total internal reflection fluorescence microscopy. Statistical analysis of single-molecule kinetics enabled us to effectively discriminate between wild type DNA sequences and single-nucleotide variants at the single-molecule level. A higher single-nucleotide discrimination is achieved than in our previous work by optimizing the assay conditions, which is guided by statistical modeling of kinetics with a gamma distribution. The KRAS c.34 A mutation can be clearly differentiated from the wild type sequence (KRAS c.34 G) at a relative abundance as low as 0.01% mutant to WT. To demonstrate the feasibility of this method for analysis of clinically relevant biological samples, we used this technology to detect mutations in single-stranded DNA generated from asymmetric RT-PCR of mRNA from two cancer cell lines.

Sub-Ensemble Monitoring of DNA Strand Displacement Using Multiparameter Single-Molecule FRET.

PubMed

Baltierra-Jasso, Laura E; Morten, Michael J; Magennis, Steven W

2018-03-05

Non-enzymatic DNA strand displacement is an important mechanism in dynamic DNA nanotechnology. Here, we show that the large parameter space that is accessible by single-molecule FRET is ideal for the simultaneous monitoring of multiple reactants and products of DNA strand exchange reactions. We monitored the strand displacement from double-stranded DNA (dsDNA) by single-stranded DNA (ssDNA) at 37 °C; the data were modelled as a second-order reaction approaching equilibrium, with a rate constant of 10 m -1  s -1 . We also followed the displacement from a DNA three-way junction (3WJ) by ssDNA. The presence of three internal mismatched bases in the middle of the invading strand did not prevent displacement from the 3WJ, but reduced the second-order rate constant by about 50 %. We attribute strand exchange in the dsDNA and 3WJ to a zero-toehold pathway from the blunt-ended duplex arms. The single-molecule approach demonstrated here will be useful for studying complex DNA networks. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effects of electrostatic screening on the conformation of single DNA molecules confined in a nanochannel

NASA Astrophysics Data System (ADS)

Zhang, Ce; Zhang, Fang; van Kan, Jeroen A.; van der Maarel, Johan R. C.

2008-06-01

Single T4-DNA molecules were confined in rectangular-shaped channels with a depth of 300 nm and a width in the range of 150-300 nm casted in a poly(dimethylsiloxane) nanofluidic chip. The extensions of the DNA molecules were measured with fluorescence microscopy as a function of the ionic strength and composition of the buffer as well as the DNA intercalation level by the YOYO-1 dye. The data were interpreted with the scaling theory for a wormlike polymer in good solvent, including the effects of confinement, charge, and self-avoidance. It was found that the elongation of the DNA molecules with decreasing ionic strength can be interpreted in terms of an increase of the persistence length. Self-avoidance effects on the extension are moderate, due to the small correlation length imposed by the channel cross-sectional diameter. Intercalation of the dye results in an increase of the DNA contour length and a partial neutralization of the DNA charge, but besides effects of electrostatic origin it has no significant effect on the bare bending rigidity. In the presence of divalent cations, the DNA molecules were observed to contract, but they do not collapse into a condensed structure. It is proposed that this contraction results from a divalent counterion mediated attractive force between the segments of the DNA molecule.

Highly Accurate Classification of Watson-Crick Basepairs on Termini of Single DNA Molecules

PubMed Central

Winters-Hilt, Stephen; Vercoutere, Wenonah; DeGuzman, Veronica S.; Deamer, David; Akeson, Mark; Haussler, David

2003-01-01

We introduce a computational method for classification of individual DNA molecules measured by an α-hemolysin channel detector. We show classification with better than 99% accuracy for DNA hairpin molecules that differ only in their terminal Watson-Crick basepairs. Signal classification was done in silico to establish performance metrics (i.e., where train and test data were of known type, via single-species data files). It was then performed in solution to assay real mixtures of DNA hairpins. Hidden Markov Models (HMMs) were used with Expectation/Maximization for denoising and for associating a feature vector with the ionic current blockade of the DNA molecule. Support Vector Machines (SVMs) were used as discriminators, and were the focus of off-line training. A multiclass SVM architecture was designed to place less discriminatory load on weaker discriminators, and novel SVM kernels were used to boost discrimination strength. The tuning on HMMs and SVMs enabled biophysical analysis of the captured molecule states and state transitions; structure revealed in the biophysical analysis was used for better feature selection. PMID:12547778

Modeling DNA

ERIC Educational Resources Information Center

Robertson, Carol

2016-01-01

Deoxyribonucleic acid (DNA) is life's most amazing molecule. It carries the genetic instructions that almost every organism needs to develop and reproduce. In the human genome alone, there are some three billion DNA base pairs. The most difficult part of teaching DNA structure, however, may be getting students to visualize something as small as a…

Screening the sequence selectivity of DNA-binding molecules using a gold nanoparticle-based colorimetric approach.

PubMed

Hurst, Sarah J; Han, Min Su; Lytton-Jean, Abigail K R; Mirkin, Chad A

2007-09-15

We have developed a novel competition assay that uses a gold nanoparticle (Au NP)-based, high-throughput colorimetric approach to screen the sequence selectivity of DNA-binding molecules. This assay hinges on the observation that the melting behavior of DNA-functionalized Au NP aggregates is sensitive to the concentration of the DNA-binding molecule in solution. When short, oligomeric hairpin DNA sequences were added to a reaction solution consisting of DNA-functionalized Au NP aggregates and DNA-binding molecules, these molecules may either bind to the Au NP aggregate interconnects or the hairpin stems based on their relative affinity for each. This relative affinity can be measured as a change in the melting temperature (Tm) of the DNA-modified Au NP aggregates in solution. As a proof of concept, we evaluated the selectivity of 4',6-diamidino-2-phenylindone (an AT-specific binder), ethidium bromide (a nonspecific binder), and chromomycin A (a GC-specific binder) for six sequences of hairpin DNA having different numbers of AT pairs in a five-base pair variable stem region. Our assay accurately and easily confirmed the known trends in selectivity for the DNA binders in question without the use of complicated instrumentation. This novel assay will be useful in assessing large libraries of potential drug candidates that work by binding DNA to form a drug/DNA complex.

Transforming single DNA molecules into fluorescent magnetic particles for detection and enumeration of genetic variations

PubMed Central

Dressman, Devin; Yan, Hai; Traverso, Giovanni; Kinzler, Kenneth W.; Vogelstein, Bert

2003-01-01

Many areas of biomedical research depend on the analysis of uncommon variations in individual genes or transcripts. Here we describe a method that can quantify such variation at a scale and ease heretofore unattainable. Each DNA molecule in a collection of such molecules is converted into a single magnetic particle to which thousands of copies of DNA identical in sequence to the original are bound. This population of beads then corresponds to a one-to-one representation of the starting DNA molecules. Variation within the original population of DNA molecules can then be simply assessed by counting fluorescently labeled particles via flow cytometry. This approach is called BEAMing on the basis of four of its principal components (beads, emulsion, amplification, and magnetics). Millions of individual DNA molecules can be assessed in this fashion with standard laboratory equipment. Moreover, specific variants can be isolated by flow sorting and used for further experimentation. BEAMing can be used for the identification and quantification of rare mutations as well as to study variations in gene sequences or transcripts in specific populations or tissues. PMID:12857956

Real-time single-molecule electronic DNA sequencing by synthesis using polymer-tagged nucleotides on a nanopore array

PubMed Central

Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue

2016-01-01

DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962

Cellular strategies for regulating DNA supercoiling: A single-molecule perspective

PubMed Central

Koster, Daniel A.; Crut, Aurélien; Shuman, Stewart; Bjornsti, Mary-Ann; Dekker, Nynke H.

2010-01-01

Summary Excess entangling and twisting of cellular DNA (i.e., DNA supercoiling) are problems inherent to the helical structure of double-stranded DNA. Supercoiling affects transcription, DNA replication, and chromosomal segregation. Consequently the cell must fine-tune supercoiling to optimize these key processes. Here, we summarize how supercoiling is generated and review experimental and theoretical insights into supercoil relaxation. We distinguish between the passive dissipation of supercoils by diffusion and the active removal of supercoils by topoisomerase enzymes. We also review single-molecule studies that elucidate the timescales and mechanisms of supercoil removal. PMID:20723754

Nanomechanical DNA origami 'single-molecule beacons' directly imaged by atomic force microscopy

PubMed Central

Kuzuya, Akinori; Sakai, Yusuke; Yamazaki, Takahiro; Xu, Yan; Komiyama, Makoto

2011-01-01

DNA origami involves the folding of long single-stranded DNA into designed structures with the aid of short staple strands; such structures may enable the development of useful nanomechanical DNA devices. Here we develop versatile sensing systems for a variety of chemical and biological targets at molecular resolution. We have designed functional nanomechanical DNA origami devices that can be used as 'single-molecule beacons', and function as pinching devices. Using 'DNA origami pliers' and 'DNA origami forceps', which consist of two levers ~170 nm long connected at a fulcrum, various single-molecule inorganic and organic targets ranging from metal ions to proteins can be visually detected using atomic force microscopy by a shape transition of the origami devices. Any detection mechanism suitable for the target of interest, pinching, zipping or unzipping, can be chosen and used orthogonally with differently shaped origami devices in the same mixture using a single platform. PMID:21863016

One-by-one single-molecule detection of mutated nucleobases by monitoring tunneling current using a DNA tip.

PubMed

Bui, Phuc Tan; Nishino, Tomoaki; Shiigi, Hiroshi; Nagaoka, Tsutomu

2015-01-31

A DNA molecule was utilized as a probe tip to achieve single-molecule genetic diagnoses. Hybridization of the probe and target DNAs resulted in electron tunneling along the emergent double-stranded DNA. Simple stationary monitoring of the tunneling current leads to single-molecule DNA detection and discovery of base mismatches and methylation.

DNA-encoded libraries - an efficient small molecule discovery technology for the biomedical sciences.

PubMed

Kunig, Verena; Potowski, Marco; Gohla, Anne; Brunschweiger, Andreas

2018-06-27

DNA-encoded compound libraries are a highly attractive technology for the discovery of small molecule protein ligands. These compound collections consist of small molecules covalently connected to individual DNA sequences carrying readable information about the compound structure. DNA-tagging allows for efficient synthesis, handling and interrogation of vast numbers of chemically synthesized, drug-like compounds. They are screened on proteins by an efficient, generic assay based on Darwinian principles of selection. To date, selection of DNA-encoded libraries allowed for the identification of numerous bioactive compounds. Some of these compounds uncovered hitherto unknown allosteric binding sites on target proteins; several compounds proved their value as chemical biology probes unraveling complex biology; and the first examples of clinical candidates that trace their ancestry to a DNA-encoded library were reported. Thus, DNA-encoded libraries proved their value for the biomedical sciences as a generic technology for the identification of bioactive drug-like molecules numerous times. However, large scale experiments showed that even the selection of billions of compounds failed to deliver bioactive compounds for the majority of proteins in an unbiased panel of target proteins. This raises the question of compound library design.

Substrate preparation for reliable imaging of DNA molecules with the scanning force microscope.

PubMed

Vesenka, J; Guthold, M; Tang, C L; Keller, D; Delaine, E; Bustamante, C

1992-07-01

A simple method of substrate preparation for imaging circular DNA molecules with the scanning force microscope (SFM) is presented. These biomolecules are adsorbed onto mica that has been soaked in magnesium acetate, sonicated and glow-discharged. The stylus-sample forces that may be endured before sample damage occurs depends on the ambient relative humidity. Images of circular DNA molecules have been obtained routinely using tips specially modified by an electron beam with a radius of curvature, Rc, of about 10 nm [D. Keller and C. Chih-Chung, Surf. Sci. 268 (1992) 333]. The resolution of these adsorbed biomolecules is determined by the Rc. At higher forces individual circular DNA molecules can be manipulated with the SFM stylus. Strategies to develop still sharper probes will be discussed.

Simultaneous Binding of Hybrid Molecules Constructed with Dual DNA-Binding Components to a G-Quadruplex and Its Proximal Duplex.

PubMed

Asamitsu, Sefan; Obata, Shunsuke; Phan, Anh Tuân; Hashiya, Kaori; Bando, Toshikazu; Sugiyama, Hiroshi

2018-03-20

A G-quadruplex (quadruplex) is a nucleic acid secondary structure adopted by guanine-rich sequences and is considered to be relevant to various pharmacological and biological contexts. Although a number of researchers have endeavored to discover and develop quadruplex-interactive molecules, poor ligand designability originating from topological similarity of the skeleton of diverse quadruplexes has remained a bottleneck for gaining specificity for individual quadruplexes. This work reports on hybrid molecules that were constructed with dual DNA-binding components, a cyclic imidazole/lysine polyamide (cIKP), and a hairpin pyrrole/imidazole polyamide (hPIP), with the aim toward specific quadruplex targeting by reading out the local duplex DNA sequence adjacent to designated quadruplexes in the genome. By means of circular dichroism (CD), fluorescence resonance energy transfer (FRET), surface plasmon resonance (SPR), and NMR techniques, we showed the dual and simultaneous recognition of the respective segment via hybrid molecules, and the synergistic and mutual effect of each binding component that was appropriately linked on higher binding affinity and modest sequence specificity. Monitoring quadruplex and duplex imino protons of the quadruplex/duplex motif titrated with hybrid molecules clearly revealed distinct features of the binding of hybrid molecules to the respective segments upon their simultaneous recognition. A series of the systematic and detailed binding assays described here showed that the concept of simultaneous recognition of quadruplex and its proximal duplex by hybrid molecules constructed with the dual DNA-binding components may provide a new strategy for ligand design, enabling targeting of a large variety of designated quadruplexes at specific genome locations. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Visualizing Chemical Interaction Dynamics of Confined DNA Molecules

NASA Astrophysics Data System (ADS)

Henkin, Gilead; Berard, Daniel; Stabile, Frank; Leslie, Sabrina

We present a novel nanofluidic approach to controllably introducing reagent molecules to interact with confined biopolymers and visualizing the reaction dynamics in real time. By dynamically deforming a flow cell using CLiC (Convex Lens-induced Confinement) microscopy, we are able to tune reaction chamber dimensions from micrometer to nanometer scales. We apply this gentle deformation to load and extend DNA polymers within embedded nanotopographies and visualize their interactions with other molecules in solution. Quantifying the change in configuration of polymers within embedded nanotopographies in response to binding/unbinding of reagent molecules provides new insights into their consequent change in physical properties. CLiC technology enables an ultra sensitive, massively parallel biochemical analysis platform which can acces a broader range of interaction parameters than existing devices.

Discrimination of Single Base Pair Differences Among Individual DNA Molecules Using a Nanopore

NASA Technical Reports Server (NTRS)

Vercoutere, Wenonah; DeGuzman, Veronica

2003-01-01

The protein toxin alpha-hemolysin form nanometer scale channels across lipid membranes. Our lab uses a single channel in an artificial lipid bilayer in a patch clamp device to capture and examine individual DNA molecules. This nanopore detector used with a support vector machine (SVM) can analyze DNA hairpin molecules on the millisecond time scale. We distinguish duplex stem length, base pair mismatches, loop length, and single base pair differences. The residual current fluxes also reveal structural molecular dynamics elements. DNA end-fraying (terminal base pair dissociation) can be observed as near full blockades, or spikes, in current. This technique can be used to investigate other biological processes dependent on DNA end-fraying, such as the processing of HIV DNA by HIV integrase.

DNA-cisplatin binding mechanism peculiarities studied with single molecule stretching experiments

NASA Astrophysics Data System (ADS)

Crisafuli, F. A. P.; Cesconetto, E. C.; Ramos, E. B.; Rocha, M. S.

2012-02-01

We propose a method to determine the DNA-cisplatin binding mechanism peculiarities by monitoring the mechanical properties of these complexes. To accomplish this task, we have performed single molecule stretching experiments by using optical tweezers, from which the persistence and contour lengths of the complexes can be promptly measured. The persistence length of the complexes as a function of the drug total concentration in the sample was used to deduce the binding data, from which we show that cisplatin binds cooperatively to the DNA molecule, a point which so far has not been stressed in binding equilibrium studies of this ligand.

Contactless experiments on individual DNA molecules show no evidence for molecular wire behavior.

PubMed

Gómez-Navarro, C; Moreno-Herrero, F; de Pablo, P J; Colchero, J; Gómez-Herrero, J; Baró, A M

2002-06-25

A fundamental requirement for a molecule to be considered a molecular wire (MW) is the ability to transport electrical charge with a reasonably low resistance. We have carried out two experiments that measure first, the charge transfer from an electrode to the molecule, and second, the dielectric response of the MW. The latter experiment requires no contacts to either end of the molecule. From our experiments we conclude that adsorbed individual DNA molecules have a resistivity similar to mica, glass, and silicon oxide substrates. Therefore adsorbed DNA is not a conductor, and it should not be considered as a viable candidate for MW applications. Parallel studies on other nanowires, including single-walled carbon nanotubes, showed conductivity as expected.

Simple horizontal magnetic tweezers for micromanipulation of single DNA molecules and DNA–protein complexes

PubMed Central

McAndrew, Christopher P.; Tyson, Christopher; Zischkau, Joseph; Mehl, Patrick; Tuma, Pamela L.; Pegg, Ian L.; Sarkar, Abhijit

2016-01-01

We report the development of a simple-to-implement magnetic force transducer that can apply a wide range of piconewton (pN) scale forces on single DNA molecules and DNA–protein complexes in the horizontal plane. The resulting low-noise force-extension data enable very high-resolution detection of changes in the DNA tether’s extension: ~0.05 pN in force and <10 nm change in extension. We have also verified that we can manipulate DNA in near equilibrium conditions through the wide range of forces by ramping the force from low to high and back again, and observing minimal hysteresis in the molecule’s force response. Using a calibration technique based on Stokes’ drag law, we have confirmed our force measurements from DNA force-extension experiments obtained using the fluctuation-dissipation theorem applied to transverse fluctuations of the magnetic microsphere. We present data on the force-distance characteristics of a DNA molecule complexed with histones. The results illustrate how the tweezers can be used to study DNA binding proteins at the single molecule level. PMID:26757808

Live-Cell Imaging of DNA Methylation Based on Synthetic-Molecule/Protein Hybrid Probe.

PubMed

Kumar, Naresh; Hori, Yuichiro; Kikuchi, Kazuya

2018-06-04

The epigenetic modification of DNA involves the conversion of cytosine to 5-methylcytosine, also known as DNA methylation. DNA methylation is important in modulating gene expression and thus, regulating genome and cellular functions. Recent studies have shown that aberrations in DNA methylation are associated with various epigenetic disorders or diseases including cancer. This stimulates great interest in the development of methods that can detect and visualize DNA methylation. For instance, fluorescent proteins (FPs) in conjugation with methyl-CpG-binding domain (MBD) have been employed for live-cell imaging of DNA methylation. However, the FP-based approach showed fluorescence signals for both the DNA-bound and -unbound states and thus differentiation between these states is difficult. Synthetic-molecule/protein hybrid probes can provide an alternative to overcome this restriction. In this article, we discuss the synthetic-molecule/protein hybrid probe that we developed recently for live-cell imaging of DNA methylation, which exhibited fluorescence enhancement only after binding to methylated DNA. © 2018 The Chemical Society of Japan & Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Analysis of DNA interactions using single-molecule force spectroscopy.

PubMed

Ritzefeld, Markus; Walhorn, Volker; Anselmetti, Dario; Sewald, Norbert

2013-06-01

Protein-DNA interactions are involved in many biochemical pathways and determine the fate of the corresponding cell. Qualitative and quantitative investigations on these recognition and binding processes are of key importance for an improved understanding of biochemical processes and also for systems biology. This review article focusses on atomic force microscopy (AFM)-based single-molecule force spectroscopy and its application to the quantification of forces and binding mechanisms that lead to the formation of protein-DNA complexes. AFM and dynamic force spectroscopy are exciting tools that allow for quantitative analysis of biomolecular interactions. Besides an overview on the method and the most important immobilization approaches, the physical basics of the data evaluation is described. Recent applications of AFM-based force spectroscopy to investigate DNA intercalation, complexes involving DNA aptamers and peptide- and protein-DNA interactions are given.

An integrated optics microfluidic device for detecting single DNA molecules.

PubMed

Krogmeier, Jeffrey R; Schaefer, Ian; Seward, George; Yantz, Gregory R; Larson, Jonathan W

2007-12-01

A fluorescence-based integrated optics microfluidic device is presented, capable of detecting single DNA molecules in a high throughput and reproducible manner. The device integrates microfluidics for DNA stretching with two optical elements for single molecule detection (SMD): a plano-aspheric refractive lens for fluorescence excitation (illuminator) and a solid parabolic reflective mirror for fluorescence collection (collector). Although miniaturized in size, both optical components were produced and assembled onto the microfluidic device by readily manufacturable fabrication techniques. The optical resolution of the device is determined by the small and relatively low numerical aperture (NA) illuminator lens (0.10 effective NA, 4.0 mm diameter) that delivers excitation light to a diffraction limited 2.0 microm diameter spot at full width half maximum within the microfluidic channel. The collector (0.82 annular NA, 15 mm diameter) reflects the fluorescence over a large collection angle, representing 71% of a hemisphere, toward a single photon counting module in an infinity-corrected scheme. As a proof-of-principle experiment for this simple integrated device, individual intercalated lambda-phage DNA molecules (48.5 kb) were stretched in a mixed elongational-shear microflow, detected, and sized with a fluorescence signal to noise ratio of 9.9 +/-1.0. We have demonstrated that SMD does not require traditional high numerical aperture objective lenses and sub-micron positioning systems conventionally used in many applications. Rather, standard manufacturing processes can be combined in a novel way that promises greater accessibility and affordability for microfluidic-based single molecule applications.

Homebuilt single-molecule scanning confocal fluorescence microscope studies of single DNA/protein interactions.

PubMed

Zheng, Haocheng; Goldner, Lori S; Leuba, Sanford H

2007-03-01

Many technical improvements in fluorescence microscopy over the years have focused on decreasing background and increasing the signal to noise ratio (SNR). The scanning confocal fluorescence microscope (SCFM) represented a major improvement in these efforts. The SCFM acquires signal from a thin layer of a thick sample, rejecting light whose origin is not in the focal plane thereby dramatically decreasing the background signal. A second major innovation was the advent of high quantum-yield, low noise, single-photon counting detectors. The superior background rejection of SCFM combined with low-noise, high-yield detectors makes it possible to detect the fluorescence from single-dye molecules. By labeling a DNA molecule or a DNA/protein complex with a donor/acceptor dye pair, fluorescence resonance energy transfer (FRET) can be used to track conformational changes in the molecule/complex itself, on a single molecule/complex basis. In this methods paper, we describe the core concepts of SCFM in the context of a study that uses FRET to reveal conformational fluctuations in individual Holliday junction DNA molecules and nucleosomal particles. We also discuss data processing methods for SCFM.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules.

PubMed

Li, Yueqi; Xiang, Limin; Palma, Julio L; Asai, Yoshihiro; Tao, Nongjian

2016-04-15

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models.

Synthetic-Molecule/Protein Hybrid Probe with Fluorogenic Switch for Live-Cell Imaging of DNA Methylation.

PubMed

Hori, Yuichiro; Otomura, Norimichi; Nishida, Ayuko; Nishiura, Miyako; Umeno, Maho; Suetake, Isao; Kikuchi, Kazuya

2018-02-07

Hybrid probes consisting of synthetic molecules and proteins are powerful tools for detecting biological molecules and signals in living cells. To date, most targets of the hybrid probes have been limited to pH and small analytes. Although biomacromolecules are essential to the physiological function of cells, the hybrid-probe-based approach has been scarcely employed for live-cell detection of biomacromolecules. Here, we developed a hybrid probe with a chemical switch for live-cell imaging of methylated DNA, an important macromolecule in the repression of gene expression. Using a protein labeling technique, we created a hybrid probe containing a DNA-binding fluorogen and a methylated-DNA-binding domain. The hybrid probe enhanced fluorescence intensity upon binding to methylated DNA and successfully monitored methylated DNA during mitosis. The hybrid probe offers notable advantages absent from probes based on small molecules or fluorescent proteins and is useful for live-cell analyses of epigenetic phenomena and diseases related to DNA methylation.

Design of stapled DNA-minor-groove-binding molecules with a mutable atom simulated annealing method

NASA Astrophysics Data System (ADS)

Walker, Wynn L.; Kopka, Mary L.; Dickerson, Richard E.; Goodsell, David S.

1997-11-01

We report the design of optimal linker geometries for the synthesis of stapledDNA-minor-groove-binding molecules. Netropsin, distamycin, and lexitropsinsbind side-by-side to mixed-sequence DNA and offer an opportunity for thedesign of sequence-reading molecules. Stapled molecules, with two moleculescovalently linked side-by-side, provide entropic gains and restrain theposition of one molecule relative to its neighbor. Using a free-atom simulatedannealing technique combined with a discrete mutable atom definition, optimallengths and atomic composition for covalent linkages are determined, and anovel hydrogen bond `zipper' is proposed to phase two molecules accuratelyside-by-side.

Mapping DNA polymerase errors by single-molecule sequencing

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lee, David F.; Lu, Jenny; Chang, Seungwoo

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Mapping DNA polymerase errors by single-molecule sequencing

DOE PAGES

Lee, David F.; Lu, Jenny; Chang, Seungwoo; ...

2016-05-16

Genomic integrity is compromised by DNA polymerase replication errors, which occur in a sequence-dependent manner across the genome. Accurate and complete quantification of a DNA polymerase's error spectrum is challenging because errors are rare and difficult to detect. We report a high-throughput sequencing assay to map in vitro DNA replication errors at the single-molecule level. Unlike previous methods, our assay is able to rapidly detect a large number of polymerase errors at base resolution over any template substrate without quantification bias. To overcome the high error rate of high-throughput sequencing, our assay uses a barcoding strategy in which each replicationmore » product is tagged with a unique nucleotide sequence before amplification. Here, this allows multiple sequencing reads of the same product to be compared so that sequencing errors can be found and removed. We demonstrate the ability of our assay to characterize the average error rate, error hotspots and lesion bypass fidelity of several DNA polymerases.« less

Crystal Structure of Mycobacterium tuberculosis H37Rv AldR (Rv2779c), a Regulator of the ald Gene: DNA BINDING AND IDENTIFICATION OF SMALL MOLECULE INHIBITORS.

PubMed

Dey, Abhishek; Shree, Sonal; Pandey, Sarvesh Kumar; Tripathi, Rama Pati; Ramachandran, Ravishankar

2016-06-03

Here we report the crystal structure of M. tuberculosis AldR (Rv2779c) showing that the N-terminal DNA-binding domains are swapped, forming a dimer, and four dimers are assembled into an octamer through crystal symmetry. The C-terminal domain is involved in oligomeric interactions that stabilize the oligomer, and it contains the effector-binding sites. The latter sites are 30-60% larger compared with homologs like MtbFFRP (Rv3291c) and can consequently accommodate larger molecules. MtbAldR binds to the region upstream to the ald gene that is highly up-regulated in nutrient-starved tuberculosis models and codes for l-alanine dehydrogenase (MtbAld; Rv2780). Further, the MtbAldR-DNA complex is inhibited upon binding of Ala, Tyr, Trp and Asp to the protein. Studies involving a ligand-binding site G131T mutant show that the mutant forms a DNA complex that cannot be inhibited by adding the amino acids. Comparative studies suggest that binding of the amino acids changes the relative spatial disposition of the DNA-binding domains and thereby disrupt the protein-DNA complex. Finally, we identified small molecules, including a tetrahydroquinoline carbonitrile derivative (S010-0261), that inhibit the MtbAldR-DNA complex. The latter molecules represent the very first inhibitors of a feast/famine regulatory protein from any source and set the stage for exploring MtbAldR as a potential anti-tuberculosis target. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Rolling Circle Amplification For Spatially Directed Synthesis Of A Solid Phase Anchored Single-Stranded DNA Molecule

NASA Astrophysics Data System (ADS)

Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.

2006-09-01

In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.

Linearisation of λDNA molecules by instantaneous variation of the trapping electrode voltage inside a micro-channel

NASA Astrophysics Data System (ADS)

Hanasaki, Itsuo; Yukimoto, Naoya; Uehara, Satoshi; Shintaku, Hirofumi; Kawano, Satoyuki

2015-04-01

Because long DNA molecules usually exist in random coil states due to the entropic effect, linearisation is required for devices equipped with nanopores where electrical sequencing is necessary during single-file translocation. We present a novel technique for linearising DNA molecules in a micro-channel. In our device, electrodes are embedded in the bottom surface of the channel. The application of a voltage induces the trapping of λDNA molecules on the positive electrode. An instantaneous voltage drop is used to put the λDNA molecules in a partly released state and the hydrodynamic force of the solution induces linearisation. Phenomena were directly observed using an optical microscopy system equipped with a high-speed camera and the linearisation principle was explored in detail. Furthermore, we estimate the tensile characteristics produced by the flow of the solution through a numerical model of a tethered polymer subject to a Poiseuille flow. The mean tensile force is in the range of 0.1-1 pN. This is sufficiently smaller than the structural transition point of λDNA but counterbalances the entropic elasticity that causes the random coil shape of λDNA molecules in solution. We show the important role of thermal fluctuation in the manipulation of molecules in solution and clarify the tensile conditions required for DNA linearisation using a combination of solution flow and voltage variation in a microchannel.

DNA Origami Directed Au Nanostar Dimers for Single-Molecule Surface-Enhanced Raman Scattering.

PubMed

Tanwar, Swati; Haldar, Krishna Kanta; Sen, Tapasi

2017-12-06

We demonstrate the synthesis of Au nanostar dimers with tunable interparticle gap and controlled stoichiometry assembled on DNA origami. Au nanostars with uniform and sharp tips were immobilized on rectangular DNA origami dimerized structures to create nanoantennas containing monomeric and dimeric Au nanostars. Single Texas red (TR) dye was specifically attached in the junction of the dimerized origami to act as a Raman reporter molecule. The SERS enhancement factors of single TR dye molecules located in the conjunction region in dimer structures having interparticle gaps of 7 and 13 nm are 2 × 10 10 and 8 × 10 9 , respectively, which are strong enough for single analyte detection. The highly enhanced electromagnetic field generated by the plasmon coupling between sharp tips and cores of two Au nanostars in the wide conjunction region allows the accommodation and specific detection of large biomolecules. Such DNA-directed assembled nanoantennas with controlled interparticle separation distance and stoichiometry, and well-defined geometry, can be used as excellent substrates in single-molecule SERS spectroscopy and will have potential applications as a reproducible platform in single-molecule sensing.

Molecule counting with alkanethiol and DNA immobilized on gold microplates for extended gate FET.

PubMed

Cao, Zhong; Xiao, Zhong-Liang; Zhang, Ling; Luo, Dong-Mei; Kamahori, Masao; Shimoda, Maki

2013-04-01

Several molecule counting methods based on electrochemical characterization of alkanethiol and thiolated single-stranded oligonucleotide (HS-ssDNA) immobilized on gold microplates, which were used as extended gates of field effect transistors (FETs), have been investigated in this paper. The surface density of alkanethiol and DNA monolayers on gold microplates were quantitatively evaluated from the reductive desorption charge by using cyclic voltammetry (CV) and fast CV (FCV) methods in strong alkali solution. Typically, the surface density of 6-hydroxy-1-hexanethiol (6-HHT) was evaluated to be 4.639 molecules/nm(2), and the 28 base-pair dsDNA about 1.226-4.849 molecules/100 nm(2) on Au microplates after post-treatment with 6-HHT. The behaviors on surface potential and capacitance of different aminoalkanethiols on Au microplates were measured in 0.1 mol/L Na2SO4 and 10 mmol/L Tris-HCl (pH=7.4) solutions, indicating that the surface potential increases and the double-layer capacitance decreases with the length of carbon chain increased for the thiol monolayers, which obey a physics relationship for a capacitor. Comparably, a simple sensing method based on the electronic signals of biochemical reaction events on DNA immobilization and hybridization at the Au surface of the extended gate FET (EGFET) was developed, with which the surface density of the hybridized dsDNA on the gold surface of the EGFET was evaluated to be 1.36 molecules per 100 nm(2), showing that the EGFET is a promising sensing biochip for DNA molecule counting. Copyright © 2012 Elsevier B.V. All rights reserved.

Butyric acid - a well-known molecule revisited.

PubMed

Borycka-Kiciak, Katarzyna; Banasiewicz, Tomasz; Rydzewska, Grażyna

2017-01-01

The properties of butyric acid, and the role it plays in the gastrointestinal tract, have been known for many years. However, the newest research shows that butyric acid still remains a molecule with a potential that has not as yet been fully exploited. The article provides an outline of relevant up-to-date knowledge about butyric acid, and presents the expert position on the clinical benefits of using butyric acid products in the therapy of gastrointestinal diseases.

