Glucomannan- and glucomannan plus spirulina-enriched pork affect liver fatty acid profile, LDL receptor expression and antioxidant status in Zucker fa/fa rats fed atherogenic diets

PubMed Central

González-Torres, Laura; Matos, Cátia; Vázquez-Velasco, Miguel; Santos-López, Jorge A.; Sánchez-Martínez, Iria; García–Fernández, Camino; Bastida, Sara; Benedí, Juana; Sánchez-Muniz, Francisco J.

2017-01-01

ABSTRACT We evaluated the effects of glucomannan or glucomannan plus spirulina-restructured pork (RP) on liver fatty acid profile, desaturase/elongase enzyme activities and oxidative status of Zucker fa/fa rats for seven weeks. Control (C), glucomannan (G) and glucomannan/spirulina (GS)-RP; HC (cholesterol-enriched control), HG and HGS (cholesterol-enriched glucomannan and glucomannan/spirulina-RP) experimental diets were tested. Increased metabolic syndrome markers were found in C, G and GS rats. Cholesterol feeding increased liver size, fat, and cholesterol and reduced antioxidant enzyme levels and expressions. Cholesterolemia was lower in HG and HGS than in HC. GS vs. G showed higher stearic but lower oleic levels. SFA and PUFA decreased while MUFA increased by cholesterol feeding. The arachidonic/linoleic and docosahexaenoic/alpha-linolenic ratios were lower in HC, HG, and HGS vs. C, G, and GS, respectively, suggesting a delta-6-elongase-desaturase system inhibition. Moreover, cholesterol feeding, mainly in HGS, decreased low-density-lipoprotein receptor expression and the delta-5-desaturase activity and increased the delta-9-desaturase activity. In conclusion, the liver production of highly unsaturated fatty acids was limited to decrease their oxidation in presence of hypercholesterolaemia. Glucomannan or glucomannan/spirulina-RP has added new attributes to their functional properties in meat, partially arresting the negative effects induced by high-fat-high-cholesterol feeding on the liver fatty acid and antioxidant statuses. PMID:28325998

The role of FaBG3 in fruit ripening and B. cinerea fungal infection of strawberry.

PubMed

Li, Qian; Ji, Kai; Sun, Yufei; Luo, Hao; Wang, Hongqing; Leng, Ping

2013-10-01

In plants, β-glucosidases (BG) have been implicated in developmental and pathogen defense, and are thought to take part in abscisic acid (ABA) synthesis via hydrolysis of ABA glucose ester to release active ABA; however, there is no genetic evidence for the role of BG genes in ripening and biotic/abiotic stress in fruits. To clarify the role of BG genes in fruit, eight Fa/FvBG genes encoding β-glucosidase were isolated using information from the GenBank strawberry nucleotide database. Of the Fa/FvBG genes examined, expression of FaBG3 was the highest, showing peaks at the mature stage, coincident with the changes observed in ABA content. To verify the role of this gene, we suppressed the expression of FaBG3 via inoculation with Agrobacterium tumefaciens containing tobacco rattle virus carrying a FaBG3 fragment (RNAi). The expression of FaBG3 in FaBG3-RNAi-treated fruit was markedly reduced, and the ABA content was lower than that of the control. FaBG3-RNAi-treated fruit did not exhibit full ripening, and were firmer, had lower sugar content, and were pale compared with the control due to down-regulation of ripening-related genes. FaBG3-RNAi-treated fruit with reduced ABA levels were much more resistant to Botrytis cinerea fungus but were more sensitive to dehydration stress than control fruit. These results indicate that FaBG3 may play key roles in fruit ripening, dehydration stress and B. cinerea fungal infection in strawberries via modulation of ABA homeostasis and transcriptional regulation of ripening-related genes. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

Composition of fatty acids in plasma and erythrocytes and eicosanoids level in patients with metabolic syndrome

PubMed Central

2011-01-01

Background Disturbances of the fatty acids composition in plasma and red blood cells and eicosanoid synthesis play an important role in the metabolic syndrome (MS) formation. Methods The observation group included 61 people with metabolic syndrome (30 patients with MS and normal levels of insulin, 31 people with MS and insulin resistance - IR). The parameters of carbohydrate and lipid metabolism in blood serum were examined. The composition of nonesterified fatty acids (NEFA), fatty acid (FA) of red blood cells lipids was analyzed by gas-liquid chromatography. Eicosanoids level in MS patients blood serum was studied by enzyme immunoassay. Results In MS patients in the absence of glucose-insulin homeostasis disturbances and in patients with IR the accumulation of polyunsaturated fatty acids (18:2 n6, 18:3 n3, 22:4 n6) and lower pool of saturated FA (12:0, 14:0, 16: 0, 17:0) in plasma were discovered. A deficit of polyunsaturated FA (18:3 n3, 20:4 n6) with a predominance of on-saturated FA (14:0, 18:0) in erythrocyte membranes was revealed. In MS patients regardless of the carbohydrate metabolism status high levels of leukotriene B4 and 6-keto-prostaglandin-F1α in serum were found. The development of IR in MS patients leads to increased synthesis of thromboxane A2. Conclusion The results revealed a disturbance in nonesterified fatty acids of plasma lipids and red blood cells, eicosanoid synthesis in MS patients. The breach of the plasma and cell membranes fatty acids compositions, synthesis of vasoactive and proinflammatory eicosanoids is an important pathogenetic part of the MS development. PMID:21595891

Duodenal infusions of palmitic, stearic or oleic acids differently affect mammary gland metabolism of fatty acids in lactating dairy cows.

PubMed

Enjalbert, F; Nicot, M C; Bayourthe, C; Moncoulon, R

1998-09-01

The effect of dietary lipids on the fatty acid (FA) profile of cows' milk fat is mainly dependent on digestive processes and mammary gland uptake and metabolism of FA. The objective of this study was to determine the separate effects of high arterial concentrations of 16:0, 18:0 and cis-18:1(n-9) on uptake, synthesis and 18:0 desaturation rate in the mammary gland of lactating dairy cows, via arterio-venous differences and mammary gland balance of FA. In a 4 x 4 Latin square, four lactating Holstein cows with cannula in the proximal duodenum were infused duodenally with a mixture providing daily 0 (C treatment) or 500 g FA with mainly 16:0 (P treatment), 18:0 (S treatment) or cis-18:1(n-9) (O treatment). Significantly higher arterial concentrations of infused FA in arterial plasma nonesterified FA and triglycerides (NETGFA) were observed with P and O treatments, but the effect of the S treatment was much lower. Arterio-venous differences of NETGFA increased with arterial concentrations. The number of synthesized FA in the mammary gland was not significantly affected by duodenal infusion of FA. Mean chain length was significantly reduced by P and O treatments, suggesting an effect of mammary gland uptake of long-chain FA on the termination process of mammary gland synthesis of FA. Across all treatments, 4:0 mammary gland balance increased linearly (r = 0.67, P = 0.004) with mammary gland FA uptake. Mammary gland desaturation of 18:0 to cis-18:1(n-9) averaged 52% and was not significantly affected by treatments, but was reduced by trans-18:1 mammary gland uptake. Uptake, synthesis and desaturation of FA by the mammary gland of dairy cows are affected by arterial concentrations of 16:0, 18:0 and cis-18:1(n-9).

Synthesis, chemical characterization, and economical feasibility of poly-phenolic-branched-chain fatty acids: Synthesis of poly-phenolic-branched-chain fatty acids

USDA-ARS?s Scientific Manuscript database

New poly-phenolic branched-chain fatty acid (poly-PBC-FA) products were synthesized from a combination of soybean fatty acids and phenolic materials through a highly efficient zeolite catalyzed arylation method. These poly-PBC-FAs are liquid at room temperature and do not have the unpleasant odor li...

Enzymatic synthesis of structured lipids.

PubMed

Iwasaki, Yugo; Yamane, Tsuneo

2004-01-01

Structured lipids (SLs) are defined as lipids that are modified chemically or enzymatically in order to change their structure. This review deals with structured triacylglycerols (STGs) and structured phospholipids (SPLs). The most typical STGs are MLM-type STGs, having medium chain fatty acids (FAs) at the 1- and 3-positions and a long chain fatty acid at the 2- position. MLM-type STGs are synthesized by: 1) 1,3-position-specific lipase-catalyzed acyl exchange of TG with FA or with FA ethylester (FAEt); 2) 1,3-position-specific lipase-catalyzed acylation of glycerol with FA, giving symmetric 1,3-diacyl-sn-glycerol, followed by chemical acylation at the sn-2 position, and; 3) 1,3-position-specific lipase-catalyzed deacylation of TG, giving 2-monoacylglycerol, followed by reacylation at the 1- and 3-positions with FA or with (FAEt). Enzymatic preparation of SPLs requires: 1) acyl group modification, and 2) head group modification of phospholipids. Acyl group modification is performed using lipases or phospholipase A2-mediated transesterification or ester synthesis to introduce arbitrary fatty acid to phospholipids. Head group modification is carried out by phospholipase D-catalyzed transphosphatidylation. A wide range of compounds can be introduced into the polar head of phospholipids, making it possible to prepare various SPLs.

pH-sensitive and folic acid-targeted MPEG-PHIS/FA-PEG-VE mixed micelles for the delivery of PTX-VE and their antitumor activity.

PubMed

Di, Yan; Li, Ting; Zhu, Zhihong; Chen, Fen; Jia, Lianqun; Liu, Wenbing; Gai, Xiumei; Wang, Yingying; Pan, Weisan; Yang, Xinggang

2017-01-01

The aim of this study was to simultaneously introduce pH sensitivity and folic acid (FA) targeting into a micelle system to achieve quick drug release and to enhance its accumulation in tumor cells. Paclitaxel-(+)-α-tocopherol (PTX-VE)-loaded mixed micelles (PHIS/FA/PM) fabricated by poly(ethylene glycol) methyl ether-poly(histidine) (MPEG-PHIS) and folic acid-poly(ethylene glycol)-(+)-α-tocopherol (FA-PEG-VE) were characterized by dynamic light scattering and transmission electron microscopy (TEM). The mixed micelles had a spherical morphology with an average diameter of 137.0±6.70 nm and a zeta potential of -48.7±4.25 mV. The drug encapsulation and loading efficiencies were 91.06%±2.45% and 5.28%±0.30%, respectively. The pH sensitivity was confirmed by changes in particle size, critical micelle concentration, and transmittance as a function of pH. MTT assay showed that PHIS/FA/PM had higher cytotoxicity at pH 6.0 than at pH 7.4, and lower cytotoxicity in the presence of free FA. Confocal laser scanning microscope images demonstrated a time-dependent and FA-inhibited cellular uptake. In vivo imaging confirmed that the mixed micelles targeted accumulation at tumor sites and the tumor inhibition rate was 85.97%. The results proved that the mixed micelle system fabricated by MPEG-PHIS and FA-PEG-VE is a promising approach to improve antitumor efficacy.

pH-sensitive and folic acid-targeted MPEG-PHIS/FA-PEG-VE mixed micelles for the delivery of PTX-VE and their antitumor activity

PubMed Central

Di, Yan; Li, Ting; Zhu, Zhihong; Chen, Fen; Jia, Lianqun; Liu, Wenbing; Gai, Xiumei; Wang, Yingying; Pan, Weisan; Yang, Xinggang

2017-01-01

The aim of this study was to simultaneously introduce pH sensitivity and folic acid (FA) targeting into a micelle system to achieve quick drug release and to enhance its accumulation in tumor cells. Paclitaxel-(+)-α-tocopherol (PTX-VE)-loaded mixed micelles (PHIS/FA/PM) fabricated by poly(ethylene glycol) methyl ether-poly(histidine) (MPEG-PHIS) and folic acid-poly(ethylene glycol)-(+)-α-tocopherol (FA-PEG-VE) were characterized by dynamic light scattering and transmission electron microscopy (TEM). The mixed micelles had a spherical morphology with an average diameter of 137.0±6.70 nm and a zeta potential of −48.7±4.25 mV. The drug encapsulation and loading efficiencies were 91.06%±2.45% and 5.28%±0.30%, respectively. The pH sensitivity was confirmed by changes in particle size, critical micelle concentration, and transmittance as a function of pH. MTT assay showed that PHIS/FA/PM had higher cytotoxicity at pH 6.0 than at pH 7.4, and lower cytotoxicity in the presence of free FA. Confocal laser scanning microscope images demonstrated a time-dependent and FA-inhibited cellular uptake. In vivo imaging confirmed that the mixed micelles targeted accumulation at tumor sites and the tumor inhibition rate was 85.97%. The results proved that the mixed micelle system fabricated by MPEG-PHIS and FA-PEG-VE is a promising approach to improve antitumor efficacy. PMID:28860753

Intensification of esterification of acids for synthesis of biodiesel using acoustic and hydrodynamic cavitation.

PubMed

Kelkar, Mandar A; Gogate, Parag R; Pandit, Aniruddha B

2008-03-01

Cavitation results in conditions of turbulence and liquid circulation in the reactor which can aid in eliminating mass transfer resistances. The present work illustrates the use of cavitation for intensification of biodiesel synthesis (esterification) reaction, which is mass transfer limited reaction considering the immiscible nature of the reactants, i.e., fatty acids and alcohol. Esterification of fatty acid (FA) odour cut (C(8)-C(10)) with methanol in the presence of concentrated H(2)SO(4) as a catalyst has been studied in hydrodynamic cavitation reactor as well as in the sonochemical reactor. The different reaction operating parameters such as molar ratio of acid to alcohol, catalyst quantity have been optimized under acoustic as well as hydrodynamic cavitating conditions in addition to the optimization of the geometry of the orifice plate in the case of hydrodynamic cavitation reactors. Few experiments have also been carried out with other acid (lower and higher)/methanol combination viz. caprylic acid and capric acids with methanol with an aim of investigating the efficacy of cavitation for giving the desired yields and also to quantify the degree of process intensification that can be achieved using the same. It has been observed that ambient operating conditions of temperature and pressure and reaction times of <3h, for all the different combinations of acid (lower and higher)/methanol studied in the present work, was sufficient for giving >90% conversion (mol%). This clearly establishes the efficacy of cavitation as an excellent way to achieve process intensification of the biodiesel synthesis process.

Pimelic acid, the first precursor of the Bacillus subtilis biotin synthesis pathway, exists as the free acid and is assembled by fatty acid synthesis.

PubMed

Manandhar, Miglena; Cronan, John E

2017-05-01

Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.

Acetate Dose-Dependently Stimulates Milk Fat Synthesis in Lactating Dairy Cows.

PubMed

Urrutia, Natalie L; Harvatine, Kevin J

2017-05-01

Background: Acetate is a short-chain fatty acid (FA) that is especially important to cows because it is the major substrate for de novo FA synthesis. However, the effect of acetate supply on mammary lipid synthesis is not clear. Objective: The objective of this experiment was to determine the effect of increasing acetate supply on milk fat synthesis in lactating dairy cows. Methods: Six multiparous lactating Holstein cows were randomly assigned to treatments in a replicated design to investigate the effect of acetate supply on milk fat synthesis. Treatments were 0 (control), 5, 10, and 15 mol acetate/d continuously infused into the rumen for 4 d. Rumen short-chain FAs, plasma hormones and metabolites, milk fat concentration, and milk FA profile were analyzed on day 4 of each treatment. Polynomial contrasts were used to test the linear and quadratic effects of increasing acetate supply. Results: Acetate increased milk fat yield quadratically ( P < 0.01) by 7%, 16%, and 14% and increased milk fat concentration linearly ( P < 0.001) by 6%, 9%, and 11% for 5, 10, and 15 mol acetate/d, respectively, compared with the control treatment. Increased milk fat yield predominantly was due to a linear increase in 16-carbon FAs ( P < 0.001) and a quadratic increase in de novo synthesized FAs (<16-carbon FAs; P < 0.01), indicating that there was stimulation of de novo synthesis pathways. Apparent transfer of acetate to milk fat was 33.4%, 36.2%, and 20.6% for 5, 10, and 15 mol/d, respectively. Acetate infusion linearly increased the relative concentration of rumen acetate ( P < 0.001) before feeding, but not after feeding. Acetate linearly increased plasma ß-hydroxybutyric acid by 29%, 50%, and 78%, respectively, after feeding compared with the control treatment ( P < 0.01). Conclusions: Increasing acetate supply to lactating cows increases milk fat synthesis, suggesting that nutritional strategies that increase ruminal acetate absorption would be expected to increase milk fat

Cellular and Molecular Responses of Dunaliella tertiolecta by Expression of a Plant Medium Chain Length Fatty Acid Specific Acyl-ACP Thioesterase

PubMed Central

Lin, Huixin; Shen, Hui; Lee, Yuan K.

2018-01-01

Metabolic engineering of microalgae to accumulate high levels of medium chain length fatty acids (MCFAs) has met with limited success. Traditional approaches employ single introduction of MCFA specific acyl-ACP thioesterases (TEs), but our current research in transgenic Dunaliella tertiolecta line has highlighted that, there is no single rate-limiting approach that can effectively increase MCFA levels. Here, we explore the accumulation of MCFAs in D. tertiolecta after transgenic expression of myristic acid biased TE (C14TE). We observe that the MCFA levels were negatively correlated to the fatty acid (FA) synthesis genes, ketoacyl-ACP synthase II (KASII), stearoyl-CoA-9-desaturase (Δ9D), and oleoyl-CoA-12-desaturase (Δ12D). To further examine the molecular mechanism of MCFA accumulation in microalgae, we investigate the transcriptomic dynamics of the MCFA producing strain of D. tertiolecta. At the transcript level, enhanced MCFA accumulation primarily involved up-regulation of photosynthetic genes and down-regulation of genes from central carbon metabolic processes, resulting in an overall decrease in carbon precursors for FA synthesis. We additionally observe that MCFA specific peroxisomal β-oxidation gene (ACX3) was greatly enhanced to prevent excessive build-up of unusual MCFA levels. Besides, long chain acyl-CoA synthetase gene (LACS) was down-regulated, likely in attempt to control fatty acyl supply flux to FA synthesis cycle. This article provides a spatial regulation model of unusual FA accumulation in microalgae and a platform for additional metabolic engineering targeting pathways from FA synthesis, FA transport, and peroxisomal β-oxidation to achieve microalgae oils with higher levels of MCFAs. PMID:29670594

Dietary Effects on Stable Carbon Isotope Composition of Fatty Acids in Polar and Neutral Fractions of Intramuscular Fat of Lambs.

PubMed

van Leeuwen, Katryna A; Camin, Federica; Jerónimo, Eliana; Vasta, Valentina; Prenzler, Paul D; Ryan, Danielle; Bessa, Rui J B

2017-11-01

In this study we measured δ 13 C values of the main fatty acids (FA) present in neutral and polar intramuscular lipids of meat samples from 24 lambs, fed with four different diets supplemented with sunflower and linseed oil and the tanniferous shrub Cistus ladanifer L. The objective was to understand if the increase in intramuscular fat observed in lambs fed simultaneously C. ladanifer and oil was explained mostly by incorporation of diet derived FA or by increased de novo FA synthesis. De novo FA synthesis was evaluated by 13 C enrichment (‰) of 16:0 in intramuscular lipids compared to bulk diet or compared to dietary 16:0. Oil reduced 13 C enrichment of 16:0 in muscle lipid but had no effect when the diet included C. ladanifer (P value <0.01). Thus, dietary C. ladanifer blocked the inhibitory effects of lipid supplementation on de novo FA synthesis.

Engineering Sialic Acid Synthesis Ability in Insect Cells.

PubMed

Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J

2015-01-01

Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.

Mechanisms of fatty acid synthesis in marine fungus-like protists.

PubMed

Xie, Yunxuan; Wang, Guangyi

2015-10-01

Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed.

Brain white matter development is associated with a human-specific haplotype increasing the synthesis of long chain fatty acids.

PubMed

Peters, Bart D; Voineskos, Aristotle N; Szeszko, Philip R; Lett, Tristram A; DeRosse, Pamela; Guha, Saurav; Karlsgodt, Katherine H; Ikuta, Toshikazu; Felsky, Daniel; John, Majnu; Rotenberg, David J; Kennedy, James L; Lencz, Todd; Malhotra, Anil K

2014-04-30

The genetic and molecular pathways driving human brain white matter (WM) development are only beginning to be discovered. Long chain polyunsaturated fatty acids (LC-PUFAs) have been implicated in myelination in animal models and humans. The biosynthesis of LC-PUFAs is regulated by the fatty acid desaturase (FADS) genes, of which a human-specific haplotype is strongly associated with ω-3 and ω-6 LC-PUFA concentrations in blood. To investigate the relationship between LC-PUFA synthesis and human brain WM development, we examined whether this FADS haplotype is associated with age-related WM differences across the life span in healthy individuals 9-86 years of age (n = 207). Diffusion tensor imaging was performed to measure fractional anisotropy (FA), a putative measure of myelination, of the cerebral WM tracts. FADS haplotype status was determined with a single nucleotide polymorphism (rs174583) that tags this haplotype. Overall, normal age-related WM differences were observed, including higher FA values in early adulthood compared with childhood, followed by lower FA values across older age ranges. However, individuals homozygous for the minor allele (associated with lower LC-PUFA concentrations) did not display these normal age-related WM differences (significant age × genotype interactions, p(corrected) < 0.05). These findings suggest that LC-PUFAs are involved in human brain WM development from childhood into adulthood. This haplotype and LC-PUFAs may play a role in myelin-related disorders of neurodevelopmental origin.

Dietary fish protein hydrolysates containing bioactive motifs affect serum and adipose tissue fatty acid compositions, serum lipids, postprandial glucose regulation and growth in obese Zucker fa/fa rats.

PubMed

Drotningsvik, Aslaug; Mjøs, Svein A; Pampanin, Daniela M; Slizyte, Rasa; Carvajal, Ana; Remman, Tore; Høgøy, Ingmar; Gudbrandsen, Oddrun A

2016-10-01

The world's fisheries and aquaculture industries produce vast amounts of protein-containing by-products that can be enzymatically hydrolysed to smaller peptides and possibly be used as additives to functional foods and nutraceuticals targeted for patients with obesity-related metabolic disorders. To investigate the effects of fish protein hydrolysates on markers of metabolic disorders, obese Zucker fa/fa rats consumed diets with 75 % of protein from casein/whey (CAS) and 25 % from herring (HER) or salmon (SAL) protein hydrolysate from rest raw material, or 100 % protein from CAS for 4 weeks. The fatty acid compositions were similar in the experimental diets, and none of them contained any long-chain n-3 PUFA. Ratios of lysine:arginine and methionine:glycine were lower in HER and SAL diets when compared with CAS, and taurine was detected only in fish protein hydrolysate diets. Motifs with reported hypocholesterolemic or antidiabetic activities were identified in both fish protein hydrolysates. Rats fed HER diet had lower serum HDL-cholesterol and LDL-cholesterol, and higher serum TAG, MUFA and n-3:n-6 PUFA ratio compared with CAS-fed rats. SAL rats gained more weight and had better postprandial glucose regulation compared with CAS rats. Serum lipids and fatty acids were only marginally affected by SAL, but adipose tissue contained less total SFA and more total n-3 PUFA when compared with CAS. To conclude, diets containing hydrolysed rest raw material from herring or salmon proteins may affect growth, lipid metabolism, postprandial glucose regulation and fatty acid composition in serum and adipose tissue in obese Zucker rats.

Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

NASA Technical Reports Server (NTRS)

Weber, Arthur L.

1998-01-01

Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

Sterol regulatory element-binding protein-1 participates in the regulation of fatty acid synthase expression in colorectal neoplasia.

PubMed

Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S

2000-11-25

Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.

Folic acid supplementation in pregnancy and implications in health and disease

PubMed Central

2014-01-01

Maternal exposure to dietary factors during pregnancy can influence embryonic development and may modulate the phenotype of offspring through epigenetic programming. Folate is critical for nucleotide synthesis, and preconceptional intake of dietary folic acid (FA) is credited with reduced incidences of neural tube defects in infants. While fortification of grains with FA resulted in a positive public-health outcome, concern has been raised for the need for further investigation of unintended consequences and potential health hazards arising from excessive FA intakes, especially following reports that FA may exert epigenetic effects. The objective of this article is to discuss the role of FA in human health and to review the benefits, concerns and epigenetic effects of maternal FA on the basis of recent findings that are important to design future studies. PMID:25135350

Folic acid conjugated cross-linked acrylic polymer (FA-CLAP) hydrogel for site specific delivery of hydrophobic drugs to cancer cells.

PubMed

Pillai, Jisha Jayadevan; Thulasidasan, Arun Kumar Theralikattu; Anto, Ruby John; Chithralekha, Devika Nandan; Narayanan, Ashwanikumar; Kumar, Gopalakrishnapillai Sankaramangalam Vinod

2014-07-15

The hydrogel based system is found to be rarely reported for the delivery of hydrophobic drug due to the incompatibility of hydrophilicity of the polymer network and the hydrophobicity of drug. This problem can be solved by preparing semi-interpenetrating network of cross-linked polymer for tuning the hydrophilicity so as to entrap the hydrophobic drugs. The current study is to develop a folic acid conjugated cross-linked pH sensitive, biocompatible polymeric hydrogel to achieve a site specific drug delivery. For that, we have synthesized a folic acid conjugated PEG cross-linked acrylic polymer (FA-CLAP) hydrogel and investigated its loading and release of curcumin. The formed polymer hydrogel was then conjugated with folic acid for the site specific delivery of curcumin to cancer cells and then further characterized and conducted the cell uptake and cytotoxicity studies on human cervical cancer cell lines (HeLa). In this study, we synthesized folic acid conjugated cross-linked acrylic hydrogel for the delivery of hydrophobic drugs to the cancer site. Poly (ethyleneglycol) (PEG) diacrylate cross-linked acrylic polymer (PAA) was prepared via inverse emulsion polymerization technique and later conjugated it with folic acid (FA-CLAP). Hydrophobic drug curcumin is entrapped into it and investigated the entrapment efficiency. Characterization of synthesized hydogel was done by using Fourier Transform-Infrared spectroscopy (FT-IR), Transmission Electron Microscopy (TEM), Differential Scanning Calorimetry (DSC). Polymerization and folate conjugation was confirmed by FT-IR spectroscopy. The release kinetics of drug from the entrapped form was studied which showed initial burst release followed by sustained release due to swelling and increased cross-linking. In vitro cytotoxicity and cell uptake studies were conducted in human cervical cancer (HeLa) cell lines. Results showed that curcumin entrapped folate conjugated cross-linked acrylic polymer (FA-CLAP) hydrogel showed

Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

PubMed

Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

2015-01-01

This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

Amino Acid Control over Deoxyribonucleic Acid Synthesis in Escherichia coli Infected With T-Even Bacteriophage

PubMed Central

Donini, Pierluigi

1970-01-01

Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067

Effect of omega-3 fatty acids on the modification of erythrocyte membrane fatty acid content including oleic acid in peritoneal dialysis patients.

