Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus
2012-10-01
Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Synthesis of bacteriophage phiC DNA in dna mutants of Esherichia coli.
Kodaira, K I; Taketo, A
1978-06-01
Host dna functions involved in the replication of microvirid phage phiC DNA were investigated in vivo. Although growth of this phage was markedly inhibited even at 35-37 degrees C even in dna+ host, conversion of the infecting single-stranded DNA into the double-stranded parental replicative form (stage I synthesis) occurred normally at 43 degrees C in dna+, dnaA, dnaB, dnaC(D), and dnaE cells. In dnaG mutant, the stage I synthesis was severely inhibited at 43 degrees C but not at 30 degrees C. The stage I replication of phiC DNA was clearly thermosensitive in dnaZ cells incubated in nutrient broth. In Tris-casamino acids-glucose medium, however, the dnaZ mutant sufficiently supported synthesis of the parental replicative form. At 43 degrees C, synthesis of the progeny replicative form DNA (stage II replication) was significantly inhibited even in dna+ cells and was nearly completely blocked in dnaB or dnaC(D) mutant. At 37 degrees C, the stage II replication proceeded normally in dna+ bacteria.
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)
1999-01-01
Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of bDNA structures is described. This new type of branched DNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branching network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb molecules were assembled on a solid support using parameters optimized for bDNA synthesis. The chemistry was used to synthesize bDNA comb molecules containing 15 secondary sequences. The bDNA comb molecules were elaborated by enzymatic ligation into branched amplification multimers, large bDNA molecules (a total of 1068 nt) containing an average of 36 repeated DNA oligomer sequences, each capable of hybridizing specifically to an alkaline phosphatase-labeled oligonucleotide. The bDNA comb molecules were characterized by electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The branched amplification multimers have been used as signal amplifiers in nucleic acid quantification assays for detection of viral infection. It is possible to detect as few as 50 molecules with bDNA technology. PMID:9365266
DNA polymerase-α regulates type I interferon activation through cytosolic RNA:DNA synthesis
Starokadomskyy, Petro; Gemelli, Terry; Rios, Jonathan J.; Xing, Chao; Wang, Richard C.; Li, Haiying; Pokatayev, Vladislav; Dozmorov, Igor; Khan, Shaheen; Miyata, Naoteru; Fraile, Guadalupe; Raj, Prithvi; Xu, Zhe; Xu, Zigang; Ma, Lin; Lin, Zhimiao; Wang, Huijun; Yang, Yong; Ben-Amitai, Dan; Orenstein, Naama; Mussaffi, Huda; Baselga, Eulalia; Tadini, Gianluca; Grunebaum, Eyal; Sarajlija, Adrijan; Krzewski, Konrad; Wakeland, Edward K.; Yan, Nan; de la Morena, Maria Teresa; Zinn, Andrew R.; Burstein, Ezra
2016-01-01
Aberrant nucleic acids generated during viral replication are the main trigger for antiviral immunity, and mutations disrupting nucleic acid metabolism can lead to autoinflammatory disorders. Here we investigated the etiology of X-linked reticulate pigmentary disorder (XLPDR), a primary immunodeficiency with autoinflammatory features. We discovered that XLPDR is caused by an intronic mutation that disrupts expression of POLA1, the gene encoding the catalytic subunit of DNA polymerase-α. Unexpectedly, POLA1 deficiency results in increased type I interferon production. This enzyme is necessary for RNA:DNA primer synthesis during DNA replication and strikingly, POLA1 is also required for the synthesis of cytosolic RNA:DNA, which directly modulates interferon activation. Altogether, this work identified POLA1 as a critical regulator of the type I interferon response. PMID:27019227
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
Design and Synthesis of Biaryl DNA-Encoded Libraries.
Ding, Yun; Franklin, G Joseph; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Clark, Matthew A; Skinner, Steven R; Belyanskaya, Svetlana
2016-10-10
DNA-encoded library technology (ELT) is a powerful tool for the discovery of new small-molecule ligands to various protein targets. Here we report the design and synthesis of biaryl DNA-encoded libraries based on the scaffold of 5-formyl 3-iodobenzoic acid. Three reactions on DNA template, acylation, Suzuki-Miyaura coupling and reductive amination, were applied in the library synthesis. The three cycle library of 3.5 million diversity has delivered potent hits for phosphoinositide 3-kinase α (PI3Kα).
Nouri, Ali; Chyba, Christopher F
2012-01-01
It is generally assumed that genetic engineering advances will, inevitably, facilitate the misapplication of biotechnology toward the production of biological weapons. Unexpectedly, however, some of these very advances in the areas of DNA synthesis and sequencing may enable the implementation of automated and nonintrusive safeguards to avert the illicit applications of biotechnology. In the case of DNA synthesis, automated DNA screening tools could be built into DNA synthesizers in order to block the synthesis of hazardous agents. In addition, a comprehensive safety and security regime for dual-use genetic engineering research could include nonintrusive monitoring of DNA sequencing. This is increasingly feasible as laboratories outsource this service to just a few centralized sequencing factories. The adoption of automated, nonintrusive monitoring and surveillance of the DNA synthesis and sequencing pipelines may avert many risks associated with dual-use biotechnology. Here, we describe the historical background and current challenges associated with dual-use biotechnologies and propose strategies to address these challenges.
RNA-primed complementary-sense DNA synthesis of the geminivirus African cassava mosaic virus.
Saunders, K; Lucy, A; Stanley, J
1992-01-01
The plant DNA virus African cassava mosaic virus (ACMV) is believed to replicate by a rolling circle mechanism. To investigate complementary-sense DNA (lagging strand) synthesis, we have analysed the heterogenous form of complementary-sense DNA (H3 DNA) from infected Nicotiana benthamiana by two-dimensional agarose gel electrophoresis and blot hybridisation. The presence of an RNA moeity is demonstrated by comparison of results for nucleic acids resolved on neutral/alkaline and neutral/formamide gels, suggesting that complementary-sense DNA synthesis on the virus-sense single-stranded DNA template is preceded by the synthesis of an RNA primer. Hybridisation with probes to specific parts of ACMV DNA A genome indicates that synthesis of the putative RNA primer initiates between nucleotides 2581-221, a region that includes intergenic sequences that have been implicated in geminivirus DNA replication and the control of gene expression. Images PMID:1475192
Horn, T; Chang, C A; Urdea, M S
1997-12-01
The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays.
Horn, T; Chang, C A; Urdea, M S
1997-01-01
The divergent synthesis of branched DNA (bDNA) comb structures is described. This new type of bDNA contains one unique oligonucleotide, the primary sequence, covalently attached through a comb-like branch network to many identical copies of a different oligonucleotide, the secondary sequence. The bDNA comb structures were assembled on a solid support and several synthesis parameters were investigated and optimized. The bDNA comb molecules were characterized by polyacrylamide gel electrophoretic methods and by controlled cleavage at periodate-cleavable moieties incorporated during synthesis. The developed chemistry allows synthesis of bDNA comb molecules containing multiple secondary sequences. In the accompanying article we describe the synthesis and characterization of large bDNA combs containing all four deoxynucleotides for use as signal amplifiers in nucleic acid quantification assays. PMID:9365265
Strand displacement synthesis by yeast DNA polymerase ε.
Ganai, Rais A; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik
2016-09-30
DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3'-5' exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3'-5' exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5' end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Franzini, Raphael M; Samain, Florent; Abd Elrahman, Maaly; Mikutis, Gediminas; Nauer, Angela; Zimmermann, Mauro; Scheuermann, Jörg; Hall, Jonathan; Neri, Dario
2014-08-20
DNA-encoded chemical libraries are collections of small molecules, attached to DNA fragments serving as identification barcodes, which can be screened against multiple protein targets, thus facilitating the drug discovery process. The preparation of large DNA-encoded chemical libraries crucially depends on the availability of robust synthetic methods, which enable the efficient conjugation to oligonucleotides of structurally diverse building blocks, sharing a common reactive group. Reactions of DNA derivatives with amines and/or carboxylic acids are particularly attractive for the synthesis of encoded libraries, in view of the very large number of building blocks that are commercially available. However, systematic studies on these reactions in the presence of DNA have not been reported so far. We first investigated conditions for the coupling of primary amines to oligonucleotides, using either a nucleophilic attack on chloroacetamide derivatives or a reductive amination on aldehyde-modified DNA. While both methods could be used for the production of secondary amines, the reductive amination approach was generally associated with higher yields and better purity. In a second endeavor, we optimized conditions for the coupling of a diverse set of 501 carboxylic acids to DNA derivatives, carrying primary and secondary amine functions. The coupling efficiency was generally higher for primary amines, compared to secondary amine substituents, but varied considerably depending on the structure of the acids and on the synthetic methods used. Optimal reaction conditions could be found for certain sets of compounds (with conversions >80%), but multiple reaction schemes are needed when assembling large libraries with highly diverse building blocks. The reactions and experimental conditions presented in this article should facilitate the synthesis of future DNA-encoded chemical libraries, while outlining the synthetic challenges that remain to be overcome.
Herpes Simplex Virus DNA Packaging without Measurable DNA Synthesis
Church, Geoffrey A.; Dasgupta, Anindya; Wilson, Duncan W.
1998-01-01
Herpes simplex virus (HSV) type 1 DNA synthesis and packaging occur within the nuclei of infected cells; however, the extent to which the two processes are coupled remains unclear. Correct packaging is thought to be dependent upon DNA debranching or other repair processes, and such events commonly involve new DNA synthesis. Furthermore, the HSV UL15 gene product, essential for packaging, nevertheless localizes to sites of active DNA replication and may link the two events. It has previously been difficult to determine whether packaging requires concomitant DNA synthesis due to the complexity of these processes and of the viral life cycle; however, we have recently described a model system which simplifies the study of HSV assembly. Cells infected with HSV strain tsProt.A accumulate unpackaged capsids at the nonpermissive temperature of 39°C. Following release of the temperature block, these capsids proceed to package viral DNA in a single, synchronous wave. Here we report that, when DNA replication was inhibited prior to release of the temperature block, DNA packaging and later events in viral assembly nevertheless occurred at near-normal levels. We conclude that, under our conditions, HSV DNA packaging does not require detectable levels of DNA synthesis. PMID:9525593
Ledinko, Nada; Fong, Caroline K. Y.
1969-01-01
Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981
Bundy, Ruth E; Marczin, Nándor; Chester, Adrian H; Yacoub, Magdi
2000-01-01
The current study explored potential redox mechanisms of nitric oxide (NO)-induced inhibition of DNA synthesis in cultured human and rat aortic smooth muscle cells.Exposure to S-nitrosothiols, DETA-NONOate and NO itself inhibited ongoing DNA synthesis and S phase progression in a concentration-dependent manner, as measured by thymidine incorporation and flow cytometry. Inhibition by NO donors occurred by release of NO, as detected by chemiluminescence and judged by the effects of NO scavengers, haemoglobin and cPTIO.Co-incubation with redox compounds, N-acetyl-L-cysteine, glutathione and L-ascorbic acid prevented NO inhibition of DNA synthesis. These observations suggest that redox agents may alternatively attenuate NO bioactivity extracellularly, interfere with intracellular actions of NO on the DNA synthesis machinery or restore DNA synthesis after established inhibition by NO.Recovery of DNA synthesis after inhibition by NO was similar with and without redox agents suggesting that augmented restoration of DNA synthesis is an unlikely mechanism to explain redox regulation.Study of extracellular interactions revealed that all redox agents potentiated S-nitrosothiol decomposition and NO release.Examination of intracellular NO bioactivity showed that as opposed to attenuation of NO inhibition of DNA synthesis by redox agents, there was no inhibition (potentiation in the presence of ascorbic acid) of soluble guanylate cyclase (sGC) activation judged by cyclic GMP accumulation in rat cells.These data provide evidence that NO-induced inhibition of ongoing DNA synthesis is sensitive to redox environment. Redox processes might protect the DNA synthesis machinery from inhibition by NO, in the setting of augmented liberation of biologically active NO from NO donors. PMID:10742309
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Mechanism for priming DNA synthesis by yeast DNA Polymerase α
Perera, Rajika L; Torella, Rubben; Klinge, Sebastian; Kilkenny, Mairi L; Maman, Joseph D; Pellegrini, Luca
2013-01-01
The DNA Polymerase α (Pol α)/primase complex initiates DNA synthesis in eukaryotic replication. In the complex, Pol α and primase cooperate in the production of RNA-DNA oligonucleotides that prime synthesis of new DNA. Here we report crystal structures of the catalytic core of yeast Pol α in unliganded form, bound to an RNA primer/DNA template and extending an RNA primer with deoxynucleotides. We combine the structural analysis with biochemical and computational data to demonstrate that Pol α specifically recognizes the A-form RNA/DNA helix and that the ensuing synthesis of B-form DNA terminates primer synthesis. The spontaneous release of the completed RNA-DNA primer by the Pol α/primase complex simplifies current models of primer transfer to leading- and lagging strand polymerases. The proposed mechanism of nucleotide polymerization by Pol α might contribute to genomic stability by limiting the amount of inaccurate DNA to be corrected at the start of each Okazaki fragment. DOI: http://dx.doi.org/10.7554/eLife.00482.001 PMID:23599895
The authors have investigated the ability of the hamster oocyte to initiate DNA synthesis in nuclei differing in basic protein content. DNA synthesis was studied by autoradiography in oocytes that had been incubated in 3H-thymidine after being parthenogenetically activated by sha...
Improved deoxyribozymes for synthesis of covalently branched DNA and RNA.
Lee, Christine S; Mui, Timothy P; Silverman, Scott K
2011-01-01
A covalently branched nucleic acid can be synthesized by joining the 2'-hydroxyl of the branch-site ribonucleotide of a DNA or RNA strand to the activated 5'-phosphorus of a separate DNA or RNA strand. We have previously used deoxyribozymes to synthesize several types of branched nucleic acids for experiments in biotechnology and biochemistry. Here, we report in vitro selection experiments to identify improved deoxyribozymes for synthesis of branched DNA and RNA. Each of the new deoxyribozymes requires Mn²(+) as a cofactor, rather than Mg²(+) as used by our previous branch-forming deoxyribozymes, and each has an initially random region of 40 rather than 22 or fewer combined nucleotides. The deoxyribozymes all function by forming a three-helix-junction (3HJ) complex with their two oligonucleotide substrates. For synthesis of branched DNA, the best new deoxyribozyme, 8LV13, has k(obs) on the order of 0.1 min⁻¹, which is about two orders of magnitude faster than our previously identified 15HA9 deoxyribozyme. 8LV13 also functions at closer-to-neutral pH than does 15HA9 (pH 7.5 versus 9.0) and has useful tolerance for many DNA substrate sequences. For synthesis of branched RNA, two new deoxyribozymes, 8LX1 and 8LX6, were identified with broad sequence tolerances and substantial activity at pH 7.5, versus pH 9.0 for many of our previous deoxyribozymes that form branched RNA. These experiments provide new, and in key aspects improved, practical catalysts for preparation of synthetic branched DNA and RNA.
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Concepts in Biochemistry: Chemical Synthesis of DNA.
ERIC Educational Resources Information Center
Caruthers, Marvin H.
1989-01-01
Outlines the chemistry of the rapid synthesis of relatively large DNA fragments (100-200 monomers each) with yields exceeding 99 percent per coupling. DNA synthesis methodologies are outlined and a polymer-supported synthesis of DNA using deoxynucleoside phosphoramidites is described with structural formulas. (YP)
Synthesis of Bipartite Tetracysteine PNA Probes for DNA In Situ Fluorescent Labeling.
Fang, Ge-Min; Seitz, Oliver
2017-12-24
"Label-free" fluorescent probes that avoid additional steps or building blocks for conjugation of fluorescent dyes with oligonucleotides can significantly reduce the time and cost of parallel bioanalysis of a large number of nucleic acid samples. A method for the synthesis of "label-free" bicysteine-modified PNA probes using solid-phase synthesis and procedures for sequence-specific DNA in situ fluorescent labeling is described here. The concept is based on the adjacent alignment of two bicysteine-modified peptide nucleic acids on a DNA target to form a structurally optimized bipartite tetracysteine motif, which induces a sequence-specific fluorogenic reaction with commercially available biarsenic dyes, even in complex media such as cell lysate. This unit will help researchers to quickly synthesize bipartite tetracysteine PNA probes and carry out low-cost DNA in situ fluorescent labeling experiments. © 2017 by John Wiley & Sons, Inc. Copyright © 2017 John Wiley & Sons, Inc.
CYTOPLASMIC DNA SYNTHESIS IN AMOEBA PROTEUS
Rabinovitch, M.; Plaut, W.
1962-01-01
The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 µ particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H3-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles. PMID:13972870
Modak, Sohan P.; Setlow, Jane K.
1969-01-01
Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934
Role of Escherichia coli dnaG function in coliphage M13 DNA synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Dasgupta, S.; Mitra, S.
Examination of the role of Escherichia coli dnaG function in different stages of M13 phage DNA synthesis by ultracentrifugal analysis of intracellular phage DNA in a thermosensitive dnaG mutant shows that: (a) the formation of parental double-strand replicative-form DNA (rfDNA) from the infecting virus is independent of dnaG function; (b) the synthesis of progeny rfDNA requires dnaG product; (c) after a pool of rfDNA is made up, dnaG function is not required for the progeny single-strand DNA (ssDNA) synthesis. The ssDNAs produced under nonpermissive condition are mostly circular and biologically functional.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Adenovirus type 2 DNA replication. I. Evidence for discontinuous DNA synthesis.
Winnacker, E L
1975-01-01
Isolated nuclei from adenovirus type 2-infected HeLa cells catalyze the incorporation of all four deoxyribonucleoside triphosphates into viral DNA. The observed DNA synthesis occurs via a transient formation of DNA fragments with a sedimentation coefficient of 10S. The fragments are precursors to unit-length viral DNA, they are self-complementary to an extent of at least 70%, and they are distributed along most of the viral chromosome. In addition, accumulation of 10S DNA fragments is observed either in intact, virus-infected HeLa cells under conditions where viral DNA synthesis is inhibited by hydroxyurea or in isolated nuclei from virus-infected HeLa cells at low concentrations of deoxyribonucleotides. Under these suboptimal conditions for DNA synthesis in isolated nuclei, ribonucleoside triphosphates determine the size distribution of DNA intermediates. The evidence presented suggests that a ribonucleoside-dependent initiation step as well at two DNA polymerase catalyzed reactions are involved in the discontinuous replication of adenovirus type 2 DNA. PMID:1117487
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Information transfer from DNA to peptide nucleic acids by template-directed syntheses
NASA Technical Reports Server (NTRS)
Schmidt, J. G.; Christensen, L.; Nielsen, P. E.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
1997-01-01
Peptide nucleic acids (PNAs) are analogs of nucleic acids in which the ribose-phosphate backbone is replaced by a backbone held together by amide bonds. PNAs are interesting as models of alternative genetic systems because they form potentially informational base paired helical structures. Oligocytidylates have been shown to act as templates for formation of longer oligomers of G from PNA G2 dimers. In this paper we show that information can be transferred from DNA to PNA. DNA C4T2C4 is an efficient template for synthesis of PNA G4A2G4 using G2 and A2 units as substrates. The corresponding synthesis of PNA G4C2G4 on DNA C4G2C4 is less efficient. Incorporation of PNA T2 into PNA products on DNA C4A2C4 is the least efficient of the three reactions. These results, obtained using PNA dimers as substrates, parallel those obtained using monomeric activated nucleotides.
Iron Reverses Impermeable Chelator Inhibition of DNA Synthesis in CCl39 Cells
NASA Astrophysics Data System (ADS)
Alcain, Francisco J.; Low, Hans; Crane, Frederick L.
1994-08-01
Treatment of Chinese hamster lung fibro-blasts (CCl 39 cells) with the impermeable iron(II) chelator bathophenanthroline disulfonate (BPS) inhibits DNA synthesis when cell growth is initiated with growth factors including epidermal growth factor plus insulin, thrombin, or ceruloplasmin, but not with 10% fetal calf serum. The BPS treatment inhibits transplasma membrane electron transport. The treatment leads to release of iron from the cells as determined by BPS iron(II) complex formation over 90 min. Growth factor stimulation of DNA synthesis and electron transport are restored by addition of di- or trivalent iron to the cells in the form of ferric ammonium citrate, ferrous ammonium sulfate, or diferric transferrin. The effect with BPS differs from the inhibition of growth by hydroxyurea, which acts on the ribonucleotide reductase, or diethylenetriaminepentaacetic acid, which is another impermeable chelating agent, in that these agents inhibit growth in 10% fetal calf serum. The BPS effect is consistent with removal of iron from a site on the cell surface that controls DNA synthesis.
Suzuki, E; Kondo, T; Makise, M; Mima, S; Sakamoto, K; Tsuchiya, T; Mizushima, T
1998-07-01
We previously reported that mutations in the dnaA gene which encodes the initiator of chromosomal DNA replication in Escherichia coli caused an alteration in the levels of unsaturated fatty acids of phospholipids in membranes. In this study, we examined fatty acid compositions in other mutants which are defective in DNA replication. As in the case of temperature-sensitive dnaA mutants, temperature-sensitive dnaC and dnaE mutants, which have defects in initiation and elongation, respectively, of DNA replication showed a lower level of unsaturation of fatty acids (ratio of unsaturated to saturated fatty acids) compared with the wild-type strain, especially at high temperatures. On the other hand, temperature-sensitive mutants defective in cellular processes other than DNA replication, such as RNA synthesis and cell division, did not show a lower level of unsaturation of fatty acids compared with the wild-type strain. These results suggest that the inhibition of DNA replication causes a lower level of unsaturation of fatty acids in Escherichia coli cells.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
NASA Technical Reports Server (NTRS)
Lin, B. L.; Raghavan, V.
1991-01-01
The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.
Role of Escherichia coli dnaA gene and its integrative suppression in M13 Coliphage DNA synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mitra, S.; Stallions, D.R.
An F/sup +/ derivative of Escherichia coli E508 thermosensitive in dnaA function (involved in DNA synthesis initiation), its revertant and an Hfr derivative of E508(ts) in which the temperature-sensitive phenotype is suppressed by integrative suppression have been compared for their ability to support M13 phage DNA synthesis at the nonpermissive temperature. Upon infection at the nonpermissive temperature, both the revertant and the Hfr strain support normal phage replication while the temperature-sensitive mutant does not. However, when infection is carried out at a permissive temperature and the temperature is shifted up after infection, phage synthesis occurs in the temperature-sensitive mutant also,more » but in lesser quantity than in the revertant strain. Analysis of intracellular labeled phage DNA indicates: (a) parental replicative form DNA synthesis is not dependent on dnaA function; (b) progeny replicative form DNA synthesis is strongly inhibited in the temperature-sensitive dnaA mutant at the nonpermissive temperature; (c) progeny single-strand DNA synthesis does not absolutely require dnaA function; (d) progeny single-strand DNA is present in the circular form. The implication of the host DNA replication in M13 DNA synthesis is discussed.« less
Powers, C. D.; Miller, B. A.; Kurtz, H.; Ackermann, W. W.
1969-01-01
Inhibition of HeLa cell deoxyribonucleic acid (DNA) synthesis, which occurred by the 4th to 5th hr after infection with poliovirus, could be blocked completely by guanidine only when it was present before the 2nd hr. At the 2nd hr, there was no significant ribonucleic acid (RNA)-replicase activity, and addition of guanidine inhibited all production of virus but allowed 57% of maximal DNA inhibition to develop. Maximum DNA inhibition developed in cells infected for 4 hr in the presence of guanidine when the guanidine was removed for a 10-min interval. RNA-replicase activity was not enzymatically detectable and viral multiplication did not develop in these cells unless the interval without guanidine was extended to 60 min. The interpretation of the data was that the effect of guanidine on viral-induced inhibition of DNA synthesis was distinct and not a consequence of the inhibition of RNA-replicase. PMID:4305675
DNA-Encoded Solid-Phase Synthesis: Encoding Language Design and Complex Oligomer Library Synthesis.
MacConnell, Andrew B; McEnaney, Patrick J; Cavett, Valerie J; Paegel, Brian M
2015-09-14
The promise of exploiting combinatorial synthesis for small molecule discovery remains unfulfilled due primarily to the "structure elucidation problem": the back-end mass spectrometric analysis that significantly restricts one-bead-one-compound (OBOC) library complexity. The very molecular features that confer binding potency and specificity, such as stereochemistry, regiochemistry, and scaffold rigidity, are conspicuously absent from most libraries because isomerism introduces mass redundancy and diverse scaffolds yield uninterpretable MS fragmentation. Here we present DNA-encoded solid-phase synthesis (DESPS), comprising parallel compound synthesis in organic solvent and aqueous enzymatic ligation of unprotected encoding dsDNA oligonucleotides. Computational encoding language design yielded 148 thermodynamically optimized sequences with Hamming string distance ≥ 3 and total read length <100 bases for facile sequencing. Ligation is efficient (70% yield), specific, and directional over 6 encoding positions. A series of isomers served as a testbed for DESPS's utility in split-and-pool diversification. Single-bead quantitative PCR detected 9 × 10(4) molecules/bead and sequencing allowed for elucidation of each compound's synthetic history. We applied DESPS to the combinatorial synthesis of a 75,645-member OBOC library containing scaffold, stereochemical and regiochemical diversity using mixed-scale resin (160-μm quality control beads and 10-μm screening beads). Tandem DNA sequencing/MALDI-TOF MS analysis of 19 quality control beads showed excellent agreement (<1 ppt) between DNA sequence-predicted mass and the observed mass. DESPS synergistically unites the advantages of solid-phase synthesis and DNA encoding, enabling single-bead structural elucidation of complex compounds and synthesis using reactions normally considered incompatible with unprotected DNA. The widespread availability of inexpensive oligonucleotide synthesis, enzymes, DNA sequencing, and PCR
Takamitsu, Emi; Fukunaga, Kazuki; Iio, Yusuke; Moriya, Koko; Utsumi, Toshihiko
2014-11-01
To establish a non-radioactive, cell-free detection system for protein N-myristoylation, metabolic labeling in a cell-free protein synthesis system using bioorthogonal myristic acid analogues was performed. After Cu(I)-catalyzed azide-alkyne cycloaddition (CuAAC) with a biotin tag, the tagged proteins were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and blotted on a polyvinylidene fluoride (PVDF) membrane, and then protein N-myristoylation was detected by enhanced chemiluminescence (ECL) using horseradish peroxidase (HRP)-conjugated streptavidin. The results showed that metabolic labeling in an insect cell-free protein synthesis system using an azide analogue of myristic acid followed by CuAAC with alkynyl biotin was the most effective strategy for cell-free detection of protein N-myristoylation. To determine whether the newly developed detection method can be applied for the detection of novel N-myristoylated proteins from complementary DNA (cDNA) resources, four candidate cDNA clones were selected from a human cDNA resource and their susceptibility to protein N-myristoylation was evaluated using the newly developed strategy. As a result, the products of three cDNA clones were found to be novel N-myristoylated protein, and myristoylation-dependent specific intracellular localization was observed for two novel N-myristoylated proteins. Thus, the metabolic labeling in an insect cell-free protein synthesis system using bioorthogonal azide analogue of myristic acid was an effective strategy to identify novel N-myristoylated proteins from cDNA resources. Copyright © 2014 Elsevier Inc. All rights reserved.
Karska-Wysocki, B; Mamet-Bratley, M D; Przewlocki, G
1977-01-01
Marker rescue experiments with alkylated T7 bacteriophage carried out in the presence and in the absence of nalidixic acid suggest that the gradient in rescue is due to two alkylation-induced causes: a DNA injection defect and an interference with DNA synthesis. PMID:916036
Synthesis and Crystal Structure of 2’-Se-modified guanosine Containing DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Salon, J.; Sheng, J; Gan, J
Selenium modification of nucleic acids is of great importance in X-ray crystal structure determination and functional study of nucleic acids. Herein, we describe a convenient synthesis of a new building block, the 2{prime}-SeMe-modified guanosine (G{sub Se}) phosphoramidite, and report the first incorporation of the 2{prime}-Se-G moiety into DNA. The X-ray crystal structure of the 2{prime}-Se-modified octamer DNA (5{prime}-GTG{sub Se}TACAC-3{prime}) was determined at a resolution of 1.20 {angstrom}. We also found that the 2{prime}-Se modification points to the minor groove and that the modified and native structures are virtually identical. Furthermore, we observed that the 2{prime}-Se-G modification can significantly facilitate themore » crystal growth with respect to the corresponding native DNA.« less
Mechanism for CCC DNA synthesis in hepadnaviruses.
Sohn, Ji A; Litwin, Samuel; Seeger, Christoph
2009-11-30
Hepadnavirus replication requires the synthesis of a covalently closed circular (CCC) DNA from the relaxed circular (RC) viral genome by an unknown mechanism. CCC DNA formation could require enzymatic activities of the viral reverse transcriptase (RT), or cellular DNA repair enzymes, or both. Physical mapping of the 5' and 3' ends of RC DNA and sequence analysis of CCC DNA revealed that CCC DNA synthesis requires the removal of the RT and an RNA oligomer from the 5' ends of minus and plus strand DNA, respectively, removal of sequences from the terminally redundant minus strand, completion of the less than full-length plus strand, and ligation of the ends. Two models have been proposed that could explain CCC DNA formation. The first (model 1) invokes a role for the RT to catalyze a cleavage-ligation reaction leading to the formation of a unit length minus strand in CCC DNA and a DNA repair reaction for the completion and ligation of plus strand DNA; the second (model 2) predicts that CCC DNA formation depends entirely on cellular DNA repair enzymes. To determine which mechanism is utilized, we developed cell lines expressing duck hepatitis B virus genomes carrying mutations permitting us to follow the fate of viral DNA sequences during their conversion from RC to CCC DNA. Our results demonstrated that the oligomer at the 5' end of minus strand DNA is completely or at least partially removed prior to CCC DNA synthesis. The results indicated that both RC DNA strands undergo DNA repair reactions carried out by the cellular DNA repair machinery as predicted by model 2. Thus, our study provided the basis for the identification of the cellular components required for CCC DNA formation.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Novicki, D.L.; Rosenberg, M.R.; Michalopoulos, G.
1985-01-01
Rat hepatocytes in primary culture can be stimulated to replicate under the influence of rat serum and sparse plating conditions. Higher replication rates are induced by serum from two-thirds partially hepatectomized rats. The effects of carcinogens and noncarcinogens on the ability of hepatocytes to synthesize DNA were examined by measuring the incorporation of (3H)thymidine by liquid scintillation counting and autoradiography. Hepatocyte DNA synthesis was not decreased by ethanol or dimethyl sulfoxide at concentrations less than 0.5%. No effect was observed when 0.1 mM ketamine, Nembutal, hypoxanthine, sucrose, ascorbic acid, or benzo(e)pyrene was added to cultures of replicating hepatocytes. Estrogen, testosterone,more » tryptophan, and vitamin E inhibited DNA synthesis by approximately 50% at 0.1 mM, a concentration at which toxicity was noticeable. Several carcinogens requiring metabolic activation as well as the direct-acting carcinogen N-methyl-N'-nitro-N-nitrosoguanidine interfered with DNA synthesis. Aflatoxin B1 inhibited DNA synthesis by 50% (ID50) at concentrations between 1 X 10(-8) and 1 X 10(-7) M. The ID50 for 2-acetylaminofluorene was between 1 X 10(-7) and 1 X 10(-6) M. Benzo(a)pyrene and 3'-methyl-4-dimethylaminoazobenzene inhibited DNA synthesis 50% between 1 X 10(-5) and 1 X 10(-4) M. Diethylnitrosamine and dimethylnitrosamine (ID50 between 1 X 10(-4) and 5 X 10(-4) M) and 1- and 2-naphthylamine (ID50 between 1 X 10(-5) and 5 X 10(-4) M) caused inhibition of DNA synthesis at concentrations which overlapped with concentrations that caused measurable toxicity.« less
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Schmidtgall, Boris; Höbartner, Claudia; Ducho, Christian
2015-01-01
Modifications of the nucleic acid backbone are essential for the development of oligonucleotide-derived bioactive agents. The NAA-modification represents a novel artificial internucleotide linkage which enables the site-specific introduction of positive charges into the otherwise polyanionic backbone of DNA oligonucleotides. Following initial studies with the introduction of the NAA-linkage at T-T sites, it is now envisioned to prepare NAA-modified oligonucleotides bearing the modification at X-T motifs (X = A, C, G). We have therefore developed the efficient and stereoselective synthesis of NAA-linked 'dimeric' A-T phosphoramidite building blocks for automated DNA synthesis. Both the (S)- and the (R)-configured NAA-motifs were constructed with high diastereoselectivities to furnish two different phosphoramidite reagents, which were employed for the solid phase-supported automated synthesis of two NAA-modified DNA oligonucleotides. This represents a significant step to further establish the NAA-linkage as a useful addition to the existing 'toolbox' of backbone modifications for the design of bioactive oligonucleotide analogues.
Yu, Chuanhe; Gan, Haiyun; Zhang, Zhiguo
2018-01-01
DNA replication initiates at DNA replication origins after unwinding of double-strand DNA(dsDNA) by replicative helicase to generate single-stranded DNA (ssDNA) templates for the continuous synthesis of leading-strand and the discontinuous synthesis of lagging-strand. Therefore, methods capable of detecting strand-specific information will likely yield insight into the association of proteins at leading and lagging strand of DNA replication forks and the regulation of leading and lagging strand synthesis during DNA replication. The enrichment and Sequencing of Protein-Associated Nascent DNA (eSPAN), which measure the relative amounts of proteins at nascent leading and lagging strands of DNA replication forks, is a step-wise procedure involving the chromatin immunoprecipitation (ChIP) of a protein of interest followed by the enrichment of protein-associated nascent DNA through BrdU immunoprecipitation. The isolated ssDNA is then subjected to strand-specific sequencing. This method can detect whether a protein is enriched at leading or lagging strand of DNA replication forks. In addition to eSPAN, two other strand-specific methods, (ChIP-ssSeq), which detects potential protein-ssDNA binding and BrdU-IP-ssSeq, which can measure synthesis of both leading and lagging strand, were developed along the way. These methods can provide strand-specific and complementary information about the association of the target protein with DNA replication forks as well as synthesis of leading and lagging strands genome wide. Below, we describe the detailed eSPAN, ChIP-ssSeq, and BrdU-IP-ssSeq protocols.
DNA synthesis inhibitors for the treatment of gastrointestinal cancer.
Yasui, Hiroshi; Tsurita, Giichiro; Imai, Kohzoh
2014-11-01
Intensive laboratory, preclinical and clinical studies have identified and validated molecular targets in cancers, leading to a shift toward the development of novel, rationally designed and specific therapeutic agents. However, gastrointestinal cancers continue to have a poor prognosis, largely due to drug resistance. Here, we discuss the current understanding of DNA synthesis inhibitors and their mechanisms of action for the treatment of gastrointestinal malignancies. Conventional agents, including DNA synthesis inhibitors such as fluoropyrimidines and platinum analogs, remain the most effective therapeutics and are the standards against which new drugs are compared. Novel DNA synthesis inhibitors for the treatment of gastrointestinal malignancies include a combination of the antimetabolite TAS-102, which consists of trifluorothymidine with a thymidine phosphorylase inhibitor, and a novel micellar formulation of cisplatin NC-6004 that uses a nanotechnology-based drug delivery system. The challenges of translational cancer research using DNA synthesis inhibitors include the identification of drugs that are specific to tumor cells to reduce toxicity and increase antitumor efficacy, biomarkers to predict pharmacological responses to chemotherapeutic drugs, identification of ways to overcome drug resistance and development of novel combination therapies with DNA synthesis inhibitors and other cancer therapies, such as targeted molecular therapeutics. Here, we discuss the current understanding of DNA synthesis inhibitors and their mechanisms of action for the treatment of gastrointestinal malignancies.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
The existence of an intricate interplay of nucleic acids and nucleotides in the chain of events leading from free amino acid to completed polypeptide chain has been determined. To this was added another participant to the nucleotides in protein synthesis - diadenosine-5', 5''', p'p/sup 4/-tetraphosphate (Ap4A). Ap/sub 4/A serves as an initiation primer for DNA synthesis in a eukaryotic system catalyzed by DNA polymerase ..cap alpha... Thus the initial step in protein synthesis is linked to the first step in DNA synthesis by a small molecular weight, unique dinucleotide signal. Advances in the methodology of nucleic acid sequencing have mademore » it possible to examine the relationship between specific short segments of DNA and RNA and their function in the metabolism of the living cell. The triester method of synthesizing deoxynucleotide polymers has made it feasible to synthesize and use specific oligomeric deoxynucleotide sequences as probes of genetic function and potential viral inhibitors. The synthesis of ribonucleotide polymers has been more difficult, due almost entirely to the presence of the 2' ribosyl hydroxyl group. The possibility is now emerging, however, of employing ribonucleotide polymers as specific RNA-virus inhibitors.« less
Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1
Nieman, R. H.; Poulsen, L. L.
1967-01-01
Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601
Characterization of human translesion DNA synthesis across a UV-induced DNA lesion
Hedglin, Mark; Pandey, Binod; Benkovic, Stephen J
2016-01-01
Translesion DNA synthesis (TLS) during S-phase uses specialized TLS DNA polymerases to replicate a DNA lesion, allowing stringent DNA synthesis to resume beyond the offending damage. Human TLS involves the conjugation of ubiquitin to PCNA clamps encircling damaged DNA and the role of this post-translational modification is under scrutiny. A widely-accepted model purports that ubiquitinated PCNA recruits TLS polymerases such as pol η to sites of DNA damage where they may also displace a blocked replicative polymerase. We provide extensive quantitative evidence that the binding of pol η to PCNA and the ensuing TLS are both independent of PCNA ubiquitination. Rather, the unique properties of pols η and δ are attuned to promote an efficient and passive exchange of polymerases during TLS on the lagging strand. DOI: http://dx.doi.org/10.7554/eLife.19788.001 PMID:27770570
Lapadat-Tapolsky, M; Gabus, C; Rau, M; Darlix, J L
1997-05-02
Retroviral nucleocapsid (NC) protein is an integral part of the virion nucleocapsid where it coats the dimeric RNA genome. Due to its nucleic acid binding and annealing activities, NC protein directs the annealing of the tRNA primer to the primer binding site and greatly facilitates minus strand DNA elongation and transfer while protecting the nucleic acids against nuclease degradation. To understand the role of NCp7 in viral DNA synthesis, we examined the influence of NCp7 on self-primed versus primer-specific reverse transcription. The results show that HIV-1 NCp7 can extensively inhibit self-primed reverse transcription of viral and cellular RNAs while promoting primer-specific synthesis of proviral DNA. The role of NCp7 vis-a-vis the presence of mutations in the viral DNA during minus strand elongation was examined. NCp7 maximized the annealing between a cDNA(-) primer containing one to five consecutive errors and an RNA representing the 3' end of the genome. The ability of reverse transcriptase (RT) in the presence of NCp7 to subsequently extend the mutated primers depended upon the position of the mismatch within the primer:template complex. When the mutations were at the polymerisation site, primer extension by RT in the presence of NCp7 was very high, about 40% for one mismatch and 3% for five consecutive mismatches. Mutations within the DNA primer or at its 5' end had little effect on the extension of viral DNA by RT. Taken together these results indicate that NCp7 plays major roles in proviral DNA synthesis within the virion core due to its ability to promote prime-specific proviral DNA synthesis while concurrently inhibiting non-specific reverse transcription of viral and cellular RNAs. Moreover, the observation that NCp7 enhances the incorporation of mutations during minus strand DNA elongation favours the notion that NCp7 is a factor contributing to the high mutation rate of HIV-1.
NASA Astrophysics Data System (ADS)
Sirajuddin, Muhammad; Ali, Saqib; McKee, Vickie; Ullah, Hameed
2015-03-01
This paper stresses on the synthesis, characterization of novel carboxylic acid derivative and its application in pharmaceutics. Carboxylic acid derivatives have a growing importance in medicine, particularly in oncology. A novel carboxylic acid, 4-(4-methoxy-2-nitrophenylamino)-4-oxobutanoic acid, was synthesized and characterized by elemental analysis, FT-IR, NMR (1H, and 13C), mass spectrometry and single crystal X-ray structural analysis. The structure of the title compound, C11H12N2O6, shows the molecules dimerised by short intramolecular Osbnd H⋯O hydrogen bonds. The compound was screened for in vitro antimicrobial, anticancer, and antileishmanial activities as well as interaction with SS-DNA. The compound was also checked for in vitro anticancer activity against BHK-21, H-157 and HCEC cell lines, and showed significant anticancer activity. The compound was almost non-toxic towards human corneal epithelial cells (HCEC) and did not show more than 7.4% antiproliferative activity when used at the 2.0 μg/mL end concentration. It was also tested for antileishmanial activity against the promastigote form of leishmania major and obtained attractive result. DNA interaction study exposes that the binding mode of the compound with SS-DNA is an intercalative as it results in hypochromism along with minor red shift. A new and efficient strategy to identify pharmacophores sites in carboxylic acid derivative for antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.
RABINOVITCH, M; PLAUT, W
1962-12-01
The incorporation of tritiated thymidine in Amoeba proteus was reinvestigated in order to see if it could be associated with microscopically detectable structures. Staining experiments with basic dyes, including the fluorochrome acridine orange, revealed the presence of large numbers of 0.3 to 0.5 micro particles in the cytoplasm of all cells studied. The effect of nuclease digestion on the dye affinity of the particles suggests that they contain DNA as well as RNA. Centrifugation of living cells at 10,000 g leads to the sedimentation of the particles in the centrifugal third of the ameba near the nucleus. Analysis of centrifuged cells which had been incubated with H(3)-thymidine showed a very high degree of correlation between the location of the nucleic acid-containing granules and that of acid-insoluble, deoxyribonuclease-sensitive labeled molecules and leads to the conclusion that cytoplasmic DNA synthesis in Amoeba proteus occurs in association with these particles.
Structure of human DNA polymerase iota and the mechanism of DNA synthesis.
Makarova, A V; Kulbachinskiy, A V
2012-06-01
Cellular DNA polymerases belong to several families and carry out different functions. Highly accurate replicative DNA polymerases play the major role in cell genome replication. A number of new specialized DNA polymerases were discovered at the turn of XX-XXI centuries and have been intensively studied during the last decade. Due to the special structure of the active site, these enzymes efficiently perform synthesis on damaged DNA but are characterized by low fidelity. Human DNA polymerase iota (Pol ι) belongs to the Y-family of specialized DNA polymerases and is one of the most error-prone enzymes involved in DNA synthesis. In contrast to other DNA polymerases, Pol ι is able to use noncanonical Hoogsteen interactions for nucleotide base pairing. This allows it to incorporate nucleotides opposite various lesions in the DNA template that impair Watson-Crick interactions. Based on the data of X-ray structural analysis of Pol ι in complexes with various DNA templates and dNTP substrates, we consider the structural peculiarities of the Pol ι active site and discuss possible mechanisms that ensure the unique behavior of the enzyme on damaged and undamaged DNA.
Gamper, Armin M.; Choi, Serah; Matsumoto, Yoshihiro; Banerjee, Dibyendu; Tomkinson, Alan E.; Bakkenist, Christopher J.
2012-01-01
Ataxia telangiectasia (A-T) is a pleiotropic disease, with a characteristic hypersensitivity to ionizing radiation that is caused by biallelic mutations in A-T mutated (ATM), a gene encoding a protein kinase critical for the induction of cellular responses to DNA damage, particularly to DNA double strand breaks. A long known characteristic of A-T cells is their ability to synthesize DNA even in the presence of ionizing radiation-induced DNA damage, a phenomenon termed radioresistant DNA synthesis. We previously reported that ATM kinase inhibition, but not ATM protein disruption, blocks sister chromatid exchange following DNA damage. We now show that ATM kinase inhibition, but not ATM protein disruption, also inhibits DNA synthesis. Investigating a potential physical interaction of ATM with the DNA replication machinery, we found that ATM co-precipitates with proliferating cell nuclear antigen (PCNA) from cellular extracts. Using bacterially purified ATM truncation mutants and in vitro translated PCNA, we showed that the interaction is direct and mediated by the C terminus of ATM. Indeed, a 20-amino acid region close to the kinase domain is sufficient for strong binding to PCNA. This binding is specific to ATM, because the homologous regions of other PIKK members, including the closely related kinase A-T and Rad3-related (ATR), did not bind PCNA. ATM was found to bind two regions in PCNA. To examine the functional significance of the interaction between ATM and PCNA, we tested the ability of ATM to stimulate DNA synthesis by DNA polymerase δ, which is implicated in both DNA replication and DNA repair processes. ATM was observed to stimulate DNA polymerase activity in a PCNA-dependent manner. PMID:22362778
Deep-sea vent phage DNA polymerase specifically initiates DNA synthesis in the absence of primers.
Zhu, Bin; Wang, Longfei; Mitsunobu, Hitoshi; Lu, Xueling; Hernandez, Alfredo J; Yoshida-Takashima, Yukari; Nunoura, Takuro; Tabor, Stanley; Richardson, Charles C
2017-03-21
A DNA polymerase is encoded by the deep-sea vent phage NrS-1. NrS-1 has a unique genome organization containing genes that are predicted to encode a helicase and a single-stranded DNA (ssDNA)-binding protein. The gene for an unknown protein shares weak homology with the bifunctional primase-polymerases (prim-pols) from archaeal plasmids but is missing the zinc-binding domain typically found in primases. We show that this gene product has efficient DNA polymerase activity and is processive in DNA synthesis in the presence of the NrS-1 helicase and ssDNA-binding protein. Remarkably, this NrS-1 DNA polymerase initiates DNA synthesis from a specific template DNA sequence in the absence of any primer. The de novo DNA polymerase activity resides in the N-terminal domain of the protein, whereas the C-terminal domain enhances DNA binding.
Grummt, F; Weinmann-Dorsch, C; Schneider-Schaulies, J; Lux, A
1986-03-01
DNA synthesis and adenosine(5')tetraphosphate(5')adenosine (Ap4A) levels decrease in cells treated with EDTA. The inhibitory effect of EDTA can be reversed with micromolar amounts of ZnCl2. ZnCl2 in micromolar concentrations also inhibits Ap4A hydrolase and stimulates amino acid-dependent Ap4A synthesis, suggesting that Zn2+ is modulating intracellular Ap4A pools. Serum addition to G1-arrested cells enhances uptake of Zn, whereas serum depletion leads to a fivefold decrease of the rates of zinc uptake. These results are discussed by regarding Zn2+ as a putative 'second messenger' of mitogenic induction and Ap4A as a possible 'third messenger' and trigger of DNA synthesis.
Initiation and Reinitiation of DNA Synthesis during Replication of Bacteriophage T7*
Dressler, David; Wolfson, John; Magazin, Marilyn
1972-01-01
In its first round of replication, the T7 chromosome follows a simple pattern, as viewed in the electron microscope. The iniation of DNA synthesis occurs about 17% from the genetic left end of the viral DNA rod. Bidirectional DNA synthesis from this origin then generates a replicating intermediate that we call an “eye form.” In the eye form, when synthesis in the leftward direction reaches the left end of the viral chromosome, the molecule is converted into a Y-shaped replicating rod. The remaining growing point continues synthesis rightward, until presumably it runs off the right end of the DNA rod, thus terminating replication. Numerous T7 chromosomes were found in which a second round of replication had begun before the first round had finished. Analysis of these reinitiated DNA molecules showed that the second round of replication, like the first, began 17% from the end of the chromosome and involved bidirectional DNA synthesis. Images PMID:4554539
Waqar, M A; Evans, M J; Huberman, J A
1978-01-01
We have studied the effects of the nucleotide analogue, 2',3'-dideoxythymidine-5'-triphosphate (ddTTP) on replicative DNA synthesis in HeLa cell lysates. As previously demonstrated (1), such lysates carry out extensive DNA synthesis in vitro, at rates and in a fashion similar to in vivo DNA replication. We report here that all aspects of DNA synthesis in such lysates (total dNTP incorporation, elongation of continuous nascent strands, and the initiation, elongation, and joining of Okazaki pieces) are only slightly inhibited by concentrations of ddTTP as high as 100-500 micrometer when the dTTP concentration is maintained at 10 micrometer. This finding is consistent with the report by Edenberg, Anderson, and DePamphilis (2) that all aspects of replicative in vitro simian virus 40 DNA synthesis are also resistant to ddTTP. We also find, in agreement with Edenberg, Anderson, and DePamphilis (2), that DNA synthesis catalyzed by DNA polymerases beta or gamma is easily inhibited by ddTTP, while synthesis catalyzed by DNA polymerase alpha is very resistant. These observations suggest that DNA polymerase alpha may be the only DNA polymerase required for all aspects of cellular DNA synthesis. PMID:673840
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C.