Thermoelectric effect and its dependence on molecular length and sequence in single DNA molecules

PubMed Central

Li, Yueqi; Xiang, Limin; Palma, Julio L.; Asai, Yoshihiro; Tao, Nongjian

2016-01-01

Studying the thermoelectric effect in DNA is important for unravelling charge transport mechanisms and for developing relevant applications of DNA molecules. Here we report a study of the thermoelectric effect in single DNA molecules. By varying the molecular length and sequence, we tune the charge transport in DNA to either a hopping- or tunnelling-dominated regimes. The thermoelectric effect is small and insensitive to the molecular length in the hopping regime. In contrast, the thermoelectric effect is large and sensitive to the length in the tunnelling regime. These findings indicate that one may control the thermoelectric effect in DNA by varying its sequence and length. We describe the experimental results in terms of hopping and tunnelling charge transport models. PMID:27079152

Single-Molecule Encoders for Tracking Motor Proteins on DNA

NASA Astrophysics Data System (ADS)

Lipman, Everett A.

2012-02-01

Devices such as inkjet printers and disk drives track position and velocity using optical encoders, which produce periodic signals precisely synchronized with linear or rotational motion. We have implemented this technique at the nanometer scale by labeling DNA with regularly spaced fluorescent dyes. The resulting molecular encoders can be used in several ways for high-resolution continuous tracking of individual motor proteins. These measurements do not require mechanical coupling to macroscopic instrumentation, are automatically calibrated by the underlying structure of DNA, and depend on signal periodicity rather than absolute level. I will describe the synthesis of single-molecule encoders, data from and modeling of experiments on a helicase and a DNA polymerase, and some ideas for future work.

Sensitive and inexpensive digital DNA analysis by microfluidic enrichment of rolling circle amplified single-molecules.

PubMed

Kühnemund, Malte; Hernández-Neuta, Iván; Sharif, Mohd Istiaq; Cornaglia, Matteo; Gijs, Martin A M; Nilsson, Mats

2017-05-05

Single molecule quantification assays provide the ultimate sensitivity and precision for molecular analysis. However, most digital analysis techniques, i.e. droplet PCR, require sophisticated and expensive instrumentation for molecule compartmentalization, amplification and analysis. Rolling circle amplification (RCA) provides a simpler means for digital analysis. Nevertheless, the sensitivity of RCA assays has until now been limited by inefficient detection methods. We have developed a simple microfluidic strategy for enrichment of RCA products into a single field of view of a low magnification fluorescent sensor, enabling ultra-sensitive digital quantification of nucleic acids over a dynamic range from 1.2 aM to 190 fM. We prove the broad applicability of our analysis platform by demonstrating 5-plex detection of as little as ∼1 pg (∼300 genome copies) of pathogenic DNA with simultaneous antibiotic resistance marker detection, and the analysis of rare oncogene mutations. Our method is simpler, more cost-effective and faster than other digital analysis techniques and provides the means to implement digital analysis in any laboratory equipped with a standard fluorescent microscope. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

Featured Molecules: Ascorbic Acid and Methylene Blue

NASA Astrophysics Data System (ADS)

Coleman, William F.; Wildman, Randall J.

2003-05-01

The WebWare molecules of the month for May are featured in several articles in this issue. "Arsenic: Not So Evil After All?" discusses the pharmaceutical uses of methylene blue and its development as the first synthetic drug used against a specific disease. The JCE Classroom Activity "Out of the Blue" and the article "Greening the Blue Bottle" feature methylene blue and ascorbic acid as two key ingredients in the formulation of the blue bottle. You can also see a colorful example of these two molecules in action on the cover. "Sailing on the 'C': A Vitamin Titration with a Twist" describes an experiment to determine the vitamin C (ascorbic acid) content of citrus fruits and challenges students, as eighteenth-century sea captains, to decide the best fruit to take on a long voyage. Fully manipulable (Chime) versions of these and other molecules are available at Only@JCE Online.

Selective inhibition of c-Myc/Max dimerization and DNA binding by small molecules.

PubMed

Kiessling, Anke; Sperl, Bianca; Hollis, Angela; Eick, Dirk; Berg, Thorsten

2006-07-01

bZip and bHLHZip protein family members comprise a large fraction of eukaryotic transcription factors and need to bind DNA in order to exert most of their fundamental biological roles. Their binding to DNA requires homo- or heterodimerization via alpha-helical domains, which generally do not contain obvious binding sites for small molecules. We have identified two small molecules, dubbed Mycro1 and Mycro2, which inhibit the protein-protein interactions between the bHLHZip proteins c-Myc and Max. Mycros are the first inhibitors of c-Myc/Max dimerization, which have been demonstrated to inhibit DNA binding of c-Myc with preference over other dimeric transcription factors in vitro. Mycros inhibit c-Myc-dependent proliferation, gene transcription, and oncogenic transformation in the low micromolar concentration range. Our data support the idea that dimeric transcription factors can be druggable even in the absence of obvious small-molecule binding pockets.

Separation of large DNA molecules by applying pulsed electric field to size exclusion chromatography-based microchip

NASA Astrophysics Data System (ADS)

Azuma, Naoki; Itoh, Shintaro; Fukuzawa, Kenji; Zhang, Hedong

2018-02-01

Through electrophoresis driven by a pulsed electric field, we succeeded in separating large DNA molecules with an electrophoretic microchip based on size exclusion chromatography (SEC), which was proposed in our previous study. The conditions of the pulsed electric field required to achieve the separation were determined by numerical analyses using our originally proposed separation model. From the numerical results, we succeeded in separating large DNA molecules (λ DNA and T4 DNA) within 1600 s, which was approximately half of that achieved under a direct electric field in our previous study. Our SEC-based electrophoresis microchip will be one of the effective tools to meet the growing demand of faster and more convenient separation of large DNA molecules, especially in the field of epidemiological research of infectious diseases.

Discrimination among individual Watson–Crick base pairs at the termini of single DNA hairpin molecules

PubMed Central

Vercoutere, Wenonah A.; Winters-Hilt, Stephen; DeGuzman, Veronica S.; Deamer, David; Ridino, Sam E.; Rodgers, Joseph T.; Olsen, Hugh E.; Marziali, Andre; Akeson, Mark

2003-01-01

Nanoscale α-hemolysin pores can be used to analyze individual DNA or RNA molecules. Serial examination of hundreds to thousands of molecules per minute is possible using ionic current impedance as the measured property. In a recent report, we showed that a nanopore device coupled with machine learning algorithms could automatically discriminate among the four combinations of Watson–Crick base pairs and their orientations at the ends of individual DNA hairpin molecules. Here we use kinetic analysis to demonstrate that ionic current signatures caused by these hairpin molecules depend on the number of hydrogen bonds within the terminal base pair, stacking between the terminal base pair and its nearest neighbor, and 5′ versus 3′ orientation of the terminal bases independent of their nearest neighbors. This report constitutes evidence that single Watson–Crick base pairs can be identified within individual unmodified DNA hairpin molecules based on their dynamic behavior in a nanoscale pore. PMID:12582251

Charge transport properties of DNA aperiodic molecule: The role of interbase hopping in Watson-Crick base pair

NASA Astrophysics Data System (ADS)

Sinurat, E. N.; Yudiarsah, E.

2017-07-01

The charge transport properties of DNA aperiodic molecule has been studied by considering various interbase hopping parameter on Watson-Crick base pair. 32 base pairs long double-stranded DNA aperiodic model with sequence GCTAGTACGTGACGTAGCTAGGATATGCCTGA on one chain and its complement on the other chain is used. Transfer matrix method has been used to calculate transmission probabilities, for determining I-V characteristic using Landauer Büttiker formula. DNA molecule is modeled using tight binding hamiltonian combined with the theory of Slater-Koster. The result show, the increment of Watson-Crick hopping value leads to the transmission probabilities and current of DNA aperiodic molecule increases.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2013-03-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with embedded pore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a pore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We demonstrate that we can optically detect successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule. Furthermore, electrical measurements through the nanopore are performed, indicating that DNA sensing is feasible using the nanochannel-nanopore device.

Single molecule analysis of Thermus thermophilus SSB protein dynamics on single-stranded DNA.

PubMed

Zhang, Jichuan; Zhou, Ruobo; Inoue, Jin; Mikawa, Tsutomu; Ha, Taekjip

2014-04-01

Single-stranded (ss) DNA binding (SSB) proteins play central roles in DNA replication, recombination and repair in all organisms. We previously showed that Escherichia coli (Eco) SSB, a homotetrameric bacterial SSB, undergoes not only rapid ssDNA-binding mode transitions but also one-dimensional diffusion (or migration) while remaining bound to ssDNA. Whereas the majority of bacterial SSB family members function as homotetramers, dimeric SSB proteins were recently discovered in a distinct bacterial lineage of extremophiles, the Thermus-Deinococcus group. Here we show, using single-molecule fluorescence resonance energy transfer (FRET), that homodimeric bacterial SSB from Thermus thermophilus (Tth) is able to diffuse spontaneously along ssDNA over a wide range of salt concentrations (20-500 mM NaCl), and that TthSSB diffusion can help transiently melt the DNA hairpin structures. Furthermore, we show that two TthSSB molecules undergo transitions among different DNA-binding modes while remaining bound to ssDNA. Our results extend our previous observations on homotetrameric SSBs to homodimeric SSBs, indicating that the dynamic features may be shared among different types of SSB proteins. These dynamic features of SSBs may facilitate SSB redistribution and removal on/from ssDNA, and help recruit other SSB-interacting proteins onto ssDNA for subsequent DNA processing in DNA replication, recombination and repair.

Hydration of nucleic acid fragments: comparison of theory and experiment for high-resolution crystal structures of RNA, DNA, and DNA-drug complexes.

PubMed Central

Hummer, G; García, A E; Soumpasis, D M

1995-01-01

A computationally efficient method to describe the organization of water around solvated biomolecules is presented. It is based on a statistical mechanical expression for the water-density distribution in terms of particle correlation functions. The method is applied to analyze the hydration of small nucleic acid molecules in the crystal environment, for which high-resolution x-ray crystal structures have been reported. Results for RNA [r(ApU).r(ApU)] and DNA [d(CpG).d(CpG) in Z form and with parallel strand orientation] and for DNA-drug complexes [d(CpG).d(CpG) with the drug proflavine intercalated] are described. A detailed comparison of theoretical and experimental data shows positional agreement for the experimentally observed water sites. The presented method can be used for refinement of the water structure in x-ray crystallography, hydration analysis of nuclear magnetic resonance structures, and theoretical modeling of biological macromolecules such as molecular docking studies. The speed of the computations allows hydration analyses of molecules of almost arbitrary size (tRNA, protein-nucleic acid complexes, etc.) in the crystal environment and in aqueous solution. Images FIGURE 1 FIGURE 2 FIGURE 5 FIGURE 6 FIGURE 9 FIGURE 12 FIGURE 13 PMID:7542034

Interaction of cationic surfactants with DNA: a single-molecule study

PubMed Central

Husale, Sudhir; Grange, Wilfried; Karle, Marc; Bürgi, Stephan; Hegner, Martin

2008-01-01

The interaction of cationic surfactants with single dsDNA molecules has been studied using force-measuring optical tweezers. For hydrophobic chains of length 12 and greater, pulling experiments show characteristic features (e.g. hysteresis between the pulling and relaxation curves, force-plateau along the force curves), typical of a condensed phase (compaction of a long DNA into a micron-sized particle). Depending on the length of the hydrophobic chain of the surfactant, we observe different mechanical behaviours of the complex (DNA-surfactants), which provide evidence for different binding modes. Taken together, our measurements suggest that short-chain surfactants, which do not induce any condensation, could lie down on the DNA surface and directly interact with the DNA grooves through hydrophobic–hydrophobic interactions. In contrast, long-chain surfactants could have their aliphatic tails pointing away from the DNA surface, which could promote inter-molecular interactions between hydrophobic chains and subsequently favour DNA condensation. PMID:18203749

Counterion accumulation effects on a suspension of DNA molecules: Equation of state and pressure-driven denaturation

NASA Astrophysics Data System (ADS)

Nicasio-Collazo, Luz Adriana; Delgado-González, Alexandra; Hernández-Lemus, Enrique; Castañeda-Priego, Ramón

2017-04-01

The study of the effects associated with the electrostatic properties of DNA is of fundamental importance to understand both its molecular properties at the single molecule level, like the rigidity of the chain, and its interaction with other charged bio-molecules, including other DNA molecules; such interactions are crucial to maintain the thermodynamic stability of the intra-cellular medium. In the present work, we combine the Poisson-Boltzmann mean-field theory with an irreversible thermodynamic approximation to analyze the effects of counterion accumulation inside DNA on both the denaturation profile of the chain and the equation of state of the suspension. To this end, we model the DNA molecule as a porous charged cylinder immersed in an aqueous solution. These thermo-electrostatic effects are explicitly studied in the particular case of some genes for which damage in their sequence is associated with diffuse large B-cell lymphoma.

Probing the dynamics of restriction endonuclease NgoMIV-DNA interaction by single-molecule FRET.

PubMed

Tutkus, Marijonas; Sasnauskas, Giedrius; Rutkauskas, Danielis

2017-12-01

Many type II restriction endonucleases require two copies of their recognition sequence for optimal activity. Concomitant binding of two DNA sites by such an enzyme produces a DNA loop. Here we exploit single-molecule Förster resonance energy transfer (smFRET) of surface-immobilized DNA fragments to study the dynamics of DNA looping induced by tetrameric endonuclease NgoMIV. We have employed a DNA fragment with two NgoMIV recognition sites and a FRET dye pair such that upon protein-induced DNA looping the dyes are brought to close proximity resulting in a FRET signal. The dynamics of DNA-NgoMIV interactions proved to be heterogeneous, with individual smFRET trajectories exhibiting broadly different average looped state durations. Distinct types of the dynamics were attributed to different types of DNA-protein complexes, mediated either by one NgoMIV tetramer simultaneously bound to two specific sites ("slow" trajectories) or by semi-specific interactions of two DNA-bound NgoMIV tetramers ("fast" trajectories), as well as to conformational heterogeneity of individual NgoMIV molecules. © 2017 Wiley Periodicals, Inc.

A pliable electroporation patch (ep-Patch) for efficient delivery of nucleic acid molecules into animal tissues with irregular surface shapes.

PubMed

Wei, Zewen; Huang, Yuanyu; Zhao, Deyao; Hu, Zhiyuan; Li, Zhihong; Liang, Zicai

2015-01-05

Delivery of nucleic acids into animal tissues by electroporation is an appealing approach for various types of gene therapy, but efficiency of existing methodsis not satisfactory. Here we present the validation of novel electroporation patch (ep-Patch) for efficient delivery of DNA and siRNA into mouse tissues. Using micromachining technology, closely spaced gold electrodes were made on the pliable parylene substrate to form a patch-like electroporation metrics. It enabled large coverage of the target tissues and close surface contact between the tissues and electrodes, thus providing a uniform electric field to deliver nucleic acids into tissues, even beneath intact skin. Using this ep-Patch for efficiently delivery of both DNA and siRNA, non-invasive electroporation of healthy mouse muscle tissue was successfully achieved. Delivery of these nucleic acids was performed to intact tumors with satisfactory results. Silencing of tumor genes using the ep-Patch was also demonstrated on mice. This pliable electroporation patch method constitutes a novel way of in vivo delivery of siRNA and DNA to certain tissues or organs to circumvent the disadvantages of existing methodologies for in vivo delivery of nucleic acid molecules.

A mushroom-derived amino acid, ergothioneine, is a potential inhibitor of inflammation-related DNA halogenation.

PubMed

Asahi, Takashi; Wu, Xiaohong; Shimoda, Hiroshi; Hisaka, Shinsuke; Harada, Etsuko; Kanno, Tomomi; Nakamura, Yoshimasa; Kato, Yoji; Osawa, Toshihiko

2016-01-01

Myeloperoxidase (MPO)-generated halogenating molecules, such as hypochlorous acid and hypobromous acid (HOBr), in inflammatory regions are postulated to contribute to disease progression. In this study, we showed that ergothioneine (EGT), derived from an edible mushroom, inhibited MPO activity as well as the formation of 8-bromo-2'-deoxyguanosine in vitro. The HOBr scavenging effect of EGT is higher than those of ascorbic acid and glutathione. We initially observed that the administration of Coprinus comatus, an edible mushroom containing a high amount of EGT, inhibited the UV-B-induced inflammatory responses and DNA halogenation, suggesting that EGT is a promising anti-inflammatory agent from mushrooms.

Nanochannel Device with Embedded Nanopore: a New Approach for Single-Molecule DNA Analysis and Manipulation

NASA Astrophysics Data System (ADS)

Zhang, Yuning; Reisner, Walter

2012-02-01

Nanopore and nanochannel based devices are robust methods for biomolecular sensing and single DNA manipulation. Nanopore-based DNA sensing has attractive features that make it a leading candidate as a single-molecule DNA sequencing technology. Nanochannel based extension of DNA, combined with enzymatic or denaturation-based barcoding schemes, is already a powerful approach for genome analysis. We believe that there is revolutionary potential in devices that combine nanochannels with nanpore detectors. In particular, due to the fast translocation of a DNA molecule through a standard nanopore configuration, there is an unfavorable trade-off between signal and sequence resolution. With a combined nanochannel-nanopore device, based on embedding a nanopore inside a nanochannel, we can in principle gain independent control over both DNA translocation speed and sensing signal, solving the key draw-back of the standard nanopore configuration. We will discuss our recent progress on device fabrication and characterization. In particular, we demonstrate that we can detect - using fluorescent microscopy - successful translocation of DNA from the nanochannel out through the nanopore, a possible method to 'select' a given barcode for further analysis. In particular, we show that in equilibrium DNA will not escape through an embedded sub-persistence length nanopore, suggesting that the embedded pore could be used as a nanoscale window through which to interrogate a nanochannel extended DNA molecule.

Mechanisms of DNA disentangling by type II topoisomerases. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Yan, Jie

2016-09-01

In this article [1] Dr. Vologodskii presents a comprehensive discussion on the mechanisms by which the type II topoisomerases unknot/disentangle DNA molecules. It is motivated by a mysterious capability of the nanometer-size enzymes to keep the steady-state probability of DNA entanglement/knot almost two orders of magnitude below that expected from thermal equilibrium [2-5]. In spite of obvious functional advantages of the enzymes, it raises a question regarding how such high efficiency could be achieved. The off-equilibrium steady state distribution of DNA topology is powered by ATP consumption. However, it remains unclear how this energy is utilized to bias the distribution toward disentangled/unknotted topological states of DNA.

Development of a reference material of a single DNA molecule for the quality control of PCR testing.

PubMed

Mano, Junichi; Hatano, Shuko; Futo, Satoshi; Yoshii, Junji; Nakae, Hiroki; Naito, Shigehiro; Takabatake, Reona; Kitta, Kazumi

2014-09-02

We developed a reference material of a single DNA molecule with a specific nucleotide sequence. The double-strand linear DNA which has PCR target sequences at the both ends was prepared as a reference DNA molecule, and we named the PCR targets on each side as confirmation sequence and standard sequence. The highly diluted solution of the reference molecule was dispensed into 96 wells of a plastic PCR plate to make the average number of molecules in a well below one. Subsequently, the presence or absence of the reference molecule in each well was checked by real-time PCR targeting for the confirmation sequence. After an enzymatic treatment of the reaction mixture in the positive wells for the digestion of PCR products, the resultant solution was used as the reference material of a single DNA molecule with the standard sequence. PCR analyses revealed that the prepared samples included only one reference molecule with high probability. The single-molecule reference material developed in this study will be useful for the absolute evaluation of a detection limit of PCR-based testing methods, the quality control of PCR analyses, performance evaluations of PCR reagents and instruments, and the preparation of an accurate calibration curve for real-time PCR quantitation.

Amino acid sequence of bovine muzzle epithelial desmocollin derived from cloned cDNA: a novel subtype of desmosomal cadherins.

PubMed

Koch, P J; Goldschmidt, M D; Walsh, M J; Zimbelmann, R; Schmelz, M; Franke, W W

1991-05-01

Desmosomes are cell-type-specific intercellular junctions found in epithelium, myocardium and certain other tissues. They consist of assemblies of molecules involved in the adhesion of specific cell types and in the anchorage of cell-type-specific cytoskeletal elements, the intermediate-size filaments, to the plasma membrane. To explore the individual desmosomal components and their functions we have isolated DNA clones encoding the desmosomal glycoprotein, desmocollin, using antibodies and a cDNA expression library from bovine muzzle epithelium. The cDNA-deduced amino-acid sequence of desmocollin (presently we cannot decide to which of the two desmocollins, DC I or DC II, this clone relates) defines a polypeptide with a calculated molecular weight of 85,000, with a single candidate sequence of 24 amino acids sufficiently long for a transmembrane arrangement, and an extracellular aminoterminal portion of 561 amino acid residues, compared to a cytoplasmic part of only 176 amino acids. Amino acid sequence comparisons have revealed that desmocollin is highly homologous to members of the cadherin family of cell adhesion molecules, including the previously sequenced desmoglein, another desmosome-specific cadherin. Using riboprobes derived from cDNAs for Northern-blot analyses, we have identified an mRNA of approximately 6 kb in stratified epithelia such as muzzle epithelium and tongue mucosa but not in two epithelial cell culture lines containing desmosomes and desmoplakins. The difference may indicate drastic differences in mRNA concentration or the existence of cell-type-specific desmocollin subforms. The molecular topology of desmocollin(s) is discussed in relation to possible functions of the individual molecular domains.

Protection of DNA against low-energy electrons by amino acids: a first-principles molecular dynamics study.

PubMed

Gu, Bin; Smyth, Maeve; Kohanoff, Jorge

2014-11-28

Using first-principles molecular dynamics simulations, we have investigated the notion that amino acids can play a protective role when DNA is exposed to excess electrons produced by ionizing radiation. In this study we focus on the interaction of glycine with the DNA nucleobase thymine. We studied thymine-glycine dimers and a condensed phase model consisting of one thymine molecule solvated in amorphous glycine. Our results show that the amino acid acts as a protective agent for the nucleobase in two ways. If the excess electron is initially captured by the thymine, then a proton is transferred in a barrier-less way from a neighboring hydrogen-bonded glycine. This stabilizes the excess electron by reducing the net partial charge on the thymine. In the second mechanism the excess electron is captured by a glycine, which acts as a electron scavenger that prevents electron localization in DNA. Both these mechanisms introduce obstacles to further reactions of the excess electron within a DNA strand, e.g. by raising the free energy barrier associated with strand breaks.

Amino Acid Racemization and the Preservation of Ancient DNA

NASA Technical Reports Server (NTRS)

Poinar, Hendrik N.; Hoss, Matthias

1996-01-01

The extent of racemization of aspartic acid, alanine, and leucine provides criteria for assessing whether ancient tissue samples contain endogenous DNA. In samples in which the D/L ratio of aspartic acid exceeds 0.08, ancient DNA sequences could not be retrieved. Paleontological finds from which DNA sequences purportedly millions of years old have been reported show extensive racemization, and the amino acids present are mainly contaminates. An exception is the amino acids in some insects preserved in amber.

Single Molecule Study of DNA Organization and Recombination

NASA Astrophysics Data System (ADS)

Xiao, Botao

We have studied five projects related to DNA organization and recombination using mainly single molecule force-spectroscopy and statistical tools. First, HU is one of the most abundant DNA-organizing proteins in bacterial chromosomes and participates in gene regulation. We report experiments that study the dependence of DNA condensation by HU on force, salt and HU concentration. A first important result is that at physiological salt levels, HU only bends DNA, resolving a previous paradox of why a chromosome-compacting protein should have a DNA-stiffening function. A second major result is quantitative demonstration of strong dependencies of HU-DNA dissociation on both salt concentration and force. Second, we have used a thermodynamic Maxwell relation to count proteins driven off large DNAs by tension, an effect important to understanding DNA organization. Our results compare well with estimates of numbers of proteins HU and Fis in previous studies. We have also shown that a semi-flexible polymer model describes our HU experimental data well. The force-dependent binding suggests mechano-chemical mechanisms for gene regulation. Third, the elusive role of protein H1 in chromatin has been clarified with purified H1 and Xenopus extracts. We find that H1 compacts DNA by both bending and looping. Addition of H1 enhances chromatin formation and maintains the plasticity of the chromatin. Fourth, the topology and mechanics of DNA twisting are critical to DNA organization and recombination. We have systematically measured DNA extension as a function of linking number density from 0.08 to -2 with holding forces from 0.2 to 2.4 pN. Unlike previous proposals, the DNA extension decreases with negative linking number. Finally, DNA recombination is a dynamic process starting from enzyme-DNA binding. We report that the Int-DBD domain of lambda integrase binds to DNA without compaction at low Int-DBD concentration. High concentration of Int-DBD loops DNA below a threshold force

Nucleic Acid Nanostructures: Bottom-Up Control of Geometry on the Nanoscale

PubMed Central

Seeman, Nadrian C.; Lukeman, Philip S.

2012-01-01

DNA may seem an unlikely molecule from which to build nanostructures, but this is not correct. The specificity of interaction that enables DNA to function so successfully as genetic material also enables its use as a smart molecule for construction on the nanoscale. The key to using DNA for this purpose is the design of stable branched molecules, which expand its ability to interact specifically with other nucleic acid molecules. The same interactions used by genetic engineers can be used to make cohesive interactions with other DNA molecules that lead to a variety of new species. Branched DNA molecules are easy to design, and the can assume a variety of structural motifs. These can be used for purposes both of specific construction, such as polyhedra, and for the assembly of topological targets. A variety of two-dimensional periodic arrays with specific patterns have been made. DNA nanomechanical devices have been built with a series of different triggers, small molecules, nucleic acid molecules and proteins. Recently, progress has been made in self-replication of DNA nano-constructs, and in the scaffolding of other species into DNA arrangements. PMID:25152542

A lab-on-chip for biothreat detection using single-molecule DNA mapping.

PubMed

Meltzer, Robert H; Krogmeier, Jeffrey R; Kwok, Lisa W; Allen, Richard; Crane, Bryan; Griffis, Joshua W; Knaian, Linda; Kojanian, Nanor; Malkin, Gene; Nahas, Michelle K; Papkov, Vyacheslav; Shaikh, Saad; Vyavahare, Kedar; Zhong, Qun; Zhou, Yi; Larson, Jonathan W; Gilmanshin, Rudolf

2011-03-07

Rapid, specific, and sensitive detection of airborne bacteria, viruses, and toxins is critical for biodefense, yet the diverse nature of the threats poses a challenge for integrated surveillance, as each class of pathogens typically requires different detection strategies. Here, we present a laboratory-on-a-chip microfluidic device (LOC-DLA) that integrates two unique assays for the detection of airborne pathogens: direct linear analysis (DLA) with unsurpassed specificity for bacterial threats and Digital DNA for toxins and viruses. The LOC-DLA device also prepares samples for analysis, incorporating upstream functions for concentrating and fractionating DNA. Both DLA and Digital DNA assays are single molecule detection technologies, therefore the assay sensitivities depend on the throughput of individual molecules. The microfluidic device and its accompanying operation protocols have been heavily optimized to maximize throughput and minimize the loss of analyzable DNA. We present here the design and operation of the LOC-DLA device, demonstrate multiplex detection of rare bacterial targets in the presence of 100-fold excess complex bacterial mixture, and demonstrate detection of picogram quantities of botulinum toxoid.

Studies on the accessibility of deoxyribonucleic acid in deoxyribonucleoprotein to cationic molecules

PubMed Central

Itzhaki, Ruth F.

1971-01-01

The binding of deoxyribonucleoprotein to Toluidine Blue, to cetylpyridinium chloride and to polylysine of various molecular weights was studied to determine the percentage of free DNA phosphate groups in deoxyribonucleoprotein. Binding was measured by addition of these reagents to deoxyribonucleoprotein at a range of concentrations such that complete precipitation of the deoxyribonucleoprotein occurred. With Toluidine Blue the binding corresponded to about 48% of the DNA phosphates in deoxyribonucleoprotein. The dye did not cause appreciable displacement of protein from the DNA. With cetylpyridinium chloride the binding corresponded to about 41% of the DNA phosphates. With polylysine preparations of molecular weight 1250 and 7790 the binding values for deoxyribonucleoprotein were 46 and 38% respectively. The results suggest that the free phosphates lie in stretches sufficiently long to accommodate most of each polylysine molecule. With polylysine of molecular weight 62000 cross-linking of free stretches of DNA on different deoxyribonucleoprotein molecules probably occurs. It is concluded that although most of the free phosphates are probably `hidden' beneath covering histone, corresponding perhaps to runs of non-basic residues in the latter, they are surprisingly accessible to very large molecules. The relevance of this finding to the problem of gene repression is discussed. PMID:5166331

Single-molecule comparison of DNA Pol I activity with native and analog nucleotides

NASA Astrophysics Data System (ADS)

Gul, Osman; Olsen, Tivoli; Choi, Yongki; Corso, Brad; Weiss, Gregory; Collins, Philip

2014-03-01

DNA polymerases are critical enzymes for DNA replication, and because of their complex catalytic cycle they are excellent targets for investigation by single-molecule experimental techniques. Recently, we studied the Klenow fragment (KF) of DNA polymerase I using a label-free, electronic technique involving single KF molecules attached to carbon nanotube transistors. The electronic technique allowed long-duration monitoring of a single KF molecule while processing thousands of template strands. Processivity of up to 42 nucleotide bases was directly observed, and statistical analysis of the recordings determined key kinetic parameters for the enzyme's open and closed conformations. Subsequently, we have used the same technique to compare the incorporation of canonical nucleotides like dATP to analogs like 1-thio-2'-dATP. The analog had almost no affect on duration of the closed conformation, during which the nucleotide is incorporated. On the other hand, the analog increased the rate-limiting duration of the open conformation by almost 40%. We propose that the thiolated analog interferes with KF's recognition and binding, two key steps that determine its ensemble turnover rate.

NALDB: nucleic acid ligand database for small molecules targeting nucleic acid.

PubMed

Kumar Mishra, Subodh; Kumar, Amit

2016-01-01

Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php. © The Author(s) 2016. Published by Oxford University Press.

NALDB: nucleic acid ligand database for small molecules targeting nucleic acid

PubMed Central

Kumar Mishra, Subodh; Kumar, Amit

2016-01-01

Nucleic acid ligand database (NALDB) is a unique database that provides detailed information about the experimental data of small molecules that were reported to target several types of nucleic acid structures. NALDB is the first ligand database that contains ligand information for all type of nucleic acid. NALDB contains more than 3500 ligand entries with detailed pharmacokinetic and pharmacodynamic information such as target name, target sequence, ligand 2D/3D structure, SMILES, molecular formula, molecular weight, net-formal charge, AlogP, number of rings, number of hydrogen bond donor and acceptor, potential energy along with their Ki, Kd, IC50 values. All these details at single platform would be helpful for the development and betterment of novel ligands targeting nucleic acids that could serve as a potential target in different diseases including cancers and neurological disorders. With maximum 255 conformers for each ligand entry, our database is a multi-conformer database and can facilitate the virtual screening process. NALDB provides powerful web-based search tools that make database searching efficient and simplified using option for text as well as for structure query. NALDB also provides multi-dimensional advanced search tool which can screen the database molecules on the basis of molecular properties of ligand provided by database users. A 3D structure visualization tool has also been included for 3D structure representation of ligands. NALDB offers an inclusive pharmacological information and the structurally flexible set of small molecules with their three-dimensional conformers that can accelerate the virtual screening and other modeling processes and eventually complement the nucleic acid-based drug discovery research. NALDB can be routinely updated and freely available on bsbe.iiti.ac.in/bsbe/naldb/HOME.php. Database URL: http://bsbe.iiti.ac.in/bsbe/naldb/HOME.php PMID:26896846

Methods of introducing nucleic acids into cellular DNA

DOEpatents

Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.

2017-06-27

A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.

Molecular threading: mechanical extraction, stretching and placement of DNA molecules from a liquid-air interface.

PubMed

Payne, Andrew C; Andregg, Michael; Kemmish, Kent; Hamalainen, Mark; Bowell, Charlotte; Bleloch, Andrew; Klejwa, Nathan; Lehrach, Wolfgang; Schatz, Ken; Stark, Heather; Marblestone, Adam; Church, George; Own, Christopher S; Andregg, William

2013-01-01

We present "molecular threading", a surface independent tip-based method for stretching and depositing single and double-stranded DNA molecules. DNA is stretched into air at a liquid-air interface, and can be subsequently deposited onto a dry substrate isolated from solution. The design of an apparatus used for molecular threading is presented, and fluorescence and electron microscopies are used to characterize the angular distribution, straightness, and reproducibility of stretched DNA deposited in arrays onto elastomeric surfaces and thin membranes. Molecular threading demonstrates high straightness and uniformity over length scales from nanometers to micrometers, and represents an alternative to existing DNA deposition and linearization methods. These results point towards scalable and high-throughput precision manipulation of single-molecule polymers.

Cloning and expression of cDNA coding for bouganin.

PubMed

den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo

2002-03-01

Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.

Single-molecule study of DNA unlinking by eukaryotic and prokaryotic type-II topoisomerases

PubMed Central

Charvin, G.; Bensimon, D.; Croquette, V.