PubMed

An, W S; Lee, S M; Son, Y K; Kim, S E; Kim, K H; Han, J Y; Bae, H R; Park, Y

2012-01-01

Erythrocyte membrane fatty acids (FA), such as oleic acid, are related to acute coronary syndrome. There is no report about the effect of omega-3 FA on oleic acid in peritoneal dialysis (PD) patients. We hypothesized that omega-3 FA can modify erythrocyte membrane FA, including oleic acid, in PD patients. In a double-blind, randomized, placebo-controlled study, 18 patients who were treated with PD for at least 6 months were randomized to treatment for 12 weeks with omega-3 FA or placebo. Erythrocyte membrane FA content was measured by gas chromatography at baseline and after 12 weeks. The erythrocyte membrane content of eicosapentaenoic acid and docosahexaenoic acid was significantly increased and saturated FA and oleic acid were significantly decreased in the omega-3 FA supplementation group after 12 weeks compared to baseline. In conclusion, erythrocyte membrane FA content, including oleic acid, was significantly modified by omega-3 FA supplementation for 12 weeks in PD patients. Copyright © 2011 Elsevier Ltd. All rights reserved.

Malonyl-coenzyme-A is a potential mediator of cytotoxicity induced by fatty-acid synthase inhibition in human breast cancer cells and xenografts.

PubMed

Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P

2000-01-15

A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.

Digestion of fatty acids in ruminants: a meta-analysis of flows and variation factors. 1. Total fatty acids.

PubMed

Schmidely, P; Glasser, F; Doreau, M; Sauvant, D

2008-05-01

A database built from 95 experiments with 303 treatments was used to quantify the ruminal biohydrogenation (BH) of fatty acids (FA), efficiency of microbial protein synthesis (EMPS), duodenal flow and intestinal absorption of total FA and of FA with 12 to 18 C units, in response to variations in dietary FA content, source or technological treatment of fat supplement. Flows of FA were expressed relative to dry matter intake (DMI) to compile data from bovine and ovine species. BH tended to increase curvilinearly with FA intake, whereas dietary FA did not affect EMPS. A linear relationship between FA intake and duodenal flow of total FA was obtained, with a coefficient of 0.75 ± 0.06 g duodenal FA/kg DMI for each g FA intake/kg DMI. Between experiments, positive balances of total FA (intake - duodenum) were related to low EMPS. Relationships between duodenal flows of FA with 12 to 18 C units and their respective intakes were linear, with a coefficient that increased with the number of C units. Duodenal flow of bacterial FA was linearly related to FA intake (coefficient 0.33 ± 0.13), whereas contribution of bacterial lipid to duodenal flow decreased as FA intake increased. For each FA with 12 to 16 C units, prediction of FA absorption from its respective duodenal flow was linear. For total FA and FA with 18 C units, apparent absorption levelled off at high duodenal flows. All these relationships were discussed according to current knowledge on microbial metabolism in the rumen and on the intestinal digestibility of FA in the intestine.

Energetics of amino acid synthesis in hydrothermal ecosystems

NASA Technical Reports Server (NTRS)

Amend, J. P.; Shock, E. L.

1998-01-01

Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

Transcriptome analysis and identification of genes associated with omega-3 fatty acid biosynthesis in Perilla frutescens (L.) var. frutescens

USDA-ARS?s Scientific Manuscript database

Background: Perilla (Perilla frutescens (L.) var frutescens) produces high levels of a-linolenic acid (ALA), an omega-3 fatty acid important to health and development. To uncover key genes involved in fatty acid (FA) and triacylglycerol (TAG) synthesis in perilla, we conducted deep sequencing of cD...

A leu-rich repeat receptor-like protein kinase, FaRIPK1, interacts with the ABA receptor, FaABAR, to regulate fruit ripening in strawberry.

PubMed

Hou, Bing-Zhu; Xu, Cheng; Shen, Yuan-Yue

2018-03-24

Strawberry (Fragaria×ananassa) is a model plant for studying non-climacteric fruit ripening regulated by abscisic acid (ABA); however, its exact molecular mechanisms are yet not fully understood. In this study, a predicted leu-rich repeat (LRR) receptor-like kinase in strawberry, red-initial protein kinase 1 (FaRIPK1), was screened and, using a yeast two-hybrid assay, was shown to interact with a putative ABA receptor, FaABAR. This association was confirmed by bimolecular fluorescence complementation and co-immunoprecipitation assays, and shown to occur in the nucleus. Expression analysis by real-time PCR showed that FaRIPK1 is expressed in roots, stems, leaves, flowers, and fruit, with a particularly high expression in white fruit at the onset of coloration. Down-regulation of FaRIPK1 expression in strawberry fruit, using Tobacco rattle virus-induced gene silencing, inhibited ripening, as evidenced by suppression of ripening-related physiological changes and reduced expression of several genes involved in softening, sugar content, pigmentation, and ABA biosynthesis and signaling. The yeast-expressed LRR and STK (serine/threonine protein kinase) domains of FaRIPK1 bound ABA and showed kinase activity, respectively. A fruit disc-incubation test revealed that FaRIPK1 expression was induced by ABA and ethylene. The synergistic action of FaRIPK1 with FaABAR in regulation of strawberry fruit ripening is discussed.

Fatty Acid Transporter CD36 Mediates Hypothalamic Effect of Fatty Acids on Food Intake in Rats

PubMed Central

Moullé, Valentine S.; Le Foll, Christelle; Philippe, Erwann; Kassis, Nadim; Rouch, Claude; Marsollier, Nicolas; Bui, Linh-Chi; Guissard, Christophe; Dairou, Julien; Lorsignol, Anne; Pénicaud, Luc; Levin, Barry E.; Cruciani-Guglielmacci, Céline; Magnan, Christophe

2013-01-01

Variations in plasma fatty acid (FA) concentrations are detected by FA sensing neurons in specific brain areas such as the hypothalamus. These neurons play a physiological role in the control of food intake and the regulation of hepatic glucose production. Le Foll et al. previously showed in vitro that at least 50% of the FA sensing in ventromedial hypothalamic (VMH) neurons is attributable to the interaction of long chain FA with FA translocase/CD36 (CD36). The present work assessed whether in vivo effects of hypothalamic FA sensing might be partly mediated by CD36 or intracellular events such as acylCoA synthesis or β-oxidation. To that end, a catheter was implanted in the carotid artery toward the brain in male Wistar rats. After 1 wk recovery, animals were food-deprived for 5 h, then 10 min infusions of triglyceride emulsion, Intralipid +/− heparin (IL, ILH, respectively) or saline/heparin (SH) were carried out and food intake was assessed over the next 5 h. Experimental groups included: 1) Rats previously injected in ventromedian nucleus (VMN) with shRNA against CD36 or scrambled RNA; 2) Etomoxir (CPT1 inhibitor) or saline co-infused with ILH/SH; and 3) Triacsin C (acylCoA synthase inhibitor) or saline co-infused with ILH/SH. ILH significantly lowered food intake during refeeding compared to SH (p<0.001). Five hours after refeeding, etomoxir did not affect this inhibitory effect of ILH on food intake while VMN CD36 depletion totally prevented it. Triacsin C also prevented ILH effects on food intake. In conclusion, the effect of FA to inhibit food intake is dependent on VMN CD36 and acylCoA synthesis but does not required FA oxidation. PMID:24040150

Diabetes-associated microbiota in fa/fa rats is modified by Roux-en-Y gastric bypass.

PubMed

Arora, Tulika; Seyfried, Florian; Docherty, Neil G; Tremaroli, Valentina; le Roux, Carel W; Perkins, Rosie; Bäckhed, Fredrik

2017-09-01

Roux-en-Y gastric bypass (RYGB) and duodenal jejunal bypass (DJB), two different forms of bariatric surgery, are associated with improved glucose tolerance, but it is not clear whether the gut microbiota contributes to this effect. Here we used fa/fa rats as a model of impaired glucose tolerance to investigate whether (i) the microbiota varies between fa/fa and nondiabetic fa/+ rats; (ii) the microbiota of fa/fa rats is affected by RYGB and/or DJB; and (iii) surgically induced microbiota alterations contribute to glucose metabolism. We observed a profound expansion of Firmicutes (specifically, Lactobacillus animalis and Lactobacillus reuteri) in the small intestine of diabetic fa/fa compared with nondiabetic fa/+ rats. RYGB-, but not DJB-, treated fa/fa rats exhibited greater microbiota diversity in the ileum and lower L. animalis and L. reuteri abundance compared with sham-operated fa/fa rats in all intestinal segments, and their microbiota composition resembled that of unoperated fa/+ rats. To investigate the functional role of RYGB-associated microbiota alterations, we transferred microbiota from sham- and RYGB-treated fa/fa rats to germ-free mice. The metabolic phenotype of RYGB-treated rats was not transferred by the transplant of ileal microbiota. In contrast, postprandial peak glucose levels were lower in mice that received cecal microbiota from RYGB- versus sham-operated rats. Thus, diabetes-associated microbiota alterations in fa/fa rats can be modified by RYGB, and modifications in the cecal microbiota may partially contribute to improved glucose tolerance after RYGB.

Diabetes-associated microbiota in fa/fa rats is modified by Roux-en-Y gastric bypass

PubMed Central

Arora, Tulika; Seyfried, Florian; Docherty, Neil G; Tremaroli, Valentina; le Roux, Carel W; Perkins, Rosie; Bäckhed, Fredrik

2017-01-01

Roux-en-Y gastric bypass (RYGB) and duodenal jejunal bypass (DJB), two different forms of bariatric surgery, are associated with improved glucose tolerance, but it is not clear whether the gut microbiota contributes to this effect. Here we used fa/fa rats as a model of impaired glucose tolerance to investigate whether (i) the microbiota varies between fa/fa and nondiabetic fa/+ rats; (ii) the microbiota of fa/fa rats is affected by RYGB and/or DJB; and (iii) surgically induced microbiota alterations contribute to glucose metabolism. We observed a profound expansion of Firmicutes (specifically, Lactobacillus animalis and Lactobacillus reuteri) in the small intestine of diabetic fa/fa compared with nondiabetic fa/+ rats. RYGB-, but not DJB-, treated fa/fa rats exhibited greater microbiota diversity in the ileum and lower L. animalis and L. reuteri abundance compared with sham-operated fa/fa rats in all intestinal segments, and their microbiota composition resembled that of unoperated fa/+ rats. To investigate the functional role of RYGB-associated microbiota alterations, we transferred microbiota from sham- and RYGB-treated fa/fa rats to germ-free mice. The metabolic phenotype of RYGB-treated rats was not transferred by the transplant of ileal microbiota. In contrast, postprandial peak glucose levels were lower in mice that received cecal microbiota from RYGB- versus sham-operated rats. Thus, diabetes-associated microbiota alterations in fa/fa rats can be modified by RYGB, and modifications in the cecal microbiota may partially contribute to improved glucose tolerance after RYGB. PMID:28524868

Synthesis of amino acids

DOEpatents

Davis, J.W. Jr.

1979-09-21

A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

[Role of fatty acids in the nervous control of energy balance].

PubMed

Magnan, Christophe; Luquet, Serge

2015-01-01

Fatty acid (FA)-sensitive neurons are present in the brain, especially the hypothalamus, and play a key role in the neural control of energy and glucose homeostasis including feeding behavior, insulin secretion and action. Subpopulations of neurons in the ventromedial and arcuate hypothalamic nuclei are selectively either inhibited or activated by FA. Molecular effectors of these FA effects include ion channels such as chloride, potassium or calcium. In addition at least half of the FA responses in ventromedial hypothalamic neurons are mediated by interaction with FAT/CD36, a FA translocator/receptor that does not require intracellular metabolism to activate downstream signaling. Recently, an important role of lipoprotein lipase in FA sensing has also been demonstrated not only in hypothalamus, but also in the hippocampus and striatum. Finally, FA overload might impair neural control of energy homeostasis through enhanced ceramide synthesis and may contribute to obesity and/or type 2 diabetes pathogenesis in predisposed subjects. © Société de Biologie, 2016.

FaPOD27 functions in the metabolism of polyphenols in strawberry fruit (Fragaria sp.)

PubMed Central

Yeh, Su-Ying; Huang, Fong-Chin; Hoffmann, Thomas; Mayershofer, Mechthild; Schwab, Wilfried

2014-01-01

The strawberry (Fragaria × ananassa) is one of the most preferred fresh fruit worldwide, accumulates numerous flavonoids but has limited shelf life due to excessive tissue softening caused by cell wall degradation. Since lignin is one of the polymers that strengthen plant cell walls and might contribute to some extent to fruit firmness monolignol biosynthesis was studied in strawberry fruit. Cinnamoyl-CoA reductase (CCR), cinnamyl alcohol dehydrogenase (CAD), and a peroxidase (POD27) gene were strongly expressed in red, ripe fruit whereas a second POD gene was primarily expressed in green, immature fruit. Moreover, FaPOD27 transcripts were strongly and constitutively induced in fruits exposed to Agrobacterium infection. Gene expression levels and enzymatic activities of FaCCR and FaCAD were efficiently suppressed through RNAi in FaCCR- and FaCAD-silenced strawberries. Besides, significantly elevated FaPOD transcript levels were detected after agroinfiltration of pBI-FaPOD constructs in fruits. At the same time, levels of G-monomers were considerably reduced in FaCCR-silenced fruits whereas the proportion of both G- and S-monomers decisively decreased in FaCAD-silenced and pBI-FaPOD fruits. Development, firmness, and lignin level of the treated fruits were similar to pBI-intron control fruits, presumably attributed to increased expression levels of FaPOD27 upon agroinfiltration. Additionally, enhanced firmness, accompanied with elevated lignin levels, was revealed in chalcone synthase-deficient fruits (CHS−), independent of down- or up-regulation of individual and combined FaCCR. FaCAD, and FaPOD genes by agroinfiltration, when compared to CHS−/pBI-intron control fruits. These approaches provide further insight into the genetic control of flavonoid and lignin synthesis in strawberries. The results suggest that FaPOD27 is a key gene for lignin biosynthesis in strawberry fruit and thus to improving the firmness of strawberries. PMID:25346738

Optimization of biodiesel synthesis by esterification using a fermented solid produced by Rhizopus microsporus on sugarcane bagasse.

PubMed

Botton, Vanderleia; Piovan, Leandro; Meier, Henry França; Mitchell, David Alexander; Cordova, Jesús; Krieger, Nadia

2018-04-01

A fermented solid containing lipases was produced by solid-state fermentation of Rhizopus microsporus on sugarcane bagasse enriched with urea, soybean oil, and a mineral solution. The dry fermented solid produced using R. microsporus (RMFS) was used to catalyze the synthesis of alkyl-esters by esterification in a solvent-free system containing ethanol and oleic acid (as a model system) or a mixture of fatty acids obtained from the physical hydrolysis of soybean soapstock acid oil (FA-SSAO) in subcritical water. The conversions were 93.5 and 84.1%, for oleic acid and FA-SSAO, respectively, at 48 h and 40 °C, at a molar ratio (MR) of ethanol to fatty acid of 5:1. A further increase in the MR to 10:1 improved the production of ethylic-esters, giving conversions at 48 h of 98 and 86% for oleic acid and FA-SSAO, respectively. The results obtained in this work foster further studies on scaling-up of an environmentally friendly process to produce biofuels.

Δ(9)-THC modulation of fatty acid 2-hydroxylase (FA2H) gene expression: possible involvement of induced levels of PPARα in MDA-MB-231 breast cancer cells.

PubMed

Takeda, Shuso; Ikeda, Eriko; Su, Shengzhong; Harada, Mari; Okazaki, Hiroyuki; Yoshioka, Yasushi; Nishimura, Hajime; Ishii, Hiroyuki; Kakizoe, Kazuhiro; Taniguchi, Aya; Tokuyasu, Miki; Himeno, Taichi; Watanabe, Kazuhito; Omiecinski, Curtis J; Aramaki, Hironori

2014-12-04

We recently reported that Δ(9)-tetrahydrocannabinol (Δ(9)-THC), a major cannabinoid component in Cannabis Sativa (marijuana), significantly stimulated the expression of fatty acid 2-hydroxylase (FA2H) in human breast cancer MDA-MB-231 cells. Peroxisome proliferator-activated receptor α (PPARα) was previously implicated in this induction. However, the mechanisms mediating this induction have not been elucidated in detail. We performed a DNA microarray analysis of Δ(9)-THC-treated samples and showed the selective up-regulation of the PPARα isoform coupled with the induction of FA2H over the other isoforms (β and γ). Δ(9)-THC itself had no binding/activation potential to/on PPARα, and palmitic acid (PA), a PPARα ligand, exhibited no stimulatory effects on FA2H in MDA-MB-231 cells; thus, we hypothesized that the levels of PPARα induced were involved in the Δ(9)-THC-mediated increase in FA2H. In support of this hypothesis, we herein demonstrated that; (i) Δ(9)-THC activated the basal transcriptional activity of PPARα in a concentration-dependent manner, (ii) the concomitant up-regulation of PPARα/FA2H was caused by Δ(9)-THC, (iii) PA could activate PPARα after the PPARα expression plasmid was introduced, and (iv) the Δ(9)-THC-induced up-regulation of FA2H was further stimulated by the co-treatment with L-663,536 (a known PPARα inducer). Taken together, these results support the concept that the induced levels of PPARα may be involved in the Δ(9)-THC up-regulation of FA2H in MDA-MB-231 cells. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

PubMed

Awasthi, Neeraj Praphulla; Singh, R P

2007-01-01

Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

PubMed

Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

2016-03-01

Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

Bioconjugated iron oxide nanocubes: synthesis, functionalization, and vectorization.

PubMed

Wortmann, Laura; Ilyas, Shaista; Niznansky, Daniel; Valldor, Martin; Arroub, Karim; Berger, Nadja; Rahme, Kamil; Holmes, Justin; Mathur, Sanjay

2014-10-08

A facile bottom-up approach for the synthesis of inorganic/organic bioconjugated nanoprobes based on iron oxide nanocubes as the core with a nanometric silica shell is demonstrated. Surface coating and functionalization protocols developed in this work offered good control over the shell thickness (8-40 nm) and enabled biovectorization of SiO2@Fe3O4 core-shell structures by covalent attachment of folic acid (FA) as a targeting unit for cellular uptake. The successful immobilization of folic acid was investigated both quantitatively (TGA, EA, XPS) and qualitatively (AT-IR, UV-vis, ζ-potential). Additionally, the magnetic behavior of the nanocomposites was monitored after each functionalization step. Cell viability studies confirmed low cytotoxicity of FA@SiO2@Fe3O4 conjugates, which makes them promising nanoprobes for targeted internalization by cells and their imaging.

Integrated acid mine drainage management using fly ash.

PubMed

Vadapalli, Viswanath R K; Gitari, Mugera W; Petrik, Leslie F; Etchebers, Olivier; Ellendt, Annabelle

2012-01-01

Fly Ash (FA) from a power station in South Africa was investigated to neutralise and remove contaminants from Acid Mine Drainage (AMD). After this primary treatment the insoluble FA residue namely solid residue (SR) was investigated as a suitable mine backfill material by means of strength testing. Moreover, SR was used to synthesise zeolite-P using a two-step synthesis procedure. Furthermore, the zeolite-P was investigated to polish process water from the primary FA-AMD reaction. The main objective of this series of investigations is to achieve zero waste and to propose an integrated AMD management using FA. Fly Ash was mixed with AMD at various predetermined FA-AMD ratios until the mixtures achieved circumneutral pH or higher. The supernatants were then analyzed using Inductively Coupled Plasma Mass Spectrometry (ICP-MS) and Ion Chromatography (IC) for cations and anions respectively. The physical strength testing of SR was carried out by mixing it with 3% Ordinary Portland Cement (OPC) and curing for 410 days. Synthesis of zeolite-P using SR was carried out by two step synthesis procedure: ageing for 24 hours followed by a mild hydrothermal synthesis at 100°C for 4 days. The polishing of process water from primary AMD treatment using FA was ascertained by mixing the process water with zeolite at a liquid to solid ratio of 100:1 for 1 hour. The results indicated that FA can be successfully used to ameliorate AMD. High removal of major AMD contaminants Fe, Al, Mg, Mn and sulphate was achieved with the ash treatment and trace elements such as Zn, Ni, Cu and Pb were also removed by the FA. Strength testing over 410 days indicated that the material gained strength over the testing period. The maximum unconfined compressive strength and elastic modulus was observed to be approximately 0.3 MPa and 150 Mpa respectively. The X-ray diffraction (XRD) analysis of the synthesized product indicated that SR was successfully converted into zeolite-P with some mullite phase

A Conserved Metal Binding Motif in the Bacillus subtilis Competence Protein ComFA Enhances Transformation.

PubMed

Chilton, Scott S; Falbel, Tanya G; Hromada, Susan; Burton, Briana M

2017-08-01

Genetic competence is a process in which cells are able to take up DNA from their environment, resulting in horizontal gene transfer, a major mechanism for generating diversity in bacteria. Many bacteria carry homologs of the central DNA uptake machinery that has been well characterized in Bacillus subtilis It has been postulated that the B. subtilis competence helicase ComFA belongs to the DEAD box family of helicases/translocases. Here, we made a series of mutants to analyze conserved amino acid motifs in several regions of B. subtilis ComFA. First, we confirmed that ComFA activity requires amino acid residues conserved among the DEAD box helicases, and second, we show that a zinc finger-like motif consisting of four cysteines is required for efficient transformation. Each cysteine in the motif is important, and mutation of at least two of the cysteines dramatically reduces transformation efficiency. Further, combining multiple cysteine mutations with the helicase mutations shows an additive phenotype. Our results suggest that the helicase and metal binding functions are two distinct activities important for ComFA function during transformation. IMPORTANCE ComFA is a highly conserved protein that has a role in DNA uptake during natural competence, a mechanism for horizontal gene transfer observed in many bacteria. Investigation of the details of the DNA uptake mechanism is important for understanding the ways in which bacteria gain new traits from their environment, such as drug resistance. To dissect the role of ComFA in the DNA uptake machinery, we introduced point mutations into several motifs in the protein sequence. We demonstrate that several amino acid motifs conserved among ComFA proteins are important for efficient transformation. This report is the first to demonstrate the functional requirement of an amino-terminal cysteine motif in ComFA. Copyright © 2017 American Society for Microbiology.

Synthesis and excretion of glycerol teichoic acid during growth of two streptococcal species.

PubMed Central

Joseph, R; Shockman, G D

1975-01-01

Examination of both supernatant culture medium and cell pellets after exponential- and stationary-phase growth of Streptococcus mutans strain FA-1 and Streptococcus faecalis ATCC 9790 (S. faecium) showed the presence of [-3H]glycerol-labeled material that possessed several of the properties of glycerol teichoic acid. In the supernatant medium of S. mutans FA-1, an apparently large-molecular-size material, which eluted from agarose columns with the Kd value expected of a lipoteichoic acid, was observed. Large amounts of this material were present in supernatants during the stationary phase. In contrast, with S. faecalis only an apparently lower-molecular-weight form, with a Kd consistent with deacylated glycerol teichoic acid, was found in the growth medium. Both organisms had high-molecular-weight lipoteichoic acid in the cells along with the deacylated glycerol teichoic acid. The presence of relatively large amounts of glycerol teichoic acids in the medium was considered to be a result of excretion of these compounds rather than a result of cellular lysis. PMID:807523

Cloning and expression analysis of FaPR-1 gene in strawberry

NASA Astrophysics Data System (ADS)

Mo, Fan; Luo, Ya; Ge, Cong; Mo, Qin; Ling, Yajie; Luo, Shu; Tang, Haoru

2018-04-01

The FaPR-1 gene was cloned by RT-PCR from `Benihoppe' strawberry and its bioinformatics analysis was conducted. The results showed that the open reading frame was 483 bp encoding encoding l60 amino acids which protein molecular weight and theoretical isoelectricity were 17854.17 and 8.72 respectively. Subcellular localization prediction shows that this gene is located extracellularly. By comparing strawberry FaPR-l and other plant Pathogenesis-related protein, homology and phylogenetic tree construction showed that the homology with grapes, peach is relatively close. In the treatments of ABA, sucrose and the mixture of the two, the expression of FaPR-1 in strawberry fruit were significantly increased.

Starmerella camargoi f.a., sp. nov., Starmerella ilheusensis f.a., sp. nov., Starmerella litoralis f.a., sp. nov., Starmerella opuntiae f.a., sp. nov., Starmerella roubikii f.a., sp. nov. and Starmerella vitae f.a., sp. nov., isolated from flowers and bees, and transfer of related Candida species to the genus Starmerella as new combinations.