2009-01-01
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5′-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations. PMID:19726688
Ghosh, Sharmistha; Marintcheva, Boriana; Takahashi, Masateru; Richardson, Charles C
2009-10-30
Single-stranded DNA-binding protein (gp2.5), encoded by gene 2.5 of bacteriophage T7, plays an essential role in DNA replication. Not only does it remove impediments of secondary structure in the DNA, it also modulates the activities of the other replication proteins. The acidic C-terminal tail of gp2.5, bearing a C-terminal phenylalanine, physically and functionally interacts with the helicase and DNA polymerase. Deletion of the phenylalanine or substitution with a nonaromatic amino acid gives rise to a dominant lethal phenotype, and the altered gp2.5 has reduced affinity for T7 DNA polymerase. Suppressors of the dominant lethal phenotype have led to the identification of mutations in gene 5 that encodes the T7 DNA polymerase. The altered residues in the polymerase are solvent-exposed and lie in regions that are adjacent to the bound DNA. gp2.5 lacking the C-terminal phenylalanine has a lower affinity for gp5-thioredoxin relative to the wild-type gp2.5, and this affinity is partially restored by the suppressor mutations in DNA polymerase. gp2.5 enables T7 DNA polymerase to catalyze strand displacement DNA synthesis at a nick in DNA. The resulting 5'-single-stranded DNA tail provides a loading site for T7 DNA helicase. gp2.5 lacking the C-terminal phenylalanine does not support this event with wild-type DNA polymerase but does to a limited extent with T7 DNA polymerase harboring the suppressor mutations.
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery.
O'Reilly, Rachel K; Turberfield, Andrew J; Wilks, Thomas R
2017-10-17
Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify "successful" structures. The largest libraries made by conventional synthesis are currently of the order of 10 8 distinct molecules. To put this in context, there are 10 13 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to engineer a
The Evolution of DNA-Templated Synthesis as a Tool for Materials Discovery
2017-01-01
Conspectus Precise control over reactivity and molecular structure is a fundamental goal of the chemical sciences. Billions of years of evolution by natural selection have resulted in chemical systems capable of information storage, self-replication, catalysis, capture and production of light, and even cognition. In all these cases, control over molecular structure is required to achieve a particular function: without structural control, function may be impaired, unpredictable, or impossible. The search for molecules with a desired function is often achieved by synthesizing a combinatorial library, which contains many or all possible combinations of a set of chemical building blocks (BBs), and then screening this library to identify “successful” structures. The largest libraries made by conventional synthesis are currently of the order of 108 distinct molecules. To put this in context, there are 1013 ways of arranging the 21 proteinogenic amino acids in chains up to 10 units long. Given that we know that a number of these compounds have potent biological activity, it would be highly desirable to be able to search them all to identify leads for new drug molecules. Large libraries of oligonucleotides can be synthesized combinatorially and translated into peptides using systems based on biological replication such as mRNA display, with selected molecules identified by DNA sequencing; but these methods are limited to BBs that are compatible with cellular machinery. In order to search the vast tracts of chemical space beyond nucleic acids and natural peptides, an alternative approach is required. DNA-templated synthesis (DTS) could enable us to meet this challenge. DTS controls chemical product formation by using the specificity of DNA hybridization to bring selected reactants into close proximity, and is capable of the programmed synthesis of many distinct products in the same reaction vessel. By making use of dynamic, programmable DNA processes, it is possible to
Strand displacement synthesis by yeast DNA polymerase ε
Ganai, Rais A.; Zhang, Xiao-Ping; Heyer, Wolf-Dietrich; Johansson, Erik
2016-01-01
DNA polymerase ε (Pol ε) is a replicative DNA polymerase with an associated 3′–5′ exonuclease activity. Here, we explored the capacity of Pol ε to perform strand displacement synthesis, a process that influences many DNA transactions in vivo. We found that Pol ε is unable to carry out extended strand displacement synthesis unless its 3′–5′ exonuclease activity is removed. However, the wild-type Pol ε holoenzyme efficiently displaced one nucleotide when encountering double-stranded DNA after filling a gap or nicked DNA. A flap, mimicking a D-loop or a hairpin structure, on the 5′ end of the blocking primer inhibited Pol ε from synthesizing DNA up to the fork junction. This inhibition was observed for Pol ε but not with Pol δ, RB69 gp43 or Pol η. Neither was Pol ε able to extend a D-loop in reconstitution experiments. Finally, we show that the observed strand displacement synthesis by exonuclease-deficient Pol ε is distributive. Our results suggest that Pol ε is unable to extend the invading strand in D-loops during homologous recombination or to add more than two nucleotides during long-patch base excision repair. Our results support the hypothesis that Pol ε participates in short-patch base excision repair and ribonucleotide excision repair. PMID:27325747
Vandersall, Jennifer A.; Gardner, Shea N.; Clague, David S.
2010-05-04
A computational method and computer-based system of modeling DNA synthesis for the design and interpretation of PCR amplification, parallel DNA synthesis, and microarray chip analysis. The method and system include modules that address the bioinformatics, kinetics, and thermodynamics of DNA amplification and synthesis. Specifically, the steps of DNA selection, as well as the kinetics and thermodynamics of DNA hybridization and extensions, are addressed, which enable the optimization of the processing and the prediction of the products as a function of DNA sequence, mixing protocol, time, temperature and concentration of species.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Ribonucleic Acid Synthesis by Cucumber Chromatin
Johnson, Kenneth D.; Purves, William K.
1970-01-01
When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.
Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G
2017-04-26
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis
2017-01-01
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050
Archaeal replicative primases can perform translesion DNA synthesis.
Jozwiakowski, Stanislaw K; Borazjani Gholami, Farimah; Doherty, Aidan J
2015-02-17
DNA replicases routinely stall at lesions encountered on the template strand, and translesion DNA synthesis (TLS) is used to rescue progression of stalled replisomes. This process requires specialized polymerases that perform translesion DNA synthesis. Although prokaryotes and eukaryotes possess canonical TLS polymerases (Y-family Pols) capable of traversing blocking DNA lesions, most archaea lack these enzymes. Here, we report that archaeal replicative primases (Pri S, primase small subunit) can also perform TLS. Archaeal Pri S can bypass common oxidative DNA lesions, such as 8-Oxo-2'-deoxyguanosines and UV light-induced DNA damage, faithfully bypassing cyclobutane pyrimidine dimers. Although it is well documented that archaeal replicases specifically arrest at deoxyuracils (dUs) due to recognition and binding to the lesions, a replication restart mechanism has not been identified. Here, we report that Pri S efficiently replicates past dUs, even in the presence of stalled replicase complexes, thus providing a mechanism for maintaining replication bypass of these DNA lesions. Together, these findings establish that some replicative primases, previously considered to be solely involved in priming replication, are also TLS proficient and therefore may play important roles in damage tolerance at replication forks.
Kim, Kyung-Il; Lee, Seonghyun; Jin, Xuelin; Kim, Su Ji; Jo, Kyubong; Lee, Jung Heon
2017-01-01
Synthesis of smooth and continuous DNA nanowires, preserving the original structure of native DNA, and allowing its analysis by scanning electron microscope (SEM), is demonstrated. Gold nanoparticles densely assembled on the DNA backbone via thiol-tagged DNA binding peptides work as seeds for metallization of DNA. This method allows whole analysis of DNA molecules with entangled 3D features. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Amino acid-dependent signaling via S6K1 and MYC is essential for regulation of rDNA transcription
Kang, Jian; Kusnadi, Eric P.; Ogden, Allison J.; Hicks, Rodney J.; Bammert, Lukas; Kutay, Ulrike; Hung, Sandy; Sanij, Elaine; Hannan, Ross D.; Hannan, Katherine M.; Pearson, Richard B.
2016-01-01
Dysregulation of RNA polymerase I (Pol I)-dependent ribosomal DNA (rDNA) transcription is a consistent feature of malignant transformation that can be targeted to treat cancer. Understanding how rDNA transcription is coupled to the availability of growth factors and nutrients will provide insight into how ribosome biogenesis is maintained in a tumour environment characterised by limiting nutrients. We demonstrate that modulation of rDNA transcription initiation, elongation and rRNA processing is an immediate, co-regulated response to altered amino acid abundance, dependent on both mTORC1 activation of S6K1 and MYC activity. Growth factors regulate rDNA transcription initiation while amino acids modulate growth factor-dependent rDNA transcription by primarily regulating S6K1-dependent rDNA transcription elongation and processing. Thus, we show for the first time amino acids regulate rRNA synthesis by a distinct, post-initiation mechanism, providing a novel model for integrated control of ribosome biogenesis that has implications for understanding how this process is dysregulated in cancer. PMID:27385002
Analytical Devices Based on Direct Synthesis of DNA on Paper.
Glavan, Ana C; Niu, Jia; Chen, Zhen; Güder, Firat; Cheng, Chao-Min; Liu, David; Whitesides, George M
2016-01-05
This paper addresses a growing need in clinical diagnostics for parallel, multiplex analysis of biomarkers from small biological samples. It describes a new procedure for assembling arrays of ssDNA and proteins on paper. This method starts with the synthesis of DNA oligonucleotides covalently linked to paper and proceeds to assemble microzones of DNA-conjugated paper into arrays capable of simultaneously capturing DNA, DNA-conjugated protein antigens, and DNA-conjugated antibodies. The synthesis of ssDNA oligonucleotides on paper is convenient and effective with 32% of the oligonucleotides cleaved and eluted from the paper substrate being full-length by HPLC for a 32-mer. These ssDNA arrays can be used to detect fluorophore-linked DNA oligonucleotides in solution, and as the basis for DNA-directed assembly of arrays of DNA-conjugated capture antibodies on paper, detect protein antigens by sandwich ELISAs. Paper-anchored ssDNA arrays with different sequences can be used to assemble paper-based devices capable of detecting DNA and antibodies in the same device and enable simple microfluidic paper-based devices.
Fukuda, A; Sinsheimer, R L
1976-01-01
Mutation in several different cistrons of bacteriophage phi chi 174 blocks net progeny single-stranded DNA synthesis at the late period of infection (15). For the study of the functions of these cistrons in single-stranded DNA synthesis, asymmetric replication of replicative form DNA was examined at the late period of infection with amber mutants of these cistrons. While the normal, rapid process of asymmetric single-stranded viral DNA synthesis is blocked at the late period of these mutant infections, an asymmetric synthesis of the viral strand of replicative-form DNA is observed in this period, though at a reduced level, together with degradation of prelabeled viral strand. Some intermediate replicative-form molecules were also detected. Asymmetric synthesis of the viral strand of replicative-form DNA at the late period of phi chi infection is completely inhibited in the presence of a low concentration (35mug/ml) of chloramphenicol (which also blocks net single-stranded viral DNA synthesis). These results are discussed in terms of the possible role of the specific viral proteins for normal single-stranded DNA synthesis. PMID:1255871
d'Ambrosio, E; Furano, A V
1987-01-01
An approximately equal to 150-bp GC-rich (approximately equal to 60%) region is at the right end of rat long interspersed repeated DNA (LINE or L1Rn) family members. We report here that one of the DNA strands from this region contains several non-palindromic sites that strongly arrest DNA synthesis in vitro by the prokaryotic Klenow and T4 DNA polymerases, the eukaryotic alpha polymerase, and AMV reverse transcriptase. The strongest arrest sites are G-rich (approximately equal to 70%) homopurine stretches of 18 or more residues. Shorter homopurine stretches (12 residues or fewer) did not arrest DNA synthesis even if the stretch contains 11/12 G residues. Arrest of the prokaryotic polymerases was not affected by their respective single strand binding proteins or polymerase accessory proteins. The region of duplex DNA which contains DNA synthesis arrest sites reacts with bromoacetaldehyde when present in negatively supercoiled molecules. By contrast, homopurine stretches that do not arrest DNA synthesis do not react with bromoacetaldehyde. The presence of bromoacetaldehyde-reactive bases in a G-rich homopurine-containing duplex under torsional stress is thought to be caused by base stacking in the homopurine strand. Therefore, we suggest that base-stacked regions of the template arrest DNA synthesis. Images PMID:2436148
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Inaccurate DNA Synthesis in Cell Extracts of Yeast Producing Active Human DNA Polymerase Iota
Makarova, Alena V.; Grabow, Corinn; Gening, Leonid V.; Tarantul, Vyacheslav Z.; Tahirov, Tahir H.; Bessho, Tadayoshi; Pavlov, Youri I.
2011-01-01
Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn2+ ions, can bypass some DNA lesions and misincorporates “G” opposite template “T” more frequently than incorporates the correct “A.” We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of “G” versus “A” method of Gening, abbreviated as “misGvA”). We provide unambiguous proof of the “misGvA” approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The “misGvA” activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts. PMID:21304950
Inaccurate DNA synthesis in cell extracts of yeast producing active human DNA polymerase iota.
Makarova, Alena V; Grabow, Corinn; Gening, Leonid V; Tarantul, Vyacheslav Z; Tahirov, Tahir H; Bessho, Tadayoshi; Pavlov, Youri I
2011-01-31
Mammalian Pol ι has an unusual combination of properties: it is stimulated by Mn(2+) ions, can bypass some DNA lesions and misincorporates "G" opposite template "T" more frequently than incorporates the correct "A." We recently proposed a method of detection of Pol ι activity in animal cell extracts, based on primer extension opposite the template T with a high concentration of only two nucleotides, dGTP and dATP (incorporation of "G" versus "A" method of Gening, abbreviated as "misGvA"). We provide unambiguous proof of the "misGvA" approach concept and extend the applicability of the method for the studies of variants of Pol ι in the yeast model system with different cation cofactors. We produced human Pol ι in baker's yeast, which do not have a POLI ortholog. The "misGvA" activity is absent in cell extracts containing an empty vector, or producing catalytically dead Pol ι, or Pol ι lacking exon 2, but is robust in the strain producing wild-type Pol ι or its catalytic core, or protein with the active center L62I mutant. The signature pattern of primer extension products resulting from inaccurate DNA synthesis by extracts of cells producing either Pol ι or human Pol η is different. The DNA sequence of the template is critical for the detection of the infidelity of DNA synthesis attributed to DNA Pol ι. The primer/template and composition of the exogenous DNA precursor pool can be adapted to monitor replication fidelity in cell extracts expressing various error-prone Pols or mutator variants of accurate Pols. Finally, we demonstrate that the mutation rates in yeast strains producing human DNA Pols ι and η are not elevated over the control strain, despite highly inaccurate DNA synthesis by their extracts.
[Effect of metalaxyl on the synthesis of RNA, DNA and protein in Phytophthora nicotianae].
Wollgiehn, R; Bräutigam, E; Schumann, B; Erge, D
1984-01-01
Metalaxyl is used to control diseases caused by fungi of the order of the Perenosporales. We investigated the action of this fungicid eon nucleic acid and protein synthesis in liquid cultures of Phytophthora nicotianae. The uptake of 32P, 3H-uridine, 3H-thymidine and 14C-leucine as precursors of nuclei acid and protein synthesis by the mycelium was not inhibited by metalaxyl. RNA synthesis as indicated by 3H-uridine incorporation was strongly inhibited (about 80%) by 0.5 micrograms/ml of metalaxyl. The inhibition was visible already few minutes after addition of the toxicant. Since the inhibition of incorporation of 3H-thymidine into DNA and of 14C-leucine into protein became significant 2-3 hours later, we conclude that metalaxyl primarily interfers with RNA synthesis. Synthesis of ribosomal RNA is more affected (more than 90%) than that of tRNA (about 55%) and poly(A)-containing RNA. Since in the presence of actinomycin, in contrast to metalaxyl, protein synthesis is inhibited immediately as a consequence of complete inhibition of RNA synthesis and of the short life-time of mRNA, it is also evident that mRNA synthesis is less strongly inhibited, at least during the early period of metalaxyl action. The molecular mechanism of metalaxyl inhibition of the transcription process remains open. The fungicide did not inhibit the activity of a partially purified RNA polymerase isolated from the fungus. On the other hand, the RNA synthesis (14C-UTP-incorporation) by a cell homogenate and by isolated nuclear fractions was inhibited significantly. Possibilities of the molecular action of metalaxyl are discussed. The RNA synthesis of some plant systems (cell cultures of Lycopersicon peruvianum, isolated nuclei from the same cell cultures, purified RNA polymerase from Spinacia oleracea chloroplasts) was not inhibited by metalaxyl, not even at high concentrations.
Monesi, Valerio
1962-01-01
Mice were injected intraperitoneally with 15 µc of H3-thymidine. The time course of the labeling in spermatogonia and spermatocytes was studied by using autoradiography on 5 µ sections stained by the periodic acid-Schiff method and hematoxylin over a period of 57 hours after injection. Four generations of type A (called AI, AII, AIII, and AIV), one of intermediate, and one of type B spermatogonia occur in one cycle of the seminiferous epithelium. The average life span is about the same in all spermatogonia, i.e., about 27 to 30.5 hours. The average pre-DNA synthetic time, including the mitotic stages from metaphase through telophase and the portion of interphase preceding DNA synthesis, is also not very different, ranging between 7.5 and 10.5 hours. A remarkable difference exists, however, in the duration of DNA synthesis and of the post-DNA synthetic period. The average DNA synthetic time is very long and is highly variable in type B (14.5 hours), a little shorter and less variable in intermediate (12.5 hours) and AIV (13 hours) spermatogonia, and much shorter and very constant in AIII (8 hours), AII and AI (7 to 7.5 hours) spermatogonia. Conversely, the average post-DNA synthetic time, corresponding essentially to the duration of the prophase, is short and very constant in type B (4.5 hours), longer and variable in intermediate (6 hours) and AIV (8 hours) spermatogonia, and much longer and much more variable in AIII (11 hours), AII and AI (14 hours) spermatogonia. The premeiotic synthesis of DNA takes place in primary spermatocytes during the resting phase and terminates just before the visible onset of the meiotic prophase. Its average duration is 14 hours. No further synthesis of DNA takes place in later stages of spermatogenesis. PMID:14475361
Mei, Hui; Liao, Jen-Yu; Jimenez, Randi M; Wang, Yajun; Bala, Saikat; McCloskey, Cailen; Switzer, Christopher; Chaput, John C
2018-05-02
In vitro selection experiments carried out on artificial genetic polymers require robust and faithful methods for copying genetic information back and forth between DNA and xeno-nucleic acids (XNA). Previously, we have shown that Kod-RI, an engineered polymerase developed to transcribe DNA templates into threose nucleic acid (TNA), can function with high fidelity in the absence of manganese ions. However, the transcriptional efficiency of this enzyme diminishes greatly when individual templates are replaced with libraries of DNA sequences, indicating that manganese ions are still required for in vitro selection. Unfortunately, the presence of manganese ions in the transcription mixture leads to the misincorporation of tGTP nucleotides opposite dG residues in the templating strand, which are detected as G-to-C transversions when the TNA is reverse transcribed back into DNA. Here we report the synthesis and fidelity of TNA replication using 7-deaza-7-modified guanosine base analogues in the DNA template and incoming TNA nucleoside triphosphate. Our findings reveal that tGTP misincorporation occurs via a Hoogsteen base pair in which the incoming tGTP residue adopts a syn conformation with respect to the sugar. Substitution of tGTP for 7-deaza-7-phenyl tGTP enabled the synthesis of TNA polymers with >99% overall fidelity. A TNA library containing the 7-deaza-7-phenyl guanine analogue was used to evolve a biologically stable TNA aptamer that binds to HIV reverse transcriptase with low nanomolar affinity.
ER-mitochondria contacts couple mtDNA synthesis with mitochondrial division in human cells.
Lewis, Samantha C; Uchiyama, Lauren F; Nunnari, Jodi
2016-07-15
Mitochondrial DNA (mtDNA) encodes RNAs and proteins critical for cell function. In human cells, hundreds to thousands of mtDNA copies are replicated asynchronously, packaged into protein-DNA nucleoids, and distributed within a dynamic mitochondrial network. The mechanisms that govern how nucleoids are chosen for replication and distribution are not understood. Mitochondrial distribution depends on division, which occurs at endoplasmic reticulum (ER)-mitochondria contact sites. These sites were spatially linked to a subset of nucleoids selectively marked by mtDNA polymerase and engaged in mtDNA synthesis--events that occurred upstream of mitochondrial constriction and division machine assembly. Our data suggest that ER tubules proximal to nucleoids are necessary but not sufficient for mtDNA synthesis. Thus, ER-mitochondria contacts coordinate licensing of mtDNA synthesis with division to distribute newly replicated nucleoids to daughter mitochondria. Copyright © 2016, American Association for the Advancement of Science.
Macromolecular Synthesis During the Germination of Saccharomyces cerevisiae Spores
Rousseau, Paul; Halvorson, Harlyn O.
1973-01-01
After the dormancy of Saccharomyces cerevisiae ascospores had been broken, the synthesis of proteins was observed first, followed rapidly by synthesis of ribonucleic acid (RNA) and much later by deoxyribonucleic acid (DNA) synthesis. Phosphoglucomutase activity increased in a periodic (step) fashion, whereas the activity of five other enzymes increased linearly during germination and outgrowth. The rate of synthesis of these enzymes was highest at about the period of DNA replication. The amino acid pools of dormant spores contained high levels of proline, glutamic acid, and histidine. At 2 h after onset of germination, the pools of phenylalanine and methionine had disappeared and the other components had decreased significantly. By 3.5 h, with the exception of proline and cystine, most amino acid pool components had significantly increased. PMID:4570780
Efficiency and Fidelity of Human DNA Polymerases λ and β during Gap-Filling DNA Synthesis
Brown, Jessica A.; Pack, Lindsey R.; Sanman, Laura E.; Suo, Zucai
2010-01-01
The base excision repair (BER) pathway coordinates the replacement of 1 to 10 nucleotides at sites of single-base lesions. This process generates DNA substrates with various gap sizes which can alter the catalytic efficiency and fidelity of a DNA polymerase during gap-filling DNA synthesis. Here, we quantitatively determined the substrate specificity and base substitution fidelity of human DNA polymerase λ (Pol λ), an enzyme proposed to support the known BER DNA polymerase β (Pol β), as it filled 1- to 10-nucleotide gaps at 1-nucleotide intervals. Pol λ incorporated a correct nucleotide with relatively high efficiency until the gap size exceeded 9 nucleotides. Unlike Pol λ, Pol β did not have an absolute threshold on gap size as the catalytic efficiency for a correct dNTP gradually decreased as the gap size increased from 2 to 10 nucleotides and then recovered for non-gapped DNA. Surprisingly, an increase in gap size resulted in lower polymerase fidelity for Pol λ, and this downregulation of fidelity was controlled by its non-enzymatic N-terminal domains. Overall, Pol λ was up to 160-fold more error-prone than Pol β, thereby suggesting Pol λ would be more mutagenic during long gap-filling DNA synthesis. In addition, dCTP was the preferred misincorporation for Pol λ and its N-terminal domain truncation mutants. This nucleotide preference was shown to be dependent upon the identity of the adjacent 5′-template base. Our results suggested that both Pol λ and Pol β would catalyze nucleotide incorporation with the highest combination of efficiency and accuracy when the DNA substrate contains a single-nucleotide gap. Thus, Pol λ, like Pol β, is better suited to catalyze gap-filling DNA synthesis during short-patch BER in vivo, although, Pol λ may play a role in long-patch BER. PMID:20961817
Maddocks, Oliver D.K.; Labuschagne, Christiaan F.; Adams, Peter D.; Vousden, Karen H.
2016-01-01
Summary Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. PMID:26774282
Maddocks, Oliver D K; Labuschagne, Christiaan F; Adams, Peter D; Vousden, Karen H
2016-01-21
Crosstalk between cellular metabolism and the epigenome regulates epigenetic and metabolic homeostasis and normal cell behavior. Changes in cancer cell metabolism can directly impact epigenetic regulation and promote transformation. Here we analyzed the contribution of methionine and serine metabolism to methylation of DNA and RNA. Serine can contribute to this pathway by providing one-carbon units to regenerate methionine from homocysteine. While we observed this contribution under methionine-depleted conditions, unexpectedly, we found that serine supported the methionine cycle in the presence and absence of methionine through de novo ATP synthesis. Serine starvation increased the methionine/S-adenosyl methionine ratio, decreasing the transfer of methyl groups to DNA and RNA. While serine starvation dramatically decreased ATP levels, this was accompanied by lower AMP and did not activate AMPK. This work highlights the difference between ATP turnover and new ATP synthesis and defines a vital function of nucleotide synthesis beyond making nucleic acids. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Morrison, Rick; Al-Rawi, Jasim M A; Jennings, Ian G; Thompson, Philip E; Angove, Michael J
2016-03-03
The synthesis of 6-aryl, 8- aryl, and 8-aryl-6-chloro-2-morpholino-1,3-benzoxazines with potent activity against PI3K and DNA-PK is described. Synthesis of thirty one analogues was facilitated by an improved synthesis of 3-bromo-2-hydroxybenzoic acid 13 by de-sulphonation of 3-bromo-2-hydroxy-5-sulfobenzoic acid 12 en route to 2-methylthio-substituted-benzoxazine intermediates 17-19. From this series, compound 20k (LTURM34) (dibenzo[b,d]thiophen-4-yl) (IC50 = 0.034 μM) was identified as a specific DNA-PK inhibitor, 170 fold more selective for DNA-PK activity compared to PI3K activity. Other compounds of the series show markedly altered selectivity for various PI3K isoforms including compound 20i (8-(naphthalen-1-yl) a potent and quite selective PI3Kδ inhibitor (IC50 = 0.64 μM). Finally, nine compounds were evaluated and showed antiproliferative activity against an NCI panel of cancer cell lines. Compound 20i (8-(naphthalen-1-yl) showed strong anti-proliferative activity against A498 renal cancer cells that warrants further investigation. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Pavlov, Andrey R.; Pavlova, Nadejda V.; Kozyavkin, Sergei A.; Slesarev, Alexei I.
2012-01-01
We have previously introduced a general kinetic approach for comparative study of processivity, thermostability, and resistance to inhibitors of DNA polymerases (Pavlov et. al., (2002) Proc. Natl. Acad. Sci. USA 99, 13510–13515). The proposed method was successfully applied to characterize hybrid DNA polymerases created by fusing catalytic DNA polymerase domains with various non-specific DNA binding domains. Here we use the developed kinetic analysis to assess basic parameters of DNA elongation by DNA polymerases and to further study the interdomain interactions in both previously constructed and new chimeric DNA polymerases. We show that connecting Helix-hairpin-Helix (HhH) domains to catalytic polymerase domains can increase thermostability, not only of DNA polymerases from extremely thermophilic species, but also of the enzyme from a faculatative thermophilic bacterium Bacillus stearothermophilus. We also demonstrate that addition of TopoV HhH domains extends efficient DNA synthesis by chimerical polymerases up to 105°C by maintaining processivity of DNA synthesis at high temperatures. We also found that reversible high-temperature structural transitions in DNA polymerases decrease the rates of binding of these enzymes to the templates. Furthermore, activation energies and pre-exponential factors of the Arrhenius equation suggest that the mechanism of electrostatic enhancement of diffusion-controlled association plays a minor role in binding templates to DNA polymerases. PMID:22320201
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
van Erp, Y H; Koopmans, M J; Heirbaut, P R; van der Hoeven, J C; Weterings, P J
1992-06-01
A new method is described to investigate unscheduled DNA synthesis (UDS) in human tissue after exposure in vitro: the human hair follicle. A histological technique was applied to assess cytotoxicity and UDS in the same hair follicle cells. UDS induction was examined for 11 chemicals and the results were compared with literature findings for UDS in rat hepatocytes. Most chemicals inducing UDS in rat hepatocytes raised DNA repair at comparable concentrations in the hair follicle. However, 1 of 9 chemicals that gave a positive response in the rat hepatocyte UDS test, 2-acetylaminofluorene, failed to induce DNA repair in the hair follicle. Metabolizing potential of hair follicle cells was shown in experiments with indirectly acting compounds, i.e., benzo[a]pyrene, 7,12-dimethylbenz[a]anthracene and dimethylnitrosamine. The results support the conclusion that the test in its present state is valuable as a screening assay for the detection of unscheduled DNA synthesis. Moreover, the use of human tissues may result in a better extrapolation to man.
CyDNA: synthesis and replication of highly Cy-dye substituted DNA by an evolved polymerase.
Ramsay, Nicola; Jemth, Ann-Sofie; Brown, Anthony; Crampton, Neal; Dear, Paul; Holliger, Philipp
2010-04-14
DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting "CyDNA" displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties.
Thormar, Hans G; Gudmundsson, Bjarki; Eiriksdottir, Freyja; Kil, Siyoen; Gunnarsson, Gudmundur H; Magnusson, Magnus Karl; Hsu, Jason C; Jonsson, Jon J
2013-04-01
The causes of imprecision in microarray expression analysis are poorly understood, limiting the use of this technology in molecular diagnostics. Two-dimensional strandness-dependent electrophoresis (2D-SDE) separates nucleic acid molecules on the basis of length and strandness, i.e., double-stranded DNA (dsDNA), single-stranded DNA (ssDNA), and RNA·DNA hybrids. We used 2D-SDE to measure the efficiency of cDNA synthesis and its importance for the imprecision of an in vitro transcription-based microarray expression analysis. The relative amount of double-stranded cDNA formed in replicate experiments that used the same RNA sample template was highly variable, ranging between 0% and 72% of the total DNA. Microarray experiments showed an inverse relationship between the difference between sample pairs in probe variance and the relative amount of dsDNA. Approximately 15% of probes showed between-sample variation (P < 0.05) when the dsDNA percentage was between 12% and 35%. In contrast, only 3% of probes showed between-sample variation when the dsDNA percentage was 69% and 72%. Replication experiments of the 35% dsDNA and 72% dsDNA samples were used to separate sample variation from probe replication variation. The estimated SD of the sample-to-sample variation and of the probe replicates was lower in 72% dsDNA samples than in 35% dsDNA samples. Variation in the relative amount of double-stranded cDNA synthesized can be an important component of the imprecision in T7 RNA polymerase-based microarray expression analysis. © 2013 American Association for Clinical Chemistry
Synthesis and Crystal Structure Study of 2’-Se-Adenosine-Derivatized DNA
DOE Office of Scientific and Technical Information (OSTI.GOV)
Sheng, J.; Salon, J; Gan, J
2010-01-01
The selenium derivatization of nucleic acids is a novel and promising strategy for 3D structure determination of nucleic acids. Selenium can serve as an excellent anomalous scattering center to solve the phase problem, which is one of the two major bottlenecks in macromolecule X-ray crystallography. The other major bottleneck is crystallization. It has been demonstrated that the incorporated selenium functionality at the 2'-positions of the nucleosides and nucleotides is stable and does not cause significant structure perturbation. Furthermore, it was observed that the 2'-Se-derivatization could facilitate crystallization of oligonucleotides with fast crystal growth and high diffraction quality. Herein, we describemore » a convenient synthesis of the 2'-Se-adenosine phosphoramidite, and report the first synthesis and X-ray crystal structure determination of the DNA containing the 2'-Se-A derivatization. The 3D structure of 2'-Se-A-DNA decamer [5'-GTACGCGT(2'-Se-A)C-3']{sub 2} was determined at 1.75 {angstrom} resolution, the 2'-Se-functionality points to the minor groove, and the Se-modified and native structures are virtually identical. Moreover, we have observed that the 2'-Se-A modification can greatly facilitate the crystal growth with high diffraction quality. In conjunction with the crystallization facilitation by the 2'-Se-U and 2'-Se-T, this novel observation on the 2'-Se-A functionality suggests that the 2'-Se moiety is sole responsible for the crystallization facilitation and the identity of nucleobases does not influence the crystal growth significantly.« less
Redrejo-Rodríguez, Modesto; Ordóñez, Carlos D; Berjón-Otero, Mónica; Moreno-González, Juan; Aparicio-Maldonado, Cristian; Forterre, Patrick; Salas, Margarita; Krupovic, Mart
2017-11-07
Family B DNA polymerases (PolBs) play a central role during replication of viral and cellular chromosomes. Here, we report the discovery of a third major group of PolBs, which we denote primer-independent PolB (piPolB), that might be a link between the previously known protein-primed and RNA/DNA-primed PolBs. PiPolBs are encoded by highly diverse mobile genetic elements, pipolins, integrated in the genomes of diverse bacteria and also present as circular plasmids in mitochondria. Biochemical characterization showed that piPolB displays efficient DNA polymerization activity that can use undamaged and damaged templates and is endowed with proofreading and strand displacement capacities. Remarkably, the protein is also capable of template-dependent de novo DNA synthesis, i.e., DNA-priming activity, thereby breaking the long-standing dogma that replicative DNA polymerases require a pre-existing primer for DNA synthesis. We suggest that piPolBs are involved in self-replication of pipolins and may also contribute to bacterial DNA damage tolerance. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Fatty acid carbon is essential for dNTP synthesis in endothelial cells
Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter
2015-01-01
The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893
Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao
2011-01-01
Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122
CyDNA: Synthesis and Replication of Highly Cy-Dye Substituted DNA by an Evolved Polymerase
2010-01-01
DNA not only transmits genetic information but can also serve as a versatile supramolecular scaffold. Here we describe a strategy for the synthesis and replication of DNA displaying hundreds of substituents using directed evolution of polymerase function by short-patch compartmentalized self-replication (spCSR) and the widely used fluorescent dye labeled deoxinucleotide triphosphates Cy3-dCTP and Cy5-dCTP as substrates. In just two rounds of spCSR selection, we have isolated a polymerase that allows the PCR amplification of double stranded DNA fragments up to 1kb, in which all dC bases are substituted by its fluorescent dye-labeled equivalent Cy3- or Cy5-dC. The resulting “CyDNA” displays hundreds of aromatic heterocycles on the outside of the DNA helix and is brightly colored and highly fluorescent. CyDNA also exhibits significantly altered physicochemical properties compared to standard B-form DNA, including loss of silica and intercalating dye binding, resistance to cleavage by some endonucleases, an up to 40% increased apparent diameter as judged by atomic force microscopy and organic phase partitioning during phenol extraction. CyDNA also displays very bright fluorescence enabling significant signal gains in microarray and microfluidic applications. CyDNA represents a step toward a long-term goal of the encoded synthesis of DNA-based polymers of programmable and evolvable sequence and properties. PMID:20235594
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Ewert, Kai K; Kotamraju, Venkata Ramana; Majzoub, Ramsey N; Steffes, Victoria M; Wonder, Emily A; Teesalu, Tambet; Ruoslahti, Erkki; Safinya, Cyrus R
2016-03-15
Because nucleic acids (NAs) have immense potential value as therapeutics, the development of safe and effective synthetic NA vectors continues to attract much attention. In vivo applications of NA vectors require stabilized, nanometer-scale particles, but the commonly used approaches of steric stabilization with a polymer coat (e.g., PEGylation; PEG=poly(ethylene glycol)) interfere with attachment to cells, uptake, and endosomal escape. Conjugation of peptides to PEG-lipids can improve cell attachment and uptake for cationic liposome-DNA (CL-DNA) complexes. We present several synthetic approaches to peptide-PEG-lipids and discuss their merits and drawbacks. A lipid-PEG-amine building block served as the common key intermediate in all synthetic routes. Assembling the entire peptide-PEG-lipid by manual solid phase peptide synthesis (employing a lipid-PEG-carboxylic acid) allowed gram-scale synthesis but is mostly applicable to linear peptides connected via their N-terminus. Conjugation via thiol-maleimide or strain-promoted (copper-free) azide-alkyne cycloaddition chemistry is highly amenable to on-demand preparation of peptide-PEG-lipids, and the appropriate PEG-lipid precursors are available in a single chemical step from the lipid-PEG-amine building block. Azide-alkyne cycloaddition is especially suitable for disulfide-bridged peptides such as iRGD (cyclic CRGDKGPDC). Added at 10 mol% of a cationic/neutral lipid mixture, the peptide-PEG-lipids stabilize the size of CL-DNA complexes. They also affect cell attachment and uptake of nanoparticles in a peptide-dependent manner, thereby providing a platform for preparing stabilized, affinity-targeted CL-DNA nanoparticles. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yoon, Jung-Hoon; Roy Choudhury, Jayati; Park, Jeseong; Prakash, Satya; Prakash, Louise
2017-11-10
N3-Methyladenine (3-MeA) is formed in DNA by reaction with S -adenosylmethionine, the reactive methyl donor, and by reaction with alkylating agents. 3-MeA protrudes into the DNA minor groove and strongly blocks synthesis by replicative DNA polymerases (Pols). However, the mechanisms for replicating through this lesion in human cells remain unidentified. Here we analyzed the roles of translesion synthesis (TLS) Pols in the replication of 3-MeA-damaged DNA in human cells. Because 3-MeA has a short half-life in vitro , we used the stable 3-deaza analog, 3-deaza-3-methyladenine (3-dMeA), which blocks the DNA minor groove similarly to 3-MeA. We found that replication through the 3-dMeA adduct is mediated via three different pathways, dependent upon Polι/Polκ, Polθ, and Polζ. As inferred from biochemical studies, in the Polι/Polκ pathway, Polι inserts a nucleotide (nt) opposite 3-dMeA and Polκ extends synthesis from the inserted nt. In the Polθ pathway, Polθ carries out both the insertion and extension steps of TLS opposite 3-dMeA, and in the Polζ pathway, Polζ extends synthesis following nt insertion by an as yet unidentified Pol. Steady-state kinetic analyses indicated that Polι and Polθ insert the correct nt T opposite 3-dMeA with a much reduced catalytic efficiency and that both Pols exhibit a high propensity for inserting a wrong nt opposite this adduct. However, despite their low fidelity of synthesis opposite 3-dMeA, TLS opposite this lesion replicates DNA in a highly error-free manner in human cells. We discuss the implications of these observations for TLS mechanisms in human cells. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
DNA-Compatible Nitro Reduction and Synthesis of Benzimidazoles.
Du, Huang-Chi; Huang, Hongbing
2017-10-18
DNA-encoded chemical libraries have emerged as a cost-effective alternative to high-throughput screening (HTS) for hit identification in drug discovery. A key factor for productive DNA-encoded libraries is the chemical diversity of the small molecule moiety attached to an encoding DNA oligomer. The library structure diversity is often limited to DNA-compatible chemical reactions in aqueous media. Herein, we describe a facile process for reducing aryl nitro groups to aryl amines. The new protocol offers simple operation and circumvents the pyrophoric potential of the conventional method (Raney nickel). The reaction is performed in aqueous solution and does not compromise DNA structural integrity. The utility of this method is demonstrated by the versatile synthesis of benzimidazoles on DNA.
Donaldson, Janet R; Courcelle, Charmain T; Courcelle, Justin
2004-01-01
Ultraviolet light induces DNA lesions that block the progression of the replication machinery. Several models speculate that the resumption of replication following disruption by UV-induced DNA damage requires regression of the nascent DNA or migration of the replication machinery away from the blocking lesion to allow repair or bypass of the lesion to occur. Both RuvAB and RecG catalyze branch migration of three- and four-stranded DNA junctions in vitro and are proposed to catalyze fork regression in vivo. To examine this possibility, we characterized the recovery of DNA synthesis in ruvAB and recG mutants. We found that in the absence of either RecG or RuvAB, arrested replication forks are maintained and DNA synthesis is resumed with kinetics that are similar to those in wild-type cells. The data presented here indicate that RecG- or RuvAB-catalyzed fork regression is not essential for DNA synthesis to resume following arrest by UV-induced DNA damage in vivo. PMID:15126385
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
Alterations in Synthesis and Repair of DNA during the Development of Loach Misgurnus fossilis
Gening, Leonid V.; Lakhin, Andrei V.; Makarova, Irina V.; Nenasheva, Valentina V.; Andreeva, Ludmila E.; Tarantul, Vyacheslav Z.
2016-01-01
Using a modified radiolabeled primer extension method (we named this modification misGvA—“misincorporation of G versus A”) we have investigated the DNA synthesis and repair at early and late stages of development of loach Misgurnus fossilis. The misincorporation activity of DNA polymerase iota (Pol ι) in wild-type loach could not be detected by this method at any stage of loach development. In transgenic loach overexpressing human Pol ι we have shown that the bypassing of DNA synthesis arrest after incorporation of mismatched nucleotide by Pol ι (the T-stop) was not associated with this enzyme. Non-transgenic loach larvae are virtually lacking the capacity for error correction of DNA duplex containing a mismatched nucleotide. Such repair activity develops only in the adult fish. It appears that the initial stages of development are characterized by more intensive DNA synthesis, while in terminal stages the repair activities become more prominent. The misGvA approach clearly indicates substantial changes in the DNA synthesis intensity, although the role of particular replicative and repair DNA polymerases in this process requires further study. PMID:29615575
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Hunter, T.C.; Knudtson, K.L.; Nadella, V.; Sol-Church, K.; Taylor, W.L.; Tighe, S.; Yueng, A.T.; Chittur, S.
2010-01-01
r1-1 Real-time reverse transcriptase quantitative PCR (RT-qPCR) is a widely used technique for measuring transcript levels. Priming strategy and reverse transcriptase enzyme are key elements that affect sensitivity and variability of RT-qPCR and microarray results. Previously, the Nucleic Acid Research Group (NARG) had conducted preliminary studies within the group to examine the effects of priming strategy on generating cDNA for use with qPCR. This year's study was an open study in which the qPCR community was invited to participate. Participants received the RT primers and RNA template and were asked to perform the RT reaction using their preferred reaction conditions. Each participating laboratory was provided at least two RNA templates of varying quality. The RT products were returned to the NARG and all RT reactions were used in a qPCR reaction. The qPCR assays looked at three genes of varying abundance, b-actin (high copy), b-glucuronidase (medium copy) and TATA binding protein (low copy) as well as varying distance from the 3? end for each transcript. Results from participating laboratories will be evaluated to determine the impact of priming strategy, assay chemistry and experimental setup on the RT step. Additionally, we will address the impact of RNA integrity on cDNA synthesis.
Champier, Jacques; Claustrat, Francine; Nazaret, Nicolas; Fèvre Montange, Michelle; Claustrat, Bruno
2012-02-01
Folate is essential for purine and thymidylate biosynthesis and in methyl transfer for DNA methylation. Folate deficiency alters the secretion of melatonin, a hormone involved in circadian rhythm entrainment, and causes hyperhomocysteinemia because of disruption of homocysteine metabolism. Adverse effects of homocysteine include the generation of free radicals, activation of proliferation or apoptosis, and alteration of gene expression. The liver is an important organ for folate metabolism, and its genome analysis has revealed numerous clock-regulated genes. The variations at the level of their expression during folate deficiency are not known. The aim of our study was to investigate the effects of folate deficiency on gene expression in the mouse liver. A control group receiving a synthetic diet and a folate-depleted group were housed for 4 weeks on a 12-hour/12-hour light/dark cycle. Three mice from each group were euthanized under dim red light at the beginning of the light cycle, and 3, at the beginning of the dark period. Gene expression was studied in a microarray analysis. Of the 53 genes showing modified daily expression in the controls, 52 showed a less marked or no difference after folate depletion. Only 1, lpin1, showed a more marked difference. Ten genes coding for proteins involved in lipid metabolism did not show a morning/evening difference in controls but did after folate depletion. This study shows that, in the mouse liver, dietary folate depletion leads to major changes in expression of several genes involved in fatty acid metabolism, DNA synthesis, and expression of circadian genes. Copyright © 2012 Elsevier Inc. All rights reserved.
Christen, Matthias; Deutsch, Samuel; Christen, Beat
2015-08-21
Recent advances in synthetic biology have resulted in an increasing demand for the de novo synthesis of large-scale DNA constructs. Any process improvement that enables fast and cost-effective streamlining of digitized genetic information into fabricable DNA sequences holds great promise to study, mine, and engineer genomes. Here, we present Genome Calligrapher, a computer-aided design web tool intended for whole genome refactoring of bacterial chromosomes for de novo DNA synthesis. By applying a neutral recoding algorithm, Genome Calligrapher optimizes GC content and removes obstructive DNA features known to interfere with the synthesis of double-stranded DNA and the higher order assembly into large DNA constructs. Subsequent bioinformatics analysis revealed that synthesis constraints are prevalent among bacterial genomes. However, a low level of codon replacement is sufficient for refactoring bacterial genomes into easy-to-synthesize DNA sequences. To test the algorithm, 168 kb of synthetic DNA comprising approximately 20 percent of the synthetic essential genome of the cell-cycle bacterium Caulobacter crescentus was streamlined and then ordered from a commercial supplier of low-cost de novo DNA synthesis. The successful assembly into eight 20 kb segments indicates that Genome Calligrapher algorithm can be efficiently used to refactor difficult-to-synthesize DNA. Genome Calligrapher is broadly applicable to recode biosynthetic pathways, DNA sequences, and whole bacterial genomes, thus offering new opportunities to use synthetic biology tools to explore the functionality of microbial diversity. The Genome Calligrapher web tool can be accessed at https://christenlab.ethz.ch/GenomeCalligrapher .
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gans, J.H.; Korson, R.
1984-02-01
Long-term, continuous (twice per week) administration of CCl/sub 4/ to male mice resulted in a high incidence of liver nodules which appear to be resistant to the necrotizing effects of CCl/sub 4/ but showed no features of malignant neoplasia. Liver nuclear DNA synthesis was compared in mice given CCl/sub 4/ and in mice subjected to partial hepatectomy (PH). Mice were given by gavage corn oil or CCl/sub 4/ in corn oil for periods of 2 to 25 weeks and several mice were subjected to PH after 12 and 25 weeks of corn oil treatment. Mice were given (/sup 3/H)TdR duringmore » liver regeneration and newly synthesized liver nuclear DNA was isolated and separated by BND-cellulose chromatography. Greater than 85% of the labeled DNA from PH mice eluted from BND-cellulose columns as double-stranded (ds) DNA with single-stranded (ss) regions or ends and less than 15% as ds DNA. When mice were treated with CCl/sub 4/ for 8 weeks or longer a significantly greater portion of liver nuclear DNA eluted as ds DNA. Administration of HU and 5-FU with (/sup 3/H)TdR decreased (/sup 3/H)TdR incorporation into DNA to low levels incompatible with unscheduled DNA synthesis. Single doses of CCl/sub 4/ given to mice treated with corn oil for 2 to 12 weeks provided newly synthesized DNA which was primarily (>80%) ds DNA with ss regions or ends, but after 25 weeks of corn oil administration, a single dose of CCl/sub 4/ resulted in newly synthesized DNA with a greater proportion of ds DNA. The high labeling of ds DNA in mice treated with CCl/sub 4/ may have resulted from an alternate pathway of DNA synthesis catalyzed by the enzymes or enzyme complexes associated with semiconservative DNA synthesis or from proliferation of nonparenchymal cells with a rapid turn-over rate.« less
Application of Biocatalysis to on-DNA Carbohydrate Library Synthesis.