2003-01-01

Type-II topoisomerases are responsible for untangling DNA during replication by removing supercoiled and interlinked DNA structures. Using a single-molecule micromanipulation setup, we follow the real-time decatenation of two mechanically braided DNA molecules by Drosophila melanogaster topoisomerase (Topo) II and Escherichia coli Topo IV. Although Topo II relaxes left-handed (L) and right-handed (R-) braids similarly at a rate of ≈2.9 s–1, Topo IV has a marked preference for L-braids, which it relaxes completely and processively at a rate of ≈2.4 s–1. However, Topo IV can unlink R-braids at about half that rate when they supercoil to form L-plectonemes. These results imply that the preferred substrate for unlinking by Topo IV has the symmetry of an L-crossing and shed new light on the decatenation of daughter strands during DNA replication, which are usually assumed to be linked in an R-braid. PMID:12902541

Butyric acid – a well-known molecule revisited

PubMed Central

Banasiewicz, Tomasz; Rydzewska, Grażyna

2017-01-01

The properties of butyric acid, and the role it plays in the gastrointestinal tract, have been known for many years. However, the newest research shows that butyric acid still remains a molecule with a potential that has not as yet been fully exploited. The article provides an outline of relevant up-to-date knowledge about butyric acid, and presents the expert position on the clinical benefits of using butyric acid products in the therapy of gastrointestinal diseases. PMID:28702095

Diffusion of isolated DNA molecules: dependence on length and topology.

PubMed

Robertson, Rae M; Laib, Stephan; Smith, Douglas E

2006-05-09

The conformation and dynamics of circular polymers is a subject of considerable theoretical and experimental interest. DNA is an important example because it occurs naturally in different topological states, including linear, relaxed circular, and supercoiled circular forms. A fundamental question is how the diffusion coefficients of isolated polymers scale with molecular length and how they vary for different topologies. Here, diffusion coefficients D for relaxed circular, supercoiled, and linear DNA molecules of length L ranging from approximately 6 to 290 kbp were measured by tracking the Brownian motion of single molecules. A topology-independent scaling law D approximately L(-nu) was observed with nu(L) = 0.571 +/- 0.014, nu(C) = 0.589 +/- 0.018, and nu(S) = 0.571 +/- 0.057 for linear, relaxed circular, and supercoiled DNA, respectively, in good agreement with the scaling exponent of nu congruent with 0.588 predicted by renormalization group theory for polymers with significant excluded volume interactions. Our findings thus provide evidence in support of several theories that predict an effective diameter of DNA much greater than the Debye screening length. In addition, the measured ratio D(Circular)/D(Linear) = 1.32 +/- 0.014 was closer to the value of 1.45 predicted by using renormalization group theory than the value of 1.18 predicted by classical Kirkwood hydrodynamic theory and agreed well with a value of 1.31 predicted when incorporating a recently proposed expression for the radius of gyration of circular polymers into the Zimm model.

Development of a simulation method for dynamics of electrons ejected from DNA molecules irradiated with X-rays.

PubMed

Kai, Takeshi; Higuchi, Mariko; Fujii, Kentaro; Watanabe, Ritsuko; Yokoya, Akinari

2012-12-01

To develop a method for simulating the dynamics of the photoelectrons and Auger electrons ejected from DNA molecules irradiated with pulsed monochromatic X-rays. A 30-base-pair (bp) DNA molecule was used as the target model, and the X-rays were assumed to have a Gaussian-shaped time distribution. Photoionization and Auger decay were considered as the atomic processes. The atoms from which the photoelectrons or Auger electrons were emitted were specified in the DNA molecule (or DNA ion) using the Monte Carlo method, and the trajectory of each electron in the electric field formed around the positively charged DNA molecule was calculated with a Newtonian equation. The kinetics of the electrons produced by irradiation with X-rays at an intensity ranging from 1 × 10(12) to 1 × 10(16) photons/mm(2) and energies of 380 eV (below the carbon K-edge), 435 eV (above the nitrogen K-edge), and 560 eV (above the oxygen K-edge) were evaluated. It was found that at an X-ray intensity of 1 × 10(14) photons/mm(2) or less, all the produced electrons escaped from the target. However, above an X-ray intensity of 1 × 10(15) photons/mm(2) and an energy of 560 eV, some photoelectrons that were ejected from the oxygen atoms were trapped near the target DNA. A simulation method for studying the trajectories of electrons ejected from a 30-bp DNA molecule irradiated with pulsed monochromatic X-rays has been developed. The present results show that electron dynamics are strongly dependent on the charged density induced in DNA by pulsed X-ray irradiation.

DNA-Based Applications in Nanobiotechnology

PubMed Central

Abu-Salah, Khalid M.; Ansari, Anees A.; Alrokayan, Salman A.

2010-01-01

Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated. PMID:20652049

DNA-based applications in nanobiotechnology.

PubMed

Abu-Salah, Khalid M; Ansari, Anees A; Alrokayan, Salman A

2010-01-01

Biological molecules such as deoxyribonucleic acid (DNA) have shown great potential in fabrication and construction of nanostructures and devices. The very properties that make DNA so effective as genetic material also make it a very suitable molecule for programmed self-assembly. The use of DNA to assemble metals or semiconducting particles has been extended to construct metallic nanowires and functionalized nanotubes. This paper highlights some important aspects of conjugating the unique physical properties of dots or wires with the remarkable recognition capabilities of DNA which could lead to miniaturizing biological electronics and optical devices, including biosensors and probes. Attempts to use DNA-based nanocarriers for gene delivery are discussed. In addition, the ecological advantages and risks of nanotechnology including DNA-based nanobiotechnology are evaluated.

Antimicrobial activities, DNA interactions, spectroscopic (FT-IR and UV-Vis) characterizations, and DFT calculations for pyridine-2-carboxylic acid and its derivates

NASA Astrophysics Data System (ADS)

Tamer, Ömer; Tamer, Sevil Arabacı; İdil, Önder; Avcı, Davut; Vural, Hatice; Atalay, Yusuf

2018-01-01

In this paper, pyridine- 2- carboxylic acid, also known as picolinic acid (pic), and its two derivate, 4- methoxy-pyridine- 2- carboxylic acid (4-Mpic) and 4- chloro-pyridine- 2- carboxylic acid (4-Clpic) have been characterized by FT-IR and UV-Vis spectroscopy techniques as well as DFT calculations. B3LYP level of Density Functional Theory (DFT) method was used to obtain ground state geometries, vibration wavenumbers, first order hyperpolarizabilities and molecular electrostatic potential (MEP) surfaces for pic, 4Clpic and 4Mpic. The electronic absorption wavelengths and HOMO-LUMO energies were investigated by time dependent B3LYP (TD-B3LYP) level with the conductor-like polarizable continuum model (CPCM). The effects of Cl atom and OCH3 group on HOMO-LUMO energy gaps and first order hyperpolarizability parameters of pic, 4Clpic and 4Mpic molecules were examined. All molecules were screened for their antibacterial activities against Gram-positive and Gram-negative bacteria and for their antifungal activities against yeast strains by using minimal inhibitory concentration method (MIC). All compounds (pic, 4Mpic and 4Clpic) have been found to be very active against to the Gram (+) and Gram (-) bacteria. The DNA interactions of pic, 4Clpic and 4Mpic were analyzed by molecular docking simulations, and the interaction of the 4Mpic molecule with DNA is found to be higher than 4Clpic and pic.

Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.

PubMed

Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay

2014-05-01

The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.

A DNA Crystal Designed to Contain Two Molecules per Asymmetric Unit

DOE Office of Scientific and Technical Information (OSTI.GOV)

T Wang; R Sha; J Birktoft

2011-12-31

We describe the self-assembly of a DNA crystal that contains two tensegrity triangle molecules per asymmetric unit. We have used X-ray crystallography to determine its crystal structure. In addition, we have demonstrated control over the colors of the crystals by attaching either Cy3 dye (pink) or Cy5 dye (blue-green) to the components of the crystal, yielding crystals of corresponding colors. Attaching the pair of dyes to the pair of molecules yields a purple crystal.

[Microspeciation of amphoteric molecules of unusual acid-base properties].

PubMed

Kóczián, Kristóf

2007-01-01

The phisico-chemical properties of bio- and drug molecules greatly influence their interactions in the body and strongly effect the mechanism of drug action. Among these properties, macroscopic and site-specific protonation constants are of crucial importance. Latter one is the tool to calculate the relative concentration of the various microspecies in the compartments of the body at different pH values, and also, it is the versatile parameter to improve the pharmacokinetic properties of a new molecule in a particular family of drugs. In the present thesis work, the microspeciation of three molecules of great pharmaceutical importance and unusual acid-base properties, were carried out. The microconstants of tenoxicam, the non-steroidal anti-inflammatory drug, were described, introducing a novel deductive method using Hammett constants. For this purpose, a total of 8 tenoxicam and piroxicam derivatives were synthesised. To the best of our knowledge, the log k(N)O microconstant of tenoxicam obtained thus is the lowest enolate basicity value, which, however, can be well explained by the effects of the intramolecular environment. The developed evaluation procedure is suitable for microconstant determination of compounds in other molecule families. Besides, prodrug-type compounds and analogues similar to the structures of selective COX-2 isoenzyme inhibitors were synthesised. The other two molecules studied, the 6-aminopenicillanic acid and 7-cephalosporanic acid, the core molecules of the two most important beta-lactam antibiotic-types were derivatised and investigated by 1D and 2D NMR techniques. The NMR-pH titration on the parent compounds and their ester derivatives, combined with in situ pH-measurements allowed the microspeciation of these easily decomposing molecules. One of the protonation constant of 7-ACA (log kN(O) = 4.12), to the best of our knowledge, is the least non-aromatic basic amino-site among the natural compounds.

DNA-encoded chemical libraries: advancing beyond conventional small-molecule libraries.

PubMed

Franzini, Raphael M; Neri, Dario; Scheuermann, Jörg

2014-04-15

DNA-encoded chemical libraries (DECLs) represent a promising tool in drug discovery. DECL technology allows the synthesis and screening of chemical libraries of unprecedented size at moderate costs. In analogy to phage-display technology, where large antibody libraries are displayed on the surface of filamentous phage and are genetically encoded in the phage genome, DECLs feature the display of individual small organic chemical moieties on DNA fragments serving as amplifiable identification barcodes. The DNA-tag facilitates the synthesis and allows the simultaneous screening of very large sets of compounds (up to billions of molecules), because the hit compounds can easily be identified and quantified by PCR-amplification of the DNA-barcode followed by high-throughput DNA sequencing. Several approaches have been used to generate DECLs, differing both in the methods used for library encoding and for the combinatorial assembly of chemical moieties. For example, DECLs can be used for fragment-based drug discovery, displaying a single molecule on DNA or two chemical moieties at the extremities of complementary DNA strands. DECLs can vary substantially in the chemical structures and the library size. While ultralarge libraries containing billions of compounds have been reported containing four or more sets of building blocks, also smaller libraries have been shown to be efficient for ligand discovery. In general, it has been found that the overall library size is a poor predictor for library performance and that the number and diversity of the building blocks are rather important indicators. Smaller libraries consisting of two to three sets of building blocks better fulfill the criteria of drug-likeness and often have higher quality. In this Account, we present advances in the DECL field from proof-of-principle studies to practical applications for drug discovery, both in industry and in academia. DECL technology can yield specific binders to a variety of target

Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths

PubMed Central

Gül, O. Tolga; Pugliese, Kaitlin M.; Choi, Yongki; Sims, Patrick C.; Pan, Deng; Rajapakse, Arith J.; Weiss, Gregory A.; Collins, Philip G.

2016-01-01

As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein’s activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF’s base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures. PMID:27348011

Single Molecule Bioelectronics and Their Application to Amplification-Free Measurement of DNA Lengths.

PubMed

Gül, O Tolga; Pugliese, Kaitlin M; Choi, Yongki; Sims, Patrick C; Pan, Deng; Rajapakse, Arith J; Weiss, Gregory A; Collins, Philip G

2016-06-24

As biosensing devices shrink smaller and smaller, they approach a scale in which single molecule electronic sensing becomes possible. Here, we review the operation of single-enzyme transistors made using single-walled carbon nanotubes. These novel hybrid devices transduce the motions and catalytic activity of a single protein into an electronic signal for real-time monitoring of the protein's activity. Analysis of these electronic signals reveals new insights into enzyme function and proves the electronic technique to be complementary to other single-molecule methods based on fluorescence. As one example of the nanocircuit technique, we have studied the Klenow Fragment (KF) of DNA polymerase I as it catalytically processes single-stranded DNA templates. The fidelity of DNA polymerases makes them a key component in many DNA sequencing techniques, and here we demonstrate that KF nanocircuits readily resolve DNA polymerization with single-base sensitivity. Consequently, template lengths can be directly counted from electronic recordings of KF's base-by-base activity. After measuring as few as 20 copies, the template length can be determined with <1 base pair resolution, and different template lengths can be identified and enumerated in solutions containing template mixtures.

A Small-Molecule Inhibitor of Human DNA Polymerase η Potentiates the Effects of Cisplatin in Tumor Cells.

PubMed

Zafar, Maroof K; Maddukuri, Leena; Ketkar, Amit; Penthala, Narsimha R; Reed, Megan R; Eddy, Sarah; Crooks, Peter A; Eoff, Robert L

2018-02-20

Translesion DNA synthesis (TLS) performed by human DNA polymerase eta (hpol η) allows tolerance of damage from cis-diamminedichloroplatinum(II) (CDDP or cisplatin). We have developed hpol η inhibitors derived from N-aryl-substituted indole barbituric acid (IBA), indole thiobarbituric acid (ITBA), and indole quinuclidine scaffolds and identified 5-((5-chloro-1-(naphthalen-2-ylmethyl)-1H-indol-3-yl)methylene)-2-thioxodihydropyrimidine-4,6(1H,5H)-dione (PNR-7-02), an ITBA derivative that inhibited hpol η activity with an IC 50 value of 8 μM and exhibited 5-10-fold specificity for hpol η over replicative pols. We conclude from kinetic analyses, chemical footprinting assays, and molecular docking that PNR-7-02 binds to a site on the little finger domain and interferes with the proper orientation of template DNA to inhibit hpol η. A synergistic increase in CDDP toxicity was observed in hpol η-proficient cells co-treated with PNR-7-02 (combination index values = 0.4-0.6). Increased γH2AX formation accompanied treatment of hpol η-proficient cells with CDDP and PNR-7-02. Importantly, PNR-7-02 did not impact the effect of CDDP on cell viability or γH2AX in hpol η-deficient cells. In summary, we observed hpol η-dependent effects on DNA damage/replication stress and sensitivity to CDDP in cells treated with PNR-7-02. The ability to employ a small-molecule inhibitor of hpol η to improve the cytotoxic effect of CDDP may aid in the development of more effective chemotherapeutic strategies.

DNA Dendrimer: An Efficient Nanocarrier of Functional Nucleic Acids for Intracellular Molecular Sensing

PubMed Central

2015-01-01

Functional nucleic acid (FNA)-based sensing systems have been developed for efficient detection of a wide range of biorelated analytes by employing DNAzymes or aptamers as recognition units. However, their intracellular delivery has always been a concern, mainly in delivery efficiency, kinetics, and the amount of delivered FNAs. Here we report a DNA dendrimer scaffold as an efficient nanocarrier to deliver FNAs and to conduct in situ monitoring of biological molecules in living cells. A histidine-dependent DNAzyme and an anti-ATP aptamer were chosen separately as the model FNAs to make the FNA dendrimer. The FNA-embedded DNA dendrimers maintained the catalytic activity of the DNAzyme or the aptamer recognition function toward ATP in the cellular environment, with no change in sensitivity or specificity. Moreover, these DNA dendrimeric nanocarriers show excellent biocompatibility, high intracellular delivery efficiency, and sufficient stability in a cellular environment. This FNA dendrimeric nanocarrier may find a broad spectrum of applications in biomedical diagnosis and therapy. PMID:24806614

Conformational transitions in DNA polymerase I revealed by single-molecule FRET

PubMed Central

Santoso, Yusdi; Joyce, Catherine M.; Potapova, Olga; Le Reste, Ludovic; Hohlbein, Johannes; Torella, Joseph P.; Grindley, Nigel D. F.; Kapanidis, Achillefs N.

2010-01-01

The remarkable fidelity of most DNA polymerases depends on a series of early steps in the reaction pathway which allow the selection of the correct nucleotide substrate, while excluding all incorrect ones, before the enzyme is committed to the chemical step of nucleotide incorporation. The conformational transitions that are involved in these early steps are detectable with a variety of fluorescence assays and include the fingers-closing transition that has been characterized in structural studies. Using DNA polymerase I (Klenow fragment) labeled with both donor and acceptor fluorophores, we have employed single-molecule fluorescence resonance energy transfer to study the polymerase conformational transitions that precede nucleotide addition. Our experiments clearly distinguish the open and closed conformations that predominate in Pol-DNA and Pol-DNA-dNTP complexes, respectively. By contrast, the unliganded polymerase shows a broad distribution of FRET values, indicating a high degree of conformational flexibility in the protein in the absence of its substrates; such flexibility was not anticipated on the basis of the available crystallographic structures. Real-time observation of conformational dynamics showed that most of the unliganded polymerase molecules sample the open and closed conformations in the millisecond timescale. Ternary complexes formed in the presence of mismatched dNTPs or complementary ribonucleotides show unique FRET species, which we suggest are relevant to kinetic checkpoints that discriminate against these incorrect substrates. PMID:20080740

Dissolving Hydroxyolite: A DNA Molecule into Its Hydroxyapatite Mold.

PubMed

Bertran, Oscar; Revilla-López, Guillermo; Casanovas, Jordi; Del Valle, Luis J; Turon, Pau; Puiggalí, Jordi; Alemán, Carlos

2016-05-04

In spite of the clinical importance of hydroxyapatite (HAp), the mechanism that controls its dissolution in acidic environments remains unclear. Knowledge of such a process is highly desirable to provide better understanding of different pathologies, as for example osteoporosis, and of the HAp potential as vehicle for gene delivery to replace damaged DNA. In this work, the mechanism of dissolution in acid conditions of HAp nanoparticles encapsulating double-stranded DNA has been investigated at the atomistic level using computer simulations. For this purpose, four consecutive (multi-step) molecular dynamics simulations, involving different temperatures and proton transfer processes, have been carried out. Results are consistent with a polynuclear decalcification mechanism in which proton transfer processes, from the surface to the internal regions of the particle, play a crucial role. In addition, the DNA remains protected by the mineral mold and transferred proton from both temperature and chemicals. These results, which indicate that biomineralization imparts very effective protection to DNA, also have important implications in other biomedical fields, as for example in the design of artificial bones or in the fight against osteoporosis by promoting the fixation of Ca(2+) ions. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Molecular traffic jams on DNA.

PubMed

Finkelstein, Ilya J; Greene, Eric C

2013-01-01

All aspects of DNA metabolism-including transcription, replication, and repair-involve motor enzymes that move along genomic DNA. These processes must all take place on chromosomes that are occupied by a large number of other proteins. However, very little is known regarding how nucleic acid motor proteins move along the crowded DNA substrates that are likely to exist in physiological settings. This review summarizes recent progress in understanding how DNA-binding motor proteins respond to the presence of other proteins that lie in their paths. We highlight recent single-molecule biophysical experiments aimed at addressing this question, with an emphasis placed on analyzing the single-molecule, ensemble biochemical, and in vivo data from a mechanistic perspective.

May the Best Molecule Win: Competition ESI Mass Spectrometry

PubMed Central

Laughlin, Sarah; Wilson, W. David

2015-01-01

Electrospray ionization mass spectrometry has become invaluable in the characterization of macromolecular biological systems such as nucleic acids and proteins. Recent advances in the field of mass spectrometry and the soft conditions characteristic of electrospray ionization allow for the investigation of non-covalent interactions among large biomolecules and ligands. Modulation of genetic processes through the use of small molecule inhibitors with the DNA minor groove is gaining attention as a potential therapeutic approach. In this review, we discuss the development of a competition method using electrospray ionization mass spectrometry to probe the interactions of multiple DNA sequences with libraries of minor groove binding molecules. Such an approach acts as a high-throughput screening method to determine important information including the stoichiometry, binding mode, cooperativity, and relative binding affinity. In addition to small molecule-DNA complexes, we highlight other applications in which competition mass spectrometry has been used. A competitive approach to simultaneously investigate complex interactions promises to be a powerful tool in the discovery of small molecule inhibitors with high specificity and for specific, important DNA sequences. PMID:26501262

DNA origami based Au-Ag-core-shell nanoparticle dimers with single-molecule SERS sensitivity

NASA Astrophysics Data System (ADS)

Prinz, J.; Heck, C.; Ellerik, L.; Merk, V.; Bald, I.

2016-03-01

DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled.DNA origami nanostructures are a versatile tool to arrange metal nanostructures and other chemical entities with nanometer precision. In this way gold nanoparticle dimers with defined distance can be constructed, which can be exploited as novel substrates for surface enhanced Raman scattering (SERS). We have optimized the size, composition and arrangement of Au/Ag nanoparticles to create intense SERS hot spots, with Raman enhancement up to 1010, which is sufficient to detect single molecules by Raman scattering. This is demonstrated using single dye molecules (TAMRA and Cy3) placed into the center of the nanoparticle dimers. In conjunction with the DNA origami nanostructures novel SERS substrates are created, which can in the future be applied to the SERS analysis of more complex biomolecular targets, whose position and conformation within the SERS hot spot can be precisely controlled. Electronic supplementary information (ESI) available: Additional information about materials and methods, designs of DNA origami templates, height profiles, additional SERS spectra, assignment of DNA

Channel Size Conversion of Phi29 DNA-Packaging Nanomotor for Discrimination of Single- and Double-Stranded Nucleic Acids

PubMed Central

Geng, Jia; Wang, Shaoying; Fang, Huaming; Guo, Peixuan

2013-01-01

Nanopores have been utilized to detect the conformation and dynamics of polymers, including DNA and RNA. Biological pores are extremely reproducible at the atomic level with uniform channel sizes. The channel of the bacterial virus phi29 DNA packaging motor is a natural conduit for the transportation of double-stranded DNA (dsDNA), and has the largest diameter among the well-studied biological channels. The larger channel facilitates translocation of dsDNA, and offers more space for further channel modification and conjugation. Interestingly, the relatively large wild type channel, which translocates dsDNA, cannot detect single-stranded nucleic acids (ssDNA or ssRNA) under the current experimental conditions. Herein, we reengineered this motor channel by removing the internal loop segment of the channel. The modification resulted in two classes of channels. One class was the same size as the wild type channel, while the other class had a cross-sectional area about 60% of the wild type. This smaller channel was able to detect the real-time translocation of single stranded nucleic acids at single-molecule level. While the wild type connector exhibited a one-way traffic property with respect to dsDNA translocation, the loop deleted connector was able to translocate ssDNA and ssRNA with equal competencies from both termini. This finding of size alterations in reengineered motor channels expands the potential application of the phi29 DNA packaging motor in nanomedicine, nanobiotechnology, and high-throughput single pore DNA sequencing. PMID:23488809

DNA methylation of amino acid transporter genes in the human placenta.

PubMed

Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K

2017-12-01

Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.

Sensitive and inexpensive digital DNA analysis by microfluidic enrichment of rolling circle amplified single-molecules

PubMed Central

Kühnemund, Malte; Hernández-Neuta, Iván; Sharif, Mohd Istiaq; Cornaglia, Matteo; Gijs, Martin A.M.

2017-01-01

Abstract Single molecule quantification assays provide the ultimate sensitivity and precision for molecular analysis. However, most digital analysis techniques, i.e. droplet PCR, require sophisticated and expensive instrumentation for molecule compartmentalization, amplification and analysis. Rolling circle amplification (RCA) provides a simpler means for digital analysis. Nevertheless, the sensitivity of RCA assays has until now been limited by inefficient detection methods. We have developed a simple microfluidic strategy for enrichment of RCA products into a single field of view of a low magnification fluorescent sensor, enabling ultra-sensitive digital quantification of nucleic acids over a dynamic range from 1.2 aM to 190 fM. We prove the broad applicability of our analysis platform by demonstrating 5-plex detection of as little as ∼1 pg (∼300 genome copies) of pathogenic DNA with simultaneous antibiotic resistance marker detection, and the analysis of rare oncogene mutations. Our method is simpler, more cost-effective and faster than other digital analysis techniques and provides the means to implement digital analysis in any laboratory equipped with a standard fluorescent microscope. PMID:28077562

Optimized catalytic DNA-cleaving ribozymes

NASA Technical Reports Server (NTRS)

Joyce, Gerald F. (Inventor)

1996-01-01

The present invention discloses nucleic acid enzymes capable of cleaving nucleic acid molecules, including single-stranded DNA, in a site-specific manner under physiologic conditions, as well as compositions including same. The present invention also discloses methods of making and using the disclosed enzymes and compositions.

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p: reinterpretation of recent single molecule experiments.

PubMed

Stigter, Dirk

2004-07-01

Brewer et al. (Biophys. J. 85 (2003) 2519-2524) have studied the compaction of dsDNA in a double flow cell by observing the extension of stained DNA tethered in buffer solutions with or without Abf2p. They use a Langmuir adsorption model in which one Abf2p molecule adsorbs on one site on the DNA, and the binding constant, K, is given as the ratio of the experimental rates of adsorption and desorption. This paper presents an improved interpretation. Instead of Langmuir adsorption we use the more appropriate McGhee-von Hippel (J. Mol. Biol. 86 (1974) 469-489) theory for the adsorption of large ligands to a one-dimensional lattice. We assume that each adsorbed molecule shortens the effective contour length of DNA by the foot print of Abf2p of 27 base pairs. When Abf2p adsorbs to DNA stretched in the flowing buffer solution, we account for a tension effect that decreases the adsorption rate and the binding constant by a factor of 2 to 4. The data suggest that the accessibility to Abf2p decreases significantly with increasing compaction of DNA, resulting in a lower adsorption rate and a lower binding constant. The kinetics reported by Brewer et al. (Biophys. J. 85 (2003) 2519-2524) lead to a binding constant K=3.6 x 10(6) M(-1) at the beginning, and to K=5 x 10(5) M(-1) near the end of a compaction run, more than an order of magnitude lower than the value K=2.57 x 10(7) M(-1) calculated by Brewer et al. (Biophys. J. 85 (2003) 2519-2524).

Organization of 'nanocrystal molecules' using DNA

NASA Astrophysics Data System (ADS)

Alivisatos, A. Paul; Johnsson, Kai P.; Peng, Xiaogang; Wilson, Troy E.; Loweth, Colin J.; Bruchez, Marcel P.; Schultz, Peter G.

1996-08-01

PATTERNING matter on the nanometre scale is an important objective of current materials chemistry and physics. It is driven by both the need to further miniaturize electronic components and the fact that at the nanometre scale, materials properties are strongly size-dependent and thus can be tuned sensitively1. In nanoscale crystals, quantum size effects and the large number of surface atoms influence the, chemical, electronic, magnetic and optical behaviour2-4. 'Top-down' (for example, lithographic) methods for nanoscale manipulation reach only to the upper end of the nanometre regime5; but whereas 'bottom-up' wet chemical techniques allow for the preparation of mono-disperse, defect-free crystallites just 1-10 nm in size6-10, ways to control the structure of nanocrystal assemblies are scarce. Here we describe a strategy for the synthesis of'nanocrystal molecules', in which discrete numbers of gold nanocrystals are organized into spatially defined structures based on Watson-Crick base-pairing interactions. We attach single-stranded DNA oligonucleotides of defined length and sequence to individual nanocrystals, and these assemble into dimers and trimers on addition of a complementary single-stranded DNA template. We anticipate that this approach should allow the construction of more complex two-and three-dimensional assemblies.

Anionic poly(amino acid)s dissolve F-actin and DNA bundles, enhance DNase activity, and reduce the viscosity of cystic fibrosis sputum.

PubMed

Tang, Jay X; Wen, Qi; Bennett, Andrew; Kim, Brian; Sheils, Catherine A; Bucki, Robert; Janmey, Paul A

2005-10-01

Bundles of F-actin and DNA present in the sputum of cystic fibrosis (CF) patients but absent from normal airway fluid contribute to the altered viscoelastic properties of sputum that inhibit clearance of infected airway fluid and exacerbate the pathology of CF. Previous strategies to remove these filamentous aggregates have focused on DNase to enzymatically depolymerize DNA to constituent monomers and gelsolin to sever F-actin to small fragments. The high densities of negative surface charge on DNA and F-actin suggest that the bundles of these filaments, which alone exhibit a strong electrostatic repulsion, may be stabilized by multivalent cations such as histones, antimicrobial peptides, and other positively charged molecules prevalent in airway fluid. This study reports that bundles of DNA or F-actin formed after addition of histone H1 or lysozyme are efficiently dissolved by soluble multivalent anions such as polymeric aspartate or glutamate. Addition of poly-aspartate or poly-glutamate also disperses DNA and actin-containing bundles in CF sputum and lowers the elastic moduli of these samples to levels comparable to those obtained after treatment with DNase I or gelsolin. Addition of poly-aspartic acid also increased DNase activity when added to samples containing DNA bundles formed with histone H1. When added to CF sputum, poly-aspartic acid significantly reduced the growth of bacteria, suggesting activation of endogenous antibacterial factors. These findings suggest that soluble multivalent anions have potential alone or in combination with other mucolytic agents to selectively dissociate the large bundles of charged biopolymers that form in CF sputum.

Design, synthesis and selection of DNA-encoded small-molecule libraries.

PubMed

Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A

2009-09-01

Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.

Amino Acid-Assisted Incorporation of Dye Molecules within Calcite Crystals.

PubMed

Marzec, Bartosz; Green, David C; Holden, Mark A; Coté, Alexander S; Ihli, Johannes; Khalid, Saba; Kulak, Alexander; Walker, Daniel; Tang, Chiu; Duffy, Dorothy M; Kim, Yi-Yeoun; Meldrum, Fiona C

2018-05-23

Biomineralisation processes invariably occur in the presence of multiple organic additives, which act in combination to give exceptional control over structures and properties. However, few synthetic studies have investigated the cooperative effects of soluble additives. This work addresses this challenge and focuses on the combined effects of amino acids and coloured dye molecules. The experiments demonstrate that strongly coloured calcite crystals only form in the presence of Brilliant Blue R (BBR) and four of the seventeen soluble amino acids, as compared with almost colourless crystals using the dye alone. The active amino acids are identified as those which themselves effectively occlude in calcite, suggesting a mechanism where they can act as chaperones for individual molecules or even aggregates of dyes molecules. These results provide new insight into crystal-additive interactions and suggest a novel strategy for generating materials with target properties. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

Effect of gold nanoparticle on stability of the DNA molecule: A study of molecular dynamics simulation.

PubMed

Izanloo, Cobra

2017-09-02

An understanding of the mechanism of DNA interactions with gold nanoparticles is useful in today medicine applications. We have performed a molecular dynamics simulation on a B-DNA duplex (CCTCAGGCCTCC) in the vicinity of a gold nanoparticle with a truncated octahedron structure composed of 201 gold atoms (diameter ∼1.8 nm) to investigate gold nanoparticle (GNP) effects on the stability of DNA. During simulation, the nanoparticle is closed to DNA and phosphate groups direct the particles into the major grooves of the DNA molecule. Because of peeling and untwisting states that are occur at end of DNA, the nucleotide base lies flat on the surface of GNP. The configuration entropy is estimated using the covariance matrix of atom-positional fluctuations for different bases. The results show that when a gold nanoparticle has interaction with DNA, entropy increases. The results of conformational energy and the hydrogen bond numbers for DNA indicated that DNA becomes unstable in the vicinity of a gold nanoparticle. The radial distribution function was calculated for water hydrogen-phosphate oxygen pairs. Almost for all nucleotide, the presence of a nanoparticle around DNA caused water molecules to be released from the DNA duplex and cations were close to the DNA.

Integration of single-molecule detection with magnetic separation for multiplexed detection of DNA glycosylases.

PubMed

Li, Chen-Chen; Zhang, Yan; Tang, Bo; Zhang, Chun-Yang

2018-06-05

We combine single-molecule detection with magnetic separation for simultaneous measurement of human 8-oxoG DNA glycosylase 1 (hOGG1) and uracil DNA glycosylase (UDG) based on excision repair-initiated endonuclease IV (Endo IV)-assisted signal amplification. This method can sensitively detect multiple DNA glycosylases, and it can be further applied for the simultaneous measurement of enzyme kinetic parameters and screening of both hOGG1 and UDG inhibitors.