PubMed

Santos, Ana Raquel O; Leon, Marina P; Barros, Katharina O; Freitas, Larissa F D; Hughes, Alice F S; Morais, Paula B; Lachance, Marc-André; Rosa, Carlos A

2018-04-01

Six novel yeast species, Starmerella camargoi f.a., sp. nov., Starmerella ilheusensis f.a., sp. nov., Starmerella litoralis f.a., Starmerella opuntiae f.a., sp. nov., sp. nov., Starmerella roubikii f.a., sp. nov. and Starmerella vitae f.a, sp. nov. are proposed to accommodate 19 isolates recovered from ephemeral flowers or bees in Brazil, Costa Rica and Belize. Sequence analysis of the ITS-5.8S region (when available) and the D1/D2 domains of the large subunit of the rRNA gene showed that the six novel yeasts are phylogenetically related to several species of the Starmerella clade. The type strains are Starmerella camargoi f.a., sp. nov. UFMG-CM-Y595 T (=CBS 14130 T ; Mycobank number MB 822640), Starmerella ilheusensis f.a., sp. nov. UFMG-CM-Y596 T (=CBS CBS14131 T ; MB 822641), Starmerella litoralis f.a., sp. nov. UFMG-CM-Y603 T (=CBS14104 T ; MB 822642), Starmerella opuntiae f.a., sp. nov. UFMG-CM-Y286 T (=CBS 13466 T ; MB 822643), Starmerella roubikii f.a., sp. nov. UWOPS 01-191.1 (=CBS 15148; MB 822645) and Starmerella vitae f.a., sp. nov. UWOPS 00-107.2 (=CBS 15147 T ; MB 822646). In addition, 25 species currently assigned to the genus Candida are reassigned formally to the genus Starmerella.

Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

PubMed

Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

2014-09-01

Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.

Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

ERIC Educational Resources Information Center

Forster, Denis; DeKleva, Thomas W.

1986-01-01

Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

Effect of surfactants and natural detergents on phosphatidylcholine synthesis in photoreceptor membranes.

PubMed

Roque, M E; Castagnet, P I; Giusto, N M

2001-07-01

The synthesis of phosphatidylcholine (PC) in rod outer segments (ROS) catalysed by lysophosphatidylcholine acyltransferase and phosphatidylethanolamine N-methyltransferase (PE N-MTase) was studied and the effects of natural (FA and lysophospholipids) and synthetic (Triton X-100, deoxycholate and CHAPS) surfactants was evaluated. In all experimental conditions used, incorporation of labelled oleate into lysophosphatidylcholine (lysoPC) was at least 40 times greater than oleate incorporation into any other lysophospholipid. Acylation of lysoPC was slightly affected by Triton X-100 and was totally inhibited in the presence of 10 mM sodium deoxycholate (NaDOC) or CHAPS. Below their critical micelle concentration (cmc) Triton X-100 and NaDOC stimulated acylation of all ROS lysophospholipids analysed. The activity of PE N-MTase was stimulated at detergent concentrations below the cmc and inhibited at concentrations above the cmc for all three detergents tested. The effect of FA with differing degree of unsaturation on PC synthesis was evaluated. Oleic acid (10 microM) inhibited methyl group incorporation into total PC, whereas from 100 microM onward, the methylating activity increased with preferential synthesis of PC. Docosahexaenoic acid, in turn, inhibited PE N-MTase activity at every concentration tested. These results suggest that PC synthesis in ROS membranes is modified by bioregulators and surfactants altering the physico-chemical state of the membrane.

Is the onset of obesity in suckling fa/fa rats linked to a potentially larger milk intake?

PubMed

Buchberger, P; Schmidt, I

1996-08-01

We wanted to find out whether fatty (fa/fa) sucklings show abnormal intake when given access to an abundant milk reservoir. To do this, we gravimetrically determined the milk ingested by small groups (4-5 pups) of 5- to 15-day-old lean (+/fa) and fatty littermates allowed to suckle for 30 min after their mother had not been nursing for periods of between 1 and 7 h. The pups were grouped randomly and their phenotypes retrospectively identified. Within both genotypes, the intakes of simultaneously tested pups were significantly higher in pups deprived for longer periods. Deprived and undeprived fa/fa pups ingested, however, slightly but significantly less milk than +/fa littermates did in the same nursing bout. In the first 2 wk of life, when fa/fa pups deposit nearly twice as much body fat as their +/fa littermates do, fa/fa pups will thus suckle less rather than more milk. This extends previous findings showing that the onset of fa/fa obesity is independent of larger intakes and thus questions that fa impairs a receptor primarily controlling food intake.

Studies on potential effects of fumaric acid on rumen microbial fermentation, methane production and microbial community.

PubMed

Riede, Susanne; Boguhn, Jeannette; Breves, Gerhard

2013-01-01

The greenhouse gas methane (CH4) contributes substantially to global climate change. As a potential approach to decrease ruminal methanogenesis, the effects of different dosages of fumaric acid (FA) on ruminal microbial metabolism and on the microbial community (archaea, bacteria) were studied using a rumen simulation technique (RUSITEC). FA acts as alternative hydrogen acceptor diverting 2H from methanogenesis of archaea towards propionate formation of bacteria. Three identical trials were conducted with 12 fermentation vessels over a period of 14 days. In each trial, four fermentation vessels were assigned to one of the three treatment groups differing in FA dosage: low fumaric acid (LFA), high fumaric acid (HFA) and without FA (control). FA was continuously infused with the buffer. Grass silage and concentrate served as substrate. FA led to decreases in pH and to higher production rates of total short chain fatty acids (SCFA) mediated by increases in propionate for LFA of 1.69 mmol d(-1) and in propionate and acetate production for HFA of 4.49 and 1.10 mmol d(-1), respectively. Concentrations of NH3-N, microbial crude protein synthesis, their efficiency, degradation of crude nutrients and detergent fibre fraction were unchanged. Total gas and CH4 production were not affected by FA. Effects of FA on structure of microbial community by means of single strand conformation polymorphism (SSCP) analyses could not be detected. Given the observed increase in propionate production and the unaffected CH4 production it can be supposed that the availability of reduction equivalents like 2H was not limited by the addition of FA in this study. It has to be concluded from the present study that the application of FA is not an appropriate approach to decrease the ruminal CH4 production.

Role of fatty-acid synthesis in dendritic cell generation and function.

PubMed

Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

2013-05-01

Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

Development of electrochemical folic acid sensor based on hydroxyapatite nanoparticles.

PubMed

Kanchana, P; Sekar, C

2015-02-25

We report the synthesis of hydroxyapatite (HA) nanoparticles (NPs) by a simple microwave irradiation method and its application as sensing element for the precise determination of folic acid (FA) by electrochemical method. The structure and composition of the HA NPs characterized using XRD, FTIR, Raman and XPS. SEM and EDX studies confirmed the formation of elongated spherical shaped HA NPs with an average particle size of about 34 nm. The HA NPs thin film on glassy carbon electrode (GCE) were deposited by drop casting method. Electrocatalytic behavior of FA in the physiological pH 7.0 was investigated by cyclic voltammetry (CV), linear sweep voltammetry (LSV) and chronoamperometry. The fabricated HA/GCE exhibited a linear calibration plot over a wide FA concentration ranging from 1.0×10(-7) to 3.5×10(-4) M with the detection limit of 75 nM. In addition, the HA NPs modified GCE showed good selectivity toward the determination of FA even in the presence of a 100-fold excess of ascorbic acid (AA) and 1000-fold excess of other common interferents. The fabricated biosensor exhibits good sensitivity and stability, and was successfully applied for the determination of FA in pharmaceutical samples. Copyright © 2014 Elsevier B.V. All rights reserved.

Development of electrochemical folic acid sensor based on hydroxyapatite nanoparticles

NASA Astrophysics Data System (ADS)

Kanchana, P.; Sekar, C.

2015-02-01

We report the synthesis of hydroxyapatite (HA) nanoparticles (NPs) by a simple microwave irradiation method and its application as sensing element for the precise determination of folic acid (FA) by electrochemical method. The structure and composition of the HA NPs characterized using XRD, FTIR, Raman and XPS. SEM and EDX studies confirmed the formation of elongated spherical shaped HA NPs with an average particle size of about 34 nm. The HA NPs thin film on glassy carbon electrode (GCE) were deposited by drop casting method. Electrocatalytic behavior of FA in the physiological pH 7.0 was investigated by cyclic voltammetry (CV), linear sweep voltammetry (LSV) and chronoamperometry. The fabricated HA/GCE exhibited a linear calibration plot over a wide FA concentration ranging from 1.0 × 10-7 to 3.5 × 10-4 M with the detection limit of 75 nM. In addition, the HA NPs modified GCE showed good selectivity toward the determination of FA even in the presence of a 100-fold excess of ascorbic acid (AA) and 1000-fold excess of other common interferents. The fabricated biosensor exhibits good sensitivity and stability, and was successfully applied for the determination of FA in pharmaceutical samples.

Regulation of protein synthesis by amino acids in muscle of neonates

PubMed Central

Suryawan, Agus; Davis, Teresa A.

2011-01-01

The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241

Fatty Acid Synthesis and Oxidation in Cumulus Cells Support Oocyte Maturation in Bovine

PubMed Central

Sanchez-Lazo, Laura; Brisard, Daphné; Elis, Sébastien; Maillard, Virginie; Uzbekov, Rustem; Labas, Valérie; Desmarchais, Alice; Papillier, Pascal; Monget, Philippe

2014-01-01

Oocyte meiotic maturation requires energy from various substrates including glucose, amino acids, and lipids. Mitochondrial fatty acid (FA) β-oxidation (FAO) in the oocyte is required for meiotic maturation, which is accompanied by differential expression of numerous genes involved in FAs metabolism in surrounding cumulus cells (CCs) in vivo. The objective was to elucidate components involved in FAs metabolism in CCs during oocyte maturation. Twenty-seven genes related to lipogenesis, lipolysis, FA transport, and FAO were chosen from comparative transcriptome analysis of bovine CCs before and after maturation in vivo. Using real-time PCR, 22 were significantly upregulated at different times of in vitro maturation (IVM) in relation to oocyte meiosis progression from germinal vesicle breakdown to metaphase-II. Proteins FA synthase, acetyl-coenzyme-A carboxylase, carnitine palmitoyltransferase, perilipin 2, and FA binding protein 3 were detected by Western blot and immunolocalized to CCs and oocyte cytoplasm, with FA binding protein 3 concentrated around oocyte chromatin. By mass spectrometry, CCs lipid profiling was shown to be different before and after IVM. FAO inhibitors etomoxir and mildronate dose-dependently decreased the oocyte maturation rate in vitro. In terms of viability, cumulus enclosed oocytes were more sensitive to etomoxir than denuded oocytes. In CCs, etomoxir (150μM) led to downregulation of lipogenesis genes and upregulated lipolysis and FAO genes. Moreover, the number of lipid droplets decreased, whereas several lipid species were more abundant compared with nontreated CCs after IVM. In conclusion, FAs metabolism in CCs is important to maintain metabolic homeostasis and may influence meiosis progression and survival of enclosed oocytes. PMID:25058602

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Sugar Potentiation of Fatty Acid and Triacylglycerol Accumulation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Zhai, Zhiyang; Liu, Hui; Xu, Changcheng

Photosynthetically derived sugar provides carbon skeletons for lipid biosynthesis. We used mutants of Arabidopsis (Arabidopsis thaliana) and the expression of oleogenic factors to investigate relationships among sugar availability, lipid synthesis, and the accumulation of triacylglycerol (TAG) in leaf tissue. The adg1 mutation disables the small subunit of ADP-glucose pyrophosphorylase, the first step in starch synthesis, and the suc2 mutation disables a sucrose/proton symporter that facilitates sucrose loading from leaves into phloem. The adg1suc2 double mutant increases glucose plus sucrose content in leaves 80-fold relative to the wild type, total fatty acid (FA) content 1.8-fold to 8.3% dry weight, and TAGmore » more than 10-fold to 1.2% dry weight. The WRINKLED1 transcription factor also accumulates to higher levels in these leaves, and the rate of FA synthesis increases by 58%. Adding tt4, which disables chalcone synthase, had little effect, but adding the tgd1 mutation, which disables an importer of lipids into plastids to create adg1suc2tt4tgd1, increased total leaf FA to 13.5% dry weight and TAG to 3.8% dry weight, demonstrating a synergistic effect upon combining these mutations. Combining adg1suc2 with the sdp1 mutation, deficient in the predominant TAG lipase, had little effect on total FA content but increased the TAG accumulation by 66% to 2% dry weight. Expression of the WRINKLED1 transcription factor, along with DIACYLGLYCEROL ACYLTRANSFERASE1 and the OLEOSIN1 oil body-associated protein, in the adg1suc2 mutant doubled leaf FA content and increased TAG content to 2.3% dry weight, a level 4.6-fold higher than that resulting from expression of the same factors in the wild type.« less

Sugar Potentiation of Fatty Acid and Triacylglycerol Accumulation

DOE PAGES

Zhai, Zhiyang; Liu, Hui; Xu, Changcheng; ...

2017-10-01

Photosynthetically derived sugar provides carbon skeletons for lipid biosynthesis. We used mutants of Arabidopsis (Arabidopsis thaliana) and the expression of oleogenic factors to investigate relationships among sugar availability, lipid synthesis, and the accumulation of triacylglycerol (TAG) in leaf tissue. The adg1 mutation disables the small subunit of ADP-glucose pyrophosphorylase, the first step in starch synthesis, and the suc2 mutation disables a sucrose/proton symporter that facilitates sucrose loading from leaves into phloem. The adg1suc2 double mutant increases glucose plus sucrose content in leaves 80-fold relative to the wild type, total fatty acid (FA) content 1.8-fold to 8.3% dry weight, and TAGmore » more than 10-fold to 1.2% dry weight. The WRINKLED1 transcription factor also accumulates to higher levels in these leaves, and the rate of FA synthesis increases by 58%. Adding tt4, which disables chalcone synthase, had little effect, but adding the tgd1 mutation, which disables an importer of lipids into plastids to create adg1suc2tt4tgd1, increased total leaf FA to 13.5% dry weight and TAG to 3.8% dry weight, demonstrating a synergistic effect upon combining these mutations. Combining adg1suc2 with the sdp1 mutation, deficient in the predominant TAG lipase, had little effect on total FA content but increased the TAG accumulation by 66% to 2% dry weight. Expression of the WRINKLED1 transcription factor, along with DIACYLGLYCEROL ACYLTRANSFERASE1 and the OLEOSIN1 oil body-associated protein, in the adg1suc2 mutant doubled leaf FA content and increased TAG content to 2.3% dry weight, a level 4.6-fold higher than that resulting from expression of the same factors in the wild type.« less

Synthesis of new kojic acid based unnatural α-amino acid derivatives.

PubMed

Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan

2015-11-01

An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.

Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

PubMed Central

Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

2013-01-01

Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

Rewiring protein synthesis: From natural to synthetic amino acids.

PubMed

Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang

2017-11-01

The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

Transaminases for the synthesis of enantiopure beta-amino acids

PubMed Central

2012-01-01

Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

Fatty acid synthase inhibition results in a magnetic resonance-detectable drop in phosphocholine

PubMed Central

Ross, James; Najjar, Amer M.; Sankaranarayanapillai, Madhuri; Tong, William P.; Kaluarachchi, Kumaralal; Ronen, Sabrina M.

2008-01-01

Expression of fatty acid synthase (FASN), the key enzyme in de novo synthesis of long-chain fatty acids (FA), is normally low but increases in cancer. Consequently, FASN is a novel target for cancer therapy. However, because FASN inhibitors can lead to tumor stasis rather than shrinkage, non-invasive methods for assessing FASN inhibition are needed. To this end, we combined 1H, 31P and 13C magnetic resonance spectroscopy (MRS) (i) to monitor the metabolic consequences of FASN inhibition and (ii) to identify MRS-detectable metabolic biomarkers of response. Treatment of PC-3 cells with the FASN inhibitor Orlistat for up to 48 h resulted in inhibition of FASN activity by 70%, correlating with 74% inhibition of FA synthesis. Furthermore, we have determined that FASN inhibition results not only in lower phosphatidylcholine levels, but also in a 59% drop in the phospholipid precursor phosphocholine (PCho). This drop resulted from inhibition in PCho synthesis as a result of a reduction in the cellular activity of its synthetic enzyme choline kinase. The drop in PCho levels following FASN inhibition was confirmed in SKOV-3 ovarian cancer cells treated with Orlistat and in MCF-7 breast cancer cells treated with Orlistat as well as cerulenin. Combining data from all treated cells, the drop in PCho significantly correlated with the drop in de novo synthesized FA levels, identifying PCho as a potential non-invasive MRS-detectable biomarker of FASN inhibition in vivo. PMID:18723500

Genetics Home Reference: congenital bile acid synthesis defect type 1

MedlinePlus

... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...

Synthesis of alpha-amino acids

DOEpatents

Davis, J.W. Jr.

1983-01-25

A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

Fatty Acids Regulate Germline Sex Determination through ACS-4-Dependent Myristoylation.

PubMed

Tang, Hongyun; Han, Min

2017-04-20

Fat metabolism has been linked to fertility and reproductive adaptation in animals and humans, and environmental sex determination potentially plays a role in the process. To investigate the impact of fatty acids (FA) on sex determination and reproductive development, we examined and observed an impact of FA synthesis and mobilization by lipolysis in somatic tissues on oocyte fate in Caenorhabditis elegans. The subsequent genetic analysis identified ACS-4, an acyl-CoA synthetase and its FA-CoA product, as key germline factors that mediate the role of FA in promoting oocyte fate through protein myristoylation. Further tests indicated that ACS-4-dependent protein myristoylation perceives and translates the FA level into regulatory cues that modulate the activities of MPK-1/MAPK and key factors in the germline sex-determination pathway. These findings, including a similar role of ACS-4 in a male/female species, uncover a likely conserved mechanism by which FA, an environmental factor, regulates sex determination and reproductive development. Copyright © 2017 Elsevier Inc. All rights reserved.

Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.

PubMed Central

Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S

1996-01-01

Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847

Identification of bottlenecks in the accumulation of cyclic fatty acids in camelina seed oil

DOE PAGES

Yu, Xiao-Hong; Cahoon, Rebecca E.; Horn, Patrick J.; ...

2017-09-20

Modified fatty acids (mFA) have diverse uses, e.g., cyclopropane fatty acids (CPA) are feedstocks for producing coatings, lubricants, plastics, and cosmetics. The expression of mFA-producing enzymes in crop and model plants generally results in lower levels of mFA accumulation than in their natural-occurring source plants. In order to further our understanding of metabolic bottlenecks that limit mFA accumulation, we generated transgenic Camelina sativa lines co-expressing Escherichia coli cyclopropane synthase (EcCPS) and Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT). In contrast to transgenic CPA-accumulating Arabidopsis, CPA accumulation in camelina caused only minor changes in seed weight, germination rate, oil accumulation, and seedlingmore » development. CPA accumulated to much higher levels in membrane than storage lipids, comprising more than 60% of total fatty acid in both phosphatidylcholine (PC) and phosphatidylethanolamine (PE) versus 26% in diacylglycerol (DAG) and 12% in triacylglycerol (TAG) indicating bottlenecks in the transfer of CPA from PC to DAG and from DAG to TAG. Upon coexpression of SfLPAT with EcCPS, di-CPA-PC increased by ~50% relative to lines expressing EcCPS alone with the di-CPA-PC primarily observed in the embryonic axis and mono-CPA-PC primarily in cotyledon tissue. EcCPS-SfLPAT lines revealed a redistribution of CPA from the sn-1 to sn-2 positions within PC and PE that was associated with a doubling of CPA accumulation in both DAG and TAG. Finally, the identification of metabolic bottlenecks in acyl transfer between site of synthesis (phospholipids) and deposition in storage oils (TAGs) lays the foundation for the optimizing CPA accumulation through directed engineering of oil synthesis in target crops.« less

Identification of bottlenecks in the accumulation of cyclic fatty acids in camelina seed oil

DOE Office of Scientific and Technical Information (OSTI.GOV)

Yu, Xiao-Hong; Cahoon, Rebecca E.; Horn, Patrick J.

Modified fatty acids (mFA) have diverse uses, e.g., cyclopropane fatty acids (CPA) are feedstocks for producing coatings, lubricants, plastics, and cosmetics. The expression of mFA-producing enzymes in crop and model plants generally results in lower levels of mFA accumulation than in their natural-occurring source plants. In order to further our understanding of metabolic bottlenecks that limit mFA accumulation, we generated transgenic Camelina sativa lines co-expressing Escherichia coli cyclopropane synthase (EcCPS) and Sterculia foetida lysophosphatidic acid acyltransferase (SfLPAT). In contrast to transgenic CPA-accumulating Arabidopsis, CPA accumulation in camelina caused only minor changes in seed weight, germination rate, oil accumulation, and seedlingmore » development. CPA accumulated to much higher levels in membrane than storage lipids, comprising more than 60% of total fatty acid in both phosphatidylcholine (PC) and phosphatidylethanolamine (PE) versus 26% in diacylglycerol (DAG) and 12% in triacylglycerol (TAG) indicating bottlenecks in the transfer of CPA from PC to DAG and from DAG to TAG. Upon coexpression of SfLPAT with EcCPS, di-CPA-PC increased by ~50% relative to lines expressing EcCPS alone with the di-CPA-PC primarily observed in the embryonic axis and mono-CPA-PC primarily in cotyledon tissue. EcCPS-SfLPAT lines revealed a redistribution of CPA from the sn-1 to sn-2 positions within PC and PE that was associated with a doubling of CPA accumulation in both DAG and TAG. Finally, the identification of metabolic bottlenecks in acyl transfer between site of synthesis (phospholipids) and deposition in storage oils (TAGs) lays the foundation for the optimizing CPA accumulation through directed engineering of oil synthesis in target crops.« less

Inhibited Carnitine Synthesis Causes Systemic Alteration of Nutrient Metabolism in Zebrafish

PubMed Central

Li, Jia-Min; Li, Ling-Yu; Qin, Xuan; Degrace, Pascal; Demizieux, Laurent; Limbu, Samwel M.; Wang, Xin; Zhang, Mei-Ling; Li, Dong-Liang; Du, Zhen-Yu

2018-01-01

Impaired mitochondrial fatty acid β-oxidation has been correlated with many metabolic syndromes, and the metabolic characteristics of the mammalian models of mitochondrial dysfunction have also been intensively studied. However, the effects of the impaired mitochondrial fatty acid β-oxidation on systemic metabolism in teleost have never been investigated. In the present study, we established a low-carnitine zebrafish model by feeding fish with mildronate as a specific carnitine synthesis inhibitor [0.05% body weight (BW)/d] for 7 weeks, and the systemically changed nutrient metabolism, including carnitine and triglyceride (TG) concentrations, fatty acid (FA) β-oxidation capability, and other molecular and biochemical assays of lipid, glucose, and protein metabolism, were measured. The results indicated that mildronate markedly decreased hepatic carnitine concentrations while it had no effect in muscle. Liver TG concentrations increased by more than 50% in mildronate-treated fish. Mildronate decreased the efficiency of liver mitochondrial β-oxidation, increased the hepatic mRNA expression of genes related to FA β-oxidation and lipolysis, and decreased the expression of lipogenesis genes. Mildronate decreased whole body glycogen content, increased glucose metabolism rate, and upregulated the expression of glucose uptake and glycolysis genes. Mildronate also increased whole body protein content and hepatic mRNA expression of mechanistic target of rapamycin (mtor), and decreased the expression of a protein catabolism-related gene. Liver, rather than muscle, was the primary organ targeted by mildronate. In short, mildronate-induced hepatic inhibited carnitine synthesis in zebrafish caused decreased mitochondrial FA β-oxidation efficiency, greater lipid accumulation, and altered glucose and protein metabolism. This reveals the key roles of mitochondrial fatty acid β-oxidation in nutrient metabolism in fish, and this low-carnitine zebrafish model could also be used

Inhibited Carnitine Synthesis Causes Systemic Alteration of Nutrient Metabolism in Zebrafish.

PubMed

Li, Jia-Min; Li, Ling-Yu; Qin, Xuan; Degrace, Pascal; Demizieux, Laurent; Limbu, Samwel M; Wang, Xin; Zhang, Mei-Ling; Li, Dong-Liang; Du, Zhen-Yu

2018-01-01

Impaired mitochondrial fatty acid β-oxidation has been correlated with many metabolic syndromes, and the metabolic characteristics of the mammalian models of mitochondrial dysfunction have also been intensively studied. However, the effects of the impaired mitochondrial fatty acid β-oxidation on systemic metabolism in teleost have never been investigated. In the present study, we established a low-carnitine zebrafish model by feeding fish with mildronate as a specific carnitine synthesis inhibitor [0.05% body weight (BW)/d] for 7 weeks, and the systemically changed nutrient metabolism, including carnitine and triglyceride (TG) concentrations, fatty acid (FA) β-oxidation capability, and other molecular and biochemical assays of lipid, glucose, and protein metabolism, were measured. The results indicated that mildronate markedly decreased hepatic carnitine concentrations while it had no effect in muscle. Liver TG concentrations increased by more than 50% in mildronate-treated fish. Mildronate decreased the efficiency of liver mitochondrial β-oxidation, increased the hepatic mRNA expression of genes related to FA β-oxidation and lipolysis, and decreased the expression of lipogenesis genes. Mildronate decreased whole body glycogen content, increased glucose metabolism rate, and upregulated the expression of glucose uptake and glycolysis genes. Mildronate also increased whole body protein content and hepatic mRNA expression of mechanistic target of rapamycin ( mtor ), and decreased the expression of a protein catabolism-related gene. Liver, rather than muscle, was the primary organ targeted by mildronate. In short, mildronate-induced hepatic inhibited carnitine synthesis in zebrafish caused decreased mitochondrial FA β-oxidation efficiency, greater lipid accumulation, and altered glucose and protein metabolism. This reveals the key roles of mitochondrial fatty acid β-oxidation in nutrient metabolism in fish, and this low-carnitine zebrafish model could also be

An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid

PubMed Central

Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

2006-01-01

Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830

An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.