Thomas, Baptiste; Lu, Xiaojie; Birmingham, William R; Huang, Kun; Both, Peter; Reyes Martinez, Juana Elizabeth; Young, Robert J; Davie, Christopher P; Flitsch, Sabine L
2017-05-04
DNA-encoded libraries are increasingly used for the discovery of bioactive lead compounds in high-throughput screening programs against specific biological targets. Although a number of libraries are now available, they cover limited chemical space due to bias in ease of synthesis and the lack of chemical reactions that are compatible with DNA tagging. For example, compound libraries rarely contain complex biomolecules such as carbohydrates with high levels of functionality, stereochemistry, and hydrophilicity. By using biocatalysis in combination with chemical methods, we aimed to significantly expand chemical space and generate generic libraries with potentially better biocompatibility. For DNA-encoded libraries, biocatalysis is particularly advantageous, as it is highly selective and can be performed in aqueous environments, which is an essential feature for this split-and-mix library technology. In this work, we demonstrated the application of biocatalysis for the on-DNA synthesis of carbohydrate-based libraries by using enzymatic oxidation and glycosylation in combination with traditional organic chemistry. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Amino Acid Racemization and the Preservation of Ancient DNA
NASA Technical Reports Server (NTRS)
Poinar, Hendrik N.; Hoss, Matthias
1996-01-01
The extent of racemization of aspartic acid, alanine, and leucine provides criteria for assessing whether ancient tissue samples contain endogenous DNA. In samples in which the D/L ratio of aspartic acid exceeds 0.08, ancient DNA sequences could not be retrieved. Paleontological finds from which DNA sequences purportedly millions of years old have been reported show extensive racemization, and the amino acids present are mainly contaminates. An exception is the amino acids in some insects preserved in amber.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horwitz, M.S.; Friefeld, B.R.; Keiser, H.D.
1982-12-01
Sera containing antinuclear antibodies from patients with systemic lupus erythematosus (SLE) and related disorders were tested for their effect on the synthesis of adenovirus (Ad) DNA in an in vitro replication system. After being heated at 60/sup 0/C for 1 h, some sera from patients with SLE inhibited Ad DNA synthesis by 60 to 100%. Antibodies to double-stranded DNA were present in 15 of the 16 inhibitory sera, and inhibitory activity copurified with anti-double-stranded DNA in the immunoglobulin G fraction. These SLE sera did not inhibit the DNA polymerases ..cap alpha.., BETA, ..gamma.. and had no antibody to the 72,000-daltonmore » DNA-binding protein necessary for Ad DNA synthesis. The presence of antibodies to single-stranded DNA and a variety of saline-extractable antigens (Sm, Ha, nRNP, and rRNP) did not correlate with SLE serum inhibitory activity. Methods previously developed for studying the individual steps in Ad DNA replication were used to determine the site of inhibition by the SLE sera that contained antibody to double-stranded DNA. Concentrations of the SLE inhibitor that decreased the elongation of Ad DNA by greater than 85% had no effect on either the initiation of Ad DNA synthesis or the polymerization of the first 26 deoxyribonucleotides.« less
DNA synthesis in the pituitary gland of the rat: effect of sulpiride and clomiphene.
Burdman, J A; Szijan, I; Jahn, G A; Machiavelli, G; Kalbermann, L E
1979-09-15
Sulpiride administration to rats releases prolactin and increases DNA replication in the anterior pituitary gland. Clomiphene prevents the stimulation of DNA synthesis produced by sulpiride, but does not affect prolactin release from the gland. These findings suggest that the intracellular prolactin content of the anterior pituitary gland plays a role in the regulation of DNA synthesis through a mechanism mediated by oestrogens.
Developing Inhibitors of Translesion DNA Synthesis as Therapeutic Agents against Lung Cancer
2015-12-01
normal DNA synthesis. In contrast, pol eta shows a combination of high efficiency and low fidelity when replicating 8-oxo-G. These combined properties...are consistent with a pro- mutagenic role for pol eta when replicating this DNA lesion under cellular conditions. Studies with modified nucleotide...analogs indicate that pol eta relies heavily on hydrogen-bonding interactions during normal and translesion synthesis. However, some nucleobase
Direct on-chip DNA synthesis using electrochemically modified gold electrodes as solid support
NASA Astrophysics Data System (ADS)
Levrie, Karen; Jans, Karolien; Schepers, Guy; Vos, Rita; Van Dorpe, Pol; Lagae, Liesbet; Van Hoof, Chris; Van Aerschot, Arthur; Stakenborg, Tim
2018-04-01
DNA microarrays have propelled important advancements in the field of genomic research by enabling the monitoring of thousands of genes in parallel. The throughput can be increased even further by scaling down the microarray feature size. In this respect, microelectronics-based DNA arrays are promising as they can leverage semiconductor processing techniques with lithographic resolutions. We propose a method that enables the use of metal electrodes for de novo DNA synthesis without the need for an insulating support. By electrochemically functionalizing gold electrodes, these electrodes can act as solid support for phosphoramidite-based synthesis. The proposed method relies on the electrochemical reduction of diazonium salts, enabling site-specific incorporation of hydroxyl groups onto the metal electrodes. An automated DNA synthesizer was used to couple phosphoramidite moieties directly onto the OH-modified electrodes to obtain the desired oligonucleotide sequence. Characterization was done via cyclic voltammetry and fluorescence microscopy. Our results present a valuable proof-of-concept for the integration of solid-phase DNA synthesis with microelectronics.
Laquel, P.; Litvak, S.; Castroviejo, M.
1994-01-01
DNA primase synthesizes short RNA primers used by DNA polymerases to initiate DNA synthesis. Two proteins of approximately 60 and 50 kD were recognized by specific antibodies raised against yeast primase subunits, suggesting a high degree of analogy between wheat and yeast primase subunits. Gel-filtration chromatography of wheat primase showed two active forms of 60 and 110 to 120 kD. Ultraviolet-induced cross-linking with radioactive oligothymidilate revealed a highly labeled protein of 60 kD. After limited trypsin digestion of wheat (Triticum aestivum L.) primase, a major band of 48 kD and two minor bands of 38 and 17 kD were observed. In the absence of DNA polymerases, the purified primase synthesizes long RNA products. The size of the RNA product synthesized by wheat primase is considerably reduced by the presence of DNA polymerases, suggesting a modulatory effect of the association between these two enzymes. Lowering the primase concentration in the assay also favored short RNA primer synthesis. Several properties of the wheat DNA primase using oligoadenylate [oligo(rA)]-primed or unprimed polythymidilate templates were studied. The ability of wheat primase, without DNA polymerases, to elongate an oligo(rA) primer to long RNA products depends on the primer size, temperature, and the divalent cation concentration. Thus, Mn2+ ions led to long RNA products in a very wide range of concentrations, whereas with Mg2+ long products were observed around 15 mM. We studied the ability of purified wheat DNA polymerases to initiate DNA synthesis from an RNA primer: wheat DNA polymerase A showed the highest activity, followed by DNA polymerases B and CII, whereas DNA polymerase CI was unable to initiate DNA synthesis from an RNA primer. Results are discussed in terms of understanding the role of these polymerases in DNA replication in plants. PMID:12232187
Konopka, Adam R; Laurin, Jaime L; Musci, Robert V; Wolff, Christopher A; Reid, Justin J; Biela, Laurie M; Zhang, Qian; Peelor, Fredrick F; Melby, Christopher L; Hamilton, Karyn L; Miller, Benjamin F
2017-04-01
In older adults, chronic oxidative and inflammatory stresses are associated with an impaired increase in skeletal muscle protein synthesis after acute anabolic stimuli. Conjugated linoleic acid (CLA) and Protandim have been shown to activate nuclear factor erythroid-derived 2-like 2 (Nrf2), a transcription factor for the antioxidant response element and anti-inflammatory pathways. This study tested the hypothesis that compared to a placebo control (CON), CLA and Protandim would increase skeletal muscle subcellular protein (myofibrillar, mitochondrial, cytoplasmic) and DNA synthesis in older adults after 6 weeks of milk protein feeding. CLA decreased oxidative stress and skeletal muscle oxidative damage with a trend to increase messenger RNA (mRNA) expression of a Nrf2 target, NAD(P)H dehydrogenase quinone 1 (NQO1). However, CLA did not influence other Nrf2 targets (heme oxygenase-1 (HO-1), glutathione peroxidase 1 (Gpx1)) or protein or DNA synthesis. Conversely, Protandim increased HO-1 protein content but not the mRNA expression of downstream Nrf2 targets, oxidative stress, or skeletal muscle oxidative damage. Rates of myofibrillar protein synthesis were maintained despite lower mitochondrial and cytoplasmic protein syntheses after Protandim versus CON. Similarly, DNA synthesis was non-significantly lower after Protandim compared to CON. After Protandim, the ratio of protein to DNA synthesis tended to be greater in the myofibrillar fraction and maintained in the mitochondrial and cytoplasmic fractions, emphasizing the importance of measuring both protein and DNA synthesis to gain insight into proteostasis. Overall, these data suggest that Protandim may enhance proteostatic mechanisms of skeletal muscle contractile proteins after 6 weeks of milk protein feeding in older adults.
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Methods of introducing nucleic acids into cellular DNA
Lajoie, Marc J.; Gregg, Christopher J.; Mosberg, Joshua A.; Church, George M.
2017-06-27
A method of introducing a nucleic acid sequence into a cell is provided where the cell has impaired or inhibited or disrupted DnaG primase activity or impaired or inhibited or disrupted DnaB helicase activity, or larger or increased gaps or distance between Okazaki fragments or lowered or reduced frequency of Okazaki fragment initiation, or the cell has increased single stranded DNA (ssDNA) on the lagging strand of the replication fork including transforming the cell through recombination with a nucleic acid oligomer.
Heinmets, F; Leary, R H
1991-06-01
A model system (1) was established to analyze purine and pyrimidine metabolism. This system has been expanded to include macrosimulation of DNA synthesis and the study of its regulation by terminal deoxynucleoside triphosphates (dNTPs) via a complex set of interactions. Computer experiments reveal that our model exhibits adequate and reasonable sensitivity in terms of dNTP pool levels and rates of DNA synthesis when inputs to the system are varied. These simulation experiments reveal that in order to achieve maximum DNA synthesis (in terms of purine metabolism), a proper balance is required in guanine and adenine input into this metabolic system. Excessive inputs will become inhibitory to DNA synthesis. In addition, studies are carried out on rates of DNA synthesis when various parameters are changed quantitatively. The current system is formulated by 110 differential equations.
Synthesis and cell-free cloning of DNA libraries using programmable microfluidics
Yehezkel, Tuval Ben; Rival, Arnaud; Raz, Ofir; Cohen, Rafael; Marx, Zipora; Camara, Miguel; Dubern, Jean-Frédéric; Koch, Birgit; Heeb, Stephan; Krasnogor, Natalio; Delattre, Cyril; Shapiro, Ehud
2016-01-01
Microfluidics may revolutionize our ability to write synthetic DNA by addressing several fundamental limitations associated with generating novel genetic constructs. Here we report the first de novo synthesis and cell-free cloning of custom DNA libraries in sub-microliter reaction droplets using programmable digital microfluidics. Specifically, we developed Programmable Order Polymerization (POP), Microfluidic Combinatorial Assembly of DNA (M-CAD) and Microfluidic In-vitro Cloning (MIC) and applied them to de novo synthesis, combinatorial assembly and cell-free cloning of genes, respectively. Proof-of-concept for these methods was demonstrated by programming an autonomous microfluidic system to construct and clone libraries of yeast ribosome binding sites and bacterial Azurine, which were then retrieved in individual droplets and validated. The ability to rapidly and robustly generate designer DNA molecules in an autonomous manner should have wide application in biological research and development. PMID:26481354
NASA Astrophysics Data System (ADS)
Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.
2013-05-01
New Fe(II) Schiff base amino acid complexes derived from the condensation of o-hydroxynaphthaldehyde with L-alanine, L-phenylalanine, L-aspartic acid, L-histidine and L-arginine were synthesized and characterized by elemental analysis, IR, electronic spectra, and conductance measurements. The stoichiometry and the stability constants of the complexes were determined spectrophotometrically. The investigated Schiff bases exhibited tridentate coordination mode with the general formulae [Fe(HL)2]·nH2O for all amino acids except L-histidine. But in case of L-histidine, the ligand acts as tetradentate ([FeL(H2O)2]·2H2O), where HL = mono anion and L = dianion of the ligand. The structure of the prepared complexes is suggested to be octahedral. The prepared complexes were tested for their toxicity on chick embryos and found to be safe until a concentration of 100 μg/egg with full embryos formation. The interaction between CT-DNA and the investigated complexes were followed by spectrophotometry and viscosity measurements. It was found that, the prepared complexes bind to DNA via classical intercalative mode and showed a different DNA cleavage activity with the sequence: nhi > nari > nali > nasi > nphali. The thermodynamic Profile of the binding of nphali complex and CT-DNA was constructed by analyzing the experimental data of absorption titration and UV melting studies with the McGhee equation, van't Hoff's equation, and the Gibbs-Helmholtz equation.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Lerner, Leticia K; Francisco, Guilherme; Soltys, Daniela T; Rocha, Clarissa R R; Quinet, Annabel; Vessoni, Alexandre T; Castro, Ligia P; David, Taynah I P; Bustos, Silvina O; Strauss, Bryan E; Gottifredi, Vanesa; Stary, Anne; Sarasin, Alain; Chammas, Roger; Menck, Carlos F M
2017-02-17
Genome lesions trigger biological responses that help cells manage damaged DNA, improving cell survival. Pol eta is a translesion synthesis (TLS) polymerase that bypasses lesions that block replicative polymerases, avoiding continued stalling of replication forks, which could lead to cell death. p53 also plays an important role in preventing cell death after ultraviolet (UV) light exposure. Intriguingly, we show that p53 does so by favoring translesion DNA synthesis by pol eta. In fact, the p53-dependent induction of pol eta in normal and DNA repair-deficient XP-C human cells after UV exposure has a protective effect on cell survival after challenging UV exposures, which was absent in p53- and Pol H-silenced cells. Viability increase was associated with improved elongation of nascent DNA, indicating the protective effect was due to more efficient lesion bypass by pol eta. This protection was observed in cells proficient or deficient in nucleotide excision repair, suggesting that, from a cell survival perspective, proper bypass of DNA damage can be as relevant as removal. These results indicate p53 controls the induction of pol eta in DNA damaged human cells, resulting in improved TLS and enhancing cell tolerance to DNA damage, which parallels SOS responses in bacteria. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Leis, Jonathan P.; Hurwitz, Jerard
1972-01-01
The role of ribonucleic acid (RNA) in deoxyribonucleic acid (DNA) synthesis with the purified DNA polymerase from the avian myeloblastosis virus has been studied. The polymerase catalyzes the synthesis of DNA in the presence of four deoxynucleoside triphosphates, Mg2+, and a variety of RNA templates including those isolated from avian myeloblastosis, Rous sarcoma, and Rauscher leukemia viruses; phages f2, MS2, and Qβ; and synthetic homopolymers such as polyadenylate·polyuridylic acid. The enzyme does not initiate the synthesis of new chains but incorporates deoxynucleotides at 3′ hydroxyl ends of primer strands. The product is an RNA·DNA hybrid in which the two polynucleotide components are covalently linked. Free DNA has not been detected among the products formed with the purified enzyme in vitro. The DNA synthesized with avian myeloblastosis virus RNA after alkaline hydrolysis has a sedimentation coefficient of 6 to 7S. PMID:4333539
Zinc-binding Domain of the Bacteriophage T7 DNA Primase Modulates Binding to the DNA Template*
Lee, Seung-Joo; Zhu, Bin; Akabayov, Barak; Richardson, Charles C.
2012-01-01
The zinc-binding domain (ZBD) of prokaryotic DNA primases has been postulated to be crucial for recognition of specific sequences in the single-stranded DNA template. To determine the molecular basis for this role in recognition, we carried out homolog-scanning mutagenesis of the zinc-binding domain of DNA primase of bacteriophage T7 using a bacterial homolog from Geobacillus stearothermophilus. The ability of T7 DNA primase to catalyze template-directed oligoribonucleotide synthesis is eliminated by substitution of any five-amino acid residue-long segment within the ZBD. The most significant defect occurs upon substitution of a region (Pro-16 to Cys-20) spanning two cysteines that coordinate the zinc ion. The role of this region in primase function was further investigated by generating a protein library composed of multiple amino acid substitutions for Pro-16, Asp-18, and Asn-19 followed by genetic screening for functional proteins. Examination of proteins selected from the screening reveals no change in sequence-specific recognition. However, the more positively charged residues in the region facilitate DNA binding, leading to more efficient oligoribonucleotide synthesis on short templates. The results suggest that the zinc-binding mode alone is not responsible for sequence recognition, but rather its interaction with the RNA polymerase domain is critical for DNA binding and for sequence recognition. Consequently, any alteration in the ZBD that disturbs its conformation leads to loss of DNA-dependent oligoribonucleotide synthesis. PMID:23024359
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Taguchi, Takahiko; Kurata, Sumiko; Ohashi, Mochihiko
2002-09-01
Putrescine biosynthesis is elevated before DNA replication, and a stimulation of DNA synthesis by 20 mM putrescine has been found using an in vitro DNA synthesizing system. Furthermore, this stimulation of DNA synthesis by putrescine involves a particular factor (factor PA). This factor PA stimulates DNA polymerases alpha, beta, and gamma, and is present in nuclei and mitochondria but not in cytoplasm. Factor PA loses about 80% of its activity by heating at 45 degrees C for 15 min or by hydrolysis with 100 mg ml(-1) Enzygel trypsin. These properties indicate that factor PA is a protein. Its size is estimated to be about 2.1 S. DNA synthesis in nuclear and mitochondrial DNA polymerase extracts from tumour tissues and host livers of tumour-bearing rats are not stimulated by 20 mM putrescine. However, the addition of excess factor PA to DNA synthesizing systems using DNA polymerase extracts from proliferative tissues again results in a stimulation of DNA synthesis by exogenous putrescine. These findings indicate that the stimulatory effect of DNA synthesis in vitro by exogenous putrescine is controlled by the ratio between factor PA and endogenously synthesized putrescine in proliferative tissues or that sent by the bloodstream from proliferative tissues. These results suggest that a non-stimulatory effect of putrescine on DNA synthesis may be diagnostic in tumour-bearing patients. Copyright 2002 John Wiley & Sons, Ltd.
Non-intercalative, deoxyribose binding of boric acid to calf thymus DNA.
Ozdemir, Ayse; Gursaclı, Refiye Tekiner; Tekinay, Turgay
2014-05-01
The present study characterizes the effects of the boric acid binding on calf thymus DNA (ct-DNA) by spectroscopic and calorimetric methods. UV-Vis absorbance spectroscopy, circular dichroism (CD) spectroscopy, transmission electron microscopy (TEM), isothermal titration calorimetry (ITC), and Fourier transform infrared (FT-IR) spectroscopy were employed to characterize binding properties. Changes in the secondary structure of ct-DNA were determined by CD spectroscopy. Sizes and morphologies of boric acid-DNA complexes were determined by transmission electron microscopy (TEM). The kinetics of boric acid binding to calf thymus DNA (ct-DNA) was investigated by isothermal titration calorimetry (ITC). ITC results revealed that boric acid exhibits a moderate affinity to ct-DNA with a binding constant (K a) of 9.54 × 10(4) M(-1). FT-IR results revealed that boric acid binds to the deoxyribose sugar of DNA without disrupting the B-conformation at tested concentrations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vieira, P.; De Waal-Malefyt, R.; Dang, M.N.
1991-02-15
The authors demonstrated the existence of human cytokine synthesis inhibitory factor (DSIF) (interleukin 10 (IL-10)). cDNA clones encoding human IL-10 (hIL-10) were isolated from a tetanus toxin-specific human T-cell clone. Like mouse IL-10, hIL-10 exhibits strong DNA and amino acid sequence homology to an open reading frame in the Epstein-Barr virus, BDRFL. hIL-10 and the BCRFI product inhibit cytokine synthesis by activated human peripheral blood mononuclear cells and by a mouse Th1 clone. Both hIL-10 and mouse IL-10 sustain the viability of a mouse mast cell line in culture, but BCRFI lacks comparable activity in this way, suggesting that BCRFImore » may have conserved only a subset of hIL-10 activities.« less
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Hybrid DNA i-motif: Aminoethylprolyl-PNA (pC5) enhance the stability of DNA (dC5) i-motif structure.
Gade, Chandrasekhar Reddy; Sharma, Nagendra K
2017-12-15
This report describes the synthesis of C-rich sequence, cytosine pentamer, of aep-PNA and its biophysical studies for the formation of hybrid DNA:aep-PNAi-motif structure with DNA cytosine pentamer (dC 5 ) under acidic pH conditions. Herein, the CD/UV/NMR/ESI-Mass studies strongly support the formation of stable hybrid DNA i-motif structure with aep-PNA even near acidic conditions. Hence aep-PNA C-rich sequence cytosine could be considered as potential DNA i-motif stabilizing agents in vivo conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Subnuclear systems for synthesis of simian virus 40 DNA in vitro.
Edenberg, H J; Waqar, M A; Huberman, J A
1976-01-01
We have developed two subnuclear systems for synthesis of DNA of simian virus 40 in vitro. We prepare chromatin from infected cells by the method of Hancock [(1974) J. Mol. Biol. 86, 649-663]; these "chromatin bodies" can be disrupted and large debris can be pelleted, leaving a supernatant ("soluble system"). Both chromatin bodies and the soluble system incorporate deoxyribonucleoside triphosphates into nucleoprotein complexes that contain simian virus 40 DNA. The DNA labeled in short pulses sediments in neutral sucrose gradients slightly faster than mature simian virus 40 DNA, as expected for replicating intermediate. When rebanded in alkaline sucrose gradients, about half of the radioactivity is found in short strands (200-300 nucleotides) and half in longer strands (up to full viral size). When these systems are supplemented with a cytoplasmic preparation from HeLa cells, synthesis is stimulated about 5-fold, and the short strands are converted into strands of up to full viral length as well as into covalently closed circles. These subnuclear DNA-replicating systems should be useful for biochemical fractionation and characterization of some of the proteins required for DNA replication. PMID:188037
Jia, Xiao-Wei; Zhang, Guo-Hui; Shi, Hai-Yan
2012-12-01
Express a novel species of single-stranded DNA-binding protein (SSB) derived from Thermococcus kodakarensis KOD1, abbreviated kod-ssb. And evaluate the effect of kod-ssb on PCR-based DNA amplification and reverse transcription. We express kod-ssb with the Transrtta (DE3), and kod-ssb was purified by affinity chromatography on a Ni2+ Sepharose column, detected by SDS-PAGE. To evaluate the effect of kod-ssb on PCR-based DNA amplification, the human beta globin gene was used as template to amplify a 5-kb, 9-kb and 13-kb. And to detect the effect of kod-ssb on reverse transcription, we used RNA from flu cell culture supernatant extraction as templates to implement qRT-PCR reaction. The plasmid pET11a-kod was transformed into Transetta (DE3) and the recombinant strain Transetta (pET11 a-kod) was obtained. The kod-ssb was highly expressed when the recombinant strain Transetta(pET11a-kod) was induced by IPTG. The specific protein was detected by SDS-PAGE. To confirm that kod-ssb can enhance target DNA synthesis and reduce PCR by-products, 5-, 9-, and 13-kb human beta globin gene fragments were used as templates for PCR. When PCR reactions did not include SSB proteins, the specific PCR product was contaminated with non-specific products. When kod -ssb was added, kod-ssb significantly enhanced amplification of the 5-, 9-and 13-kb target product and minimised the non-specific PCR products. To confirm that kod-ssb can enhance target cDNA synthesis, RNA from flu cell culture supernatant extraction was used as templates for qRT-PCR reaction. The results was that when kod-ssb was added, kod-ssb significantly enhanced the synthesis of cDNA, average Ct value is 19.42, and the average Ct value without kod-ssb is 22.15. kod-ssb may in future be used to enhance DNA and cDNA amplification.
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Zinchenko, Anatoly; Miwa, Yasuyuki; Lopatina, Larisa I; Sergeyev, Vladimir G; Murata, Shizuaki
2014-03-12
DNA cross-linked hydrogel was used as a matrix for synthesis of gold nanoparticles. DNA possesses a strong affinity to transition metals such as gold, which allows for the concentration of Au precursor inside a hydrogel. Further reduction of HAuCl4 inside DNA hydrogel yields well dispersed, non-aggregated spherical Au nanoparticles of 2-3 nm size. The average size of these Au nanoparticles synthesized in DNA hydrogel is the smallest reported so far for in-gel metal nanoparticles synthesis. DNA hybrid hydrogel containing gold nanoparticles showed high catalytic activity in the hydrogenation reaction of nitrophenol to aminophenol. The proposed soft hybrid material is promising as environmentally friendly and sustainable material for catalytic applications.
DNA methylation of amino acid transporter genes in the human placenta.
Simner, C; Novakovic, B; Lillycrop, K A; Bell, C G; Harvey, N C; Cooper, C; Saffery, R; Lewis, R M; Cleal, J K
2017-12-01
Placental transfer of amino acids via amino acid transporters is essential for fetal growth. Little is known about the epigenetic regulation of amino acid transporters in placenta. This study investigates the DNA methylation status of amino acid transporters and their expression across gestation in human placenta. BeWo cells were treated with 5-aza-2'-deoxycytidine to inhibit methylation and assess the effects on amino acid transporter gene expression. The DNA methylation levels of amino acid transporter genes in human placenta were determined across gestation using DNA methylation array data. Placental amino acid transporter gene expression across gestation was also analysed using data from publically available Gene Expression Omnibus data sets. The expression levels of these transporters at term were established using RNA sequencing data. Inhibition of DNA methylation in BeWo cells demonstrated that expression of specific amino acid transporters can be inversely associated with DNA methylation. Amino acid transporters expressed in term placenta generally showed low levels of promoter DNA methylation. Transporters with little or no expression in term placenta tended to be more highly methylated at gene promoter regions. The transporter genes SLC1A2, SLC1A3, SLC1A4, SLC7A5, SLC7A11 and SLC7A10 had significant changes in enhancer DNA methylation across gestation, as well as gene expression changes across gestation. This study implicates DNA methylation in the regulation of amino acid transporter gene expression. However, in human placenta, DNA methylation of these genes remains low across gestation and does not always play an obvious role in regulating gene expression, despite clear evidence for differential expression as gestation proceeds. Copyright © 2017. Published by Elsevier Ltd.
Krokan, H; Eriksen, A
1977-02-01
Addition of methyl glyoxal bis(guanylhydrazone) to HeLa S3 suspension cultures resulted in increased putrescine levels and decreased spermidine and spermine levels preceding a drop in incorporation of [3H]thymidine, [3H]uridine and [14C]leucine into macromolecules. When putrescine, spermidine, spermine or cadaverine was added simultaneously with methyl glyoxal bis(guanylhydrazone), the drug had no detectable effect on the synthesis of macromolecules. In nuclei isolated from cells treated with methyl glyoxal bis(guanylhydrazone) the reduction in the rate of DNA synthesis was equal to the reduction of [3H]thymidine incorporation in the corresponding whole cells. The capability of the nuclei to synthesize DNA could not be restored by adding spermidine or spermine to the system in vitro. The rate of DNA chain elongation was only reduced slightly by methyl glyoxal bis(guanylhydrazone) indicating that decreased levels of spermidine and spermine lead to a decrease in the number of replication units active in DNA synthesis within each cell.
Beltz, Hervé; Clauss, Céline; Piémont, Etienne; Ficheux, Damien; Gorelick, Robert J; Roques, Bernard; Gabus, Caroline; Darlix, Jean-Luc; de Rocquigny, Hugues; Mély, Yves
2005-05-20
The nucleocapsid protein (NC) of human immunodeficiency virus type 1 (HIV-1) is formed of two highly conserved CCHC zinc fingers flanked by small basic domains. NC is required for the two obligatory strand transfers in viral DNA synthesis through its nucleic acid chaperoning properties. The first DNA strand transfer relies on NC's ability to bind and destabilize the secondary structure of complementary transactivation response region (cTAR) DNA, to inhibit self-priming, and to promote the annealing of cTAR to TAR RNA. To further investigate NC chaperone properties, our aim was to identify by fluorescence spectroscopy and gel electrophoresis, the NC structural determinants for cTAR binding and destabilization, and for the inhibition of self-primed DNA synthesis on a model system using a series of NC mutants and HIV-1 reverse transcriptase. NC destabilization and self-priming inhibition properties were found to be supported by the two fingers in their proper context and the basic (29)RAPRKKG(35) linker. The strict requirement of the native proximal finger suggests that its hydrophobic platform (Val13, Phe16, Thr24 and Ala25) is crucial for binding, destabilization and inhibition of self-priming. In contrast, only partial folding of the distal finger is required, probably for presenting the Trp37 residue in an appropriate orientation. Also, Trp37 and the hydrophobic residues of the proximal finger appear to be essential for the propagation of the melting from the cTAR ends up to the middle of the stem. Finally, both N-terminal and C-terminal basic domains contribute to cTAR binding but not to its destabilization.
CdS nanowires formed by chemical synthesis using conjugated single-stranded DNA molecules
NASA Astrophysics Data System (ADS)
Sarangi, S. N.; Sahu, S. N.; Nozaki, S.
2018-03-01
CdS nanowires were successfully grown by chemical synthesis using two conjugated single-stranded (ss) DNA molecules, poly G (30) and poly C (30), as templates. During the early stage of the synthesis with the DNA molecules, the Cd 2+ interacts with Poly G and Poly C and produces the (Cd 2+)-Poly GC complex. As the growth proceeds, it results in nanowires. The structural analysis by grazing angle x-ray diffraction and transmission electron microscopy confirmed the zinc-blende CdS nanowires with the growth direction of <220>. Although the nanowires are well surface-passivated with the DNA molecules, the photoluminescence quenching was caused by the electron transfer from the nanowires to the DNA molecules. The quenching can be used to detect and label the DNAs.
Jiang, Sibo; Sheng, Jia
2015-01-01
Introduction In this unit, an efficient method for the synthesis of 2’-tellerium modified phosphoramidite and its incorporation into oligonucleotide are presented. We choose 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine nucleosides (S.1, S.2) as starting materials due to their easy preparation. The 5’-O-DMTr-2,2’-anhydro-uridine and -thymidine can be converted to corresponding the 2’-tellerium-derivatized nucleosides by treating with the telluride nucleophiles. Subsequently, the 2’-Te-nucleosides can be transformed into 3’-phosphoramidites, which are the building blocks for DNA/RNA synthesis. The DNA synthesis, purification and applications of oligonucleotides containing 2’-Te-U or 2’-Te-T are described in this protocol. PMID:22147418
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Higgins, M. L.; Daneo-Moore, L.; Boothby, D.; Shockman, G. D.
1974-01-01
Selective inhibition of protein synthesis in Streptococcus faecalis (ATCC 9790) was accompanied by a rapid and severe inhibition of cell division and a reduction of enlargement of cellular surface area. Continued synthesis of cell wall polymers resulted in rapid thickening of the wall to an extent not seen in exponential-phase populations. Thus, the normal direction of wall growth was changed from a preferential feeding out of new wall surface to that of thickening existing cell surfaces. However, the overall manner in which the wall thickened, from nascent septa toward polar regions, was the same in both exponential-phase and inhibited populations. In contrast, selective inhibition of deoxyribonucleic acid (DNA) synthesis using mitomycin C was accompanied by an increase in cellular surface area and by division of about 80% of the cells in random populations. Little or no wall thickening was observed until the synthesis of macromolecules other than DNA was impaired and further cell division ceased. Concomitant inhibition of both DNA and protein synthesis inhibited cell division but permitted an increase in average cell volume. In such doubly inhibited cells, walls thickened less than in cells inhibited for protein synthesis only. On the basis of the results obtained, a model for cell surface enlargement and cell division is presented. The model proposes that: (i) each wall enlargement site is influenced by an individual chromosome replication cycle; (ii) during chromosome replication peripheral surface enlargement would be favored over thickening (or septation); (iii) a signal associated with chromosome termination would favor thickening (and septation) at the expense of surface enlargement; and (iv) a factor or signal related to protein synthesis would be required for one or more of the near terminal stages of cell division or cell separation, or both. Images PMID:4133352
Deoxyribonucleic acid (DNA)-based optical materials
NASA Astrophysics Data System (ADS)
Grote, James G.; Heckman, Emily M.; Hagen, Joshua A.; Yaney, Perry P.; Subramanyam, Guru; Clarson, Stephen J.; Diggs, Darnell E.; Nelson, Robert L.; Zetts, John S.; Hopkins, F. Kenneth; Ogata, Naoya
2004-12-01
Optical materials for waveguiding applications must possess the desired optical and electromagnetic properties for optimal device performance. Purified deoxyribonucleic acid (DNA), derived from salmon sperm, has been investigated for use as an optical waveguide material. In this paper we present the materials processing and optical and electromagnetic characterization of this purified DNA to render a high quality, low loss optical waveguide material.
Uracil misincorporation into DNA and folic acid supplementation
USDA-ARS?s Scientific Manuscript database
BACKGROUND: Folate deficiency decreases thymidylate synthesis from deoxyuridylate, which results in an imbalance of deoxyribonucleotide that may lead to excessive uracil misincorporation (UrMis) into DNA during replication and repair. OBJECTIVE: We evaluated the relation between UrMis in different ...
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
Improved DNA hybridization parameters by Twisted Intercalating Nucleic Acid (TINA).
Schneider, Uffe Vest
2012-01-01
This thesis establishes oligonucleotide design rules and applications of a novel group of DNA stabilizing molecules collectively called Twisted Intercalating Nucleic Acid - TINA. Three peer-reviewed publications form the basis for the thesis. One publication describes an improved and rapid method for determination of DNA melting points and two publications describe the effects of positioning TINA molecules in parallel triplex helix and antiparallel duplex helix forming DNA structures. The third publication establishes that TINA molecules containing oligonucleotides improve an antiparallel duplex hybridization based capture assay's analytical sensitivity compared to conventionel DNA oligonucleotides. Clinical microbiology is traditionally based on pathogenic microorganisms' culture and serological tests. The introduction of DNA target amplification methods like PCR has improved the analytical sensitivity and total turn around time involved in clinical diagnostics of infections. Due to the relatively weak hybridization between the two strands of double stranded DNA, a number of nucleic acid stabilizing molecules have been developed to improve the sensitivity of DNA based diagnostics through superior binding properties. A short introduction is given to Watson-Crick and Hoogsteen based DNA binding and the derived DNA structures. A number of other nucleic acid stabilizing molecules are described. The stabilizing effect of TINA molecules on different DNA structures is discussed and considered in relation to other nucleic acid stabilizing molecules and in relation to future use of TINA containing oligonucleotides in clinical diagnostics and therapy. In conclusion, design of TINA modified oligonucleotides for antiparallel duplex helixes and parallel triplex helixes follows simple purpose dependent rules. TINA molecules are well suited for improving multiplex PCR assays and can be used as part of novel technologies. Future research should test whether combinations of TINA
Swayne, Breanne G; Kawata, Alice; Behan, Nathalie A; Williams, Andrew; Wade, Mike G; Macfarlane, Amanda J; Yauk, Carole L
2012-09-01
To date, fewer than 50 mutagens have been studied for their ability to cause heritable mutations. The majority of those studied are classical mutagens like radiation and anti-cancer drugs. Very little is known about the dietary variables influencing germline mutation rates. Folate is essential for DNA synthesis and methylation and can impact chromatin structure. We therefore determined the effects of folic acid-deficient (0mg/kg), control (2mg/kg) and supplemented (6mg/kg) diets in early development and during lactation or post-weaning on mutation rates and chromatin quality in sperm of adult male Balb/c mice. The sperm chromatin structure assay and mutation frequencies at expanded simple tandem repeats (ESTRs) were used to evaluate germline DNA integrity. Treatment of a subset of mice fed the control diet with the mutagen ethylnitrosourea (ENU) at 8 weeks of age was included as a positive control. ENU treated mice exhibited decreased cauda sperm counts, increased DNA fragmentation and increased ESTR mutation frequencies relative to non-ENU treated mice fed the control diet. Male mice weaned to the folic acid deficient diet had decreased cauda sperm numbers, increased DNA fragmentation index, and increased ESTR mutation frequency. Folic acid deficiency in early development did not lead to changes in sperm counts or chromatin integrity in adult mice. Folic acid supplementation in early development or post-weaning did not affect germ cell measures. Therefore, adequate folic acid intake in adulthood is important for preventing chromatin damage and mutation in the male germline. Folic acid supplementation at the level achieved in this study does not improve nor is it detrimental to male germline chromatin integrity. Crown Copyright © 2012. Published by Elsevier B.V. All rights reserved.
Nilforoushan, Arman; Furrer, Antonia; Wyss, Laura A; van Loon, Barbara; Sturla, Shana J
2015-04-15
Human DNA polymerase η (hPol η) contributes to anticancer drug resistance by catalyzing the replicative bypass of DNA adducts formed by the widely used chemotherapeutic agent cis-diamminedichloroplatinum (cisplatin). A chemical basis for overcoming bypass-associated resistance requires greater knowledge of how small molecules influence the hPol η-catalyzed bypass of DNA adducts. In this study, we demonstrated how synthetic nucleoside triphosphates act as hPol η substrates and characterized their influence on hPol η-mediated DNA synthesis over unmodified and platinated DNA. The single nucleotide incorporation efficiency of the altered nucleotides varied by more than 10-fold and the higher incorporation rates appeared to be attributable to the presence of an additional hydrogen bond between incoming dNTP and templating base. Finally, full-length DNA synthesis in the presence of increasing concentrations of synthetic nucleotides reduced the amount of DNA product independent of the template, representing the first example of hPol η inhibition in the presence of a platinated DNA template.
Amino acid racemization in amber-entombed insects: implications for DNA preservation
NASA Technical Reports Server (NTRS)
Bada, J. L.; Wang, X. S.; Poinar, H. N.; Paabo, S.; Poinar, G. O.
1994-01-01
DNA depurination and amino acid racemization take place at similar rates in aqueous solution at neutral pH. This relationship suggests that amino acid racemization may be useful in accessing the extent of DNA chain breakage in ancient biological remains. To test this suggestion, we have investigated the amino acids in insects entombed in fossilized tree resins ranging in age from <100 years to 130 million years. The amino acids present in 40 to 130 million year old amber-entombed insects resemble those in a modern fly and are probably the most ancient, unaltered amino acids found so far on Earth. In comparison to other geochemical environments on the surface of the Earth, the amino acid racemization rate in amber insect inclusions is retarded by a factor of >10(4). These results suggest that in amber insect inclusions DNA depurination rates would also likely be retarded in comparison to aqueous solution measurements, and thus DNA fragments containing many hundreds of base pairs should be preserved. This conclusion is consistent with the reported successful retrieval of DNA sequences from amber-entombed organisms.
Conditions Determining Initiation of DNA Synthesis in 3T3 Cells*
Dulbecco, R.; Stoker, M. G. P.
1970-01-01
Experiments were designed to discriminate between inhibition of growth due to contacts or exhaustion of serum factors. The cell layer was wounded and the migrating cells were followed by time-lapse cinematography; DNA synthesis in the same cells was recognized by means of 3H-thymidine labeling and radioautography. In this way, the complete history of individual cells migrating to the wound could be described. The results show that topographical relationships between cells play an important role in controlling initiation of DNA synthesis. It is still unclear whether initiation is promoted by release from contacts or by the increased ability of the cells to utilize serum factors because of their changes in shapes and activities. PMID:5273897
Programmable autonomous synthesis of single-stranded DNA
NASA Astrophysics Data System (ADS)
Kishi, Jocelyn Y.; Schaus, Thomas E.; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng
2018-02-01
DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.
Programmable autonomous synthesis of single-stranded DNA.
Kishi, Jocelyn Y; Schaus, Thomas E; Gopalkrishnan, Nikhil; Xuan, Feng; Yin, Peng
2018-02-01
DNA performs diverse functional roles in biology, nanotechnology and biotechnology, but current methods for autonomously synthesizing arbitrary single-stranded DNA are limited. Here, we introduce the concept of primer exchange reaction (PER) cascades, which grow nascent single-stranded DNA with user-specified sequences following prescribed reaction pathways. PER synthesis happens in a programmable, autonomous, in situ and environmentally responsive fashion, providing a platform for engineering molecular circuits and devices with a wide range of sensing, monitoring, recording, signal-processing and actuation capabilities. We experimentally demonstrate a nanodevice that transduces the detection of a trigger RNA into the production of a DNAzyme that degrades an independent RNA substrate, a signal amplifier that conditionally synthesizes long fluorescent strands only in the presence of a particular RNA signal, molecular computing circuits that evaluate logic (AND, OR, NOT) combinations of RNA inputs, and a temporal molecular event recorder that records in the PER transcript the order in which distinct RNA inputs are sequentially detected.
Yu, W; Sanders, B G; Kline, K
1997-01-01
RRR-alpha-tocopheryl succinate (vitamin E succinate, VES) treatment of murine EL4 T lymphoma cells induced the cells to undergo apoptosis. After 48 hours of VES treatment at 20 micrograms/ml, 95% of cells were apoptotic. Evidence for the induction of apoptosis by VES treatments is based on staining of DNA for detection of chromatin condensation/fragmentation, two-color flow-cytometric analyses of DNA content, and end-labeled DNA and electrophoretic analyses for detection of DNA ladder formation. VES-treated EL4 cells were blocked in the G1 cell cycle phase; however, apoptotic cells came from all cell cycle phases. Analyses of mRNA expression of genes involved in apoptosis revealed decreased c-myc and increased bcl-2, c-fos, and c-jun mRNAs within three to six hours after treatment. Western analyses showed increased c-Jun, c-Fos, and Bcl-2 protein levels. Electrophoretic mobility shift assays showed increased AP-1 binding at 6, 12, and 24 hours after treatment and decreased c-Myc binding after 12 and 24 hours of VES treatment. Treatments of EL4 cells with VES+RRR-alpha-to-copherol reduced apoptosis without effecting DNA synthesis arrest. Treatments of EL4 cells with VES+rac-6-hydroxyl-2, 5,7,8-tetramethyl-chroman-2-carboxylic acid, butylated hydroxytoluene, or butylated hydroxyanisole had no effect on apoptosis or DNA synthesis arrest caused by VES treatments. Analyses of bcl-2, c-myc, c-jun, and c-fos mRNA levels in cells receiving VES + RRR-alpha-tocopherol treatments showed no change from cells receiving VES treatments alone, implying that these changes are correlated with VES treatments but are not causal for apoptosis. However, treatments with VES + RRR-alpha-tocopherol decreased AP-1 binding to consensus DNA oligomer, suggesting AP-1 involvement in apoptosis induced by VES treatments.
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
PI3K is required for both basal and LPA-induced DNA synthesis in oral carcinoma cells.
Aasrum, Monica; Tjomsland, Vegard; Thoresen, G Hege; De Angelis, Paula M; Christoffersen, Thoralf; Brusevold, Ingvild J
2016-07-01
The glycerophospholipid lysophosphatidic acid (LPA), which is present in most tissues and in high concentrations in saliva, may exert profound effects on oral cancer cells. We have investigated mitogenic signalling induced by LPA in the two oral carcinoma cell lines, D2 and E10, focusing on the role of EGFR transactivation and downstream pathways. Two oral squamous carcinoma cell lines, D2 and E10, were analysed for effects of LPA on signalling pathways and induction of DNA synthesis. Pathway activation was investigated by examining phosphorylation of signalling proteins and by the use of specific pathway inhibitors. The D2 cells had higher levels of activated signalling proteins and higher DNA synthesis activity in the basal condition than E10 cells. EGF did not induce proliferation in D2 cells, whereas LPA induced proliferation in both cell lines, by mechanisms depending on EGFR transactivation. Release of EGFR ligands was involved in basal and LPA-induced proliferation in both D2 and E10 cells. The proliferation in D2 cells was dependent on the PI3K/Akt pathway, but not the MEK/ERK pathway. In E10 cells, the PI3K/Akt, MEK/ERK and p38 pathways were all involved in the proliferation. Transactivation of EGFR is required for LPA-induced DNA synthesis in D2 and E10 cells. Our results also show that although proliferation of oral carcinoma cells is regulated by several pathways, and differentially in E10 and D2 cells, the PI3K pathway has a crucial role in both cell lines. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Yasuno, Rie; Wada, Hajime
1998-01-01
Lipoic acid is a coenzyme that is essential for the activity of enzyme complexes such as those of pyruvate dehydrogenase and glycine decarboxylase. We report here the isolation and characterization of LIP1 cDNA for lipoic acid synthase of Arabidopsis. The Arabidopsis LIP1 cDNA was isolated using an expressed sequence tag homologous to the lipoic acid synthase of Escherichia coli. This cDNA was shown to code for Arabidopsis lipoic acid synthase by its ability to complement a lipA mutant of E. coli defective in lipoic acid synthase. DNA-sequence analysis of the LIP1 cDNA revealed an open reading frame predicting a protein of 374 amino acids. Comparisons of the deduced amino acid sequence with those of E. coli and yeast lipoic acid synthase homologs showed a high degree of sequence similarity and the presence of a leader sequence presumably required for import into the mitochondria. Southern-hybridization analysis suggested that LIP1 is a single-copy gene in Arabidopsis. Western analysis with an antibody against lipoic acid synthase demonstrated that this enzyme is located in the mitochondrial compartment in Arabidopsis cells as a 43-kD polypeptide. PMID:9808738
Xiong, Ai-Sheng; Yao, Quan-Hong; Peng, Ri-He; Li, Xian; Fan, Hui-Qin; Cheng, Zong-Ming; Li, Yi
2004-07-07
Chemical synthesis of DNA sequences provides a powerful tool for modifying genes and for studying gene function, structure and expression. Here, we report a simple, high-fidelity and cost-effective PCR-based two-step DNA synthesis (PTDS) method for synthesis of long segments of DNA. The method involves two steps. (i) Synthesis of individual fragments of the DNA of interest: ten to twelve 60mer oligonucleotides with 20 bp overlap are mixed and a PCR reaction is carried out with high-fidelity DNA polymerase Pfu to produce DNA fragments that are approximately 500 bp in length. (ii) Synthesis of the entire sequence of the DNA of interest: five to ten PCR products from the first step are combined and used as the template for a second PCR reaction using high-fidelity DNA polymerase pyrobest, with the two outermost oligonucleotides as primers. Compared with the previously published methods, the PTDS method is rapid (5-7 days) and suitable for synthesizing long segments of DNA (5-6 kb) with high G + C contents, repetitive sequences or complex secondary structures. Thus, the PTDS method provides an alternative tool for synthesizing and assembling long genes with complex structures. Using the newly developed PTDS method, we have successfully obtained several genes of interest with sizes ranging from 1.0 to 5.4 kb.
Self-assembled catalytic DNA nanostructures for synthesis of para-directed polyaniline.
Wang, Zhen-Gang; Zhan, Pengfei; Ding, Baoquan
2013-02-26
Templated synthesis has been considered as an efficient approach to produce polyaniline (PANI) nanostructures. The features of DNA molecules enable a DNA template to be an intriguing template for fabrication of emeraldine PANI. In this work, we assembled HRP-mimicking DNAzyme with different artificial DNA nanostructures, aiming to manipulate the molecular structures and morphologies of PANI nanostructures through the controlled DNA self-assembly. UV-vis absorption spectra were used to investigate the molecular structures of PANI and monitor kinetic growth of PANI. It was found that PANI was well-doped at neutral pH and the redox behaviors of the resultant PANI were dependent on the charge density of the template, which was controlled by the template configurations. CD spectra indicated that the PANI threaded tightly around the helical DNA backbone, resulting in the right handedness of PANI. These reveal the formation of the emeraldine form of PANI that was doped by the DNA. The morphologies of the resultant PANI were studied by AFM and SEM. It was concluded from the imaging and spectroscopic kinetic results that PANI grew preferably from the DNAzyme sites and then expanded over the template to form 1D PANI nanostructures. The strategy of the DNAzyme-DNA template assembly brings several advantages in the synthesis of para-coupling PANI, including the region-selective growth of PANI, facilitating the formation of a para-coupling structure and facile regulation. We believe this study contributes significantly to the fabrication of doped PANI nanopatterns with controlled complexity, and the development of DNA nanotechnology.
Development and Synthesis of DNA-Encoded Benzimidazole Library.
Ding, Yun; Chai, Jing; Centrella, Paolo A; Gondo, Chenaimwoyo; DeLorey, Jennifer L; Clark, Matthew A
2018-04-25
Encoded library technology (ELT) is an effective approach to the discovery of novel small-molecule ligands for biological targets. A key factor for the success of the technology is the chemical diversity of the libraries. Here we report the development of DNA-conjugated benzimidazoles. Using 4-fluoro-3-nitrobenzoic acid as a key synthon, we synthesized a 320 million-member DNA-encoded benzimidazole library using Fmoc-protected amino acids, amines and aldehydes as diversity elements. Affinity selection of the library led to the discovery of a novel, potent and specific antagonist of the NK3 receptor.