Utilizing Molecular Dynamics ' Multipotent Methodologies to Measure Microscopic Motions of DNA Molecules: A Magniloquent Manuscript On DNA's Means and Mannerisms

NASA Astrophysics Data System (ADS)

Kingsland, Addie

DNA is an amazing molecule which is the basic template for all genetics. It is the primary molecule for storing biological information, and has many applications in nanotechnology. Double-stranded DNA may contain mismatched base pairs beyond the Watson-Crick pairs guanine-cytosine and adenine-thymine. To date, no one has found a physical property of base pair mismatches which describes the behavior of naturally occurring mismatch repair enzymes. Many materials properties of DNA are also unknown, for instance, when pulling DNA in different configurations, different energy differences are observed with no obvious reason why. DNA mismatches also affect their local environment, for instance changing the quantum yield of nearby azobenzene moieties. We utilize molecular dynamics computer simulations to study the structure and dynamics for both matched and mismatched base pairs, within both biological and materials contexts, and in both equilibrium and biased dynamics. We show that mismatched pairs shift further in the plane normal to the DNA strand and are more likely to exhibit non-canonical structures, including the e-motif. Base pair mismatches alter their local environment, affecting the trans- to cis- photoisomerization quantum yield of azobenzene, as well as increasing the likelihood of observing the e-motif. We also show that by using simulated data, we can give new insights on theoretical models to calculate the energetics of pulling DNA strands apart. These results, all relatively inexpensive on modern computer hardware, can help guide the design of DNA-based nanotechnologies, as well as give new insights into the functioning of mismatch repair systems in cancer prevention.

DNA Molecules in Microfluidic Oscillatory Flow

PubMed Central

Chen, Y.-L.; Graham, M.D.; de Pablo, J.J.; Jo, K.; Schwartz, D.C.

2008-01-01

The conformation and dynamics of a single DNA molecule undergoing oscillatory pressure-driven flow in microfluidic channels is studied using Brownian dynamics simulations, accounting for hydrodynamic interactions between segments in the bulk and between the chain and the walls. Oscillatory flow provides a scenario under which the polymers may remain in the channel for an indefinite amount of time as they are stretched and migrate away from the channel walls. We show that by controlling the chain length, flow rate and oscillatory flow frequency, we are able to manipulate the chain extension and the chain migration from the channel walls. The chain stretch and the chain depletion layer thickness near the wall are found to increase as the Weissenberg number increases and as the oscillatory frequency decreases. PMID:19057656

Deoxyribonucleic acid (DNA)-based optical materials

NASA Astrophysics Data System (ADS)

Grote, James G.; Heckman, Emily M.; Hagen, Joshua A.; Yaney, Perry P.; Subramanyam, Guru; Clarson, Stephen J.; Diggs, Darnell E.; Nelson, Robert L.; Zetts, John S.; Hopkins, F. Kenneth; Ogata, Naoya

2004-12-01

Optical materials for waveguiding applications must possess the desired optical and electromagnetic properties for optimal device performance. Purified deoxyribonucleic acid (DNA), derived from salmon sperm, has been investigated for use as an optical waveguide material. In this paper we present the materials processing and optical and electromagnetic characterization of this purified DNA to render a high quality, low loss optical waveguide material.

Screening by imaging: scaling up single-DNA-molecule analysis with a novel parabolic VA-TIRF reflector and noise-reduction techniques.

PubMed

van 't Hoff, Marcel; Reuter, Marcel; Dryden, David T F; Oheim, Martin

2009-09-21

Bacteriophage lambda-DNA molecules are frequently used as a scaffold to characterize the action of single proteins unwinding, translocating, digesting or repairing DNA. However, scaling up such single-DNA-molecule experiments under identical conditions to attain statistically relevant sample sizes remains challenging. Additionally the movies obtained are frequently noisy and difficult to analyse with any precision. We address these two problems here using, firstly, a novel variable-angle total internal reflection fluorescence (VA-TIRF) reflector composed of a minimal set of optical reflective elements, and secondly, using single value decomposition (SVD) to improve the signal-to-noise ratio prior to analysing time-lapse image stacks. As an example, we visualize under identical optical conditions hundreds of surface-tethered single lambda-DNA molecules, stained with the intercalating dye YOYO-1 iodide, and stretched out in a microcapillary flow. Another novelty of our approach is that we arrange on a mechanically driven stage several capillaries containing saline, calibration buffer and lambda-DNA, respectively, thus extending the approach to high-content, high-throughput screening of single molecules. Our length measurements of individual DNA molecules from noise-reduced kymograph images using SVD display a 6-fold enhanced precision compared to raw-data analysis, reaching approximately 1 kbp resolution. Combining these two methods, our approach provides a straightforward yet powerful way of collecting statistically relevant amounts of data in a semi-automated manner. We believe that our conceptually simple technique should be of interest for a broader range of single-molecule studies, well beyond the specific example of lambda-DNA shown here.

Folic acid deficiency increases delayed neuronal death, DNA damage, platelet endothelial cell adhesion molecule-1 immunoreactivity, and gliosis in the hippocampus after transient cerebral ischemia.

PubMed

Hwang, In Koo; Yoo, Ki-Yeon; Suh, Hong-Won; Kim, Young Sup; Kwon, Dae Young; Kwon, Young-Guen; Yoo, Jun-Hyun; Won, Moo-Ho

2008-07-01

Folic acid deficiency increases stroke risk. In the present study, we examined whether folic acid deficiency enhances neuronal damage and gliosis via oxidative stress in the gerbil hippocampus after transient forebrain ischemia. Animals were exposed to a folic acid-deficient diet (FAD) for 3 months and then subjected to occlusion of both common carotid arteries for 5 min. Exposure to an FAD increased plasma homocysteine levels by five- to eightfold compared with those of animals fed with a control diet (CD). In CD-treated animals, most neurons were dead in the hippocampal CA1 region 4 days after ischemia/reperfusion, whereas, in FAD-treated animals, this occurred 3 days after ischemia/reperfusion. Immunostaining for 8-hydroxy-2'-deoxyguanosine (8-OHdG) was performed to examine DNA damage in CA1 neurons in both groups after ischemia, and it was found that 8-OHdG immunoreactivity in both FAD and CD groups peaked at 12 hr after reperfusion, although the immunoreactivity in the FAD group was much greater than that in the CD group. Platelet endothelial cell adhesion molecule-1 (PECAM-1; a final mediator of neutrophil transendothelial migration) immunoreactivity in both groups increased with time after ischemia/reperfusion: Its immunoreactivity in the FAD group was much higher than that in the CD group 3 days after ischemia/reperfusion. In addition, reactive gliosis in the ischemic CA1 region increased with time after ischemia in both groups, but astrocytosis and microgliosis in the FAD group were more severe than in the CD group at all times after ischemia. Our results suggest that folic acid deficiency enhances neuronal damage induced by ischemia. 2008 Wiley-Liss, Inc.

Single molecule photobleaching (SMPB) technology for counting of RNA, DNA, protein and other molecules in nanoparticles and biological complexes by TIRF instrumentation.

PubMed

Zhang, Hui; Guo, Peixuan

2014-05-15

Direct counting of biomolecules within biological complexes or nanomachines is demanding. Single molecule counting using optical microscopy is challenging due to the diffraction limit. The single molecule photobleaching (SMPB) technology for direct counting developed by our team (Shu et al., 2007 [18]; Zhang et al., 2007 [19]) offers a simple and straightforward method to determine the stoichiometry of molecules or subunits within biocomplexes or nanomachines at nanometer scales. Stoichiometry is determined by real-time observation of the number of descending steps resulted from the photobleaching of individual fluorophore. This technology has now been used extensively for single molecule counting of protein, RNA, and other macromolecules in a variety of complexes or nanostructures. Here, we elucidate the SMPB technology, using the counting of RNA molecules within a bacteriophage phi29 DNA-packaging biomotor as an example. The method described here can be applied to the single molecule counting of other molecules in other systems. The construction of a concise, simple and economical single molecule total internal reflection fluorescence (TIRF) microscope combining prism-type and objective-type TIRF is described. The imaging system contains a deep-cooled sensitive EMCCD camera with single fluorophore detection sensitivity, a laser combiner for simultaneous dual-color excitation, and a Dual-View™ imager to split the multiple outcome signals to different detector channels based on their wavelengths. Methodology of the single molecule photobleaching assay used to elucidate the stoichiometry of RNA on phi29 DNA packaging motor and the mechanism of protein/RNA interaction are described. Different methods for single fluorophore labeling of RNA molecules are reviewed. The process of statistical modeling to reveal the true copy number of the biomolecules based on binomial distribution is also described. Copyright © 2014 Elsevier Inc. All rights reserved.

Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL.

PubMed

Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H; Mao, Hanbin

2014-05-01

Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120-180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. © 2014 The Author(s). Published by Oxford University Press [on behalf of Nucleic Acids Research].

Effect of genomic long-range correlations on DNA persistence length: from theory to single molecule experiments.

PubMed

Moukhtar, Julien; Faivre-Moskalenko, Cendrine; Milani, Pascale; Audit, Benjamin; Vaillant, Cedric; Fontaine, Emeline; Mongelard, Fabien; Lavorel, Guillaume; St-Jean, Philippe; Bouvet, Philippe; Argoul, Françoise; Arneodo, Alain

2010-04-22

Sequence dependency of DNA intrinsic bending properties has been emphasized as a possible key ingredient to in vivo chromatin organization. We use atomic force microscopy (AFM) in air and liquid to image intrinsically straight (synthetic), uncorrelated (hepatitis C RNA virus) and persistent long-range correlated (human) DNA fragments in various ionic conditions such that the molecules freely equilibrate on the mica surface before being captured in a particular conformation. 2D thermodynamic equilibrium is experimentally verified by a detailed statistical analysis of the Gaussian nature of the DNA bend angle fluctuations. We show that the worm-like chain (WLC) model, commonly used to describe the average conformation of long semiflexible polymers, reproduces remarkably well the persistence length estimates for the first two molecules as consistently obtained from (i) mean square end-to-end distance measurement and (ii) mean projection of the end-to-end vector on the initial orientation. Whatever the operating conditions (air or liquid, concentration of metal cations Mg(2+) and/or Ni(2+)), the persistence length found for the uncorrelated viral DNA underestimates the value obtained for the straight DNA. We show that this systematic difference is the signature of the presence of an uncorrelated structural intrinsic disorder in the hepatitis C virus (HCV) DNA fragment that superimposes on local curvatures induced by thermal fluctuations and that only the entropic disorder depends upon experimental conditions. In contrast, the WLC model fails to describe the human DNA conformations. We use a mean-field extension of the WLC model to account for the presence of long-range correlations (LRC) in the intrinsic curvature disorder of human genomic DNA: the stronger the LRC, the smaller the persistence length. The comparison of AFM imaging of human DNA with LRC DNA simulations confirms that the rather small mean square end-to-end distance observed, particularly for G

Anion photoelectron spectroscopy of acid-base systems, solvated molecules and MALDI matrix molecules

NASA Astrophysics Data System (ADS)

Eustis, Soren Newman

Gas phase, mass-selected, anion photoelectron spectroscopic studies were performed on a variety of molecular systems. These studies can be grouped into three main themes: acid-base interactions, solvation, and ions of analytical interest. Acid-base interactions represent some of the most fundamental processes in chemistry. The study of these processes elucidates elementary principles such as inner and outer sphere complexes, hard and soft ions, and salt formation---to name a few. Apart from their appeal from a pedagogical standpoint, the ubiquity of chemical reactions which involve acids, bases or the resulting salts makes the study of their fundamental interactions both necessary and fruitful. With this in mind, the neutral and anionic series (NH3···HX) (X= F, Cl, Br, I) were examined experimentally and theoretically. The relatively small size of these systems, combined with the advances in computational methods, allowed our experimental results to be compared with very high level ab initio theoretical results. The synergy between theory and experiment yielded an understanding of the nature of the complexes that could not be achieved with either method in isolation. The second theme present in this body or work is molecular solvation. Solvation is a phenomenon which is present in biology, chemistry and physics. Many biological molecules do not become 'active' until they are solvated by water. Thus, the study of biologically relevant species solvated by water is one step in a bottom up approach to studying the biochemical interactions in living organisms. Furthermore, the hydration of acidic molecules in the atmosphere is what drives the formation of 'free' protons or hydronium ions which are the key players in acid driven chemistry. Here are presented two unique solvation studies, Adenine(H2O)-n and C6F6(H2O)-n, these systems are very distinct, but show somewhat similar responses to hydration. The last theme presented in this work is the electronic properties

Amino acid racemization in amber-entombed insects: implications for DNA preservation

NASA Technical Reports Server (NTRS)

Bada, J. L.; Wang, X. S.; Poinar, H. N.; Paabo, S.; Poinar, G. O.

1994-01-01

DNA depurination and amino acid racemization take place at similar rates in aqueous solution at neutral pH. This relationship suggests that amino acid racemization may be useful in accessing the extent of DNA chain breakage in ancient biological remains. To test this suggestion, we have investigated the amino acids in insects entombed in fossilized tree resins ranging in age from <100 years to 130 million years. The amino acids present in 40 to 130 million year old amber-entombed insects resemble those in a modern fly and are probably the most ancient, unaltered amino acids found so far on Earth. In comparison to other geochemical environments on the surface of the Earth, the amino acid racemization rate in amber insect inclusions is retarded by a factor of >10(4). These results suggest that in amber insect inclusions DNA depurination rates would also likely be retarded in comparison to aqueous solution measurements, and thus DNA fragments containing many hundreds of base pairs should be preserved. This conclusion is consistent with the reported successful retrieval of DNA sequences from amber-entombed organisms.

Double-strand breaks in genome-sized DNA caused by mechanical stress under mixing: Quantitative evaluation through single-molecule observation

NASA Astrophysics Data System (ADS)

Kikuchi, Hayato; Nose, Keiji; Yoshikawa, Yuko; Yoshikawa, Kenichi

2018-06-01

It is becoming increasingly apparent that changes in the higher-order structure of genome-sized DNA molecules of more than several tens kbp play important roles in the self-control of genome activity in living cells. Unfortunately, it has been rather difficult to prepare genome-sized DNA molecules without damage or fragmentation. Here, we evaluated the degree of double-strand breaks (DSBs) caused by mechanical mixing by single-molecule observation with fluorescence microscopy. The results show that DNA breaks are most significant for the first second after the initiation of mechanical agitation. Based on such observation, we propose a novel mixing procedure to significantly decrease DSBs.

Photonic-plasmonic hybrid single-molecule nanosensor measures the effect of fluorescent labels on DNA-protein dynamics

PubMed Central

Liang, Feng; Guo, Yuzheng; Hou, Shaocong; Quan, Qimin

2017-01-01

Current methods to study molecular interactions require labeling the subject molecules with fluorescent reporters. However, the effect of the fluorescent reporters on molecular dynamics has not been quantified because of a lack of alternative methods. We develop a hybrid photonic-plasmonic antenna-in-a-nanocavity single-molecule biosensor to study DNA-protein dynamics without using fluorescent labels. Our results indicate that the fluorescein and fluorescent protein labels decrease the interaction between a single DNA and a protein due to weakened electrostatic interaction. Although the study is performed on the DNA-XPA system, the conclusion has a general implication that the traditional fluorescent labeling methods might be misestimating the molecular interactions. PMID:28560341

Visualizing biological reaction intermediates with DNA curtains

NASA Astrophysics Data System (ADS)

Zhao, Yiling; Jiang, Yanzhou; Qi, Zhi

2017-04-01

Single-molecule approaches have tremendous potential analyzing dynamic biological reaction with heterogeneity that cannot be effectively accessed via traditional ensemble-level biochemical approaches. The approach of deoxyribonucleic acid (DNA) curtains developed by Dr Eric Greene and his research team at Columbia University is a high-throughput single-molecule technique that utilizes fluorescent imaging to visualize protein-DNA interactions directly and allows the acquisition of statistically relevant information from hundreds or even thousands of individual reactions. This review aims to summarize the past, present, and future of DNA curtains, with an emphasis on its applications to solve important biological questions.

Small-molecule inhibitors of APE1 DNA repair function: an overview.

PubMed

Al-Safi, Rasha I; Odde, Srinivas; Shabaik, Yumna; Neamati, Nouri

2012-01-01

APE1 is a multifaceted protein that orchestrates multiple activities in the cell, one of which is the preservation of genomic integrity; a vital process that takes place in the context of the base excision repair (BER) pathway. Studies have implicated APE1 in rendering cancerous cells less vulnerable to the effects of DNA-damaging agents that are commonly used for the treatment of cancer. Furthermore, suppression of APE1 expression in cancer cell lines is accompanied by the potentiation of the activity of cytotoxic agents. As a result, major efforts have been directed towards the identification of small-molecule inhibitors of this DNA-repair enzyme. Herein, we review all patented small-molecule APE1 inhibitors reported prior to 2011. Unfortunately, the potency and selectivity of many of the reported inhibitors were not disclosed by the original authors, and at present it is unclear if APE1 is a bona fide target for many of the purported inhibitors. Moreover, cellular activity and toxicity of many inhibitors remain to be established. Since this is the first comprehensive review of small molecule APE1 inhibitors, we present all compounds reported to inhibit APE1 activity with an IC50 value ≤ 25 μM. Efforts towards a careful validation and optimization of these compounds are warranted. Furthermore, we explore potential allosteric drug-binding sites on the protein as an alternative approach for modulating the activity of this multifunctional protein. In addition, we give an overview of APE2, as well as other APE1 homologues in some disease-causing pathogens. Finally, given the universal importance of DNA repair, as well as the considerable conservation of repair proteins across all living organisms, we propose targeting the AP endonuclease activity of pathogens by the compounds discussed in this review, thereby expanding their therapeutic potential and application.

Biosynthesis of Lipoic Acid in Arabidopsis: Cloning and Characterization of the cDNA for Lipoic Acid Synthase1

PubMed Central

Yasuno, Rie; Wada, Hajime

1998-01-01

Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738

Quantitative Single-Molecule Surface-Enhanced Raman Scattering by Optothermal Tuning of DNA Origami-Assembled Plasmonic Nanoantennas.

PubMed

Simoncelli, Sabrina; Roller, Eva-Maria; Urban, Patrick; Schreiber, Robert; Turberfield, Andrew J; Liedl, Tim; Lohmüller, Theobald

2016-11-22

DNA origami is a powerful approach for assembling plasmonic nanoparticle dimers and Raman dyes with high yields and excellent positioning control. Here we show how optothermal-induced shrinking of a DNA origami template can be employed to control the gap sizes between two 40 nm gold nanoparticles in a range from 1 to 2 nm. The high field confinement achieved with this optothermal approach was demonstrated by detection of surface-enhanced Raman spectroscopy (SERS) signals from single molecules that are precisely placed within the DNA origami template that spans the nanoparticle gap. By comparing the SERS intensity with respect to the field enhancement in the plasmonic hot-spot region, we found good agreement between measurement and theory. Our straightforward approach for the fabrication of addressable plasmonic nanosensors by DNA origami demonstrates a path toward future sensing applications with single-molecule resolution.

Quantification of false positive reduction in nucleic acid purification on hemorrhagic fever DNA.

DOE Office of Scientific and Technical Information (OSTI.GOV)

James, Conrad D.; Pohl, Kenneth Roy; Derzon, Mark Steven

2006-11-01

Columbia University has developed a sensitive highly multiplexed system for genetic identification of nucleic acid targets. The primary obstacle to implementing this technology is the high rate of false positives due to high levels of unbound reporters that remain within the system after hybridization. The ability to distinguish between free reporters and reporters bound to targets limits the use of this technology. We previously demonstrated a new electrokinetic method for binary separation of kb pair long DNA molecules and oligonucleotides. The purpose of this project 99864 is to take these previous demonstrations and further develop the technique and hardware formore » field use. Specifically, our objective was to implement separation in a heterogeneous sample (containing target DNA and background oligo), to perform the separation in a flow-based device, and to develop all of the components necessary for field testing a breadboard prototype system.« less

Protein dynamics during presynaptic complex assembly on individual ssDNA molecules

PubMed Central

Gibb, Bryan; Ye, Ling F.; Kwon, YoungHo; Niu, Hengyao; Sung, Patrick; Greene, Eric C.

2014-01-01

Homologous recombination is a conserved pathway for repairing double–stranded breaks, which are processed to yield single–stranded DNA overhangs that serve as platforms for presynaptic complex assembly. Here we use single–molecule imaging to reveal the interplay between Saccharomyce cerevisiae RPA, Rad52, and Rad51 during presynaptic complex assembly. We show that Rad52 binds RPA–ssDNA and suppresses RPA turnover, highlighting an unanticipated regulatory influence on protein dynamics. Rad51 binding extends the ssDNA, and Rad52–RPA clusters remain interspersed along the presynaptic complex. These clusters promote additional binding of RPA and Rad52. Together, our work illustrates the spatial and temporal progression of RPA and Rad52 association with the presynaptic complex, and reveals a novel RPA–Rad52–Rad51–ssDNA intermediate, which has implications for understanding how the activities of Rad52 and RPA are coordinated with Rad51 during the later stages recombination. PMID:25195049

Repair of oxidative DNA damage by amino acids.

PubMed

Milligan, J R; Aguilera, J A; Ly, A; Tran, N Q; Hoang, O; Ward, J F

2003-11-01

Guanyl radicals, the product of the removal of a single electron from guanine, are produced in DNA by the direct effect of ionizing radiation. We have produced guanyl radicals in DNA by using the single electron oxidizing agent (SCN)2-, itself derived from the indirect effect of ionizing radiation via thiocyanate scavenging of OH. We have examined the reactivity of guanyl radicals in plasmid DNA with the six most easily oxidized amino acids cysteine, cystine, histidine, methionine, tryptophan and tyrosine and also simple ester and amide derivatives of them. Cystine and histidine derivatives are unreactive. Cysteine, methionine, tyrosine and particularly tryptophan derivatives react to repair guanyl radicals in plasmid DNA with rate constants in the region of approximately 10(5), 10(5), 10(6) and 10(7) dm3 mol(-1) s(-1), respectively. The implication is that amino acid residues in DNA binding proteins such as histones might be able to repair by an electron transfer reaction the DNA damage produced by the direct effect of ionizing radiation or by other oxidative insults.

Genome organization of Tobacco leaf curl Zimbabwe virus, a new, distinct monopartite begomovirus associated with subgenomic defective DNA molecules.

PubMed

Paximadis, M; Rey, M E

2001-12-01

The complete DNA A of the begomovirus Tobacco leaf curl Zimbabwe virus (TbLCZWV) was sequenced: it comprises 2767 nucleotides with six major open reading frames encoding proteins with molecular masses greater than 9 kDa. Full-length TbLCZWV DNA A tandem dimers, cloned in binary vectors (pBin19 and pBI121) and transformed into Agrobacterium tumefaciens, were systemically infectious upon agroinoculation of tobacco and tomato. Efforts to identify a DNA B component were unsuccessful. These findings suggest that TbLCZWV is a new member of the monopartite group of begomoviruses. Phylogenetic analysis identified TbLCZWV as a distinct begomovirus with its closest relative being Chayote mosaic virus. Abutting primer PCR amplified ca. 1300 bp molecules, and cloning and sequencing of two of these molecules revealed them to be subgenomic defective DNA molecules originating from TbLCZWV DNA A. Variable symptom severity associated with tobacco leaf curl disease and TbLCZWV is discussed.

Influence of amine and thiol modifications at the 3' ends of single stranded DNA molecules on their adsorption on gold surface and the efficiency of their hybridization.

PubMed

Jaworska, Aleksandra; Jablonska, Anna; Wilanowski, Tomasz; Palys, Barbara; Sek, Slawomir; Kudelski, Andrzej

2018-05-24

Adsorption of molecules of DNA (deoxyribonucleic acid) or modified DNA on gold surfaces is often the first step in construction of many various biosensors, including biosensors for detection of DNA with a particular sequence. In this work we study the influence of amine and thiol modifications at the 3' ends of single stranded DNA (ssDNA) molecules on their adsorption on the surface of gold substrates and on the efficiency of hybridization of immobilized DNA with the complementary single stranded DNA. The characterization of formed layers has been carried out using infrared spectroscopy and atomic force microscopy. As model single stranded DNA we used DNA containing 20 adenine bases, whereas the complementary DNA contained 20 thymine bases. We found that the bands in polarization modulation-infrared reflection-adsorption spectroscopy (PM-IRRAS) spectra of layers formed from thiol-modified DNA are significantly narrower and sharper, indicating their higher regularity in the orientation of DNA on gold surface when using thiol linker. Also, hybridization of the layer of thiol-modified DNA containing 20 adenine bases with the respective DNA containing thymine bases leads to formation of much more organized structures than in the case of unmodified DNA or DNA with the amine linker. We conclude that the thiol-modified ssDNA is more promising for the preparation of biosensors, in comparison with the amine-modified or unmodified ssDNA. We have also found that the above-mentioned modifications at the 3' end of ssDNA significantly influence the IR spectrum (and hence the structure) of polycrystalline films formed from such compounds, even though adsorbed fragments contain less than 5% of the DNA chain. This effect should be taken into account when comparing IR spectra of various polycrystalline films formed from modified and unmodified DNA. Copyright © 2018. Published by Elsevier B.V.

Detection of viral infection and gene expression in clinical tissue specimens using branched DNA (bDNA) in situ hybridization.

PubMed

Kenny, Daryn; Shen, Lu-Ping; Kolberg, Janice A

2002-09-01

In situ hybridization (ISH) methods for detection of nucleic acid sequences have proved especially powerful for revealing genetic markers and gene expression in a morphological context. Although target and signal amplification technologies have enabled researchers to detect relatively low-abundance molecules in cell extracts, the sensitive detection of nucleic acid sequences in tissue specimens has proved more challenging. We recently reported the development of a branched DNA (bDNA) ISH method for detection of DNA and mRNA in whole cells. Based on bDNA signal amplification technology, bDNA ISH is highly sensitive and can detect one or two copies of DNA per cell. In this study we evaluated bDNA ISH for detection of nucleic acid sequences in tissue specimens. Using normal and human papillomavirus (HPV)-infected cervical biopsy specimens, we explored the cell type-specific distribution of HPV DNA and mRNA by bDNA ISH. We found that bDNA ISH allowed rapid, sensitive detection of nucleic acids with high specificity while preserving tissue morphology. As an adjunct to conventional histopathology, bDNA ISH may improve diagnostic accuracy and prognosis for viral and neoplastic diseases.

Dynamics of water around the complex structures formed between the KH domains of far upstream element binding protein and single-stranded DNA molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chakraborty, Kaushik; Bandyopadhyay, Sanjoy, E-mail: sanjoy@chem.iitkgp.ernet.in

2015-07-28

Single-stranded DNA (ss-DNA) binding proteins specifically bind to the single-stranded regions of the DNA and protect it from premature annealing, thereby stabilizing the DNA structure. We have carried out atomistic molecular dynamics simulations of the aqueous solutions of two DNA binding K homology (KH) domains (KH3 and KH4) of the far upstream element binding protein complexed with two short ss-DNA segments. Attempts have been made to explore the influence of the formation of such complex structures on the microscopic dynamics and hydrogen bond properties of the interfacial water molecules. It is found that the water molecules involved in bridging themore » ss-DNA segments and the protein domains form a highly constrained thin layer with extremely retarded mobility. These water molecules play important roles in freezing the conformational oscillations of the ss-DNA oligomers and thereby forming rigid complex structures. Further, it is demonstrated that the effect of complexation on the slow long-time relaxations of hydrogen bonds at the interface is correlated with hindered motions of the surrounding water molecules. Importantly, it is observed that the highly restricted motions of the water molecules bridging the protein and the DNA components in the complexed forms originate from more frequent hydrogen bond reformations.« less

The role of solitons on the tunneling magnetoresistance through a double-stranded DNA molecule

NASA Astrophysics Data System (ADS)

Ashhadi, M.

2018-07-01

We have studied the role of solitons on the spin-dependent transport properties of through a double-stranded DNA (dsDNA) molecule attached to two the semi-infinite ferromagnetic (FM) electrodes. The work is based on a tight-binding Hamiltonian model within the framework of a generalized Green's function technique and relies on the Landauer-Bütikker formalism as the basis for studying the current-voltage characteristic of this system. The conductance properties of the spin system are studied for a ladder model for poly (dG)-poly (dC) DNA molecule. Our calculations indicate that the presence of a homogeneous distribution of the solitons along the molecular, as a sublattice of the correlated solitons, gives rise to significant enhancement in the density of states within the bandgap and large enhancement in conductance and the current-voltage characteristic. It is also shown that tunnel magnetoresistance (TMR) decreases in compared with TMR obtained in the absence of solitons.

Estimation of lactic acid bacterial cell number by DNA quantification.

PubMed

Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa

2018-01-01

Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.

Nucleic Acid Engineering: RNA Following the Trail of DNA.

PubMed

Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum

2016-02-08

The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.

Directed self-organization of single DNA molecules in a nanoslit via embedded nanopit arrays

PubMed Central

Reisner, Walter; Larsen, Niels B.; Flyvbjerg, Henrik; Tegenfeldt, Jonas O.; Kristensen, Anders

2009-01-01

We show that arrays of nanopit structures etched in a nanoslit can control the positioning and conformation of single DNA molecules in nanofluidic devices. By adjusting the spacing, organization and placement of the nanopits it is possible to immobilize DNA at predetermined regions of a device without additional chemical modification and achieve a high degree of control over local DNA conformation. DNA can be extended between two nanopits and in closely spaced arrays will self-assemble into “connect-the-dots” conformations consisting of locally pinned segments joined by fluctuating linkers. These results have broad implications for nanotechnology fields that require methods for the nanoscale positioning and manipulation of DNA. PMID:19122138

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores

NASA Astrophysics Data System (ADS)

Bell, Nicholas A. W.; Keyser, Ulrich F.

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Digitally encoded DNA nanostructures for multiplexed, single-molecule protein sensing with nanopores.

PubMed

Bell, Nicholas A W; Keyser, Ulrich F

2016-07-01

The simultaneous detection of a large number of different analytes is important in bionanotechnology research and in diagnostic applications. Nanopore sensing is an attractive method in this regard as the approach can be integrated into small, portable device architectures, and there is significant potential for detecting multiple sub-populations in a sample. Here, we show that highly multiplexed sensing of single molecules can be achieved with solid-state nanopores by using digitally encoded DNA nanostructures. Based on the principles of DNA origami, we designed a library of DNA nanostructures in which each member contains a unique barcode; each bit in the barcode is signalled by the presence or absence of multiple DNA dumbbell hairpins. We show that a 3-bit barcode can be assigned with 94% accuracy by electrophoretically driving the DNA structures through a solid-state nanopore. Select members of the library were then functionalized to detect a single, specific antibody through antigen presentation at designed positions on the DNA. This allows us to simultaneously detect four different antibodies of the same isotype at nanomolar concentration levels.

Exporters for Production of Amino Acids and Other Small Molecules.

PubMed

Eggeling, Lothar

Microbes are talented catalysts to synthesize valuable small molecules in their cytosol. However, to make full use of their skills - and that of metabolic engineers - the export of intracellularly synthesized molecules to the culture medium has to be considered. This step is as essential as is each step for the synthesis of the favorite molecule of the metabolic engineer, but is frequently not taken into account. To export small molecules via the microbial cell envelope, a range of different types of carrier proteins is recognized to be involved, which are primary active carriers, secondary active carriers, or proteins increasing diffusion. Relevant export may require just one carrier as is the case with L-lysine export by Corynebacterium glutamicum or involve up to four carriers as known for L-cysteine excretion by Escherichia coli. Meanwhile carriers for a number of small molecules of biotechnological interest are recognized, like for production of peptides, nucleosides, diamines, organic acids, or biofuels. In addition to carriers involved in amino acid excretion, such carriers and their impact on product formation are described, as well as the relatedness of export carriers which may serve as a hint to identify further carriers required to improve product formation by engineering export.

Single molecule detection of nitric oxide enabled by d(AT)15 DNA adsorbed to near infrared fluorescent single-walled carbon nanotubes.

PubMed

Zhang, Jingqing; Boghossian, Ardemis A; Barone, Paul W; Rwei, Alina; Kim, Jong-Ho; Lin, Dahua; Heller, Daniel A; Hilmer, Andrew J; Nair, Nitish; Reuel, Nigel F; Strano, Michael S

2011-01-26

We report the selective detection of single nitric oxide (NO) molecules using a specific DNA sequence of d(AT)(15) oligonucleotides, adsorbed to an array of near-infrared fluorescent semiconducting single-walled carbon nanotubes (AT(15)-SWNT). While SWNT suspended with eight other variant DNA sequences show fluorescence quenching or enhancement from analytes such as dopamine, NADH, L-ascorbic acid, and riboflavin, d(AT)(15) imparts SWNT with a distinct selectivity toward NO. In contrast, the electrostatically neutral polyvinyl alcohol enables no response to nitric oxide, but exhibits fluorescent enhancement to other molecules in the tested library. For AT(15)-SWNT, a stepwise fluorescence decrease is observed when the nanotubes are exposed to NO, reporting the dynamics of single-molecule NO adsorption via SWNT exciton quenching. We describe these quenching traces using a birth-and-death Markov model, and the maximum likelihood estimator of adsorption and desorption rates of NO is derived. Applying the method to simulated traces indicates that the resulting error in the estimated rate constants is less than 5% under our experimental conditions, allowing for calibration using a series of NO concentrations. As expected, the adsorption rate is found to be linearly proportional to NO concentration, and the intrinsic single-site NO adsorption rate constant is 0.001 s(-1) μM NO(-1). The ability to detect nitric oxide quantitatively at the single-molecule level may find applications in new cellular assays for the study of nitric oxide carcinogenesis and chemical signaling, as well as medical diagnostics for inflammation.

Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA

NASA Astrophysics Data System (ADS)

Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei

2013-08-01

The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K290K = 7.60 × 104 L mol-1 and K310K = 4.90 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69 × 104 J mol-1, 35.36 J K-1 mol-1 and -2.79 × 104 J mol-1 at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, Marcelo Bento; Bonaldo, Maria de Fatima

1998-01-01

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods.

Efficient and simpler method to construct normalized cDNA libraries with improved representations of full-length cDNAs

DOEpatents

Soares, M.B.; Fatima Bonaldo, M. de

1998-12-08

This invention provides a method to normalize a cDNA library comprising: (a) constructing a directionally cloned library containing cDNA inserts wherein the insert is capable of being amplified by polymerase chain reaction; (b) converting a double-stranded cDNA library into single-stranded DNA circles; (c) generating single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) by polymerase chain reaction with appropriate primers; (d) hybridizing the single-stranded DNA circles converted in step (b) with the complementary single-stranded nucleic acid molecules generated in step (c) to produce partial duplexes to an appropriate Cot; and (e) separating the unhybridized single-stranded DNA circles from the hybridized DNA circles, thereby generating a normalized cDNA library. This invention also provides a method to normalize a cDNA library wherein the generating of single-stranded nucleic acid molecules complementary to the single-stranded DNA circles converted in step (b) is by excising cDNA inserts from the double-stranded cDNA library; purifying the cDNA inserts from cloning vectors; and digesting the cDNA inserts with an exonuclease. This invention further provides a method to construct a subtractive cDNA library following the steps described above. This invention further provides normalized and/or subtractive cDNA libraries generated by the above methods. 25 figs.

Fixed-Gap Tunnel Junction for Reading DNA Nucleotides

PubMed Central

2015-01-01

Previous measurements of the electronic conductance of DNA nucleotides or amino acids have used tunnel junctions in which the gap is mechanically adjusted, such as scanning tunneling microscopes or mechanically controllable break junctions. Fixed-junction devices have, at best, detected the passage of whole DNA molecules without yielding chemical information. Here, we report on a layered tunnel junction in which the tunnel gap is defined by a dielectric layer, deposited by atomic layer deposition. Reactive ion etching is used to drill a hole through the layers so that the tunnel junction can be exposed to molecules in solution. When the metal electrodes are functionalized with recognition molecules that capture DNA nucleotides via hydrogen bonds, the identities of the individual nucleotides are revealed by characteristic features of the fluctuating tunnel current associated with single-molecule binding events. PMID:25380505

Elasticity of short DNA molecules: theory and experiment for contour lengths of 0.6-7 microm.

PubMed

Seol, Yeonee; Li, Jinyu; Nelson, Philip C; Perkins, Thomas T; Betterton, M D

2007-12-15

The wormlike chain (WLC) model currently provides the best description of double-stranded DNA elasticity for micron-sized molecules. This theory requires two intrinsic material parameters-the contour length L and the persistence length p. We measured and then analyzed the elasticity of double-stranded DNA as a function of L (632 nm-7.03 microm) using the classic solution to the WLC model. When the elasticity data were analyzed using this solution, the resulting fitted value for the persistence length p(wlc) depended on L; even for moderately long DNA molecules (L = 1300 nm), this apparent persistence length was 10% smaller than its limiting value for long DNA. Because p is a material parameter, and cannot depend on length, we sought a new solution to the WLC model, which we call the "finite wormlike chain (FWLC)," to account for effects not considered in the classic solution. Specifically we accounted for the finite chain length, the chain-end boundary conditions, and the bead rotational fluctuations inherent in optical trapping assays where beads are used to apply the force. After incorporating these corrections, we used our FWLC solution to generate force-extension curves, and then fit those curves with the classic WLC solution, as done in the standard experimental analysis. These results qualitatively reproduced the apparent dependence of p(wlc) on L seen in experimental data when analyzed with the classic WLC solution. Directly fitting experimental data to the FWLC solution reduces the apparent dependence of p(fwlc) on L by a factor of 3. Thus, the FWLC solution provides a significantly improved theoretical framework in which to analyze single-molecule experiments over a broad range of experimentally accessible DNA lengths, including both short (a few hundred nanometers in contour length) and very long (microns in contour length) molecules.

Single molecule views of Nature's nano-machines

NASA Astrophysics Data System (ADS)

Ha, Taekjip

2006-03-01

We are interested in the perturbational analysis of biological molecules to better understand their mechanisms. Our readout is the fluorescence signal from individual biomolecules, mainly in the form of single molecule fluorescence resonance energy transfer (FRET). We are pioneering approaches to perturb and control biomolecular conformations using external force (combination of single molecule FRET and optical trap) or other biological motifs (DNA hybridization, G-quadruplex, aptamers,.). In this talk, I will present our latest results on mapping the conformational energy landscape of the Holliday junction through simultaneous fluorescence and force measurements. In addition, a new nanomechanical device called single molecule nano-metronome will be discussed with an outlook toward controlling protein conformations using nucleic acids motifs.

DNA mechanics as a tool to probe helicase and translocase activity.

PubMed

Lionnet, Timothée; Dawid, Alexandre; Bigot, Sarah; Barre, François-Xavier; Saleh, Omar A; Heslot, François; Allemand, Jean-François; Bensimon, David; Croquette, Vincent

2006-01-01

Helicases and translocases are proteins that use the energy derived from ATP hydrolysis to move along or pump nucleic acid substrates. Single molecule manipulation has proved to be a powerful tool to investigate the mechanochemistry of these motors. Here we first describe the basic mechanical properties of DNA unraveled by single molecule manipulation techniques. Then we demonstrate how the knowledge of these properties has been used to design single molecule assays to address the enzymatic mechanisms of different translocases. We report on four single molecule manipulation systems addressing the mechanism of different helicases using specifically designed DNA substrates: UvrD enzyme activity detection on a stretched nicked DNA molecule, HCV NS3 helicase unwinding of a RNA hairpin under tension, the observation of RecBCD helicase/nuclease forward and backward motion, and T7 gp4 helicase mediated opening of a synthetic DNA replication fork. We then discuss experiments on two dsDNA translocases: the RuvAB motor studied on its natural substrate, the Holliday junction, and the chromosome-segregation motor FtsK, showing its unusual coupling to DNA supercoiling.

Packaging of single DNA molecules by the yeast mitochondrial protein Abf2p.

PubMed

Brewer, Laurence R; Friddle, Raymond; Noy, Aleksandr; Baldwin, Enoch; Martin, Shelley S; Corzett, Michele; Balhorn, Rod; Baskin, Ronald J

2003-10-01

Mitochondrial and nuclear DNA are packaged by proteins in a very different manner. Although protein-DNA complexes called "nucleoids" have been identified as the genetic units of mitochondrial inheritance in yeast and man, little is known about their physical structure. The yeast mitochondrial protein Abf2p was shown to be sufficient to compact linear dsDNA, without the benefit of supercoiling, using optical and atomic force microscopy single molecule techniques. The packaging of DNA by Abf2p was observed to be very weak as evidenced by a fast Abf2p off-rate (k(off) = 0.014 +/- 0.001 s(-1)) and the extremely small forces (<0.6 pN) stabilizing the condensed protein-DNA complex. Atomic force microscopy images of individual complexes showed the 190-nm structures are loosely packaged relative to nuclear chromatin. This organization may leave mtDNA accessible for transcription and replication, while making it more vulnerable to damage.

Spectrophotometric study on binding of 2-thioxanthone acetic acid with ct-DNA.

PubMed

Ataci, Nese; Ozcelik, Elif; Arsu, Nergis

2018-06-02

Thioxanthone and its derivatives are the most remarkable molecules due to their vast variety of application such as radiation curing that is, until using them as a therapeutic drug. Therefore, in this study it was intended to use 2-Thioxanthone acetic acid with and without NaCl in Tris HCl buffer solution (pH:7.0) to represent the interaction with ct-DNA. The UV-vis absorption spectra of TXCH 2 COOH in the presence of ct-DNA showed hypochromism and the intrinstic binding constant (K b ) was determined as 6 × 10 3  L mol -1 . The fluoresence intensity of TXCH 2 COOH with ct-DNA clearly increased up to 101% which indicated that the fluorescence intensity was very sensitive to ct-DNA concentration. The binding constant (K) and the values of number of binding sites (n) and were calculated as 1.8 × 10 3  L mol -1 and 0.69, respectively. When the quenching constants (K sv ) of free TXCH 2 COOH and TXCH 2 COOH, which were bonded with ct-DNA were compared, slightly changed values of Ksv were seen. Moreover, displacement assay with Hoechst 33,258 and viscosity measurements in the presence and absence of NaCl salt also confirmed the binding mode which noted the electrostatic interaction following groove binding between TXCH 2 COOH and ct-DNA. Last but not least, the salt effect was examined on ct-DNA binding with TXCH 2 COOH. The results of the experiments indicated that the groove binding was strengthened by NaCl whereas in the high NaCl concentration, the binding ability of TXCH 2 COOH to ct-DNA was inversely affected. Copyright © 2018 Elsevier B.V. All rights reserved.

[Interactions of DNA bases with individual water molecules. Molecular mechanics and quantum mechanics computation results vs. experimental data].

PubMed

Gonzalez, E; Lino, J; Deriabina, A; Herrera, J N F; Poltev, V I

2013-01-01

To elucidate details of the DNA-water interactions we performed the calculations and systemaitic search for minima of interaction energy of the systems consisting of one of DNA bases and one or two water molecules. The results of calculations using two force fields of molecular mechanics (MM) and correlated ab initio method MP2/6-31G(d, p) of quantum mechanics (QM) have been compared with one another and with experimental data. The calculations demonstrated a qualitative agreement between geometry characteristics of the most of local energy minima obtained via different methods. The deepest minima revealed by MM and QM methods correspond to water molecule position between two neighbor hydrophilic centers of the base and to the formation by water molecule of hydrogen bonds with them. Nevertheless, the relative depth of some minima and peculiarities of mutual water-base positions in' these minima depend on the method used. The analysis revealed insignificance of some differences in the results of calculations performed via different methods and the importance of other ones for the description of DNA hydration. The calculations via MM methods enable us to reproduce quantitatively all the experimental data on the enthalpies of complex formation of single water molecule with the set of mono-, di-, and trimethylated bases, as well as on water molecule locations near base hydrophilic atoms in the crystals of DNA duplex fragments, while some of these data cannot be rationalized by QM calculations.

Nanopore arrays in a silicon membrane for parallel single-molecule detection: DNA translocation

NASA Astrophysics Data System (ADS)

Zhang, Miao; Schmidt, Torsten; Jemt, Anders; Sahlén, Pelin; Sychugov, Ilya; Lundeberg, Joakim; Linnros, Jan

2015-08-01

Optical nanopore sensing offers great potential in single-molecule detection, genotyping, or DNA sequencing for high-throughput applications. However, one of the bottle-necks for fluorophore-based biomolecule sensing is the lack of an optically optimized membrane with a large array of nanopores, which has large pore-to-pore distance, small variation in pore size and low background photoluminescence (PL). Here, we demonstrate parallel detection of single-fluorophore-labeled DNA strands (450 bps) translocating through an array of silicon nanopores that fulfills the above-mentioned requirements for optical sensing. The nanopore array was fabricated using electron beam lithography and anisotropic etching followed by electrochemical etching resulting in pore diameters down to ∼7 nm. The DNA translocation measurements were performed in a conventional wide-field microscope tailored for effective background PL control. The individual nanopore diameter was found to have a substantial effect on the translocation velocity, where smaller openings slow the translocation enough for the event to be clearly detectable in the fluorescence. Our results demonstrate that a uniform silicon nanopore array combined with wide-field optical detection is a promising alternative with which to realize massively-parallel single-molecule detection.

An Undergraduate Investigation into the 10-23 DNA Enzyme that Cleaves RNA: DNA Can Cut It in the Biochemistry Laboratory

ERIC Educational Resources Information Center

Flynn-Charlebois, Amber; Burns, Jamie; Chapelliquen, Stephanie; Sanmartino, Holly

2011-01-01

A low-cost biochemistry experiment is described that demonstrates current techniques in the use of catalytic DNA molecules and introduces a nonradioactive, nonfluorescent, inexpensive, fast, and safe method for monitoring these nucleic acid reactions. The laboratory involves the exploration of the 10-23 DNA enzyme as it cleaves a specific RNA…

DNA and RNA sequencing by nanoscale reading through programmable electrophoresis and nanoelectrode-gated tunneling and dielectric detection

DOEpatents

Lee, James W.; Thundat, Thomas G.

2005-06-14

An apparatus and method for performing nucleic acid (DNA and/or RNA) sequencing on a single molecule. The genetic sequence information is obtained by probing through a DNA or RNA molecule base by base at nanometer scale as though looking through a strip of movie film. This DNA sequencing nanotechnology has the theoretical capability of performing DNA sequencing at a maximal rate of about 1,000,000 bases per second. This enhanced performance is made possible by a series of innovations including: novel applications of a fine-tuned nanometer gap for passage of a single DNA or RNA molecule; thin layer microfluidics for sample loading and delivery; and programmable electric fields for precise control of DNA or RNA movement. Detection methods include nanoelectrode-gated tunneling current measurements, dielectric molecular characterization, and atomic force microscopy/electrostatic force microscopy (AFM/EFM) probing for nanoscale reading of the nucleic acid sequences.

Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA.

PubMed

Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei

2013-08-01

The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K(290K)=7.60×10(4) L mol(-1) and K(310K)=4.90×10(4) L mol(-1). The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69×10(4) J mol(-1), 35.36 J K(-1) mol(-1) and -2.79×10(4) J mol(-1) at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA. Copyright © 2013 Elsevier B.V. All rights reserved.

Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes

PubMed Central

Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji

2013-01-01

Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052

Two distinct overstretched DNA structures revealed by single-molecule thermodynamics measurements

PubMed Central

Zhang, Xinghua; Chen, Hu; Fu, Hongxia; Doyle, Patrick S.; Yan, Jie

2012-01-01

Double-stranded DNA is a dynamic molecule whose structure can change depending on conditions. While there is consensus in the literature about many structures DNA can have, the state of highly-stretched DNA is still not clear. Several groups have shown that DNA in the torsion-unconstrained B-form undergoes an “overstretching” transition at a stretching force of around 65 pN, which leads to approximately 1.7-fold elongation of the DNA contour length. Recent experiments have revealed that two distinct structural transitions are involved in the overstretching process: (i) a hysteretic “peeling” off one strand from its complementary strand, and (ii) a nonhysteretic transition that leads to an undetermined DNA structure. We report the first simultaneous determination of the entropy (ΔS) and enthalpy changes (ΔH) pertaining to these respective transitions. For the hysteretic peeling transition, we determined ΔS ∼ 20 cal/(K.mol) and ΔH ∼ 7 kcal/mol. In the case of the nonhysteretic transition, ΔS ∼ -3 cal/(K.mol) and ΔH ∼ 1 kcal/mol. Furthermore, the response of the transition force to salt concentration implies that the two DNA strands are spatially separated after the hysteretic peeling transition. In contrast, the corresponding response after the nonhysteretic transition indicated that the strands remained in close proximity. The selection between the two transitions depends on DNA base-pair stability, and it can be illustrated by a multidimensional phase diagram. Our results provide important insights into the thermodynamics of DNA overstretching and conformational structures of overstretched DNA that may play an important role in vivo. PMID:22532662

Single DNA molecules on freestanding and supported cationic lipid bilayers: diverse conformational dynamics controlled by the local bilayer properties

NASA Astrophysics Data System (ADS)

Herold, Christoph; Schwille, Petra; Petrov, Eugene P.

2016-02-01

We present experimental results on the interaction of DNA macromolecules with cationic lipid membranes with different properties, including freestanding membranes in the fluid and gel state, and supported lipid membranes in the fluid state and under conditions of fluid-gel phase coexistence. We observe diverse conformational dynamics of membrane-bound DNA molecules controlled by the local properties of the lipid bilayer. In case of fluid-state freestanding lipid membranes, the behaviour of DNA on the membrane is controlled by the membrane charge density: whereas DNA bound to weakly charged membranes predominantly behaves as a 2D random coil, an increase in the membrane charge density leads to membrane-driven irreversible DNA collapse and formation of subresolution-sized DNA globules. On the other hand, electrostatic binding of DNA macromolecules to gel-state freestanding membranes leads to completely arrested diffusion and conformational dynamics of membrane-adsorbed DNA. A drastically different picture is observed in case of DNA interaction with supported cationic lipid bilayers: When the supported bilayer is in the fluid state, membrane-bound DNA molecules undergo 2D translational Brownian motion and conformational fluctuations, irrespectively of the charge density of the supported bilayer. At the same time, when the supported cationic membrane shows fluid-gel phase coexistence, membrane-bound DNA molecules are strongly attracted to micrometre-sized gel-phase domains enriched with the cationic lipid, which results in 2D compaction of the membrane-bound macromolecules. This DNA compaction, however, is fully reversible, and disappears as soon as the membrane is heated above the fluid-gel coexistence. We also discuss possible biological implications of our experimental findings.

Ultrasonic irradiation enhanced the ability of Fluorescein-DA-Fe(III) on sonodynamic and sonocatalytic damages of DNA molecules.

PubMed

Wu, Qiong; Chen, Xia; Jia, Lizhen; Wang, Yi; Sun, Ying; Huang, Xingjun; Shen, Yuxiang; Wang, Jun

2017-11-01

The interaction of DNA with Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein-Ferrous(III) (Fluorescein-DA-Fe(III)) with dual functional (sonodynamic and sonocatalytic) activity was studied by UV-vis spectroscopy, fluorescence spectroscopy, FT-IR spectroscopy, circular dichroism (CD) spectroscopy and viscosity measurements. And then, the damage of DNA caused by Fluorescein-DA-Fe(III) under ultrasonic irradiation (US) was researched by agarose gel electrophoresis and cytotoxicity assay. Meanwhile, some influenced factors such as ultrasonic irradiation time and Fluorescein-DA-Fe(III) concentration on the damage degree of DNA molecules were also examined. As a control, for Bis [N,N-bis (carboxymethyl) aminomethyl] fluorescein (Fluorescein-DA), the same experiments were carried out. The results showed that both Fluorescein-DA-Fe(III) and Fluorescein-DA can interact with DNA molecules. Under ultrasonic irradiation, Fluorescein-DA shows sonodynamic activity, which can damage DNA molecules. While, in the presence of Fe(III) ion, the Fluorescein-DA-Fe(III) displays not only sonodynamic activity but also sonocatalytic activity under ultrasonic irradiation, which injures DNA more serious than Fluorescein-DA. The researches confirmed the dual function (sonodynamic activity and sonocatalytic activity) of Fluorescein-DA-Fe(III) and expanded the usage of Fluorescein-DA-Fe(III) as a sonosensitizer in sonodynamic therapy (SDT). Copyright © 2017 Elsevier B.V. All rights reserved.

Self-assembling complexes between binary mixtures of lipids with different linkers and nucleic acids promote universal mRNA, DNA and siRNA delivery.

PubMed

Colombani, Thibault; Peuziat, Pauline; Dallet, Laurence; Haudebourg, Thomas; Mével, Mathieu; Berchel, Mathieu; Lambert, Olivier; Habrant, Damien; Pitard, Bruno

2017-03-10

Protein expression and RNA interference require efficient delivery of DNA or mRNA and small double stranded RNA into cells, respectively. Although cationic lipids are the most commonly used synthetic delivery vectors, a clear need still exists for a better delivery of various types of nucleic acids molecules to improve their biological activity. To optimize the transfection efficiency, a molecular approach consisting in modifying the chemical structure of a given cationic lipid is usually performed, but an alternative strategy could rely on modulating the supramolecular assembly of lipidic lamellar phases sandwiching the nucleic acids molecules. To validate this new concept, we synthesized on one hand two paromomycin-based cationic lipids, with either an amide or a phosphoramide linker, and on the other hand two imidazole-based neutral lipids, having as well either an amide or a phosphoramide function as linker. Combinations of cationic and helper lipids containing the same amide or phosphoramide linkers led to the formation of homogeneous lamellar phases, while hybrid lamellar phases were obtained when the linkers on the cationic and helper lipids were different. Cryo-transmission electron microscopy and fluorescence experiments showed that liposomes/nucleic acids complexes resulting from the association of nucleic acids with hybrid lamellar phases led to complexes that were more stable in the extracellular compartment compared to those obtained with homogeneous systems. In addition, we observed that the most active supramolecular assemblies for the delivery of DNA, mRNA and siRNA were obtained when the cationic and helper lipids possess linkers of different natures. The results clearly show that this supramolecular strategy modulating the property of the lipidic lamellar phase constitutes a new approach for increasing the delivery of various types of nucleic acid molecules. Copyright © 2017 Elsevier B.V. All rights reserved.

A universal colorimetry for nucleic acids and aptamer-specific ligands detection based on DNA hybridization amplification.

PubMed

Li, Shuang; Shang, Xinxin; Liu, Jia; Wang, Yujie; Guo, Yingshu; You, Jinmao

2017-07-01

We present a universal amplified-colorimetric for detecting nucleic acid targets or aptamer-specific ligand targets based on gold nanoparticle-DNA (GNP-DNA) hybridization chain reaction (HCR). The universal arrays consisted of capture probe and hairpin DNA-GNP. First, capture probe recognized target specificity and released the initiator sequence. Then dispersed hairpin DNA modified GNPs were cross-linked to form aggregates through HCR events triggered by initiator sequence. As the aggregates accumulate, a significant red-to purple color change can be easily visualized by the naked eye. We used miRNA target sequence (miRNA-203) and aptamer-specific ligand (ATP) as target molecules for this proof-of-concept experiment. Initiator sequence (DNA2) was released from the capture probe (MNP/DNA1/2 conjugates) under the strong competitiveness of miRNA-203. Hairpin DNA (H1 and H2) can be complementary with the help of initiator DNA2 to form GNP-H1/GNP-H2 aggregates. The absorption ratio (A 620 /A 520 ) values of solutions were a sensitive function of miRNA-203 concentration covering from 1.0 × 10 -11  M to 9.0 × 10 -10  M, and as low as 1.0 × 10 -11  M could be detected. At the same time, the color changed from light wine red to purple and then to light blue have occurred in the solution. For ATP, initiator sequence (5'-end of DNA3) was released from the capture probe (DNA3) under the strong combination of aptamer-ATP. The present colorimetric for specific detection of ATP exhibited good sensitivity and 1.0 × 10 -8  M ATP could be detected. The proposed strategy also showed good performances for qualitative analysis and quantitative analysis of intracellular nucleic acids and aptamer-specific ligands. Copyright © 2017 Elsevier Inc. All rights reserved.

Lesion search and recognition by thymine DNA glycosylase revealed by single molecule imaging

PubMed Central

Buechner, Claudia N.; Maiti, Atanu; Drohat, Alexander C.; Tessmer, Ingrid

2015-01-01

The ability of DNA glycosylases to rapidly and efficiently detect lesions among a vast excess of nondamaged DNA bases is vitally important in base excision repair (BER). Here, we use single molecule imaging by atomic force microscopy (AFM) supported by a 2-aminopurine fluorescence base flipping assay to study damage search by human thymine DNA glycosylase (hTDG), which initiates BER of mutagenic and cytotoxic G:T and G:U mispairs in DNA. Our data reveal an equilibrium between two conformational states of hTDG–DNA complexes, assigned as search complex (SC) and interrogation complex (IC), both at target lesions and undamaged DNA sites. Notably, for both hTDG and a second glycosylase, hOGG1, which recognizes structurally different 8-oxoguanine lesions, the conformation of the DNA in the SC mirrors innate structural properties of their respective target sites. In the IC, the DNA is sharply bent, as seen in crystal structures of hTDG lesion recognition complexes, which likely supports the base flipping required for lesion identification. Our results support a potentially general concept of sculpting of glycosylases to their targets, allowing them to exploit the energetic cost of DNA bending for initial lesion sensing, coupled with continuous (extrahelical) base interrogation during lesion search by DNA glycosylases. PMID:25712093

Determination of adsorption and desorption of DNA molecules on freshwater and marine sediments.

PubMed

Xue, J; Feng, Y

2018-06-01

Free DNA and its adsorption by sediment in the aquatic environment lead to ambiguity in the identification of recent faecal pollution sources. The goal of this study was to understand the mechanisms of DNA adsorption and desorption on aquatic sediment under various conditions using quantitative polymerase chain reaction (qPCR). Both raw sewage (RS) DNA and purified PCR product (PPP) were used in adsorption and desorption experiments; autoclaved freshwater and marine sediments served as sorbents. Thirty-six hours were needed for adsorption to reach equilibrium. More DNA was adsorbed on both sediments in stream water than in 5 mmol l -1 NaCl and DNA adsorption increased in the presence of Ca 2+ and Mg 2+ . Successive desorption experiments showed that between 5% and 22% of adsorbed DNA was desorbed. Organic matter and clay played a significant role in determining the DNA adsorption capacity on sediment. The data suggest the presence of multilayer adsorption. DNA molecules on sediments were mostly adsorbed through ligand binding rather than electrostatic binding. Quantitative polymerase chain reaction assays provide a better way to investigate the DNA adsorption and desorption mechanisms by sediment. DNA desorption can potentially complicate the outcomes of microbial source tracking studies. © 2018 The Society for Applied Microbiology.

Computational design of co-assembling protein-DNA nanowires

NASA Astrophysics Data System (ADS)

Mou, Yun; Yu, Jiun-Yann; Wannier, Timothy M.; Guo, Chin-Lin; Mayo, Stephen L.

2015-09-01

Biomolecular self-assemblies are of great interest to nanotechnologists because of their functional versatility and their biocompatibility. Over the past decade, sophisticated single-component nanostructures composed exclusively of nucleic acids, peptides and proteins have been reported, and these nanostructures have been used in a wide range of applications, from drug delivery to molecular computing. Despite these successes, the development of hybrid co-assemblies of nucleic acids and proteins has remained elusive. Here we use computational protein design to create a protein-DNA co-assembling nanomaterial whose assembly is driven via non-covalent interactions. To achieve this, a homodimerization interface is engineered onto the Drosophila Engrailed homeodomain (ENH), allowing the dimerized protein complex to bind to two double-stranded DNA (dsDNA) molecules. By varying the arrangement of protein-binding sites on the dsDNA, an irregular bulk nanoparticle or a nanowire with single-molecule width can be spontaneously formed by mixing the protein and dsDNA building blocks. We characterize the protein-DNA nanowire using fluorescence microscopy, atomic force microscopy and X-ray crystallography, confirming that the nanowire is formed via the proposed mechanism. This work lays the foundation for the development of new classes of protein-DNA hybrid materials. Further applications can be explored by incorporating DNA origami, DNA aptamers and/or peptide epitopes into the protein-DNA framework presented here.

Engineering DNA scaffolds for delivery of anticancer therapeutics.

PubMed

Sun, Wujin; Gu, Zhen

2015-07-01

Engineering DNA nanostructures with programmability in size, shape and surface chemistry holds tremendous promise in biomedical applications. As an emerging platform for drug delivery, DNA nanostructures have been extensively studied for delivering anticancer therapeutics, including small-molecule drug, nucleic acids and proteins. In this mini-review, current advances in utilizing DNA scaffolds as drug carriers for cancer treatment were summarized and future challenges were also discussed.

Single molecule analysis of Trypanosoma brucei DNA replication dynamics

PubMed Central

Calderano, Simone Guedes; Drosopoulos, William C.; Quaresma, Marina Mônaco; Marques, Catarina A.; Kosiyatrakul, Settapong; McCulloch, Richard; Schildkraut, Carl L.; Elias, Maria Carolina

2015-01-01

Eukaryotic genome duplication relies on origins of replication, distributed over multiple chromosomes, to initiate DNA replication. A recent genome-wide analysis of Trypanosoma brucei, the etiological agent of sleeping sickness, localized its replication origins to the boundaries of multigenic transcription units. To better understand genomic replication in this organism, we examined replication by single molecule analysis of replicated DNA. We determined the average speed of replication forks of procyclic and bloodstream form cells and we found that T. brucei DNA replication rate is similar to rates seen in other eukaryotes. We also analyzed the replication dynamics of a central region of chromosome 1 in procyclic forms. We present evidence for replication terminating within the central part of the chromosome and thus emanating from both sides, suggesting a previously unmapped origin toward the 5′ extremity of chromosome 1. Also, termination is not at a fixed location in chromosome 1, but is rather variable. Importantly, we found a replication origin located near an ORC1/CDC6 binding site that is detected after replicative stress induced by hydroxyurea treatment, suggesting it may be a dormant origin activated in response to replicative stress. Collectively, our findings support the existence of more replication origins in T. brucei than previously appreciated. PMID:25690894

Multiplex single-molecule interaction profiling of DNA barcoded proteins

PubMed Central

Gu, Liangcai; Li, Chao; Aach, John; Hill, David E.; Vidal, Marc; Church, George M.

2014-01-01

In contrast with advances in massively parallel DNA sequencing1, high-throughput protein analyses2-4 are often limited by ensemble measurements, individual analyte purification and hence compromised quality and cost-effectiveness. Single-molecule (SM) protein detection achieved using optical methods5 is limited by the number of spectrally nonoverlapping chromophores. Here, we introduce a single molecular interaction-sequencing (SMI-Seq) technology for parallel protein interaction profiling leveraging SM advantages. DNA barcodes are attached to proteins collectively via ribosome display6 or individually via enzymatic conjugation. Barcoded proteins are assayed en masse in aqueous solution and subsequently immobilized in a polyacrylamide (PAA) thin film to construct a random SM array, where barcoding DNAs are amplified into in situ polymerase colonies (polonies)7 and analyzed by DNA sequencing. This method allows precise quantification of various proteins with a theoretical maximum array density of over one million polonies per square millimeter. Furthermore, protein interactions can be measured based on the statistics of colocalized polonies arising from barcoding DNAs of interacting proteins. Two demanding applications, G-protein coupled receptor (GPCR) and antibody binding profiling, were demonstrated. SMI-Seq enables “library vs. library” screening in a one-pot assay, simultaneously interrogating molecular binding affinity and specificity. PMID:25252978

Poly(2-alkylacrylic acid) polymers deliver molecules to the cytosol by pH-sensitive disruption of endosomal vesicles.

PubMed

Jones, Rachel A; Cheung, Charles Y; Black, Fiona E; Zia, Jasmine K; Stayton, Patrick S; Hoffman, Allan S; Wilson, Mark R

2003-05-15

The permeability barrier posed by cell membranes represents a challenge for the delivery of hydrophilic molecules into cells. We previously proposed that poly(2-alkylacrylic acid)s are endocytosed by cells into acidified vesicles and are there triggered by low pH to disrupt membranes and release the contents of endosomes/lysosomes to the cytosol. If this hypothesis is correct, these polymers could be valuable in drug-delivery applications. The present paper reports functional comparisons of a family of three poly(2-alkylacrylic acid)s. Poly(2-propylacrylic acid) (PPAA), poly(2-ethylacrylic acid) (PEAA) and poly(2-methylacrylic acid) (PMAA) were compared in red-blood-cell haemolysis assays and in a lipoplex (liposome-DNA complex) assay. We also directly examined the ability of these polymers to disrupt endosomes and lysosomes in cultured human cells. Our results show that: (i) unlike membrane-disruptive peptides, the endosomal-disruptive ability of poly(2-alkylacrylic acid)s cannot necessarily be predicted from their haemolytic activity at low pH, (ii) PPAA (but not PEAA or PMAA) potently facilitates gene transfection by cationic lipoplexes and (iii) endocytosed poly(2-alkylacrylic acid)s are triggered by luminal acidification to selectively disrupt endosomes (not lysosomes) and release their contents to the cytosol. These results will facilitate the rational design of future endosomal-disrupting polymers for drug delivery.

Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein

NASA Astrophysics Data System (ADS)

Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.

2013-09-01

The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.