PubMed

Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

2006-12-06

Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.

Castor phospholipid:diacylglycerol acyltransferase facilitates efficient metabolism of hydroxy fatty acids in transgenic Arabidopsis

USDA-ARS?s Scientific Manuscript database

Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...

A never-ending story: the steadily growing family of the FA and FA-like genes

PubMed Central

Gueiderikh, Anna; Rosselli, Filippo; Neto, Januario B.C.

2017-01-01

Abstract Among the chromosome fragility-associated human syndromes that present cancer predisposition, Fanconi anemia (FA) is unique due to its large genetic heterogeneity. To date, mutations in 21 genes have been associated with an FA or an FA-like clinical and cellular phenotype, whose hallmarks are bone marrow failure, predisposition to acute myeloid leukemia and a cellular and chromosomal hypersensitivity to DNA crosslinking agents exposure. The goal of this review is to trace the history of the identification of FA genes, a history that started in the eighties and is not yet over, as indicated by the cloning of a twenty-first FA gene in 2016. PMID:28558075

Role of Fatty Acid Kinase in Cellular Lipid Homeostasis and SaeRS-Dependent Virulence Factor Expression in Staphylococcus aureus

PubMed Central

Ericson, Megan E.; Subramanian, Chitra; Frank, Matthew W.

2017-01-01

ABSTRACT The SaeRS two-component system is a master activator of virulence factor transcription in Staphylococcus aureus, but the cellular factors that control its activity are unknown. Fatty acid (FA) kinase is a two-component enzyme system required for extracellular FA uptake and SaeRS activity. Here, we demonstrate the existence of an intracellular nonesterified FA pool in S. aureus that is elevated in strains lacking FA kinase activity. SaeRS-mediated transcription is restored in FA kinase-negative strains when the intracellular FA pool is reduced either by growth with FA-depleted bovine serum albumin to extract the FA into the medium or by the heterologous expression of Neisseria gonorrhoeae acyl-acyl carrier protein synthetase to activate FA for phospholipid synthesis. These data show that FAs act as negative regulators of SaeRS signaling, and FA kinase activates SaeRS-dependent virulence factor production by lowering inhibitory FA levels. Thus, FA kinase plays a role in cellular lipid homeostasis by activating FA for incorporation into phospholipid, and it indirectly regulates SaeRS signaling by maintaining a low intracellular FA pool. PMID:28765222

Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver

PubMed Central

Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.

1969-01-01

1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319

Alterations of local cerebral glucose utilization in lean and obese fa/fa rats after acute adrenalectomy.

PubMed

Doyle, P; Rohner-Jeanrenaud, F; Jeanrenaud, B

1994-08-29

An animal model often used to investigate the aetiology of obesity is the genetically obese fa/fa rat. It has many abnormalities, including hyperphagia, hyper-insulinemia, insulin resistance, low cerebral glucose utilization and an overactive hypothalamo-pituitary adrenal (HPA) axis with resulting hypercorticism. Due to the latter consideration, the aim of this work was to study the impact of acute adrenalectomy (ADX) on the local cerebral glucose utilization (LCGU) of lean and obese fa/fa rats. ADX resulted in discrete increases in LCGU of regions common to both lean and obese rats. These common regions were found to belong to be related to the limbic system. Within this system, the LCGU of the brain of obese rats was either normalized to lean sham operated values or increased by ADX to a similar degree in both groups on a percentage basis. It was concluded that the LCGU of both lean and obese animals appears to be negatively regulated, albeit to different extents, by glucocorticoids. Such negative regulation is particularly salient within the limbic system of the lean rat and even more so in the fa/fa rat. It is suggested that the long-term hypercorticism of obese fa/fa rats due to abnormal regulation of the HPA axis may result in a decreased LCGU in limbic and related regions of the brain of fa/fa rats and contribute to the expression of the obese phenotype.

Weekly infusional high-dose fluorouracil (HD-FU), HD-FU plus folinic acid (HD-FU/FA), or HD-FU/FA plus biweekly cisplatin in advanced gastric cancer: randomized phase II trial 40953 of the European Organisation for Research and Treatment of Cancer Gastrointestinal Group and the Arbeitsgemeinschaft Internistische Onkologie.

PubMed

Lutz, Manfred P; Wilke, Hansjochen; Wagener, D J Theo; Vanhoefer, Udo; Jeziorski, Krzysztof; Hegewisch-Becker, Susanna; Balleisen, Leopold; Joossens, Eric; Jansen, Rob L; Debois, Muriel; Bethe, Ullrich; Praet, Michel; Wils, Jacques; Van Cutsem, Eric

2007-06-20

This multicentric, randomized, two-stage phase II trial evaluated three simplified weekly infusional regimens of fluorouracil (FU) or FU plus folinic acid (FA) and cisplatin (Cis) with the aim to select a regimen for future phase III trials. A total of 145 patients with advanced gastric cancer where randomly assigned to weekly FU 3,000 mg/m2/24 hours (HD-FU), FU 2,600 mg/m2/24 hours plus dl-FA 500 mg/m2 or l-FA 250 mg/m2 (HD-FU/FA), or FU 2000 mg/m2/24 hours plus FA plus biweekly Cis 50 mg/m2, each administered for 6 weeks with a 1-week rest. The primary end point was the response rate. Confirmed responses were observed in 6.1% (two of 33) of the eligible patients treated with HD-FU, in 25% (12 of 48, including one complete remission [CR]) with HD-FU/FA, and in 45.7% (21 of 46, including four CRs) with HD-FU/FA/Cis. The HD-FU arm was closed after stage 1 because the required minimum number of responses was not met. The median progression-free survival of all patients in the HD-FU, HD-FU/FA, and HD-FU/FA/Cis arm was 1.9, 4.0, and 6.1 months, respectively. The median overall survival was 7.1, 8.9, and 9.7 months, and the survival rate at 1 year was 24.3%, 30.3%, and 45.3%, respectively. Grade 4 toxicities were rare. The most relevant grade 3/4 toxicities were neutropenia in 1.9%, 5.4%, and 19.6%, and diarrhea in 2.7%, 1.9%, and 3.9% of the cycles in the HD-FU, HD-FU/FA, and HD-/FU/Cis arms, respectively. Weekly infusional FU/FA plus biweekly Cis is effective and safe in patients with gastric cancer.

Biomedical applications of SPION@APTES@PEG-folic acid@carboxylated quercetin nanodrug on various cancer cells

NASA Astrophysics Data System (ADS)

Akal, Z. Ü.; Alpsoy, L.; Baykal, A.

2016-08-01

In this study, carboxylated quercetin (CQ) was conjugated to superparamagnetic iron oxide nanoparticles (SPIONs) which were modified by (3-aminopropyl) triethoxysilane (APTES), Folic acid (FA) and carboxylated Polyethylene glycol (PEG); (SPION@APTES@FA-PEG@CQ), nanodrug has been synthesized via polyol and accompanying by various chemical synthesis routes. The characterization of the final product was done via X-ray powder diffraction (XRD), Fourier transform infrared spectroscopy (FT-IR), Thermal gravimetric analysis (TGA), Transmission electron spectroscopy (TEM) and Vibrating sample magnetometer (VSM). Its cytotoxic and apoptotic activities on over expressed folic acid receptor (FR +) (MCF-7, HeLa) and none expressed folic acid receptor (FR-) (A549) cancer cell lines were determined by using MTT assay, Real-Time Cell Analysis, TUNEL assay, Annexin assay and RT-PCR analysis for Caspase3/7 respectively. SPION@APTES@FA-PEG@CQ nanodrug showed higher cytotoxicity against HeLa and MCF-7 cell lines as compared with A549 cell line. Moreover, SPION@APTES@FA-PEG@CQ nanodrug also caused higher apoptotic and necrotic effects in 100 μg/mL HeLa and MCF-7 cells than A549 cells. The findings showed that SPION@APTES@FA-PEG@CQ nanodrug has cytotoxic, apoptotic and necrotic effects on HeLa and MCF-7 which are FR over expressed cell lines and can be potentially used for the delivery of quercetin to cervical and breast cancer cells.

Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

NASA Astrophysics Data System (ADS)

Berti, Lorenzo; Burley, Glenn A.

2008-02-01

Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

NASA Technical Reports Server (NTRS)

Morowitz, Harold; Peterson, Eta; Chang, Sherwood

1995-01-01

This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

PubMed Central

Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

2016-01-01

Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

Ferulic acid (FA) abrogates γ-radiation induced oxidative stress and DNA damage by up-regulating nuclear translocation of Nrf2 and activation of NHEJ pathway.

PubMed

Das, Ujjal; Manna, Krishnendu; Khan, Amitava; Sinha, Mahuya; Biswas, Sushobhan; Sengupta, Aaveri; Chakraborty, Anindita; Dey, Sanjit

2017-01-01

The present study was aimed to evaluate the radioprotective effect of ferulic acid (FA), a naturally occurring plant flavonoid in terms of DNA damage and damage related alterations of repair pathways by gamma radiation. FA was administered at a dose of 50 mg/kg body weight for five consecutive days prior to exposing the swiss albino mice to a single dose of 10 Gy gamma radiation. Ionising radiation induces oxidative damage manifested by decreased expression of Cu, Zn-SOD (SOD stands for super oxide dismutase), Mn-SOD and catalase. Gamma radiation promulgated reactive oxygen species (ROS) mediated DNA damage and modified repair pathways. ROS enhanced nuclear translocation of p53, activated ATM (ataxia telangiectasia-mutated protein), increased expression of GADD45a (growth arrest and DNA-damage-inducible protein) gene and inactivated Non homologous end joining (NHEJ) repair pathway. The comet formation in irradiated mice peripheral blood mononuclear cells (PBMC) reiterated the DNA damage in IR exposed groups. FA pretreatment significantly prevented the comet formation and regulated the nuclear translocation of p53, inhibited ATM activation and expression of GADD45a gene. FA promoted the nuclear translocation of nuclear factor (erythroid-derived 2)-like 2 (Nrf2) and activated NHEJ repair pathway to overcome ROS mediated oxidative stress and DNA damage. Therefore, the current study stated that FA can challenge the oxidative stress by (i) inducing nuclear translocation of Nrf2, (ii) scavenging ROS, and (iii) activating NHEJ DNA repair process.

Folate/NIR 797-Conjugated Albumin Magnetic Nanospheres: Synthesis, Characterisation, and In Vitro and In Vivo Targeting Evaluation

PubMed Central

Liu, Dongfang; Liu, Peidang; Zhang, Dongsheng

2014-01-01

A practical and effective strategy for synthesis of Folate-NIR 797-conjugated Magnetic Albumin Nanospheres (FA-NIR 797-MAN) was developed. For this strategy, Magnetic Albumin Nanospheres (MAN), composed of superparamagnetic iron oxide nanoparticles (SPIONs) and bovine serum albumin (BSA), were covalently conjugated with folic acid (FA) ligands to enhance the targeting capability of the particles to folate receptor (FR) over-expressing tumours. Subsequently, a near-infrared (NIR) fluorescent dye NIR 797 was conjugated with FA-conjugated MAN for in vivo fluorescence imaging. The FA-NIR 797-MAN exhibited low toxicity to a human nasopharyngeal epidermal carcinoma cell line (KB cells). Additionally, in vitro and in vivo evaluation of the dynamic behaviour and targeting ability of FA-NIR 797-MAN to KB tumours validated the highly selective affinity of FA-NIR 797-MAN for FR-positive tumours. In summary, the FA-NIR 797-MAN prepared here exhibited great potential for tumour imaging, since the near-infrared fluorescence contrast agents target cells via FR-mediated endocytosis. The high fluorescence intensity together with the targeting effect makes FA-NIR 797-MAN a promising candidate for imaging, monitoring, and early diagnosis of cancer at the molecular and cellular levels. PMID:25188308

Liver phospholipids fatty acids composition in response to different types of diets in rats of both sexes.

PubMed

Ranković, Slavica; Popović, Tamara; Martačić, Jasmina Debeljak; Petrović, Snježana; Tomić, Mirko; Ignjatović, Đurđica; Tovilović-Kovačević, Gordana; Glibetić, Maria

2017-05-19

Dietary intake influence changes in fatty acids (FA) profiles in liver which plays a central role in fatty acid metabolism, triacylglycerol synthesis and energy homeostasis. We investigated the effects of 4-weeks treatment with milk- and fish-based diet, on plasma biochemical parameters and FA composition of liver phospholipids (PL) in rats of both sexes. Adult, 4 months old, Wistar rats of both sexes, were fed with different types of diets: standard, milk-based and fish-based, during 4 weeks. Analytical characterization of different foods was done. Biochemical parameters in plasma were determined. Fatty acid composition was analyzed by gas-chromatography. Statistical significance of FA levels was tested with two-way analysis of variance (ANOVA) using the sex of animals and treatment (type of diet) as factors on logarithmic or trigonometric transformed data. Our results showed that both, milk- and fish-based diet, changed the composition and ratio of rat liver phospholipids FA, in gender-specific manner. Initially present sex differences appear to be dietary modulated. Although, applied diets changed the ratio of total saturated fatty acids (SFA), monounsaturated fatty acids (MUFA) and polyunsaturated fatty acids (PUFA), and effects were gender specific. Milk-based diet lowered SFA and elevated MUFA in males and increased PUFA in females vs. standard diet. The same diet decreased n-3, increased n-6 and n-6/n-3 ratio in males. Fish-based diet increased n-3, decreased n-6 and n-6/n-3 ratio vs. standard and milk-based diet in females. However, the ratio of individual FA in liver PL was also dietary-influenced, but with gender specific manner. While in females fish-based diet decreased AA (arachidonic acid) increased level of EPA (eicosapentaenoic acid), DPA (docosapentaenoic acid) and DHA (docosahexaenoic acid), the same diet elevated only DHA levels in males. Gender related variations in FA composition of rat liver PL were observed, and results have shown that

The spark discharge synthesis of amino acids from various hydrocarbons

NASA Technical Reports Server (NTRS)

Ring, D.; Miller, S. L.

1984-01-01

The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

Folic Acid and Creatine as Therapeutic Approaches to Lower Blood Arsenic: A Randomized Controlled Trial.

PubMed

Peters, Brandilyn A; Hall, Megan N; Liu, Xinhua; Parvez, Faruque; Sanchez, Tiffany R; van Geen, Alexander; Mey, Jacob L; Siddique, Abu B; Shahriar, Hasan; Uddin, Mohammad Nasir; Islam, Tariqul; Balac, Olgica; Ilievski, Vesna; Factor-Litvak, Pam; Graziano, Joseph H; Gamble, Mary V

2015-12-01

The World Health Organization estimates that > 140 million people worldwide are exposed to arsenic (As)-contaminated drinking water. As undergoes biologic methylation, which facilitates renal As elimination. In folate-deficient individuals, this process is augmented by folic acid (FA) supplementation, thereby lowering blood As (bAs). Creatinine concentrations in urine are a robust predictor of As methylation patterns. Although the reasons for this are unclear, creatine synthesis is a major consumer of methyl donors, and this synthesis is down-regulated by dietary/supplemental creatine. Our aim was to determine whether 400 or 800 μg FA and/or creatine supplementation lowers bAs in an As-exposed Bangladeshi population. We conducted a clinical trial in which 622 participants were randomized to receive 400 μg FA, 800 μg FA, 3 g creatine, 3 g creatine+400 μg FA, or placebo daily. All participants received an As-removal filter on enrollment, and were followed for 24 weeks. After the 12th week, half of the two FA groups were switched to placebo to evaluate post-treatment bAs patterns. Linear models with repeated measures indicated that the decline in ln(bAs) from baseline in the 800-μg FA group exceeded that of the placebo group (weeks 1-12: β= -0.09, 95% CI: -0.18, -0.01; weeks 13-24: FA continued: β= -0.12, 95% CI: -0.24, -0.00; FA switched to placebo: β= -0.14, 95% CI: -0.26, -0.02). There was no rebound in bAs related to cessation of FA supplementation. Declines in bAs observed in the remaining treatment arms were not significantly different from those of the placebo group. In this mixed folate-deficient/replete study population, 12- and 24-week treatment with 800 μg (but not 400 μg) FA lowered bAs to a greater extent than placebo; this was sustained 12 weeks after FA cessation. In future studies, we will evaluate whether FA and/or creatine altered As methylation profiles.

Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.

PubMed

Hashimoto, F; Taira, S; Hayashi, H

2000-05-15

We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.

Deposition of dietary fatty acids in young Zucker rats fed a cafeteria diet.

PubMed

Rafecas, I; Esteve, M; Fernández-López, J A; Remesar, X; Alemany, M

1992-10-01

The content and accretion of fatty acids in 30, 45 and 60-day-old Zucker lean Fa/? and obese fa/fa rats fed either reference chow or a cafeteria diet has been studied, together with their actual fatty acid intake during each period. Diet had little overall effect on the pattern of deposition of fatty acids, but quantitatively the deposition of fat was much higher in cafeteria-fed rats. The fat-rich cafeteria diet allowed the direct incorporation of most fatty acids into the rat lipids, whilst chow feeding activated lipogenesis and the deposition of a shorter chain and more saturated pattern of fatty acids. Genetic, obesity induced a significant expansion of net lipogenesis when compared with lean controls. Cafeteria-fed obese rats accrued a high proportion of fatty acids, which was close to that ingested, but nevertheless showed a net de novo synthesis of fatty acids. It is postulated that the combined effects of genetic obesity and a fat-rich diet result in high rates of fat accretion with limited net lipogenesis. Lean Zucker rats show a progressive impairment of their delta 5-desaturase system, a situation also observed in obese rats fed a reference diet. In Zucker obese rats, cafeteria feeding resulted in an alteration of the conversion of C18:2 into C20:3. The cafeteria diet fully compensated for these drawbacks by supplying very high amounts of polyunsaturated fatty acids.

A branched chain amino acid metabolite drives vascular transport of fat and causes insulin resistance

PubMed Central

Jang, Cholsoon; Oh, Sungwhan F; Wada, Shogo; Rowe, Glenn C; Liu, Laura; Chan, Mun Chun; Rhee, James; Hoshino, Atsushi; Kim, Boa; Ibrahim, Ayon; Baca, Luisa G; Kim, Esl; Ghosh, Chandra C; Parikh, Samir M; Jiang, Aihua; Chu, Qingwei; Forman, Daniel E.; Lecker, Stewart H.; Krishnaiah, Saikumari; Rabinowitz, Joshua D; Weljie, Aalim M; Baur, Joseph A; Kasper, Dennis L; Arany, Zoltan

2016-01-01

Epidemiological and experimental data implicate branched chain amino acids (BCAAs) in the development of insulin resistance, but the mechanisms underlying this link remain unclear.1–3 Insulin resistance in skeletal muscle stems from excess accumulation of lipid species4, a process that requires blood-borne lipids to first traverse the blood vessel wall. Little is known, however, of how this trans-endothelial transport occurs or is regulated. Here, we leverage PGC-1α, a transcriptional coactivator that regulates broad programs of FA consumption, to identify 3-hydroxy-isobutyrate (3-HIB), a catabolic intermediate of the BCAA valine, as a novel paracrine regulator of trans-endothelial fatty acids (FA) transport. 3-HIB is secreted from muscle cells, activates endothelial FA transport, stimulates muscle FA uptake in vivo, and promotes muscle lipid accumulation and insulin resistance in animals. Conversely, inhibiting the synthesis of 3-HIB in muscle cells blocks the promotion of endothelial FA uptake. 3-HIB levels are elevated in muscle from db/db mice and from subjects with diabetes. These data thus unveil a novel mechanism that regulates trans-endothelial flux of FAs, revealing 3-HIB as a new bioactive signaling metabolite that links the regulation of FA flux to BCAA catabolism and provides a mechanistic explanation for how increased BCAA catabolic flux can cause diabetes. PMID:26950361

Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.

PubMed

Matsuno, Koya; Fujimura, Tatsuhito

2014-03-01

A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?

PubMed Central

Parsons, Joshua B.; Rock, Charles O.

2011-01-01

The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391

De novo synthesis of milk triglycerides in humans

PubMed Central

Mohammad, Mahmoud A.; Sunehag, Agneta L.

2014-01-01

Mammary gland (MG) de novo lipogenesis contributes significantly to milk fat in animals but little is known in humans. Objective: To test the hypothesis that the incorporation of 13C carbons from [U-13C]glucose into fatty acids (FA) and glycerol in triglycerides (TG) will be greater: 1) in milk than plasma TG, 2) during a high-carbohydrate (H-CHO) diet than high-fat (H-FAT) diet, and 3) during feeding than fasting. Seven healthy, lactating women were studied on two isocaloric, isonitrogenous diets. On one occasion, subjects received diets containing H-FAT or H-CHO diet for 1 wk. Incorporation of 13C from infused [U-13C]glucose into FA and glycerol was measured using GC-MS and gene expression in RNA isolated from milk fat globule using microarrays. Incorporation of 13C2 into milk FA increased with increased FA chain length from C2:0 to C12:0 but progressively declined in C14:0 and C16:0 and was not detected in FA>C16. During feeding, regardless of diets, enrichment of 13C2 in milk FA and 13C3 in milk glycerol were ∼3- and ∼7-fold higher compared with plasma FA and glycerol, respectively. Following an overnight fast during H-CHO and H-FAT diets, 25 and 6%, respectively, of medium-chain FA (MCFA, C6–C12) in milk were derived from glucose but increased to 75 and 25% with feeding. Expression of genes involved in FA or glycerol synthesis was unchanged regardless of diet or fast/fed conditions. The human MG is capable of de novo lipogenesis of primarily MCFA and glycerol, which is influenced by the macronutrient composition of the maternal diet. PMID:24496312

Folic Acid and Creatine as Therapeutic Approaches to Lower Blood Arsenic: A Randomized Controlled Trial

PubMed Central

Peters, Brandilyn A.; Hall, Megan N.; Liu, Xinhua; Parvez, Faruque; Sanchez, Tiffany R.; van Geen, Alexander; Mey, Jacob L.; Siddique, Abu B.; Shahriar, Hasan; Uddin, Mohammad Nasir; Islam, Tariqul; Balac, Olgica; Ilievski, Vesna; Factor-Litvak, Pam; Graziano, Joseph H.

2015-01-01

Background The World Health Organization estimates that > 140 million people worldwide are exposed to arsenic (As)–contaminated drinking water. As undergoes biologic methylation, which facilitates renal As elimination. In folate-deficient individuals, this process is augmented by folic acid (FA) supplementation, thereby lowering blood As (bAs). Creatinine concentrations in urine are a robust predictor of As methylation patterns. Although the reasons for this are unclear, creatine synthesis is a major consumer of methyl donors, and this synthesis is down-regulated by dietary/supplemental creatine. Objectives Our aim was to determine whether 400 or 800 μg FA and/or creatine supplementation lowers bAs in an As-exposed Bangladeshi population. Methods We conducted a clinical trial in which 622 participants were randomized to receive 400 μg FA, 800 μg FA, 3 g creatine, 3 g creatine+400 μg FA, or placebo daily. All participants received an As-removal filter on enrollment, and were followed for 24 weeks. After the 12th week, half of the two FA groups were switched to placebo to evaluate post-treatment bAs patterns. Results Linear models with repeated measures indicated that the decline in ln(bAs) from baseline in the 800-μg FA group exceeded that of the placebo group (weeks 1–12: β= –0.09, 95% CI: –0.18, –0.01; weeks 13–24: FA continued: β= –0.12, 95% CI: –0.24, –0.00; FA switched to placebo: β= –0.14, 95% CI: –0.26, –0.02). There was no rebound in bAs related to cessation of FA supplementation. Declines in bAs observed in the remaining treatment arms were not significantly different from those of the placebo group. Conclusions In this mixed folate-deficient/replete study population, 12- and 24-week treatment with 800 μg (but not 400 μg) FA lowered bAs to a greater extent than placebo; this was sustained 12 weeks after FA cessation. In future studies, we will evaluate whether FA and/or creatine altered As methylation profiles. Citation

Fatty Acid Synthase Cooperates with Glyoxalase 1 to Protect against Sugar Toxicity

PubMed Central

Garrido, Damien; Rubin, Thomas; Poidevin, Mickael; Maroni, Brigitte; Le Rouzic, Arnaud; Parvy, Jean-Philippe; Montagne, Jacques

2015-01-01

Fatty acid (FA) metabolism is deregulated in several human diseases including metabolic syndrome, type 2 diabetes and cancers. Therefore, FA-metabolic enzymes are potential targets for drug therapy, although the consequence of these treatments must be precisely evaluated at the organismal and cellular levels. In healthy organism, synthesis of triacylglycerols (TAGs)—composed of three FA units esterified to a glycerol backbone—is increased in response to dietary sugar. Saturation in the storage and synthesis capacity of TAGs is associated with type 2 diabetes progression. Sugar toxicity likely depends on advanced-glycation-end-products (AGEs) that form through covalent bounding between amine groups and carbonyl groups of sugar or their derivatives α-oxoaldehydes. Methylglyoxal (MG) is a highly reactive α-oxoaldehyde that is derived from glycolysis through a non-enzymatic reaction. Glyoxalase 1 (Glo1) works to neutralize MG, reducing its deleterious effects. Here, we have used the power of Drosophila genetics to generate Fatty acid synthase (FASN) mutants, allowing us to investigate the consequence of this deficiency upon sugar-supplemented diets. We found that FASN mutants are lethal but can be rescued by an appropriate lipid diet. Rescued animals do not exhibit insulin resistance, are dramatically sensitive to dietary sugar and accumulate AGEs. We show that FASN and Glo1 cooperate at systemic and cell-autonomous levels to protect against sugar toxicity. We observed that the size of FASN mutant cells decreases as dietary sucrose increases. Genetic interactions at the cell-autonomous level, where glycolytic enzymes or Glo1 were manipulated in FASN mutant cells, revealed that this sugar-dependent size reduction is a direct consequence of MG-derived-AGE accumulation. In summary, our findings indicate that FASN is dispensable for cell growth if extracellular lipids are available. In contrast, FA-synthesis appears to be required to limit a cell

Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

PubMed Central

Cronan, John E.