Repair of oxidative DNA damage by amino acids.
Milligan, J R; Aguilera, J A; Ly, A; Tran, N Q; Hoang, O; Ward, J F
2003-11-01
Guanyl radicals, the product of the removal of a single electron from guanine, are produced in DNA by the direct effect of ionizing radiation. We have produced guanyl radicals in DNA by using the single electron oxidizing agent (SCN)2-, itself derived from the indirect effect of ionizing radiation via thiocyanate scavenging of OH. We have examined the reactivity of guanyl radicals in plasmid DNA with the six most easily oxidized amino acids cysteine, cystine, histidine, methionine, tryptophan and tyrosine and also simple ester and amide derivatives of them. Cystine and histidine derivatives are unreactive. Cysteine, methionine, tyrosine and particularly tryptophan derivatives react to repair guanyl radicals in plasmid DNA with rate constants in the region of approximately 10(5), 10(5), 10(6) and 10(7) dm3 mol(-1) s(-1), respectively. The implication is that amino acid residues in DNA binding proteins such as histones might be able to repair by an electron transfer reaction the DNA damage produced by the direct effect of ionizing radiation or by other oxidative insults.
Hocek, Michal
2014-11-07
The synthesis of 2'-deoxyribonucleoside triphosphates (dNTPs) either by classical triphosphorylation of nucleosides or by aqueous cross-coupling reactions of halogenated dNTPs is discussed. Different enzymatic methods for synthesis of modified oligonucleotides and DNA by polymerase incorporation of modified nucleotides are summarized, and the applications in redox or fluorescent labeling, as well as in bioconjugations and modulation of interactions of DNA with proteins, are outlined.
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Regulation of yeast DNA polymerase δ-mediated strand displacement synthesis by 5′-flaps
Koc, Katrina N.; Stodola, Joseph L.; Burgers, Peter M.; Galletto, Roberto
2015-01-01
The strand displacement activity of DNA polymerase δ is strongly stimulated by its interaction with proliferating cell nuclear antigen (PCNA). However, inactivation of the 3′–5′ exonuclease activity is sufficient to allow the polymerase to carry out strand displacement even in the absence of PCNA. We have examined in vitro the basic biochemical properties that allow Pol δ-exo− to carry out strand displacement synthesis and discovered that it is regulated by the 5′-flaps in the DNA strand to be displaced. Under conditions where Pol δ carries out strand displacement synthesis, the presence of long 5′-flaps or addition in trans of ssDNA suppress this activity. This suggests the presence of a secondary DNA binding site on the enzyme that is responsible for modulation of strand displacement activity. The inhibitory effect of a long 5′-flap can be suppressed by its interaction with single-stranded DNA binding proteins. However, this relief of flap-inhibition does not simply originate from binding of Replication Protein A to the flap and sequestering it. Interaction of Pol δ with PCNA eliminates flap-mediated inhibition of strand displacement synthesis by masking the secondary DNA site on the polymerase. These data suggest that in addition to enhancing the processivity of the polymerase PCNA is an allosteric modulator of other Pol δ activities. PMID:25813050
Toxicity of nalidixic acid on candida albicans, Saccharomyces cerevisiae, and Kluyveromyces lactis.
Sobieski, R J; Brewer, A R
1976-03-01
The antibacterial drug nalidixic acid (Nal) can suppress the growth of Candida albicans at levels of the drug normally found in urine. Growth suppression increases as drug levels are increased, and Nal also causes a similar proportional inhibition of the synthesis of all cellular macromolecules. However, growth temperature (25 versus 37 C) and the divalent cations Mg(2+) and Mn(2+) can increase C. albicans resistance to Nal. Also, nitrogen depletion of Candida shows that Nal-treated and untreated cells exhibit no difference in leucine uptake during readaptation to nitrogen. In Nal-treated, nitrogen-starved cells, ribonucleic acid and deoxyribonucleic acid (DNA) biosynthesis are less affected than in unstarved Nal-treated cells, but of the two nucleic acids DNA synthesis is the most affected. Nal-resistant strains of C. albicans exhibit a slight toxicity for macromolecular synthesis. Nal treatment of a synchronized population of Saccharomyces cerevisiae results in an increase in the culture mean doubling time of, at most, 20%, but Nal causes the loss of synchronous cell division. With a synchronized population of Kluyveromyces lactis, Nal causes an increase in the mean doubling time of upwards of 300%, with synchrony of cell division being maintained. It is known that S. cerevisiae asynchronously synthesizes mitochondrial DNA during the cell cycle, whereas with K. lactis it is synchronous. Thus, with C. albicans Nal toxicity is dependent both on the dose and the physiological state of the cell. Furthermore, Nal inhibits growth of yeast with synchronous mitochondrial DNA synthesis more adversely than yeast with asynchronous mitochondrial DNA synthesis.
Estimation of lactic acid bacterial cell number by DNA quantification.
Ishii, Masaki; Matsumoto, Yasuhiko; Sekimizu, Kazuhisa
2018-01-01
Lactic acid bacteria are provided by fermented foods, beverages, medicines, and supplements. Because the beneficial effects of medicines and supplements containing functional lactic acid bacteria are related to the bacterial cell number, it is important to establish a simple method for estimating the total number of lactic acid bacterial cells in the products for quality control. Almost all of the lactic acid bacteria in the products are dead, however, making it difficult to estimate the total number of lactic acid bacterial cells in the products using a standard colony-counting method. Here we estimated the total lactic acid bacterial cell number in samples containing dead bacteria by quantifying the DNA. The number of viable Enterococcus faecalis 0831-07 cells decreased to less than 1 × 10 -8 by 15 min of heat treatment at 80°C. The amount of extracted DNA from heat-treated cells was 78% that of non-heated cells. The number of viable Lactobacillus paraplantarum 11-1 cells decreased to 1 × 10 -4 after 4 days culture. The amount of extracted DNA of the long-cultured cells, however, was maintained at 97%. These results suggest that cell number of lactic acid bacteria killed by heat-treatment or long-term culture can be estimated by DNA quantification.
Effect of TPA on ion fluxes and DNA synthesis in vascular smooth muscle cells
1985-01-01
Previous reports have suggested that phorbol esters can decrease the affinity of epidermal growth factor (EGF) for its cellular receptors. Investigations of the consequences of the interaction between phorbol esters and EGF, however, have been limited to EGF-stimulated Na/H exchange in A431 cells (Whitely, B., D. Cassel, Y.-X. Zuang, and L. Glaser, 1984, J. Cell Biol., 99:1162-1166). In the present study, the effect of the phorbol ester 12-O-tetradecanoyl phorbol-13-acetate (TPA) on EGF-stimulated ion transport and DNA synthesis was determined in cultured vascular smooth muscle cells (A7r5). It was found that TPA stimulated Na/H exchange when added alone (half-maximal stimulatory concentration, 25 nM). However, when cells were pretreated with TPA and then challenged with EGF, TPA significantly inhibited EGF-stimulated Na/H exchange (78%; half-maximal inhibition [Ki] at 2.5 nM). Subsequently the effects of TPA on Na/K/Cl co-transport were measured. TPA was observed to inhibit Na/K/Cl co-transport (half-maximal inhibitory concentration, 50 nM) and also to inhibit EGF-stimulated Na/K/Cl co-transport (100%; Ki at 5 nM). Finally, the effects of TPA on DNA synthesis were assessed. TPA had a modest stimulatory effect on DNA synthesis (half-maximal stimulatory concentration, 6 nM), but had a significant inhibitory effect on EGF-stimulated DNA synthesis (56%; Ki at 5 nM). These findings suggest that the inhibitory effect of TPA on EGF-receptor functions goes beyond previously reported effects on Na/H exchange in A431 cells and extends to EGF-stimulation of Na/K/Cl co- transport and DNA synthesis in vascular smooth muscle cells. PMID:2410432
Randrianjatovo-Gbalou, Irina; Rosario, Sandrine; Sismeiro, Odile; Varet, Hugo; Legendre, Rachel; Coppée, Jean-Yves; Huteau, Valérie; Pochet, Sylvie; Delarue, Marc
2018-05-21
Nucleic acid aptamers, especially RNA, exhibit valuable advantages compared to protein therapeutics in terms of size, affinity and specificity. However, the synthesis of libraries of large random RNAs is still difficult and expensive. The engineering of polymerases able to directly generate these libraries has the potential to replace the chemical synthesis approach. Here, we start with a DNA polymerase that already displays a significant template-free nucleotidyltransferase activity, human DNA polymerase theta, and we mutate it based on the knowledge of its three-dimensional structure as well as previous mutational studies on members of the same polA family. One mutant exhibited a high tolerance towards ribonucleotides (NTPs) and displayed an efficient ribonucleotidyltransferase activity that resulted in the assembly of long RNA polymers. HPLC analysis and RNA sequencing of the products were used to quantify the incorporation of the four NTPs as a function of initial NTP concentrations and established the randomness of each generated nucleic acid sequence. The same mutant revealed a propensity to accept other modified nucleotides and to extend them in long fragments. Hence, this mutant can deliver random natural and modified RNA polymers libraries ready to use for SELEX, with custom lengths and balanced or unbalanced ratios.
Coordinating DNA polymerase traffic during high and low fidelity synthesis.
Sutton, Mark D
2010-05-01
With the discovery that organisms possess multiple DNA polymerases (Pols) displaying different fidelities, processivities, and activities came the realization that mechanisms must exist to manage the actions of these diverse enzymes to prevent gratuitous mutations. Although many of the Pols encoded by most organisms are largely accurate, and participate in DNA replication and DNA repair, a sizeable fraction display a reduced fidelity, and act to catalyze potentially error-prone translesion DNA synthesis (TLS) past lesions that persist in the DNA. Striking the proper balance between use of these different enzymes during DNA replication, DNA repair, and TLS is essential for ensuring accurate duplication of the cell's genome. This review highlights mechanisms that organisms utilize to manage the actions of their different Pols. A particular emphasis is placed on discussion of current models for how different Pols switch places with each other at the replication fork during high fidelity replication and potentially error-pone TLS. Copyright (c) 2010 Elsevier B.V. All rights reserved.
Nucleic Acid Engineering: RNA Following the Trail of DNA.
Kim, Hyejin; Park, Yongkuk; Kim, Jieun; Jeong, Jaepil; Han, Sangwoo; Lee, Jae Sung; Lee, Jong Bum
2016-02-08
The self-assembly feature of the naturally occurring biopolymer, DNA, has fascinated researchers in the fields of materials science and bioengineering. With the improved understanding of the chemical and structural nature of DNA, DNA-based constructs have been designed and fabricated from two-dimensional arbitrary shapes to reconfigurable three-dimensional nanodevices. Although DNA has been used successfully as a building block in a finely organized and controlled manner, its applications need to be explored. Hence, with the myriad of biological functions, RNA has recently attracted considerable attention to further the application of nucleic acid-based structures. This Review categorizes different approaches of engineering nucleic acid-based structures and introduces the concepts, principles, and applications of each technique, focusing on how DNA engineering is applied as a guide to RNA engineering.
Cdt2-mediated XPG degradation promotes gap-filling DNA synthesis in nucleotide excision repair
Han, Chunhua; Wani, Gulzar; Zhao, Ran; Qian, Jiang; Sharma, Nidhi; He, Jinshan; Zhu, Qianzheng; Wang, Qi-En; Wani, Altaf A
2015-01-01
Xeroderma pigmentosum group G (XPG) protein is a structure-specific repair endonuclease, which cleaves DNA strands on the 3′ side of the DNA damage during nucleotide excision repair (NER). XPG also plays a crucial role in initiating DNA repair synthesis through recruitment of PCNA to the repair sites. However, the fate of XPG protein subsequent to the excision of DNA damage has remained unresolved. Here, we show that XPG, following its action on bulky lesions resulting from exposures to UV irradiation and cisplatin, is subjected to proteasome-mediated proteolytic degradation. Productive NER processing is required for XPG degradation as both UV and cisplatin treatment-induced XPG degradation is compromised in NER-deficient XP-A, XP-B, XP-C, and XP-F cells. In addition, the NER-related XPG degradation requires Cdt2, a component of an E3 ubiquitin ligase, CRL4Cdt2. Micropore local UV irradiation and in situ Proximity Ligation assays demonstrated that Cdt2 is recruited to the UV-damage sites and interacts with XPG in the presence of PCNA. Importantly, Cdt2-mediated XPG degradation is crucial to the subsequent recruitment of DNA polymerase δ and DNA repair synthesis. Collectively, our data support the idea of PCNA recruitment to damage sites which occurs in conjunction with XPG, recognition of the PCNA-bound XPG by CRL4Cdt2 for specific ubiquitylation and finally the protein degradation. In essence, XPG elimination from DNA damage sites clears the chromatin space needed for the subsequent recruitment of DNA polymerase δ to the damage site and completion of gap-filling DNA synthesis during the final stage of NER. PMID:25483071
Pène, Jacques J.; Marmur, Julius
1967-01-01
The role of deoxyribonucleic acid (DNA) replication in the control of the synthesis of deoxycytidylate (dCMP) deaminase and lysozyme in Bacillus subtilis infected with bacteriophage 2C has been studied. These phage-induced enzymes are synthesized at different times during the latent period. It was shown by actinomycin inhibition that the formation of the late enzyme (lysozyme) required messenger ribonucleic acid (mRNA) synthesized de novo after the initiation of translation of mRNA which specifies the early function (dCMP deaminase). The inhibition of phage DNA synthesis by mitomycin C prevented the synthesis of lysozyme only when added before the onset of phage DNA replication, but it did not affect the synthesis or action of dCMP deaminase when added at any time during the latent period. Treatment of infected cells with mitomycin C after phage DNA synthesis had reached 8 to 10% of its maximal rate resulted in the production of normal amounts of lysozyme. These observations suggest that mRNA specifying early enzymes can be transcribed from parental (and probably also from progeny) DNA, whereas late functional messengers can be transcribed only after the formation of progeny DNA. PMID:4990039
Kautz, Armin R.; Weisshart, Klaus; Schneider, Annerose; Grosse, Frank; Nasheuer, Heinz-Peter
2001-01-01
Although p48 is the most conserved subunit of mammalian DNA polymerase α-primase (pol-prim), the polypeptide is the major species-specific factor for mouse polyomavirus (PyV) DNA replication. Human and murine p48 contain two regions (A and B) that show significantly lower homology than the rest of the protein. Chimerical human-murine p48 was prepared and coexpressed with three wild-type subunits of pol-prim, and four subunit protein complexes were purified. All enzyme complexes synthesized DNA on single-stranded (ss) DNA and replicated simian virus 40 DNA. Although the recombinant protein complexes physically interacted with PyV T antigen (Tag), we determined that the murine region A mediates the species specificity of PyV DNA replication in vitro. More precisely, the nonconserved phenylalanine 262 of mouse p48 is crucial for this activity, and pol-prim with mutant p48, h-S262F, supports PyV DNA replication in vitro. DNA synthesis on RPA-bound ssDNA revealed that amino acid (aa) 262, aa 266, and aa 273 to 288 are involved in the functional cooperation of RPA, pol-prim, and PyV Tag. PMID:11507202
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA
NASA Astrophysics Data System (ADS)
Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei
2013-08-01
The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K290K = 7.60 × 104 L mol-1 and K310K = 4.90 × 104 L mol-1. The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69 × 104 J mol-1, 35.36 J K-1 mol-1 and -2.79 × 104 J mol-1 at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA.
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Visualization of DNA and Protein-DNA Complexes with Atomic Force Microscopy
Lyubchenko, Yuri L.; Gall, Alexander A.; Shlyakhtenko, Luda S.
2014-01-01
This article describes sample preparation techniques for AFM imaging of DNA and protein–DNA complexes. The approach is based on chemical functionalization of the mica surface with aminopropyl silatrane (APS) to yield an APS-mica surface. This surface binds nucleic acids and nucleoprotein complexes in a wide range of ionic strengths, in the absence of divalent cations, and in a broad range of pH. The chapter describes the methodologies for the preparation of APS-mica surfaces and the preparation of samples for AFM imaging. The protocol for synthesis and purifi cation of APS is also provided. The AFM applications are illustrated with examples of images of DNA and protein–DNA complexes. PMID:24357372
The mitochondrial outer membrane protein MDI promotes local protein synthesis and mtDNA replication.
Zhang, Yi; Chen, Yong; Gucek, Marjan; Xu, Hong
2016-05-17
Early embryonic development features rapid nuclear DNA replication cycles, but lacks mtDNA replication. To meet the high-energy demands of embryogenesis, mature oocytes are furnished with vast amounts of mitochondria and mtDNA However, the cellular machinery driving massive mtDNA replication in ovaries remains unknown. Here, we describe a Drosophila AKAP protein, MDI that recruits a translation stimulator, La-related protein (Larp), to the mitochondrial outer membrane in ovaries. The MDI-Larp complex promotes the synthesis of a subset of nuclear-encoded mitochondrial proteins by cytosolic ribosomes on the mitochondrial surface. MDI-Larp's targets include mtDNA replication factors, mitochondrial ribosomal proteins, and electron-transport chain subunits. Lack of MDI abolishes mtDNA replication in ovaries, which leads to mtDNA deficiency in mature eggs. Targeting Larp to the mitochondrial outer membrane independently of MDI restores local protein synthesis and rescues the phenotypes of mdi mutant flies. Our work suggests that a selective translational boost by the MDI-Larp complex on the outer mitochondrial membrane might be essential for mtDNA replication and mitochondrial biogenesis during oogenesis. Published 2016. This article is a U.S. Government work and is in the public domain in the USA.
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Kurat, Christoph F; Yeeles, Joseph T P; Patel, Harshil; Early, Anne; Diffley, John F X
2017-01-05
The integrity of eukaryotic genomes requires rapid and regulated chromatin replication. How this is accomplished is still poorly understood. Using purified yeast replication proteins and fully chromatinized templates, we have reconstituted this process in vitro. We show that chromatin enforces DNA replication origin specificity by preventing non-specific MCM helicase loading. Helicase activation occurs efficiently in the context of chromatin, but subsequent replisome progression requires the histone chaperone FACT (facilitates chromatin transcription). The FACT-associated Nhp6 protein, the nucleosome remodelers INO80 or ISW1A, and the lysine acetyltransferases Gcn5 and Esa1 each contribute separately to maximum DNA synthesis rates. Chromatin promotes the regular priming of lagging-strand DNA synthesis by facilitating DNA polymerase α function at replication forks. Finally, nucleosomes disrupted during replication are efficiently re-assembled into regular arrays on nascent DNA. Our work defines the minimum requirements for chromatin replication in vitro and shows how multiple chromatin factors might modulate replication fork rates in vivo. Copyright © 2017 The Authors. Published by Elsevier Inc. All rights reserved.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Min, Jaewon; Wright, Woodring E.
2017-01-01
ABSTRACT Alternative lengthening of telomeres (ALT) is a telomerase-independent telomere maintenance mechanism that occurs in a subset of cancers. By analyzing telomerase-positive cells and their human TERC knockout-derived ALT human cell lines, we show that ALT cells harbor more fragile telomeres representing telomere replication problems. ALT-associated replication defects trigger mitotic DNA synthesis (MiDAS) at telomeres in a RAD52-dependent, but RAD51-independent, manner. Telomeric MiDAS is a conservative DNA synthesis process, potentially mediated by break-induced replication, similar to type II ALT survivors in Saccharomyces cerevisiae. Replication stresses induced by ectopic oncogenic expression of cyclin E, G-quadruplexes, or R-loop formation facilitate the ALT pathway and lead to telomere clustering, a hallmark of ALT cancers. The TIMELESS/TIPIN complex suppresses telomere clustering and telomeric MiDAS, whereas the SMC5/6 complex promotes them. In summary, ALT cells exhibit more telomere replication defects that result in persistent DNA damage responses at telomeres, leading to the engagement of telomeric MiDAS (spontaneous mitotic telomere synthesis) that is triggered by DNA replication stress, a potential driver of genomic duplications in cancer. PMID:28760773
Hormann, Jan; Malina, Jaroslav; Lemke, Oliver; Hülsey, Max J; Wedepohl, Stefanie; Potthoff, Jan; Schmidt, Claudia; Ott, Ingo; Keller, Bettina G; Brabec, Viktor; Kulak, Nora
2018-05-07
Many drugs that are applied in anticancer therapy such as the anthracycline doxorubicin contain DNA-intercalating 9,10-anthraquinone (AQ) moieties. When Cu(II) cyclen complexes were functionalized with up to three (2-anthraquinonyl)methyl substituents, they efficiently inhibited DNA and RNA synthesis resulting in high cytotoxicity (selective for cancer cells) accompanied by DNA condensation/aggregation phenomena. Molecular modeling suggests an unusual bisintercalation mode with only one base pair between the two AQ moieties and the metal complex as a linker. A regioisomer, in which the AQ moieties point in directions unfavorable for such an interaction, had a much weaker biological activity. The ligands alone and corresponding Zn(II) complexes (used as redox inert control compounds) also exhibited lower activity.
Rapid synthesis of DNA-cysteine conjugates for expressed protein ligation
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lovrinovic, Marina; Niemeyer, Christof M.
2005-09-30
We report a rapid method for the covalent modification of commercially available amino-modified DNA oligonucleotides with a cysteine moiety. The resulting DNA-cysteine conjugates are versatile reagents for the efficient preparation of covalent DNA-protein conjugates by means of expressed protein ligation (EPL). The EPL method allows for the site-specific coupling of cysteine-modified DNA oligomers with recombinant intein-fusion proteins, the latter of which contain a C-terminal thioester enabling the mild and highly specific reaction with N-terminal cysteine compounds. We prepared a cysteine-modifier reagent in a single-step reaction which allows for the rapid and near quantitative synthesis of cysteine-DNA conjugates. The latter weremore » ligated with the green fluorescent protein mutant EYFP, recombinantly expressed as an intein-fusion protein, allowing for the mild and selective formation of EYFP-DNA conjugates in high yields of about 60%. We anticipate many applications of our approach, ranging from protein microarrays to the arising field of nanobiotechnology.« less
Molecular spectroscopic studies on the interaction of ferulic acid with calf thymus DNA.
Zhang, Shufang; Sun, Xuejun; Qu, Fengli; Kong, Rongmei
2013-08-01
The interaction between ferulic acid and calf thymus deoxyribonucleic acid (ctDNA) under physiological conditions (Tris-HCl buffer solutions, pH 7.4) was investigated by UV-Vis spectroscopy, fluorescence spectroscopy, DNA melting techniques, and viscosity measurements. Results indicated that a complex of ferulic acid with ctDNA was formed with a binding constant of K(290K)=7.60×10(4) L mol(-1) and K(310K)=4.90×10(4) L mol(-1). The thermodynamic parameters enthalpy change (ΔH°), entropy change (ΔS°) and Gibbs free energy (ΔG°) were calculated to be -1.69×10(4) J mol(-1), 35.36 J K(-1) mol(-1) and -2.79×10(4) J mol(-1) at 310 K, respectively. The acting forces between ferulic acid and DNA mainly included hydrophobic interaction and hydrogen bonds. Acridine orange displacement studies revealed that ferulic acid can substitute for AO probe in the AO-DNA complex which was indicative of intercalation binding. Thermal denaturation study suggested that the interaction of ferulic acid with DNA could result in the increase of the denaturation temperature, which indicated that the stabilization of the DNA helix was increased in the presence of ferulic acid. Spectroscopic techniques together with melting techniques and viscosity determination provided evidences of intercalation mode of binding for the interaction between ferulic acid and ctDNA. Copyright © 2013 Elsevier B.V. All rights reserved.
Vasopressin stimulates DNA synthesis and ion transport in quiescent epithelial cells.
Reznik, V M; Shapiro, R J; Mendoza, S A
1985-09-01
The mitogenic effect of vasopressin was studied in subconfluent quiescent renal epithelial cells (MDCK). Vasopressin stimulated DNA synthesis in the presence of low concentrations of serum. Vasopressin increased the entry of Na into the cells and increased ouabain-sensitive 86Rb uptake, a measure of Na-K pump activity. Because the activity of the Na-K pump in MDCK cells is steeply dependent on intracellular Na, it is likely that stimulation of the Na-K pump by vasopressin was mediated by the increase in Na entry into the cells. Thus both serum and vasopressin stimulate Na uptake and Na-K pump activity in quiescent MDCK cells with a subsequent increase in DNA synthesis. It is concluded that growth regulation in epithelial cells may be mediated in part by changes in monovalent ion transport.
NASA Astrophysics Data System (ADS)
Hosny, Nasser Mohammed; Hussien, Mostafa A.; Radwan, Fatima M.; Nawar, Nagwa
2014-11-01
Four new metal complexes derived from the reaction of Cu(II), Co(II), Ni(II) and Zn(II) acetates with the Schiff-base ligand (H3L) resulted from the condensation of the amino acid 2-amino-3-hydroxyprobanoic acid (serine) and acetylacetone have been synthesized and characterized by, elemental analyses, ES-MS, IR, UV-Vis., 1H NMR, 13C NMR, ESR, thermal analyses (TGA and DTG) and magnetic measurements. The results showed that the Schiff-base ligand acts as bi-negative tridentate through the azomethine nitrogen, the deprotonated carboxylate oxygen and the enolic carbonyl oxygen. The optical band gaps measurements indicated the semi-conducting nature of these complexes. Molecular docking was used to predict the binding between the Schiff base ligand with the receptor of prostate cancer mutant H874Y. The interactions between the Cu(II) complex and calf thymus DNA (CT-DNA) have been studied by UV spectra. The results confirm that the Cu(II) complex binds to CT-DNA in an intercalative mode.
MacAlpine, D M; Perlman, P S; Butow, R A
2000-02-15
Mitochondrial DNA (mtDNA) is inherited as a protein-DNA complex (the nucleoid). We show that activation of the general amino acid response pathway in rho(+) and rho(-) petite cells results in an increased number of nucleoids without an increase in mtDNA copy number. In rho(-) cells, activation of the general amino acid response pathway results in increased intramolecular recombination between tandemly repeated sequences of rho(-) mtDNA to produce small, circular oligomers that are packaged into individual nucleoids, resulting in an approximately 10-fold increase in nucleoid number. The parsing of mtDNA into nucleoids due to general amino acid control requires Ilv5p, a mitochondrial protein that also functions in branched chain amino acid biosynthesis, and one or more factors required for mtDNA recombination. Two additional proteins known to function in mtDNA recombination, Abf2p and Mgt1p, are also required for parsing mtDNA into a larger number of nucleoids, although expression of these proteins is not under general amino acid control. Increased nucleoid number leads to increased mtDNA transmission, suggesting a mechanism to enhance mtDNA inheritance under amino acid starvation conditions.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Label-Free Potentiometry for Detecting DNA Hybridization Using Peptide Nucleic Acid and DNA Probes
Goda, Tatsuro; Singi, Ankit Balram; Maeda, Yasuhiro; Matsumoto, Akira; Torimura, Masaki; Aoki, Hiroshi; Miyahara, Yuji
2013-01-01
Peptide nucleic acid (PNA) has outstanding affinity over DNA for complementary nucleic acid sequences by forming a PNA-DNA heterodimer upon hybridization via Watson-Crick base-pairing. To verify whether PNA probes on an electrode surface enhance sensitivity for potentiometric DNA detection or not, we conducted a comparative study on the hybridization of PNA and DNA probes on the surface of a 10-channel gold electrodes microarray. Changes in the charge density as a result of hybridization at the solution/electrode interface on the self-assembled monolayer (SAM)-formed microelectrodes were directly transformed into potentiometric signals using a high input impedance electrometer. The charge readout allows label-free, reagent-less, and multi-parallel detection of target oligonucleotides without any optical assistance. The differences in the probe lengths between 15- to 22-mer dramatically influenced on the sensitivity of the PNA and DNA sensors. Molecular type of the capturing probe did not affect the degree of potential shift. Theoretical model for charged rod-like duplex using the Gouy-Chapman equation indicates the dominant effect of electrostatic attractive forces between anionic DNA and underlying electrode at the electrolyte/electrode interface in the potentiometry. PMID:23435052
Scanlon, K J; Jiao, L; Funato, T; Wang, W; Tone, T; Rossi, J J; Kashani-Sabet, M
1991-01-01
The c-fos gene product Fos has been implicated in many cellular processes, including signal transduction, DNA synthesis, and resistance to antineoplastic agents. A fos ribozyme (catalytic RNA) was designed to evaluate the effects of suppressing Fos protein synthesis on expression of enzymes involved in DNA synthesis, DNA repair, and drug resistance. DNA encoding the fos ribozyme (fosRb) was cloned into the pMAMneo expression plasmid, and the resultant vector was transfected into A2780DDP cells resistant to the chemotherapeutic agent cisplatin. The parental drug-sensitive A2780S cells were transfected with the pMMV vector containing the c-fos gene. Morphological alterations were accompanied by significant changes in pharmacological sensitivity in both c-fos- and fosRb-transfected cells. pMAMneo fosRb transfectants revealed decreased c-fos gene expression, concomitant with reduced thymidylate (dTMP) synthase, DNA polymerase beta, topoisomerase I, and metallothionein IIA mRNAs. In contrast, c-myc expression was elevated after fos ribozyme action. Insertion of a mutant ribozyme, mainly capable of antisense activity, into A2780DDP cells resulted in smaller reductions in c-fos gene expression and in cisplatin resistance than the active ribozyme. These studies establish a role for c-fos in drug resistance and in mediating DNA synthesis and repair processes by modulating expression of genes such as dTMP synthase, DNA polymerase beta, and topoisomerase I. These studies also suggest the utility of ribozymes in the analysis of cellular gene expression. Images PMID:1660142
Metz, James G.; Pollard, Michael R.; Anderson, Lana; Hayes, Thomas R.; Lassner, Michael W.
2000-01-01
The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes. PMID:10712526
Metz, J G; Pollard, M R; Anderson, L; Hayes, T R; Lassner, M W
2000-03-01
The jojoba (Simmondsia chinensis) plant produces esters of long-chain alcohols and fatty acids (waxes) as a seed lipid energy reserve. This is in contrast to the triglycerides found in seeds of other plants. We purified an alcohol-forming fatty acyl-coenzyme A reductase (FAR) from developing embryos and cloned the cDNA encoding the enzyme. Expression of a cDNA in Escherichia coli confers FAR activity upon those cells and results in the accumulation of fatty alcohols. The FAR sequence shows significant homology to an Arabidopsis protein of unknown function that is essential for pollen development. When the jojoba FAR cDNA is expressed in embryos of Brassica napus, long-chain alcohols can be detected in transmethylated seed oils. Resynthesis of the gene to reduce its A plus T content resulted in increased levels of alcohol production. In addition to free alcohols, novel wax esters were detected in the transgenic seed oils. In vitro assays revealed that B. napus embryos have an endogenous fatty acyl-coenzyme A: fatty alcohol acyl-transferase activity that could account for this wax synthesis. Thus, introduction of a single cDNA into B. napus results in a redirection of a portion of seed oil synthesis from triglycerides to waxes.
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Synthesis of dicationic diaryltriazines nucleic acid binding agents
Spychala, J; Wilson, WD; Zhao, M; Tidwell, RR; Dykstra, CC; Hall, JE; Jones, SK; Schinazi, RF
2010-01-01
Summary — The synthesis of 2,4-bis[4-(4,5-dihydro-1H-imidazol-2-yl)phenyl]-1,3,5-triazine 6a and 2,4-bis[4-(1,4,5,6-tetrahydropyrimidin-2-yl)phenyl]-1,3,5-triazine 6b in 3 steps from either 4-bromobenzamidine or 4-(carbamoyl)benzamidine is reported. The synthesis of 4,6-bis[4-(4,5-dihydro-1H-imidazol-2-yl)phenyl]-2-dimethylamino-1,3,5-triazine 9a and 4,6-bis[4-(1,4,5,6-tetrahydropyrimidin-2-yl)phenyl]-2-dimethylamino-1,3,5-triazine 9b in 2 steps from 1,4-dicyanobenzene is also described. The compounds 6b and 9b bind strongly to DNA model sequences and inhibit topoisomerase II from 2 microbial sources. Compounds 6a and 9a bind to both DNA and RNA model sequences whereas 6b and 9b essentially do not bind to the RNA model. PMID:21556310
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Antipova, Valeriya N; Zheleznaya, Lyudmila A; Zyrina, Nadezhda V
2014-08-01
In the absence of added DNA, thermophilic DNA polymerases synthesize double-stranded DNA from free dNTPs, which consist of numerous repetitive units (ab initio DNA synthesis). The addition of thermophilic restriction endonuclease (REase), or nicking endonuclease (NEase), effectively stimulates ab initio DNA synthesis and determines the nucleotide sequence of reaction products. We have found that NEases Nt.AlwI, Nb.BbvCI, and Nb.BsmI with non-palindromic recognition sites stimulate the synthesis of sequences organized mainly as palindromes. Moreover, the nucleotide sequence of the palindromes appeared to be dependent on NEase recognition/cleavage modes. Thus, the heterodimeric Nb.BbvCI stimulated the synthesis of palindromes composed of two recognition sites of this NEase, which were separated by AT-reach sequences or (A)n (T)m spacers. Palindromic DNA sequences obtained in the ab initio DNA synthesis with the monomeric NEases Nb.BsmI and Nt.AlwI contained, along with the sites of these NEases, randomly synthesized sequences consisted of blocks of short repeats. These findings could help investigation of the potential abilities of highly productive ab initio DNA synthesis for the creation of DNA molecules with desirable sequence. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian
2015-01-01
SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kodadek, T.; Gamper, H.
The authors report a simple method for the in vitro synthesis of large quantities of site specifically modified DNA. The protocol involves extension of an oligonucleotide primer annealed to M13 single-stranded DNA using part of the T4 DNA polymerase holoenzyme. The resulting nicked double-stranded circles are ligated and supercoiled in the same tube, producing good yields of form I DNA. When the oligonucleotide primer is chemically modified, the resultant product contains a site-specific lesion. In this study, they report the synthesis of an M13 mp19 form I DNA which contains a psoralen monoadduct or cross-link at the KpnI site. Theymore » demonstrate the utility of these modified substrates by assessing the ability of the bacteriophage T4 DNA replication complex to bypass the damage and show that the psoralen monoadduct poses a severe block to the holoenzyme when attached to the template strand.« less
Database of amino acid-nucleotide contacts in contacts in DNA-homeodomain protein
NASA Astrophysics Data System (ADS)
Grokhlina, T. I.; Zrelov, P. V.; Ivanov, V. V.; Polozov, R. V.; Chirgadze, Yu. N.; Sivozhelezov, V. S.
2013-09-01
The analysis of amino acid-nucleotide contacts in interfaces of the protein-DNA complexes, intended to find consistencies in the protein-DNA recognition, is a complex problem that requires an analysis of the physicochemical characteristics of these contacts and the positions of the participating amino acids and nucleotides in the chains of the protein and the DNA, respectively, as well as conservatism of these contacts. Thus, those heterogeneous data should be systematized. For this purpose we have developed a database of amino acid-nucleotide contacts ANTPC (Amino acid Nucleotide Type Position Conservation) following the archetypal example of the proteins in the homeodomain family. We show that it can be used to compare and classify the interfaces of the protein-DNA complexes.
Bai, Yalong; Cui, Yan; Paoli, George C; Shi, Chunlei; Wang, Dapeng; Zhou, Min; Zhang, Lida; Shi, Xianming
2016-09-01
Magnetic separation has great advantages over traditional bio-separation methods and has become popular in the development of methods for the detection of bacterial pathogens, viruses, and transgenic crops. Functionalization of magnetic nanoparticles is a key factor for efficient capture of the target analytes. In this paper, we report the synthesis of amino-rich silica-coated magnetic nanoparticles using a one-pot method. This type of magnetic nanoparticle has a rough surface and a higher density of amino groups than the nanoparticles prepared by a post-modification method. Furthermore, the results of hydrochloric acid treatment indicated that the magnetic nanoparticles were stably coated. The developed amino-rich silica-coated magnetic nanoparticles were used to directly adsorb DNA. After magnetic separation and blocking, the magnetic nanoparticles and DNA complexes were used directly for the polymerase chain reaction (PCR), without onerous and time-consuming purification and elution steps. The results of real-time quantitative PCR showed that the nanoparticles with higher amino group density resulted in improved DNA capture efficiency. The results suggest that amino-rich silica-coated magnetic nanoparticles are of great potential for efficient bio-separation of DNA prior to detection by PCR. Copyright © 2016. Published by Elsevier B.V.
Kuhl, S J; Brown, L R
1980-01-01
Ribonucleic acid (RNA) synthesis was examined in cold-shocked Bacillus subtilis cells. The cells were grown to mid-log stage, harvested, and cold shocked. RNA synthesis was monitored by the incorporation of [3H]uridine triphosphate or [alpha 32P]adenosine triphosphate into trichloroacetic acid-precipitable material in the presence of all four nucleoside triphosphates. The inhibition of RNA synthesis in cold-shocked cells by lipiarmycin, ethidium bromide, rifampin. or streptolydigin was analyzed using mutant or wild-type cells. Also examined were the effects of temperature, salt concentration, and the addition of polyamines or highly phosphorylated nucleotides. In ultraviolet-irradiated and cold-shocked cells, RNA wynthesis decreased to low levels. The addition of exogenous phi 29 or TSP-1 template to these cells caused a 13- to 20-fold increase in RNA synthesis, as monitored by trichloroacetic acid-precipitable counts. RNA synthesized in the presence of phi 29 deoxyribonucleic acid (DNA) hybridizes mainly to EcoRI fragments A and C of phi 29 DBA, These two fragments direct transcription by purified RNA polymerase in vitro and hybridize to early phi 29 DNA produced in vivo. Our results with TSP-1 DNA in this system indicated that the RNA produced hybridizes to the same fragments as early RNA produced in vivo. Plasmic pUB110 DNA was not transcribed in this system. Images PMID:6157674
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Pyrrole-Imidazole Polyamides: Manual Solid-Phase Synthesis.
Pauff, Steven M; Fallows, Andrew J; Mackay, Simon P; Su, Wu; Cullis, Paul M; Burley, Glenn A
2015-12-01
Pyrrole-imidazole polyamides (PAs) are a family of DNA-binding peptides that bind in the minor groove of double-stranded DNA (dsDNA) in a sequence-selective, programmable fashion. This protocol describes a detailed manual procedure for the solid-phase synthesis of this family of compounds. The protocol entails solution-phase synthesis of the Boc-protected pyrrole (Py) and imidazole (Im) carboxylic acid building blocks. This unit also describes the importance of choosing the appropriate condensing agent to form the amide linkages between each building block. Finally, a monomeric coupling protocol and a fragment-based approach are described that delivers PAs in 13% to 30% yield in 8 days. Copyright © 2015 John Wiley & Sons, Inc.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
DNA attachment to support structures
Balhorn, Rodney L.; Barry, Christopher H.
2002-01-01
Microscopic beads or other structures are attached to nucleic acids (DNA) using a terminal transferase. The transferase adds labeled dideoxy nucleotide bases to the ends of linear strands of DNA. The labels, such as the antigens digoxigenin and biotin, bind to the antibody compounds or other appropriate complementary ligands, which are bound to the microscopic beads or other support structures. The method does not require the synthesis of a synthetic oligonucleotide probe. The method can be used to tag or label DNA even when the DNA has an unknown sequence, has blunt ends, or is a very large fragment (e.g., >500 kilobase pairs).
FANCJ promotes DNA synthesis through G-quadruplex structures
Castillo Bosch, Pau; Segura-Bayona, Sandra; Koole, Wouter; van Heteren, Jane T; Dewar, James M; Tijsterman, Marcel; Knipscheer, Puck
2014-01-01
Our genome contains many G-rich sequences, which have the propensity to fold into stable secondary DNA structures called G4 or G-quadruplex structures. These structures have been implicated in cellular processes such as gene regulation and telomere maintenance. However, G4 sequences are prone to mutations particularly upon replication stress or in the absence of specific helicases. To investigate how G-quadruplex structures are resolved during DNA replication, we developed a model system using ssDNA templates and Xenopus egg extracts that recapitulates eukaryotic G4 replication. Here, we show that G-quadruplex structures form a barrier for DNA replication. Nascent strand synthesis is blocked at one or two nucleotides from the G4. After transient stalling, G-quadruplexes are efficiently unwound and replicated. In contrast, depletion of the FANCJ/BRIP1 helicase causes persistent replication stalling at G-quadruplex structures, demonstrating a vital role for this helicase in resolving these structures. FANCJ performs this function independently of the classical Fanconi anemia pathway. These data provide evidence that the G4 sequence instability in FANCJ−/− cells and Fancj/dog1 deficient C. elegans is caused by replication stalling at G-quadruplexes. PMID:25193968
Ong, Hui San; Rahim, Mohd Syafiq; Firdaus-Raih, Mohd; Ramlan, Effirul Ikhwan
2015-01-01
The unique programmability of nucleic acids offers alternative in constructing excitable and functional nanostructures. This work introduces an autonomous protocol to construct DNA Tetris shapes (L-Shape, B-Shape, T-Shape and I-Shape) using modular DNA blocks. The protocol exploits the rich number of sequence combinations available from the nucleic acid alphabets, thus allowing for diversity to be applied in designing various DNA nanostructures. Instead of a deterministic set of sequences corresponding to a particular design, the protocol promotes a large pool of DNA shapes that can assemble to conform to any desired structures. By utilising evolutionary programming in the design stage, DNA blocks are subjected to processes such as sequence insertion, deletion and base shifting in order to enrich the diversity of the resulting shapes based on a set of cascading filters. The optimisation algorithm allows mutation to be exerted indefinitely on the candidate sequences until these sequences complied with all the four fitness criteria. Generated candidates from the protocol are in agreement with the filter cascades and thermodynamic simulation. Further validation using gel electrophoresis indicated the formation of the designed shapes. Thus, supporting the plausibility of constructing DNA nanostructures in a more hierarchical, modular, and interchangeable manner.
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Alteration in the contents of unsaturated fatty acids in dnaA mutants of Escherichia coli.
Suzuki, E; Kondo, T; Makise, M; Mima, S; Sakamoto, K; Tsuchiya, T; Mizushima, T
1998-04-01
DnaA protein, the initiator of chromosomal DNA replication in Escherichia coli, has a high affinity for acidic phospholipids containing unsaturated fatty acids. We have examined here the fatty acid composition of phospholipids in dnaA mutants. A temperature-sensitive dnaA46 mutant showed a lower level of unsaturation of fatty acids (ratio of unsaturated to saturated fatty acids) at 42 degrees C (non-permissive temperature) and at 37 degrees C (semi-permissive temperature), but not at 28 degrees C (permissive temperature), compared with the wild-type strain. Plasmid complementation analysis revealed that the dnaA46 mutation is responsible for the phenotype. Other temperature-sensitive dnaA mutants showed similar results. On the other hand, a cold-sensitive dnaAcos mutant, in which over-initiation of DNA replication occurs at low temperature (28 degrees C), showed a higher level of unsaturation of fatty acids at 28 degrees C. Based on these observations, we discuss the role of phospholipids in the regulation of the activity of DnaA protein.
Liao, Hongwei; Ji, Fang; Geng, Xinwei; Xing, Meichun; Li, Wen; Chen, Zhihua; Shen, Huahao; Ying, Songmin
2017-01-01
Cyclin dependent kinase 1 (CDK1) is essential for cell viability and plays a vital role in many biological events including cell cycle control, DNA damage repair, and checkpoint activation. Here, we identify an unanticipated role for CDK1 in promoting nascent DNA synthesis during S-phase. We report that a short duration of CDK1 inhibition, which does not perturb cell cycle progression, triggers a replication-associated DNA damage response (DDR). This DDR is associated with a disruption of replication fork progression and leads to genome instability. Moreover, we show that compromised CDK1 activity dramatically increases the efficacy of chemotherapeutic agents that kill cancer cells through perturbing DNA replication, including Olaparib, an FDA approved PARP inhibitor. Our study has revealed an important role for CDK1 in the DNA replication program, and suggests that the therapeutic targeting CDK1 may be a novel approach for combination chemotherapy. PMID:29207595
Cloning and expression of cDNA coding for bouganin.
den Hartog, Marcel T; Lubelli, Chiara; Boon, Louis; Heerkens, Sijmie; Ortiz Buijsse, Antonio P; de Boer, Mark; Stirpe, Fiorenzo
2002-03-01
Bouganin is a ribosome-inactivating protein that recently was isolated from Bougainvillea spectabilis Willd. In this work, the cloning and expression of the cDNA encoding for bouganin is described. From the cDNA, the amino-acid sequence was deduced, which correlated with the primary sequence data obtained by amino-acid sequencing on the native protein. Bouganin is synthesized as a pro-peptide consisting of 305 amino acids, the first 26 of which act as a leader signal while the 29 C-terminal amino acids are cleaved during processing of the molecule. The mature protein consists of 250 amino acids. Using the cDNA sequence encoding the mature protein of 250 amino acids, a recombinant protein was expressed, purified and characterized. The recombinant molecule had similar activity in a cell-free protein synthesis assay and had comparable toxicity on living cells as compared to the isolated native bouganin.
Anderson, Donald D; Woeller, Collynn F; Chiang, En-Pei; Shane, Barry; Stover, Patrick J
2012-03-02
The de novo thymidylate biosynthetic pathway in mammalian cells translocates to the nucleus for DNA replication and repair and consists of the enzymes serine hydroxymethyltransferase 1 and 2α (SHMT1 and SHMT2α), thymidylate synthase, and dihydrofolate reductase. In this study, we demonstrate that this pathway forms a multienzyme complex that is associated with the nuclear lamina. SHMT1 or SHMT2α is required for co-localization of dihydrofolate reductase, SHMT, and thymidylate synthase to the nuclear lamina, indicating that SHMT serves as scaffold protein that is essential for complex formation. The metabolic complex is enriched at sites of DNA replication initiation and associated with proliferating cell nuclear antigen and other components of the DNA replication machinery. These data provide a mechanism for previous studies demonstrating that SHMT expression is rate-limiting for de novo thymidylate synthesis and indicate that de novo thymidylate biosynthesis occurs at replication forks.
Spherical Nucleic Acids: A New Form of DNA
NASA Astrophysics Data System (ADS)
Cutler, Joshua Isaac
Spherical Nucleic Acids (SNAs) are a new class of nucleic acid-based nanomaterials that exhibit unique properties currently being explored in the contexts of gene-based cancer therapies and in the design of programmable nanoparticle-based materials. The properties of SNAs differ from canonical, linear nucleic acids by virtue of their dense packing into an oriented 3-dimensional array. SNAs can be synthesized from a number of useful nanoparticle templates, such as plasmonic gold and silver, magnetic oxides, luminescent semi-conductor quantum dots, and silica. In addition, by crosslinking the oligonucleotides and dissolving the core, they can be made in a hollow form as well. This dissertation describes the evolution of SNAs from initial studies of inorganic nanoparticle-based materials densely functionalized with oligonucleotides to the proving of a hypothesis that their unique properties can be observed in a core-less structure if the nucleic acids are densely packed and highly oriented. Chapter two describes the synthesis of densely functionalized polyvalent oligonucleotide superparamagnetic iron oxide nanoparticles using the copper-catalyzed azide-alkyne cycloaddition reaction. These particles are shown to exhibit cooperative binding in a density- and salt concentration-dependent fashion, with nearly identical behaviors to those of SNA-functionalized gold nanoparticles. Importantly, these particles are the first non-gold particles shown to be capable of entering cells in high numbers via the SNA-mediated cellular uptake pathway, and provided the first evidence that SNA-mediated cellular uptake is core-independent. In the third chapter, a gold nanoparticle catalyzed alkyne cross-linking reaction is described that is capable of forming hollow organic nanoparticles using polymers with alkyne-functionalized backbones. With this method, the alkyne-modified polymers adsorb to the particle surfaces, cross-link on the surface, allowing the gold nanoparticle to be
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.
T Banaszak1 A; LaJeunesse; Trench
2000-06-28
We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.
Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen
2012-01-01
During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
DNA adsorption to and elution from silica surfaces: influence of amino acid buffers.
Vandeventer, Peter E; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S; Niemz, Angelika
2013-09-19
Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction.