Conformational changes of the phenyl and naphthyl isocyanate-DNA adducts during DNA replication and by minor groove binding molecules

PubMed Central

Nakano, Shu-ichi; Uotani, Yuuki; Sato, Yuichi; Oka, Hirohito; Fujii, Masayuki; Sugimoto, Naoki

2013-01-01

DNA lesions produced by aromatic isocyanates have an extra bulky group on the nucleotide bases, with the capability of forming stacking interaction within a DNA helix. In this work, we investigated the conformation of the 2′-deoxyadenosine and 2′-deoxycytidine derivatives tethering a phenyl or naphthyl group, introduced in a DNA duplex. The chemical modification experiments using KMnO4 and 1-cyclohexyl-3 -(2-morpholinoethyl) carbodiimide metho-p-toluenesulfonate have shown that the 2′-deoxycytidine lesions form the base pair with guanine while the 2′-deoxyadenosine lesions have less ability of forming the base pair with thymine in solution. Nevertheless, the kinetic analysis shows that these DNA lesions are compatible with DNA ligase and DNA polymerase reactions, as much as natural DNA bases. We suggest that the adduct lesions have a capability of adopting dual conformations, depending on the difference in their interaction energies between stacking of the attached aromatic group and base pairing through hydrogen bonds. It is also presented that the attached aromatic groups change their orientation by interacting with the minor groove binding netropsin, distamycin and synthetic polyamide. The nucleotide derivatives would be useful for enhancing the phenotypic diversity of DNA molecules and for exploring new non-natural nucleotides. PMID:23873956

Circulating nucleic acids damage DNA of healthy cells by integrating into their genomes

PubMed Central

Mittra, Indraneel; Khare, Naveen Kumar; Raghuram, Gorantla Venkata; Chaubal, Rohan; Khambatti, Fatema; Gupta, Deepika; Gaikwad, Ashwini; Prasannan, Preeti; Singh, Akshita; Iyer, Aishwarya; Singh, Ankita; Upadhyay, Pawan; Nair, Naveen Kumar; Mishra, Pradyumna Kumar; Dutt, Amit

2018-01-01

Whether nucleic acids that circulate in blood have any patho-physiological functions in the host have not been explored. We report here that far from being inert molecules, circulating nucleic acids have significant biological activities of their own that are deleterious to healthy cells of the body. Fragmented DNA and chromatin (DNAfs and Cfs) isolated from blood of cancer patients and healthy volunteers are readily taken up by a variety of cells in culture to be localized in their nuclei within a few minutes. The intra-nuclear DNAfs and Cfs associate themselves with host cell chromosomes to evoke a cellular DNA-damage-repair-response (DDR) followed by their incorporation into the host cell genomes. Whole genome sequencing detected the presence of tens of thousands of human sequence reads in the recipient mouse cells. Genomic incorporation of DNAfs and Cfs leads to dsDNA breaks and activation of apoptotic pathways in the treated cells. When injected intravenously into Balb/C mice, DNAfs and Cfs undergo genomic integration into cells of their vital organs resulting in activation of DDR and apoptotic proteins in the recipient cells. Cfs have significantly greater activity than DNAfs with respect to all parameters examined, while both DNAfs and Cfs isolated from cancer patients are more active than those from normal volunteers. All the above pathological actions of DNAfs and Cfs described above can be abrogated by concurrent treatment with DNase I and/or anti-histone antibody complexed nanoparticles both in vitro and in vivo. Taken together, our results that circulating DNAfs and Cfs are physiological, continuously arising, endogenous DNA damaging agents with implications to ageing and a multitude of human pathologies including initiation of cancer. PMID:25740145

Binding mechanism of PicoGreen to DNA characterized by magnetic tweezers and fluorescence spectroscopy.

PubMed

Wang, Ying; Schellenberg, Helene; Walhorn, Volker; Toensing, Katja; Anselmetti, Dario

2017-09-01

Fluorescent dyes are broadly used in many biotechnological applications to detect and visualize DNA molecules. However, their binding to DNA alters the structural and nanomechanical properties of DNA and, thus, interferes with associated biological processes. In this work we employed magnetic tweezers and fluorescence spectroscopy to investigate the binding of PicoGreen to DNA at room temperature in a concentration-dependent manner. PicoGreen is an ultrasensitive quinolinium nucleic acid stain exhibiting hardly any background signal from unbound dye molecules. By means of stretching and overwinding single, torsionally constrained, nick-free double-stranded DNA molecules, we acquired force-extension and supercoiling curves which allow quantifying DNA contour length, persistence length and other thermodynamical binding parameters, respectively. The results of our magnetic tweezers single-molecule binding study were well supported through analyzing the fluorescent spectra of stained DNA. On the basis of our work, we could identify a concentration-dependent bimodal binding behavior, where, apparently, PicoGreen associates to DNA as an intercalator and minor-groove binder simultaneously.

Preparation, Single-Molecule Manipulation, and Energy Transfer Investigation of a Polyfluorene-graft-DNA polymer.

PubMed

Madsen, Mikael; Christensen, Rasmus S; Krissanaprasit, Abhichart; Bakke, Mette R; Riber, Camilla F; Nielsen, Karina S; Zelikin, Alexander N; Gothelf, Kurt V

2017-08-04

Conjugated polymers have been intensively studied due to their unique optical and electronic properties combined with their physical flexibility and scalable bottom up synthesis. Although the bulk qualities of conjugated polymers have been extensively utilized in research and industry, the ability to handle and manipulate conjugated polymers at the nanoscale lacks significantly behind. Here, the toolbox for controlled manipulation of conjugated polymers was expanded through the synthesis of a polyfluorene-DNA graft-type polymer (poly(F-DNA)). The polymer possesses the characteristics associated with the conjugated polyfluorene backbone, but the protruding single-stranded DNA provides the material with an exceptional addressability. This study demonstrates controlled single-molecule patterning of poly(F-DNA), as well as energy transfer between two different polymer-DNA conjugates. Finally, highly efficient DNA-directed quenching of polyfluorene fluorescence was shown. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

DNA tetrominoes: the construction of DNA nanostructures using self-organised heterogeneous deoxyribonucleic acids shapes.

PubMed

Ong, Hui San; Rahim, Mohd Syafiq; Firdaus-Raih, Mohd; Ramlan, Effirul Ikhwan

2015-01-01

The unique programmability of nucleic acids offers alternative in constructing excitable and functional nanostructures. This work introduces an autonomous protocol to construct DNA Tetris shapes (L-Shape, B-Shape, T-Shape and I-Shape) using modular DNA blocks. The protocol exploits the rich number of sequence combinations available from the nucleic acid alphabets, thus allowing for diversity to be applied in designing various DNA nanostructures. Instead of a deterministic set of sequences corresponding to a particular design, the protocol promotes a large pool of DNA shapes that can assemble to conform to any desired structures. By utilising evolutionary programming in the design stage, DNA blocks are subjected to processes such as sequence insertion, deletion and base shifting in order to enrich the diversity of the resulting shapes based on a set of cascading filters. The optimisation algorithm allows mutation to be exerted indefinitely on the candidate sequences until these sequences complied with all the four fitness criteria. Generated candidates from the protocol are in agreement with the filter cascades and thermodynamic simulation. Further validation using gel electrophoresis indicated the formation of the designed shapes. Thus, supporting the plausibility of constructing DNA nanostructures in a more hierarchical, modular, and interchangeable manner.

Integrity and Biological Activity of DNA after UV Exposure

NASA Astrophysics Data System (ADS)

Lyon, Delina Y.; Monier, Jean-Michel; Dupraz, Sébastien; Freissinet, Caroline; Simonet, Pascal; Vogel, Timothy M.

2010-04-01

The field of astrobiology lacks a universal marker with which to indicate the presence of life. This study supports the proposal to use nucleic acids, specifically DNA, as a signature of life (biosignature). In addition to its specificity to living organisms, DNA is a functional molecule that can confer new activities and characteristics to other organisms, following the molecular biology dogma, that is, DNA is transcribed to RNA, which is translated into proteins. Previous criticisms of the use of DNA as a biosignature have asserted that DNA molecules would be destroyed by UV radiation in space. To address this concern, DNA in plasmid form was deposited onto different surfaces and exposed to UVC radiation. The surviving DNA was quantified via the quantitative polymerase chain reaction (qPCR). Results demonstrate increased survivability of DNA attached to surfaces versus non-adsorbed DNA. The DNA was also tested for biological activity via transformation into the bacterium Acinetobacter sp. and assaying for antibiotic resistance conferred by genes encoded by the plasmid. The success of these methods to detect DNA and its gene products after UV exposure (254 nm, 3.5 J/m2s) not only supports the use of the DNA molecule as a biosignature on mineral surfaces but also demonstrates that the DNA retained biological activity.

Alteration in the contents of unsaturated fatty acids in dnaA mutants of Escherichia coli.

PubMed

Suzuki, E; Kondo, T; Makise, M; Mima, S; Sakamoto, K; Tsuchiya, T; Mizushima, T

1998-04-01

DnaA protein, the initiator of chromosomal DNA replication in Escherichia coli, has a high affinity for acidic phospholipids containing unsaturated fatty acids. We have examined here the fatty acid composition of phospholipids in dnaA mutants. A temperature-sensitive dnaA46 mutant showed a lower level of unsaturation of fatty acids (ratio of unsaturated to saturated fatty acids) at 42 degrees C (non-permissive temperature) and at 37 degrees C (semi-permissive temperature), but not at 28 degrees C (permissive temperature), compared with the wild-type strain. Plasmid complementation analysis revealed that the dnaA46 mutation is responsible for the phenotype. Other temperature-sensitive dnaA mutants showed similar results. On the other hand, a cold-sensitive dnaAcos mutant, in which over-initiation of DNA replication occurs at low temperature (28 degrees C), showed a higher level of unsaturation of fatty acids at 28 degrees C. Based on these observations, we discuss the role of phospholipids in the regulation of the activity of DnaA protein.

DNA - peptide polyelectrolyte complexes: Phase control by hybridization

NASA Astrophysics Data System (ADS)

Vieregg, Jeffrey; Lueckheide, Michael; Marciel, Amanda; Leon, Lorraine; Tirrell, Matthew

DNA is one of the most highly-charged molecules known, and interacts strongly with charged molecules in the cell. Condensation of long double-stranded DNA is one of the classic problems of biophysics, but the polyelectrolyte behavior of short and/or single-stranded nucleic acids has attracted far less study despite its importance for both biological and engineered systems. We report here studies of DNA oligonucleotides complexed with cationic peptides and polyamines. As seen previously for longer sequences, double-stranded oligonucleotides form solid precipitates, but single-stranded oligonucleotides instead undergo liquid-liquid phase separation to form coacervate droplets. Complexed oligonucleotides remain competent for hybridization, and display sequence-dependent environmental response. We observe similar behavior for RNA oligonucleotides, and methylphosphonate substitution of the DNA backbone indicates that nucleic acid charge density controls whether liquid or solid complexes are formed. Liquid-liquid phase separations of this type have been implicated in formation of membraneless organelles in vivo, and have been suggested as protocells in early life scenarios; oligonucleotides offer an excellent method to probe the physics controlling these phenomena.

Nucleic Acid-Based Cross-Linking Assay for Detection and Quantification of Hepatitis B Virus DNA

PubMed Central

Lai, Vicky C. H.; Guan, Richard; Wood, Michael L.; Lo, Su Kong; Yuen, Man-Fung; Lai, Ching-Lung

1999-01-01

A nucleic acid photo-cross-linking technology was used to develop a direct assay for the quantification of hepatitis B virus (HBV) DNA levels in serum. Cross-linker-modified DNA probes complementary to the viral genomes of the major HBV subtypes were synthesized and used in an assay that could be completed in less than 6 h. The quantification range of the assay, as determined by testing serial dilutions of Eurohep HBV reference standards and cloned HBV DNA, was 5 × 105 to 3 × 109 molecules of HBV DNA/ml of serum. Within-run and between-run coefficients of variation (CVs) for the assay were 4.3 and 4.0%, respectively. The assay was used to determine HBV DNA levels in 302 serum samples, and the results were compared to those obtained after testing the same samples with the Chiron branched-DNA (bDNA) assay for HBV DNA. Of the samples tested, 218 were positive for HBV DNA by both assays and 72 gave results below the cutoff for both assays. Of the remaining 12 samples, 10 were positive for HBV DNA by the cross-linking assay only; the 2 other samples were positive by the bDNA assay only. Twenty-eight samples had to be retested by the bDNA assay (CV, >20% between the results obtained from the testing of each sample in duplicate), whereas only three samples required retesting by the cross-linking assay. The correlation between the HBV DNA levels, as measured by the two tests, was very high (r = 0.902; P = 0.01). We conclude that the cross-linking assay is a sensitive and reproducible method for the detection and quantification of HBV DNA levels in serum. PMID:9854083

Down-regulation of increased TRAF6 expression in the peripheral mononuclear cells of patients with primary Sjögren's syndrome by an EBV-EBER1-specific synthetic single-stranded complementary DNA molecule.

PubMed

Sipka, Sándor; Zilahi, Erika; Papp, Gábor; Chen, Ji-Qing; Nagy, Andrea; Hegyi, Katalin; Kónya, József; Zeher, Margit

2017-05-01

We described earlier a simultaneously increased that the increased expression of miRNA-146a/b was accompanied by an increase in the expression of and TRAF6 and a decrease in the expression of IRAK1 genes in the peripheral mononuclear cells (PBMCs) of patients with primary Sjogren's syndrome (pSS) patients. Recently, the expression of EBV encoded. RNA (EBER) was published in the B cells of salivary glands of in pSS. In the present study, we applied an EBV-EBER1 specific synthetic single stranded complementary DNA molecule (EBV-EBER1-cDNA) to test whether any EBER1 related effect exists also in PBMCs of pSS patients. In the PBMCs of pSS patients and healthy controls, we investigated in vitro the effects of a synthetic single stranded EBV-EBER1-cDNA molecule, synthetic double-stranded (ds)RNA polyinosinic-polycytidylic acid [poly (I:C)] and polyadenylic acid potassium salt poly-adenylic acid [poly-(A)] on the expression of TRAF6 gene tested by qRTPCR. The release of interferon -α was detected by ELISA. EBV-EBER1-cDNA resulted in a significant reduction in the expression of TRAF6 in the cells of patients, but in the healthy controls not, whereas the treatments with poly (I:C) and poly-(A) could not reduce the TRAF6 over-expression. No release of EBER1 could be observed in the culture supernatants of patients with pSS. Only the treatment with poly (I:C) resulted in a significant increase of interferon -α release, and only in the heathy controls. No release of EBER1 molecules took place during the culturing of cells. EBV-EBER- cDNA acted functionally on the cells of patients only. These findings give a further evidence of the linkage between EBV and pSS, furthermore, they show the possible role of EBV-EBER1 in the induction of increased TRAF6 expression in the peripheral B cells of Sjögren's patients. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.

Modeling DNA methylation by analyzing the individual configurations of single molecules

PubMed Central

Affinito, Ornella; Scala, Giovanni; Palumbo, Domenico; Florio, Ermanno; Monticelli, Antonella; Miele, Gennaro; Avvedimento, Vittorio Enrico; Usiello, Alessandro; Chiariotti, Lorenzo; Cocozza, Sergio

2016-01-01

ABSTRACT DNA methylation is often analyzed by reporting the average methylation degree of each cytosine. In this study, we used a single molecule methylation analysis in order to look at the methylation conformation of individual molecules. Using D-aspartate oxidase as a model gene, we performed an in-depth methylation analysis through the developmental stages of 3 different mouse tissues (brain, lung, and gut), where this gene undergoes opposite methylation destiny. This approach allowed us to track both methylation and demethylation processes at high resolution. The complexity of these dynamics was markedly simplified by introducing the concept of methylation classes (MCs), defined as the number of methylated cytosines per molecule, irrespective of their position. The MC concept smooths the stochasticity of the system, allowing a more deterministic description. In this framework, we also propose a mathematical model based on the Markov chain. This model aims to identify the transition probability of a molecule from one MC to another during methylation and demethylation processes. The results of our model suggest that: 1) both processes are ruled by a dominant class of phenomena, namely, the gain or loss of one methyl group at a time; and 2) the probability of a single CpG site becoming methylated or demethylated depends on the methylation status of the whole molecule at that time. PMID:27748645

Carbon Nanotube Biosensors for Space Molecule Detection and Clinical Molecular Diagnostics

NASA Technical Reports Server (NTRS)

Han, Jie

2001-01-01

Both space molecule detection and clinical molecule diagnostics need to develop ultra sensitive biosensors for detection of less than attomole molecules such as amino acids for DNA. However all the electrode sensor systems including those fabricated from the existing carbon nanotubes, have a background level of nA (nanoAmp). This has limited DNA or other molecule detection to nA level or molecules whose concentration is, much higher than attomole level. A program has been created by NASA and NCI (National Cancer Institute) to exploit the possibility of carbon nanotube based biosensors to solve this problem for both's interest. In this talk, I will present our effort on the evaluation and novel design of carbon nanotubes as electrode biosensors with strategies to minimize background currents while maximizing signal intensity.The fabrication of nanotube electrode arrays, immobilization of molecular probes on nanotube electrodes and in vitro biosensor testing will also be discussed.

In Vitro Selection for Small-Molecule-Triggered Strand Displacement and Riboswitch Activity.

PubMed

Martini, Laura; Meyer, Adam J; Ellefson, Jared W; Milligan, John N; Forlin, Michele; Ellington, Andrew D; Mansy, Sheref S

2015-10-16

An in vitro selection method for ligand-responsive RNA sensors was developed that exploited strand displacement reactions. The RNA library was based on the thiamine pyrophosphate (TPP) riboswitch, and RNA sequences capable of hybridizing to a target duplex DNA in a TPP regulated manner were identified. After three rounds of selection, RNA molecules that mediated a strand exchange reaction upon TPP binding were enriched. The enriched sequences also showed riboswitch activity. Our results demonstrated that small-molecule-responsive nucleic acid sensors can be selected to control the activity of target nucleic acid circuitry.

Nanopores and nucleic acids: prospects for ultrarapid sequencing

NASA Technical Reports Server (NTRS)

Deamer, D. W.; Akeson, M.

2000-01-01

DNA and RNA molecules can be detected as they are driven through a nanopore by an applied electric field at rates ranging from several hundred microseconds to a few milliseconds per molecule. The nanopore can rapidly discriminate between pyrimidine and purine segments along a single-stranded nucleic acid molecule. Nanopore detection and characterization of single molecules represents a new method for directly reading information encoded in linear polymers. If single-nucleotide resolution can be achieved, it is possible that nucleic acid sequences can be determined at rates exceeding a thousand bases per second.

DNA adsorption to and elution from silica surfaces: influence of amino acid buffers.

PubMed

Vandeventer, Peter E; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S; Niemz, Angelika

2013-09-19

Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction.

DNA Adsorption to and Elution from Silica Surfaces: Influence of Amino Acid Buffers

PubMed Central

Vandeventer, Peter E.; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S.; Niemz, Angelika

2014-01-01

Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed, and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction. PMID:23931415

Topology simplification: Important biological phenomenon or evolutionary relic?. Comment on "Disentangling DNA molecules" by Alexander Vologodskii

NASA Astrophysics Data System (ADS)

Bates, Andrew D.; Maxwell, Anthony

2016-09-01

The review, Disentangling DNA molecules[1], gives an excellent technical description of the phenomenon of topology simplification (TS) by type IIA DNA topoisomerases (topos). In the 20 years since its discovery [2], this effect has attracted a good deal of attention, probably because of its apparently magical nature, and because it seemed to offer a solution to the conundrum that all type II topos rely on ATP hydrolysis, but only bacterial DNA gyrases were known to transduce the free energy of hydrolysis into torsion (supercoiling) in the DNA. It made good sense to think that the other enzymes are using the energy to reduce the level of supercoiling, knotting, and particularly decatenation (unlinking), below equilibrium, since the key activity of the non-supercoiling topos is the removal of links between daughter chromosomes [3]. As Vologodskii discusses [1], there have been a number of theoretical models developed to explain how the local effect of a type II topo can influence the global level of knotting and catenation in large DNA molecules, and he explains how features of two of the most successful models (bent G segment and hooked juxtapositions) may be combined to explain the magnitude of the effect and overcome a kinetic problem with the hooked juxtaposition model.

Another expert system rule inference based on DNA molecule logic gates

NASA Astrophysics Data System (ADS)

WÄ siewicz, Piotr

2013-10-01

With the help of silicon industry microfluidic processors were invented utilizing nano membrane valves, pumps and microreactors. These so called lab-on-a-chips combined together with molecular computing create molecular-systems-ona- chips. This work presents a new approach to implementation of molecular inference systems. It requires the unique representation of signals by DNA molecules. The main part of this work includes the concept of logic gates based on typical genetic engineering reactions. The presented method allows for constructing logic gates with many inputs and for executing them at the same quantity of elementary operations, regardless of a number of input signals. Every microreactor of the lab-on-a-chip performs one unique operation on input molecules and can be connected by dataflow output-input connections to other ones.

Acridine orange--its use in the specific staining of DNA in mammalian tissue sections.

PubMed

Dutt, M K

1981-01-01

This paper reports on a new method for the use of acridine orange (AO) in an aqueous solution at pH 4.5 for staining DNA of rat tissue sections from which RNA has been extracted selectively with cold phosphoric acid. Not only this, AO can also be used as dye-SO2 reagent, prepared with NHCl and potassium metabisulphite, for staining DNA-aldehyde molecules of acid-hydrolysed tissue sections. AO samples, manufactured by the National Aniline Division as well as by G. T. Gurr have been used with equal success. Studies of stained sections under light microscope reveal the presence of specifically stained yellowish-orange nuclei. Those sections under fluorescent microscope with proper exciter and barrier filters reveal nuclei of maroon colour. The in situ absorption spectra of nuclei stained with AO-SO2 following acid-hydrolysis of tissue sections as well as those of nuclei stained with an aqueous solution of the dye following extraction of RNA have been presented herein. The mode of binding in the former case has been considered to be due to binding of the teritary amino group of the dye molecules with the DNA-aldehyde molecules and in the latter case to be due to electrostatic binding between the positively charged dye molecules with negatively charged phosphate groups of DNA. Implications of all these findings have been discussed.

Small-molecule inhibitors of DNA damage-repair pathways: an approach to overcome tumor resistance to alkylating anticancer drugs

PubMed Central

Srinivasan, Ajay; Gold, Barry

2013-01-01

A major challenge in the future development of cancer therapeutics is the identification of biological targets and pathways, and the subsequent design of molecules to combat the drug-resistant cells hiding in virtually all cancers. This therapeutic approach is justified based upon the limited advances in cancer cures over the past 30 years, despite the development of many novel chemotherapies and earlier detection, which often fail due to drug resistance. Among the various targets to overcome tumor resistance are the DNA repair systems that can reverse the cytotoxicity of many clinically used DNA-damaging agents. Some progress has already been made but much remains to be done. We explore some components of the DNA-repair process, which are involved in repair of alkylation damage of DNA, as targets for the development of novel and effective molecules designed to improve the efficacy of existing anticancer drugs. PMID:22709253

Highly sensitive detection of mutations in CHO cell recombinant DNA using multi-parallel single molecule real-time DNA sequencing.

PubMed

Cartwright, Joseph F; Anderson, Karin; Longworth, Joseph; Lobb, Philip; James, David C

2018-06-01

High-fidelity replication of biologic-encoding recombinant DNA sequences by engineered mammalian cell cultures is an essential pre-requisite for the development of stable cell lines for the production of biotherapeutics. However, immortalized mammalian cells characteristically exhibit an increased point mutation frequency compared to mammalian cells in vivo, both across their genomes and at specific loci (hotspots). Thus unforeseen mutations in recombinant DNA sequences can arise and be maintained within producer cell populations. These may affect both the stability of recombinant gene expression and give rise to protein sequence variants with variable bioactivity and immunogenicity. Rigorous quantitative assessment of recombinant DNA integrity should therefore form part of the cell line development process and be an essential quality assurance metric for instances where synthetic/multi-component assemblies are utilized to engineer mammalian cells, such as the assessment of recombinant DNA fidelity or the mutability of single-site integration target loci. Based on Pacific Biosciences (Menlo Park, CA) single molecule real-time (SMRT™) circular consensus sequencing (CCS) technology we developed a rDNA sequence analysis tool to process the multi-parallel sequencing of ∼40,000 single recombinant DNA molecules. After statistical filtering of raw sequencing data, we show that this analytical method is capable of detecting single point mutations in rDNA to a minimum single mutation frequency of 0.0042% (<1/24,000 bases). Using a stable CHO transfectant pool harboring a randomly integrated 5 kB plasmid construct encoding GFP we found that 28% of recombinant plasmid copies contained at least one low frequency (<0.3%) point mutation. These mutations were predominantly found in GC base pairs (85%) and that there was no positional bias in mutation across the plasmid sequence. There was no discernable difference between the mutation frequencies of coding and non

Effect of DNA-CTMA complex on optical properties of LDS 821 dye

NASA Astrophysics Data System (ADS)

Udayan, Sony; Ramachandran, Vijesh Kavumoottil; Sebastian, Mathew; Chandran, Pradeep; Nampoori, Vadakkedath Parameswaran Narayanan; Thomas, Sheenu

2017-07-01

We have investigated the fluorescence behavior of LDS 821 dye (Styryl 9 M) with deoxyribonucleic acid attached with cetyltrimethyl-ammonium (DNA-CTMA). Optical absorption studies confirm the intercalation of the dye molecules with DNA-CTMA. Fluorescence studies show an enhancement of fluorescence intensity of dye with DNA-CTMA, which suggest the reduction of TICT states of the dye molecule. The FWHM of the fluorescence spectrum increases from 95 nm to 161 nm indicating the formation of new energy levels when DNA-CTMA forms a complex with LDS 821 dye. Fluorescence lifetime measurements shows that lifetime of LDS 821 varies from 507ps to 953 ps with the addition of DNA-CTMA, which also confirms the deactivation of TICT states of dye molecule. Results show that the incorporation of DNA-CTMA with LDS 821 dye improves the optical characteristics of LDS 821 dye and therefore, can be used as a good fluorescence probe for DNA visualization as well as in lasing applications.

Four-color single-molecule fluorescence with noncovalent dye labeling to monitor dynamic multimolecular complexes.

PubMed

DeRocco, Vanessa; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A; Weninger, Keith

2010-11-01

To enable studies of conformational changes within multimolecular complexes, we present a simultaneous, four-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera-based, wide-field detection. We further demonstrate labeling histidine-tagged proteins noncovalently with Tris-nitrilotriacetic acid (Tris-NTA)-conjugated dyes to achieve single molecule detection. We combine these methods to colocalize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes.

Four-color single molecule fluorescence with noncovalent dye labeling to monitor dynamic multimolecular complexes

PubMed Central

DeRocco, Vanessa C.; Anderson, Trevor; Piehler, Jacob; Erie, Dorothy A.; Weninger, Keith

2010-01-01

To allow studies of conformational changes within multi-molecular complexes, we present a simultaneous, 4-color single molecule fluorescence methodology implemented with total internal reflection illumination and camera based, wide-field detection. We further demonstrate labeling histidine-tagged proteins non-covalently with tris-Nitrilotriacetic acid (tris-NTA) conjugated dyes to achieve single molecule detection. We combine these methods to co-localize the mismatch repair protein MutSα on DNA while monitoring MutSα-induced DNA bending using Förster resonance energy transfer (FRET) and to monitor assembly of membrane-tethered SNARE protein complexes. PMID:21091445

Protein Detection via Direct Enzymatic Amplification of Short DNA Aptamers

PubMed Central

Fischer, Nicholas O.; Tarasow, Theodore M.; Tok, Jeffrey B.-H.

2008-01-01

Aptamers are single-stranded nucleic acids that fold into defined tertiary structures to bind target molecules with high specificities and affinities. DNA aptamers have garnered much interest as recognition elements for biodetection and diagnostic applications due to their small size, ease of discovery and synthesis, and chemical and thermal stability. Herein, we describe the design and application of a short DNA molecule capable of both protein target binding and amplifiable bioreadout processes. As both recognition and readout capabilities are incorporated into a single DNA molecule, tedious conjugation procedures required for protein-DNA hybrids can be omitted. The DNA aptamer is designed to be amplified directly by either the polymerase chain reaction (PCR) or rolling circle amplification (RCA) processes, taking advantage of real-time amplification monitoring techniques for target detection. A combination of both RCA and PCR provides a wide protein target dynamic range (1 μM to 10 pM). PMID:17980857

Diffusivity of dicarboxylic acids molecules to secondary organic material governed by particle phase state

NASA Astrophysics Data System (ADS)

Han, Y.; Gong, Z.; Liu, P.; de Sá, S. S.; McKinney, K. A.; Martin, S. T.

2017-12-01

Atmospheric secondary organic material (SOM) from oxidation of volatile organic compounds can exist in amorphous solid, semisolid, and liquid states depending on a range of factors such as relative humidity (RH), temperature, and reaction history. The phase state of SOM affects the dynamic exchange and reactivity between particles and gas-phase molecules. Dicarboxylic acids are ubiquitous in ambient atmosphere and the uptake of which may lead to substantial changes in hygroscopicity, absorption property, and light scattering of aerosol particles. This study investigates the diffusivity of dicarboxylic acids to the matrix of SOM particles. SOM was generated from dark ozonolysis of a-pinene in Harvard Environmental Chamber. The produced SOM particles were passed through an ozone scrubber to remove gas-phase chemistry before being led into a flask reactor, where gas-phase dicarboxylic acid was injected continuously and RH was varied from 5% to 85%. The probe dicarboxylic acids molecules including malonic acid and a-ketoglutaric acid have been investigated for the uptake to SOM particles. Organic composition in the outflow of the flask was measured with a high-resolution time-of-flight aerosol mass spectrometer. The mass fractions of tracer ions in total organic mass for both malonic acid and a-ketoglutaric acid increased substantially with the increase of RH values. The tracer ions of malonic acid were also more abundant in a-pinene SOM particles with increased gas-phase concentrations. These results suggest that the diffusion of the studied dicarboxylic acids molecules to a-pinene SOM particles was enhanced at increased RH values, which is possibly due to the phase transition of a-pinene SOM particles from non-liquid to liquid states. Therefore, particle phase state may be an important factor governing the diffusivity of dicarboxylic acids molecules to a-pinene SOM. Further dicarboxylic acids with various functional groups will be investigated to understand the

Molecular population dynamics of DNA structures in a bcl-2 promoter sequence is regulated by small molecules and the transcription factor hnRNP LL

PubMed Central

Cui, Yunxi; Koirala, Deepak; Kang, HyunJin; Dhakal, Soma; Yangyuoru, Philip; Hurley, Laurence H.; Mao, Hanbin

2014-01-01

Minute difference in free energy change of unfolding among structures in an oligonucleotide sequence can lead to a complex population equilibrium, which is rather challenging for ensemble techniques to decipher. Herein, we introduce a new method, molecular population dynamics (MPD), to describe the intricate equilibrium among non-B deoxyribonucleic acid (DNA) structures. Using mechanical unfolding in laser tweezers, we identified six DNA species in a cytosine (C)-rich bcl-2 promoter sequence. Population patterns of these species with and without a small molecule (IMC-76 or IMC-48) or the transcription factor hnRNP LL are compared to reveal the MPD of different species. With a pattern recognition algorithm, we found that IMC-48 and hnRNP LL share 80% similarity in stabilizing i-motifs with 60 s incubation. In contrast, IMC-76 demonstrates an opposite behavior, preferring flexible DNA hairpins. With 120–180 s incubation, IMC-48 and hnRNP LL destabilize i-motifs, which has been previously proposed to activate bcl-2 transcriptions. These results provide strong support, from the population equilibrium perspective, that small molecules and hnRNP LL can modulate bcl-2 transcription through interaction with i-motifs. The excellent agreement with biochemical results firmly validates the MPD analyses, which, we expect, can be widely applicable to investigate complex equilibrium of biomacromolecules. PMID:24609386

Arachidonic and oleic acid exert distinct effects on the DNA methylome

PubMed Central

Silva-Martínez, Guillermo A.; Rodríguez-Ríos, Dalia; Alvarado-Caudillo, Yolanda; Vaquero, Alejandro; Esteller, Manel; Carmona, F. Javier; Moran, Sebastian; Nielsen, Finn C.; Wickström-Lindholm, Marie; Wrobel, Katarzyna; Wrobel, Kazimierz; Barbosa-Sabanero, Gloria; Zaina, Silvio; Lund, Gertrud

2016-01-01

ABSTRACT Abnormal fatty acid metabolism and availability are landmarks of metabolic diseases, which in turn are associated with aberrant DNA methylation profiles. To understand the role of fatty acids in disease epigenetics, we sought DNA methylation profiles specifically induced by arachidonic (AA) or oleic acid (OA) in cultured cells and compared those with published profiles of normal and diseased tissues. THP-1 monocytes were stimulated with AA or OA and analyzed using Infinium HumanMethylation450 BeadChip (Illumina) and Human Exon 1.0 ST array (Affymetrix). Data were corroborated in mouse embryonic fibroblasts. Comparisons with publicly available data were conducted by standard bioinformatics. AA and OA elicited a complex response marked by a general DNA hypermethylation and hypomethylation in the 1–200 μM range, respectively, with a maximal differential response at the 100 μM dose. The divergent response to AA and OA was prominent within the gene body of target genes, where it correlated positively with transcription. AA-induced DNA methylation profiles were similar to the corresponding profiles described for palmitic acid, atherosclerosis, diabetes, obesity, and autism, but relatively dissimilar from OA-induced profiles. Furthermore, human atherosclerosis grade-associated DNA methylation profiles were significantly enriched in AA-induced profiles. Biochemical evidence pointed to β-oxidation, PPAR-α, and sirtuin 1 as important mediators of AA-induced DNA methylation changes. In conclusion, AA and OA exert distinct effects on the DNA methylome. The observation that AA may contribute to shape the epigenome of important metabolic diseases, supports and expands current diet-based therapeutic and preventive efforts. PMID:27088456

Enantiomer analysis of chiral carboxylic acids by AIE molecules bearing optically pure aminol groups.