2014-01-01

Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

Time to Detection with BacT/Alert FA Plus Compared to BacT/Alert FA Blood Culture Media.

PubMed

Nutman, A; Fisher Even-Tsur, S; Shapiro, G; Braun, T; Schwartz, D; Carmeli, Y

2016-09-01

Rapid identification of the causative pathogen in patients with bacteremia allows adjustment of antibiotic therapy and improves patient outcomes. We compared in vitro and real-life time to detection (TTD) of two blood culture media, BacT/Alert FA (FA) and BacT/Alert FA Plus (FA Plus), for the nine most common species of bacterial pathogens recovered from blood samples. Experimental data from simulated cultures was compared with microbiology records of TTD for both culture media with growth of the species of interest in clinical blood cultures. In the experimental conditions, median TTD was 3.8 hours (23.9 %) shorter using FA Plus media. The magnitude of reduction differed between species. Similarly, in real life data, FA Plus had shorter TTD than FA media; however, the difference between culture media was smaller, and median TTD was only 1 hour (8.5 %) less. We found shorter TTD with BacT/Alert FA Plus culture media, both experimentally and in real-life conditions and unrelated to antibiotic neutralization, highlighting the importance of appropriate blood culture media selection.

Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

PubMed

Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

2015-04-01

D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

Age-related changes in cyclic phosphatidic acid-induced hyaluronic acid synthesis in human fibroblasts.

PubMed

Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko

2018-01-01

Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.

Nitrogen-doped carbon quantum dots as a fluorescence probe combined with magnetic solid-phase extraction purification for analysis of folic acid in human serum.

PubMed

Wang, Meng; Jiao, Yang; Cheng, Chunsheng; Hua, Jianhao; Yang, Yaling

2017-12-01

A novel and sensitive method based on nitrogen-doped carbon quantum dots as a fluorescence probe coupled with magnetic solid-phase extraction (MSPE) purification for analysis of folic acid (FA) in human serum samples has been established for the first time. In the developed system, magnetic nanoparticles coated with hexanoic acid (Fe 3 O 4 @C 6 ) were synthesized by a one-step chemical co-precipitation method with good magnetic properties and dispersibility for sample purification, and it is better to be separated from the sample. High fluorescence nitrogen-doped carbon quantum dots (N-CQDs), simply prepared using a one-step hydrothermal method with nitrilotriacetic acid, could be selectively quenched by FA. Based on this phenomenon, a fluorescence assay was proposed for specific determination of FA. Various operational experiment parameters have been studied and optimized in detail. Under the optimum experimental conditions, the detection limit of the proposed method for FA was evaluated to be 0.5 nM (S/N = 3), while the relative standard deviation (RSD) was 1.2% (n = 6). Finally, the proposed method was applied for determination of trace levels of FA from human serum samples and quantitative recoveries were achieved within the range of 95.7-103.5%. All of the results showed that the proposed method had significant application in further research. Graphical abstract Schematic of synthesis of N-CQDs and schematic of suggested mode for analysis of folic acid (FA).

Targeted metabolomics analysis reveals the association between maternal folic acid supplementation and fatty acids and amino acids profiles in rat pups.

PubMed

Liu, Zhipeng; Liu, Rui; Chou, Jing; Yu, Jiaying; Liu, Xiaowei; Sun, Changhao; Li, Ying; Liu, Liyan

2018-07-15

Maternal diet during pregnancy can influence offspring's health by affecting development and metabolism. This study aimed to analyze the influence of maternal folic acid (FA) supplementation on the metabolism of rat pups using targeted metabolomics. Twenty female rats were randomly assigned to a FA supplementation (FAS group, n = 10) or control group (n = 10), which were fed AIN93G diet with 2 or 10 mg/kg FA, respectively. We then measured amino acids and their derivatives, biogenic amines, and fatty acids in the female rats and their pups by ultra-high performance liquid chromatography-triple quadrupole mass spectrometry (UHPLC/MS-MS) and gas chromatography-mass spectrometry (GC/MS-MS). In maternal rats, the significant changes of three metabolites (proline, γ-aminobutyric acid and esterified octadecatetraenoic acid, P < 0.05) were observed in FAS group. For the rat pups, FAS pups had significantly lower homocysteine and higher FA levels than control pups. The lower levels of amino acids (leucine, isoleucine, serine, proline) were obtained in FAS pups. Furthermore, there were the decreased esterified fatty acids (arachidonic acid, eicosapentaenoic acid, and docosatetraenoic acid) and free fatty acids (oleic acid, linoleic acid, γ-linolenic acid, octadecatetraenoic acid, arachidonic acid, eicosapentaenoic acid and selacholeic acid) in FAS pups. Metabolic changes in the FAS pups were characterized by changes in fatty acids and amino acids. These results suggested that FA supplementation during pregnancy influenced amino acids and fatty acids metabolism in rat pups. This study provides new insights into the regulation of amino acids and fatty acids metabolism during early life. Copyright © 2018 Elsevier B.V. All rights reserved.

Derivatives of diphosphonic acids: synthesis and biological activity

NASA Astrophysics Data System (ADS)

Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

1993-07-01

The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

PubMed

Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

2016-04-01

Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.

Abiotic synthesis of fatty acids

NASA Technical Reports Server (NTRS)

Leach, W. W.; Nooner, D. W.; Oro, J.

1978-01-01

The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

Effects of exogenous fatty acids and inhibition of de novo fatty acid synthesis on disaturated phosphatidylcholine production by fetal lung cells and adult type II cells.

PubMed

Maniscalco, W M; Finkelstein, J N; Parkhurst, A B

1989-05-01

De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.

Enzymatic routes for the synthesis of ursodeoxycholic acid.

PubMed

Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner

2014-12-10

Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

A genome-wide association study of red-blood cell fatty acids and ratios incorporating dietary covariates: Framingham Heart Study Offspring Cohort.

PubMed

Kalsbeek, Anya; Veenstra, Jenna; Westra, Jason; Disselkoen, Craig; Koch, Kristin; McKenzie, Katelyn A; O'Bott, Jacob; Vander Woude, Jason; Fischer, Karen; Shearer, Greg C; Harris, William S; Tintle, Nathan L

2018-01-01

Recent analyses have suggested a strong heritable component to circulating fatty acid (FA) levels; however, only a limited number of genes have been identified which associate with FA levels. In order to expand upon a previous genome wide association study done on participants in the Framingham Heart Study Offspring Cohort and FA levels, we used data from 2,400 of these individuals for whom red blood cell FA profiles, dietary information and genotypes are available, and then conducted a genome-wide evaluation of potential genetic variants associated with 22 FAs and 15 FA ratios, after adjusting for relevant dietary covariates. Our analysis found nine previously identified loci associated with FA levels (FADS, ELOVL2, PCOLCE2, LPCAT3, AGPAT4, NTAN1/PDXDC1, PKD2L1, HBS1L/MYB and RAB3GAP1/MCM6), while identifying four novel loci. The latter include an association between variants in CALN1 (Chromosome 7) and eicosapentaenoic acid (EPA), DHRS4L2 (Chromosome 14) and a FA ratio measuring delta-9-desaturase activity, as well as two loci associated with less well understood proteins. Thus, the inclusion of dietary covariates had a modest impact, helping to uncover four additional loci. While genome-wide association studies continue to uncover additional genes associated with circulating FA levels, much of the heritable risk is yet to be explained, suggesting the potential role of rare genetic variation, epistasis and gene-environment interactions on FA levels as well. Further studies are needed to continue to understand the complex genetic picture of FA metabolism and synthesis.

Association of protein kinase FA/GSK-3alpha (a proline-directed kinase and a regulator of protooncogenes) with human cervical carcinoma dedifferentiation/progression.

PubMed

Yang, S D; Yu, J S; Lee, T T; Ni, M H; Yang, C C; Ho, Y S; Tsen, T Z

1995-10-01

Computer analysis of protein phosphorylation-sites sequence revealed that most transcriptional factors and viral oncoproteins are prime targets for regulation of proline-directed protein phosphorylation, suggesting an association of proline-directed protein kinase (PDPK) family with neoplastic transformation and tumorigenesis. In this report, an immunoprecipitate activity assay of protein kinase FA/glycogen synthase kinase-3alpha (kinase FA/GSK-3alpha) (a particular member of PDPK family) has been optimized for human cervical tissue and used to demonstrate for the first time significantly increased (P < 0.001) activity in poorly differentiated cervical carcinoma (82.8 +/- 6.6 U/mg of protein), moderately differentiated carcinoma (36.2 +/- 3.4 U/mg of protein), and well-differentiated carcinoma (18.3 +/- 2.4 U/mg of protein) from 36 human cervical carcinoma samples when compared to 12 normal controls (4.9 +/- 0.6 U/mg of protein). Immunoblotting analysis further revealed that increased activity of kinase FA/GSK-3alpha in cervical carcinoma is due to overexpression of protein synthesis of the kinase. Taken together, the results provide initial evidence that overexpression of protein synthesis and cellular activity of kinase FA/GSK-3alpha may be involved in human cervical carcinoma dedifferentiation/progression, supporting an association of proline-directed protein kinase with neoplastic transformation and tumorigenesis. Since protein kinase FA/GSK-3alpha may function as a possible regulator of transcription factors/proto-oncogenes, the results further suggest that kinase FA/GSK-3alpha may play a potential role in human cervical carcinogenesis, especially in its dedifferentiation and progression.

Interactions between dietary oil treatments and genetic variants modulate fatty acid ethanolamides in plasma and body weight composition.

PubMed

Pu, Shuaihua; Eck, Peter; Jenkins, David J A; Connelly, Philip W; Lamarche, Benoît; Kris-Etherton, Penny M; West, Sheila G; Liu, Xiaoran; Jones, Peter J H

2016-03-28

Fatty acid ethanolamides (FAE), a group of lipid mediators derived from long-chain fatty acids (FA), mediate biological activities including activation of cannabinoid receptors, stimulation of fat oxidation and regulation of satiety. However, how circulating FAE levels are influenced by FA intake in humans remains unclear. The objective of the present study was to investigate the response of six major circulating FAE to various dietary oil treatments in a five-period, cross-over, randomised, double-blind, clinical study in volunteers with abdominal obesity. The treatment oils (60 g/12 552 kJ per d (60 g/3000 kcal per d)) provided for 30 d were as follows: conventional canola oil, high oleic canola oil, high oleic canola oil enriched with DHA, flax/safflower oil blend and corn/safflower oil blend. Two SNP associated with FAE degradation and synthesis were studied. Post-treatment results showed overall that plasma FAE levels were modulated by dietary FA and were positively correlated with corresponding plasma FA levels; minor allele (A) carriers of SNP rs324420 in gene fatty acid amide hydrolase produced higher circulating oleoylethanolamide (OEA) (P=0·0209) and docosahexaenoylethanolamide (DHEA) levels (P=0·0002). In addition, elevated plasma DHEA levels in response to DHA intake tended to be associated with lower plasma OEA levels and an increased gynoid fat mass. In summary, data suggest that the metabolic and physiological responses to dietary FA may be influenced via circulating FAE. Genetic analysis of rs324420 might help identify a sub-population that appears to benefit from increased consumption of DHA and oleic acid.

Fanconi anemia (FA) binding protein FAAP20 stabilizes FA complementation group A (FANCA) and participates in interstrand cross-link repair.

PubMed

Leung, Justin Wai Chung; Wang, Yucai; Fong, Ka Wing; Huen, Michael Shing Yan; Li, Lei; Chen, Junjie

2012-03-20

The Fanconi anemia (FA) pathway participates in interstrand cross-link (ICL) repair and the maintenance of genomic stability. The FA core complex consists of eight FA proteins and two Fanconi anemia-associated proteins (FAAP24 and FAAP100). The FA core complex has ubiquitin ligase activity responsible for monoubiquitination of the FANCI-FANCD2 (ID) complex, which in turn initiates a cascade of biochemical events that allow processing and removal of cross-linked DNA and thereby promotes cell survival following DNA damage. Here, we report the identification of a unique component of the FA core complex, namely, FAAP20, which contains a RAD18-like ubiquitin-binding zinc-finger domain. Our data suggest that FAAP20 promotes the functional integrity of the FA core complex via its direct interaction with the FA gene product, FANCA. Indeed, somatic knockout cells devoid of FAAP20 displayed the hallmarks of FA cells, including hypersensitivity to DNA cross-linking agents, chromosome aberrations, and reduced FANCD2 monoubiquitination. Taking these data together, our study indicates that FAAP20 is an important player involved in the FA pathway.

The nonproton ligand of acid-sensing ion channel 3 activates mollusk-specific FaNaC channels via a mechanism independent of the native FMRFamide peptide.

PubMed

Yang, Xiao-Na; Niu, You-Ya; Liu, Yan; Yang, Yang; Wang, Jin; Cheng, Xiao-Yang; Liang, Hong; Wang, Heng-Shan; Hu, You-Min; Lu, Xiang-Yang; Zhu, Michael X; Xu, Tian-Le; Tian, Yun; Yu, Ye

2017-12-29

The degenerin/epithelial sodium channel (DEG/ENaC) superfamily of ion channels contains subfamilies with diverse functions that are fundamental to many physiological and pathological processes, ranging from synaptic transmission to epileptogenesis. The absence in mammals of some DEG/ENaCs subfamily orthologues such as FMRFamide peptide-activated sodium channels (FaNaCs), which have been identified only in mollusks, indicates that the various subfamilies diverged early in evolution. We recently reported that the nonproton agonist 2-guanidine-4-methylquinazoline (GMQ) activates acid-sensing ion channels (ASICs), a DEG/ENaC subfamily mainly in mammals, in the absence of acidosis. Here, we show that GMQ also could directly activate the mollusk-specific FaNaCs. Differences in ion selectivity and unitary conductance and effects of substitutions at key residues revealed that GMQ and FMRFamide activate FaNaCs via distinct mechanisms. The presence of two activation mechanisms in the FaNaC subfamily diverging early in the evolution of DEG/ENaCs suggested that dual gating is an ancient feature in this superfamily. Notably, the GMQ-gating mode is still preserved in the mammalian ASIC subfamily, whereas FMRFamide-mediated channel gating was lost during evolution. This implied that GMQ activation may be essential for the functions of mammalian DEG/ENaCs. Our findings provide new insights into the evolution of DEG/ENaCs and may facilitate the discovery and characterization of their endogenous agonists. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Climate warming is predicted to reduce omega-3, long-chain, polyunsaturated fatty acid production in phytoplankton.

PubMed

Hixson, Stefanie M; Arts, Michael T

2016-08-01

Phytoplankton are the main source of energy and omega-3 (n-3) long-chain essential fatty acids (EFA) in aquatic ecosystems. Their growth and biochemical composition are affected by surrounding environmental conditions, including temperature, which continues to increase as a result of climate warming. Increasing water temperatures may negatively impact the production of EFA by phytoplankton through the process of homeoviscous adaptation. To investigate this, we conducted an exploratory data synthesis with 952 fatty acid (FA) profiles from six major groups of marine and freshwater phytoplankton. Temperature was strongly correlated with a decrease in the proportion of n-3 long-chain polyunsaturated FA (LC-PUFA) and an increase in omega-6 FA and saturated FA. Based on linear regression models, we predict that global n-3 LC-PUFA production will be reduced by 8.2% for eicosapentaenoic acid (EPA) and 27.8% for docosahexaenoic acid (DHA) with an increase in water temperature of 2.5 °C. Using a previously published estimate of the global production of EPA by diatoms, which contribute to most of the world's supply of EPA, we predict a loss of 14.2 Mt of EPA annually as a result of ocean warming. The n-3 LC-PUFA are vitally important for an array of key physiological functions in aquatic and terrestrial organisms, and these FA are mainly produced by phytoplankton. Therefore, reduced production of these EFA, as a consequence of climate warming, is predicted to negatively affect species that depend on these compounds for optimum physiological function. Such profound changes in the biochemical composition of phytoplankton cell membranes can lead to cascading effects throughout the world's ecosystems. © 2016 John Wiley & Sons Ltd.

Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.

PubMed

Halvorson, D L; McCune, S A

1984-11-01

The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.

A Lipidomic Approach to Understanding Free Fatty Acid Lipogenesis Derived from Dissolved Inorganic Carbon within Cnidarian-Dinoflagellate Symbiosis

PubMed Central

Dunn, Simon R.; Thomas, Michael C.; Nette, Geoffrey W.; Dove, Sophie G.

2012-01-01

The cnidarian-dinoflagellate symbiosis is arguably one of the most important within the marine environment in that it is integral to the formation of coral reefs. However, the regulatory processes that perpetuate this symbiosis remain unresolved. It is essential to understand these processes, if we are to elucidate the mechanisms that support growth and resource accumulation by coral host, and conversely, recently observed reduction and/or mortality of corals in response to rapid environmental change. This study specifically focused on one area of metabolic activity within the symbiosis, that of free fatty acid synthesis within both the dinoflagellate symbionts and cnidarian host. The main model system used was Aiptasia pulchella and Symbiodinium sp. in combination with aposymbiotic A. pulchella, the symbiotic coral Acropora millepora system and dinoflagellate culture. Fatty acids (FAs) were selected because of their multiple essential roles inclusive of energy storage (resource accumulation), membrane structure fluidity and cell signaling. The study addressed free FA lipogenesis by using a new method of enriched stable isotopic (13C) incorporation from dissolved inorganic carbon (DI13C) combined with HPLC-MS. FAs derived from DI13C aligned with a mixture of known lipogenesis pathways with the addition of some unusual FAs. After 120 hr, 13C-enriched FA synthesis rates were attributed to only a complex integration of both n–3 and n–6 lipogenesis pathways within the dinoflagellate symbionts. Furthermore, there was no detectible evidence of symbiont derived enriched isotope fatty acids, catabolized 13C derivatives or DI13C being directly utilized, in host late n–6 pathway long-chain FA lipogenesis. These findings do not align with a popular mutualistic translocation model with respect to the use of translocated symbiont photoassimilates in host long-chain FA lipogenesis, which has important connotations for linking nutrient sources with metabolite production and

A lipidomic approach to understanding free fatty acid lipogenesis derived from dissolved inorganic carbon within cnidarian-dinoflagellate symbiosis.

PubMed

Dunn, Simon R; Thomas, Michael C; Nette, Geoffrey W; Dove, Sophie G

2012-01-01

The cnidarian-dinoflagellate symbiosis is arguably one of the most important within the marine environment in that it is integral to the formation of coral reefs. However, the regulatory processes that perpetuate this symbiosis remain unresolved. It is essential to understand these processes, if we are to elucidate the mechanisms that support growth and resource accumulation by coral host, and conversely, recently observed reduction and/or mortality of corals in response to rapid environmental change. This study specifically focused on one area of metabolic activity within the symbiosis, that of free fatty acid synthesis within both the dinoflagellate symbionts and cnidarian host. The main model system used was Aiptasia pulchella and Symbiodinium sp. in combination with aposymbiotic A. pulchella, the symbiotic coral Acropora millepora system and dinoflagellate culture. Fatty acids (FAs) were selected because of their multiple essential roles inclusive of energy storage (resource accumulation), membrane structure fluidity and cell signaling. The study addressed free FA lipogenesis by using a new method of enriched stable isotopic ((13)C) incorporation from dissolved inorganic carbon (DI(13)C) combined with HPLC-MS. FAs derived from DI(13)C aligned with a mixture of known lipogenesis pathways with the addition of some unusual FAs. After 120 hr, (13)C-enriched FA synthesis rates were attributed to only a complex integration of both n-3 and n-6 lipogenesis pathways within the dinoflagellate symbionts. Furthermore, there was no detectible evidence of symbiont derived enriched isotope fatty acids, catabolized (13)C derivatives or DI(13)C being directly utilized, in host late n-6 pathway long-chain FA lipogenesis. These findings do not align with a popular mutualistic translocation model with respect to the use of translocated symbiont photoassimilates in host long-chain FA lipogenesis, which has important connotations for linking nutrient sources with metabolite

Effect of α-linolenic acid and DHA intake on lipogenesis and gene expression involved in fatty acid metabolism in growing-finishing pigs.

PubMed

De Tonnac, A; Labussière, E; Vincent, A; Mourot, J

2016-07-01

The regulation of lipogenesis mechanisms related to consumption of n-3 PUFA is poorly understood. The aim of the present study was to find out whether α-linolenic acid (ALA) or DHA uptake can have an effect on activities and gene expressions of enzymes involved in lipid metabolism in the liver, subcutaneous adipose tissue and longissimus dorsi (LD) muscle of growing-finishing pigs. Six groups of ten pigs received one of six experimental diets supplemented with rapeseed oil in the control diet, extruded linseed, microalgae or a mixture of both to implement different levels of ALA and DHA with the same content in total n-3. Results were analysed for linear and quadratic effects of DHA intake. The results showed that activities of malic enzyme (ME) and fatty acid synthase (FAS) decreased linearly in the liver with dietary DHA. Although the expression of the genes of these enzymes and their activities were poorly correlated, ME and FAS expressions also decreased linearly with DHA intake. The intake of DHA down-regulates the expressions of other genes involved in fatty acid (FA) metabolism in some tissues of pigs, such as fatty acid desaturase 2 and sterol-regulatory element binding transcription factor 1 in the liver and 2,4-dienoyl CoA reductase 2 in the LD muscle. FA oxidation in the LD muscle and FA synthesis decreased in the liver with increasing amount of dietary DHA, whereas a retroconversion of DHA into EPA seems to be set up in this last tissue.

Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

PubMed

Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

2017-08-01

Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

Ferulic acid-4-O-sulfate rather than ferulic acid relaxes arteries and lowers blood pressure in mice.

PubMed

Van Rymenant, Evelien; Van Camp, John; Pauwels, Bart; Boydens, Charlotte; Vanden Daele, Laura; Beerens, Katrijn; Brouckaert, Peter; Smagghe, Guy; Kerimi, Asimina; Williamson, Gary; Grootaert, Charlotte; Van de Voorde, Johan

2017-06-01

Consumption of foods rich in ferulic acid (FA) such as wholegrain cereals, or FA precursors such as chlorogenic acids in coffee, is inversely correlated with risk of cardiovascular disease and type 2 diabetes. As a result of digestion and phase II metabolism in the gut and liver, FA is converted predominantly into ferulic acid-4-O-sulfate (FA-sul), an abundant plasma metabolite. Although FA-sul is the main metabolite, very little has been reported regarding its bioactivities. We have compared the ex vivo vasorelaxing effect of FA and FA-sul (10 -7 -3.10 -5 M) on isolated mouse arteries mounted in tissue myographs. FA-sul, but not FA, elicited a concentration-dependent vasorelaxation of saphenous and femoral arteries and aortae. The FA-sul-mediated vasorelaxation was blunted by 1H-[1,2,4]oxadiazolo[4,3-a]quinoxalin-1-one, a soluble guanylate cyclase (sGC) inhibitor. The role of sGC was confirmed in femoral arteries isolated from sGCα 1 (-/-) knockout mice. Furthermore, 4-aminopyridine, a specific inhibitor of voltage-dependent potassium channels, significantly decreased FA-sul-mediated effects. In anesthetized mice, intravenous injection of FA-sul decreased mean arterial pressure, whereas FA had no effect, confirming the results obtained ex vivo. FA-sul is probably one of the major metabolites accounting for the blood pressure-lowering effects associated with FA consumption. Copyright © 2017 Elsevier Inc. All rights reserved.

Evaluation of Carbohydrate-Derived Fulvic Acid (CHD-FA) as a Topical Broad-Spectrum Antimicrobial for Drug-Resistant Wound Infections

DTIC Science & Technology

2016-10-01

restored from day 3 till day 6 in the cutaneous wound infection model. Although we have previously confirmed the broad-spectrum activity of CHD-FA in...vitro, CHD-FA may be less active against Gram-positive pathogens in vivo. The exact molecular mechanisms of the antibiotic activity of CHD-FA are still...not clear, and will be further investigated to address the discrepancy in its activity against Gram-positive and Gram-negative pathogens in our

Elovl5 regulates the mTORC2-Akt-FOXO1 pathway by controlling hepatic cis-vaccenic acid synthesis in diet-induced obese mice[S

PubMed Central

Tripathy, Sasmita; Jump, Donald B.