DNA Adsorption to and Elution from Silica Surfaces: Influence of Amino Acid Buffers
Vandeventer, Peter E.; Mejia, Jorge; Nadim, Ali; Johal, Malkiat S.; Niemz, Angelika
2014-01-01
Solid phase extraction and purification of DNA from complex samples typically requires chaotropic salts that can inhibit downstream polymerase amplification if carried into the elution buffer. Amino acid buffers may serve as a more compatible alternative for modulating the interaction between DNA and silica surfaces. We characterized DNA binding to silica surfaces, facilitated by representative amino acid buffers, and the subsequent elution of DNA from the silica surfaces. Through bulk depletion experiments, we found that more DNA adsorbs to silica particles out of positively compared to negatively charged amino acid buffers. Additionally, the type of the silica surface greatly influences the amount of DNA adsorbed, and the final elution yield. Quartz crystal microbalance experiments with dissipation monitoring (QCM-D) revealed multiphasic DNA adsorption out of stronger adsorbing conditions such as arginine, glycine, and glutamine, with DNA more rigidly bound during the early stages of the adsorption process. The DNA film adsorbed out of glutamate was more flexible and uniform throughout the adsorption process. QCM-D characterization of DNA elution from the silica surface indicates an uptake in water mass during the initial stage of DNA elution for the stronger adsorbing conditions, which suggests that for these conditions the DNA film is partly dehydrated during the prior adsorption process. Overall, several positively charged and polar neutral amino acid buffers show promise as an alternative to methods based on chaotropic salts for solid phase DNA extraction. PMID:23931415
Schütt, Burkhardt Siegfried; Abbadi, Amine; Loddenkötter, Brigitte; Brummel, Monika; Spener, Friedrich
2002-09-01
With the aim of elucidating the mechanisms involved in the biosynthesis of medium-chain fatty acids in Cuphea lanceolata Ait., a crop accumulating up to 90% decanoic acid in seed triacylglycerols, cDNA clones of a beta-ketoacyl-acyl carrier protein (ACP) synthase IV (clKAS IV, EC 2.3.1.41) were isolated from C. lanceolata seed embryos. The amino acid sequence deduced from clKAS IV cDNA showed 80% identity to other plant KAS II-type enzymes, 55% identity towards plant KAS I and over 90% towards other Cuphea KAS IV-type sequences. Recombinant clKAS IV was functionally overexpressed in Escherichia coli, and substrate specificity of purified enzyme showed strong preference for elongation of short-chain and medium-chain acyl-ACPs (C4- to C10-ACP) with nearly equal activity. Further elongation steps were catalysed with distinctly less activity. Moreover, short- and medium-chain acyl-ACPs exerted a chain-length-specific and concentration-dependent substrate inhibition of clKAS IV. Based on these findings a regulatory mechanism for medium-chain fatty acid synthesis in C. lanceolata is presented.
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Synthesis and DNA cleavage activity of Bis-3-chloropiperidines as alkylating agents.
Zuravka, Ivonne; Roesmann, Rolf; Sosic, Alice; Wende, Wolfgang; Pingoud, Alfred; Gatto, Barbara; Göttlich, Richard
2014-09-01
Nitrogen mustards are an important class of bifunctional alkylating agents routinely used in chemotherapy. They react with DNA as electrophiles through the formation of highly reactive aziridinium ion intermediates. The antibiotic 593A, with potential antitumor activity, can be considered a naturally occurring piperidine mustard containing a unique 3-chloropiperidine ring. However, the total synthesis of this antibiotic proved to be rather challenging. With the aim of designing simplified analogues of this natural product, we developed an efficient bidirectional synthetic route to bis-3-chloropiperidines joined by flexible, conformationally restricted, or rigid diamine linkers. The key step involves an iodide-catalyzed double cyclization of unsaturated bis-N-chloroamines to simultaneously generate both piperidine rings. Herein we describe the synthesis and subsequent evaluation of a series of novel nitrogen-bridged bis-3-chloropiperidines, enabling the study of the impact of the linker structure on DNA alkylation properties. Our studies reveal that the synthesized compounds possess DNA alkylating abilities and induce strand cleavage, with a strong preference for guanine residues. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Multiple two-polymerase mechanisms in mammalian translesion DNA synthesis.
Livneh, Zvi; Ziv, Omer; Shachar, Sigal
2010-02-15
The encounter of replication forks with DNA lesions may lead to fork arrest and/or the formation of single-stranded gaps. A major strategy to cope with these replication irregularities is translesion DNA synthesis (TLS), in which specialized error-prone DNA polymerases bypass the blocking lesions. Recent studies suggest that TLS across a particular DNA lesion may involve as many as four different TLS polymerases, acting in two-polymerase reactions in which insertion by a particular polymerase is followed by extension by another polymerase. Insertion determines the accuracy and mutagenic specificity of the TLS reaction, and is carried out by one of several polymerases such as poleta, polkappa or poliota. In contrast, extension is carried out primarily by polzeta. In cells from XPV patients, which are deficient in TLS across cyclobutane pyrimidine dimers (CPD) due to a deficiency in poleta, TLS is carried out by at least two backup reactions each involving two polymerases: One reaction involves polkappa and polzeta, and the other poliota and polzeta. These mechanisms may also assist poleta in normal cells under an excessive amount of UV lesions.
H3-THYMIDINE DERIVATIVE POOLS IN RELATION TO MACRONUCLEAR DNA SYNTHESIS IN TETRAHYMENA PYRIFORMIS
Stone, G. E.; Miller, O. L.; Prescott, D. M.
1965-01-01
The formation of a soluble H3-thymidine derivative pool has been examined in Tetrahymena pyriformis as a function of macronuclear DNA synthesis during the cell life cycle. An autoradiographic technique which allows the detection of water-soluble materials within a cell has shown that these cells do not take up and retain exogenous H3-thymidine during G1 or G2. Uptake of H3-thymidine is restricted to the S period of the cell cycle. Additional autoradiographic experiments show, however, that a soluble pool of H3-thymidine derivatives persists from the end of one DNA synthesis period to the beginning of the next synthesis period in the subsequent cell cycle. Since this persisting pool cannot be labeled with H3-thymidine, the pool does not turn over during non-S periods. PMID:19866660
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Morris, D R; Jorstad, C M; Seyfried, C E
1977-09-01
The cancer chemotherapeutic drug, methylglyoxal bis(guanylhydrazone), inhibits the synthesis of spermidine and spermine, but allows continued putrescine production in small lymphocytes stimulated by concanavalin A. DNA replication in these cells is inhibited 50% while the synthesis of protein and RNA continues normally. When excess putrescine accumulation in the presence of methylglyoxal bis(guanylhydrazone) was inhibited with alpha-methylornithine, a competitive inhibitor of ornithine decarboxylase, the inhibition of DNA replication was accentuated, with still no effect on protein or RNA synthesis. No inhibition of DNA synthesis by the combination of alpha-methylornithine and methylglyoxal bis(guanylhydrazone) was observed when the inhibitors were added after accumulation of cellular polyamines. In addition, inhibition was reversed by exogenous putrescine, spermidine, or spermine. We conclude that putrescine can fulfill in part the role normally played by spermidine and spermine in DNA replication, and that blocking putrescine synthesis in the presence of methylglyoxal bis(guanylhydrazone) amplifies the polyamine requirement. The implications of this with regard to polyamine synthesis as a site of chemotherapy are discussed.
Effect of haloperidol on the synthesis of DNA in the pituitary gland of the rat.
Machiavelli, G A; Jahn, G A; Kalbermann, L E; Szijan, I; Alonso, G E; Burdman, J A
1982-03-01
The administration of haloperidol increased serum prolactin and decreased the pituitary concentration of prolactin 15 min after its administration. Concomitantly there was a stimulation in the synthesis of DNA and the activity of DNA polymerase alpha in the anterior pituitary gland that was greater in oestrogenized than in non-oestrogenized male rats. Both these effects were greatly reduced by clomiphene in the oestrogenized male rats, although it did not affect the release of prolactin produced by haloperidol. In non-oestrogenized animals clomiphene abolished the stimulatory effect of haloperidol on the synthesis of DNA. These results suggest that the reduction in the intracellular levels of prolactin are a primary event in the oestrogen mediated stimulation of cell proliferation by prolactin releasing agents.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Template-switching during DNA synthesis by Thermus aquaticus DNA polymerase I.
Odelberg, S J; Weiss, R B; Hata, A; White, R
1995-01-01
Recombinant DNA molecules are often generated during the polymerase chain reaction (PCR) when partially homologous templates are available [e.g., see Pääbo et al. (1990) J. Biol. Chem. 265, 4718-4721]. It has been suggested that these recombinant molecules are a consequence of truncated extension products annealing to partially homologous templates on subsequent PCR cycles. However, we demonstrate here that recombinants can be generated during a single round of primer extension in the absence of subsequent heat denaturation, indicating that template-switching produces some of these recombinant molecules. Two types of template-switches were observed: (i) switches to pre-existing templates and (ii) switches to the complementary nascent strand. Recombination is reduced several fold when the complementary template strands are physically separated by attachment to streptavidin magnetic beads. This result supports the hypothesis that either the polymerase or at least one of the two extending strands switches templates during DNA synthesis and that interaction between the complementary template strands is necessary for efficient template-switching. Images PMID:7596836
Arachidonic and oleic acid exert distinct effects on the DNA methylome
Silva-Martínez, Guillermo A.; Rodríguez-Ríos, Dalia; Alvarado-Caudillo, Yolanda; Vaquero, Alejandro; Esteller, Manel; Carmona, F. Javier; Moran, Sebastian; Nielsen, Finn C.; Wickström-Lindholm, Marie; Wrobel, Katarzyna; Wrobel, Kazimierz; Barbosa-Sabanero, Gloria; Zaina, Silvio; Lund, Gertrud
2016-01-01
ABSTRACT Abnormal fatty acid metabolism and availability are landmarks of metabolic diseases, which in turn are associated with aberrant DNA methylation profiles. To understand the role of fatty acids in disease epigenetics, we sought DNA methylation profiles specifically induced by arachidonic (AA) or oleic acid (OA) in cultured cells and compared those with published profiles of normal and diseased tissues. THP-1 monocytes were stimulated with AA or OA and analyzed using Infinium HumanMethylation450 BeadChip (Illumina) and Human Exon 1.0 ST array (Affymetrix). Data were corroborated in mouse embryonic fibroblasts. Comparisons with publicly available data were conducted by standard bioinformatics. AA and OA elicited a complex response marked by a general DNA hypermethylation and hypomethylation in the 1–200 μM range, respectively, with a maximal differential response at the 100 μM dose. The divergent response to AA and OA was prominent within the gene body of target genes, where it correlated positively with transcription. AA-induced DNA methylation profiles were similar to the corresponding profiles described for palmitic acid, atherosclerosis, diabetes, obesity, and autism, but relatively dissimilar from OA-induced profiles. Furthermore, human atherosclerosis grade-associated DNA methylation profiles were significantly enriched in AA-induced profiles. Biochemical evidence pointed to β-oxidation, PPAR-α, and sirtuin 1 as important mediators of AA-induced DNA methylation changes. In conclusion, AA and OA exert distinct effects on the DNA methylome. The observation that AA may contribute to shape the epigenome of important metabolic diseases, supports and expands current diet-based therapeutic and preventive efforts. PMID:27088456
Thermodynamic impact of abasic sites on simulated translesion DNA synthesis.
Malina, Jaroslav; Brabec, Viktor
2014-06-16
Loss of a base in DNA and the creation of an abasic (apurinic/apyrimidinic, AP) site is a frequent lesion that may occur spontaneously, or as a consequence of the action of DNA-damaging agents. The AP lesion is mutagenic or lethal if not repaired. We report a systematic thermodynamic investigation by differential scanning calorimetry on the evolution, during primer extension, of a model AP site in chemically simulated DNA translesion synthesis. Incorporation of dAMP (deoxyadenosine monophosphate), as well as dTMP (deoxythymidine monophosphate), opposite an AP site is enthalpically unfavorable, although incorporation of dTMP is more enthalpically unfavorable than that of dAMP. This finding is in a good agreement with experimental data showing that AP sites block various DNA polymerases of eukaryotic and prokaryotic origin and that, if bypassed, dAMP is preferentially inserted, whereas insertion of dTMP is less likely. The results emphasize the importance of thermodynamic contributions to the insertion of nucleotides opposite an AP site by DNA polymerases. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Seco, Elena M.
2017-01-01
Abstract Firmicutes have two distinct replicative DNA polymerases, the PolC leading strand polymerase, and PolC and DnaE synthesizing the lagging strand. We have reconstituted in vitro Bacillus subtilis bacteriophage SPP1 θ-type DNA replication, which initiates unidirectionally at oriL. With this system we show that DnaE is not only restricted to lagging strand synthesis as previously suggested. DnaG primase and DnaE polymerase are required for initiation of DNA replication on both strands. DnaE and DnaG synthesize in concert a hybrid RNA/DNA ‘initiation primer’ on both leading and lagging strands at the SPP1 oriL region, as it does the eukaryotic Pol α complex. DnaE, as a RNA-primed DNA polymerase, extends this initial primer in a reaction modulated by DnaG and one single-strand binding protein (SSB, SsbA or G36P), and hands off the initiation primer to PolC, a DNA-primed DNA polymerase. Then, PolC, stimulated by DnaG and the SSBs, performs the bulk of DNA chain elongation at both leading and lagging strands. Overall, these modulations by the SSBs and DnaG may contribute to the mechanism of polymerase switch at Firmicutes replisomes. PMID:28575448
[Chromosomal proteins: histones and acid proteins].
Salvini, M; Gabrielli, F
1976-01-01
Experimental data about the chemistry and the biology of chromosomal proteins are reviewed. Paragraphs include: aminoacid sequential data and post-translational covalent modications of histones, histone chemical differences in different tissues of the same species and in homologous organs of different species, histone synthesis subcellular localization and its association with DNA synthesis, histone synthesis transcriptional and translational control, histone synthesis during meiosis, oogenesis and early embryogenesis. The possible role of histones as controllers of gene expression is discussed and a model of primary structure of chromatine is proposed. The "acidic proteins" data concern the high tissue eterogenity of these proteins and their role in the steroid-hormon-controlled gene expression. The possible role of acidic proteins as general controllers of gene expression in eucariotic cells is discussed.
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Design, synthesis and selection of DNA-encoded small-molecule libraries.
Clark, Matthew A; Acharya, Raksha A; Arico-Muendel, Christopher C; Belyanskaya, Svetlana L; Benjamin, Dennis R; Carlson, Neil R; Centrella, Paolo A; Chiu, Cynthia H; Creaser, Steffen P; Cuozzo, John W; Davie, Christopher P; Ding, Yun; Franklin, G Joseph; Franzen, Kurt D; Gefter, Malcolm L; Hale, Steven P; Hansen, Nils J V; Israel, David I; Jiang, Jinwei; Kavarana, Malcolm J; Kelley, Michael S; Kollmann, Christopher S; Li, Fan; Lind, Kenneth; Mataruse, Sibongile; Medeiros, Patricia F; Messer, Jeffrey A; Myers, Paul; O'Keefe, Heather; Oliff, Matthew C; Rise, Cecil E; Satz, Alexander L; Skinner, Steven R; Svendsen, Jennifer L; Tang, Lujia; van Vloten, Kurt; Wagner, Richard W; Yao, Gang; Zhao, Baoguang; Morgan, Barry A
2009-09-01
Biochemical combinatorial techniques such as phage display, RNA display and oligonucleotide aptamers have proven to be reliable methods for generation of ligands to protein targets. Adapting these techniques to small synthetic molecules has been a long-sought goal. We report the synthesis and interrogation of an 800-million-member DNA-encoded library in which small molecules are covalently attached to an encoding oligonucleotide. The library was assembled by a combination of chemical and enzymatic synthesis, and interrogated by affinity selection. We describe methods for the selection and deconvolution of the chemical display library, and the discovery of inhibitors for two enzymes: Aurora A kinase and p38 MAP kinase.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Mariella, Jr., Raymond P.
2008-11-18
A method of synthesizing a desired double-stranded DNA of a predetermined length and of a predetermined sequence. Preselected sequence segments that will complete the desired double-stranded DNA are determined. Preselected segment sequences of DNA that will be used to complete the desired double-stranded DNA are provided. The preselected segment sequences of DNA are assembled to produce the desired double-stranded DNA.
Multiple regulatory systems coordinate DNA replication with cell growth in Bacillus subtilis.
Murray, Heath; Koh, Alan
2014-10-01
In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes.
Fuller, Carl W.; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Bibillo, Arek; Stranges, P. Benjamin; Dorwart, Michael; Tao, Chuanjuan; Li, Zengmin; Guo, Wenjing; Shi, Shundi; Korenblum, Daniel; Trans, Andrew; Aguirre, Anne; Liu, Edward; Harada, Eric T.; Pollard, James; Bhat, Ashwini; Cech, Cynthia; Yang, Alexander; Arnold, Cleoma; Palla, Mirkó; Hovis, Jennifer; Chen, Roger; Morozova, Irina; Kalachikov, Sergey; Russo, James J.; Kasianowicz, John J.; Davis, Randy; Roever, Stefan; Church, George M.; Ju, Jingyue
2016-01-01
DNA sequencing by synthesis (SBS) offers a robust platform to decipher nucleic acid sequences. Recently, we reported a single-molecule nanopore-based SBS strategy that accurately distinguishes four bases by electronically detecting and differentiating four different polymer tags attached to the 5′-phosphate of the nucleotides during their incorporation into a growing DNA strand catalyzed by DNA polymerase. Further developing this approach, we report here the use of nucleotides tagged at the terminal phosphate with oligonucleotide-based polymers to perform nanopore SBS on an α-hemolysin nanopore array platform. We designed and synthesized several polymer-tagged nucleotides using tags that produce different electrical current blockade levels and verified they are active substrates for DNA polymerase. A highly processive DNA polymerase was conjugated to the nanopore, and the conjugates were complexed with primer/template DNA and inserted into lipid bilayers over individually addressable electrodes of the nanopore chip. When an incoming complementary-tagged nucleotide forms a tight ternary complex with the primer/template and polymerase, the tag enters the pore, and the current blockade level is measured. The levels displayed by the four nucleotides tagged with four different polymers captured in the nanopore in such ternary complexes were clearly distinguishable and sequence-specific, enabling continuous sequence determination during the polymerase reaction. Thus, real-time single-molecule electronic DNA sequencing data with single-base resolution were obtained. The use of these polymer-tagged nucleotides, combined with polymerase tethering to nanopores and multiplexed nanopore sensors, should lead to new high-throughput sequencing methods. PMID:27091962
Roos, F; Renier, A; Ettlinger, J; Iwatsubo, Y; Letourneux, M; Haguenoer, J M; Jaurand, M C; Pairon, J C
1997-01-01
OBJECTIVES: A study was conducted in coke oven workers to evaluate the biological consequences of the exposure of these workers, particularly production of potential genotoxic factors. METHODS: 60 coke oven workers and 40 controls were recruited in the same iron and steel works. Exposure to polycyclic aromatic hydrocarbons (PAHs) was assessed by job and measurement of 1-hydroxypyrene (1OHP) in urine samples. An unscheduled DNA synthesis assay was performed on rat pleural mesothelial cells used as a test system to evaluate the effect of the workers' filtered urine on the DNA repair capacity of rat cells to determine whether DNA damaging agents are present in the urine of these workers. RESULTS: Urinary concentrations of 1OHP ranged from 0.06 to 24.2 (mean (SD) 2.1 (3.6)) mumol/mol creatinine in exposed coke oven workers, and from 0.01 to 0.9 in controls (0.12 (0.15)). These high concentrations in coke oven workers reflected recent exposure to PAHs and were in agreement with the assessment of exposure by job. No significant difference was found between coke oven workers and controls in the DNA repair level of rat cells treated with urine samples. However, the rat cell repair capacity decreased with increasing 1OHP concentrations in the exposed population (r = -0.28, P < 0.05). CONCLUSIONS: As high concentrations of 1OHP were found in the urine of some workers, a more stringent control of exposures to PAHs in the workplace is required. Exposure to PAHs was not associated with a clear cut modification of the urinary excretion of DNA damaging factors in this test, as shown by the absence of increased unscheduled DNA synthesis in rat cells. However, impairment of some repair mechanisms by urinary constituents is suspected. PMID:9470892
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Chen, Yang; Tao, Guangyu; Lin, Ruoyun; Pei, Xiaojing; Liu, Feng; Li, Na
2016-06-06
The rationale for the preparation of DNA-templated gold nanoclusters (DNA-Au NCs) has not been well understood, thereby slowing down the advancement of the synthesis and applications of DNA-Au NCs. The interaction between metal ions and the DNA template seems to be the key factor for the successful preparation of DNA-templated metal nanoclusters. With the help of circular dichroism in this contribution, we put efforts into interrogating the necessity of pre-incubation of HAuCl4 with poly-adenine template in the formation of Au NCs by citrate reduction. Our results revealed that the pre-incubation of HAuCl4 with poly-adenine is not favorable for the formation of Au NCs, which is distinctly different from the formation process for silver nanoclusters. It is our hope that this study can provide guidance in the preparation of Au NCs with more DNA templates. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
NASA Technical Reports Server (NTRS)
Frank, Natia L.; Meade, Thomas J.
2003-01-01
Incorporation of metalated nucleosides into DNA through covalent modification is crucial to measurement of thermal electron-transfer rates and the dependence of these rates with structure, distance, and position. Here, we report the first synthesis of an electron donor-acceptor pair of 5' metallonucleosides and their subsequent incorporation into oligonucleotides using solid-phase DNA synthesis techniques. Large-scale syntheses of metal-containing oligonucleotides are achieved using 5' modified phosporamidites containing [Ru(acac)(2)(IMPy)](2+) (acac is acetylacetonato; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (3) and [Ru(bpy)(2)(IMPy)](2+) (bpy is 2,2'-bipyridine; IMPy is 2'-iminomethylpyridyl-2'-deoxyuridine) (4). Duplexes formed with the metal-containing oligonucleotides exhibit thermal stability comparable to the corresponding unmetalated duplexes (T(m) of modified duplex = 49 degrees C vs T(m) of unmodified duplex = 47 degrees C). Electrochemical (3, E(1/2) = -0.04 V vs NHE; 4, E(1/2) = 1.12 V vs NHE), absorption (3, lambda(max) = 568, 369 nm; 4, lambda(max) = 480 nm), and emission (4, lambda(max) = 720 nm, tau = 55 ns, Phi = 1.2 x 10(-)(4)) data for the ruthenium-modified nucleosides and oligonucleotides indicate that incorporation into an oligonucleotide does not perturb the electronic properties of the ruthenium complex or the DNA significantly. In addition, the absence of any change in the emission properties upon metalated duplex formation suggests that the [Ru(bpy)(2)(IMPy)](2+)[Ru(acac)(2)(IMPy)](2+) pair will provide a valuable probe for DNA-mediated electron-transfer studies.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Method for nucleic acid hybridization using single-stranded DNA binding protein
Tabor, Stanley; Richardson, Charles C.
1996-01-01
Method of nucleic acid hybridization for detecting the presence of a specific nucleic acid sequence in a population of different nucleic acid sequences using a nucleic acid probe. The nucleic acid probe hybridizes with the specific nucleic acid sequence but not with other nucleic acid sequences in the population. The method includes contacting a sample (potentially including the nucleic acid sequence) with the nucleic acid probe under hybridizing conditions in the presence of a single-stranded DNA binding protein provided in an amount which stimulates renaturation of a dilute solution (i.e., one in which the t.sub.1/2 of renaturation is longer than 3 weeks) of single-stranded DNA greater than 500 fold (i.e., to a t.sub.1/2 less than 60 min, preferably less than 5 min, and most preferably about 1 min.) in the absence of nucleotide triphosphates.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Seth, Punit P; Yu, Jinghua; Jazayeri, Ali; Pallan, Pradeep S; Allerson, Charles R; Østergaard, Michael E; Liu, Fengwu; Herdewijn, Piet; Egli, Martin; Swayze, Eric E
2012-06-01
We report the design and synthesis of 2'-fluoro cyclohexenyl nucleic acid (F-CeNA) pyrimidine phosphoramidites and the synthesis and biophysical, structural, and biological evaluation of modified oligonucleotides. The synthesis of the nucleoside phosphoramidites was accomplished in multigram quantities starting from commercially available methyl-D-mannose pyranoside. Installation of the fluorine atom was accomplished using nonafluorobutanesulfonyl fluoride, and the cyclohexenyl ring system was assembled by means of a palladium-catalyzed Ferrier rearrangement. Installation of the nucleobase was carried out under Mitsunobu conditions followed by standard protecting group manipulations to provide the desired pyrimidine phosphoramidites. Biophysical evaluation indicated that F-CeNA shows behavior similar to that of a 2'-modified nucleotide, and duplexes with RNA showed slightly lower duplex thermostability as compared to that of the more rigid 3'-fluoro hexitol nucleic acid (FHNA). However, F-CeNA modified oligonucleotides were significantly more stable against digestion by snake venom phosphodiesterases (SVPD) as compared to unmodified DNA, 2'-fluoro RNA (FRNA), 2'-methoxyethyl RNA (MOE), and FHNA modified oligonucleotides. Examination of crystal structures of a modified DNA heptamer duplex d(GCG)-T*-d(GCG):d(CGCACGC) by X-ray crystallography indicated that the cyclohexenyl ring system exhibits both the (3)H(2) and (2)H(3) conformations, similar to the C3'-endo/C2'-endo conformation equilibrium seen in natural furanose nucleosides. In the (2)H(3) conformation, the equatorial fluorine engages in a relatively close contact with C8 (2.94 Å) of the 3'-adjacent dG nucleotide that may represent a pseudo hydrogen bond. In contrast, the cyclohexenyl ring of F-CeNA was found to exist exclusively in the (3)H(2) (C3'-endo like) conformation in the crystal structure of the modified A-form DNA decamer duplex [d(GCGTA)-T*-d(ACGC)](2.) In an animal experiment, a 16-mer F
Kim, Jiae; Roberts, Anne; Yuan, Hua; Xiong, Yong; Anderson, Karen S.
2012-01-01
Human immunodeficiency virus type-1 (HIV-1) requires reverse transcriptase (RT) and HIV-1 nucleocapsid protein (NCp7) for proper viral replication. HIV-1 NCp7 has been shown to enhance various steps in reverse transcription including tRNA initiation and strand transfer which may be mediated through interactions with RT as well as RNA and DNA oligonucleotides. With the use of DNA oligonucleotides, we have examined the interaction of NCp7 with RT and the kinetics of reverse transcription during (+)-strand synthesis with an NCp7-facilitated annealed primer-template. Using a pre-steady state kinetics approach, the NCp7-annealed primer-template has a substantial increase (3-7 fold) in the rate of incorporation (kpol) by RT as compared to heat annealed primer-template with single nucleotide incorporation. There was also a 2-fold increase in the binding affinity constant (Kd) of the nucleotide. These differences in kpol and Kd were not through direct interactions between HIV-1 RT and NCp7. When examining extension by RT, the data suggests that the NCp7-annealed primer-template facilitates the formation of a longer product more quickly compared to the heat annealed primer-template. This enhancement in rate is mediated through interactions with NCp7’s zinc fingers and N-terminal domain and nucleic acids. The NCp7-annealed primer-template also enhances the fidelity of RT (3-fold) by slowing the rate of incorporation of an incorrect nucleotide. Taken together, this study elucidates a new role of NCp7 by facilitating DNA-directed DNA synthesis during reverse transcription by HIV-1 RT that may translate into enhanced viral fitness and offers an avenue to exploit for targeted therapeutic intervention against HIV. PMID:22210155
DNA sensing by a Eu-binding peptide containing a proflavine unit.
Ancel, Laetitia; Gateau, Christelle; Lebrun, Colette; Delangle, Pascale
2013-01-18
Synthesis of a lanthanide-binding peptide (LBP) for the detection of double-stranded DNA is presented. A proflavine moiety was introduced into a high affinity LBP involving two unnatural chelating amino acids in the Ln ion coordination. The Eu(3+)-LBP complex is demonstrated to bind to ct-DNA and to sensitize Eu luminescence. The DNA binding process is effectively detected via the Eu-centered luminescence thanks to the intimate coupling between the LBP scaffold and DNA intercalating unit.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Dietary choline deficiency causes DNA strand breaks and alters epigenetic marks on DNA and histones.
Zeisel, Steven H
2012-05-01
Dietary choline is an important modulator of gene expression (via epigenetic marks) and of DNA integrity. Choline was discovered to be an essential nutrient for some humans approximately one decade ago. This requirement is diminished in young women because estrogen drives endogenous synthesis of phosphatidylcholine, from which choline can be derived. Almost half of women have a single nucleotide polymorphism that abrogates estrogen-induction of endogenous synthesis, and these women require dietary choline just as do men. In the US, dietary intake of choline is marginal. Choline deficiency in people is associated with liver and muscle dysfunction and damage, with apoptosis, and with increased DNA strand breaks. Several mechanisms explain these modifications to DNA. Choline deficiency increases leakage of reactive oxygen species from mitochondria consequent to altered mitochondrial membrane composition and enhanced fatty acid oxidation. Choline deficiency impairs folate metabolism, resulting in decreased thymidylate synthesis and increased uracil misincorporation into DNA, with strand breaks resulting during error-prone repair attempts. Choline deficiency alters DNA methylation, which alters gene expression for critical genes involved in DNA mismatch repair, resulting in increased mutation rates. Any dietary deficiency which increases mutation rates should be associated with increased risk of cancers, and this is the case for choline deficiency. In rodent models, diets low in choline and methyl-groups result in spontaneous hepatocarcinomas. In human epidemiological studies, there are interesting data that suggest that this also may be the case for humans, especially those with SNPs that increase the dietary requirement for choline. Copyright © 2011 Elsevier B.V. All rights reserved.
Dietary Choline Deficiency causes DNA Strand Breaks and Alters Epigenetic Marks on DNA and Histones
Zeisel, Steven H.
2011-01-01
Dietary choline is an important modulator of gene expression (via epigenetic marks) and of DNA integrity. Choline was discovered to be an essential nutrient for some humans approximately one decade ago. This requirement is diminished in young women because estrogen drives endogenous synthesis of phosphatidylcholine, from which choline can be derived. Almost half of women have a single nucleotide polymorphism that abrogates estrogen-induction of endogenous synthesis, and these women require dietary choline just as do men. In the US, dietary intake of choline is marginal. Choline deficiency in people is associated with liver and muscle dysfunction and damage, with apoptosis, and with increased DNA strand breaks. Several mechanisms explain these modifications to DNA. Choline deficiency increases leakage of reactive oxygen species from mitochondria consequent to altered mitochondrial membrane composition and enhanced fatty acid oxidation. Choline deficiency impairs folate metabolism, resulting in decreased thymidylate synthesis and increased uracil misincorporation into DNA, with strand breaks resulting during error-prone repair attempts. Choline deficiency alters DNA methylation, which alters gene expression for critical genes involved in DNA mismatch repair, resulting in increased mutation rates. Any dietary deficiency which increases mutation rates should be associated with increased risk of cancers, and this is the case for choline deficiency. In rodent models, diets low in choline and methyl-groups result in spontaneous hepatocarcinomas. In human epidemiological studies, there are interesting data that suggest that this also may be the case for humans, especially those with SNPs that increase the dietary requirement for choline. PMID:22041500
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Fillingame, R H; Jorstad, C M; Morris, D R
1975-01-01
There are large increases in cellular levels of the polyamines spermidine and spermine in lymphocytes induced to transform by concanavalin A. The anti-leukemic agent methylglyoxal bis(guanylhydrazone) (MGBG) blocks synthesis of these polyamines by inhibiting S-adenosylmethionine decarboxylase. Previous results showed that when cells are activated in the presence of MGBG the synthesis and processing of RNA, as well as protein synthesis, proceed as in the absence of the drug. In contrast, the incorporation of [methyl-3H]thymidine into DNA and the rate of entry of the cells into mitosis are inhibited by 60% in the presence of MGBG. Several experiments suggest that MGBG inhibits cell proliferation by directly blocking polyamine synthesis and not by an unrelated pharmacological effect: (1) the inhibitory action of MGBG is reversed by exogenously added spermidine or spermine; (2) inhibition of DNA synthesis by MGBG shows the same dose-response curve as does inhibition of spermidine and spermine synthesis; and (3) if MGBG is added to cells which have been allowed to accumulate their maximum complement of polyamines, there is no inhibition of thymidine incorporation. MGBG-treated and control cultures initiate DNA synthesis at the same time and show the same percentage of labeled cells by autoradiography. Therefore, it appears that in the absence of increased cellular levels of polyamines, lymphocytes progress normally from G0 through G1 and into S-phase. Furthermore, these experiments suggest that the increased levels of spermidine and spermine generally seen in rapidly proliferating eukaryotic systems are necessary for enhanced rates of DNA replication. PMID:1060087
Method for promoting specific alignment of short oligonucleotides on nucleic acids
Studier, F. William; Kieleczawa, Jan; Dunn, John J.
1996-01-01
Disclosed is a method for promoting specific alignment of short oligonucleotides on a nucleic acid polymer. The nucleic acid polymer is incubated in a solution containing a single-stranded DNA-binding protein and a plurality of oligonucleotides which are perfectly complementary to distinct but adjacent regions of a predetermined contiguous nucleotide sequence in the nucleic acid polymer. The plurality of oligonucleotides anneal to the nucleic acid polymer to form a contiguous region of double stranded nucleic acid. Specific application of the methods disclosed include priming DNA synthesis and template-directed ligation.
Yuan, Cong; Zhang, Yingying; Liu, Yan; Zhang, Ting; Wang, Zaizhao
2016-09-01
DNA methylation is a commonly studied epigenetic modification. The mechanism of BPA on DNA methylation is poorly understood. The present study aims to explore whether GSH synthesis affects DNA methylation in the testes of adult male rare minnow Gobiocypris rarus in response to Bisphenol A (BPA). Male G. rarus was exposed to 1, 15 and 225μgL(-1) BPA for 7 days. The levels of global DNA methylation, hydrogen peroxide (H2O2) and glutathione (GSH) in the testes were analyzed. Meanwhile, the levels of enzymes involved in DNA methylation and de novo GSH synthesis, and the substrate contents for GSH production were measured. Furthermore, gene expression profiles of the corresponding genes of all studied enzymes were analyzed. Results indicated that BPA at 15 and 225μgL(-1) caused hypermethylation of global DNA in the testes. The 15μgL(-1) BPA resulted in significant decrease of ten-eleven translocation proteins (TETs) while 225μgL(-1) BPA caused significant increase of DNA methyltransferase proteins (DNMTs). Moreover, 225μgL(-1) BPA caused significant increase of H2O2 and GSH levels, and the de novo GSH synthesis was enhanced. These results indicated that the significant decrease of the level of TETs may be sufficient to cause the DNA hypermethylation by 15μgL(-1) BPA. However, the significantly increased of DNMTs contributed to the significant increase of DNA methylation levels by 225μgL(-1) BPA. Moreover, the elevated de novo GSH synthesis may promote the DNA methylation process. Copyright © 2016 Elsevier B.V. All rights reserved.
DNA synthesis by Pol η promotes fragile site stability by preventing under-replicated DNA in mitosis
Bergoglio, Valérie; Boyer, Anne-Sophie; Walsh, Erin; Naim, Valeria; Legube, Gaëlle; Lee, Marietta Y.W.T.; Rey, Laurie; Rosselli, Filippo; Cazaux, Christophe; Eckert, Kristin A.
2013-01-01
Human DNA polymerase η (Pol η) is best known for its role in responding to UV irradiation–induced genome damage. We have recently observed that Pol η is also required for the stability of common fragile sites (CFSs), whose rearrangements are considered a driving force of oncogenesis. Here, we explored the molecular mechanisms underlying this newly identified role. We demonstrated that Pol η accumulated at CFSs upon partial replication stress and could efficiently replicate non-B DNA sequences within CFSs. Pol η deficiency led to persistence of checkpoint-blind under-replicated CFS regions in mitosis, detectable as FANCD2-associated chromosomal sites that were transmitted to daughter cells in 53BP1-shielded nuclear bodies. Expression of a catalytically inactive mutant of Pol η increased replication fork stalling and activated the replication checkpoint. These data are consistent with the requirement of Pol η–dependent DNA synthesis during S phase at replication forks stalled in CFS regions to suppress CFS instability by preventing checkpoint-blind under-replicated DNA in mitosis. PMID:23609533
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Kulkarni, Asmita; Dangat, Kamini; Kale, Anvita; Sable, Pratiksha; Chavan-Gautam, Preeti; Joshi, Sadhana
2011-03-10
Potential adverse effects of excess maternal folic acid supplementation on a vegetarian population deficient in vitamin B(12) are poorly understood. We have previously shown in a rat model that maternal folic acid supplementation at marginal protein levels reduces brain omega-3 fatty acid levels in the adult offspring. We have also reported that reduced docosahexaenoic acid (DHA) levels may result in diversion of methyl groups towards DNA in the one carbon metabolic pathway ultimately resulting in DNA methylation. This study was designed to examine the effect of normal and excess folic acid in the absence and presence of vitamin B(12) deficiency on global methylation patterns in the placenta. Further, the effect of maternal omega 3 fatty acid supplementation on the above vitamin B(12) deficient diets was also examined. Our results suggest maternal folic acid supplementation in the absence of vitamin B(12) lowers plasma and placental DHA levels (p<0.05) and reduces global DNA methylation levels (p<0.05). When this group was supplemented with omega 3 fatty acids there was an increase in placental DHA levels and subsequently DNA methylation levels revert back to the levels of the control group. Our results suggest for the first time that DHA plays an important role in one carbon metabolism thereby influencing global DNA methylation in the placenta.
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
von Walden, Ferdinand; Liu, Chang; Aurigemma, Nicole; Nader, Gustavo A
2016-10-01
Ribosome production is an early event during skeletal muscle hypertrophy and precedes muscle protein accretion. Signaling via mTOR is crucial for ribosome production and hypertrophy; however, the mechanisms by which it regulates these processes remain to be identified. Herein, we investigated the activation of mTOR signaling in hypertrophying myotubes and determined that mTOR coordinates various aspects of gene expression important for ribosome production. First, inhibition of translation with cycloheximide had a more potent effect on protein synthesis than rapamycin indicating that mTOR function during hypertrophy is not on general, but rather on specific protein synthesis. Second, blocking Pol II transcription had a similar effect as Rapamycin and, unexpectedly, revealed the necessity of Pol II transcription for Pol I transcription, suggesting that mTOR may regulate ribosome production also by controlling Class II genes at the transcriptional level. Third, Pol I activity is essential for rDNA transcription and, surprisingly, for protein synthesis as selective Pol I inhibition blunted rDNA transcription, protein synthesis, and the hypertrophic response of myotubes. Finally, mTOR has nuclear localization in muscle, which is not sensitive to rapamycin. Inhibition of mTOR signaling by rapamycin disrupted mTOR-rDNA promoter interaction and resulted in altered histone marks indicative of repressed transcription and formation of higher-order chromatin structure. Thus mTOR signaling appears to regulate muscle hypertrophy by affecting protein synthesis, Class I and II gene expression, and chromatin remodeling. Copyright © 2016 the American Physiological Society.
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
Jacobi, H; Leier, G; Witte, I
1996-04-01
The binary combination effects of DNA synthesis of human fibroblasts were investigated using 2,4-D with 15 xenobiotics of different chemical substance classes. Results were compared with previous investigations on cell growth. Each of the 15 chemicals tested at their no effect concentrations (NOEC's) increased the effects of 2,4-D on DNA synthesis. Thereby, the EC20 value of 2,4-D was reduced by approximately 40% in the combinations. The NOEC's of the xenobiotics used in the combinations varied by a factor of 1,600 and depended strongly on the lipophilicity of the agents combined with 2,4-D. A significant statistical correlation of r = 0.90 was found between the NOEC's of the 15 combined xenobiotics and their lipophilicity. The combination effects on DNA synthesis were similar to those on cell growth. The regression lines of the relationship between the NOEC's and lipophilicity in both assays showed only slight differences in the slopes. This is an additional confirmation of our hypothesis on a facilitated uptake of 2,4-D in the binary combinations.
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Multiple Regulatory Systems Coordinate DNA Replication with Cell Growth in Bacillus subtilis
Murray, Heath; Koh, Alan
2014-01-01
In many bacteria the rate of DNA replication is linked with cellular physiology to ensure that genome duplication is coordinated with growth. Nutrient-mediated growth rate control of DNA replication initiation has been appreciated for decades, however the mechanism(s) that connects these cell cycle activities has eluded understanding. In order to help address this fundamental question we have investigated regulation of DNA replication in the model organism Bacillus subtilis. Contrary to the prevailing view we find that changes in DnaA protein level are not sufficient to account for nutrient-mediated growth rate control of DNA replication initiation, although this regulation does require both DnaA and the endogenous replication origin. We go on to report connections between DNA replication and several essential cellular activities required for rapid bacterial growth, including respiration, central carbon metabolism, fatty acid synthesis, phospholipid synthesis, and protein synthesis. Unexpectedly, the results indicate that multiple regulatory systems are involved in coordinating DNA replication with cell physiology, with some of the regulatory systems targeting oriC while others act in a oriC-independent manner. We propose that distinct regulatory systems are utilized to control DNA replication in response to diverse physiological and chemical changes. PMID:25340815
Complete complementary DNA-derived amino acid sequence of canine cardiac phospholamban.
Fujii, J; Ueno, A; Kitano, K; Tanaka, S; Kadoma, M; Tada, M
1987-01-01
Complementary DNA (cDNA) clones specific for phospholamban of sarcoplasmic reticulum membranes have been isolated from a canine cardiac cDNA library. The amino acid sequence deduced from the cDNA sequence indicates that phospholamban consists of 52 amino acid residues and lacks an amino-terminal signal sequence. The protein has an inferred mol wt 6,080 that is in agreement with its apparent monomeric mol wt 6,000, estimated previously by sodium dodecyl sulfate-polyacrylamide gel electrophoresis. Phospholamban contains two distinct domains, a hydrophilic region at the amino terminus (domain I) and a hydrophobic region at the carboxy terminus (domain II). We propose that domain I is localized at the cytoplasmic surface and offers phosphorylatable sites whereas domain II is anchored into the sarcoplasmic reticulum membrane. PMID:3793929
Bell, R M
1974-03-01
sn-Glycerol 3-phosphate (G3P) auxotrophs of Escherichia coli have been selected from a strain which cannot aerobically catabolize G3P. The auxotrophy resulted from loss of the biosynthetic G3P dehydrogenase (EC 1.1.1.8) or from a defective membranous G3P acyltransferase. The apparent K(m) of the acyltransferase for G3P was 11- to 14-fold higher (from about 90 mum to 1,000 to 1,250 mum) in membrane preparations from the mutants than those of the parent. All extracts prepared from revertants of the G3P dehydrogenase mutants showed G3P dehydrogenase activity, but most contained less than 10% of the wild-type level. Membrane preparations from revertants of the acyltransferase mutants had apparent K(m)'s for G3P similar to that of the parent. Strains have been derived in which the G3P requirement can be satisfied with glycerol in the presence of glucose, presumably because the glycerol kinase was desensitized to inhibition by fructose 1,6-diphosphate. Investigations on the growth and macromolecular synthesis in a G3P acyltransferase K(m) mutant revealed that upon glycerol deprivation, net phospholipid synthesis stopped immediately; growth continued for about one doubling; net ribonucleic acid (RNA), deoxyribonucleic acid (DNA), and protein nearly doubled paralleling the growth curve; the rate of phospholipid synthesis assessed by labeling cells with (32)P-phosphate, (14)C-acetate, or (3)H-serine was reduced greater than 90%; the rates of RNA and DNA synthesis increased as the cells grew and then decreased as the cells stopped growing; the rate of protein synthesis showed no increase and declined more slowly than the rates of RNA and DNA synthesis when the cells stopped growing. The cells retained and gained in the capacity to synthesize phospholipids upon glycerol deprivation. These data indicate that net phospholipid synthesis is not required for continued macromolecular synthesis for about one doubling, and that the rates of these processes are not coupled during this
Villalva, C; Touriol, C; Seurat, P; Trempat, P; Delsol, G; Brousset, P
2001-07-01
Under certain conditions, T4 gene 32 protein is known to increase the efficiency of different enzymes, such as Taq DNA polymerase, reverse transcriptase, and telomerase. In this study, we compared the efficiency of the SMART PCR cDNA synthesis kit with and without the T4 gene 32 protein. The use of this cDNA synthesis procedure, in combination with T4 gene 32 protein, increases the yield of RT-PCR products from approximately 90% to 150%. This effect is even observed for long mRNA templates and low concentrations of total RNA (25 ng). Therefore, we suggest the addition of T4 gene 32 protein in the RT-PCR mixture to increase the efficiency of cDNA synthesis, particularly in cases when low amounts of tissue are used.
Synthesis of G-N2-(CH2)3-N2-G Trimethylene DNA interstrand cross-links
Gruppi, Francesca; Salyard, Tracy L. Johnson; Rizzo, Carmelo J.
2014-01-01
The synthesis of G-N2-(CH2)3-N2-G trimethylene DNA interstrand cross-links (ICLs) in a 5′-CG-3′ and 5′-GC-3′ sequence from oligodeoxynucleotides containing N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine is presented. Automated solid-phase DNA synthesis was used for unmodified bases and modified nucleotides were incorporated via their corresponding phosphoramidite reagent by a manual coupling protocol. The preparation of the phosphoramidite reagents for incorporation of N2-(3-aminopropyl)-2′-deoxyguanosine is reported. The high-purity trimethylene DNA interstrand cross-link product is obtained through a nucleophilic aromatic substitution reaction between the N2-(3-aminopropyl)-2′-deoxyguanosine and 2-fluoro-O6-(trimethylsilylethyl)inosine containing oligodeoxynucleotides. PMID:25431636
The prion protein has DNA strand transfer properties similar to retroviral nucleocapsid protein.
Gabus, C; Auxilien, S; Péchoux, C; Dormont, D; Swietnicki, W; Morillas, M; Surewicz, W; Nandi, P; Darlix, J L
2001-04-06
The transmissible spongiform encephalopathies are fatal neurodegenerative diseases that are associated with the accumulation of a protease-resistant form of the cellular prion protein (PrP). Although PrP is highly conserved and widely expressed in vertebrates, its function remains a matter of speculation. Indeed PrP null mice develop normally and are healthy. Recent results show that PrP binds to nucleic acids in vitro and is found associated with retroviral particles. Furthermore, in mice the scrapie infectious process appears to be accelerated by MuLV replication. These observations prompted us to further investigate the interaction between PrP and nucleic acids, and compare it with that of the retroviral nucleocapsid protein (NC). As the major nucleic acid-binding protein of the retroviral particle, NC protein is tightly associated with the genomic RNA in the virion nucleocapsid, where it chaperones proviral DNA synthesis by reverse transcriptase. Our results show that the human prion protein (huPrP) functionally resembles NCp7 of HIV-1. Both proteins form large nucleoprotein complexes upon binding to DNA. They accelerate the hybridization of complementary DNA strands and chaperone viral DNA synthesis during the minus and plus DNA strand transfers necessary to generate the long terminal repeats. The DNA-binding and strand transfer properties of huPrP appear to map to the N-terminal fragment comprising residues 23 to 144, whereas the C-terminal domain is inactive. These findings suggest that PrP could be involved in nucleic acid metabolism in vivo. Copyright 2001 Academic Press.
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
A method for detecting genetic toxicity using the RNA synthesis response to DNA damage.