PubMed

Zheng, Yan-Song; Hu, Yu-Jian; Li, Dong-Mi; Chen, Yi-Chang

2010-01-15

Pure enantiomers of carboxylic acids are a class of important biomolecules, chiral drugs, chiral reagents, etc. Analysis of the enantiomers usually needs expensive instrument or complex chiral receptors. However, to develop simple and reliable methods for the enantiomer analysis of acids is difficult. In this paper, chiral recognition of 2,3-dibenzoyltartaric acid and mandelic acid was first carried out by aggregation-induced emission molecules bearing optically pure aminol group, which was easily synthesized. The chiral recognition is not only seen by naked eyes but also measured by fluorophotometer. The difference of fluorescence intensity between the two enantiomers of the acids aroused by the aggregation-induced emission molecules was up to 598. The chiral recognition could be applied to quantitative analysis of enantiomer content of chiral acids. More chiral AIE amines need to be developed for enantiomer analysis of more carboxylic acids.

Ursolic Acid-Regulated Energy Metabolism—Reliever or Propeller of Ultraviolet-Induced Oxidative Stress and DNA Damage?

PubMed Central

Lee, Yuan-Hao; Sun, Youping; Glickman, Randolph D.

2014-01-01

Ultraviolet (UV) light is a leading cause of diseases, such as skin cancers and cataracts. A main process mediating UV-induced pathogenesis is the production of reactive oxygen species (ROS). Excessive ROS levels induce the formation of DNA adducts (e.g., pyrimidine dimers) and result in stalled DNA replication forks. In addition, ROS promotes phosphorylation of tyrosine kinase-coupled hormone receptors and alters downstream energy metabolism. With respect to the risk of UV-induced photocarcinogenesis and photodamage, the antitumoral and antioxidant functions of natural compounds become important for reducing UV-induced adverse effects. One important question in the field is what determines the differential sensitivity of various types of cells to UV light and how exogenous molecules, such as phytochemicals, protect normal cells from UV-inflicted damage while potentiating tumor cell death, presumably via interaction with intracellular target molecules and signaling pathways. Several endogenous molecules have emerged as possible players mediating UV-triggered DNA damage responses. Specifically, UV activates the PIKK (phosphatidylinositol 3-kinase-related kinase) family members, which include DNA-PKcs, ATM (ataxia telangiectasia mutated) and mTOR (mammalian target of rapamycin), whose signaling can be affected by energy metabolism; however, it remains unclear to what extent the activation of hormone receptors regulates PIKKs and whether this crosstalk occurs in all types of cells in response to UV. This review focuses on proteomic descriptions of the relationships between cellular photosensitivity and the phenotypic expression of the insulin/insulin-like growth receptor. It covers the cAMP-dependent pathways, which have recently been shown to regulate the DNA repair machinery through interactions with the PIKK family members. Finally, this review provides a strategic illustration of how UV-induced mitogenic activity is modulated by the insulin sensitizer, ursolic

Quantification of DNA-associated proteins inside eukaryotic cells using single-molecule localization microscopy

PubMed Central

Etheridge, Thomas J.; Boulineau, Rémi L.; Herbert, Alex; Watson, Adam T.; Daigaku, Yasukazu; Tucker, Jem; George, Sophie; Jönsson, Peter; Palayret, Matthieu; Lando, David; Laue, Ernest; Osborne, Mark A.; Klenerman, David; Lee, Steven F.; Carr, Antony M.

2014-01-01

Development of single-molecule localization microscopy techniques has allowed nanometre scale localization accuracy inside cells, permitting the resolution of ultra-fine cell structure and the elucidation of crucial molecular mechanisms. Application of these methodologies to understanding processes underlying DNA replication and repair has been limited to defined in vitro biochemical analysis and prokaryotic cells. In order to expand these techniques to eukaryotic systems, we have further developed a photo-activated localization microscopy-based method to directly visualize DNA-associated proteins in unfixed eukaryotic cells. We demonstrate that motion blurring of fluorescence due to protein diffusivity can be used to selectively image the DNA-bound population of proteins. We designed and tested a simple methodology and show that it can be used to detect changes in DNA binding of a replicative helicase subunit, Mcm4, and the replication sliding clamp, PCNA, between different stages of the cell cycle and between distinct genetic backgrounds. PMID:25106872

Synthesis, spectroscopic characterization and in vitro antimicrobial, anticancer and antileishmanial activities as well interaction with Salmon sperm DNA of newly synthesized carboxylic acid derivative, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid

NASA Astrophysics Data System (ADS)

Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed

2015-03-01

This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR (1H, and 13C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular Osbnd H⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0 μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.

Alteration in levels of unsaturated fatty acids in mutants of Escherichia coli defective in DNA replication.

PubMed

Suzuki, E; Kondo, T; Makise, M; Mima, S; Sakamoto, K; Tsuchiya, T; Mizushima, T

1998-07-01

We previously reported that mutations in the dnaA gene which encodes the initiator of chromosomal DNA replication in Escherichia coli caused an alteration in the levels of unsaturated fatty acids of phospholipids in membranes. In this study, we examined fatty acid compositions in other mutants which are defective in DNA replication. As in the case of temperature-sensitive dnaA mutants, temperature-sensitive dnaC and dnaE mutants, which have defects in initiation and elongation, respectively, of DNA replication showed a lower level of unsaturation of fatty acids (ratio of unsaturated to saturated fatty acids) compared with the wild-type strain, especially at high temperatures. On the other hand, temperature-sensitive mutants defective in cellular processes other than DNA replication, such as RNA synthesis and cell division, did not show a lower level of unsaturation of fatty acids compared with the wild-type strain. These results suggest that the inhibition of DNA replication causes a lower level of unsaturation of fatty acids in Escherichia coli cells.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets.

PubMed

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-10-30

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 x 10(8) bound targets per cm(2) sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format.

Switchable DNA interfaces for the highly sensitive detection of label-free DNA targets

PubMed Central

Rant, Ulrich; Arinaga, Kenji; Scherer, Simon; Pringsheim, Erika; Fujita, Shozo; Yokoyama, Naoki; Tornow, Marc; Abstreiter, Gerhard

2007-01-01

We report a method to detect label-free oligonucleotide targets. The conformation of surface-tethered probe nucleic acids is modulated by alternating electric fields, which cause the molecules to extend away from or fold onto the biased surface. Binding (hybridization) of targets to the single-stranded probes results in a pronounced enhancement of the layer-height modulation amplitude, monitored optically in real time. The method features an exceptional detection limit of <3 × 108 bound targets per cm2 sensor area. Single base-pair mismatches in the sequences of DNA complements may readily be identified; moreover, binding kinetics and binding affinities can be determined with high accuracy. When driving the DNA to oscillate at frequencies in the kHz regime, distinct switching kinetics are revealed for single- and double-stranded DNA. Molecular dynamics are used to identify the binding state of molecules according to their characteristic kinetic fingerprints by using a chip-compatible detection format. PMID:17951434

Interactions of DNA binding proteins with G-Quadruplex structures at the single molecule level

NASA Astrophysics Data System (ADS)

Ray, Sujay

Guanine-rich nucleic acid (DNA/RNA) sequences can form non-canonical secondary structures, known as G-quadruplex (GQ). Numerous in vivo and in vitro studies have demonstrated formation of these structures in telomeric and non-telomeric regions of the genome. Telomeric GQs protect the chromosome ends whereas non-telomeric GQs either act as road blocks or recognition sites for DNA metabolic machinery. These observations suggest the significance of these structures in regulation of different metabolic processes, such as replication and repair. GQs are typically thermodynamically more stable than the corresponding Watson-Crick base pairing formed by G-rich and C-rich strands, making protein activity a crucial factor for their destabilization. Inside the cell, GQs interact with different proteins and their enzymatic activity is the determining factor for their stability. We studied interactions of several proteins with GQs to understand the underlying principles of protein-GQ interactions using single-molecule FRET and other biophysical techniques. Replication Protein-A (RPA), a single stranded DNA (ssDNA) binding protein, is known to posses GQ unfolding activity. First, we compared the thermal stability of three potentially GQ-forming DNA sequences (PQS) to their stability against RPA-mediated unfolding. One of these sequences is the human telomeric repeat and the other two, located in the promoter region of tyrosine hydroxylase gene, are highly heterogeneous sequences that better represent PQS in the genome. The thermal stability of these structures do not necessarily correlate with their stability against protein-mediated unfolding. We conclude that thermal stability is not necessarily an adequate criterion for predicting the physiological viability of GQ structures. To determine the critical structural factors that influence protein-GQ interactions we studied two groups of GQ structures that have systematically varying loop lengths and number of G-tetrad layers. We

Simultaneous Single-Molecule Force and Fluorescence Sampling of DNA Nanostructure Conformations Using Magnetic Tweezers.

PubMed

Kemmerich, Felix E; Swoboda, Marko; Kauert, Dominik J; Grieb, M Svea; Hahn, Steffen; Schwarz, Friedrich W; Seidel, Ralf; Schlierf, Michael

2016-01-13

We present a hybrid single-molecule technique combining magnetic tweezers and Förster resonance energy transfer (FRET) measurements. Through applying external forces to a paramagnetic sphere, we induce conformational changes in DNA nanostructures, which are detected in two output channels simultaneously. First, by tracking a magnetic bead with high spatial and temporal resolution, we observe overall DNA length changes along the force axis. Second, the measured FRET efficiency between two fluorescent probes monitors local conformational changes. The synchronized orthogonal readout in different observation channels will facilitate deciphering the complex mechanisms of biomolecular machines.

Systematic evaluation and optimization of modification reactions of oligonucleotides with amines and carboxylic acids for the synthesis of DNA-encoded chemical libraries.

PubMed

Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario

2014-08-20

DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.

Method for nucleic acid hybridization using single-stranded DNA binding protein

DOEpatents

Tabor, Stanley; Richardson, Charles C.

1996-01-01

Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.

Extracting physical chemistry from mechanics: a new approach to investigate DNA interactions with drugs and proteins in single molecule experiments.

PubMed

Rocha, M S

2015-09-01

In this review we focus on the idea of establishing connections between the mechanical properties of DNA-ligand complexes and the physical chemistry of DNA-ligand interactions. This type of connection is interesting because it opens the possibility of performing a robust characterization of such interactions by using only one experimental technique: single molecule stretching. Furthermore, it also opens new possibilities in comparing results obtained by very different approaches, in particular when comparing single molecule techniques to ensemble-averaging techniques. We start the manuscript reviewing important concepts of DNA mechanics, from the basic mechanical properties to the Worm-Like Chain model. Next we review the basic concepts of the physical chemistry of DNA-ligand interactions, revisiting the most important models used to analyze the binding data and discussing their binding isotherms. Then, we discuss the basic features of the single molecule techniques most used to stretch DNA-ligand complexes and to obtain "force × extension" data, from which the mechanical properties of the complexes can be determined. We also discuss the characteristics of the main types of interactions that can occur between DNA and ligands, from covalent binding to simple electrostatic driven interactions. Finally, we present a historical survey of the attempts to connect mechanics to physical chemistry for DNA-ligand systems, emphasizing a recently developed fitting approach useful to connect the persistence length of DNA-ligand complexes to the physicochemical properties of the interaction. Such an approach in principle can be used for any type of ligand, from drugs to proteins, even if multiple binding modes are present.

Helical Structure Determines Different Susceptibilities of dsDNA, dsRNA, and tsDNA to Counterion-Induced Condensation

PubMed Central

Kornyshev, Alexei A.; Leikin, Sergey

2013-01-01

Recent studies of counterion-induced condensation of nucleic acid helices into aggregates produced several puzzling observations. For instance, trivalent cobalt hexamine ions condensed double-stranded (ds) DNA oligomers but not their more highly charged dsRNA counterparts. Divalent alkaline earth metal ions condensed triple-stranded (ts) DNA oligomers but not dsDNA. Here we show that these counterintuitive experimental results can be rationalized within the electrostatic zipper model of interactions between molecules with helical charge motifs. We report statistical mechanical calculations that reveal dramatic and nontrivial interplay between the effects of helical structure and thermal fluctuations on electrostatic interaction between oligomeric nucleic acids. Combining predictions for oligomeric and much longer helices, we also interpret recent experimental studies of the role of counterion charge, structure, and chemistry. We argue that an electrostatic zipper attraction might be a major or even dominant force in nucleic acid condensation. PMID:23663846

Synthesis, spectroscopic characterization, crystal structure, DNA interaction study and invitro biological screenings of 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid

NASA Astrophysics Data System (ADS)

Sirajuddin, Muhammad; Nooruddin; Ali, Saqib; McKee, Vickie; Khan, Shahan Zeb; Malook, Khan

2015-01-01

The titled compound, 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid was synthesized and characterized by various techniques like elemental analyses, FT-IR, NMR (1H, and 13C) and single crystal X-ray structural analysis. The appearance of the OH peak of the carboxylic acid in the FT-IR and NMR spectra conform the formation of the compound. A good agreement was found between the calculated values of C, H, N and found values in elemental analysis that show the purity of the compound. Protons H2 and H3 are in cis conformation with each other as conformed both from 1H NMR as well as from single crystal X-ray analysis. The molecular structure of the title compound, C10H10NO3Cl, is stabilized by short intramolecular Osbnd H- - -O hydrogen bonds within the molecule. In the crystal structure, intermolecular Nsbnd H- - -O hydrogen bonds link molecules into zigzag chains resulting in a dendrimer like structure. The title compound was screened for biological activities like interaction with DNA, cytotoxicity, antitumor and antioxidant activities. DNA interaction study reveals that the binding mode of interaction of the compound with SS-DNA is intercalative as it results in hypochromism along with significant red shift of 5 nm. It was also found to be effective antioxidant of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) and show almost comparable antioxidant activity to that of the standard and known antioxidant, ascorbic acid, at higher concentration. The antitumor activity data of the compound shows that it can be used as potent antitumor agent.

Interaction of plant cell signaling molecules, salicylic acid and jasmonic acid, with the mitochondria of Helicoverpa armigera.

PubMed

Akbar, S M D; Sharma, H C; Jayalakshmi, S K; Sreeramulu, K

2012-02-01

The cotton bollworm, Helicoverpa armigera is a polyphagous pest in Asia, Africa, and the Mediterranean Europe. Salicylic acid (SA) and jasmonic acid (JA) are the cell signaling molecules produced in response to insect attack in plants. The effect of these signaling molecules was investigated on the oxidative phosphorylation and oxidative stress of H. armigera. SA significantly inhibited the state III and state IV respiration, respiratory control index (RCI), respiratory complexes I and II, induced mitochondrial swelling, and cytochrome c release in vitro. Under in vivo conditions, SA induced state IV respiration as well as oxidative stress in time- and dose-dependent manner, and also inhibited the larval growth. In contrast, JA did not affect the mitochondrial respiration and oxidative stress. SA affected the growth and development of H. armigera, in addition to its function as signaling molecules involved in both local defense reactions at feeding sites and the induction of systemic acquired resistance in plants.

Single-molecule FRET studies of the cooperative and non-cooperative binding kinetics of the bacteriophage T4 single-stranded DNA binding protein (gp32) to ssDNA lattices at replication fork junctions

PubMed Central

Lee, Wonbae; Gillies, John P.; Jose, Davis; Israels, Brett A.; von Hippel, Peter H.; Marcus, Andrew H.

2016-01-01

Gene 32 protein (gp32) is the single-stranded (ss) DNA binding protein of the bacteriophage T4. It binds transiently and cooperatively to ssDNA sequences exposed during the DNA replication process and regulates the interactions of the other sub-assemblies of the replication complex during the replication cycle. We here use single-molecule FRET techniques to build on previous thermodynamic studies of gp32 binding to initiate studies of the dynamics of the isolated and cooperative binding of gp32 molecules within the replication complex. DNA primer/template (p/t) constructs are used as models to determine the effects of ssDNA lattice length, gp32 concentration, salt concentration, binding cooperativity and binding polarity at p/t junctions. Hidden Markov models (HMMs) and transition density plots (TDPs) are used to characterize the dynamics of the multi-step assembly pathway of gp32 at p/t junctions of differing polarity, and show that isolated gp32 molecules bind to their ssDNA targets weakly and dissociate quickly, while cooperatively bound dimeric or trimeric clusters of gp32 bind much more tightly, can ‘slide’ on ssDNA sequences, and exhibit binding dynamics that depend on p/t junction polarities. The potential relationships of these binding dynamics to interactions with other components of the T4 DNA replication complex are discussed. PMID:27694621

[Synthesis of Circular DNA Templates with T4 RNA Ligase for Rolling Circle Amplification].

PubMed

Sakhabutdinova, A R; Maksimova, M A; Garafutdinov, R R

2017-01-01

Currently, isothermal methods of nucleic acid amplification have been well established; in particular, rolling circle amplification is of great interest. In this approach, circular ssDNA molecules have been used as a target that can be obtained by the intramolecular template-dependent ligation of an oligonucleotide C-probe. Here, a new method of synthesizing small circular DNA molecules via the cyclization of ssDNA based on T4 RNA ligase has been proposed. Circular ssDNA is further used as the template for the rolling circle amplification. The maximum yield of the cyclization products was observed in the presence of 5-10% polyethylene glycol 4000, and the optimum DNA length for the cyclization constituted 50 nucleotides. This highly sensitive method was shown to detect less than 10^(2) circular DNA molecules. The method reliability was proved based on artificially destroyed dsDNA, which suggests its implementation for analyzing any significantly fragmented dsDNA.

A nonenzymatic DNA nanomachine for biomolecular detection by target recycling of hairpin DNA cascade amplification.

PubMed

Zheng, Jiao; Li, Ningxing; Li, Chunrong; Wang, Xinxin; Liu, Yucheng; Mao, Guobin; Ji, Xinghu; He, Zhike

2018-06-01

Synthetic enzyme-free DNA nanomachine performs quasi-mechanical movements in response to external intervention, suggesting the promise of constructing sensitive and specific biosensors. Herein, a smart DNA nanomachine biosensor for biomolecule (such as nucleic acid, thrombin and adenosine) detection is developed by target-assisted enzyme-free hairpin DNA cascade amplifier. The whole DNA nanomachine system is constructed on gold nanoparticle which decorated with hundreds of locked hairpin substrate strands serving as DNA tracks, and the DNA nanomachine could be activated by target molecule toehold-mediated exchange on gold nanoparticle surface, resulted in the fluorescence recovery of fluorophore. The process is repeated so that each copy of the target can open multiplex fluorophore-labeled hairpin substrate strands, resulted in amplification of the fluorescence signal. Compared with the conventional biosensors of catalytic hairpin assembly (CHA) without substrate in solution, the DNA nanomachine could generate 2-3 orders of magnitude higher fluorescence signal. Furthermore, the DNA nanomachine could be used for nucleic acid, thrombin and adenosine highly sensitive specific detection based on isothermal, and homogeneous hairpin DNA cascade signal amplification in both buffer and a complicated biomatrix, and this kind of DNA nanomachine could be efficiently applied in the field of biomedical analysis. Copyright © 2018 Elsevier B.V. All rights reserved.

Polylactic acid promotes healing of photodegraded disperse orange 11 molecules

NASA Astrophysics Data System (ADS)

Stubbs, Najee; Bridgewater, Mauricio; Stubbs, Micheala; Kabir, Amin; Crescimanno, Michael; Kuzyk, Mark G.; Dawson, Nathan J.

2018-02-01

We report on the recovery of a photodegraded organic molecule mediated by a biopolymer. Amplified spontaneous emission (ASE) from disperse orange 11 (DO11) dye-doped polylactic acid (PLA) was used to monitor photodegradation while the material was being damaged by a strong pump laser. The ASE signal fully recovers over two hours time when the pump beam is blocked. The fluorescence spectra was also observed to recover after partial photobleaching the dye-doped polymer. PLA is the first biopolymer known to mediate the recovery of a photodegraded organic dye molecule.

Thermodynamic properties of water molecules in the presence of cosolute depend on DNA structure: a study using grid inhomogeneous solvation theory

PubMed Central

Nakano, Miki; Tateishi-Karimata, Hisae; Tanaka, Shigenori; Tama, Florence; Miyashita, Osamu; Nakano, Shu-ichi; Sugimoto, Naoki

2015-01-01

In conditions that mimic those of the living cell, where various biomolecules and other components are present, DNA strands can adopt many structures in addition to the canonical B-form duplex. Previous studies in the presence of cosolutes that induce molecular crowding showed that thermal stabilities of DNA structures are associated with the properties of the water molecules around the DNAs. To understand how cosolutes, such as ethylene glycol, affect the thermal stability of DNA structures, we investigated the thermodynamic properties of water molecules around a hairpin duplex and a G-quadruplex using grid inhomogeneous solvation theory (GIST) with or without cosolutes. Our analysis indicated that (i) cosolutes increased the free energy of water molecules around DNA by disrupting water–water interactions, (ii) ethylene glycol more effectively disrupted water–water interactions around Watson–Crick base pairs than those around G-quartets or non-paired bases, (iii) due to the negative electrostatic potential there was a thicker hydration shell around G-quartets than around Watson–Crick-paired bases. Our findings suggest that the thermal stability of the hydration shell around DNAs is one factor that affects the thermal stabilities of DNA structures under the crowding conditions. PMID:26538600

Single-molecule manipulation reveals supercoiling-dependent modulation of lac repressor-mediated DNA looping

PubMed Central

Normanno, Davide; Vanzi, Francesco; Pavone, Francesco Saverio

2008-01-01

Gene expression regulation is a fundamental biological process which deploys specific sets of genomic information depending on physiological or environmental conditions. Several transcription factors (including lac repressor, LacI) are present in the cell at very low copy number and increase their local concentration by binding to multiple sites on DNA and looping the intervening sequence. In this work, we employ single-molecule manipulation to experimentally address the role of DNA supercoiling in the dynamics and stability of LacI-mediated DNA looping. We performed measurements over a range of degrees of supercoiling between −0.026 and +0.026, in the absence of axial stretching forces. A supercoiling-dependent modulation of the lifetimes of both the looped and unlooped states was observed. Our experiments also provide evidence for multiple structural conformations of the LacI–DNA complex, depending on torsional constraints. The supercoiling-dependent modulation demonstrated here adds an important element to the model of the lac operon. In fact, the complex network of proteins acting on the DNA in a living cell constantly modifies its topological and mechanical properties: our observations demonstrate the possibility of establishing a signaling pathway from factors affecting DNA supercoiling to transcription factors responsible for the regulation of specific sets of genes. PMID:18310101

Small molecule-mediated duplex formation of nucleic acids with 'incompatible' backbones.

PubMed

Cafferty, Brian J; Musetti, Caterina; Kim, Keunsoo; Horowitz, Eric D; Krishnamurthy, Ramanarayanan; Hud, Nicholas V

2016-04-07

Proflavine, a known intercalator of DNA and RNA, promotes duplex formation by nucleic acids with natural and non-natural backbones that otherwise form duplexes with low thermal stability, and even some that show no sign of duplex formation in the absence of proflavine. These findings demonstrate the potential for intercalators to be used as cofactors for the assembly of rationally designed nucleic acid structures, and could provide fundamental insights regarding intercalation of natural nucleic acid duplexes.

Increasing the Analytical Sensitivity by Oligonucleotides Modified with Para- and Ortho-Twisted Intercalating Nucleic Acids – TINA

PubMed Central

Schneider, Uffe V.; Géci, Imrich; Jøhnk, Nina; Mikkelsen, Nikolaj D.; Pedersen, Erik B.; Lisby, Gorm

2011-01-01

The sensitivity and specificity of clinical diagnostic assays using DNA hybridization techniques are limited by the dissociation of double-stranded DNA (dsDNA) antiparallel duplex helices. This situation can be improved by addition of DNA stabilizing molecules such as nucleic acid intercalators. Here, we report the synthesis of a novel ortho-Twisted Intercalating Nucleic Acid (TINA) amidite utilizing the phosphoramidite approach, and examine the stabilizing effect of ortho- and para-TINA molecules in antiparallel DNA duplex formation. In a thermal stability assay, ortho- and para-TINA molecules increased the melting point (Tm) of Watson-Crick based antiparallel DNA duplexes. The increase in Tm was greatest when the intercalators were placed at the 5′ and 3′ termini (preferable) or, if placed internally, for each half or whole helix turn. Terminally positioned TINA molecules improved analytical sensitivity in a DNA hybridization capture assay targeting the Escherichia coli rrs gene. The corresponding sequence from the Pseudomonas aeruginosa rrs gene was used as cross-reactivity control. At 150 mM ionic strength, analytical sensitivity was improved 27-fold by addition of ortho-TINA molecules and 7-fold by addition of para-TINA molecules (versus the unmodified DNA oligonucleotide), with a 4-fold increase retained at 1 M ionic strength. Both intercalators sustained the discrimination of mismatches in the dsDNA (indicated by ΔTm), unless placed directly adjacent to the mismatch – in which case they partly concealed ΔTm (most pronounced for para-TINA molecules). We anticipate that the presented rules for placement of TINA molecules will be broadly applicable in hybridization capture assays and target amplification systems. PMID:21673988

An analysis of subunit exchange in the dimeric DNA-binding and DNA-bending protein, TF1.

PubMed

Andera, L; Schneider, G J; Geiduschek, E P

1994-01-01

TF1 is the Bacillus subtilis bacteriophage-encoded dimeric type II DNA-binding protein. This relative of the eubacterial HU proteins and of the Escherichia coli integration host factor binds preferentially to 5-(hydroxymethyluracil)-containing DNA. We have examined the dynamics of exchange of monomer subunits between molecules of dimeric TF1. The analysis takes advantage of the fact that replacement of phenylalanine with arginine at amino acid 61 in the beta-loop 'arm' of TF1 alters DNA-bending and -binding properties, generating DNA complexes with distinctively different mobilities in gel electrophoresis. New species of DNA-protein complexes were formed by mixtures of wild type and mutant TF1, reflecting the formation of heterodimeric TF1, and making the dynamics of monomer exchange between TF1 dimers accessible to a simple gel retardation analysis. Exchange was rapid at high protein concentrations, even at 0 degrees C, and is proposed to be capable of proceeding through an interaction of molecules of TF1 dimer rather than exclusively through dissociation into monomer subunits. Evidence suggesting that DNA-bound TF1 dimers do not exchange subunits readily is also presented.

DNA Nanotechnology-Enabled Interfacial Engineering for Biosensor Development.

PubMed

Ye, Dekai; Zuo, Xiaolei; Fan, Chunhai

2018-06-12

Biosensors represent biomimetic analytical tools for addressing increasing needs in medical diagnosis, environmental monitoring, security, and biodefense. Nevertheless, widespread real-world applications of biosensors remain challenging due to limitations of performance, including sensitivity, specificity, speed, and reproducibility. In this review, we present a DNA nanotechnology-enabled interfacial engineering approach for improving the performance of biosensors. We first introduce the main challenges of the biosensing interfaces, especially under the context of controlling the DNA interfacial assembly. We then summarize recent progress in DNA nanotechnology and efforts to harness DNA nanostructures to engineer various biological interfaces, with a particular focus on the use of framework nucleic acids. We also discuss the implementation of biosensors to detect physiologically relevant nucleic acids, proteins, small molecules, ions, and other biomarkers. This review highlights promising applications of DNA nanotechnology in interfacial engineering for biosensors and related areas.

Neutron Nucleic Acid Crystallography.

PubMed

Chatake, Toshiyuki

2016-01-01

The hydration shells surrounding nucleic acids and hydrogen-bonding networks involving water molecules and nucleic acids are essential interactions for the structural stability and function of nucleic acids. Water molecules in the hydration shells influence various conformations of DNA and RNA by specific hydrogen-bonding networks, which often contribute to the chemical reactivity and molecular recognition of nucleic acids. However, X-ray crystallography could not provide a complete description of structural information with respect to hydrogen bonds. Indeed, X-ray crystallography is a powerful tool for determining the locations of water molecules, i.e., the location of the oxygen atom of H2O; however, it is very difficult to determine the orientation of the water molecules, i.e., the orientation of the two hydrogen atoms of H2O, because X-ray scattering from the hydrogen atom is very small.Neutron crystallography is a specialized tool for determining the positions of hydrogen atoms. Neutrons are not diffracted by electrons, but are diffracted by atomic nuclei; accordingly, neutron scattering lengths of hydrogen and its isotopes are comparable to those of non-hydrogen atoms. Therefore, neutron crystallography can determine both of the locations and orientations of water molecules. This chapter describes the current status of neutron nucleic acid crystallographic research as well as the basic principles of neutron diffraction experiments performed on nucleic acid crystals: materials, crystallization, diffraction experiments, and structure determination.

DNA Origami: Folded DNA-Nanodevices That Can Direct and Interpret Cell Behavior

PubMed Central

Kearney, Cathal J.; Lucas, Christopher R.; O'Brien, Fergal J.; Castro, Carlos E.

2016-01-01

DNA origami is a DNA-based nanotechnology that utilizes programmed combinations of short complementary oligonucleotides to fold a large single strand of DNA into precise 2-D and 3-D shapes. The exquisite nanoscale shape control of this inherently biocompatible material is combined with the potential to spatially address the origami structures with diverse cargos including drugs, antibodies, nucleic acid sequences, small molecules and inorganic particles. This programmable flexibility enables the fabrication of precise nanoscale devices that have already shown great potential for biomedical applications such as: drug delivery, biosensing and synthetic nanopore formation. In this Progress Report, we will review the advances in the DNA origami field since its inception several years ago and then focus on how these DNA-nanodevices can be designed to interact with cells to direct or probe their behavior. PMID:26840503

Laser-triggered release of encapsulated molecules from polylactic-co-glycolic acid microcapsules

NASA Astrophysics Data System (ADS)

Ariyasu, Kazumasa; Ishii, Atsuhiro; Umemoto, Taiga; Terakawa, Mitsuhiro

2016-08-01

The controlled release of encapsulated molecules from a microcapsule is a promising method of targeted drug delivery. Laser-triggered methods for the release of encapsulated molecules have the advantage of spatial and temporal controllability. In this study, we demonstrated the release of encapsulated molecules from biodegradable polymer-based microcapsules using near-infrared femtosecond laser pulses. The polylactic-co-glycolic acid microcapsules encapsulating fluorescein isothiocyanate-dextran molecules were fabricated using a dual-coaxial nozzle system. Irradiation of femtosecond laser pulses enhanced the release of the molecules from the microcapsules, which was accompanied by a decrease in the residual ratio of the microcapsules. The laser-induced modification of the surface of the shell of the microcapsules indicated the potential for sustained release as well as burst release.

Investigating Deinococcus radiodurans RecA protein filament formation on dsDNA by a real-time single-molecule approach

PubMed Central

Hsu, Hsin-Fang; Ngo, Khanh V.; Chitteni-Pattu, Sindhu; Cox, Michael M.; Li, Hung-Wen

2011-01-01

With the aid of an efficient, precise, and almost error-free DNA repair system, Deinococcus radiodurans can survive hundreds of double strand breaks inflicted by high doses of irradiation or desiccation. The RecA of Deinococcus radiodurans (DrRecA) plays a central role both in the early phase of repair by an extended synthesis-dependent strand annealing process and in the later more general homologous recombination phase. Both roles likely require DrRecA filament formation on duplex DNA. We have developed single-molecule tethered particle motion (TPM) experiments to study the assembly dynamics of RecA proteins on individual duplex DNA molecules by observing changes in DNA tether length resulting from RecA binding. We demonstrate that DrRecA nucleation on dsDNA is much faster than Escherichia coli (Ec) RecA protein, but the extension is slower. This combination of attributes would tend to increase the number and decrease the length of DrRecA filaments relative to those of EcRecA, a feature that may reflect the requirement to repair hundreds of genomic double strand breaks concurrently in irradiated Deinococcus cells. PMID:21853996

Effects of altered maternal folic acid, vitamin B12 and docosahexaenoic acid on placental global DNA methylation patterns in Wistar rats.

PubMed

Kulkarni, Asmita; Dangat, Kamini; Kale, Anvita; Sable, Pratiksha; Chavan-Gautam, Preeti; Joshi, Sadhana

2011-03-10

Potential adverse effects of excess maternal folic acid supplementation on a vegetarian population deficient in vitamin B(12) are poorly understood. We have previously shown in a rat model that maternal folic acid supplementation at marginal protein levels reduces brain omega-3 fatty acid levels in the adult offspring. We have also reported that reduced docosahexaenoic acid (DHA) levels may result in diversion of methyl groups towards DNA in the one carbon metabolic pathway ultimately resulting in DNA methylation. This study was designed to examine the effect of normal and excess folic acid in the absence and presence of vitamin B(12) deficiency on global methylation patterns in the placenta. Further, the effect of maternal omega 3 fatty acid supplementation on the above vitamin B(12) deficient diets was also examined. Our results suggest maternal folic acid supplementation in the absence of vitamin B(12) lowers plasma and placental DHA levels (p<0.05) and reduces global DNA methylation levels (p<0.05). When this group was supplemented with omega 3 fatty acids there was an increase in placental DHA levels and subsequently DNA methylation levels revert back to the levels of the control group. Our results suggest for the first time that DHA plays an important role in one carbon metabolism thereby influencing global DNA methylation in the placenta.