2013-01-01

Elevated hepatic expression of fatty acid elongase-5 (Elovl5) induces FoxO1 phosphorylation, lowers FoxO1 nuclear content, and suppresses expression of genes involved in gluconeogenesis (GNG). In this report, we define the molecular and metabolic basis of Elovl5 control of FoxO1 phosphorylation. Adenoviral-mediated (Ad-Elovl5) induction of hepatic Elovl5 in diet-induced obese, glucose-intolerant mice and HepG2 cells increased the phosphorylation of Akt2-S473 [mammalian target of rapamycin complex-2 (mTORC2) site], but not Akt2-T308 (PDK1 site). The Akt2 inhibitor Akti1/2 blocked Elovl5 induction of FoxO1-S256 phosphorylation in HepG2 cells. Elevated Elovl5 activity in liver and HepG2 cells induced rictor mRNA, rictor protein, and rictor-mTOR interaction, whereas rictor knockdown (siRNA) attenuated Elovl5 induction of Akt2-S473 and FoxO1-S256 phosphorylation in HepG2 cells. FA analysis revealed that the abundance of cis-vaccenic acid (18:1,n-7) was increased in livers of obese mice and HepG2 cells following Ad-Elovl5 infection. Treating HepG2 cells with Elovl5 substrates established that palmitoleic acid (16:1,n-7), but not γ-linolenic acid (18:3,n-6), induced rictor protein, Akt-S473, and FoxO1-S256 phosphorylation. Inhibition of FA elongation blocked 16:1,n-7 but not 18:1,n-7 induction of rictor protein and Akt-S473 and FoxO1-S256 phosphorylation. These results establish a novel link between Elovl5-mediated synthesis of 18:1,n-7 and GNG through the control of the mTORC2-Akt-FoxO1 pathway. PMID:23099444

Fanconi anemia (FA) binding protein FAAP20 stabilizes FA complementation group A (FANCA) and participates in interstrand cross-link repair

PubMed Central

Leung, Justin Wai Chung; Wang, Yucai; Fong, Ka Wing; Huen, Michael Shing Yan; Li, Lei; Chen, Junjie

2012-01-01

The Fanconi anemia (FA) pathway participates in interstrand cross-link (ICL) repair and the maintenance of genomic stability. The FA core complex consists of eight FA proteins and two Fanconi anemia-associated proteins (FAAP24 and FAAP100). The FA core complex has ubiquitin ligase activity responsible for monoubiquitination of the FANCI-FANCD2 (ID) complex, which in turn initiates a cascade of biochemical events that allow processing and removal of cross-linked DNA and thereby promotes cell survival following DNA damage. Here, we report the identification of a unique component of the FA core complex, namely, FAAP20, which contains a RAD18-like ubiquitin-binding zinc-finger domain. Our data suggest that FAAP20 promotes the functional integrity of the FA core complex via its direct interaction with the FA gene product, FANCA. Indeed, somatic knockout cells devoid of FAAP20 displayed the hallmarks of FA cells, including hypersensitivity to DNA cross-linking agents, chromosome aberrations, and reduced FANCD2 monoubiquitination. Taking these data together, our study indicates that FAAP20 is an important player involved in the FA pathway. PMID:22396592

N-3 fatty acids reduced trans fatty acids retention and increased docosahexaenoic acid levels in the brain.

PubMed

Lavandera, Jimena Verónica; Saín, Juliana; Fariña, Ana Clara; Bernal, Claudio Adrián; González, Marcela Aída

2017-09-01

The levels of docosahexaenoic acid (DHA, 22:6n-3) and arachidonic acid (AA, 20:4n-6) are critical for the normal structure and function of the brain. Trans fatty acids (TFA) and the source of the dietary fatty acids (FA) interfere with long-chain polyunsaturated fatty acids (LC-PUFA) biosynthesis. The aim of this study was to investigate the effect of TFA supplementation in diets containing different proportions of n-9, n-6, and n-3 FA on the brain FA profile, including the retention of TFA, LC-PUFA levels, and n-6/n-3 PUFA ratios. These parameters were also investigated in the liver, considering that LC-PUFA are mainly bioconverted from their dietary precursors in this tissue and transported by serum to the brain. Also, stearoyl-CoA desaturase-1 (SCD1) and sterol regulatory element-binding protein-1c (SREBP-1c) gene expressions were evaluated. Male CF1 mice were fed (16 weeks) diets containing different oils (olive, corn, and rapeseed) with distinct proportions of n-9, n-6, and n-3 FA (55.2/17.2/0.7, 32.0/51.3/0.9, and 61.1/18.4/8.6), respectively, substituted or not with 0.75% of TFA. FA composition of the brain, liver, and serum was assessed by gas chromatography. TFA were incorporated into, and therefore retained in the brain, liver, and serum. However, the magnitude of retention was dependent on the tissue and type of isomer. In the brain, total TFA retention was lower than 1% in all diets. Dietary n-3 PUFA decreased TFA retention and increased DHA accretion in the brain. The results underscore the importance of the type of dietary FA on the retention of TFA in the brain and also on the changes of the FA profile.

Association between Plasma Nonesterified Fatty Acids Species and Adipose Tissue Fatty Acid Composition

PubMed Central

Hellmuth, Christian; Demmelmair, Hans; Schmitt, Isabel; Peissner, Wolfgang; Blüher, Matthias; Koletzko, Berthold

2013-01-01

Fatty acid composition of adipose tissue (AT) is an established long-term biomarker for fatty acid (FA) intake and status, but AT samples are not easily available. Nonesterified FA composition in plasma (pNEFA) may be a good indicator of AT FA composition, because pNEFA are mainly generated by AT lipolysis. We investigated the correlation of 42 pNEFA and subcutaneous as well as visceral AT FA in 27 non-diabetic women with a median BMI of 36 kg/m2 (Q0.25: 25 kg/m2; Q0.75: 49 kg/m2). Close correlations of pNEFA and AT FA were found for odd-chain FA (15∶0 r = 0.838 and 0.862 for subcutaneous and visceral AT, respectively) and omega-3 FA (22∶6 r = 0.719/0.535), while no significant or low correlations were found for other FA including 18∶1 (r = 0.384/0.325) and 20∶4 (r = 0.386/0.266). Close correlations of pNEFA and AT FA were found for essential fatty acids, like 18∶2 (r = 0.541/0.610) and 20∶5 (r = 0.561/0.543). The lower correlation for some pNEFA species with AT FA indicates that the variation of most pNEFA is significantly affected by other FA sources and flux of FA to tissue, in addition to release from AT. A relevant influence of BMI on the level of correlation was shown for saturated FA. NEFA analysis in fasted plasma can serve as a virtual AT biopsy for some FA, and as a biomarker for intake of dairy products and sea fish. PMID:24098359

Association between plasma nonesterified fatty acids species and adipose tissue fatty acid composition.

PubMed

Hellmuth, Christian; Demmelmair, Hans; Schmitt, Isabel; Peissner, Wolfgang; Blüher, Matthias; Koletzko, Berthold

2013-01-01

Fatty acid composition of adipose tissue (AT) is an established long-term biomarker for fatty acid (FA) intake and status, but AT samples are not easily available. Nonesterified FA composition in plasma (pNEFA) may be a good indicator of AT FA composition, because pNEFA are mainly generated by AT lipolysis. We investigated the correlation of 42 pNEFA and subcutaneous as well as visceral AT FA in 27 non-diabetic women with a median BMI of 36 kg/m(2) (Q0.25: 25 kg/m(2); Q0.75: 49 kg/m(2)). Close correlations of pNEFA and AT FA were found for odd-chain FA (15∶0 r = 0.838 and 0.862 for subcutaneous and visceral AT, respectively) and omega-3 FA (22∶6 r = 0.719/0.535), while no significant or low correlations were found for other FA including 18∶1 (r = 0.384/0.325) and 20∶4 (r = 0.386/0.266). Close correlations of pNEFA and AT FA were found for essential fatty acids, like 18∶2 (r = 0.541/0.610) and 20∶5 (r = 0.561/0.543). The lower correlation for some pNEFA species with AT FA indicates that the variation of most pNEFA is significantly affected by other FA sources and flux of FA to tissue, in addition to release from AT. A relevant influence of BMI on the level of correlation was shown for saturated FA. NEFA analysis in fasted plasma can serve as a virtual AT biopsy for some FA, and as a biomarker for intake of dairy products and sea fish.

Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

PubMed

Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

2016-08-01

Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

Stereoselective synthesis of conformationally constrained omega-amino acid analogues from pyroglutamic acid.

PubMed

Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M

2005-08-07

Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.

Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli

PubMed Central

Broda, Paul

1968-01-01

Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126

A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

PubMed

Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

2015-04-01

The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

A novel unsaturated fatty acid hydratase toward C16 to C22 fatty acids from Lactobacillus acidophilus

PubMed Central

Hirata, Akiko; Kishino, Shigenobu; Park, Si-Bum; Takeuchi, Michiki; Kitamura, Nahoko; Ogawa, Jun

2015-01-01

Hydroxy FAs, one of the gut microbial metabolites of PUFAs, have attracted much attention because of their various bioactivities. The purpose of this study was to identify lactic acid bacteria with the ability to convert linoleic acid (LA) to hydroxy FAs. A screening process revealed that a gut bacterium, Lactobacillus acidophilus NTV001, converts LA mainly into 13-hydroxy-cis-9-octadecenoic acid and resulted in the identification of the hydratase responsible, fatty acid hydratase 1 (FA-HY1). Recombinant FA-HY1 was purified, and its enzymatic characteristics were investigated. FA-HY1 could convert not only C18 PUFAs but also C20 and C22 PUFAs. C18 PUFAs with a cis carbon-carbon double bond at the Δ12 position were converted into the corresponding 13-hydroxy FAs. Arachidonic acid and DHA were converted into the corresponding 15-hydroxy FA and 14-hydroxy FA, respectively. To the best of our knowledge, this is the first report of a bacterial FA hydratase that can convert C20 and C22 PUFAs into the corresponding hydroxy FAs. These novel hydroxy FAs produced by using FA-HY1 should contribute to elucidating the bioactivities of hydroxy FAs. PMID:25966711

Synthesis of α-linolenic acid-rich triacylglycerol using a newly prepared immobilized lipase.

PubMed

Kim, Heejin; Choi, Nakyung; Oh, Se-Wook; Kim, Yangha; Hee Kim, Byung; Kim, In-Hwan

2017-12-15

An α-linolenic acid (ALA)-rich triacylglycerol (TAG) was synthesized from an ALA-rich fatty acid (FA) from perilla oil and glycerol, using a newly prepared immobilized lipase under vacuum. The ALA-rich FA (purity >90wt%) used as the substrate was prepared by urea complexation from perilla oil FAs. Liquid Lipozyme TL 100L lipase from Thermomyces lanuginosus was used for immobilization. Nine different hydrophilic and hydrophobic carriers for immobilization were tested, and Duolite A568, which is a hydrophilic resin, was selected as the best carrier. This immobilized lipase was used to synthesize TAG by direct esterification under vacuum. The parameters investigated were temperature, enzyme loading, and vacuum level. The optimum reaction conditions were a temperature of 60°C, an enzyme loading of 15% (based on the total weight of the substrate), and a vacuum of 0.7kPa, respectively. The maximum conversion to TAG of ca. 88wt% was obtained in 12h under the optimum conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.

Synthesis and chirality of amino acids under interstellar conditions.

PubMed

Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

2013-01-01

Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

NASA Technical Reports Server (NTRS)

Weber, A. L.

1986-01-01

The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.

PubMed

Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan

2011-12-01

In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.

Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

PubMed

Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

2016-09-01

Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

A genome-wide association study of red-blood cell fatty acids and ratios incorporating dietary covariates: Framingham Heart Study Offspring Cohort

PubMed Central

Veenstra, Jenna; Westra, Jason; Disselkoen, Craig; Koch, Kristin; McKenzie, Katelyn A.; O’Bott, Jacob; Vander Woude, Jason; Fischer, Karen; Shearer, Greg C.; Harris, William S.; Tintle, Nathan L.

2018-01-01

Recent analyses have suggested a strong heritable component to circulating fatty acid (FA) levels; however, only a limited number of genes have been identified which associate with FA levels. In order to expand upon a previous genome wide association study done on participants in the Framingham Heart Study Offspring Cohort and FA levels, we used data from 2,400 of these individuals for whom red blood cell FA profiles, dietary information and genotypes are available, and then conducted a genome-wide evaluation of potential genetic variants associated with 22 FAs and 15 FA ratios, after adjusting for relevant dietary covariates. Our analysis found nine previously identified loci associated with FA levels (FADS, ELOVL2, PCOLCE2, LPCAT3, AGPAT4, NTAN1/PDXDC1, PKD2L1, HBS1L/MYB and RAB3GAP1/MCM6), while identifying four novel loci. The latter include an association between variants in CALN1 (Chromosome 7) and eicosapentaenoic acid (EPA), DHRS4L2 (Chromosome 14) and a FA ratio measuring delta-9-desaturase activity, as well as two loci associated with less well understood proteins. Thus, the inclusion of dietary covariates had a modest impact, helping to uncover four additional loci. While genome-wide association studies continue to uncover additional genes associated with circulating FA levels, much of the heritable risk is yet to be explained, suggesting the potential role of rare genetic variation, epistasis and gene-environment interactions on FA levels as well. Further studies are needed to continue to understand the complex genetic picture of FA metabolism and synthesis. PMID:29652918

Possible radioprotective effect of folic acid supplementation on low dose ionizing radiation-induced genomic instability in vitro.

PubMed

Padula, Gisel; Ponzinibbio, María Virginia; Seoane, Analia I

2016-08-01

Ionizing radiation (IR) induces DNA damage through production of single and double-strand breaks and reactive oxygen species (ROS). Folic acid (FA) prevents radiation-induced DNA damage by modification of DNA synthesis and/or repair and as a radical scavenger. We hypothesized that in vitro supplementation with FA will decrease the sensitivity of cells to genetic damage induced by low dose of ionizing radiation. Annexin V, comet and micronucleus assays were performed in cultured CHO cells. After 7 days of pre-treatment with 0, 100, 200 or 300 nM FA, cultures were exposed to radiation (100 mSv). Two un-irradiated controls were executed (0 and 100 nM FA). Data were statistically analyzed with X2-test and linear regression analysis (P 0.05). We observed a significantly decreased frequency of apoptotic cells with the increasing FA concentration (P <0.05). The same trend was observed when analyzing DNA damage and chromosomal instability (P <0.05 for 300 nM). Only micronuclei frequencies showed significant differences for linear regression analysis (R2=94.04; P <0.01). Our results have demonstrated the radioprotective effect of folic acid supplementation on low dose ionizing radiation-induced genomic instability in vitro; folate status should be taken into account when studying the effect of low dose radiation in environmental or occupational exposure.

Poly(l-lysine)-graft-folic acid-coupled poly(2-methyl-2-oxazoline) (PLL-g-PMOXA-c-FA): a bioactive copolymer for specific targeting to folate receptor-positive cancer cells.

PubMed

Chen, Yin; Cao, Wenbin; Zhou, Junli; Pidhatika, Bidhari; Xiong, Bin; Huang, Lu; Tian, Qian; Shu, Yiwei; Wen, Weijia; Hsing, I-Ming; Wu, Hongkai

2015-02-04

In this study, we present the preparation, characterization and application of a novel bioactive copolymer poly(l-lysine)-graft-folic acid-coupled poly(2-methyl-2-oxazoline) (PLL-g-PMOXA-c-FA), which has a specific interaction with folate receptor (FR)-positive cancer cells. Glass surface immobilized with PLL-g-PMOXA-c-FA was demonstrated to be adhesive to FR-positive cancer cells (HeLa, JEG-3) while nonadhesive to FR-negative ones (MCF-7, HepG2) in 3 h. The specific interaction between conjugated FA on the substrate and FRs on the cells could hardly be inhibited unless a high concentration (5 mM) of free FA was used due to the multivalent nature of it. The FA functionality ratio of the copolymer on the substrate had a significant influence on the adhesion of HeLa cells, and our experiments revealed that the affinity of the substrate to the cells declined dramatically with the decrease of functionality ratio. This was believed to be caused by the polydispersity of PMOXA tethers, as supported by GPC and ToF-SIMS data. As a proof of concept in the application of our material, we demonstrated successful recovery of HeLa cells from mixture with MCF-7 (1:100) on the copolymer-coated glass, and our results showed that both high sensitivity (95.6 ± 13.3%) and specificity (24.3 ± 8.6%) were achieved.

Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

PubMed Central

Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

1983-01-01

Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

Different Fatty Acids Compete with Arachidonic Acid for Binding to the Allosteric or Catalytic Subunits of Cyclooxygenases to Regulate Prostanoid Synthesis*

PubMed Central

Dong, Liang; Zou, Hechang; Yuan, Chong; Hong, Yu H.; Kuklev, Dmitry V.; Smith, William L.

2016-01-01

Prostaglandin endoperoxide H synthases (PGHSs), also called cyclooxygenases (COXs), convert arachidonic acid (AA) to PGH2. PGHS-1 and PGHS-2 are conformational heterodimers, each composed of an (Eallo) and a catalytic (Ecat) monomer. Previous studies suggested that the binding to Eallo of saturated or monounsaturated fatty acids (FAs) that are not COX substrates differentially regulate PGHS-1 versus PGHS-2. Here, we substantiate and expand this concept to include polyunsaturated FAs known to modulate COX activities. Non-substrate FAs like palmitic acid bind Eallo of PGHSs stimulating human (hu) PGHS-2 but inhibiting huPGHS-1. We find the maximal effects of non-substrate FAs on both huPGHSs occurring at the same physiologically relevant FA/AA ratio of ∼20. This inverse allosteric regulation likely underlies the ability of PGHS-2 to operate at low AA concentrations, when PGHS-1 is effectively latent. Unlike FAs tested previously, we observe that C-22 FAs, including ω-3 fish oil FAs, have higher affinities for Ecat than Eallo subunits of PGHSs. Curiously, C-20 ω-3 eicosapentaenoate preferentially binds Ecat of huPGHS-1 but Eallo of huPGHS-2. PGE2 production decreases 50% when fish oil consumption produces tissue EPA/AA ratios of ≥0.2. However, 50% inhibition of huPGHS-1 itself is only seen with ω-3 FA/AA ratios of ≥5.0. This suggests that fish oil-enriched diets disfavor AA oxygenation by altering the composition of the FA pool in which PGHS-1 functions. The distinctive binding specificities of PGHS subunits permit different combinations of non-esterified FAs, which can be manipulated dietarily, to regulate AA binding to Eallo and/or Ecat thereby controlling COX activities. PMID:26703471

The cathepsin B inhibitor, z-FA-CMK is toxic and readily induced cell death in human T lymphocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Liow, K.Y.; Chow, S.C., E-mail: chow.sek.chuen@monash.edu

The cathepsin B inhibitor, benzyloxycarbonyl-phenylalanine-alanine-chloromethylketone (z-FA-CMK) was found to be toxic and readily induced cell death in the human T cell line, Jurkat, whereas two other analogs benzyloxycarbonyl-phenylalanine-alanine-fluoromethylketone (z-FA-FMK) and benzyloxycarbonyl-phenylalanine-alanine-diazomethylketone (z-FA-DMK) were not toxic. The toxicity of z-FA-CMK requires not only the CMK group, but also the presence of alanine in the P1 position and the benzyloxycarbonyl group at the N-terminal. Dose–response studies showed that lower concentrations of z-FA-CMK induced apoptosis in Jurkat T cells whereas higher concentrations induced necrosis. In z-FA-CMK-induced apoptosis, both initiator caspases (-8 and -9) and effector caspases (-3, -6 and -7) were processed tomore » their respective subunits in Jurkat T cells. However, only the pro-form of the initiator caspases were reduced in z-FA-CMK-induced necrosis and no respective subunits were apparent. The caspase inihibitor benzyloxycarbonyl-valine-alanine-aspartic acid-(O-methyl)-fluoromehylketone (z-VAD-FMK) inhibits apoptosis and caspase processing in Jurkat T cells treated with low concentration of z-FA-CMK but has no effect on z-FA-CMK-induced necrosis and the loss of initiator caspases. This suggests that the loss of initiator caspases in Jurkat T cells during z-FA-CMK-induced necrosis is not a caspase-dependent process. Taken together, we have demonstrated that z-FA-CMK is toxic to Jurkat T cells and induces apoptosis at low concentrations, while at higher concentrations the cells die of necrosis. - Highlights: • z-FA-CMK is toxic and induce cell death in the human T cells. • z-FA-CMK toxicity requires the CMK group, alanine and the benzyloxycarbonyl group. • z-FA-CMK induced apoptosis at low concentration and necrosis at high concentration.« less

Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.

PubMed

Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

2009-07-01

In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.

New hydrazones of ferulic acid: synthesis, characterization and biological activity.

PubMed

Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa

2014-01-01

The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.

Functional characterization of two microsomal fatty acid desaturases from Jatropha curcas L.

PubMed

Wu, Pingzhi; Zhang, Sheng; Zhang, Lin; Chen, Yaping; Li, Meiru; Jiang, Huawu; Wu, Guojiang

2013-10-15

Linoleic acid (LA, C18:2) and α-linolenic acid (ALA, C18:3) are polyunsaturated fatty acids (PUFAs) and major storage compounds in plant seed oils. Microsomal ω-6 and ω-3 fatty acid (FA) desaturases catalyze the synthesis of seed oil LA and ALA, respectively. Jatropha curcas L. seed oils contain large proportions of LA, but very little ALA. In this study, two microsomal desaturase genes, named JcFAD2 and JcFAD3, were isolated from J. curcas. Both deduced amino acid sequences possessed eight histidines shown to be essential for desaturases activity, and contained motif in the C-terminal for endoplasmic reticulum localization. Heterologous expression in Saccharomyces cerevisiae and Arabidopsis thaliana confirmed that the isolated JcFAD2 and JcFAD3 proteins could catalyze LA and ALA synthesis, respectively. The results indicate that JcFAD2 and JcFAD3 are functional in controlling PUFA contents of seed oils and could be exploited in the genetic engineering of J. curcas, and potentially other plants. Copyright © 2013 Elsevier GmbH. All rights reserved.

Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

PubMed

Jiang, Jianghui; Xu, Jiaxi

2017-04-16

4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

Synthesis of monomethyl 5,5'-dehydrodiferulic acid

USDA-ARS?s Scientific Manuscript database

Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

PubMed Central

Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

2006-01-01

An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

Effect of the quality of dietary amino acids composition on the urea synthesis in rats.

PubMed

Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko

2011-01-01

We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.

Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.

PubMed

Lund, F; Telhag, H

1978-12-01

The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.

Total amino acid stabilization during cell-free protein synthesis reactions.

PubMed

Calhoun, Kara A; Swartz, James R

2006-05-17

Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.

Effects of antiglucocorticoid RU 486 on development of obesity in obese fa/fa Zucker rats.

PubMed

Langley, S C; York, D A

1990-09-01

The effects of RU 486 (mitepristone), an antagonist of type II glucocorticoid receptors (GR), on the development of obesity in young 5-wk-old obese fa/fa rats has been investigated. After 15 days of treatment, body composition of obese RU 486-treated rats was similar to that of lean-vehicle rats. Analysis of body composition changes showed that RU 486 effectively reversed the obesity. It stopped fat deposition in obese rats but increased protein deposition to the level of lean-vehicle rats. RU 486 prevented the development of hyperphagia and reduced gross energetic efficiency in the obese rats but had little effect on lean rats. Brown adipose tissue mitochondrial GDP binding was increased in obese rats but was reduced in lean rats by RU 486 treatment. RU 486 also reduced the elevated activity of hippocampal glycerophosphate dehydrogenase, a glucocorticoid-responsive enzyme, of obese rats to the level of lean rats. The evidence suggests that abnormal activity of glucocorticoid GR receptors or abnormal cellular responsiveness to corticosterone receptor complexes may be important in the development of obesity in the fa/fa rat.

Stereoselective synthesis of unsaturated α-amino acids.

PubMed

Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

2015-06-01

Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

PubMed

Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

2016-04-01

The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

PubMed

Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

2014-05-20

Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.

Effect of substitution of low linolenic acid soybean oil for hydrogenated soybean oil on fatty acid intake.

PubMed

DiRienzo, Maureen A; Astwood, James D; Petersen, Barbara J; Smith, Kim M

2006-02-01

Low linolenic acid soybean oil (LLSO) has been developed as a substitute for hydrogenated soybean oil to reduce intake of trans FA while improving stability and functionality in processed foods. We assessed the dietary impact of substitution of LLSO for hydrogenated soybean oil (HSBO) used in several food categories. All substitutions were done using an assumption of 100% market penetration. The impact of this substitution on the intake of five FA and trans FA was assessed. Substitution of LLSO for current versions of HSBO resulted in a 45% decrease in intake of trans FA. Impacts on other FA intakes were within the realm of typical dietary intakes. No decrease in intake of alpha-linolenic acid was associated with the use of LLSO in place of HSBO because LLSO substitutes for HSBO that are already low in alpha-linolenic acid.

Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

PubMed

Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

2016-07-02

Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

Dietary supplementation of finishing pigs with the docosahexaenoic acid-rich microalgae, Aurantiochytrium limacinum: effects on performance, carcass characteristics and tissue fatty acid profile

PubMed Central

2018-01-01

Objective The aim of this experiment was to evaluate the effect of dietary supplementation with the docosahexaenoic acid (DHA)-rich microalgae, Aurantiochytrium limacinum (AURA) on pig performance, carcass traits, and the fatty acid composition of pork Longissimus lumborum (LL) and backfat. Methods A total of 144 Pig Improvement Company (PIC)×Goland finishing pigs (72 females and 72 castrated males) of mean weight 117.1 (±13.1) kg were blocked by sex and body weight and provided with 0% or 1% AURA in isonutritive and isocaloric diets. A total of 24 pens provided 12 replicates per treatment. Animals were weighed on day 0 and 28 with feed and water intake recorded per pen. After 31 days supplementation (28 days of study and 3 days until the slaughtering date) three animals per pen (n = 72) were slaughtered and the LL and backfat thickness, lean meat content and dressing percentage were recorded for the carcasses. The fatty acid (FA) profile of the LL and backfat was established by direct FA methyl ester synthesis. Results No differences were observed for any performance parameters or carcass traits. Supplementation with AURA resulted in significant changes to the FA profiles of both the LL and backfat with male and female pigs responding differently to supplementation in terms of particular FAs. Overall, pork LL samples had significantly higher eicosapentaenoic acid (p<0.001) and DHA concentrations (p<0.001), and higher omega-3 (n-3) FAs (p<0.001), as well as an increased omega3:omega6 (n-3:n-6) ratio (p = 0.001). For backfat, supplementation resulted in significantly higher amounts of DHA (p<0.001) and n-3 FAs (p<0.001). Conclusion These results indicate that dietary supplementation with 1% AURA over a 31 day period can increase the FA composition of pork LL and backfat, specifically the DHA, with no major impact on growth performance and carcass traits. PMID:29381901

Dietary supplementation of finishing pigs with the docosahexaenoic acid-rich microalgae, Aurantiochytrium limacinum: effects on performance, carcass characteristics and tissue fatty acid profile.