Morita, Yoko; Iwai, Shigenori; Kuraoka, Isao
2011-10-01
To date, biological risk assessment studies of chemicals that induce DNA lesions have been primarily based on the action of DNA polymerases during replication. However, DNA lesions interfere not only with replication but also with transcription. Therefore, detecting the damaging effects of DNA lesions during transcription might be important for estimating the safety of chemical mutagens and carcinogens. However, methods to address these effects have not been developed. Here, we report a simple, non-isotopic method for determining the toxicity of chemical agents by visualizing transcription in a mammalian cell system. The method is based on the measurement of the incorporation of bromouridine (as the uridine analogue) into the nascent RNA during RNA synthesis inhibition (RSI) induced by the stalling of RNA polymerases at DNA lesions on the transcribed DNA strand, which triggers transcription-coupled nucleotide excision repair (TC-NER). When we tested chemical agents (camptothecin, etoposide, 4-nitroquinoline-1-oxide, mitomycin C, methyl methanesulfonate, and cisplatin) in HeLa cells by the method, RSI indicative of genomic toxicity was observed in the nucleoli of the tested cells. This procedure provides the following advantages: 1) it uses common, affordable mammalian cells (HeLa cells, WI38VA13 cells, human dermal fibroblasts, or Chinese hamster ovary cells) rather than genetically modified microorganisms; 2) it can be completed within approximately 8 hr after the cells are prepared because RNA polymerase responses during TC-NER are faster than other DNA damage responses (replication, recombination, and apoptosis); and 3) it is safe because it uses non-radioactive bromouridine and antibodies to detect RNA synthesis on undamaged transcribed DNA strands.
Erkel, G; Anke, T; Velten, R; Steglich, W
1991-01-01
A novel enzyme inhibitor of RNA-directed DNA-polymerases of avian myeloblastosis and murine leukemia virus was isolated from fermentations of an tasmanian Podoscypha species. Its structure was elucidated by spectroscopic methods and oxidative degradation as (E)-4,5-dioxo-2-hexadecenoic acid (1). The enzyme inhibitor, which was named podoscyphic acid, did not inhibit DNA and RNA synthesis in permeabilized L 1210 cells nor did it affect RNA synthesis in isolated nuclei of L 1210 cells. 1 inhibits protein synthesis in whole L 1210 cells and rabbit reticulocyte lysate and shows very weak antimicrobial and cytotoxic properties. The testing of ethyl (E)-4,5-dioxo-2-hexadecenoate (2) and (E)-4-oxo-2-tetradecenoic acid (11) revealed the importance of the free gamma-oxoacrylic acid unit for the biological activities of 1.
Stranges, P. Benjamin; Palla, Mirkó; Kalachikov, Sergey; Nivala, Jeff; Dorwart, Michael; Trans, Andrew; Kumar, Shiv; Porel, Mintu; Chien, Minchen; Tao, Chuanjuan; Morozova, Irina; Li, Zengmin; Shi, Shundi; Aberra, Aman; Arnold, Cleoma; Yang, Alexander; Aguirre, Anne; Harada, Eric T.; Korenblum, Daniel; Pollard, James; Bhat, Ashwini; Gremyachinskiy, Dmitriy; Bibillo, Arek; Chen, Roger; Davis, Randy; Russo, James J.; Fuller, Carl W.; Roever, Stefan; Ju, Jingyue; Church, George M.
2016-01-01
Scalable, high-throughput DNA sequencing is a prerequisite for precision medicine and biomedical research. Recently, we presented a nanopore-based sequencing-by-synthesis (Nanopore-SBS) approach, which used a set of nucleotides with polymer tags that allow discrimination of the nucleotides in a biological nanopore. Here, we designed and covalently coupled a DNA polymerase to an α-hemolysin (αHL) heptamer using the SpyCatcher/SpyTag conjugation approach. These porin–polymerase conjugates were inserted into lipid bilayers on a complementary metal oxide semiconductor (CMOS)-based electrode array for high-throughput electrical recording of DNA synthesis. The designed nanopore construct successfully detected the capture of tagged nucleotides complementary to a DNA base on a provided template. We measured over 200 tagged-nucleotide signals for each of the four bases and developed a classification method to uniquely distinguish them from each other and background signals. The probability of falsely identifying a background event as a true capture event was less than 1.2%. In the presence of all four tagged nucleotides, we observed sequential additions in real time during polymerase-catalyzed DNA synthesis. Single-polymerase coupling to a nanopore, in combination with the Nanopore-SBS approach, can provide the foundation for a low-cost, single-molecule, electronic DNA-sequencing platform. PMID:27729524
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Awate, Sanket; Brosh, Robert M
2017-06-08
Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies.
Awate, Sanket; Brosh, Robert M.
2017-01-01
Helicases and translocases use the energy of nucleoside triphosphate binding and hydrolysis to unwind/resolve structured nucleic acids or move along a single-stranded or double-stranded polynucleotide chain, respectively. These molecular motors facilitate a variety of transactions including replication, DNA repair, recombination, and transcription. A key partner of eukaryotic DNA helicases/translocases is the single-stranded DNA binding protein Replication Protein A (RPA). Biochemical, genetic, and cell biological assays have demonstrated that RPA interacts with these human molecular motors physically and functionally, and their association is enriched in cells undergoing replication stress. The roles of DNA helicases/translocases are orchestrated with RPA in pathways of nucleic acid metabolism. RPA stimulates helicase-catalyzed DNA unwinding, enlists translocases to sites of action, and modulates their activities in DNA repair, fork remodeling, checkpoint activation, and telomere maintenance. The dynamic interplay between DNA helicases/translocases and RPA is just beginning to be understood at the molecular and cellular levels, and there is still much to be learned, which may inform potential therapeutic strategies. PMID:28594346
Wienholz, Franziska; Vermeulen, Wim
2017-01-01
Abstract Nucleotide excision repair (NER) comprises two damage recognition pathways: global genome NER (GG-NER) and transcription-coupled NER (TC-NER), which remove a wide variety of helix-distorting lesions including UV-induced damage. During NER, a short stretch of single-stranded DNA containing damage is excised and the resulting gap is filled by DNA synthesis in a process called unscheduled DNA synthesis (UDS). UDS is measured by quantifying the incorporation of nucleotide analogues into repair patches to provide a measure of NER activity. However, this assay is unable to quantitatively determine TC-NER activity due to the low contribution of TC-NER to the overall NER activity. Therefore, we developed a user-friendly, fluorescence-based single-cell assay to measure TC-NER activity. We combined the UDS assay with tyramide-based signal amplification to greatly increase the UDS signal, thereby allowing UDS to be quantified at low UV doses, as well as DNA-repair synthesis of other excision-based repair mechanisms such as base excision repair and mismatch repair. Importantly, we demonstrated that the amplified UDS is sufficiently sensitive to quantify TC-NER-derived repair synthesis in GG-NER-deficient cells. This assay is important as a diagnostic tool for NER-related disorders and as a research tool for obtaining new insights into the mechanism and regulation of excision repair. PMID:28088761
Synthesis and DNA interaction of a mixed proflavine-phenanthroline Tröger base.
Baldeyrou, Brigitte; Tardy, Christelle; Bailly, Christian; Colson, Pierre; Houssier, Claude; Charmantray, Franck; Demeunynck, Martine
2002-04-01
We report the synthesis of an asymmetric Tröger base containing the two well characterised DNA binding chromophores, proflavine and phenanthroline. The mode of interaction of the hybrid molecule was investigated by circular and linear dichroism experiments and a biochemical assay using DNA topoisomerase I. The data are compatible with a model in which the proflavine moiety intercalates between DNA base pairs and the phenanthroline ring occupies the DNA groove. DNase I cleavage experiments were carried out to investigate the sequence preference of the hybrid ligand and a well resolved footprint was detected at a site encompassing two adjacent 5'-GTC.5-GAC triplets. The sequence preference of the asymmetric molecule is compared to that of the symmetric analogues.
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Parkin regulates translesion DNA synthesis in response to UV radiation.
Zhu, Xuefei; Ma, Xiaolu; Tu, Yingfeng; Huang, Min; Liu, Hongmei; Wang, Fengli; Gong, Juanjuan; Wang, Jiuqiang; Li, Xiaoling; Chen, Qian; Shen, Hongyan; Zhu, Shu; Wang, Yun; Liu, Yang; Guo, Caixia; Tang, Tie-Shan
2017-05-30
Deficiency of Parkin is a major cause of early-onset Parkinson's disease (PD). Notably, PD patients also exhibit a significantly higher risk in melanoma and other skin tumors, while the mechanism remains largely unknown. In this study, we show that depletion of Parkin causes compromised cell viability and genome stability after ultraviolet (UV) radiation. We demonstrate that Parkin promotes efficient Rad18-dependent proliferating cell nuclear antigen (PCNA) monoubiquitination by facilitating the formation of Replication protein A (RPA)-coated ssDNA upon UV radiation. Furthermore, Parkin is found to physically interact with NBS1 (Nijmegen breakage syndrome 1), and to be required for optimal recruitment of NBS1 and DNA polymerase eta (Polη) to UV-induced damage sites. Consequently, depletion of Parkin leads to increased UV-induced mutagenesis. These findings unveil an important role of Parkin in protecting genome stability through positively regulating translesion DNA synthesis (TLS) upon UV damage, providing a novel mechanistic link between Parkin deficiency and predisposition to skin cancers in PD patients.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
2011-01-01
Background Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. Results An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). Conclusions The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at
Sobolewski, Ireneusz; Polska, Katarzyna; Zylicz-Stachula, Agnieszka; Jeżewska-Frąckowiak, Joanna; Rak, Janusz; Skowron, Piotr
2011-08-24
Restriction endonucleases are widely applied in recombinant DNA technology. Among them, enzymes of class IIS, which cleave DNA beyond recognition sites, are especially useful. We use BsaI enzyme for the pinpoint introduction of halogen nucleobases into DNA. This has been done for the purpose of anticancer radio- and phototherapy that is our long-term objective. An enzymatic method for synthesizing long double-stranded DNA labeled with the halogen derivatives of nucleobases (Hal-NBs) with 1-bp accuracy has been put forward and successfully tested on three different DNA fragments containing the 5-bromouracil (5-BrU) residue. The protocol assumes enzymatic cleavage of two Polymerase-Chain-Reaction (PCR) fragments containing two recognition sequences for the same or different class IIS restriction endonucleases, where each PCR fragment has a partially complementary cleavage site. These sites are introduced using synthetic DNA primers or are naturally present in the sequence used. The cleavage sites are not compatible, and therefore not susceptible to ligation until they are partially filled with a Hal-NB or original nucleobase, resulting in complementary cohesive end formation. Ligation of these fragments ultimately leads to the required Hal-NB-labeled DNA duplex. With this approach, a synthetic, extremely long DNA fragment can be obtained by means of a multiple assembly reaction (n × maximum PCR product length: n × app. 50 kb). The long, precisely labeled DNA duplexes obtained behave in very much the same manner as natural DNA and are beyond the range of chemical synthesis. Moreover, the conditions of synthesis closely resemble the natural ones, and all the artifacts accompanying the chemical synthesis of DNA are thus eliminated. The approach proposed seems to be completely general and could be used to label DNA at multiple pre-determined sites and with halogen derivatives of any nucleobase. Access to DNAs labeled with Hal-NBs at specific position is an
Goldman, Aaron; Shahidullah, Mohammad; Goldman, David; Khailova, Ludmila; Watts, George; Delamere, Nicholas; Dvorak, Katerina
2010-12-01
Barrett's oesophagus is a premalignant disease associated with oesophageal adenocarcinoma. The major goal of this study was to determine the mechanism responsible for bile acid-induced alteration in intracellular pH (pH(i)) and its effect on DNA damage in cells derived from normal oesophagus (HET1A) or Barrett's oesophagus (CP-A). Cells were exposed to bile acid cocktail (BA) and/or acid in the presence/absence of inhibitors of nitric oxide synthase (NOS) or sodium-hydrogen exchanger (NHE). Nitric oxide (NO), pH(i) and DNA damage were measured by fluorescent imaging and comet assay. Expression of NHE1 and NOS in cultured cells and biopsies from Barrett's oesophagus or normal squamous epithelium was determined by RT-PCR, immunoblotting or immunohistochemistry. A dose dependent decrease in pH(i) was observed in CP-A cells exposed to BA. This effect of BA is the consequence of NOS activation and increased NO production, which leads to NHE inhibition. Exposure of oesophageal cells to acid in combination with BA synergistically decreased pH(i). The decrease was more pronounced in CP-A cells and resulted in >2-fold increase in DNA damage compared to acid treatment alone. Examination of biopsies and cell lines revealed robust expression of NHE1 in Barrett's oesophagus but an absence of NHE1 in normal epithelium. The results of this study identify a new mechanism of bile acid-induced DNA damage. We found that bile acids present in the refluxate activate immediately all three isoforms of NOS, which leads to an increased NO production and NHE inhibition. This consequently results in increased intracellular acidification and DNA damage, which may lead to mutations and cancer progression. Therefore, we propose that in addition to gastric reflux, bile reflux should be controlled in patients with Barrett's oesophagus.
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Silvestri, Catherine; Brodbelt, Jennifer S.
2012-01-01
The chemotherapeutic activities of many anticancer and antibacterial drugs arise from their interactions with nucleic acid substrates. Some of these ligands interact with DNA in a way that causes conformational changes or damage to the nucleic acid targets, ultimately altering recognition by key DNA-specific enzymes, interfering with DNA transcription or prohibiting replication, and terminating cell growth and proliferation. The design and synthesis of ligands that bind to nucleic acids remains a dynamic field in medicinal chemistry and pharmaceutical research. The quest for more selective and efficacious DNA-interactive anti-cancer chemotherapeutics has likewise catalyzed the need for sensitive analytical methods that can provide structural information about the nature of the resulting DNA adducts and provide insight into the mechanistic pathways of the DNA/drug interactions and the impact on the cellular processes in biological systems. This review focuses on the array of tandem mass spectrometric strategies developed and applied for characterization of covalent adducts formed between DNA and anti-cancer ligands. PMID:23150278
Protein synthesis editing by a DNA aptamer.
Hale, S P; Schimmel, P
1996-01-01
Potential errors in decoding genetic information are corrected by tRNA-dependent amino acid recognition processes manifested through editing reactions. One example is the rejection of difficult-to-discriminate misactivated amino acids by tRNA synthetases through hydrolytic reactions. Although several crystal structures of tRNA synthetases and synthetase-tRNA complexes exist, none of them have provided insight into the editing reactions. Other work suggested that editing required active amino acid acceptor hydroxyl groups at the 3' end of a tRNA effector. We describe here the isolation of a DNA aptamer that specifically induced hydrolysis of a misactivated amino acid bound to a tRNA synthetase. The aptamer had no effect on the stability of the correctly activated amino acid and was almost as efficient as the tRNA for inducing editing activity. The aptamer has no sequence similarity to that of the tRNA effector and cannot be folded into a tRNA-like structure. These and additional data show that active acceptor hydroxyl groups in a tRNA effector and a tRNA-like structure are not essential for editing. Thus, specific bases in a nucleic acid effector trigger the editing response. Images Fig. 3 Fig. 4 PMID:8610114
Design, Synthesis, and Evaluation of Novel Tyrosine-Based DNA Gyrase B Inhibitors.
Cotman, Andrej E; Trampuž, Marko; Brvar, Matjaž; Kikelj, Danijel; Ilaš, Janez; Peterlin-Mašič, Lucija; Montalvão, Sofia; Tammela, Päivi; Frlan, Rok
2017-08-01
The discovery and synthesis of new tyrosine-based inhibitors of DNA gyrase B (GyrB), which target its ATPase subunit, is reported. Twenty-four compounds were synthesized and evaluated for activity against DNA gyrase and DNA topoisomerase IV. The antibacterial properties of selected GyrB inhibitors were demonstrated by their activity against Staphylococcus aureus and Enterococcus faecalis in the low micromolar range. The most promising compounds, 8a and 13e, inhibited Escherichia coli and S. aureus GyrB with IC 50 values of 40 and 30 µM. The same compound also inhibited the growth of S. aureus and E. faecalis with minimal inhibitory concentrations (MIC 90 ) of 14 and 28 µg/mL, respectively. © 2017 Deutsche Pharmazeutische Gesellschaft.
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman
2015-04-05
This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out. Copyright © 2014 Elsevier B.V. All rights reserved.
NASA Astrophysics Data System (ADS)
Uddin, Noor; Sirajuddin, Muhammad; Uddin, Nizam; Tariq, Muhammad; Ullah, Hameed; Ali, Saqib; Tirmizi, Syed Ahmed; Khan, Abdur Rehman
2015-04-01
This article contains the synthesis of a novel carboxylic acid derivative, its transition metal complexes and evaluation of biological applications. Six carboxylate complexes of transition metals, Zn(II) and Hg(II), have been successfully synthesized and characterized by FT-IR and NMR (1H, 13C). The ligand, HL, (4-[(2,6-Diethylphenyl)amino]-4-oxobutanoic acid) was also characterized by single crystal X-ray analysis. The complexation occurs via oxygen atoms of the carboxylate moiety. FT-IR date show the bidentate nature of the carboxylate moiety of the ligand as the Δν value in all complexes is less than that of the free ligand. The ligand and its complexes were screened for antifungal and antileishmanial activities. The results showed that the ligand and its complexes are active with few exceptions. UV-visible spectroscopy and viscometry results reveal that the ligand and its complexes interact with the DNA via intercalative mode of interaction. A new and efficient strategy to identify the pharmacophores and anti-pharmacophores sites in carboxylate derivatives for the antibacterial/antifungal activity using Petra, Osiris and Molinspiration (POM) analyses was also carried out.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Havert, Michael B.; Ji, Lin; Loeb, Daniel D.
2002-01-01
The synthesis of the hepadnavirus relaxed circular DNA genome requires two template switches, primer translocation and circularization, during plus-strand DNA synthesis. Repeated sequences serve as donor and acceptor templates for these template switches, with direct repeat 1 (DR1) and DR2 for primer translocation and 5′r and 3′r for circularization. These donor and acceptor sequences are at, or near, the ends of the minus-strand DNA. Analysis of plus-strand DNA synthesis of duck hepatitis B virus (DHBV) has indicated that there are at least three other cis-acting sequences that make contributions during the synthesis of relaxed circular DNA. These sequences, 5E, M, and 3E, are located near the 5′ end, the middle, and the 3′ end of minus-strand DNA, respectively. The mechanism by which these sequences contribute to the synthesis of plus-strand DNA was unclear. Our aim was to better understand the mechanism by which 5E and M act. We localized the DHBV 5E element to a short sequence of approximately 30 nucleotides that is 100 nucleotides 3′ of DR2 on minus-strand DNA. We found that the new 5E mutants were partially defective for primer translocation/utilization at DR2. They were also invariably defective for circularization. In addition, examination of several new DHBV M variants indicated that they too were defective for primer translocation/utilization and circularization. Thus, this analysis indicated that 5E and M play roles in both primer translocation/utilization and circularization. In conjunction with earlier findings that 3E functions in both template switches, our findings indicate that the processes of primer translocation and circularization share a common underlying mechanism. PMID:11861843
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Holden, Matthew T; Carter, Matthew C D; Wu, Cheng-Hsien; Wolfer, Jamison; Codner, Eric; Sussman, Michael R; Lynn, David M; Smith, Lloyd M
2015-11-17
The photolithographic fabrication of high-density DNA and RNA arrays on flexible and transparent plastic substrates is reported. The substrates are thin sheets of poly(ethylene terephthalate) (PET) coated with cross-linked polymer multilayers that present hydroxyl groups suitable for conventional phosphoramidite-based nucleic acid synthesis. We demonstrate that by modifying array synthesis procedures to accommodate the physical and chemical properties of these materials, it is possible to synthesize plastic-backed oligonucleotide arrays with feature sizes as small as 14 μm × 14 μm and feature densities in excess of 125 000/cm(2), similar to specifications attainable using rigid substrates such as glass or glassy carbon. These plastic-backed arrays are tolerant to a wide range of hybridization temperatures, and improved synthetic procedures are described that enable the fabrication of arrays with sequences up to 50 nucleotides in length. These arrays hybridize with S/N ratios comparable to those fabricated on otherwise identical arrays prepared on glass or glassy carbon. This platform supports the enzymatic synthesis of RNA arrays and proof-of-concept experiments are presented showing that the arrays can be readily subdivided into smaller arrays (or "millichips") using common laboratory-scale laser cutting tools. These results expand the utility of oligonucleotide arrays fabricated on plastic substrates and open the door to new applications for these important bioanalytical tools.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
A comparison of RNA with DNA in template-directed synthesis
NASA Technical Reports Server (NTRS)
Zielinski, M.; Kozlov, I. A.; Orgel, L. E.; Bada, J. L. (Principal Investigator)
2000-01-01
Nonenzymatic template-directed copying of RNA sequences rich in cytidylic acid using nucleoside 5'-(2-methylimidazol-1-yl phosphates) as substrates is substantially more efficient than the copying of corresponding DNA sequences. However, many sequences cannot be copied, and the prospect of replication in this system is remote, even for RNA. Surprisingly, wobble-pairing leads to much more efficient incorporation of G opposite U on RNA templates than of G opposite T on DNA templates.
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Efficiency, error and yield in light-directed maskless synthesis of DNA microarrays
2011-01-01
Background Light-directed in situ synthesis of DNA microarrays using computer-controlled projection from a digital micromirror device--maskless array synthesis (MAS)--has proved to be successful at both commercial and laboratory scales. The chemical synthetic cycle in MAS is quite similar to that of conventional solid-phase synthesis of oligonucleotides, but the complexity of microarrays and unique synthesis kinetics on the glass substrate require a careful tuning of parameters and unique modifications to the synthesis cycle to obtain optimal deprotection and phosphoramidite coupling. In addition, unintended deprotection due to scattering and diffraction introduce insertion errors that contribute significantly to the overall error rate. Results Stepwise phosphoramidite coupling yields have been greatly improved and are now comparable to those obtained in solid phase synthesis of oligonucleotides. Extended chemical exposure in the synthesis of complex, long oligonucleotide arrays result in lower--but still high--final average yields which approach 99%. The new synthesis chemistry includes elimination of the standard oxidation until the final step, and improved coupling and light deprotection. Coupling Insertions due to stray light are the limiting factor in sequence quality for oligonucleotide synthesis for gene assembly. Diffraction and local flare are by far the largest contributors to loss of optical contrast. Conclusions Maskless array synthesis is an efficient and versatile method for synthesizing high density arrays of long oligonucleotides for hybridization- and other molecular binding-based experiments. For applications requiring high sequence purity, such as gene assembly, diffraction and flare remain significant obstacles, but can be significantly reduced with straightforward experimental strategies. PMID:22152062
Synthesis of Mitochondrial DNA Precursors during Myogenesis, an Analysis in Purified C2C12 Myotubes*
Frangini, Miriam; Franzolin, Elisa; Chemello, Francesco; Laveder, Paolo; Romualdi, Chiara; Bianchi, Vera; Rampazzo, Chiara
2013-01-01
During myogenesis, myoblasts fuse into multinucleated myotubes that acquire the contractile fibrils and accessory structures typical of striated skeletal muscle fibers. To support the high energy requirements of muscle contraction, myogenesis entails an increase in mitochondrial (mt) mass with stimulation of mtDNA synthesis and consumption of DNA precursors (dNTPs). Myotubes are quiescent cells and as such down-regulate dNTP production despite a high demand for dNTPs. Although myogenesis has been studied extensively, changes in dNTP metabolism have not been examined specifically. In differentiating cultures of C2C12 myoblasts and purified myotubes, we analyzed expression and activities of enzymes of dNTP biosynthesis, dNTP pools, and the expansion of mtDNA. Myotubes exibited pronounced post-mitotic modifications of dNTP synthesis with a particularly marked down-regulation of de novo thymidylate synthesis. Expression profiling revealed the same pattern of enzyme down-regulation in adult murine muscles. The mtDNA increased steadily after myoblast fusion, turning over rapidly, as revealed after treatment with ethidium bromide. We individually down-regulated p53R2 ribonucleotide reductase, thymidine kinase 2, and deoxyguanosine kinase by siRNA transfection to examine how a further reduction of these synthetic enzymes impacted myotube development. Silencing of p53R2 had little effect, but silencing of either mt kinase caused 50% mtDNA depletion and an unexpected decrease of all four dNTP pools independently of the kinase specificity. We suggest that during development of myotubes the shortage of even a single dNTP may affect all four pools through dysregulation of ribonucleotide reduction and/or dissipation of the non-limiting dNTPs during unproductive elongation of new DNA chains. PMID:23297407
Natsume, Toyoaki; Nishimura, Kohei; Minocherhomji, Sheroy; Bhowmick, Rahul; Hickson, Ian D.; Kanemaki, Masato T.
2017-01-01
DNA replication fork progression can be disrupted at difficult to replicate loci in the human genome, which has the potential to challenge chromosome integrity. This replication fork disruption can lead to the dissociation of the replisome and the formation of DNA damage. To model the events stemming from replisome dissociation during DNA replication perturbation, we used a degron-based system for inducible proteolysis of a subunit of the replicative helicase. We show that MCM2-depleted cells activate a DNA damage response pathway and generate replication-associated DNA double-strand breaks (DSBs). Remarkably, these cells maintain some DNA synthesis in the absence of MCM2, and this requires the MCM8–9 complex, a paralog of the MCM2–7 replicative helicase. We show that MCM8–9 functions in a homologous recombination-based pathway downstream from RAD51, which is promoted by DSB induction. This RAD51/MCM8–9 axis is distinct from the recently described RAD52-dependent DNA synthesis pathway that operates in early mitosis at common fragile sites. We propose that stalled replication forks can be restarted in S phase via homologous recombination using MCM8–9 as an alternative replicative helicase. PMID:28487407
[Intensity of DNA synthesis in animal organs after a flight on the Kosmos-782 biosatellite].
Guseĭnov, F T; Egorov, I A; Komolova, G S; Tigranian, R A
1979-01-01
With respect to H3-thymidine incorporation the rate of DNA synthesis in the liver, spleen and thymus of rats was determined in flight and synchronous rats. Six hours post-flight the rate of H3-thymidine incorporation into the liver of flight rats did not differ from the normal (vivarium controls) and was 50% higher than in the synchronous rats. In the spleen and thymus of flight animals this parameter was 60 and 33% below the norm. Similar but less pronounced changes in the spleen were found in the synchronous rats. Twenty-five days postflight the rate of DNA synthesis in lymph organs recovered completely and tended to increase, whereas in the liver it remained significantly below the norm.
Therapeutic touch affects DNA synthesis and mineralization of human osteoblasts in culture.
Jhaveri, Ankur; Walsh, Stephen J; Wang, Yatzen; McCarthy, MaryBeth; Gronowicz, Gloria
2008-11-01
Complementary and alternative medicine (CAM) techniques are commonly used in hospitals and private medical facilities; however, the effectiveness of many of these practices has not been thoroughly studied in a scientific manner. Developed by Dr. Dolores Krieger and Dora Kunz, Therapeutic Touch is one of these CAM practices and is a highly disciplined five-step process by which a practitioner can generate energy through their hands to promote healing. There are numerous clinical studies on the effects of TT but few in vitro studies. Our purpose was to determine if Therapeutic Touch had any effect on osteoblast proliferation, differentiation, and mineralization in vitro. TT was performed twice a week for 10 min each on human osteoblasts (HOBs) and on an osteosarcoma-derived cell line, SaOs-2. No significant differences were found in DNA synthesis, assayed by [(3)H]-thymidine incorporation at 1 or 2 weeks for SaOs-2 or 1 week for HOBs. However, after four TT treatments in 2 weeks, TT significantly (p = 0.03) increased HOB DNA synthesis compared to controls. Immunocytochemistry for Proliferating Cell Nuclear Antigen (PCNA) confirmed these data. At 2 weeks in differentiation medium, TT significantly increased mineralization in HOBs (p = 0.016) and decreased mineralization in SaOs-2 (p = 0.0007), compared to controls. Additionally, Northern blot analysis indicated a TT-induced increase in mRNA expression for Type I collagen, bone sialoprotein, and alkaline phosphatase in HOBs and a decrease of these bone markers in SaOs-2 cells. In conclusion, Therapeutic Touch appears to increase human osteoblast DNA synthesis, differentiation and mineralization, and decrease differentiation and mineralization in a human osteosarcoma-derived cell line. (c) 2008 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Zhu, Yali; Song, Liping; Stroud, Jason; Parris, Deborah S
2008-01-01
Results suggest a high probability that abasic (AP) sites occur at least once per herpes simplex virus type 1 (HSV-1) genome. The parameters that control the ability of HSV-1 DNA polymerase (pol) to engage in AP translesion synthesis (TLS) were examined because AP lesions could influence the completion and fidelity of viral DNA synthesis. Pre-steady-state kinetic experiments demonstrated that wildtype (WT) and exonuclease-deficient (exo-) pol could incorporate opposite an AP lesion, but full TLS required absence of exo function. Virtually all of the WT pol was bound at the exo site to AP-containing primer-templates (P/Ts) at equilibrium, and the pre-steady-state rate of excision by WT pol was higher on AP-containing than on matched DNA. However, several factors influencing polymerization work synergistically with exo activity to prevent HSV-1 pol from engaging in TLS. Although the pre-steady-state catalytic rate constant for insertion of dATP opposite a T or AP site was similar, ground-state-binding affinity of dATP for insertion opposite an AP site was reduced 3-9-fold. Single-turnover running-start experiments demonstrated a reduced proportion of P/Ts extended to the AP site compared to the preceding site during processive synthesis by WT or exo- pol. Only the exo- pol engaged in TLS, though inefficiently and without burst kinetics, suggesting a much slower rate-limiting step for extension beyond the AP site.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Roles of exonucleases and translesion synthesis DNA polymerases during mitotic gap repair in yeast
Guo, Xiaoge; Jinks-Robertson, Sue
2013-01-01
Transformation-based gap-repair assays have long been used to model the repair of mitotic double-strand breaks (DSBs) by homologous recombination in yeast. In the current study, we examine genetic requirements of two key processes involved in DSB repair: (1) the processive 5′-end resection that is required to efficiently engage a repair template and (2) the filling of resected ends by DNA polymerases. The specific gap-repair assay used allows repair events resolved as crossover versus noncrossover products to be distinguished, as well as the extent of heteroduplex DNA formed during recombination to be measured. To examine end resection, the efficiency and outcome of gap repair were monitored in the absence of the Exo1 exonuclease and the Sgs1 helicase. We found that either Exo1 or Sgs1 presence is sufficient to inhibit gap-repair efficiency over 10-fold, consistent with resection-mediated destruction of the introduced plasmid. In terms of DNA polymerase requirements for gap repair, we focused specifically on potential roles of the Pol ζ and Pol η translesion synthesis DNA polymerases. We found that both Pol ζ and Pol η are necessary for efficient gap repair and that each functions independently of the other. These polymerases may be either in the initiation of DNA synthesis from the an invading end, or in a gap-filling process that is required to complete recombination. PMID:24210827
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Chen, Y; Feng, H; Chen, D; Abuduwaili, K; Li, X; Zhang, H
2018-01-01
The protective effects of folic acid on DNA damage and DNA methylation induced by N-methyl- N'-nitro- N-nitrosoguanidine (MNNG) in Kazakh esophageal epithelial cells were investigated using a 3 × 3 factorial design trial. The cells were cultured in vitro and exposed to media containing different concentrations of folic acid and MNNG, after which growth indices were detected. DNA damage levels were measured using comet assays, and genome-wide DNA methylation levels (MLs) were measured using high-performance liquid chromatography. The DNA methylation of methylenetetrahydrofolate reductase (MTHFR) and folate receptor- α (FR α) genes was detected by bisulfite sequencing polymerase chain reaction (PCR). The results showed significant increases in tail DNA concentration, tail length, and Olive tail moment ( p < 0.01); a significant reduction of genome-wide DNA MLs ( p < 0.01); and an increase in the methylation frequencies of MTHFR and FR α genes. In particular, significant differences were observed in the promoter regions of both genes ( p < 0.01). Our study indicated that a reduction in folic acid concentration promotes DNA damage and DNA methylation in Kazakh esophageal epithelial cells upon MNNG exposure. Thus, sufficient folic acid levels could play a protective role against the damage induced by this compound.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minor, P.D.; Dimmock, N.J.
1977-05-15
Various known inhibitors of cellular DNA function were shown to inhibit cellular RNA synthesis and influenza (fowl plague) virus multiplication. The drugs were investigated for their effect upon the synthesis of influenza virus proteins. According to this effect they could be classified with previously studied compounds as follows: Group I (ethidium bromide, proflavine, and N-nitroquinoline-N-oxide) inhibited both viral and cellular protein synthesis; Group II (nogalomycin, daunomycin and ..cap alpha..-amanitin) inhibited viral but not cellular protein synthesis, and all viral proteins were inhibited coordinately; Group III (mithramycin, echinomycin, and actinomycin D) inhibited all viral but not cellular protein synthesis at highmore » concentrations, but at a lower critical concentration inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein preferentially; Group IV(uv irradiation and camptothecin) inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein, but not other viral proteins, even at high doses. The mode of action of these inhibitors is discussed in relation to the mechanism of the nuclear events upon which influenza virus multiplication is dependent.« less
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Terminations of DNA synthesis on 'proflavine and light'-treated phi X174 single-stranded DNA.
Piette, J; Calberg-Bacq, C M; Lopez, M; van de Vorst, A
1984-04-05
Bacteriophage phi X174 single-stranded DNA molecules were primed with five different restriction fragments and irradiated with visible light in the presence of proflavine. This photodamaged DNA was used as template for the in vitro complementary chain synthesis by E. coli DNA polymerase I (Klenow fragment). Chain terminations were observed by polyacrylamide gel electrophoresis of the synthesized products and localized by comparison with standard sequencing performed simultaneously on the untreated template. 90% of the chain terminations occurred one nucleotide before a guanine residue in the template strand. More than 80% of the sequenced guanine residues were blocking lesions demonstrating the absence of 'hot-spots' for the photodamaging effect of proflavine. At a defined position, the chain termination frequency increased linearly with the irradiation time and was directly influenced by the proflavine concentration present. An important part of lesions resulted from the action of singlet oxygen produced by excited proflavine as shown by the effect that both NaN3 and 2H2O exerted on the reaction. The induced blocking lesions must be important in vivo since no complete replicative forms could be extracted from cell infected with bacteriophages inactivated by 'proflavine and light' treatment.
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Zhuo, Ming; Gorgun, Murat F; Englander, Ella W
2018-06-01
Peripheral Nervous System (PNS) neurotoxicity caused by cancer drugs hinders attainment of chemotherapy goals. Due to leakiness of the blood nerve barrier, circulating chemotherapeutic drugs reach PNS neurons and adversely affect their function. Chemotherapeutic drugs are designed to target dividing cancer cells and mechanisms underlying their toxicity in postmitotic neurons remain to be fully clarified. The objective of this work was to elucidate progression of events triggered by antimitotic drugs in postmitotic neurons. For proof of mechanism study, we chose cytarabine (ara-C), an antimetabolite used in treatment of hematological cancers. Ara-C is a cytosine analog that terminates DNA synthesis. To investigate how ara-C affects postmitotic neurons, which replicate mitochondrial but not genomic DNA, we adapted a model of Dorsal Root Ganglion (DRG) neurons. We showed that DNA polymerase γ, which is responsible for mtDNA synthesis, is inhibited by ara-C and that sublethal ara-C exposure of DRG neurons leads to reduction in mtDNA content, ROS generation, oxidative mtDNA damage formation, compromised mitochondrial respiration and diminution of NADPH and GSH stores, as well as, activation of the DNA damage response. Hence, it is plausible that in ara-C exposed DRG neurons, ROS amplified by the high mitochondrial content shifts from physiologic to pathologic levels signaling stress to the nucleus. Combined, the findings suggest that ara-C neurotoxicity in DRG neurons originates in mitochondria and that continuous mtDNA synthesis and reliance on oxidative phosphorylation for energy needs sensitize the highly metabolic neurons to injury by mtDNA synthesis terminating cancer drugs. Copyright © 2018 Elsevier Inc. All rights reserved.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Did the Pre-RNA World Rest Upon DNA Molecules?
NASA Technical Reports Server (NTRS)
Lazcano, Antonio; Dworkin, Jason P.; Miller, Stanley L.
2004-01-01
The isolation of a DNA sequence that catalyzes the ligation of oligodeoxynucleotides via the formation of 3' - 5' phosphodiester linkage significance in selection experiments has been reported. Ball recently used this to discuss the possibility that natural DNA molecules may have formed in the primitive Earth leading to the origin of life. As noted by Ferris and Usher, if metabolic pathways evolved backwards, it could be argued that the biosynthesis of 2-deoxyribose from ribose suggests that RNA came from DNA. As summarized elsewhere, there are several properties of deoxyribose which could be interpreted to support the possibility that DNA-like molecules arose prior to the RNA world. For example, 2-deoxyribose is slightly more soluble than ribose (which may have been an advantage in a drying pool scenario), may have been more reactive under possible prebiotic conditions (it forms a nucleoside approx. 150 times faster than ribose with the alternative base urazole at 25 C), while it decomposes in solution (approximately 2.6 times more slowly than ribose at 100 C). Other advantages of DNA over RNA are that it has one fewer chiral center, has a greater stability at the 8.2 pH value of the current oceans, and does not has the 2'5' and 3'5' ambiguity in polymerizations. Yet, there is strong molecular biological and biochemical evidence that RNA was featured in the biology well before the last common ancestor. The presence of sugar acids, including both ribo- and deoxysugar acids, in the 4.6 Ga old Murchison meteorite suggest that both may have been available in the primitive Earth, derived from the accretion of extraterrestrial sources and/or from endogenous processes involving formaldehyde and its derivatives. However, the abiotic synthesis of deoxyribose, ribose, and other sugars from glyceraldehyde and acetaldehyde under alkaline conditions is inefficient and unespecific. Although sugars are labile compounds, the role of cyanamide or borate minerals in the
Beyond DNA origami: A look on the bright future of nucleic acid nanotechnology
Michelotti, Nicole; Johnson-Buck, Alexander; Manzo, Anthony J.
2012-01-01
Nucleic acid nanotechnology exploits the programmable molecular recognition properties of natural and synthetic nucleic acids to assemble structures with nanometer-scale precision. In 2006, DNA origami transformed the field by providing a versatile platform for self-assembly of arbitrary shapes from one long DNA strand held in place by hundreds of short, site-specific (spatially addressable) DNA ”staples”. This revolutionary approach has led to the creation of a multitude of 2D and 3D scaffolds that form the basis for functional nanodevices. Not limited to nucleic acids, these nanodevices can incorporate other structural and functional materials, such as proteins and nanoparticles, making them broadly useful for current and future applications in emerging fields such as nanomedicine, nanoelectronics, and alternative energy. PMID:22131292
Collective helicity switching of a DNA-coat assembly
NASA Astrophysics Data System (ADS)
Kim, Yongju; Li, Huichang; He, Ying; Chen, Xi; Ma, Xiaoteng; Lee, Myongsoo
2017-07-01
Hierarchical assemblies of biomolecular subunits can carry out versatile tasks at the cellular level with remarkable spatial and temporal precision. As an example, the collective motion and mutual cooperation between complex protein machines mediate essential functions for life, such as replication, synthesis, degradation, repair and transport. Nucleic acid molecules are far less dynamic than proteins and need to bind to specific proteins to form hierarchical structures. The simplest example of these nucleic acid-based structures is provided by a rod-shaped tobacco mosaic virus, which consists of genetic material surrounded by coat proteins. Inspired by the complexity and hierarchical assembly of viruses, a great deal of effort has been devoted to design similarly constructed artificial viruses. However, such a wrapping approach makes nucleic acid dynamics insensitive to environmental changes. This limitation generally restricts, for example, the amplification of the conformational dynamics between the right-handed B form to the left-handed Z form of double-stranded deoxyribonucleic acid (DNA). Here we report a virus-like hierarchical assembly in which the native DNA and a synthetic coat undergo repeated collective helicity switching triggered by pH change under physiological conditions. We also show that this collective helicity inversion occurs during translocation of the DNA-coat assembly into intracellular compartments. Translating DNA conformational dynamics into a higher level of hierarchical dynamics may provide an approach to create DNA-based nanomachines.
DNA and RNA Synthesis in Animal Cells in Culture--Methods for Use in Schools
ERIC Educational Resources Information Center
Godsell, P. M.; Balls, M.
1973-01-01
Describes the experimental procedures used for detecting DNA and RNA synthesis in xenopus cells by autoradiography. The method described is suitable for senior high school laboratory classes or biology projects, if supervised by a teacher qualified to handle radioisotopes. (JR)
Parkin regulates translesion DNA synthesis in response to UV radiation
Huang, Min; Liu, Hongmei; Wang, Fengli; Gong, Juanjuan; Wang, Jiuqiang; Li, Xiaoling; Chen, Qian; Shen, Hongyan; Zhu, Shu; Wang, Yun; Liu, Yang; Guo, Caixia; Tang, Tie-Shan
2017-01-01
Deficiency of Parkin is a major cause of early-onset Parkinson's disease (PD). Notably, PD patients also exhibit a significantly higher risk in melanoma and other skin tumors, while the mechanism remains largely unknown. In this study, we show that depletion of Parkin causes compromised cell viability and genome stability after ultraviolet (UV) radiation. We demonstrate that Parkin promotes efficient Rad18-dependent proliferating cell nuclear antigen (PCNA) monoubiquitination by facilitating the formation of Replication protein A (RPA)-coated ssDNA upon UV radiation. Furthermore, Parkin is found to physically interact with NBS1 (Nijmegen breakage syndrome 1), and to be required for optimal recruitment of NBS1 and DNA polymerase eta (Polη) to UV-induced damage sites. Consequently, depletion of Parkin leads to increased UV-induced mutagenesis. These findings unveil an important role of Parkin in protecting genome stability through positively regulating translesion DNA synthesis (TLS) upon UV damage, providing a novel mechanistic link between Parkin deficiency and predisposition to skin cancers in PD patients. PMID:28430587
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Ghaoui, Roula; Sallustio, Benedetta C; Burcham, Philip C; Fontaine, Frank R
2003-05-06
Glucuronidation of a number of carboxyl-containing drugs generates reactive acyl glucuronide metabolites. These electrophilic species alkylate cell proteins and may be implicated in the pathogenesis of a number of toxic syndromes seen in patients receiving the parent aglycones. Whether acyl glucuronides also attack nuclear DNA is unknown, although the acyl glucuronide formed from clofibric acid was recently found to decrease the transfection efficiency of phage DNA and generate strand breaks in plasmid DNA in vitro. To determine if such a DNA damage occurs within a cellular environment, the comet assay (i.e. single-cell gel electrophoresis) was used to detect DNA lesions in the nuclear genome of isolated mouse hepatocytes cultured with clofibric acid. Overnight exposure to 50 microM and higher concentrations of clofibric acid produced concentration-dependent increases in the comet areas of hepatocyte nuclei, with 1 mM clofibrate producing a 3.6-fold elevation over controls. These effects closely coincided with culture medium concentrations of the glucuronide metabolite formed from clofibric acid, 1-O-beta-clofibryl glucuronide. Consistent with a role for glucuronidation in the DNA damage observed, the glucuronidation inhibitor borneol diminished glucuronide formation from 100 microM clofibrate by 98% and returned comet areas to baseline levels. Collectively, these results suggest that the acyl glucuronide formed from clofibric acid is capable of migrating from its site of formation within the endoplasmic reticulum to generate strand nicks in nuclear DNA.
Nucleotide Sequence Analysis of RNA Synthesized from Rabbit Globin Complementary DNA
Poon, Raymond; Paddock, Gary V.; Heindell, Howard; Whitcome, Philip; Salser, Winston; Kacian, Dan; Bank, Arthur; Gambino, Roberto; Ramirez, Francesco
1974-01-01
Rabbit globin complementary DNA made with RNA-dependent DNA polymerase (reverse transcriptase) was used as template for in vitro synthesis of 32P-labeled RNA. The sequences of the nucleotides in most of the fragments resulting from combined ribonuclease T1 and alkaline phosphatase digestion have been determined. Several fragments were long enough to fit uniquely with the α or β globin amino-acid sequences. These data demonstrate that the cDNA was copied from globin mRNA and contained no detectable contaminants. Images PMID:4139714
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
Therapeutic nucleic acids: current clinical status
Sridharan, Kannan
2016-01-01
Abstract Deoxyribonucleic acid (DNA) and ribonucleic acid (RNA) are simple linear polymers that have been the subject of considerable research in the last two decades and have now moved into the realm of being stand‐alone therapeutic agents. Much of this has stemmed from the appreciation that they carry out myriad functions that go beyond mere storage of genetic information and protein synthesis. Therapy with nucleic acids either uses unmodified DNA or RNA or closely related compounds. From both a development and regulatory perspective, they fall somewhere between small molecules and biologics. Several of these compounds are in clinical development and many have received regulatory approval for human use. This review addresses therapeutic uses of DNA based on antisense oligonucleotides, DNA aptamers and gene therapy; and therapeutic uses of RNA including micro RNAs, short interfering RNAs, ribozymes, RNA decoys and circular RNAs. With their specificity, functional diversity and limited toxicity, therapeutic nucleic acids hold enormous promise. However, challenges that need to be addressed include targeted delivery, mass production at low cost, sustaining efficacy and minimizing off‐target toxicity. Technological developments will hold the key to this and help accelerate drug approvals in the years to come. PMID:27111518
PLASMID DNA DAMAGE CAUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN
PLASMID DNA DAMAGE CAOUSED BY METHYLATED ARSENICALS, ASCORBIC ACID AND HUMAN LIVER FERRITIN
ABSTRACT
Both dimethylarsinic acid (DMA(V)) and dimethylarsinous acid (DMA(III)) release iron from human liver ferritin (HLF) with or without the presence of ascorbic acid. ...
Gannett, Peter M; Heavner, Sue; Daft, Jonathan R; Shaughnessy, Kevin H; Epperson, Jon D; Greenbaum, Nancy L
2003-10-01
Carcinogenic aryl hydrazines produce C8-arylated purine adducts. The effect of these adducts on DNA conformation and their role in hydrazine carcinogenesis are unknown. Here, we describe a new synthetic route to produce these adducts that is also compatible with the synthesis of the corresponding phosphoramidites needed for oligonucleotide synthesis. Two oligonucleotides were prepared, an unmodified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')), and a C8-phenylguanine modified oligonucleotide, d((5)(')CGCGCGCGCG(3)(')) (G = 8-phenylguanine). These oligonucleotides were compared using thermal denaturation, circular dichroism, NMR, and molecular modeling. The phenyl modification destabilizes the B DNA form and stabilizes the Z DNA form such that the B:Z ratio is near one under physiological conditions. In light of recent studies that show a role for Z DNA in gene expression and cell transformation, Z DNA stabilization by C8-arylguanine formation from aryl hydrazines may be relevant to their role in carcinogenesis.
Daigh, Leighton H; Liu, Chad; Chung, Mingyu; Cimprich, Karlene A; Meyer, Tobias
2018-06-04
Faithful DNA replication is challenged by stalling of replication forks during S phase. Replication stress is further increased in cancer cells or in response to genotoxic insults. Using live single-cell image analysis, we found that CDK2 activity fluctuates throughout an unperturbed S phase. We show that CDK2 fluctuations result from transient ATR signals triggered by stochastic replication stress events. In turn, fluctuating endogenous CDK2 activity causes corresponding decreases and increases in DNA synthesis rates, linking changes in stochastic replication stress to fluctuating global DNA replication rates throughout S phase. Moreover, cells that re-enter the cell cycle after mitogen stimulation have increased CDK2 fluctuations and prolonged S phase resulting from increased replication stress-induced CDK2 suppression. Thus, our study reveals a dynamic control principle for DNA replication whereby CDK2 activity is suppressed and fluctuates throughout S phase to continually adjust global DNA synthesis rates in response to recurring stochastic replication stress events. Copyright © 2018. Published by Elsevier Inc.
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Kitchen, J L; Li, Z; Crooke, E
1999-05-11
The initiation of Escherichia coli chromosomal replication by DnaA protein is strongly influenced by the tight binding of the nucleotides ATP and ADP. Anionic phospholipids in a fluid bilayer promote the conversion of inactive ADP-DnaA protein to replicatively active ATP-DnaA protein in vitro, and thus likely play a key role in regulating DnaA activity. Previous studies have revealed that, during this reactivation, a specific region of DnaA protein inserts into the hydrophobic portion of the lipid bilayer in an acidic phospholipid-dependent manner. To elucidate the requirement for acidic phospholipids in the reactivation process, the contribution of electrostatic forces in the interaction of DnaA and lipid was examined. DnaA-lipid binding required anionic phospholipids, and DnaA-lipid binding as well as lipid-mediated release of DnaA-bound nucleotide were inhibited by increased ionic strength, suggesting the involvement of electrostatic interactions in these processes. As the vesicular content of acidic phospholipids was increased, both nucleotide release and DnaA-lipid binding increased in a linear, parallel manner. Given that DnaA-membrane binding, the insertion of DnaA into the membrane, and the consequent nucleotide release all require anionic phospholipids, the acidic headgroup may be necessary to recruit DnaA protein to the membrane for insertion and subsequent reactivation for replication.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Beskrovnaya, O.Yu.; Fonshtein, M.Yu.; Kolibaba, L.G.