The role of the C-domain of bacteriophage T4 gene 32 protein in ssDNA binding and dsDNA helix-destabilization: Kinetic, single-molecule, and cross-linking studies

PubMed Central

Pant, Kiran; Anderson, Brian; Perdana, Hendrik; Malinowski, Matthew A.; Win, Aye T.; Williams, Mark C.

2018-01-01

The model single-stranded DNA binding protein of bacteriophage T4, gene 32 protein (gp32) has well-established roles in DNA replication, recombination, and repair. gp32 is a single-chain polypeptide consisting of three domains. Based on thermodynamics and kinetics measurements, we have proposed that gp32 can undergo a conformational change where the acidic C-terminal domain binds internally to or near the single-stranded (ss) DNA binding surface in the core (central) domain, blocking ssDNA interaction. To test this model, we have employed a variety of experimental approaches and gp32 variants to characterize this conformational change. Utilizing stopped-flow methods, the association kinetics of wild type and truncated forms of gp32 with ssDNA were measured. When the C-domain is present, the log-log plot of k vs. [NaCl] shows a positive slope, whereas when it is absent (*I protein), there is little rate change with salt concentration, as expected for this model.A gp32 variant lacking residues 292–296 within the C-domain, ΔPR201, displays kinetic properties intermediate between gp32 and *I. The single molecule force-induced DNA helix-destabilizing activitiesas well as the single- and double-stranded DNA affinities of ΔPR201 and gp32 truncated at residue 295 also fall between full-length protein and *I. Finally, chemical cross-linking of recombinant C-domain and gp32 lacking both N- and C-terminal domains is inhibited by increasing concentrations of a short single-stranded oligonucleotide, and the salt dependence of cross-linking mirrors that expected for the model. Taken together, these results provide the first evidence in support of this model that have been obtained through structural probes. PMID:29634784

Influence of Ionic Liquids on Thermodynamics of Small Molecule-DNA Interaction: The Binding of Ethidium Bromide to Calf Thymus DNA.

PubMed

Mishra, Arpit; Ekka, Mary Krishna; Maiti, Souvik

2016-03-17

Ionic liquids (ILs) are salts with poor ionic coordination, resultantly remaining in liquid state below 100 °C and some may retain liquid state even at room temperature. ILs are known to provide a conducive environment for many biological enzymatic reactions, but their interaction with biomacromolecules are poorly understood. In the present study, we investigate the effect of various ionic liquids on DNA-small molecule interaction using calf thymus DNA (ctDNA)-ethidium bromide (EB) as a model system. The effect of various ionic liquids on these interactions is studied by an array of techniques such as circular dichroism (CD), UV melting, fluorescence exclusion and isothermal titration calorimetry. Interestingly, we observed that presence of IL increased the stability of ctDNA without altering its structure. The binding affinities Kbs for EB binding to ctDNA in the presence of 300 mM ILs are about half order of magnitude smaller than the Kbs in absence of ILs and correspond to a less favorable free energy. We noted that, when adjusted to corresponding buffer condition, the unfavorable shift in ΔG of ctDNA-EB interaction is attributed to decreased entropy in the case of ILs, whereas the same effect by NaCl was due to increased enthalpy.

Design and Synthesis of Biaryl DNA-Encoded Libraries.

PubMed

Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana

2016-10-10

DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).

Background of the Hammett equation as observed for isolated molecules: meta- and para-substituted benzoic acids.

PubMed

Exner, Otto; Böhm, Stanislav

2002-09-06

Fundamental model compounds for the Hammett equation, meta- and para-substituted benzoic acids, were investigated by the density functional theory at the B3LYP/6-311+G(d,p) level. Energies of 25 acids and of their anions were calculated in all possible conformations and from them the energies of the assumed mixture of conformers. Relative acidities correlated with the experimental gas-phase acidities almost within the experimental uncertainty, much more precisely than in the case of previous calculations at lower levels. Dissection of the substituent effects into those operating in the acid molecule and in the anion was carried out by means of isodesmic reactions starting from monosubstituted benzenes. Both effects are cooperating in the resulting effect on the acidity; those in the acid molecule are smaller but not negligible. They are also responsible for some deviations from the Hammett equation (through-resonance of para donor substituents) and for the weaker resonance in the acid molecule in meta derivatives; in the anions the inductive and resonance effects are almost equal. On the other hand, the cooperation of effects in the acid and in the anion makes the relative acidity more sensitive to electron withdrawing and is probably one of the reasons why the Hammett equation is so generally valid.

Branchpoint expansion in a fully complementary three-way DNA junction.

PubMed

Sabir, Tara; Toulmin, Anita; Ma, Long; Jones, Anita C; McGlynn, Peter; Schröder, Gunnar F; Magennis, Steven W

2012-04-11

Branched nucleic acid molecules serve as key intermediates in DNA replication, recombination, and repair; architectural elements in RNA; and building blocks and functional components for nanoscience applications. Using a combination of high-resolution single-molecule FRET, time-resolved spectroscopy, and molecular modeling, we have probed the local and global structure of a DNA three-way junction (3WJ) in solution. We found that it adopts a Y-shaped, pyramidal structure, in which the bases adjacent to the branchpoint are unpaired, despite the full Watson-Crick complementarity of the molecule. The unpairing allows a nanoscale cavity to form at the junction center. Our structure accounts for earlier observations made of the structure, flexibility, and reactivity of 3WJs. We anticipate that these results will guide the development of new DNA-based supramolecular receptors and nanosystems. © 2012 American Chemical Society

Label-free in-flow detection of single DNA molecules using glass nanopipettes.

PubMed

Gong, Xiuqing; Patil, Amol V; Ivanov, Aleksandar P; Kong, Qingyuan; Gibb, Thomas; Dogan, Fatma; deMello, Andrew J; Edel, Joshua B

2014-01-07

With the view of enhancing the functionality of label-free single molecule nanopore-based detection, we have designed and developed a highly robust, mechanically stable, integrated nanopipette-microfluidic device which combines the recognized advantages of microfluidic systems and the unique properties/advantages of nanopipettes. Unlike more typical planar solid-state nanopores, which have inherent geometrical constraints, nanopipettes can be easily positioned at any point within a microfluidic channel. This is highly advantageous, especially when taking into account fluid flow properties. We show that we are able to detect and discriminate between DNA molecules of varying lengths when motivated through a microfluidic channel, upon the application of appropriate voltage bias across the nanopipette. The effects of applied voltage and volumetric flow rates have been studied to ascertain translocation event frequency and capture rate. Additionally, by exploiting the advantages associated with microfluidic systems (such as flow control and concomitant control over analyte concentration/presence), we show that the technology offers a new opportunity for single molecule detection and recognition in microfluidic devices.

Enhancement of anion-exchange chromatography of DNA using compaction agents

NASA Technical Reports Server (NTRS)

Murphy, Jason C.; Fox, George E.; Willson, Richard C.

2003-01-01

The use of adsorptive chromatography for preparative nucleic acid separations is often limited by low capacity. The possibility that the adsorbent surface area sterically accessible to nucleic acid molecules could be increased by reducing their radius of gyration with compaction agents has been investigated. The equilibrium adsorption capacity of Q Sepharose anion-exchange matrix for plasmid DNA at 600 mM NaCl was enhanced by up to ca. 40% in the presence of 2.5 mM spermine. In addition, compaction agent selectivity has been demonstrated. Spermine, for example, enhances the adsorption of both plasmid and genomic DNA, spermidine enhances binding only of plasmid, and hexamine cobalt enhances only the binding of genomic DNA. Compaction may be generally useful for enhancing adsorptive separations of nucleic acids.

Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.

PubMed Central

Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M

1987-01-01

Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929

Functional transferred DNA within extracellular vesicles

DOE Office of Scientific and Technical Information (OSTI.GOV)

Cai, Jin; Department of Neurology, Jinling Hospital, Nanjing University School of Medicine, Jiangsu Province; Wu, Gengze

Extracellular vesicles (EVs) are small membrane vesicles including exosomes and shedding vesicles that mediated a cell-to-cell communication. EVs are released from almost all cell types under both physiological and pathological conditions and incorporate nuclear and cytoplasmic molecules for intercellular delivery. Besides protein, mRNA, and microRNA of these molecules, as recent studies show, specific DNA are prominently packaged into EVs. It appears likely that some of exosomes or shedding vesicles, bearing nuclear molecules are released upon bubble-like blebs. Specific interaction of EVs with susceptible recipients performs the uptake of EVs into the target cells, discharging their cargo including nuclear and cytoplasmicmore » macromolecules into the cytosol. These findings expand the nucleic acid content of EVs to include increased levels of specific DNA. Thus, EVs contain a repertoire of genetic information available for horizontal gene transfer and potential use as blood biomarkers for cancer and atherosclerosis. In this review, the focus is on the characteristics, biological functions, and roles in diseases of DNA within EVs. - Highlights: • This review is focused on the DNA within EVs including its characteristics, biological functions, and roles in diseases. • It is clear that DNA within EVs might have important physiological and pathological roles in various diseases. • Knowledge in this area may provides us alternative methods for disease diagnosis or therapy in the future.« less

Development and Synthesis of DNA-Encoded Benzimidazole Library.

PubMed

Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A

2018-04-25

Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.

Crowding Induces Complex Ergodic Diffusion and Dynamic Elongation of Large DNA Molecules

PubMed Central

Chapman, Cole D.; Gorczyca, Stephanie; Robertson-Anderson, Rae M.

2015-01-01

Despite the ubiquity of molecular crowding in living cells, the effects of crowding on the dynamics of genome-sized DNA are poorly understood. Here, we track single, fluorescent-labeled large DNA molecules (11, 115 kbp) diffusing in dextran solutions that mimic intracellular crowding conditions (0–40%), and determine the effects of crowding on both DNA mobility and conformation. Both DNAs exhibit ergodic Brownian motion and comparable mobility reduction in all conditions; however, crowder size (10 vs. 500 kDa) plays a critical role in the underlying diffusive mechanisms and dependence on crowder concentration. Surprisingly, in 10-kDa dextran, crowder influence saturates at ∼20% with an ∼5× drop in DNA diffusion, in stark contrast to exponentially retarded mobility, coupled to weak anomalous subdiffusion, with increasing concentration of 500-kDa dextran. Both DNAs elongate into lower-entropy states (compared to random coil conformations) when crowded, with elongation states that are gamma distributed and fluctuate in time. However, the broadness of the distribution of states and the time-dependence and length scale of elongation length fluctuations depend on both DNA and crowder size with concentration having surprisingly little impact. Results collectively show that mobility reduction and coil elongation of large crowded DNAs are due to a complex interplay between entropic effects and crowder mobility. Although elongation and initial mobility retardation are driven by depletion interactions, subdiffusive dynamics, and the drastic exponential slowing of DNA, up to ∼300×, arise from the reduced mobility of larger crowders. Our results elucidate the highly important and widely debated effects of cellular crowding on genome-sized DNA. PMID:25762333

Visualization of nanoconstructions with DNA-Aptamers for targeted molecules binding on the surface of screen-printed electrodes

NASA Astrophysics Data System (ADS)

Lapin, Ivan N.; Shabalina, Anastasiia V.; Svetlichyi, Valery A.; Kolovskaya, Olga S.

2018-04-01

Nanoconstructions of gold nanoparticles (NPs) obtained via pulsed laser ablation in liquid with DNA-aptamer specific to protein tumor marker were visualized on the surface of screen-printed electrode using scanning electron microscopy (SEM) and confocal laser scanning microscopy (CLSM). AuNPs/aptamer nanoconstuctions distribution on the solid surface was studied. More uniform coverage of the carbon electrode surface with the nanoconstuctions was showed in comparison with DNA-aptamer alone on the golden electrode surface. Targeted binding of the tumor marker molecules with the AuNPs/DNA-aptamer nanoconstuctions was approved.

The Amazing Molecule Race: A WebQuest for 8th Grade Science

NASA Astrophysics Data System (ADS)

Soehl, Diana; Moats, S. J.; Langston, G. I.

2009-01-01

Did you ever wonder if life exists beyond Earth? The molecules that helped make up you and your friends are the same floating in outer space! The Race is ON to discover as many molecules in space as possible and to find the most important molecules for life: amino acids, DNA and RNA! As aspiring astronomers and astrobiologists, you will explore how these molecules are detected on Earth and in space. The `Search for Life’ is a pretty big task considering the size of the Universe. By learning how to find evidence of life forming molecules you will be able to provide conclusions that will shape policy regarding space missions, funding and technology development during your lifetime.

Resonant electron capture by aspartame and aspartic acid molecules.

PubMed

Muftakhov, M V; Shchukin, P V

2016-12-30

The processes for dissociative electron capture are the key mechanisms for decomposition of biomolecules, proteins in particular, under interaction with low-energy electrons. Molecules of aspartic acid and aspartame, i.e. modified dipeptides, were studied herein to define the impact of the side functional groups on peptide chain decomposition in resonant electron-molecular reactions. The processes of formation and decomposition of negative ions of both aspartame and aspartic acid were studied by mass spectrometry of negative ions under resonant electron capture. The obtained mass spectra were interpreted under thermochemical analysis by quantum chemical calculations. Main channels of negative molecular ions fragmentation were found and characteristic fragment ions were identified. The СООН fragment of the side chain in aspartic acid is shown to play a key role like the carboxyl group in amino acids and aliphatic oligopeptides. Copyright © 2016 John Wiley & Sons, Ltd. Copyright © 2016 John Wiley & Sons, Ltd.

Competition between B-Z and B-L transitions in a single DNA molecule: Computational studies

NASA Astrophysics Data System (ADS)

Kwon, Ah-Young; Nam, Gi-Moon; Johner, Albert; Kim, Seyong; Hong, Seok-Cheol; Lee, Nam-Kyung

2016-02-01

Under negative torsion, DNA adopts left-handed helical forms, such as Z-DNA and L-DNA. Using the random copolymer model developed for a wormlike chain, we represent a single DNA molecule with structural heterogeneity as a helical chain consisting of monomers which can be characterized by different helical senses and pitches. By Monte Carlo simulation, where we take into account bending and twist fluctuations explicitly, we study sequence dependence of B-Z transitions under torsional stress and tension focusing on the interaction with B-L transitions. We consider core sequences, (GC) n repeats or (TG) n repeats, which can interconvert between the right-handed B form and the left-handed Z form, imbedded in a random sequence, which can convert to left-handed L form with different (tension dependent) helical pitch. We show that Z-DNA formation from the (GC) n sequence is always supported by unwinding torsional stress but Z-DNA formation from the (TG) n sequence, which are more costly to convert but numerous, can be strongly influenced by the quenched disorder in the surrounding random sequence.

The Mitochondrial Transcription Factor TFAM Coordinates the Assembly of Multiple DNA Molecules into Nucleoid-like Structures

PubMed Central

Kaufman, Brett A.; Durisic, Nela; Mativetsky, Jeffrey M.; Costantino, Santiago; Hancock, Mark A.; Grutter, Peter

2007-01-01

Packaging DNA into condensed structures is integral to the transmission of genomes. The mammalian mitochondrial genome (mtDNA) is a high copy, maternally inherited genome in which mutations cause a variety of multisystem disorders. In all eukaryotic cells, multiple mtDNAs are packaged with protein into spheroid bodies called nucleoids, which are the fundamental units of mtDNA segregation. The mechanism of nucleoid formation, however, remains unknown. Here, we show that the mitochondrial transcription factor TFAM, an abundant and highly conserved High Mobility Group box protein, binds DNA cooperatively with nanomolar affinity as a homodimer and that it is capable of coordinating and fully compacting several DNA molecules together to form spheroid structures. We use noncontact atomic force microscopy, which achieves near cryo-electron microscope resolution, to reveal the structural details of protein–DNA compaction intermediates. The formation of these complexes involves the bending of the DNA backbone, and DNA loop formation, followed by the filling in of proximal available DNA sites until the DNA is compacted. These results indicate that TFAM alone is sufficient to organize mitochondrial chromatin and provide a mechanism for nucleoid formation. PMID:17581862

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

PubMed Central

2017-01-01

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 103 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale. PMID:29166033

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami.

PubMed

Chikkaraddy, Rohit; Turek, V A; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F; Baumberg, Jeremy J

2018-01-10

Fabricating nanocavities in which optically active single quantum emitters are precisely positioned is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5 nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore and obtain enhancements of ≥4 × 10 3 with high quantum yield (≥50%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of ±1.5 nm. Our approach introduces a straightforward noninvasive way to measure and quantify confined optical modes on the nanoscale.

Mapping Nanoscale Hotspots with Single-Molecule Emitters Assembled into Plasmonic Nanocavities Using DNA Origami

NASA Astrophysics Data System (ADS)

Chikkaraddy, Rohit; Turek, V. A.; Kongsuwan, Nuttawut; Benz, Felix; Carnegie, Cloudy; van de Goor, Tim; de Nijs, Bart; Demetriadou, Angela; Hess, Ortwin; Keyser, Ulrich F.; Baumberg, Jeremy J.

2018-01-01

Fabricating nanocavities in which optically-active single quantum emitters are precisely positioned, is crucial for building nanophotonic devices. Here we show that self-assembly based on robust DNA-origami constructs can precisely position single molecules laterally within sub-5nm gaps between plasmonic substrates that support intense optical confinement. By placing single-molecules at the center of a nanocavity, we show modification of the plasmon cavity resonance before and after bleaching the chromophore, and obtain enhancements of $\\geq4\\times10^3$ with high quantum yield ($\\geq50$%). By varying the lateral position of the molecule in the gap, we directly map the spatial profile of the local density of optical states with a resolution of $\\pm1.5$ nm. Our approach introduces a straightforward non-invasive way to measure and quantify confined optical modes on the nanoscale.

Thermophoretic melting curves quantify the conformation and stability of RNA and DNA

PubMed Central

Wienken, Christoph J.; Baaske, Philipp; Duhr, Stefan; Braun, Dieter

2011-01-01

Measuring parameters such as stability and conformation of biomolecules, especially of nucleic acids, is important in the field of biology, medical diagnostics and biotechnology. We present a thermophoretic method to analyse the conformation and thermal stability of nucleic acids. It relies on the directed movement of molecules in a temperature gradient that depends on surface characteristics of the molecule, such as size, charge and hydrophobicity. By measuring thermophoresis of nucleic acids over temperature, we find clear melting transitions and resolve intermediate conformational states. These intermediate states are indicated by an additional peak in the thermophoretic signal preceding most melting transitions. We analysed single nucleotide polymorphisms, DNA modifications, conformational states of DNA hairpins and microRNA duplexes. The method is validated successfully against calculated melting temperatures and UV absorbance measurements. Interestingly, the methylation of DNA is detected by the thermophoretic amplitude even if it does not affect the melting temperature. In the described setup, thermophoresis is measured all-optical in a simple setup using a reproducible capillary format with only 250 nl probe consumption. The thermophoretic analysis of nucleic acids shows the technique’s versatility for the investigation of nucleic acids relevant in cellular processes like RNA interference or gene silencing. PMID:21297115

Cellular Uptake of Tile-Assembled DNA Nanotubes.

PubMed

Kocabey, Samet; Meinl, Hanna; MacPherson, Iain S; Cassinelli, Valentina; Manetto, Antonio; Rothenfusser, Simon; Liedl, Tim; Lichtenegger, Felix S

2014-12-30

DNA-based nanostructures have received great attention as molecular vehicles for cellular delivery of biomolecules and cancer drugs. Here, we report on the cellular uptake of tubule-like DNA tile-assembled nanostructures 27 nm in length and 8 nm in diameter that carry siRNA molecules, folic acid and fluorescent dyes. In our observations, the DNA structures are delivered to the endosome and do not reach the cytosol of the GFP -expressing HeLa cells that were used in the experiments. Consistent with this observation, no elevated silencing of the GFP gene could be detected. Furthermore, the presence of up to six molecules of folic acid on the carrier surface did not alter the uptake behavior and gene silencing. We further observed several challenges that have to be considered when performing in vitro and in vivo experiments with DNA structures: (i) DNA tile tubes consisting of 42 nt-long oligonucleotides and carrying single- or double-stranded extensions degrade within one hour in cell medium at 37 °C, while the same tubes without extensions are stable for up to eight hours. The degradation is caused mainly by the low concentration of divalent ions in the media. The lifetime in cell medium can be increased drastically by employing DNA tiles that are 84 nt long. (ii) Dyes may get cleaved from the oligonucleotides and then accumulate inside the cell close to the mitochondria, which can lead to misinterpretation of data generated by flow cytometry and fluorescence microscopy. (iii) Single-stranded DNA carrying fluorescent dyes are internalized at similar levels as the DNA tile-assembled tubes used here.

Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism.

PubMed

Awate, Sanket; Brosh, Robert M

2017-06-08

Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.

Interactive Roles of DNA Helicases and Translocases with the Single-Stranded DNA Binding Protein RPA in Nucleic Acid Metabolism

PubMed Central

Awate, Sanket; Brosh, Robert M.

2017-01-01

Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346

DNA Encoding Training Using 3D Gesture Interaction.

PubMed

Nicola, Stelian; Handrea, Flavia-Laura; Crişan-Vida, Mihaela; Stoicu-Tivadar, Lăcrămioara

2017-01-01

The work described in this paper summarizes the development process and presents the results of a human genetics training application, studying the 20 amino acids formed by the combination of the 3 nucleotides of DNA targeting mainly medical and bioinformatics students. Currently, the domain applications using recognized human gestures of the Leap Motion sensor are used in molecules controlling and learning from Mendeleev table or in visualizing the animated reactions of specific molecules with water. The novelty in the current application consists in using the Leap Motion sensor creating new gestures for the application control and creating a tag based algorithm corresponding to each amino acid, depending on the position in the 3D virtual space of the 4 nucleotides of DNA and their type. The team proposes a 3D application based on Unity editor and on Leap Motion sensor where the user has the liberty of forming different combinations of the 20 amino acids. The results confirm that this new type of study of medicine/biochemistry using the Leap Motion sensor for handling amino acids is suitable for students. The application is original and interactive and the users can create their own amino acid structures in a 3D-like environment which they could not do otherwise using traditional pen-and-paper.

Human somatostatin I: sequence of the cDNA.

PubMed Central

Shen, L P; Pictet, R L; Rutter, W J

1982-01-01

RNA has been isolated from a human pancreatic somatostatinoma and used to prepare a cDNA library. After prescreening, clones containing somatostatin I sequences were identified by hybridization with an anglerfish somatostatin I-cloned cDNA probe. From the nucleotide sequence of two of these clones, we have deduced an essentially full-length mRNA sequence, including the preprosomatostatin coding region, 105 nucleotides from the 5' untranslated region and the complete 150-nucleotide 3' untranslated region. The coding region predicts a 116-amino acid precursor protein (Mr, 12.727) that contains somatostatin-14 and -28 at its COOH terminus. The predicted amino acid sequence of human somatostatin-28 is identical to that of somatostatin-28 isolated from the porcine and ovine species. A comparison of the amino acid sequences of human and anglerfish preprosomatostatin I indicated that the COOH-terminal region encoding somatostatin-14 and the adjacent 6 amino acids are highly conserved, whereas the remainder of the molecule, including the signal peptide region, is more divergent. However, many of the amino acid differences found in the pro region of the human and anglerfish proteins are conservative changes. This suggests that the propeptides have a similar secondary structure, which in turn may imply a biological function for this region of the molecule. Images PMID:6126875

Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

DOE Office of Scientific and Technical Information (OSTI.GOV)

Singh, Deepa; Gawel, Damian; Itsko, Mark

The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

Structure of Escherichia coli dGTP Triphosphohydrolase: A Hexameric Enzyme with DNA Effector Molecules

DOE PAGES

Singh, Deepa; Gawel, Damian; Itsko, Mark; ...

2015-02-18

The Escherichia coli dgt gene encodes a dGTP triphosphohydrolase whose detailed role still remains to be determined. Deletion of dgt creates a mutator phenotype, indicating that the dGTPase has a fidelity role, possibly by affecting the cellular dNTP pool. In the present paper, we have investigated the structure of the Dgt protein at 3.1-Å resolution. One of the obtained structures revealed a protein hexamer that contained two molecules of single-stranded DNA. The presence of DNA caused significant conformational changes in the enzyme, including in the catalytic site of the enzyme. Dgt preparations lacking DNA were able to bind single-stranded DNAmore » with high affinity (K d ~ 50 nM). DNA binding positively affected the activity of the enzyme: dGTPase activity displayed sigmoidal (cooperative) behavior without DNA but hyperbolic (Michaelis-Menten) kinetics in its presence, consistent with a specific lowering of the apparent K m for dGTP. A mutant Dgt enzyme was also created containing residue changes in the DNA binding cleft. This mutant enzyme, whereas still active, was incapable of DNA binding and could no longer be stimulated by addition of DNA. We also created an E. coli strain containing the mutant dgt gene on the chromosome replacing the wild-type gene. The mutant also displayed a mutator phenotype. Finally, our results provide insight into the allosteric regulation of the enzyme and support a physiologically important role of DNA binding.« less

Surface functionalization of bioactive glasses with natural molecules of biological significance, Part I: Gallic acid as model molecule

NASA Astrophysics Data System (ADS)

Zhang, Xin; Ferraris, Sara; Prenesti, Enrico; Verné, Enrica

2013-12-01

Gallic acid (3,4,5-trihydroxybenzoic acid, GA) and its derivatives are a group of biomolecules (polyphenols) obtained from plants. They have effects which are potentially beneficial to heath, for example they are antioxidant, anticarcinogenic and antibacterial, as recently investigated in many fields such as medicine, food and plant sciences. The main drawbacks of these molecules are both low stability and bioavailability. In this research work the opportunity to graft GA to bioactive glasses is investigated, in order to deliver the undamaged biological molecule into the body, using the biomaterial surfaces as a localized carrier. GA was considered for functionalization since it is a good model molecule for polyphenols and presents several interesting biological activities, like antibacterial, antioxidant and anticarcinogenic properties. Two different silica based bioactive glasses (SCNA and CEL2), with different reactivity, were employed as substrates. UV photometry combined with the Folin&Ciocalteu reagent was adopted to test the concentration of GA in uptake solution after functionalization. This test verified how much GA consumption occurred with surface modification and it was also used on solid samples to test the presence of GA on functionalized glasses. XPS and SEM-EDS techniques were employed to characterize the modification of material surface properties and functional group composition before and after functionalization.

75 FR 21008 - Office of Biotechnology Activities; Recombinant DNA Research: Proposed Actions Under the NIH...

Federal Register 2010, 2011, 2012, 2013, 2014

2010-04-22

... Activities; Recombinant DNA Research: Proposed Actions Under the NIH Guidelines for Research Involving... Biotechnology Activities (OBA) published a proposal to revise the NIH Guidelines for Research with Recombinant DNA Molecules (NIH Guidelines) to address biosafety for research with synthetic nucleic acids (74 FR...

Localization microscopy of DNA in situ using Vybrant(®) DyeCycle™ Violet fluorescent probe: A new approach to study nuclear nanostructure at single molecule resolution.

PubMed

Żurek-Biesiada, Dominika; Szczurek, Aleksander T; Prakash, Kirti; Mohana, Giriram K; Lee, Hyun-Keun; Roignant, Jean-Yves; Birk, Udo J; Dobrucki, Jurek W; Cremer, Christoph

2016-05-01

Higher order chromatin structure is not only required to compact and spatially arrange long chromatids within a nucleus, but have also important functional roles, including control of gene expression and DNA processing. However, studies of chromatin nanostructures cannot be performed using conventional widefield and confocal microscopy because of the limited optical resolution. Various methods of superresolution microscopy have been described to overcome this difficulty, like structured illumination and single molecule localization microscopy. We report here that the standard DNA dye Vybrant(®) DyeCycle™ Violet can be used to provide single molecule localization microscopy (SMLM) images of DNA in nuclei of fixed mammalian cells. This SMLM method enabled optical isolation and localization of large numbers of DNA-bound molecules, usually in excess of 10(6) signals in one cell nucleus. The technique yielded high-quality images of nuclear DNA density, revealing subdiffraction chromatin structures of the size in the order of 100nm; the interchromatin compartment was visualized at unprecedented optical resolution. The approach offers several advantages over previously described high resolution DNA imaging methods, including high specificity, an ability to record images using a single wavelength excitation, and a higher density of single molecule signals than reported in previous SMLM studies. The method is compatible with DNA/multicolor SMLM imaging which employs simple staining methods suited also for conventional optical microscopy. Copyright © 2016. Published by Elsevier Inc.

Evaluation of genotoxicity testing of FDA approved large molecule therapeutics.

PubMed

Sawant, Satin G; Fielden, Mark R; Black, Kurt A

2014-10-01

Large molecule therapeutics (MW>1000daltons) are not expected to enter the cell and thus have reduced potential to interact directly with DNA or related physiological processes. Genotoxicity studies are therefore not relevant and typically not required for large molecule therapeutic candidates. Regulatory guidance supports this approach; however there are examples of marketed large molecule therapeutics where sponsors have conducted genotoxicity studies. A retrospective analysis was performed on genotoxicity studies of United States FDA approved large molecule therapeutics since 1998 identified through the Drugs@FDA website. This information was used to provide a data-driven rationale for genotoxicity evaluations of large molecule therapeutics. Fifty-three of the 99 therapeutics identified were tested for genotoxic potential. None of the therapeutics tested showed a positive outcome in any study except the peptide glucagon (GlucaGen®) showing equivocal in vitro results, as stated in the product labeling. Scientific rationale and data from this review indicate that testing of a majority of large molecule modalities do not add value to risk assessment and support current regulatory guidance. Similarly, the data do not support testing of peptides containing only natural amino acids. Peptides containing non-natural amino acids and small molecules in conjugated products may need to be tested. Copyright © 2014 Elsevier Inc. All rights reserved.

The nature of the force-induced conformation transition of dsDNA studied by using single molecule force spectroscopy.

PubMed

Liu, Ningning; Bu, Tianjia; Song, Yu; Zhang, Wei; Li, Jinjing; Zhang, Wenke; Shen, Jiacong; Li, Hongbin

2010-06-15

Single-stranded DNA binding proteins (SSB) interact with single-stranded DNA (ssDNA) specifically. Taking advantage of this character, we have employed Bacillus subtilis SSB protein to investigate the nature of force-induced conformation transition of double-stranded DNA (dsDNA) by using AFM-based single molecule force spectroscopy (SMFS) technique. Our results show that, when a dsDNA is stretched beyond its contour length, the dsDNA is partially melted, producing some ssDNA segments which can be captured by SSB proteins. We have also systematically investigated the effects of stretching length, waiting time, and salt concentration on the conformation transition of dsDNA and SSB-ssDNA interactions, respectively. Furthermore, the effect of proflavine, a DNA intercalator, on the SSB-DNA interactions has been investigated, and the results indicate that the proflavine-saturated dsDNA can be stabilized to the extent that the dsDNA will no longer melt into ssDNA under the mechanical force even up to 150 pN, and no SSB-DNA interactions are detectable.

A novel mechanism of acid and bile acid-induced DNA damage involving Na+/H+ exchanger: implication for Barrett's oesophagus.

PubMed

Goldman, Aaron; Shahidullah, Mohammad; Goldman, David; Khailova, Ludmila; Watts, George; Delamere, Nicholas; Dvorak, Katerina

2010-12-01

Barrett's oesophagus is a premalignant disease associated with oesophageal adenocarcinoma. The major goal of this study was to determine the mechanism responsible for bile acid-induced alteration in intracellular pH (pH(i)) and its effect on DNA damage in cells derived from normal oesophagus (HET1A) or Barrett's oesophagus (CP-A). Cells were exposed to bile acid cocktail (BA) and/or acid in the presence/absence of inhibitors of nitric oxide synthase (NOS) or sodium-hydrogen exchanger (NHE). Nitric oxide (NO), pH(i) and DNA damage were measured by fluorescent imaging and comet assay. Expression of NHE1 and NOS in cultured cells and biopsies from Barrett's oesophagus or normal squamous epithelium was determined by RT-PCR, immunoblotting or immunohistochemistry. A dose dependent decrease in pH(i) was observed in CP-A cells exposed to BA. This effect of BA is the consequence of NOS activation and increased NO production, which leads to NHE inhibition. Exposure of oesophageal cells to acid in combination with BA synergistically decreased pH(i). The decrease was more pronounced in CP-A cells and resulted in >2-fold increase in DNA damage compared to acid treatment alone. Examination of biopsies and cell lines revealed robust expression of NHE1 in Barrett's oesophagus but an absence of NHE1 in normal epithelium. The results of this study identify a new mechanism of bile acid-induced DNA damage. We found that bile acids present in the refluxate activate immediately all three isoforms of NOS, which leads to an increased NO production and NHE inhibition. This consequently results in increased intracellular acidification and DNA damage, which may lead to mutations and cancer progression. Therefore, we propose that in addition to gastric reflux, bile reflux should be controlled in patients with Barrett's oesophagus.