PubMed

Moran, Colm A; Morlacchini, Mauro; Keegan, Jason D; Fusconi, Giorgio

2018-05-01

The aim of this experiment was to evaluate the effect of dietary supplementation with the docosahexaenoic acid (DHA)-rich microalgae, Aurantiochytrium limacinum (AURA) on pig performance, carcass traits, and the fatty acid composition of pork Longissimus lumborum (LL) and backfat. A total of 144 Pig Improvement Company (PIC)×Goland finishing pigs (72 females and 72 castrated males) of mean weight 117.1 (±13.1) kg were blocked by sex and body weight and provided with 0% or 1% AURA in isonutritive and isocaloric diets. A total of 24 pens provided 12 replicates per treatment. Animals were weighed on day 0 and 28 with feed and water intake recorded per pen. After 31 days supplementation (28 days of study and 3 days until the slaughtering date) three animals per pen (n = 72) were slaughtered and the LL and backfat thickness, lean meat content and dressing percentage were recorded for the carcasses. The fatty acid (FA) profile of the LL and backfat was established by direct FA methyl ester synthesis. No differences were observed for any performance parameters or carcass traits. Supplementation with AURA resulted in significant changes to the FA profiles of both the LL and backfat with male and female pigs responding differently to supplementation in terms of particular FAs. Overall, pork LL samples had significantly higher eicosapentaenoic acid (p<0.001) and DHA concentrations (p<0.001), and higher omega-3 (n-3) FAs (p<0.001), as well as an increased omega3:omega6 (n-3:n-6) ratio (p = 0.001). For backfat, supplementation resulted in significantly higher amounts of DHA (p<0.001) and n-3 FAs (p<0.001). These results indicate that dietary supplementation with 1% AURA over a 31 day period can increase the FA composition of pork LL and backfat, specifically the DHA, with no major impact on growth performance and carcass traits.

White Bass (Morone chrysops) Preferentially Retain n-3 PUFA in Ova When Fed Prepared Diets with Varying FA Content.

PubMed

Fuller, S Adam; Rawles, Steven D; McEntire, Matthew E; Bader, Troy J; Riche, Marty; Beck, Benjamin H; Webster, Carl D

2017-10-01

We evaluated the fatty acid (FA) composition of broodstock white bass ova fed one of six commercial diets with increasing polyunsaturated FA content (n-6/n-3 ratio; 0.36, 0.39, 0.46, 0.83, 1.07, 1.12) eight weeks prior to sampling. Fatty acid profiles of ova from brooders fed each of the six diets were significantly altered according to canonical discriminant analysis. Ova FA profiles resulting from the 0.39 diet separated those from the 0.36 diet based on lower 18:2n-6 (LNA) and higher 20:1n-9 concentrations from the 0.36 diet. Ova profiles were further separated based on lower concentrations of 22:5n-3 (DPA) from the 0.46 diet, lower concentrations of 20:5n-3 (EPA) in the 1.12 and 0.83 diets, and lower concentrations of 22:6n-3 (DHA) in all other diets relative to the 0.46 diet. Changes in ova FA profile at four and eight weeks were consistent with dietary intake with an approximate 2% increase in any given FA class with increasing time on individual diet. There was no correlation between dietary ARA concentrations (0.7-1.1 mol%), or dietary EPA/ARA ratios (7-15), and the concentrations (1.4-1.7 mol%) or ratios (3.3-4.4) found in the ova by diet. Our results suggest that white bass females have the ability to preferentially incorporate n-3 PUFA, particularly DHA, suggesting mobilization of this FA from other tissues for ova deposition or preferential dietary incorporation of PUFA into ova. These results will add to the limited FA information available in white bass and enable nutritionists to formulate broodstock diets that maximize reproductive potential in this species.

Management, nutrition, and lactation performance are related to bulk tank milk de novo fatty acid concentration on northeastern US dairy farms.

PubMed

Woolpert, M E; Dann, H M; Cotanch, K W; Melilli, C; Chase, L E; Grant, R J; Barbano, D M

2016-10-01

This study investigated the relationship of management practices, dietary characteristics, milk composition, and lactation performance with de novo fatty acid (FA) concentration in bulk tank milk from commercial dairy farms with Holstein, Jersey, and mixed-breed cows. It was hypothesized that farms with higher de novo milk FA concentrations would more commonly use management and nutrition practices known to optimize ruminal conditions that enhance de novo synthesis of milk FA. Farms (n=44) located in Vermont and northeastern New York were selected based on a history of high de novo (HDN; 26.18±0.94g/100g of FA; mean ± standard deviation) or low de novo (LDN; 24.19±1.22g/100g of FA) FA in bulk tank milk. Management practices were assessed during one visit to each farm in March or April, 2014. Total mixed ration samples were collected and analyzed for chemical composition using near infrared spectroscopy. We found no differences in days in milk at the farm level. Yield of milk fat, true protein, and de novo FA per cow per day were higher for HDN versus LDN farms. The HDN farms had lower freestall stocking density (cows/stall) than LDN farms. Additionally, tiestall feeding frequency was higher for HDN than LDN farms. No differences between HDN and LDN farms were detected for dietary dry matter, crude protein, neutral detergent fiber, starch, or percentage of forage in the diet. However, dietary ether extract was lower for HDN than LDN farms. This research indicates that overcrowded freestalls, reduced feeding frequency, and greater dietary ether extract content are associated with lower de novo FA synthesis and reduced milk fat and true protein yields on commercial dairy farms. Copyright © 2016 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Erythrocyte membrane fatty acids in multiple myeloma patients.

PubMed

Jurczyszyn, Artur; Czepiel, Jacek; Gdula-Argasińska, Joanna; Czapkiewicz, Anna; Biesiada, Grażyna; Dróżdż, Mirosław; Perucki, William; Castillo, Jorge J

2014-10-01

Mounting data show that fatty acids (FA) and fatty acid synthase (FAS) function could be potential targets for multiple myeloma (MM) therapy. Our study aimed at comparing the FA composition of erythrocyte membranes of MM patients and healthy controls. MM patients had higher saturated FA and n-6 polyunsaturated FA (PUFA) and lower monounsaturated, n-3 PUFA and trans-FA indices than controls. The n-3/n-6 PUFA ratio was lower in MM patients and there was distinct clustering of variants of individual FA in MM patients. The FA content of erythrocyte membrane could serve as a diagnostic and/or predictive biomarker in MM. Copyright © 2014. Published by Elsevier Ltd.

Regulation of L-ascorbic acid content in strawberry fruits

PubMed Central

Cruz-Rus, Eduardo; Amaya, Iraida; Sánchez-Sevilla, José F.; Botella, Miguel A.; Valpuesta, Victoriano

2011-01-01

Plants have several L-ascorbic acid (AsA) biosynthetic pathways, but the contribution of each one to the synthesis of AsA varyies between different species, organs, and developmental stages. Strawberry (Fragaria×ananassa) fruits are rich in AsA. The pathway that uses D-galacturonate as the initial substrate is functional in ripe fruits, but the contribution of other pathways to AsA biosynthesis has not been studied. The transcription of genes encoding biosynthetic enzymes such as D-galacturonate reductase (FaGalUR) and myo-inositol oxygenase (FaMIOX), and the AsA recycling enzyme monodehydroascorbate reductase (FaMDHAR) were positively correlated with the increase in AsA during fruit ripening. Fruit storage for 72 h in a cold room reduced the AsA content by 30%. Under an ozone atmosphere, this reduction was 15%. Ozone treatment increased the expression of the FaGalUR, FaMIOX, and L-galactose-1-phosphate phosphatase (FaGIPP) genes, and transcription of the L-galactono-1,4-lactone dehydrogenase (FaGLDH) and FAMDHAR genes was higher in the ozone-stored than in the air-stored fruits. Analysis of AsA content in a segregating population from two strawberry cultivars showed high variability, which did not correlate with the transcription of any of the genes studied. Study of GalUR protein in diverse cultivars of strawberry and different Fragaria species showed that a correlation between GalUR and AsA content was apparent in most cases, but it was not general. Three alleles were identified in strawberry, but any sequence effect on the AsA variability was eliminated by analysis of the allele-specific expression. Taken together, these results indicate that FaGalUR shares the control of AsA levels with other enzymes and regulatory elements in strawberry fruit. PMID:21561953

Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

PubMed

Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

2015-01-01

We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

Phosphatidic Acid Synthesis in Bacteria

PubMed Central

Yao, Jiangwei; Rock, Charles O.

2012-01-01

Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

PubMed

Myrtle, J D; Beekman, A M; Barrow, R A

2016-09-21

A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).

Overexpression of the olive acyl carrier protein gene (OeACP1) produces alterations in fatty acid composition of tobacco leaves.

PubMed

De Marchis, Francesca; Valeri, Maria Cristina; Pompa, Andrea; Bouveret, Emmanuelle; Alagna, Fiammetta; Grisan, Simone; Stanzione, Vitale; Mariotti, Roberto; Cultrera, Nicolò; Baldoni, Luciana; Bellucci, Michele

2016-02-01

Taking into account that fatty acid (FA) biosynthesis plays a crucial role in lipid accumulation in olive (Olea europaea L.) mesocarp, we investigated the effect of olive acyl carrier protein (ACP) on FA composition by overexpressing an olive ACP cDNA in tobacco plants. The OeACP1.1A cDNA was inserted in the nucleus or in the chloroplast DNA of different tobacco plants, resulting in extensive transcription of the transgenes. The transplastomic plants accumulated lower olive ACP levels in comparison to nuclear-transformed plants. Moreover, the phenotype of the former plants was characterized by pale green/white cotyledons with abnormal chloroplasts, delayed germination and reduced growth. We suggest that the transplastomic phenotype was likely caused by inefficient olive ACP mRNA translation in chloroplast stroma. Conversely, total lipids from leaves of nuclear transformants expressing high olive ACP levels showed a significant increase in oleic acid (18:1) and linolenic acid (18:3), and a concomitant significant reduction of hexadecadienoic acid (16:2) and hexadecatrienoic acid (16:3). This implies that in leaves of tobacco transformants, as likely in the mesocarp of olive fruit, olive ACP not only plays a general role in FA synthesis, but seems to be specifically involved in chain length regulation forwarding the elongation to C18 FAs and the subsequent desaturation to 18:1 and 18:3.

Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.

1983-09-01

We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less

Interactions between fatty acid synthesis, oxidation, and esterification in the production of triglyceride-rich lipoproteins by the liver.

PubMed

Fukuda, N; Ontko, J A

1984-08-01

In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of

Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs

PubMed Central

Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.

2009-01-01

The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020

Biotransformation of ferulic acid to protocatechuic acid by Corynebacterium glutamicum ATCC 21420 engineered to express vanillate O-demethylase.

PubMed

Okai, Naoko; Masuda, Takaya; Takeshima, Yasunobu; Tanaka, Kosei; Yoshida, Ken-Ichi; Miyamoto, Masanori; Ogino, Chiaki; Kondo, Akihiko

2017-12-01

Ferulic acid (4-hydroxy-3-methoxycinnamic acid, FA) is a lignin-derived phenolic compound abundant in plant biomass. The utilization of FA and its conversion to valuable compounds is desired. Protocatechuic acid (3,4-dihydroxybenzoic acid, PCA) is a precursor of polymers and plastics and a constituent of food. A microbial conversion system to produce PCA from FA was developed in this study using a PCA-producing strain of Corynebacterium glutamicum F (ATCC 21420). C. glutamicum strain F grown at 30 °C for 48 h utilized 2 mM each of FA and vanillic acid (4-hydroxy-3-methoxybenzoic acid, VA) to produce PCA, which was secreted into the medium. FA may be catabolized by C. glutamicum through proposed (I) non-β-oxidative, CoA-dependent or (II) β-oxidative, CoA-dependent phenylpropanoid pathways. The conversion of VA to PCA is the last step in each pathway. Therefore, the vanillate O-demethylase gene (vanAB) from Corynebacterium efficiens NBRC 100395 was expressed in C. glutamicum F (designated strain FVan) cultured at 30 °C in AF medium containing FA. Strain C. glutamicum FVan converted 4.57 ± 0.07 mM of FA into 2.87 ± 0.01 mM PCA after 48 h with yields of 62.8% (mol/mol), and 6.91 mM (1064 mg/L) of PCA was produced from 16.0 mM of FA after 12 h of fed-batch biotransformation. Genomic analysis of C. glutamicum ATCC 21420 revealed that the PCA-utilization genes (pca cluster) were conserved in strain ATCC 21420 and that mutations were present in the PCA importer gene pcaK.

By-products of electrochemical synthesis of suberic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.

By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation.

PubMed

Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A

2007-11-01

In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.

Effect of dietary fatty acid supplements, varying in fatty acid composition, on milk fat secretion in dairy cattle fed diets supplemented to less than 3% total fatty acids.

PubMed

Stoffel, C M; Crump, P M; Armentano, L E

2015-01-01

Dietary fatty acids can affect both milk fat yield and fatty acid (FA) composition. This relationship is well established when the dietary level of FA exceeds 3% of diet dry matter (DM). We could find no reports directly examining the effects of dietary FA profile on milk fat at levels below 3%. Twenty-four primiparous and 36 multiparous lactating cows were paired by production (1 high with 1 low, within parity) to form 30 experimental units. Pairs were fed 6 diets in five 6×6 balanced Latin squares with 21-d periods, and data were collected during the last 5d of each period. Two control diets were fed: a corn control diet (CC; 29% corn silage, 16% alfalfa silage, 19% corn grain, and 8% distillers grain on a DM basis) containing 1.8% FA; and a low-oil control diet (LOC; 9% corn silage, 35% alfalfa silage, 20% food-grade corn starch, and 8% corn gluten feed on a DM basis) containing 1.2% FA. A portion of the food-grade corn starch in LOC was replaced with 4 different FA supplements to create the 4 treatment diets. Treatments were 1.7% (DM basis) of a 50:50 blend of corn oil and high-linoleic safflower oil (LO), 1.7% high-oleic sunflower oil (OO), 1.7% palm oil (PO), or 1.8% calcium salts of palm fatty acids (PFA). The resultant diets were thus enriched in linoleic (LO), oleic (OO), or palmitic acid (PO and PFA). Dietary treatments did not affect dry matter intake. Addition of any of the fat sources to LOC resulted in increased milk yield, but milk fat yields and milk FA composition were variable for the different treatments. The LO treatment resulted in lower milk fat yield, fat concentration, and C16:0 yield but increased both trans-10 C18:1 and trans-10,cis-12 C18:2 yields compared with the other added FA treatments. Diets PO and PFA resulted in increased milk C16:0 yield and decreased total milk C18 yield compared with OO. Regression analysis revealed a negative coefficient for dietary linoleic acid content over basal (LOC) for both milk short-chain FA yield and

Fatty acid synthesis in Escherichia coli

PubMed Central

Knivett, V. A.; Cullen, Julia

1967-01-01

1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364

Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

PubMed

Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

2014-07-01

The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

Inhibition of rotavirus replication by downregulation of fatty acid synthesis.

PubMed

Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich

2013-06-01

Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.

Friedreich's Ataxia (FA)

MedlinePlus

... success- ful people with FA — business leaders, outstanding students, engineers, active teens and bright kids, parents, even ... tory experiments have shown that it’s possible to design short fragments of DNA that prevent abnormal folding ...

Palmitoleic acid is elevated in fatty liver disease and reflects hepatic lipogenesis1234

PubMed Central

Lee, Joseph J; Lambert, Jennifer E; Hovhannisyan, Yelena; Ramos-Roman, Maria A; Trombold, Justin R; Wagner, David A

2015-01-01

Background: Biochemical evidence has linked the coordinate control of fatty acid (FA) synthesis with the activity of stearoyl-CoA desaturase-1 (SCD1). The ratio of 16:1n–7 to 16:0 [SCD1(16)] in plasma triacylglycerol FA has been used as an index to reflect liver SCD1(16) activity and has been proposed as a biomarker of FA synthesis, although this use has not been validated by comparison with isotopically measured de novo lipogenesis (DNLMeas). Objective: We investigated plasma lipid 16:1n–7 and FA indexes of elongation and desaturation in relation to lipogenesis. Design: In this cross-sectional investigation of metabolism, 24 overweight adults, who were likely to have elevated DNL, consumed D2O for 10 d and had liver fat (LF) measured by magnetic resonance spectroscopy. Very-low-density lipoprotein (VLDL)-triacylglycerols and plasma free FA [nonesterified fatty acids (NEFAs)] were analyzed by using gas chromatography for the FA composition (molar percentage) and gas chromatography–mass spectrometry and gas chromatography–combustion isotope ratio mass spectrometry for deuterium enrichment. Results: In all subjects, VLDL-triacylglycerol 16:1n–7 was significantly (P < 0.01) related to DNLMeas (r = 0.56), liver fat (r = 0.53), and adipose insulin resistance (r = 0.56); similar positive relations were shown with the SCD1(16) index, and the pattern in NEFAs echoed that of VLDL-triacylglycerols. Compared with subjects with low LF (3.1 ± 2.7%; n = 11), subjects with high LF (18.4 ± 3.6%; n = 13) exhibited a 45% higher VLDL-triacylglycerol 16:1n–7 molar percentage (P < 0.01), 16% of subjects had lower 18:2n–6 (P = 0.01), and 27% of subjects had higher DNL as assessed by using a published DNL index (ratio of 16:0 to 18:2n–6; P = 0.03), which was isotopically confirmed by DNLMeas (increased 2.5-fold; P < 0.01). Compared with 16:0 in the diet, the low amount of dietary 16:1n–7 in VLDL-triacylglycerols corresponded to a stronger signal of elevated DNL

Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

PubMed

Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

2012-01-07

Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012

Synthesis of acid-soluble spore proteins by Bacillus subtilis.

PubMed

Leventhal, J M; Chambliss, G H

1982-12-01

The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.

Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

NASA Astrophysics Data System (ADS)

Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

2017-07-01

The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

Palmitoleic acid (16:1n7) increases oxygen consumption, fatty acid oxidation and ATP content in white adipocytes.

PubMed

Cruz, Maysa M; Lopes, Andressa B; Crisma, Amanda R; de Sá, Roberta C C; Kuwabara, Wilson M T; Curi, Rui; de Andrade, Paula B M; Alonso-Vale, Maria I C

2018-03-20

We have recently demonstrated that palmitoleic acid (16:1n7) increases lipolysis, glucose uptake and glucose utilization for energy production in white adipose cells. In the present study, we tested the hypothesis that palmitoleic acid modulates bioenergetic activity in white adipocytes. For this, 3 T3-L1 pre-adipocytes were differentiated into mature adipocytes in the presence (or absence) of palmitic (16:0) or palmitoleic (16:1n7) acid at 100 or 200 μM. The following parameters were evaluated: lipolysis, lipogenesis, fatty acid (FA) oxidation, ATP content, oxygen consumption, mitochondrial mass, citrate synthase activity and protein content of mitochondrial oxidative phosphorylation (OXPHOS) complexes. Treatment with 16:1n7 during 9 days raised basal and isoproterenol-stimulated lipolysis, FA incorporation into triacylglycerol (TAG), FA oxidation, oxygen consumption, protein expression of subunits representing OXPHOS complex II, III, and V and intracellular ATP content. These effects were not observed in adipocytes treated with 16:0. Palmitoleic acid, by concerted action on lipolysis, FA esterification, mitochondrial FA oxidation, oxygen consumption and ATP content, does enhance white adipocyte energy expenditure and may act as local hormone.

Adipose Fatty Acid Binding Protein Promotes Saturated Fatty Acid-induced Macrophage Cell Death through Enhancing Ceramide Production

PubMed Central

Zhang, Yuwen; Rao, Enyu; Zeng, Jun; Hao, Jiaqing; Sun, Yanwen; Liu, Shujun; Sauter, Edward R.; Bernlohr, David A.; Cleary, Margot P.; Suttles, Jill; Li, Bing

2016-01-01

Macrophages play a critical role in obesity-associated chronic inflammation and disorders. However, the molecular mechanisms underlying the response of macrophages to elevated fatty acids (FAs) and their contribution to metabolic inflammation in obesity remain to be fully elucidated. Here, we report a new mechanism by which dietary FAs, in particular saturated FAs, are able to directly trigger macrophage cell death. We demonstrated that excess saturated FAs, but not unsaturated FAs, induced the production of cytotoxic ceramides in macrophage cell lines. Most importantly, expression of adipose fatty acid binding protein (A-FABP) in macrophages facilitated metabolism of excess saturated FAs for ceramide synthesis. Inhibition or deficiency of A-FABP in macrophage cell lines decreased saturated FA-induced ceramide production, thereby resulting in reduced cell death. Furthermore, we validated the role of A-FABP in promoting saturated FA-induced macrophage cell death with primary bone-marrow derived macrophages and high-fat diet-induced obese mice. Altogether, our data reveal that excess dietary saturated FAs may serve as direct triggers in induction of ceramide production and macrophage cell death through elevated expression of A-FABP, thus establishing A-FABP as a new molecular sensor in triggering macrophage-associated sterile inflammation in obesity. PMID:27920274

Folic acid bio-inspired route for facile synthesis of AuPt nanodendrites as enhanced electrocatalysts for methanol and ethanol oxidation reactions

NASA Astrophysics Data System (ADS)

Wang, Ai-Jun; Ju, Ke-Jian; Zhang, Qian-Li; Song, Pei; Wei, Jie; Feng, Jiu-Ju

2016-09-01

Folic acid (FA), as an important biomolecule in cell division and growth, is firstly employed as the structure director and stabilizing agent for controlled synthesis of uniform Au65Pt35 nanodendrites (NDs) by a one-pot wet-chemical bio-inspired route at room temperature. No pre-seed, template, organic solvent, polymer, surfactant or complex instrument is involved. The products are mainly characterized by transmission electron microscopy (TEM), high angle annular dark-field scanning transmission electron microscopy (HAADF-STEM), X-ray diffraction (XRD), and X-Ray photoelectron spectroscopy (XPS). The architectures have enlarged electrochemically active surface area (60.6 m2 gPt-1), enhanced catalytic activity and durability for methanol and ethanol oxidation in contrast with commercial Pt black and the other AuPt alloys by tuning the molar ratios of Au to Pt (e.g., Au31Pt69 and Au82Pt18 nanoparticles). This strategy would be applied to fabricate other bimetallic nanocatalysts in fuel cells.

Reversible Hydrogenation of Carbon Dioxide to Formic Acid and Methanol: Lewis Acid Enhancement of Base Metal Catalysts.

PubMed

Bernskoetter, Wesley H; Hazari, Nilay

2017-04-18

New and sustainable energy vectors are required as a consequence of the environmental issues associated with the continued use of fossil fuels. H 2 is a potential clean energy source, but as a result of problems associated with its storage and transport as a gas, chemical H 2 storage (CHS), which involves the dehydrogenation of small molecules, is an attractive alternative. In principle, formic acid (FA, 4.4 wt % H 2 ) and methanol (MeOH, 12.6 wt % H 2 ) can be obtained renewably and are excellent prospective liquid CHS materials. In addition, MeOH has considerable potential both as a direct replacement for gasoline and as a fuel cell input. The current commercial syntheses of FA and MeOH, however, use nonrenewable feedstocks and will not facilitate the use of these molecules for CHS. An appealing option for the sustainable synthesis of both FA and MeOH, which could be implemented on a large scale, is the direct metal catalyzed hydrogenation of CO 2 . Furthermore, given that CO 2 is a readily available, nontoxic and inexpensive source of carbon, it is expected that there will be economic and environmental benefits from using CO 2 as a feedstock. One strategy to facilitate both the dehydrogenation of FA and MeOH and the hydrogenation of CO 2 and H 2 to FA and MeOH is to utilize a homogeneous transition metal catalyst. In particular, the development of catalysts based on first row transition metals, which are cheaper, and more abundant than their precious metal counterparts, is desirable. In this Account, we describe recent advances in the development of iron and cobalt systems for the hydrogenation of CO 2 to FA and MeOH and the dehydrogenation of FA and MeOH and provide a brief comparison between precious metal and base metal systems. We highlight the different ligands that have been used to stabilize first row transition metal catalysts and discuss the use of additives to promote catalytic activity. In particular, the Account focuses on the crucial role that

Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver stage development

PubMed Central

Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.

2014-01-01

SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260

This NASA Dryden F/A-18 is participating in the Automated Aerial Refueling (AAR) project. F/A-18 (No

NASA Technical Reports Server (NTRS)

2002-01-01

A NASA Dryden F/A-18 is participating in the Automated Aerial Refueling (AAR) project. F/A-18 (No. 847) is acting as an in-flight refueling tanker in the study to develop analytical models for an automated aerial refueling system for unmanned vehicles. A 300-gallon aerodynamic pod containing air-refueling equipment is seen beneath the fuselage. The hose and refueling basket are extended during an assessment of their dynamics on the F/A-18A.

WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

PubMed Central

Browse, John

2016-01-01

Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis.

PubMed

Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A

2008-10-01

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.

A comparative assessment of fatty acids in Antarctic organisms from the Ross Sea: Occurrence and distribution.