1989-01-01
Molecular cloning of Corynebacterium glutamicum genes for threonine and lysine synthesis has been done in Escherichia coli cells. The clonal library of EcoRI fragments of chromosomal DNA of C. glutamicum was constructed on the plasmid vector /lambda/pSL5. The genes for threonine and lysine synthesis were identified by complementation of E. coli mutations in thrB and lysA genes, respectively. Recombinant plasmids, isolated from independent ThrB/sup +/ clone have a common 4.1-kb long EcoRI DNA fragment. Hybrid plasmids isolated from LysA/sup +/ transductants of E. coli have common 2.2 and 3.3 kb long EcoRI fragments of C. glutamicum DNA. The hybrid plasmidsmore » consistently transduced the markers thrB/sup +/ and lysA/sup +/. The Southern hybridization analysis showed that the cloned DNA fragments hybridized with the fragments of identical length in C. glutamicum chromosomes.« less
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Taggart, David J.; Camerlengo, Terry L.; Harrison, Jason K.; Sherrer, Shanen M.; Kshetry, Ajay K.; Taylor, John-Stephen; Huang, Kun; Suo, Zucai
2013-01-01
Cellular genomes are constantly damaged by endogenous and exogenous agents that covalently and structurally modify DNA to produce DNA lesions. Although most lesions are mended by various DNA repair pathways in vivo, a significant number of damage sites persist during genomic replication. Our understanding of the mutagenic outcomes derived from these unrepaired DNA lesions has been hindered by the low throughput of existing sequencing methods. Therefore, we have developed a cost-effective high-throughput short oligonucleotide sequencing assay that uses next-generation DNA sequencing technology for the assessment of the mutagenic profiles of translesion DNA synthesis catalyzed by any error-prone DNA polymerase. The vast amount of sequencing data produced were aligned and quantified by using our novel software. As an example, the high-throughput short oligonucleotide sequencing assay was used to analyze the types and frequencies of mutations upstream, downstream and at a site-specifically placed cis–syn thymidine–thymidine dimer generated individually by three lesion-bypass human Y-family DNA polymerases. PMID:23470999
RNA:DNA Ratio and Other Nucleic Acid Derived Indices in Marine Ecology
Chícharo, Maria Alexandra; Chícharo, Luis
2008-01-01
Some of most used indicators in marine ecology are nucleic acid-derived indices. They can be divided by target levels in three groups: 1) at the organism level as ecophysiologic indicators, indicators such as RNA:DNA ratios, DNA:dry weight and RNA:protein, 2) at the population level, indicators such as growth rate, starvation incidence or fisheries impact indicators, and 3) at the community level, indicators such as trophic interactions, exergy indices and prey identification. The nucleic acids derived indices, especially RNA:DNA ratio, have been applied with success as indicators of nutritional condition, well been and growth in marine organisms. They are also useful as indicators of natural or anthropogenic impacts in marine population and communities, such as upwelling or dredge fisheries, respectively. They can help in understanding important issues of marine ecology such as trophic interactions in marine environment, fish and invertebrate recruitment failure and biodiversity changes, without laborious work of counting, measuring and identification of small marine organisms. Besides the objective of integrate nucleic acid derived indices across levels of organization, the paper will also include a general characterization of most used nucleic acid derived indices in marine ecology and also advantages and limitations of them. We can conclude that using indicators, such RNA:DNA ratios and other nucleic acids derived indices concomitantly with organism and ecosystems measures of responses to climate change (distribution, abundance, activity, metabolic rate, survival) will allow for the development of more rigorous and realistic predictions of the effects of anthropogenic climate change on marine systems. PMID:19325815
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-01-01
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase η, the POLH gene product. A deficiency in DNA polymerase η due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase ζ cooperates with DNA polymerases κ and ι to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases ζ and κ, but not ι, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load. PMID:19564618
Ziv, Omer; Geacintov, Nicholas; Nakajima, Satoshi; Yasui, Akira; Livneh, Zvi
2009-07-14
Human cells tolerate UV-induced cyclobutane pyrimidine dimers (CPD) by translesion DNA synthesis (TLS), carried out by DNA polymerase eta, the POLH gene product. A deficiency in DNA polymerase eta due to germ-line mutations in POLH causes the hereditary disease xeroderma pigmentosum variant (XPV), which is characterized by sunlight sensitivity and extreme predisposition to sunlight-induced skin cancer. XPV cells are UV hypermutable due to the activity of mutagenic TLS across CPD, which explains the cancer predisposition of the patients. However, the identity of the backup polymerase that carries out this mutagenic TLS was unclear. Here, we show that DNA polymerase zeta cooperates with DNA polymerases kappa and iota to carry out error-prone TLS across a TT CPD. Moreover, DNA polymerases zeta and kappa, but not iota, protect XPV cells against UV cytotoxicity, independently of nucleotide excision repair. This presents an extreme example of benefit-risk balance in the activity of TLS polymerases, which provide protection against UV cytotoxicity at the cost of increased mutagenic load.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kirsten, E.; Bauer, P.I.; Kun, E.
1991-03-01
The cellular inhibitory effects of 6-amino-1,2-benzopyrone (6-ABP), a DNA site-specific ligand of adenosine diphosphoribosyl transferase (ADPRT), were determined in a dexamethasone-sensitive EJ-ras gene construct containing cell line (14C cells). Dexamethansone in vitro transforms these cells to a tumorigenic phenotype and also stimulates cell replication. AT a nontoxic concentration 6-ABP treatment of intact cells for 4 days inhibits the dexamethasone-stimulated increment of cellular DNA content, depresses replicative DNA synthesis as assayed by thymidine incorporation to the level of cells that were not exposed to dexamethasone, and in permeabilized cells reduces the dexamethasone-stimulated increase of deoxyribonucleotide incorporation into DNA to the levelmore » of untreated cells. In situ pulse labeling of cells pretreated with 6-ABP indicated an inhibition of DNA synthesis at a stage prior to the formation of the 10-kb intermediate species. Neither dexamethasone nor the drug influenced the cellular quantity of ADPRT molecules, tested immunochemically.« less
Ceccarelli, Veronica; Valentini, Virginia; Ronchetti, Simona; Cannarile, Lorenza; Billi, Monia; Riccardi, Carlo; Ottini, Laura; Talesa, Vincenzo Nicola; Grignani, Francesco; Vecchini, Alba
2018-05-14
In cancer cells, global genomic hypomethylation is found together with localized hypermethylation of CpG islands within the promoters and regulatory regions of silenced tumor suppressor genes. Demethylating agents may reverse hypermethylation, thus promoting gene re-expression. Unfortunately, demethylating strategies are not efficient in solid tumor cells. DNA demethylation is mediated by ten-eleven translocation enzymes (TETs). They sequentially convert 5-methylcytosine (5mC) to 5-hydroxymethylcytosine (5hmC), which is associated with active transcription; 5-formylcytosine; and finally, 5-carboxylcytosine. Although α-linolenic acid, eicosapentaenoic acid (EPA), and docosahexaenoic acid, the major n-3 polyunsaturated fatty acids, have anti-cancer effects, their action, as DNA-demethylating agents, has never been investigated in solid tumor cells. Here, we report that EPA demethylates DNA in hepatocarcinoma cells. EPA rapidly increases 5hmC on DNA, inducing p21 Waf1/Cip1 gene expression, which slows cancer cell-cycle progression. We show that the underlying molecular mechanism involves TET1. EPA simultaneously binds peroxisome proliferator-activated receptor γ (PPARγ) and retinoid X receptor α (RXRα), thus promoting their heterodimer and inducing a PPARγ-TET1 interaction. They generate a TET1-PPARγ-RXRα protein complex, which binds to a hypermethylated CpG island on the p21 gene, where TET1 converts 5mC to 5hmC. In an apparent shuttling motion, PPARγ and RXRα leave the DNA, whereas TET1 associates stably. Overall, EPA directly regulates DNA methylation levels, permitting TET1 to exert its anti-tumoral function.-Ceccarelli, V., Valentini, V., Ronchetti, S., Cannarile, L., Billi, M., Riccardi, C., Ottini, L., Talesa, V. N., Grignani, F., Vecchini, A., Eicosapentaenoic acid induces DNA demethylation in carcinoma cells through a TET1-dependent mechanism.
SYNTHESIS, IN VITRO METABOLISM, MUTAGENICITY, AND DNA-ADDUCTION OF NAPHTHO[1,2-E]PYRENE
SYNTHESIS, IN V1TRO METABOLISM, MUTAGENICITY , AND DNA-ADDUCnON OF NAPHTHO[l ,2-e ]PYRENE
Literature data, although limited, underscore the contribution of C24HI4 polycyclic aromatic hydrocarbons to the biological activity of the extracts of complex environmental samples....
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
NASA Astrophysics Data System (ADS)
Enriquez Schumacher, Iris Vanessa
Conventional cancer chemotherapy results in systemic toxicity which severely limits effectiveness and often adversely affects patient quality of life. There is a need to find new drugs and delivery methods for less toxic therapy. Previous studies concerning DNA complexing with chemotherapy drugs suggest unique opportunities for DNA as a mesosphere drug carrier. The overall objective of this research was devoted to the synthesis and evaluation of novel DNA-drug nano-mesospheres designed for localized chemotherapy via intratumoral injection. My research presents DNA nano-meso-microspheres (DNA-MS) that were prepared using a modified steric stabilization method originally developed in this lab for the preparation of albumin MS. DNA-MS were prepared with glutaraldehyde covalent crosslinking (genipin crosslinking was attempted) through the DNA base pairs. In addition, novel crosslinking of DNA-MS was demonstrated using chromium, gadolinium, or iron cations through the DNA phosphate groups. Covalent and ionic crosslinked DNA-MS syntheses yielded smooth and spherical particle morphologies with multimodal size distributions. Optimized DNA-MS syntheses produced particles with narrow and normal size distributions in the 50nm to 5mum diameter size range. In aqueous dispersions approximately 200% swelling was observed with dispersion stability for more than 48 hours. Typical process conditions included a 1550rpm initial mixing speed and particle filtration through 20mum filters to facilitate preparation. DNA-MS were in situ loaded during synthesis for the first time with mitoxantrone, 5-fluorouracil, and methotrexate. DNA-MS drug incorporation was 12%(w/w) for mitoxantrone, 9%(w/w) for methotrexate, and 5%(w/w) for 5-fluorouracil. In vitro drug release into phosphate buffered saline was observed for over 35 days by minimum sink release testing. The effect of gadolinium crosslink concentration on mitoxantrone release was evaluated at molar equivalences in the range of 20% to
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
Sánchez, Beatriz; Rodríguez, Mar; Casado, Eva M; Martín, Alberto; Córdoba, Juan J
2008-12-01
A variety of previously established mechanical and chemical treatments to achieve fungal cell lysis combined with a semiautomatic system operated by a vacuum pump were tested to obtain DNA extract to be directly used in randomly amplified polymorphic DNA (RAPD)-PCR to differentiate cyclopiazonic acid-producing and -nonproducing mold strains. A DNA extraction method that includes digestion with proteinase K and lyticase prior to using a mortar and pestle grinding and a semiautomatic vacuum system yielded DNA of high quality in all the fungal strains and species tested, at concentrations ranging from 17 to 89 ng/microl in 150 microl of the final DNA extract. Two microliters of DNA extracted with this method was directly used for RAPD-PCR using primer (GACA)4. Reproducible RAPD fingerprints showing high differences between producer and nonproducer strains were observed. These differences in the RAPD patterns did not differentiate all the strains tested in clusters by cyclopiazonic acid production but may be very useful to distinguish cyclopiazonic acid producer strains from nonproducer strains by a simple RAPD analysis. Thus, the DNA extracts obtained could be used directly without previous purification and quantification for RAPD analysis to differentiate cyclopiazonic acid producer from nonproducer mold strains. This combined analysis could be adaptable to other toxigenic fungal species to enable differentiation of toxigenic and non-toxigenic molds, a procedure of great interest in food safety.
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
In vivo evidence for translesion synthesis by the replicative DNA polymerase δ
Hirota, Kouji; Tsuda, Masataka; Mohiuddin; Tsurimoto, Toshiki; Cohen, Isadora S.; Livneh, Zvi; Kobayashi, Kaori; Narita, Takeo; Nishihara, Kana; Murai, Junko; Iwai, Shigenori; Guilbaud, Guillaume; Sale, Julian E.; Takeda, Shunichi
2016-01-01
The intolerance of DNA polymerase δ (Polδ) to incorrect base pairing contributes to its extremely high accuracy during replication, but is believed to inhibit translesion synthesis (TLS). However, chicken DT40 cells lacking the POLD3 subunit of Polδ are deficient in TLS. Previous genetic and biochemical analysis showed that POLD3 may promote lesion bypass by Polδ itself independently of the translesion polymerase Polζ of which POLD3 is also a subunit. To test this hypothesis, we have inactivated Polδ proofreading in pold3 cells. This significantly restored TLS in pold3 mutants, enhancing dA incorporation opposite abasic sites. Purified proofreading-deficient human Polδ holoenzyme performs TLS of abasic sites in vitro much more efficiently than the wild type enzyme, with over 90% of TLS events resulting in dA incorporation. Furthermore, proofreading deficiency enhances the capability of Polδ to continue DNA synthesis over UV lesions both in vivo and in vitro. These data support Polδ contributing to TLS in vivo and suggest that the mutagenesis resulting from loss of Polδ proofreading activity may in part be explained by enhanced lesion bypass. PMID:27185888
Ketone-DNA: a versatile postsynthetic DNA decoration platform.
Dey, S; Sheppard, T L
2001-12-13
[reaction: see text] A general strategy for the functional diversification of DNA oligonucleotides under physiological conditions was developed. We describe the synthesis of DNA molecules bearing ketone ports (ketone-DNA) and the efficient postsynthetic decoration of ketone-DNA with structurally diverse aminooxy compounds.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
NASA Astrophysics Data System (ADS)
Sirajuddin, Muhammad; Nooruddin; Ali, Saqib; McKee, Vickie; Khan, Shahan Zeb; Malook, Khan
2015-01-01
The titled compound, 4-(5-chloro-2-hydroxyphenylamino)-4-oxobut-2-enoic acid was synthesized and characterized by various techniques like elemental analyses, FT-IR, NMR (1H, and 13C) and single crystal X-ray structural analysis. The appearance of the OH peak of the carboxylic acid in the FT-IR and NMR spectra conform the formation of the compound. A good agreement was found between the calculated values of C, H, N and found values in elemental analysis that show the purity of the compound. Protons H2 and H3 are in cis conformation with each other as conformed both from 1H NMR as well as from single crystal X-ray analysis. The molecular structure of the title compound, C10H10NO3Cl, is stabilized by short intramolecular Osbnd H- - -O hydrogen bonds within the molecule. In the crystal structure, intermolecular Nsbnd H- - -O hydrogen bonds link molecules into zigzag chains resulting in a dendrimer like structure. The title compound was screened for biological activities like interaction with DNA, cytotoxicity, antitumor and antioxidant activities. DNA interaction study reveals that the binding mode of interaction of the compound with SS-DNA is intercalative as it results in hypochromism along with significant red shift of 5 nm. It was also found to be effective antioxidant of 2,2-diphenyl-1-picrylhydrazyl radical (DPPH) and show almost comparable antioxidant activity to that of the standard and known antioxidant, ascorbic acid, at higher concentration. The antitumor activity data of the compound shows that it can be used as potent antitumor agent.
Flexibility of nucleic acids: From DNA to RNA
NASA Astrophysics Data System (ADS)
Lei, Bao; Xi, Zhang; Lei, Jin; Zhi-Jie, Tan
2016-01-01
The structural flexibility of nucleic acids plays a key role in many fundamental life processes, such as gene replication and expression, DNA-protein recognition, and gene regulation. To obtain a thorough understanding of nucleic acid flexibility, extensive studies have been performed using various experimental methods and theoretical models. In this review, we will introduce the progress that has been made in understanding the flexibility of nucleic acids including DNAs and RNAs, and will emphasize the experimental findings and the effects of salt, temperature, and sequence. Finally, we will discuss the major unanswered questions in understanding the flexibility of nucleic acids. Project supported by the National Basic Research Program of China (Grant No. 2011CB933600), the National Natural Science Foundation of China (Grant Nos. 11175132, 11575128, and 11374234), and the Program for New Century Excellent Talents, China (Grant No. NCET 08-0408).
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Uracil misincorporation into DNA and folic acid supplementation123
Selhub, Jacob; Chao, Wei-Hsun; Ueland, Per Magne; Hunter, David J; Baron, John A
2010-01-01
Background: Folate deficiency decreases thymidylate synthesis from deoxyuridylate, which results in an imbalance of deoxyribonucleotide that may lead to excessive uracil misincorporation (UrMis) into DNA during replication and repair. Objective: We evaluated the relation between UrMis in different tissues and the effect of folate supplementation on UrMis. Design: We analyzed UrMis concentrations in rectal mucosa (n = 92) and white blood cells (WBCs; n = 60) among individuals randomly assigned to receive supplementation with 1 mg folate/d or placebo, who were then evaluated for colorectal adenoma recurrence. Results: As expected, total homocysteine was significantly lower among the study participants who received active folate treatment (Wilcoxon's P = 0.003) than among those in the placebo group. The median UrMis concentration in rectal mucosa and WBCs among individuals treated with folate was not significantly lower than that in those who received placebo (Wilcoxon's P = 0.17). UrMis concentrations in both rectal mucosa and WBCs did not correlate significantly with folate measured in plasma and red blood cells. UrMis in rectal mucosa was marginally associated with an increased risk of adenoma recurrence (odds ratio per SD: 1.43; 95% CI: 0.91, 2.25). Conclusions: UrMis measurements in WBCs are not a robust surrogate for UrMis measurements in the rectal mucosa (Spearman correlation coefficient = 0.23, P = 0.08). Furthermore, folate supplementation in an already replete population (half treated with folic acid supplements and all exposed to folic acid fortification of the food supply) was not significantly associated with reduced UrMis in rectal mucosa cells or WBCs. Large-scale studies are needed to evaluate whether excessive UrMis concentrations are an important risk factor for colorectal neoplasia. This trial was registered at clinicaltrials.gov as NCT00272324. PMID:19923375
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
[Comparative analysis between diatom nitric acid digestion method and plankton 16S rDNA PCR method].
Han, Jun-ge; Wang, Cheng-bao; Li, Xing-biao; Fan, Yan-yan; Feng, Xiang-ping
2013-10-01
To compare and explore the application value of diatom nitric acid digestion method and plankton 16S rDNA PCR method for drowning identification. Forty drowning cases from 2010 to 2011 were collected from Department of Forensic Medicine of Wenzhou Medical University. Samples including lung, kidney, liver and field water from each case were tested with diatom nitric acid digestion method and plankton 16S rDNA PCR method, respectively. The Diatom nitric acid digestion method and plankton 16S rDNA PCR method required 20 g and 2 g of each organ, and 15 mL and 1.5 mL of field water, respectively. The inspection time and detection rate were compared between the two methods. Diatom nitric acid digestion method mainly detected two species of diatoms, Centriae and Pennatae, while plankton 16S rDNA PCR method amplified a length of 162 bp band. The average inspection time of each case of the Diatom nitric acid digestion method was (95.30 +/- 2.78) min less than (325.33 +/- 14.18) min of plankton 16S rDNA PCR method (P < 0.05). The detection rates of two methods for field water and lung were both 100%. For liver and kidney, the detection rate of plankton 16S rDNA PCR method was both 80%, higher than 40% and 30% of diatom nitric acid digestion method (P < 0.05), respectively. The laboratory testing method needs to be appropriately selected according to the specific circumstances in the forensic appraisal of drowning. Compared with diatom nitric acid digestion method, plankton 16S rDNA PCR method has practice values with such advantages as less quantity of samples, huge information and high specificity.
NASA Astrophysics Data System (ADS)
Abdel-Rahman, Laila H.; El-Khatib, Rafat M.; Nassr, Lobna A. E.; Abu-Dief, Ahmed M.; Ismael, Mohamed; Seleem, Amin Abdou
2014-01-01
In recent years, great interest has been focused on Fe(II) Schiff base amino acid complexes as cytotoxic and antitumor drugs. Thus a series of new iron(II) complexes based on Schiff bases amino acids ligands have been designed and synthesized from condensation of 5-bromosalicylaldehyde (bs) and α-amino acids (L-alanine (ala), L-phenylalanine (phala), L-aspartic acid (aspa), L-histidine (his) and L-arginine (arg)). The structure of the investigated iron(II) complexes was elucidated using elemental analyses, infrared, ultraviolet-visible, thermogravimetric analysis, as well as conductivity and magnetic susceptibility measurements. Moreover, the stoichiometry and the stability constants of the prepared complexes have been determined spectrophotometrically. The results suggest that 5-bromosalicylaldehyde amino acid Schiff bases (bs:aa) behave as dibasic tridentate ONO ligands and coordinate to Fe(II) in octahedral geometry according to the general formula [Fe(bs:aa)2]ṡnH2O. The conductivity values between 37 and 64 ohm-1 mol-1 cm2 in ethanol imply the presence of nonelectrolyte species. The structure of the complexes was validated using quantum mechanics calculations based on accurate DFT methods. Geometry optimization of the Fe-Schiff base amino acid complexes showed that all complexes had octahedral coordination. In addition, the interaction of these complexes with (CT-DNA) was investigated at pH = 7.2, by using UV-vis absorption, viscosity and agarose gel electrophoresis measurements. Results indicated that the investigated complexes strongly bind to calf thymus DNA via intercalative mode and showed a different DNA binding according to the sequence: bsari > bshi > bsali > bsasi > bsphali. Moreover, the prepared compounds are screened for their in vitro antibacterial and antifungal activity against three types of bacteria, Escherichia coli, Pseudomonas aeruginosa and Bacillus cereus and three types of anti fungal cultures, Penicillium purpurogenium, Aspergillus
Eukaryotic DNA Replication Fork.
Burgers, Peter M J; Kunkel, Thomas A
2017-06-20
This review focuses on the biogenesis and composition of the eukaryotic DNA replication fork, with an emphasis on the enzymes that synthesize DNA and repair discontinuities on the lagging strand of the replication fork. Physical and genetic methodologies aimed at understanding these processes are discussed. The preponderance of evidence supports a model in which DNA polymerase ε (Pol ε) carries out the bulk of leading strand DNA synthesis at an undisturbed replication fork. DNA polymerases α and δ carry out the initiation of Okazaki fragment synthesis and its elongation and maturation, respectively. This review also discusses alternative proposals, including cellular processes during which alternative forks may be utilized, and new biochemical studies with purified proteins that are aimed at reconstituting leading and lagging strand DNA synthesis separately and as an integrated replication fork.
Sallustio, Benedetta C; Degraaf, Yvette C; Weekley, Josephine S; Burcham, Philip C
2006-05-01
Nonenzymatic modification of proteins by acyl glucuronides is well documented; however, little is known about their potential to damage DNA. We have previously reported that clofibric acid undergoes glucuronidation-dependent bioactivation to DNA-damaging species in cultured mouse hepatocytes. The aim of this study was to investigate the mechanisms underlying such DNA damage, and to screen chemically diverse carboxylic acid drugs for their DNA-damaging potential in glucuronidation proficient murine hepatocytes. Cells were incubated with each aglycone for 18 h, followed by assessment of compound cytotoxicity using the MTT assay and evaluation of DNA damage using the Comet assay. Relative cytotoxic potencies were ketoprofen > diclofenac, benoxaprofen, nafenopin > gemfibrozil, probenecid > bezafibrate > clofibric acid. At a noncytotoxic (0.1 mM) concentration, only benoxaprofen, nafenopin, clofibric acid, and probenecid significantly increased Comet moments (P < 0.05 Kruskal-Wallis). Clofibric acid and probenecid exhibited the greatest DNA-damaging potency, producing significant DNA damage at 0.01 mM concentrations. The two drugs produced maximal increases in Comet moment of 4.51 x and 2.57 x control, respectively. The glucuronidation inhibitor borneol (1 mM) abolished the induction of DNA damage by 0.5 mM concentrations of clofibric acid and probenecid. In an in vitro cell-free system, clofibric acid glucuronide was 10 x more potent than glucuronic acid in causing DNA strand-nicking, although both compounds showed similar rates of autoxidation to generate hydroxyl radicals. In cultured hepatocytes, the glycation inhibitor, aminoguanidine, and the iron chelator, desferrioxamine mesylate, inhibited DNA damage by clofibric acid, whereas the free radical scavengers Trolox and butylated hydroxytoluene, and the superoxide dismutase mimetic bis-3,5-diisopropylsalicylate had no effect. In conclusion, clinically relevant concentrations of two structurally unrelated carboxylic
NUCLEIC ACID AND PROTEIN METABOLISM DURING THE MITOTIC CYCLE IN VICIA FABA
Woodard, John; Rasch, Ellen; Swift, Hewson
1961-01-01
In order to investigate some of the cytochemical processes involved in interphase growth and culminating in cell division, a combined autoradiographic and microphotometric study of nucleic acids and proteins was undertaken on statistically seriated cells of Vicia faba root meristems. Adenine-8-C14 and uridine-H3 were used as ribonucleic acid (RNA) precursors, thymidine-H3 as a deoxyribonucleic acid (DNA) precursor, and phenylalanine-3-C14 as a protein precursor. Stains used in microphotometry were Feulgen (DNA), azure B (RNA), pH 2.0 fast green (total protein), and pH 8.1 fast green (histone). The autoradiographic data (representing rate of incorporation per organelle) and the microphotometric data (representing changes in amounts of the various components) indicate that the mitotic cycle may be divided into several metabolic phases, three predominantly anabolic (net increase), and a fourth phase predominantly catabolic (net decrease). The anabolic periods are: 1. Telophase to post-telophase during which there are high rates of accumulation of cytoplasmic and nucleolar RNA and nucleolar and chromosomal total protein. 2. Post-telophase to preprophase characterized by histone synthesis and a diphasic synthesis of DNA with the peak of synthesis at mid-interphase and a minor peak just preceding prophase. The minor peak is coincident with a relatively localized DNA synthesis in several chromosomal regions. This period is also characterized by minimal accumulations of cytoplasmic RNA and chromosomal and nucleolar total protein and RNA. 3. Preprophase to prophase in which there are again high rates of accumulation of cytoplasmic RNA, and nucleolar and chromosomal total protein and RNA. The catabolic phase is: 4. The mitotic division during which there are marked losses of cytoplasmic RNA and chromosomal and nucleolar total protein and RNA. PMID:13786522
Yao, Jiangwei; Bruhn, David F.; Frank, Matthew W.; Lee, Richard E.; Rock, Charles O.
2016-01-01
Neisseria is a Gram-negative pathogen with phospholipids composed of straight chain saturated and monounsaturated fatty acids, the ability to incorporate exogenous fatty acids, and lipopolysaccharides that are not essential. The FabI inhibitor, AFN-1252, was deployed as a chemical biology tool to determine whether Neisseria can bypass the inhibition of fatty acid synthesis by incorporating exogenous fatty acids. Neisseria encodes a functional FabI that was potently inhibited by AFN-1252. AFN-1252 caused a dose-dependent inhibition of fatty acid synthesis in growing Neisseria, a delayed inhibition of growth phenotype, and minimal inhibition of DNA, RNA, and protein synthesis, showing that its mode of action is through inhibiting fatty acid synthesis. Isotopic fatty acid labeling experiments showed that Neisseria encodes the ability to incorporate exogenous fatty acids into its phospholipids by an acyl-acyl carrier protein-dependent pathway. However, AFN-1252 remained an effective antibacterial when Neisseria were supplemented with exogenous fatty acids. These results demonstrate that extracellular fatty acids are activated by an acyl-acyl carrier protein synthetase (AasN) and validate type II fatty acid synthesis (FabI) as a therapeutic target against Neisseria. PMID:26567338
NASA Astrophysics Data System (ADS)
Reiß, Edda; Hölzel, Ralph; von Nickisch-Rosenegk, Markus; Bier, Frank F.
2006-09-01
In this article the usefulness of the enzyme phi29 DNA polymerase and the principle of rolling circle amplification (RCA) for creating single-stranded DNA (ssDNA) nanostructures is described. Currently we are working on the spatial orientation of a growing ssDNA molecule during its RCA-based synthesis by the application of a hydrodynamic force. Starting at an immobilized primer at single molecule level, the aim is to construct a nanostructure of known location and orientation, providing multiple repeating binding sites that can be addressed via complementary base-pairing. Proof-of-principle experiments demonstrate the potential of the enzymatic reaction. ssDNA molecules of more than 20 μm length were created at an immobilized primer and detected by means of fluorescence microscopy.
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Guilan Chen; Elisabeth M. Perchellet; Xiao Mei Gao; Fatima K. Johnson; Amy W. Davis; Steven W. Newell; Richard W. Hemingway; Vittorio Bottari; Jean-Pierre Perchellett
1996-01-01
m-Chloroperoxybenzoic acid (CPBA). Which induces ornithine decarboxylase activity as much as 12-0- terradecanoyIp horbol-13-acetate (TPA ). was tested for its ability to induce DNA synthesis. bydroperoxide (HPx) production. and tumor promotion in mouse epidermis in vivo. After an early inhibition. CPBA stimulates DNA synthesis. A response which is maintained between 16...
Assessment of DNA synthesis in Islet-1{sup +} cells in the adult murine heart
DOE Office of Scientific and Technical Information (OSTI.GOV)
Weinberger, Florian, E-mail: f.weinberger@uke.de; Mehrkens, Dennis, E-mail: dennis.mehrkens@uk-koeln.de; Starbatty, Jutta, E-mail: starbatty@uke.uni-hamburg.de
Highlights: • Islet-1 was expressed in the adult heart. • Islet-1-positive cells did not proliferate in the adult heart. • Sinoatrial node cells did not proliferate in the adult heart. - Abstract: Rationale: Islet-1 positive (Islet-1{sup +}) cardiac progenitor cells give rise to the right ventricle, atria and outflow tract during murine cardiac development. In the adult heart Islet-1 expression is limited to parasympathetic neurons, few cardiomyocytes, smooth muscle cells, within the proximal aorta and pulmonary artery and sinoatrial node cells. Its role in these cells is unknown. Here we tested the hypothesis that Islet-1{sup +} cells retain proliferative activitymore » and may therefore play a role in regenerating specialized regions in the heart. Methods and results: DNA synthesis was analyzed by the incorporation of tritiated thymidine ({sup 3}H-thymidine) in Isl-1-nLacZ mice, a transgenic model with an insertion of a nuclear beta-galactosidase in the Islet-1 locus. Mice received daily injections of {sup 3}H-thymidine for 5 days. DNA synthesis was visualized throughout the heart by dipping autoradiography of cryosections. Colocalization of an nLacZ-signal and silver grains would indicate DNA synthesis in Islet-1{sup +} cells. Whereas Islet{sup −} non-myocyte nuclei were regularly marked by accumulation of silver grains, colocalization with nLacZ-signals was not detected in >25,000 cells analyzed. Conclusions: Islet-1{sup +} cells are quiescent in the adult heart, suggesting that, under normal conditions, even pacemaking cells do not proliferate at higher rates than normal cardiac myocytes.« less
Cell-free protein synthesis: the state of the art.
Whittaker, James W
2013-02-01
Cell-free protein synthesis harnesses the synthetic power of biology, programming the ribosomal translational machinery of the cell to create macromolecular products. Like PCR, which uses cellular replication machinery to create a DNA amplifier, cell-free protein synthesis is emerging as a transformative technology with broad applications in protein engineering, biopharmaceutical development, and post-genomic research. By breaking free from the constraints of cell-based systems, it takes the next step towards synthetic biology. Recent advances in reconstituted cell-free protein synthesis (Protein synthesis Using Recombinant Elements expression systems) are creating new opportunities to tailor the reactions for specialized applications including in vitro protein evolution, printing protein microarrays, isotopic labeling, and incorporating nonnatural amino acids.
5-Hydroxymethylcytosine is a predominantly stable DNA modification
NASA Astrophysics Data System (ADS)
Bachman, Martin; Uribe-Lewis, Santiago; Yang, Xiaoping; Williams, Michael; Murrell, Adele; Balasubramanian, Shankar
2014-12-01
5-Hydroxymethylcytosine (hmC) is an oxidation product of 5-methylcytosine which is present in the deoxyribonucleic acid (DNA) of most mammalian cells. Reduction of hmC levels in DNA is a hallmark of cancers. Elucidating the dynamics of this oxidation reaction and the lifetime of hmC in DNA is fundamental to understanding hmC function. Using stable isotope labelling of cytosine derivatives in the DNA of mammalian cells and ultrasensitive tandem liquid-chromatography mass spectrometry, we show that the majority of hmC is a stable modification, as opposed to a transient intermediate. In contrast with DNA methylation, which occurs immediately during replication, hmC forms slowly during the first 30 hours following DNA synthesis. Isotopic labelling of DNA in mouse tissues confirmed the stability of hmC in vivo and demonstrated a relationship between global levels of hmC and cell proliferation. These insights have important implications for understanding the states of chemically modified DNA bases in health and disease.
Taspinar, Mahmut Sinan; Aydin, Murat; Sigmaz, Burcu; Yildirim, Nalan; Agar, Guleray
2017-10-01
Picloram (4-amino-3,5,6-trichloropicolinic acid) is a liquid auxinic herbicide used to control broad-leaved weeds. Picloram is representing a possible hazard to ecosystems and human health. Therefore, in this study, DNA methylation changes and DNA damage levels in Phaseolus vulgaris exposed to picloram, as well as whether humic acid (HA) has preventive effects on these changes were investigated. Random amplified polymorphic DNA (RAPD) techniques were used for identification of DNA damage and coupled restriction enzyme digestion-random amplification (CRED-RA) techniques were used to detect the changed pattern of DNA methylation. According to the obtained results, picloram (5, 10, 20, and 40 mg/l) caused DNA damage profile changes (RAPDs) increasing, DNA hypomethylation and genomic template stability (GTS) decreasing. On the other hand, different concentrations of applied HA (2, 4, 6, 8, and 10%) reduced hazardous effects of picloram. The results of the experiment have explicitly indicated that HAs could be an alternative for reducing genetic damage in plants. In addition to the alleviate effects of humic acid on genetic damage, its epigenetic effect is hypomethylation.
Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis.
Pham, Phuong; Seitz, Erica M; Saveliev, Sergei; Shen, Xuan; Woodgate, Roger; Cox, Michael M; Goodman, Myron F
2002-08-20
SOS mutagenesis in Escherichia coli requires DNA polymerase V (pol V) and RecA protein to copy damaged DNA templates. Here we show that two distinct biochemical modes for RecA protein are necessary for pol V-catalyzed translesion synthesis. One RecA mode is characterized by a strong stimulation in nucleotide incorporation either directly opposite a lesion or at undamaged template sites, but by the absence of lesion bypass. A separate RecA mode is necessary for translesion synthesis. The RecA1730 mutant protein, which was identified on the basis of its inability to promote pol V (UmuD'(2)C)-dependent UV-mutagenesis, appears proficient for the first mode of RecA action but is deficient in the second mode. Data are presented suggesting that the two RecA modes are "nonfilamentous". That is, contrary to current models for SOS mutagenesis, formation of a RecA nucleoprotein filament may not be required for copying damaged DNA templates. Instead, SOS mutagenesis occurs when pol V interacts with two RecA molecules, first at a 3' primer end, upstream of a template lesion, where RecA mode 1 stimulates pol V activity, and subsequently at a site immediately downstream of the lesion, where RecA mode 2 cocatalyzes lesion bypass. We posit that in vivo assembly of a RecA nucleoprotein filament may be required principally to target pol V to a site of DNA damage and to stabilize the pol V-RecA interaction at the lesion. However, it is only a RecA molecule located at the 3' filament tip, proximal to a damaged template base, that is directly responsible for translesion synthesis.
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Genna, Vito; Gaspari, Roberto; Dal Peraro, Matteo; De Vivo, Marco
2016-04-07
Trans-lesion synthesis polymerases, like DNA Polymerase-η (Pol-η), are essential for cell survival. Pol-η bypasses ultraviolet-induced DNA damages via a two-metal-ion mechanism that assures DNA strand elongation, with formation of the leaving group pyrophosphate (PPi). Recent structural and kinetics studies have shown that Pol-η function depends on the highly flexible and conserved Arg61 and, intriguingly, on a transient third ion resolved at the catalytic site, as lately observed in other nucleic acid-processing metalloenzymes. How these conserved structural features facilitate DNA replication, however, is still poorly understood. Through extended molecular dynamics and free energy simulations, we unravel a highly cooperative and dynamic mechanism for DNA elongation and repair, which is here described by an equilibrium ensemble of structures that connect the reactants to the products in Pol-η catalysis. We reveal that specific conformations of Arg61 help facilitate the recruitment of the incoming base and favor the proper formation of a pre-reactive complex in Pol-η for efficient DNA editing. Also, we show that a third transient metal ion, which acts concertedly with Arg61, serves as an exit shuttle for the leaving PPi. Finally, we discuss how this effective and cooperative mechanism for DNA repair may be shared by other DNA-repairing polymerases. © The Author(s) 2016. Published by Oxford University Press on behalf of Nucleic Acids Research.
Peng, Sui; Huo, Xiaofang; Rezaei, Davood; Zhang, Qiuyang; Zhang, Xi; Yu, Chunhua; Asanuma, Kiyotaka; Cheng, Edaire; Pham, Thai H; Wang, David H; Chen, Minhu; Souza, Rhonda F; Spechler, Stuart Jon
2014-07-15
Hydrophobic bile acids like deoxycholic acid (DCA), which cause oxidative DNA damage and activate NF-κB in Barrett's metaplasia, might contribute to carcinogenesis in Barrett's esophagus. We have explored mechanisms whereby ursodeoxycholic acid (UDCA, a hydrophilic bile acid) protects against DCA-induced injury in vivo in patients and in vitro using nonneoplastic, telomerase-immortalized Barrett's cell lines. We took biopsies of Barrett's esophagus from 21 patients before and after esophageal perfusion with DCA (250 μM) at baseline and after 8 wk of oral UDCA treatment. DNA damage was assessed by phospho-H2AX expression, neutral CometAssay, and phospho-H2AX nuclear foci formation. Quantitative PCR was performed for antioxidants including catalase and GPX1. Nrf2, catalase, and GPX1 were knocked down with siRNAs. Reporter assays were performed using a plasmid construct containing antioxidant responsive element. In patients, baseline esophageal perfusion with DCA significantly increased phospho-H2AX and phospho-p65 in Barrett's metaplasia. Oral UDCA increased GPX1 and catalase levels in Barrett's metaplasia and prevented DCA perfusion from inducing DNA damage and NF-κB activation. In cells, DCA-induced DNA damage and NF-κB activation was prevented by 24-h pretreatment with UDCA, but not by mixing UDCA with DCA. UDCA activated Nrf2 signaling to increase GPX1 and catalase expression, and protective effects of UDCA pretreatment were blocked by siRNA knockdown of these antioxidants. UDCA increases expression of antioxidants that prevent toxic bile acids from causing DNA damage and NF-κB activation in Barrett's metaplasia. Elucidation of this molecular pathway for UDCA protection provides rationale for clinical trials on UDCA for chemoprevention in Barrett's esophagus. Copyright © 2014 the American Physiological Society.
Peng, Sui; Huo, Xiaofang; Rezaei, Davood; Zhang, Qiuyang; Zhang, Xi; Yu, Chunhua; Asanuma, Kiyotaka; Cheng, Edaire; Pham, Thai H.; Wang, David H.; Chen, Minhu; Spechler, Stuart Jon
2014-01-01
Hydrophobic bile acids like deoxycholic acid (DCA), which cause oxidative DNA damage and activate NF-κB in Barrett's metaplasia, might contribute to carcinogenesis in Barrett's esophagus. We have explored mechanisms whereby ursodeoxycholic acid (UDCA, a hydrophilic bile acid) protects against DCA-induced injury in vivo in patients and in vitro using nonneoplastic, telomerase-immortalized Barrett's cell lines. We took biopsies of Barrett's esophagus from 21 patients before and after esophageal perfusion with DCA (250 μM) at baseline and after 8 wk of oral UDCA treatment. DNA damage was assessed by phospho-H2AX expression, neutral CometAssay, and phospho-H2AX nuclear foci formation. Quantitative PCR was performed for antioxidants including catalase and GPX1. Nrf2, catalase, and GPX1 were knocked down with siRNAs. Reporter assays were performed using a plasmid construct containing antioxidant responsive element. In patients, baseline esophageal perfusion with DCA significantly increased phospho-H2AX and phospho-p65 in Barrett's metaplasia. Oral UDCA increased GPX1 and catalase levels in Barrett's metaplasia and prevented DCA perfusion from inducing DNA damage and NF-κB activation. In cells, DCA-induced DNA damage and NF-κB activation was prevented by 24-h pretreatment with UDCA, but not by mixing UDCA with DCA. UDCA activated Nrf2 signaling to increase GPX1 and catalase expression, and protective effects of UDCA pretreatment were blocked by siRNA knockdown of these antioxidants. UDCA increases expression of antioxidants that prevent toxic bile acids from causing DNA damage and NF-κB activation in Barrett's metaplasia. Elucidation of this molecular pathway for UDCA protection provides rationale for clinical trials on UDCA for chemoprevention in Barrett's esophagus. PMID:24852569
Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.
He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J
2012-07-01
Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.
R. Minocha; S.C. Minocha; A. Komamine; W.C. Shortle
1991-01-01
Various inhibitors of polyamine biosynthesis were used to study the role of polyamines in DNA synthesis and cell division in suspension cultures of Catharanthus roseus (L) G. Don. Arginine decarboxylase (ADC; EC 4.1.1.19) was the major enzyme responsible for putrescine production. DL α-difluoromethylarginine inhibited ADC activity, cellular...
Genotoxic effect of ethacrynic acid and impact of antioxidants
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ward, William M.; Hoffman, Jared D.; Loo, George, E-mail: g_loo@uncg.edu
It is known that ethacrynic acid (EA) decreases the intracellular levels of glutathione. Whether the anticipated oxidative stress affects the structural integrity of DNA is unknown. Therefore, DNA damage was assessed in EA-treated HCT116 cells, and the impact of several antioxidants was also determined. EA caused both concentration-dependent and time-dependent DNA damage that eventually resulted in cell death. Unexpectedly, the DNA damage caused by EA was intensified by either ascorbic acid or trolox. In contrast, EA-induced DNA damage was reduced by N-acetylcysteine and by the iron chelator, deferoxamine. In elucidating the DNA damage, it was determined that EA increased themore » production of reactive oxygen species, which was inhibited by N-acetylcysteine and deferoxamine but not by ascorbic acid and trolox. Also, EA decreased glutathione levels, which were inhibited by N-acetylcysteine. But, ascorbic acid, trolox, and deferoxamine neither inhibited nor enhanced the capacity of EA to decrease glutathione. Interestingly, the glutathione synthesis inhibitor, buthionine sulfoxime, lowered glutathione to a similar degree as EA, but no noticeable DNA damage was found. Nevertheless, buthionine sulfoxime potentiated the glutathione-lowering effect of EA and intensified the DNA damage caused by EA. Additionally, in examining redox-sensitive stress gene expression, it was found that EA increased HO-1, GADD153, and p21mRNA expression, in association with increased nuclear localization of Nrf-2 and p53 proteins. In contrast to ascorbic acid, trolox, and deferoxamine, N-acetylcysteine suppressed the EA-induced upregulation of GADD153, although not of HO-1. Overall, it is concluded that EA has genotoxic properties that can be amplified by certain antioxidants. - Highlights: • Ethacrynic acid (EA) caused cellular DNA damage. • EA-induced DNA damage was potentiated by ascorbic acid or trolox. • EA increased ROS production, not inhibited by ascorbic acid or trolox.
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Zusman, David R.; Carbonell, Augustina; Haga, Juli Y.
1973-01-01
The reorganization of the bacterial nucleoid of an Escherichia coli mutant, MX74T2 ts52, was studied by electron microscopy after protein synthesis inhibition by using whole mounts of cell ghosts, ultrathin-sectioning, and freeze-etching. The bacterial nucleoid showed two morphological changes after chloramphenicol addition: deoxyribonucleic acid (DNA) localization and DNA condensation. DNA localization was observed 10 min after chloramphenicol addition; the DNA appeared as a compact, solid mass. DNA condensation was observed at 25 min; the nucleoid appeared as a cytoplasm-filled sphere, often opened at one end. Ribosomes were observed in the center. Giant nucleoids present in some mutant filaments showed fused, spherical nucleoids arranged linearly, suggesting that the tertiary structure of the nucleoid reflects the number of replicated genomes. Inhibitors which directly or indirectly blocked protein synthesis and caused DNA condensation were chloramphenicol, puromycin, amino acid starvation, rifampicin, or carbonyl cyanide m-chlorophenyl hydrazone. All inhibitors that caused cell division in the mutant also caused condensation, although some inhibitors caused condensation without cell division. Nucleoid condensation appears to be related to chromosome structure rather than to DNA segregation upon cell division. Images PMID:4580561
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Recognition and repair of chemically heterogeneous structures at DNA ends
Andres, Sara N.; Schellenberg, Matthew J.; Wallace, Bret D.; Tumbale, Percy; Williams, R. Scott
2014-01-01
Exposure to environmental toxicants and stressors, radiation, pharmaceutical drugs, inflammation, cellular respiration, and routine DNA metabolism all lead to the production of cytotoxic DNA strand breaks. Akin to splintered wood, DNA breaks are not “clean”. Rather, DNA breaks typically lack DNA 5'-phosphate and 3'-hydroxyl moieties required for DNA synthesis and DNA ligation. Failure to resolve damage at DNA ends can lead to abnormal DNA replication and repair, and is associated with genomic instability, mutagenesis, neurological disease, ageing and carcinogenesis. An array of chemically heterogeneous DNA termini arises from spontaneously generated DNA single-strand and double-strand breaks (SSBs and DSBs), and also from normal and/or inappropriate DNA metabolism by DNA polymerases, DNA ligases and topoisomerases. As a front line of defense to these genotoxic insults, eukaryotic cells have accrued an arsenal of enzymatic first responders that bind and protect damaged DNA termini, and enzymatically tailor DNA ends for DNA repair synthesis and ligation. These nucleic acid transactions employ direct damage reversal enzymes including Aprataxin (APTX), Polynucleotide kinase phosphatase (PNK), the tyrosyl DNA phosphodiesterases (TDP1 and TDP2), the Ku70/80 complex and DNA polymerase β (POLβ). Nucleolytic processing enzymes such as the MRE11/RAD50/NBS1/CtIP complex, Flap endonuclease (FEN1) and the apurinic endonucleases (APE1 and APE2) also act in the chemical "cleansing" of DNA breaks to prevent genomic instability and disease, and promote progression of DNA- and RNA-DNA damage response (DDR and RDDR) pathways. Here, we provide an overview of cellular first responders dedicated to the detection and repair of abnormal DNA termini. PMID:25111769
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hansson, J.; Keyse, S.M.; Lindahl, T.
Whole cell extracts from human lymphoid cell lines can perform in vitro DNA repair synthesis in plasmids damaged by agents including UV or cis-diamminedichloroplatinum(II) (cis-DDP). Extracts from xeroderma pigmentosum (XP) cells are defective in repair synthesis. We have now studied in vitro DNA repair synthesis using extracts from lymphoblastoid cell lines representing four human hereditary syndromes with increased sensitivity to DNA-damaging agents. Extracts of cell lines from individuals with the sunlight-sensitive disorders dysplastic nevus syndrome or Cockayne's syndrome (complementation groups A and B) showed normal DNA repair synthesis in plasmids with UV photoproducts. This is consistent with in vivo measurementsmore » of the overall DNA repair capacity in such cell lines. A number of extracts were prepared from two cell lines representing the variant form of XP (XP-V). Half of the extracts prepared showed normal levels of in vitro DNA repair synthesis in plasmids containing UV lesions, but the remainder of the extracts from the same cell lines showed deficient repair synthesis, suggesting the possibility of an unusually labile excision repair protein in XP-V. Fanconi's anemia (FA) cells show cellular hypersensitivity to cross-linking agents including cis-DDP. Extracts from cell lines belonging to two different complementation groups of FA showed normal DNA repair synthesis in plasmids containing cis-DDP or UV adducts. Thus, there does not appear to be an overall excision repair defect in FA, but the data do not exclude a defect in the repair of interstrand DNA cross-links.« less
Optimized Reaction Conditions for Amide Bond Formation in DNA-Encoded Combinatorial Libraries.
Li, Yizhou; Gabriele, Elena; Samain, Florent; Favalli, Nicholas; Sladojevich, Filippo; Scheuermann, Jörg; Neri, Dario
2016-08-08
DNA-encoded combinatorial libraries are increasingly being used as tools for the discovery of small organic binding molecules to proteins of biological or pharmaceutical interest. In the majority of cases, synthetic procedures for the formation of DNA-encoded combinatorial libraries incorporate at least one step of amide bond formation between amino-modified DNA and a carboxylic acid. We investigated reaction conditions and established a methodology by using 1-ethyl-3-(3-(dimethylamino)propyl)carbodiimide, 1-hydroxy-7-azabenzotriazole and N,N'-diisopropylethylamine (EDC/HOAt/DIPEA) in combination, which provided conversions greater than 75% for 423/543 (78%) of the carboxylic acids tested. These reaction conditions were efficient with a variety of primary and secondary amines, as well as with various types of amino-modified oligonucleotides. The reaction conditions, which also worked efficiently over a broad range of DNA concentrations and reaction scales, should facilitate the synthesis of novel DNA-encoded combinatorial libraries.
DNA-templated synthesis of Pt nanoparticles on single-walled carbon nanotubes.
Dong, Lifeng
2009-11-18
A series of electron microscopy characterizations demonstrate that single-stranded deoxyribonucleic acid (ssDNA) can bind to nanotube surfaces and disperse bundled single-walled carbon nanotubes (SWCNTs) into individual tubes. The ssDNA molecules on the nanotube surfaces demonstrate various morphologies, such as aggregated clusters and spiral wrapping around a nanotube with different pitches and spaces, indicating that the morphology of the SWCNT/DNA hybrids is not related solely to the base sequence of the ssDNA or the chirality or the diameter of the nanotubes. In addition to serving as a non-covalent dispersion agent, the ssDNA molecules bonded to the nanotube surface can provide addresses for localizing Pt(II) complexes along the nanotubes. The Pt nanoparticles obtained by a reduction of the Pt2+-DNA adducts are crystals with a size of < or =1-2 nm. These results expand our understanding of the interactions between ssDNA and SWCNTs and provide an efficient approach for positioning Pt and other metal particles, with uniform sizes and without aggregations, along the nanotube surfaces for applications in direct ethanol/methanol fuel cells and nanoscale electronics.
2009-01-01
Background Identical blood samples tested using different kits can give markedly different hepatitis B virus (HBV) DNA levels, which can cause difficulty in the interpretation of viral load. A universal double-stranded DNA control or standard that can be used in all commercial HBV DNA nucleic acid amplification assay kits is urgently needed. By aligning all HBV genotypes (A-H), we found that the surface antigen gene and precore-core gene regions of HBV are the most conserved regions among the different HBV genotypes. We constructed a chimeric fragment by overlapping extension polymerase chain reaction and obtained a 1,349-bp HBVC+S fragment. We then packaged the fragment into lambda phages using a traditional lambda phage cloning procedure. Results The obtained armored DNA was resistant to DNase I digestion and was stable, noninfectious to humans, and could be easily extracted using commercial kits. More importantly, the armored DNA may be used with all HBV DNA nucleic acid amplification assay kits. Conclusions The lambda phage packaging system can be used as an excellent expression platform for armored DNA. The obtained armored DNA possessed all characteristics of an excellent positive control or standard. In addition, this armored DNA is likely to be appropriate for all commercial HBV DNA nucleic acid amplification detection kits. Thus, the constructed armored DNA can probably be used as a universal positive control or standard in HBV DNA assays. PMID:20025781
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; De Bouvere, B.; Van Aerschot, A.; Herdewijn, P.; Orgel, L. E.
1999-01-01
Hexitol nucleic acids (HNAs) are DNA analogues that contain the standard nucleoside bases attached to a phosphorylated 1,5-anhydrohexitol backbone. We find that HNAs support efficient information transfer in nonensymatic template-directed reactions. HNA heterosequences appeared to be superior to the corresponding DNA heterosequences in facilitating synthesis of complementary oligonucleotides from nucleoside-5'-phosphoro-2-methyl imidazolides.
Hirota, Kouji; Yoshikiyo, Kazunori; Guilbaud, Guillaume; Tsurimoto, Toshiki; Murai, Junko; Tsuda, Masataka; Phillips, Lara G.; Narita, Takeo; Nishihara, Kana; Kobayashi, Kaori; Yamada, Kouich; Nakamura, Jun; Pommier, Yves; Lehmann, Alan; Sale, Julian E.; Takeda, Shunichi
2015-01-01
The replicative DNA polymerase Polδ consists of a catalytic subunit POLD1/p125 and three regulatory subunits POLD2/p50, POLD3/p66 and POLD4/p12. The ortholog of POLD3 in Saccharomyces cerevisiae, Pol32, is required for a significant proportion of spontaneous and UV-induced mutagenesis through its additional role in translesion synthesis (TLS) as a subunit of DNA polymerase ζ. Remarkably, chicken DT40 B lymphocytes deficient in POLD3 are viable and able to replicate undamaged genomic DNA with normal kinetics. Like its counterpart in yeast, POLD3 is required for fully effective TLS, its loss resulting in hypersensitivity to a variety of DNA damaging agents, a diminished ability to maintain replication fork progression after UV irradiation and a significant decrease in abasic site-induced mutagenesis in the immunoglobulin loci. However, these defects appear to be largely independent of Polζ, suggesting that POLD3 makes a significant contribution to TLS independently of Polζ in DT40 cells. Indeed, combining polη, polζ and pold3 mutations results in synthetic lethality. Additionally, we show in vitro that POLD3 promotes extension beyond an abasic by the Polδ holoenzyme suggesting that while POLD3 is not required for normal replication, it may help Polδ to complete abasic site bypass independently of canonical TLS polymerases. PMID:25628356
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Jõers, Priit; Lewis, Samantha C; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J; Jacobs, Howard T
2013-01-01
All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis.
Jõers, Priit; Lewis, Samantha C.; Fukuoh, Atsushi; Parhiala, Mikael; Ellilä, Simo; Holt, Ian J.; Jacobs, Howard T.
2013-01-01
All genomes require a system for avoidance or handling of collisions between the machineries of DNA replication and transcription. We have investigated the roles in this process of the mTERF (mitochondrial transcription termination factor) family members mTTF and mTerf5 in Drosophila melanogaster. The two mTTF binding sites in Drosophila mtDNA, which also bind mTerf5, were found to coincide with major sites of replication pausing. RNAi-mediated knockdown of either factor resulted in mtDNA depletion and developmental arrest. mTTF knockdown decreased site-specific replication pausing, but led to an increase in replication stalling and fork regression in broad zones around each mTTF binding site. Lagging-strand DNA synthesis was impaired, with extended RNA/DNA hybrid segments seen in replication intermediates. This was accompanied by the accumulation of recombination intermediates and nicked/broken mtDNA species. Conversely, mTerf5 knockdown led to enhanced replication pausing at mTTF binding sites, a decrease in fragile replication intermediates containing single-stranded segments, and the disappearance of species containing segments of RNA/DNA hybrid. These findings indicate an essential and previously undescribed role for proteins of the mTERF family in the integration of transcription and DNA replication, preventing unregulated collisions and facilitating productive interactions between the two machineries that are inferred to be essential for completion of lagging-strand DNA synthesis. PMID:24068965
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ramp, W.K.; Lenz, L.G.; Galvin, R.J.
1991-05-01
Use of smokeless tobacco is associated with various oral lesions including periodontal damage and alveolar bone loss. This study was performed to test the effects of nicotine on bone-forming cells at concentrations that occur in the saliva of smokeless tobacco users. Confluent cultures of osteoblast-like cells isolated from chick embryo calvariae were incubated for 2 days with nicotine added to the culture medium (25-600 micrograms/ml). Nicotine inhibited alkaline phosphatase in the cell layer and released to the medium, whereas glycolysis (as indexed by lactate production) was unaffected or slightly elevated. The effects on medium and cell layer alkaline phosphatase weremore » concentration dependent with maximal inhibition occurring at 600 micrograms nicotine/ml. Nicotine essentially did not affect the noncollagenous protein content of the cell layer, but did inhibit collagen synthesis (hydroxylation of ({sup 3}H)proline and collagenase-digestible protein) at 100, 300, and 600 micrograms/ml. Release of ({sup 3}H)hydroxyproline to the medium was also decreased in a dose-dependent manner, as was the collagenase-digestible protein for both the medium and cell layer. In contrast, DNA synthesis (incorporation of ({sup 3}H)thymidine) was more than doubled by the alkaloid, whereas total DNA content was slightly inhibited at 600 micrograms/ml, suggesting stimulated cell turnover. Morphologic changes occurred in nicotine-treated cells including rounding up, detachment, and the occurrence of numerous large vacuoles. These results suggest that steps to reduce the salivary concentration of nicotine in smokeless tobacco users might diminish damaging effects of this product on alveolar bone.« less
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Two distinct modes of RecA action are required for DNA polymerase V-catalyzed translesion synthesis
Pham, Phuong; Seitz, Erica M.; Saveliev, Sergei; Shen, Xuan; Woodgate, Roger; Cox, Michael M.; Goodman, Myron F.
2002-01-01
SOS mutagenesis in Escherichia coli requires DNA polymerase V (pol V) and RecA protein to copy damaged DNA templates. Here we show that two distinct biochemical modes for RecA protein are necessary for pol V-catalyzed translesion synthesis. One RecA mode is characterized by a strong stimulation in nucleotide incorporation either directly opposite a lesion or at undamaged template sites, but by the absence of lesion bypass. A separate RecA mode is necessary for translesion synthesis. The RecA1730 mutant protein, which was identified on the basis of its inability to promote pol V (UmuD′2C)-dependent UV-mutagenesis, appears proficient for the first mode of RecA action but is deficient in the second mode. Data are presented suggesting that the two RecA modes are “nonfilamentous”. That is, contrary to current models for SOS mutagenesis, formation of a RecA nucleoprotein filament may not be required for copying damaged DNA templates. Instead, SOS mutagenesis occurs when pol V interacts with two RecA molecules, first at a 3′ primer end, upstream of a template lesion, where RecA mode 1 stimulates pol V activity, and subsequently at a site immediately downstream of the lesion, where RecA mode 2 cocatalyzes lesion bypass. We posit that in vivo assembly of a RecA nucleoprotein filament may be required principally to target pol V to a site of DNA damage and to stabilize the pol V-RecA interaction at the lesion. However, it is only a RecA molecule located at the 3′ filament tip, proximal to a damaged template base, that is directly responsible for translesion synthesis. PMID:12177433
NASA Astrophysics Data System (ADS)
Abdel-Rahman, Laila H.; Abu-Dief, Ahmed M.; Ismael, Mohammed; Mohamed, Mounir A. A.; Hashem, Nahla Ali
2016-01-01
Three tridentate Schiff bases amino acids were prepared by direct condensation of 3-methoxysalicylaldehyde (MS) or 4-diethylaminosalicylaldehyde (DS) with α-amino acid ligands [L-phenylalanine (P), L-histidine (H) and DL-tryptophan (T)]. The prepared Schiff bases amino acids were investigated by melting points, elemental analysis, 1HNMR and 13CNMR, IR, UV-Vis spectra, conductivity and magnetic measurements analyses. Subsequently, copper was introduced and Cu(II) complexes formed. These complexes were analyzed by thermal and elemental analyses and further investigated by FT-IR and UV/Vis spectroscopies. The experimental results indicating that all Cu(II) complexes contain hydrated water molecules (except DSPCu complex) and don't contain coordinated water molecules. The kinetic and thermal parameters were extracted from the thermal data using Coast and Redfern method. The molar conductance values of the Schiff base amino acid ligands and their Cu(II) complexes were relatively low, showing that these compounds have non-electrolytic nature. Magnetic susceptibility measurements showed the diamagnetic nature of the Schiff base amino acid ligands and paramagnetic nature of their complexes. Additionally, a spectrophotometric method was determined to extract their stability constants. It was found that the complexes possess 1:2 (M:L) stoichiometry. The results suggested that 3-methoxysalicylaldehyde and 4-diethylaminosalicylaldehyde amino acid Schiff bases behave as monobasic tridentate ONO ligands and coordinate Cu(II) ions in octahedral geometry according to the general formula [Cu(HL)2]·nH2O. To further understanding the structural and electronic properties of these complexes, Density Functional Theory (DFT) calculations were employed and provided a satisfactory description. The optimized structures of MST Schiff base ligand and its complex were calculated using DFT. The antimicrobial activity of the Schiff base ligands and their complexes were screened against some
Mukherjee, Shivam; Guainazzi, Angelo; Schärer, Orlando D.
2014-01-01
DNA interstrand crosslinks (ICLs) are extremely cytotoxic lesions that block essential cellular processes, such as replication and transcription. Crosslinking agents are widely used in cancer chemotherapy and form an array of structurally diverse ICLs. Despite the clinical success of these agents, resistance of tumors to crosslinking agents, for example, through repair of these lesions by the cellular machinery remains a problem. We have previously reported the synthesis of site-specific ICLs mimicking those formed by nitrogen mustards to facilitate the studies of cellular responses to ICL formation. Here we extend these efforts and report the synthesis of structurally diverse major groove ICLs that induce severe, little or no distortion in the DNA. Our approach employs the incorporation of aldehyde precursors of different lengths into complementary strands and ICL formation using a double reductive amination with a variety of amines. Our studies provide insight into the structure and reactivity parameters of ICL formation by double reductive amination and yield a set of diverse ICLs that will be invaluable for exploring structure–activity relationships in ICL repair. PMID:24782532
Ng, K. W.; DeFrancis, J. G.; Kugler, L. E.; Kelly, T.-A. N.; Ho, M. M.; O’Conor, C. J.; Ateshian, G. A.; Hung, C. T.
2013-01-01
Summary Increased amino acid supplementation (0.5×, 1.0×, and 5.0× recommended concentrations or additional proline) was hypothesized to increase the collagen content in engineered cartilage. No significant differences were found between groups in matrix content or dynamic modulus. Control constructs possessed the highest compressive Young’s modulus on day 42. On day 42, compared to controls, decreased type II collagen was found with 0.5×, 1.0×, and 5.0× supplementation and significantly increased DNA content found in 1.0× and 5.0×. No effects were observed on these measures with added proline. These results lead us to reject our hypothesis and indicate that the low collagen synthesis in engineered cartilage is not due to a limited supply of amino acids in media but may require a further stimulatory signal. The results of this study also highlight the impact that culture environment can play on the development of engineered cartilage. PMID:17713744
1990-12-01
Maximum 200 words) Perfluoro -n-decanoic acid ( PFDA ), a perfluorinated fatty acid was evaluated in in vitro bioassays to assess its potential...PolychlorotrifluoroethyleneDU.TBL PFDA Perfluoro -n-decanoic acid PFOA Perfluoro -n-octanoic acid ..... RI Replicative index rpm Revolutions per minute By...an increase in the amount of S-phase DNA synthesis. The perfluorinated carboxylic acid, perfluoro -n-decanoic acid ( PFDA ), has previously been shown to
DNA polymerase V activity is autoregulated by a novel intrinsic DNA-dependent ATPase
Erdem, Aysen L; Jaszczur, Malgorzata; Bertram, Jeffrey G; Woodgate, Roger; Cox, Michael M; Goodman, Myron F
2014-01-01
Escherichia coli DNA polymerase V (pol V), a heterotrimeric complex composed of UmuD′2C, is marginally active. ATP and RecA play essential roles in the activation of pol V for DNA synthesis including translesion synthesis (TLS). We have established three features of the roles of ATP and RecA. (1) RecA-activated DNA polymerase V (pol V Mut), is a DNA-dependent ATPase; (2) bound ATP is required for DNA synthesis; (3) pol V Mut function is regulated by ATP, with ATP required to bind primer/template (p/t) DNA and ATP hydrolysis triggering dissociation from the DNA. Pol V Mut formed with an ATPase-deficient RecA E38K/K72R mutant hydrolyzes ATP rapidly, establishing the DNA-dependent ATPase as an intrinsic property of pol V Mut distinct from the ATP hydrolytic activity of RecA when bound to single-stranded (ss)DNA as a nucleoprotein filament (RecA*). No similar ATPase activity or autoregulatory mechanism has previously been found for a DNA polymerase. DOI: http://dx.doi.org/10.7554/eLife.02384.001 PMID:24843026
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
2013-01-01
Precise regulation of DNA replication is necessary to ensure the inheritance of genetic features by daughter cells after each cell division. Therefore, determining how the regulatory processes operate to control DNA replication is crucial to our understanding and application to biotechnological processes. Contrary to early concepts of DNA replication, it appears that this process is operated by large, stationary nucleoprotein complexes, called replication factories, rather than by single enzymes trafficking along template molecules. Recent discoveries indicated that in bacterial cells two processes, central carbon metabolism (CCM) and transcription, significantly and specifically influence the control of DNA replication of various replicons. The impact of these discoveries on our understanding of the regulation of DNA synthesis is discussed in this review. It appears that CCM may influence DNA replication by either action of specific metabolites or moonlighting activities of some enzymes involved in this metabolic pathway. The role of transcription in the control of DNA replication may arise from either topological changes in nucleic acids which accompany RNA synthesis or direct interactions between replication and transcription machineries. Due to intriguing similarities between some prokaryotic and eukaryotic regulatory systems, possible implications of studies on regulation of microbial DNA replication on understanding such a process occurring in human cells are discussed. PMID:23714207
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Design, synthesis and DNA-binding study of some novel morpholine linked thiazolidinone derivatives
NASA Astrophysics Data System (ADS)
War, Javeed Ahmad; Srivastava, Santosh Kumar; Srivastava, Savitri Devi
2017-02-01
The emergence of multiple drug resistance amongst bacterial strains resulted in many clinical drugs to be ineffective. Being vulnerable to bacterial infections any lack in the development of new antimicrobial drugs could pose a serious threat to public health. Here we report design and synthesis of a novel class of morpholine linked thiazolidinone hybrid molecules. The compounds were characterized by FT-IR, NMR and HRMS techniques. Susceptibility tests showed that most of the synthesized molecules were highly active against multiple bacterial strains. Compound 3f displayed MIC values which were better than the standard drug for most of the tested strains. DNA being a well defined target for many antimicrobial drugs was probed as possible target for these synthetic molecules. DNA-binding study of 3f with sm-DNA was probed through UV-vis absorption, fluorescence quenching, gel electrophoresis and molecular docking techniques. The studies revealed that compound 3f has strong affinity towards DNA and binds at the minor groove. The docking studies revealed that the compound 3f shows preferential binding towards A/T residues.
The use of acid phosphatase test papers for DNA profiling.
Reshef, A; Barash, M; Gallili, N; Michael, A; Brauner, P
2005-01-01
The acid phosphatase (AP) test is a routine assay used to screen casework items for the possible presence of semen. This colour test is carried out on filter paper which is retained after testing. Two-year-old AP test papers were found to contain sufficient DNA for short tandem repeat (STR) profiling. Prior to polymerase chain reaction (PCR) amplification, the DNA was preferentially separated into sperm depleted and sperm enriched cell fractions. The implication of these findings for past and present cases is discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minagawa, T.; Nakaya, C.; Iida, H.
1974-05-01
Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated componentnent which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virusmore » as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither uv-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. (auth)« less
Minagawa, Tomonori; Nakaya, Chikako; Iida, Hiroo
1974-01-01
Host DNA synthesis is suppressed by the culture fluid of cell cultures infected with measles virus. This activity in the culture fluid is initiated somewhat later than the growth of infectious virus. Ninety percent of host DNA synthesis in HeLa cells is inhibited by culture fluid of 3-day-old cell cultures of Vero or HeLa cells infected with measles virus. This suppressing activity is not a property of the virion, but is due to nonvirion-associated component which shows none of the activities of measles virus such as hemagglutination, hemolysis, or cell fusion nor does it have the antigenicity of measles virus as tested by complement-fixation or hemagglutination-inhibiting antibody blocking tests. Neutralization of the activity of this component is not attained with the pooled sera of convalescent measles patients. This component has molecular weights of about 45,000, 20,000, and 3,000 and appears to be a heat-stable protein. The production of host DNA suppressing factor (DSF) is blocked by cycloheximide. Neither UV-inactivated nor antiserum-neutralized measles virus produce DSF. Furthermore, such activity of nonvirion-associated component is not detected in the culture fluid of cultures infected with other RNA viruses such as poliovirus, vesicular stomatitis virus, or Sindbis virus. PMID:4207526
Chen, Youjun; Zhou, Yi-Hui; Neo, Dayna; Clement, Jean; Takata, Minoru; Takeda, Shunichi; Sale, Julian; Wright, Fred A.; Swenberg, James A.; Nakamura, Jun
2016-01-01
Contamination of potentially carcinogenic hexavalent chromium (Cr(VI)) in the drinking water is a major public health concern worldwide. However, little information is available regarding the biological effects of a nanomoler amount of Cr(VI). Here, we investigated the genotoxic effects of Cr(VI) at nanomoler levels and their repair pathways. We found that DNA damage response analyzed based on differential toxicity of isogenic cells deficient in various DNA repair proteins is observed after a three-day incubation with K2CrO4 in REV1-deficient DT40 cells at 19.2 μg/L or higher as well as in TK6 cells deficient in polymerase delta subunit 3 (POLD3) at 9.8 μg/L or higher. The genotoxicity of Cr(VI) decreased ~3000 times when the incubation time was reduced from three days to ten minutes. TK mutation rate also significantly decreased from 6 day to 1 day exposure to Cr(VI). The DNA damage response analysis suggest that DNA repair pathways, including the homologous recombination and REV1- and POLD3-mediated error-prone translesion synthesis pathways, are critical for the cells to tolerate to DNA damage caused by trace amount of Cr(VI). PMID:27907204
Primer synthesis by a eukaryotic-like archaeal primase is independent of its Fe-S cluster.
Holzer, Sandro; Yan, Jiangyu; Kilkenny, Mairi L; Bell, Stephen D; Pellegrini, Luca
2017-11-23
DNA replication depends on primase, the specialised polymerase responsible for synthesis of the RNA primers that are elongated by the replicative DNA polymerases. In eukaryotic and archaeal replication, primase is a heterodimer of two subunits, PriS and PriL. Recently, a third primase subunit named PriX was identified in the archaeon Sulfolobus solfataricus. PriX is essential for primer synthesis and is structurally related to the Fe-S cluster domain of eukaryotic PriL. Here we show that PriX contains a nucleotide-binding site required for primer synthesis, and demonstrate equivalence of nucleotide-binding residues in PriX with eukaryotic PriL residues that are known to be important for primer synthesis. A primase chimera, where PriX is fused to a truncated version of PriL lacking the Fe-S cluster domain retains wild-type levels of primer synthesis. Our evidence shows that PriX has replaced PriL as the subunit that endows primase with the unique ability to initiate nucleic acid synthesis. Importantly, our findings reveal that the Fe-S cluster is not required for primer synthesis.
Options for Synthetic DNA Order Screening, Revisited.
DiEuliis, Diane; Carter, Sarah R; Gronvall, Gigi Kwik
2017-01-01
Gene synthesis providers affiliated with the International Gene Synthesis Consortium (IGSC) voluntarily screen double-stranded DNA (dsDNA) synthesis orders over 200 bp to check for matches to regulated pathogens and to screen customers. Questions have been raised, however, about the continuing feasibility and effectiveness of screening. There are technical challenges (e.g., oligonucleotides and tracts of DNA less than 200 bp are not screened) and corporate challenges (e.g., the costs of screening are high, but other costs are dropping, so screening is an increasing portion of operating costs). In this article, we describe tangible actions that should be taken to (i) preserve the effectiveness of DNA order screening as a security tool and (ii) develop additional mechanisms to increase the safety and security of DNA synthesis technologies. Screening is not a perfect solution to DNA synthesis security challenges, but we believe it is still a valuable addition to security, and it can remain effective for some time.
Özer, Özgün; Bhowmick, Rahul; Liu, Ying; Hickson, Ian D.
2018-01-01
Telomeres resemble common fragile sites (CFSs) in that they are difficult-to-replicate and exhibit fragility in mitosis in response to DNA replication stress. At CFSs, this fragility is associated with a delay in the completion of DNA replication until early mitosis, whereupon cells are proposed to switch to a RAD52-dependent form of break-induced replication. Here, we show that this mitotic DNA synthesis (MiDAS) is also a feature of human telomeres. Telomeric MiDAS is not restricted to those telomeres displaying overt fragility, and is a feature of a wide range of cell lines irrespective of whether their telomeres are maintained by telomerase or by the alternative lengthening of telomeres (ALT) mechanism. MiDAS at telomeres requires RAD52, and is mechanistically similar to CFS-associated MiDAS, with the notable exception that telomeric MiDAS does not require the MUS81-EME1 endonuclease. We propose a model whereby replication stress initiates a RAD52-dependent form of break-induced replication that bypasses a requirement for MUS81-EME1 to complete DNA synthesis in mitosis. PMID:29662610
NASA Astrophysics Data System (ADS)
Chen, Guofang; Mao, Chengde
2016-05-01
Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties.Complex and functional nanostructures are always desired. Herein, we present the synthesis of novel long conducting polymer nanonecklaces with a `beads-on-a-string' morphology by the DNA nanotube-template approach and in situ oxidative polymerization of the 3-methylthiophene monomer with FeCl3 as the oxidant/catalyst. The length of the nanonecklaces is up to 60 μm, and the polymer beads of around 20-25 nm in diameter are closely packed along the axis of the DNA nanotube template with a density of ca. 45 particles per μm. The formation of porous DNA nanotubes impregnated with FeCl3 was also demonstrated as intermediate nanostructures. The mechanisms for the formation of both the porous DNA nanotubes and the conducting polymer nanonecklaces are discussed in detail. The as-synthesized polymer/DNA nanonecklaces exhibit good electrical properties. Electronic supplementary information (ESI) available. See DOI: 10.1039/c6nr01603k
[Folic acid in physiology and pathology].
Czeczot, Hanna
2008-08-13
This paper presents current knowledge of the biological functions of folic acid, the effects of its deficiency in the organism, as well as the possibilities of its therapeutic use. Folic acid (folate, B9) is a vitamin of special importance in normal cellular functions. Tetrahydrofolate (TH4-folate) is the biologically active form of folic acid. The main role of folic acid in biochemistry is the single-carbon transfer reaction (e.g. transfer of a methyl, methylene, or formyl group). Folic acid is involved in the transformation of certain amino acids as well as in the synthesis of purines and dTMP (2'-deoxythymidine-5'-phosphate) needed for the synthesis of nucleic acid (DNA), required by all rapidly growing cells. In humans, folate deficiency results in serious pathologies, the most important of which are neural tube defects, megablastic anemia, acceleration of the arteriosclerotic process, changes in the central nervous system, and the development of certain types of cancer. To increase the intake of folic acid, preventive actions include dietary education, the main objectives of which are to increase the intake of natural folate in the daily diet, add folic acid to selected dietary products (e.g. fl our, pasta, rice), and encourage supplementation with folic acid-containing pharmaceuticals.
Rella, M; Haas, D
1982-01-01
Resistance to high concentrations of nalidixic acid in Pseudomonas aeruginosa PAO was due to mutations in one locus designated nalA, which was mapped by transduction between hex-9001 and leu-10. The nalA mutants were cross-resistant to pipemidic acid, a nalidixic acid analog, at relatively low concentrations. Replicative DNA synthesis was resistant to both drugs in permeabilized cells of nalA mutants. A locus coding for low-level resistance to nalidixic acid, nalB, was cotransducible with pyrB, proC, and met-28. The nalB mutants were also resistant to low levels of pipemidic acid, novobiocin, and beta-lactam antibiotics (e.g., carbenicillin, azlocillin, and cefsulodin), but not to other drugs, such as gentamicin, rifampin, kanamycin, or tetracycline. In nalB mutants, DNA replication showed wild-type sensitivity to nalidixic acid, whereas carbenicillin-induced filamentation required higher drug levels than in the wild-type strain. Thus, nalB mutations appear to decrease cell permeability to some antibiotics. The sensitivity of replicative DNA synthesis to nalidixic acid and novobiocin was very similar in P. aeruginosa and Escherichia coli; by contrast, the concentrations of these drugs needed to inhibit growth of P. aeruginosa were higher than those reported for E. coli by one or two orders of magnitude. PMID:6821455
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
Supercomputer analysis of purine and pyrimidine metabolism leading to DNA synthesis.
Heinmets, F
1989-06-01
A model-system is established to analyze purine and pyrimidine metabolism leading to DNA synthesis. The principal aim is to explore the flow and regulation of terminal deoxynucleoside triophosphates (dNTPs) in various input and parametric conditions. A series of flow equations are established, which are subsequently converted to differential equations. These are programmed (Fortran) and analyzed on a Cray chi-MP/48 supercomputer. The pool concentrations are presented as a function of time in conditions in which various pertinent parameters of the system are modified. The system is formulated by 100 differential equations.
Chan, D; McGraw, S; Klein, K; Wallock, L M; Konermann, C; Plass, C; Chan, P; Robaire, B; Jacob, R A; Greenwood, C M T; Trasler, J M
2017-02-01
Do short-term and long-term exposures to low-dose folic acid supplementation alter DNA methylation in sperm? No alterations in sperm DNA methylation patterns were found following the administration of low-dose folic acid supplements of 400 μg/day for 90 days (short-term exposure) or when pre-fortification of food with folic acid and post-fortification sperm samples (long-term exposure) were compared. Excess dietary folate may be detrimental to health and DNA methylation profiles due to folate's role in one-carbon metabolism and the formation of S-adenosyl methionine, the universal methyl donor. DNA methylation patterns are established in developing male germ cells and have been suggested to be affected by high-dose (5 mg/day) folic acid supplementation. This is a control versus treatment study where genome-wide sperm DNA methylation patterns were examined prior to fortification of food (1996-1997) in men with no history of infertility at baseline and following 90-day exposure to placebo (n = 9) or supplement containing 400 μg folic acid/day (n = 10). Additionally, pre-fortification sperm DNA methylation profiles (n = 19) were compared with those of a group of post-fortification (post-2004) men (n = 8) who had been exposed for several years to dietary folic acid fortification. Blood and seminal plasma folate levels were measured in participants before and following the 90-day treatment with placebo or supplement. Sperm DNA methylation was assessed using the whole-genome and genome-wide techniques, MassArray epityper, restriction landmark genomic scanning, methyl-CpG immunoprecipitation and Illumina HumanMethylation450 Bead Array. Following treatment, supplemented individuals had significantly higher levels of blood and seminal plasma folates compared to placebo. Initial first-generation genome-wide analyses of sperm DNA methylation showed little evidence of changes when comparing pre- and post-treatment samples. With Illumina HumanMethylation450 BeadChip arrays
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
TopBP1-mediated DNA processing during mitosis.
Gallina, Irene; Christiansen, Signe Korbo; Pedersen, Rune Troelsgaard; Lisby, Michael; Oestergaard, Vibe H
2016-01-01
Maintenance of genome integrity is crucial to avoid cancer and other genetic diseases. Thus faced with DNA damage, cells mount a DNA damage response to avoid genome instability. The DNA damage response is partially inhibited during mitosis presumably to avoid erroneous processing of the segregating chromosomes. Yet our recent study shows that TopBP1-mediated DNA processing during mitosis is highly important to reduce transmission of DNA damage to daughter cells. (1) Here we provide an overview of the DNA damage response and DNA repair during mitosis. One role of TopBP1 during mitosis is to stimulate unscheduled DNA synthesis at underreplicated regions. We speculated that such genomic regions are likely to hold stalled replication forks or post-replicative gaps, which become the substrate for DNA synthesis upon entry into mitosis. Thus, we addressed whether the translesion pathways for fork restart or post-replicative gap filling are required for unscheduled DNA synthesis in mitosis. Using genetics in the avian DT40 cell line, we provide evidence that unscheduled DNA synthesis in mitosis does not require the translesion synthesis scaffold factor Rev1 or PCNA ubiquitylation at K164, which serve to recruit translesion polymerases to stalled forks. In line with this finding, translesion polymerase η foci do not colocalize with TopBP1 or FANCD2 in mitosis. Taken together, we conclude that TopBP1 promotes unscheduled DNA synthesis in mitosis independently of the examined translesion polymerases.
Kinetic studies of amino acid-based surfactant binding to DNA.
Santhiya, Deenan; Dias, Rita S; Dutta, Sounak; Das, Prasanta Kumar; Miguel, Maria G; Lindman, Björn; Maiti, Souvik
2012-05-24
In this work, the binding kinetics of amino acid-based surfactants, presenting different linkers and head groups, with calf thymus (CT)-DNA was studied using stopped-flow fluorescence spectroscopy. The kinetic studies were carried out as a function of Na(+) concentration and surfactant-to-DNA charge ratio. The surfactant binding on DNA took place in two consecutive steps, for which the corresponding first and second relative rate constants (k(1) and k(2)) were determined. The fast step was attributed to the surfactant binding to DNA and micelle formation in its vicinity, the slower step to DNA condensation and possible rearrangement of the surfactant aggregates. In general, both relative rate constants increase with surfactant concentration and decrease with the ionic strength of the medium. The architecture of the surfactant was found to have a significant impact on the kinetics of the DNA-surfactant complexation. Surfactants with amide linkers showed larger relative rate constants than those with ester linkers. The variation of the relative rate constants with the head groups of the surfactants, alanine and proline, was found to be less obvious, being partially dependent on the surfactant concentration.
Synthesis and Properties of Size-expanded DNAs: Toward Designed, Functional Genetic Systems
Krueger, Andrew T.; Lu, Haige; Lee, Alex H. F.; Kool, Eric T.
2008-01-01
We describe the design, synthesis, and properties of DNA-like molecules in which the base pairs are expanded by benzo homologation. The resulting size-expanded genetic helices are called xDNA (“expanded DNA”) and yDNA (“wide DNA”). The large component bases are fluorescent, and they display high stacking affinity. When singly substituted into natural DNA, they are destabilizing because the benzo-expanded base pair size is too large for the natural helix. However, when all base pairs are expanded, xDNA and yDNA form highly stable, sequence-selective double helices. The size-expanded DNAs are candidates for components of new, functioning genetic systems. In addition, the fluorescence of expanded DNA bases makes them potentially useful in probing nucleic acids. PMID:17309194
Yamamoto, Hiro-aki; Mohanan, Parayanthala V
2003-07-20
The effects of alpha-ketoglutarate and oxaloacetate on brain mitochondrial DNA (mtDNA) damage and seizures induced by kainic acid were examined both in vivo and in vitro. An intraperitoneal (ip) injection of kainic acid (45 mg/kg) produced broad-spectrum limbic and severe sustained seizures in all of the treated mice. The seizures were abolished when alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg) was injected intraperitoneally in the animals 1 min before kainic acid administration. In addition, the administration of kainic acid caused damage to mtDNA in brain frontal and middle cortex of mice. These effects were completely abolished by the ip preinjection of alpha-ketoglutarate (2 g/kg) or oxaloacetate (1 g/kg). In vitro exposure of kainic acid (0.25, 0.5 or 1.0 mM) to brain homogenate inflicted damage to mtDNA in a concentration-dependent manner. The damage of mtDNA induced by 1.0 mM kainic acid was attenuated by the co-treatment with alpha-ketoglutarate (2.5 or 5.0 mM) or oxaloacetate (0.75 or 1.0 mM). Furthermore, in vivo and in vitro exposure of kainic acid elicited an increase in lipid peroxidation. However, the increased lipid peroxidation was completely inhibited by cotreatment of alpha-ketoglutarate or oxaloacetate. These results suggest that alpha-keto acids such as alpha-ketoglutarate and oxaloacetate play a role in the inhibition of seizures and subsequent mtDNA damage induced by the excitotoxic/neurotoxic agent, kainic acid.
Li, M; Selvin, P R
1997-01-01
An isothiocyanate form of a lanthanide chelate which is highly luminescent when bound to terbium or europium has been synthesized. The chelate consists of diethylenetriaminepentaacetic acid (DTPA) covalently joined to a chromophore, 7-amino-4-methyl-2(1H)-quinolinone (cs124), and to L-p-aminophenylalanine, in which the aromatic amine was further converted to an isothiocyanate group. Ethylenediamine was also used in place of aminophenylalanine, but the isothiocyanate formed from the aliphatic amine was significantly less reactive. Site-specific attachments to triglycine and to the 5' ends of amine-modified DNA oligomers have been made. In addition, as an alternative method of coupling to macromolecules, DTPA anhydride-cs124 can be used to react specifically with a 5' amine group on base-deprotected synthetic DNA oligomers. Synthesis and purification is relatively straightforward in both cases, and luminescent properties are favorable for several applications, including as nonisotopic labels, as long-lifetime alternatives to fluorophores in imaging and diagnostics and particularly as donors in luminescence resonance energy transfer. Energy transfer measurements are consistent with previously reported measurements using different attachment mechanisms.
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.
Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert
2017-11-30
Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
New Deoxyribonucleic Acid Polymerase Induced by Bacillus subtilis Bacteriophage PBS2
Price, Alan R.; Cook, Sandra J.
1972-01-01
The deoxyribonucleic acid (DNA) of Bacillus subtilis phage PBS2 has been confirmed to contain uracil instead of thymine. PBS2 phage infection of wild-type cells or DNA polymerase-deficient cells results in an increase in the specific activity of DNA polymerase. This induction of DNA polymerase activity is prevented by actinomycin D and chloramphenicol. In contrast to the major B. subtilis DNA polymerase, which prefers deoxythymidine triphosphate (dTTP) to deoxyuridine triphosphate (dUTP), the DNA polymerase in crude extracts of PBS2-infected cells is equally active whether dTTP or dUTP is employed. This phage-induced polymerase may be responsible for the synthesis of uracil-containing DNA during PBS2 phage infection. PMID:4623224
Repair of Clustered Damage and DNA Polymerase Iota.
Belousova, E A; Lavrik, O I
2015-08-01
Multiple DNA lesions occurring within one or two turns of the DNA helix known as clustered damage are a source of double-stranded DNA breaks, which represent a serious threat to the cells. Repair of clustered lesions is accomplished in several steps. If a clustered lesion contains oxidized bases, an individual DNA lesion is repaired by the base excision repair (BER) mechanism involving a specialized DNA polymerase after excising DNA damage. Here, we investigated DNA synthesis catalyzed by DNA polymerase iota using damaged DNA templates. Two types of DNA substrates were used as model DNAs: partial DNA duplexes containing breaks of different length, and DNA duplexes containing 5-formyluracil (5-foU) and uracil as a precursor of apurinic/apyrimidinic sites (AP) in opposite DNA strands. For the first time, we showed that DNA polymerase iota is able to catalyze DNA synthesis using partial DNA duplexes having breaks of different length as substrates. In addition, we found that DNA polymerase iota could catalyze DNA synthesis during repair of clustered damage via the BER system by using both undamaged and 5-foU-containing templates. We found that hPCNA (human proliferating cell nuclear antigen) increased efficacy of DNA synthesis catalyzed by DNA polymerase iota.
Zheng, Qi-Huang; Liu, Xuan; Fei, Xiangshu; Wang, Ji-Quan; Ohannesian, David W; Erickson, Leonard C; Stone, K Lee; Hutchins, Gary D
2003-05-01
Novel radiolabeled O(6)-benzylguanine (O(6)-BG) derivatives, 2-amino-6-O-[(11)C]-[(methoxymethyl)benzyloxy]-9-methyl purines ([(11)C]p-O(6)-AMMP, 1a; [(11)C]m-O(6)-AMMP, 1b; [(11)C]o-O(6)-AMMP, 1c), 2-amino-6-O-benzyloxy-9-[(11)C]-[(methoxycarbonyl)methyl]purine ([(11)C]ABMMP, 2), and 2-amino-6-O-benzyloxy-9-[(11)C]-[(4'-methoxycarbonyl)benzyl]purine ([(11)C]ABMBP, 3), have been synthesized for evaluation as new potential positron emission tomography (PET) imaging agents for the DNA repair protein O(6)-alkylguanine-DNA alkyltransferase (AGT) in breast cancer. The appropriate precursors for radiolabeling were obtained in two to three steps from starting material 2-amino-6-chloropurine with moderate to excellent chemical yields. Tracers were prepared by O-[(11)C]methylation of hydroxymethyl or acid precursors using [(11)C]methyl triflate. Pure target compounds were isolated by solid-phase extraction (SPE) purification procedure in 45-65% radiochemical yields (decay corrected to end of bombardment), and a synthesis time of 20-25 min. The activity of unlabeled standard samples of 1-3 was evaluated via an in vitro AGT oligonucleotide assay. Preliminary findings from biological assay indicate the synthesized analogs have similar strong inhibitory effectiveness on AGT in comparison with the parent compound O(6)-BG. The results warrant further evaluation of these radiotracers as new potential PET imaging agents for the DNA repair protein AGT in breast cancer in vivo.
NASA Astrophysics Data System (ADS)
Hussain, Bilal; Sultana, Tayyaba; Sultana, Salma; Al-Ghanim, K. A.; Mahboob, Shahid
2017-05-01
The objective of this study was to evaluate the effect of anthropogenic pollution on DNA damage and the fatty acid profile of the bottom dweller fish ( Cirrhinus mrigala), collected from the River Chenab, in order to assess the effect of the toxicants on the quality of the fish meat. The levels of Cd, Hg, Cu, Mn, Zn, Pb, Cr and Sn and of phenols from this river were significantly higher than the permissible limits set by the USEPA. Comet assays showed DNA damage in Cirrhinus mrigala collected from three different sampling sites in the polluted area of the river. Significant differences were observed for DNA damage through comet assay in fish collected from polluted compared to control sites. No significant differences were observed for DNA damage between farmed and fish collected from upstream. The micronucleus assay showed similar trends. Fish from the highly polluted sites showed less number of fatty acids and more saturated fatty acids in their meat compared to fish from less polluted areas. Several fatty acids were missing in fish with higher levels of DNA in comet tail and micronucleus induction. Long-chain polyunsaturated fatty acids, eicosapentaenoic acid (20:5n-3) was found missing in the fish from polluted environment while it was found in considerable amount in farmed fish 7.8±0.4%. Docosahexaenoic acid (22:6n-3) also showed significant differences as 0.1±0.0 and 7.0±0.1% respectively, in wild polluted and farmed fishes.
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Protein Interactions in T7 DNA Replisome Facilitate DNA Damage Bypass.
Zou, Zhenyu; Chen, Ze; Xue, Qizhen; Xu, Ying; Xiong, Jingyuan; Yang, Ping; Le, Shuai; Zhang, Huidong
2018-06-14
DNA replisome inevitably encounters DNA damage during DNA replication. T7 DNA replisome contains DNA polymerase (gp5), the processivity factor thioredoxin (trx), helicase-primase (gp4), and ssDNA binding protein (gp2.5). T7 protein interactions mediate this DNA replication. However, whether the protein interactions could promote DNA damage bypass is still little addressed. In this study, we investigated the strand-displacement DNA synthesis past 8-oxoG or O6-MeG at the synthetic DNA fork by T7 DNA replisome. DNA damage does not obviously affect the binding affinities among helicase, polymerase, and DNA fork. Relative to unmodified G, both 8-oxoG and O6-MeG, as well as GC-rich template sequence clusters, inhibit the strand-displacement DNA synthesis and produce partial extension products. Relative to gp4 ΔC-tail, gp4 promotes the DNA damage bypass. The presence of gp2.5 further promotes this bypass. Thus, the interactions of polymerase with helicase and ssDNA binidng protein faciliate the DNA damage bypass. Similarly, accessory proteins in other complicated DNA replisomes also facilitate the DNA damage bypass. This work provides the novel mechanism information of DNA damage bypass by DNA replisome. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Saito, Yoshio; Kugenuma, Kenji; Tanaka, Makiko; Suzuki, Azusa; Saito, Isao
2012-06-01
We demonstrated an intriguing method to discriminate adenine by incident appearance of an intense new emission via exciplex formation in hybridization of target DNA with newly designed fluorescent 8-arylethynylated deoxyguanosine derivatives. We described the synthesis of such highly electron donating fluorescent guanosine derivatives and their incorporation into DNA oligomers which may be used for the structural study and the fluorometric analysis of nucleic acids. Copyright © 2012 Elsevier Ltd. All rights reserved.
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
Hsiung, H M; Sung, W L; Brousseau, R; Wu, R; Narang, S A
1980-01-01
A method for phosphorylating a protected deoxyribooligonucleotide containing phosphotriester linkages is described. The modified phosphotriester method of chemical synthesis is further refined in terms of (i) better final deblocking conditions and (ii) new chromatography solvent systems containing acetone-water-ethyl acetate to yield pure oligomers. The effectiveness of these improvements has been demonstrated in the rapid and efficient synthesis of seventeen fragments constituting the sequence of human insulin C-chain DNA. Images PMID:7008029
DOE Office of Scientific and Technical Information (OSTI.GOV)
Akabayov, B.; Lee, S; Akabayov, S
2009-01-01
Synthesis of oligoribonucleotide primers for lagging-strand DNA synthesis in the DNA replication system of bacteriophage T7 is catalyzed by the primase domain of the gene 4 helicase-primase. The primase consists of a zinc-binding domain (ZBD) and an RNA polymerase (RPD) domain. The ZBD is responsible for recognition of a specific sequence in the ssDNA template whereas catalytic activity resides in the RPD. The ZBD contains a zinc ion coordinated with four cysteine residues. We have examined the ligation state of the zinc ion by X-ray absorption spectroscopy and biochemical analysis of genetically altered primases. The ZBD of primase engaged inmore » catalysis exhibits considerable asymmetry in coordination to zinc, as evidenced by a gradual increase in electron density of the zinc together with elongation of the zinc-sulfur bonds. Both wild-type primase and primase reconstituted from purified ZBD and RPD have a similar electronic change in the level of the zinc ion as well as the configuration of the ZBD. Single amino acid replacements in the ZBD (H33A and C36S) result in the loss of both zinc binding and its structural integrity. Thus the zinc in the ZBD may act as a charge modulation indicator for the surrounding sulfur atoms necessary for recognition of specific DNA sequences.« less
Palanca, Ana; Casafont, Iñigo; Berciano, María T; Lafarga, Miguel
2014-05-01
Bortezomib is a reversible proteasome inhibitor used as an anticancer drug. However, its clinical use is limited since it causes peripheral neurotoxicity. We have used Sprague-Dawley rats as an animal model to investigate the cellular mechanisms affected by both short-term and chronic bortezomib treatments in sensory ganglia neurons. Proteasome inhibition induces dose-dependent alterations in the architecture, positioning, shape and polarity of the neuronal nucleus. It also produces DNA damage without affecting neuronal survival, and severe disruption of the protein synthesis machinery at the central cytoplasm accompanied by decreased expression of the brain-derived neurotrophic factor. As a compensatory or adaptive survival response against proteotoxic stress caused by bortezomib treatment, sensory neurons preserve basal levels of transcriptional activity, up-regulate the expression of proteasome subunit genes, and generate a new cytoplasmic perinuclear domain for protein synthesis. We propose that proteasome activity is crucial for controlling nuclear architecture, DNA repair and the organization of the protein synthesis machinery in sensory neurons. These neurons are primary targets of bortezomib neurotoxicity, for which reason their dysfunction may contribute to the pathogenesis of the bortezomib-induced peripheral neuropathy in treated patients.