PubMed

Corsolini, Simonetta; Borghesi, Nicoletta

2017-05-01

Lipids are important energy source and structural component for cellular membranes and tissues, involved in the osmoregulation and immune response, and are very important in the bioaccumulation of lipophilic chemicals too. Among lipids, fatty acids (FAs) give information on diet of organisms, since FA of consumer lipids can be related to those of diet; plants and animals vary in their FA signature because of differences in the synthesis of lipids. In this study, lipid content and FA composition in tissues of Antarctic organisms from the Ross Sea (Odontaster validus, Sterechinus neumayeri, Chionodraco hamatus, Trematomus bernacchii, Pygoscelis adèliae) were assessed. Differences in lipid characterisation were found between both species and tissues. The lipid content was highest in C. hamatus liver (3.51%), and lowest in T. bernacchii muscle (0.16%). The polyunsaturated fatty acids (PUFAs) prevailed in the C. hamatus muscle, and among FAs, the docosahexaenoic acid (DHA; C22:6n3) was the most abundant (20.93%). The C22:6n3 accumulated more in fish and penguin tissues than in invertebrate species. The high contribution of unsaturated fatty acids (>74%) in fish tissues wats related to the low environmental temperature. The fatty acid profile and the essential fatty acids occurrence were also discussed in the light of physiological adaptations and feeding habits of organisms; the relationships with contaminant bioaccumulation were also assessed. To the best of our knowledge, this is the first report of fatty acid composition and fingerprint in a Ross Sea trophic web and their correlation with contaminant concentration. Copyright © 2017 Elsevier Ltd. All rights reserved.

Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver-stage development.

PubMed

Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M

2014-02-01

Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.

Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

PubMed

Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

2012-03-27

In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society

Protein source in a high-protein diet modulates reductions in insulin resistance and hepatic steatosis in fa/fa Zucker rats.

PubMed

Wojcik, Jennifer L; Devassy, Jessay G; Wu, Yinghong; Zahradka, Peter; Taylor, Carla G; Aukema, Harold M

2016-01-01

High-protein diets are being promoted to reduce insulin resistance and hepatic steatosis in metabolic syndrome. Therefore, the effect of protein source in high-protein diets on reducing insulin resistance and hepatic steatosis was examined. Fa/fa Zucker rats were provided normal-protein (15% of energy) casein, high-protein (35% of energy) casein, high-protein soy, or high-protein mixed diets with animal and plant proteins. The high-protein mixed diet reduced area under the curve for insulin during glucose tolerance testing, fasting serum insulin and free fatty acid concentrations, homeostatic model assessment index, insulin to glucose ratio, and pancreatic islet cell area. The high-protein mixed and the high-protein soy diets reduced hepatic lipid concentrations, liver to body weight ratio, and hepatic steatosis rating. These improvements were observed despite no differences in body weight, feed intake, or adiposity among high-protein diet groups. The high-protein casein diet had minimal benefits. A high-protein mixed diet was the most effective for modulating reductions in insulin resistance and hepatic steatosis independent of weight loss, indicating that the source of protein within a high-protein diet is critical for the management of these metabolic syndrome parameters. © 2015 The Obesity Society.

Synthesis of new Cα-tetrasubstituted α-amino acids

PubMed Central

Grauer, Andreas A

2009-01-01

Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341

A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

ERIC Educational Resources Information Center

Barrelle, M.; And Others

1983-01-01

Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water

NASA Technical Reports Server (NTRS)

Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.

2017-01-01

Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing

Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

PubMed Central

Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

2015-01-01

Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

Synthesis of novel acid electrolytes for phosphoric acid fuel cells

NASA Astrophysics Data System (ADS)

Adcock, James L.

1988-11-01

A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis

PubMed Central

Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.

2018-01-01

It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492

Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis.

PubMed

Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan

2018-01-01

It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.

Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Chander, A.; Gullo, J.; Reicherter, J.

1987-05-01

Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less

Generation and esterification of electrophilic fatty acid nitroalkenes in triacylglycerides

PubMed Central

Fazzari, Marco; Khoo, Nicholas; Woodcock, Steven R.; Li, Lihua; Freeman, Bruce A.; Schopfer, Francisco J.

2015-01-01

Electrophilic fatty acid nitroalkenes (NO2-FA) are products of nitric oxide and nitrite-mediated unsaturated fatty acid nitration. These electrophilic products induce pleiotropic signaling actions that modulate metabolic and inflammatory responses in cell and animal models. The metabolism of NO2-FA includes reduction of the vinyl nitro moiety by prostaglandin reductase-1, mitochondrial β–oxidation and Michael addition with low molecular weight nucleophilic amino acids. Complex lipid reactions of fatty acid nitroalkenes are not well defined. Herein we report the detection and characterization of NO2-FA-containing triacylglycerides (NO2-FA-TAG) via mass spectrometry-based methods. In this regard, unsaturated fatty acids of dietary triacylglycerides are targets for nitration reactions during gastric acidification, where NO2-FA-TAG can be detected in rat plasma after oral administration of nitro-oleic acid (NO2-OA). Furthermore, the characterization and profiling of these species, including the generation of beta oxidation and dehydrogenation products, could be detected in NO2-OA supplemented adipocytes. These data revealed that NO2-FA-TAG, formed by either the direct nitration of esterified unsaturated fatty acids or the incorporation of nitrated free fatty acids into triacylglycerides, contribute to the systemic distribution of these reactive electrophilic mediators and may serve as a depot for subsequent mobilization by lipases to in turn impact adipocyte homeostasis and tissue signaling events. PMID:26066303

Synthesis and antituberculosis activity of new fatty acid amides.

PubMed

D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

2010-09-01

This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.

Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.

PubMed

Evans, R M; Scholz, R W

1977-04-01

Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.

Serum bile acid level and fatty acid composition in Chinese children with non-alcoholic fatty liver disease.

PubMed

Lu, Li Ping; Wan, Yan Ping; Xun, Peng Cheng; Zhou, Ke Jun; Chen, Cheng; Cheng, Si Yang; Zhang, Min Zhong; Wu, Chun Hua; Lin, Wei Wei; Jiang, Ying; Feng, Hai Xia; Wang, Jia Lu; He, Ka; Cai, Wei

2017-08-01

To determine serum bile acid (BA) and fatty acid (FA) profiles in Chinese children with non-alcoholic fatty liver disease (NAFLD). A total 76 children aged 4-17 years were categorized into three groups according to the presence and absence of as well as the severity of NAFLD, that is, non-NAFLD (control), mild and moderate to severe NAFLD groups, respectively, based on their liver ultrasonography findings. Serum BA and FA profiles were quantified separately by mass spectrometry and gas chromatography. General linear models were performed to assess the differences among the groups. After adjusted for potential confounders, children with NAFLD had higher levels of chenodeoxycholic acid (CDCA), unconjugated primary BAs (CDCA + cholic acid) but lower levels of deoxycholic acid (DCA), taurodeoxycholic acid (TDCA), glycodeoxycholic acid (GDCA), total DCA (DCA + TDCA + GDCA), glycolithocholic acid (GLCA) and total lithocholic acid (GLCA + taurolithocholic acid) than children without NAFLD. As for FAs, children with mild and moderate to severe NAFLD had higher levels of n-7 monounsaturated FA. Circulating BA and FA profiles may change in children with NAFLD. Further studies are needed to determine their associations and to understand the underlying mechanism of action. © 2017 Chinese Medical Association Shanghai Branch, Chinese Society of Gastroenterology, Renji Hospital Affiliated to Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

Comparison between conjugated linoleic acid and essential fatty acids in preventing oxidative stress in bovine mammary epithelial cells.

PubMed

Basiricò, L; Morera, P; Dipasquale, D; Tröscher, A; Bernabucci, U

2017-03-01

Some in vitro and in vivo studies have demonstrated protective effects of conjugated linoleic acid (CLA) isomers against oxidative stress and lipid peroxidation. However, only a few and conflicting studies have been conducted showing the antioxidant potential of essential fatty acids. The objectives of the study were to compare the effects of CLA to other essential fatty acids on the thiol redox status of bovine mammary epithelia cells (BME-UV1) and their protective role against oxidative damage on the mammary gland by an in vitro study. The BME-UV1 cells were treated with complete medium containing 50 μM of cis-9,trans-11 CLA, trans-10,cis-12 CLA, α-linolenic acid, γ-linolenic acid, and linoleic acid. To assess the cellular antioxidant response, glutathione, NADPH, and γ-glutamyl-cysteine ligase activity were measured 48 h after addition of fatty acids (FA). Intracellular reactive oxygen species and malondialdehyde production were also assessed in cells supplemented with FA. Reactive oxygen species production after 3 h of H 2 O 2 exposure was assessed to evaluate and to compare the potential protection of different FA against H 2 O 2 -induced oxidative stress. All FA treatments induced an intracellular GSH increase, matched by high concentrations of NADPH and an increase of γ-glutamyl-cysteine ligase activity. Cells supplemented with FA showed a reduction in intracellular malondialdehyde levels. In particular, CLA isomers and linoleic acid supplementation showed a better antioxidant cellular response against oxidative damage induced by H 2 O 2 compared with other FA. The Authors. Published by the Federation of Animal Science Societies and Elsevier Inc. on behalf of the American Dairy Science Association®. This is an open access article under the CC BY-NC-ND license (http://creativecommons.org/licenses/by-nc-nd/3.0/).

Synthesis of the sulfur amino acids: cysteine and methionine.

PubMed

Wirtz, Markus; Droux, Michel

2005-12-01

This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.

Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

PubMed Central

Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

2009-01-01

In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

Recoveries of rat lymph FA after administration of specific structured 13C-TAG.

PubMed

Vistisen, Bodil; Mu, Huiling; Høy, Carl-Erik

2003-09-01

The potential of the specific structured TAG MLM [where M = caprylic acid (8:0) and L = linoleic acid (18:2n-6)] is the simultaneous delivery of energy and EFA. Compared with long-chain TAG (LLL), they may be more rapidly hydrolyzed and absorbed. This study examined the lymphatic recoveries of intragastrically administered L*L*L*, M*M*M*, ML*M, and ML*L* (where * = 13C-labeled FA) in rats. Lymph lipids were separated into lipid classes and analyzed by GC combustion isotope ratio MS. The recoveries of lymph TAG 18:2n-6 8 h after administration of L*L*L*, ML*M, and ML*L* were 38.6, 48.4, and 49.1%, respectively, whereas after 24 h the recoveries were approximately 50% in all experimental groups. The exogenous contribution to lymph TAG 18:2n-6 was approximately 80 and 60% at maximum absorption of the specific structured TAG and L*L*L*, respectively, 3-6 h after administration. The tendency toward more rapid recovery of exogenous long-chain FA following administration of specific structured TAG compared with long-chain TAG was probably due to fast hydrolysis. The lymphatic recovery of 8:0 was 2.2% 24 h after administration of M*M*M*. This minor lymphatic recovery of exogenous 8:0 was probably due to low stimulation of chylomicron formation. These results demonstrate tendencies toward faster lymphatic recovery of long-chain FA after administration of specific structured TAG compared with long-chain TAG.

Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

PubMed

Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

2016-01-15

Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

PubMed

Hansen, Alexandar L; Behrman, Edward J

2016-08-05

We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.

Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

PubMed

Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

2016-08-29

α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.

Synthesis and characterization of 3-ketohexadecanoic acid-1-14-C, DL-3-hydroxyhexadecanoic acid-1-14-C, and trans-2-hexadecenoic acid-1-14-C.

PubMed

Jones, J A; Blecher, M

1966-05-01

The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.

Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

PubMed Central

Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian

2015-01-01

SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

PubMed

Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

2016-09-01

Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions

NASA Astrophysics Data System (ADS)

Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.

1980-09-01

Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.

FAAP20: a novel ubiquitin-binding FA nuclear core-complex protein required for functional integrity of the FA-BRCA DNA repair pathway

PubMed Central

Ali, Abdullah Mahmood; Pradhan, Arun; Singh, Thiyam Ramsingh; Du, Changhu; Li, Jie; Wahengbam, Kebola; Grassman, Elke; Auerbach, Arleen D.; Pang, Qishen

2012-01-01

Fanconi anemia (FA) nuclear core complex is a multiprotein complex required for the functional integrity of the FA-BRCA pathway regulating DNA repair. This pathway is inactivated in FA, a devastating genetic disease, which leads to hematologic defects and cancer in patients. Here we report the isolation and characterization of a novel 20-kDa FANCA-associated protein (FAAP20). We show that FAAP20 is an integral component of the FA nuclear core complex. We identify a region on FANCA that physically interacts with FAAP20, and show that FANCA regulates stability of this protein. FAAP20 contains a conserved ubiquitin-binding zinc-finger domain (UBZ), and binds K-63–linked ubiquitin chains in vitro. The FAAP20-UBZ domain is not required for interaction with FANCA, but is required for DNA-damage–induced chromatin loading of FANCA and the functional integrity of the FA pathway. These findings reveal critical roles for FAAP20 in the FA-BRCA pathway of DNA damage repair and genome maintenance. PMID:22343915

Xenograft Studies of Fatty Acid Synthesis Inhibition as Novel Therapy for Breast Cancer

DTIC Science & Technology

2000-08-01

stimulating substances produced in the brain. The reduction in NPY is blocked by inhibition of acetyl-CoA carboxylase by TOFA , indicating that malonyl-CoA...mediated 5-(tetradecyloxy)-2-furoic acid ( TOFA ) was not cytotoxic to breast cancer the cytotoxic effects of cerulenin and C75, then any other FA syn...intracellular malonyl-CoA to several fold above control levels, whereas test this idea, we compared the effects on cancer cells of inhibition of TOFA reduced

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

PubMed Central

Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.

2008-01-01

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537

Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.

PubMed

Galardon, Erwan; Lec, Jean-Chrstophe

2018-05-20

A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Folic Acid-Conjugated Pyropheophorbide a as the Photosensitizer Tested for In Vivo Targeted Photodynamic Therapy.

PubMed

Wang, Jin; Liu, Qian; Zhang, Yuting; Shi, Huan; Liu, Hui; Guo, Wenjun; Ma, Yanhong; Huang, Weiqiang; Hong, Zhangyong

2017-06-01

Photodynamic therapy (PDT) is a highly localized and minimally invasive cancer treatment modality with many important advantages, but the lack of ideal photosensitizers (PSs) greatly restricts its clinical utility. To develop new PSs with highly efficient singlet oxygen production and high tumor-localizing ability to reduce damage to healthy adjacent tissues, we conjugated folic acid (FA) with pyropheophorbide a (Pyro), a potent PS with a very high singlet oxygen quantum yield and a high extinction coefficient. In the present work, we describe the synthesis and PDT evaluation of this FA-Pyro conjugate both in vitro and in vivo. This conjugation increased the accumulation of Pyro inside the tumors and improved the efficiency of PDT, resulting in eradication of subcutaneous xenograft KB (human mouth epidermal carcinoma) tumors after only 1 or 2 applications of external near infrared light irradiation. This outstanding PDT outcome in a tumor-bearing mouse model and the simple synthesis of the conjugate should have very good practical potential for clinical application. Copyright © 2017 American Pharmacists Association®. Published by Elsevier Inc. All rights reserved.

Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.

PubMed

Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D

1980-06-01

The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.

Synthesis of medium-chain fatty acids and their incorporation into triacylglycerols by cell-free fractions from Cuphea embryos.

PubMed

Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P

1990-02-01

During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.

Hepatic secretion of VLDL fatty acids during stimulated lipogenesis in men.

PubMed

Aarsland, A; Wolfe, R R

1998-06-01

Fatty acids (FA) that are utilized for triglyceride (TG) synthesis in the liver and principally from two sources: FA synthesized de novo in the liver and preformed FA. We have measured the contribution from the two sources to very low density lipoprotein (VLDL) TG synthesis individually for palmitate, oleate, stearate, and linoleate (approximately 98% of the total FA of VLDL TG (VLDL TGFA)) by isotopomer analysis. Five healthy men were studied in the basal state, and 1 (day 1) and 4 days (day 4) after the start of a hypercaloric carbohydrate-enriched diet (approximately 2.5 times energy expenditure). The secretion of de novo palmitate was increased 15- and 43-fold after 1 and 4 days of hyperalimentation (2.6+/-1.2 (basal state), 40.8+/-20.0 (day 1), and 113.3+/-42.0 micromol/kg per d (day 4)). Even though 4 days of hyperalimentation increased the secretion of de novo stearate 43-fold and de novo oleate 70-fold (stearate; 0.2+/-0.2 (basal), 8.6+/-3.3 micromol/kg per d (day 4), oleate; 0.4+/-0.4 (basal), 28.2+/-12.7 micromol/kg per d (day 4)), palmitate accounted for 75-85% of all the de novo VLDL TGFA. One day of carbohydrate hyperalimentation tended to decrease the secretion while 4 days increased the secretion of all preformed FA in VLDL TG. The rate of secretion of preformed palmitate and oleate were almost identical (palmitate; 80.2+/-22.2 (basal), 45.1+/-23.8 (day 1), and 256.2+/-74.1 micromol/kg per d (day 4), oleate; 95.2+/-22.8 (basal), 46.2+/-24.2 (day 1), and 356.8+/-74.1 micromol/kg per d (day 4)) and collectively these two FA accounted for 80-90% of the secretion from the preformed source. Palmitate is the predominant product of acute and prolonged carbohydrate mediated lipogenesis in the human liver. The pathway of further elongation and subsequent desaturation of de novo synthesized palmitate to generate stearate and oleate is inducible but, quantitatively, of minor significance in hepatic lipogenesis.

Role of Fatty Acid Kinase in Cellular Lipid Homeostasis and SaeRS-Dependent Virulence Factor Expression in Staphylococcus aureus.

PubMed

Ericson, Megan E; Subramanian, Chitra; Frank, Matthew W; Rock, Charles O

2017-08-01

The SaeRS two-component system is a master activator of virulence factor transcription in Staphylococcus aureus , but the cellular factors that control its activity are unknown. Fatty acid (FA) kinase is a two-component enzyme system required for extracellular FA uptake and SaeRS activity. Here, we demonstrate the existence of an intracellular nonesterified FA pool in S. aureus that is elevated in strains lacking FA kinase activity. SaeRS-mediated transcription is restored in FA kinase-negative strains when the intracellular FA pool is reduced either by growth with FA-depleted bovine serum albumin to extract the FA into the medium or by the heterologous expression of Neisseria gonorrhoeae acyl-acyl carrier protein synthetase to activate FA for phospholipid synthesis. These data show that FAs act as negative regulators of SaeRS signaling, and FA kinase activates SaeRS-dependent virulence factor production by lowering inhibitory FA levels. Thus, FA kinase plays a role in cellular lipid homeostasis by activating FA for incorporation into phospholipid, and it indirectly regulates SaeRS signaling by maintaining a low intracellular FA pool. IMPORTANCE The SaeRS two-component system is a master transcriptional activator of virulence factor production in response to the host environment in S. aureus , and strains lacking FA kinase have severely attenuated SaeRS-dependent virulence factor transcription. FA kinase is required for the activation of exogenous FAs, and it plays a role in cellular lipid homeostasis by recycling cellular FAs into the phospholipid biosynthetic pathway. Activation of the sensor kinase, SaeS, is mediated by its membrane anchor domain, and the FAs which accumulate in FA kinase knockout strains are potent inhibitors of SaeS-dependent signaling. This work identifies FAs as physiological effectors for the SaeRS system and reveals a connection between cellular lipid homeostasis and the regulation of virulence factor transcription. FA kinase is widely

pH-sensitive Au–BSA–DOX–FA nanocomposites for combined CT imaging and targeted drug delivery

PubMed Central

Huang, He; Yang, Da-Peng; Liu, Minghuan; Wang, Xiangsheng; Zhang, Zhiyong; Zhou, Guangdong; Liu, Wei; Cao, Yilin; Zhang, Wen Jie; Wang, Xiansong

2017-01-01

Albumin-based nanoparticles (NPs) as a drug delivery system have attracted much attention owing to their nontoxicity, non-immunogenicity, great stability and ability to bind to many therapeutic drugs. Herein, bovine serum albumin (BSA) was utilized as a template to prepare Au–BSA core/shell NPs. The outer layer BSA was subsequently conjugated with cis-aconityl doxorubicin (DOX) and folic acid (FA) to create Au–BSA–DOX–FA nanocomposites. A list of characterizations was undertaken to identify the successful conjugation of drug molecules and targeted agents. In vitro cytotoxicity using a cell counting kit-8 (CCK-8) assay indicated that Au–BSA NPs did not display obvious cytotoxicity to MGC-803 and GES-1 cells in the concentration range of 0–100 μg/mL, which can therefore be used as a safe drug delivery carrier. Furthermore, compared with free DOX, Au–BSA–DOX–FA nanocomposites exhibited a pH-sensitive drug release ability and superior antitumor activity in a drug concentration-dependent manner. In vivo computed tomography (CT) imaging experiments showed that Au–BSA–DOX–FA nanocomposites could be used as an efficient and durable CT contrast agent for targeted CT imaging of the folate receptor (FR) overexpressed in cancer tissues. In vivo antitumor experiments demonstrated that Au–BSA–DOX–FA nanocomposites have selective antitumor activity effects on FR-overexpressing tumors and no adverse effects on normal tissues and organs. In conclusion, the Au–BSA–DOX–FA nanocomposite exhibits selective targeting activity, X-ray attenuation activity and pH-sensitive drug release activity. Therefore, it can enhance CT imaging and improve the targeting therapeutic efficacy of FR-overexpressing gastric cancers. Our findings suggest that Au–BSA–DOX–FA nanocomposite is a novel drug delivery carrier and a promising candidate for cancer theranostic applications. PMID:28435261

Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

PubMed

Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

2012-05-18

A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

Probiotic administration modifies the milk fatty acid profile, intestinal morphology, and intestinal fatty acid profile of goats.

PubMed

Apás, A L; Arena, M E; Colombo, S; González, S N

2015-01-01

The effect of a mixture of potentially probiotic bacteria (MPPB; Lactobacillus reuteri DDL 19, Lactobacillus alimentarius DDL 48, Enterococcus faecium DDE 39, and Bifidobacterium bifidum strains) on the milk fatty acid (FA) profile, with emphasis on cis-9,trans-11 conjugated linoleic acid (CLA) in the middle stage of goat lactation, was determined. In addition, the effects of MPPB feeding on the FA profile in intestinal content and intestinal morphology in weaned goats were analyzed. The probiotic supplement was able to modify FA composition of milk and intestinal content. The unsaturated FA concentrations in milk (g of FA/L of milk) increased from 4.49 to 7.86 for oleic (18:1), from 0.70 to 1.39 for linoleic (18:2), from 0.063 to 0.187 for linolenic (18:3) acid, and from 0.093 to 0.232 for CLA. The atherogenicity index diminished 2-fold after MPPB ingestion. In the intestinal content of the weaned goats, no significant difference in saturated FA concentration compared with the control was observed. However, oleic acid, linolenic acid, CLA, and docosahexaenoic acid concentrations increased by 81, 23, 344, and 74%, respectively, after probiotic consumption. The ruminal production of CLA was increased by the MPPB. However, bacterial strains of MPPB were unable to produce CLA in culture media. By histological techniques, it was observed that the treated group had intestinally more conserved morphological structures than the control group. The results obtained in this study indicate that the MPPB administration in lactating and weaned goats allows for the production of milk with improved concentrations of beneficial compounds, and also produces a protective effect in the goat intestine. The results obtained in this study reinforce the strategy of probiotics application to enhance goat health with the production of milk with higher concentrations of polyunsaturated FA. Copyright © 2015 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Synthesis of customized petroleum-replica fuel molecules by targeted modification of free fatty acid pools in Escherichia coli

PubMed Central

Howard, Thomas P.; Middelhaufe, Sabine; Moore, Karen; Edner, Christoph; Kolak, Dagmara M.; Taylor, George N.; Parker, David A.; Lee, Rob; Smirnoff, Nicholas; Aves, Stephen J.; Love, John

2013-01-01

Biofuels are the most immediate, practical solution for mitigating dependence on fossil hydrocarbons, but current biofuels (alcohols and biodiesels) require significant downstream processing and are not fully compatible with modern, mass-market internal combustion engines. Rather, the ideal biofuels are structurally and chemically identical to the fossil fuels they seek to replace (i.e., aliphatic n- and iso-alkanes and -alkenes of various chain lengths). Here we report on production of such petroleum-replica hydrocarbons in Escherichia coli. The activity of the fatty acid (FA) reductase complex from Photorhabdus luminescens was coupled with aldehyde decarbonylase from Nostoc punctiforme to use free FAs as substrates for alkane biosynthesis. This combination of genes enabled rational alterations to hydrocarbon chain length (Cn) and the production of branched alkanes through upstream genetic and exogenous manipulations of the FA pool. Genetic components for targeted manipulation of the FA pool included expression of a thioesterase from Cinnamomum camphora (camphor) to alter alkane Cn and expression of the branched-chain α-keto acid dehydrogenase complex and β-keto acyl-acyl carrier protein synthase III from Bacillus subtilis to synthesize branched (iso-) alkanes. Rather than simply reconstituting existing metabolic routes to alkane production found in nature, these results demonstrate the ability to design and implement artificial molecular pathways for the production of renewable, industrially relevant fuel molecules. PMID:23610415

Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid

PubMed Central

Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.

2017-01-01

mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357

Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.

PubMed

Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A

2017-04-14

mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Synthesis and characterization of bis-thiourea having amino acid derivatives

NASA Astrophysics Data System (ADS)

Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

2016-11-01

In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

From N-triisopropylsilylpyrrole to an optically active C-4 substituted pyroglutamic acid: total synthesis of penmacric acid.

PubMed

Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël

2009-11-07

The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.

[Determination of ferulic acid absorbed into human serum from oral decoction of rhizoma chuanxiong and pharmacokinetic study of ferulic acid].

PubMed

Sun, S; Huang, X; Zhang, L; Ren, P; Chang, Z

2001-10-01

To improve the HPLC method for determining ferulic acid(FA) in the human serum and to research FA clinical pharmacokinetics. Serum concentrations of FA were determined by HPLC using methanol-water-acetic acid (40:59.7:0.3, v/v) as the mobile phase and the column packed with ODS (150 mm x 4.6 mm, 5 microns) as a fixed phase and the flow rate was 1.0 ml/min. FA was detected at 320 nm wave length. The internal standard was coumarin. The serum samples were treated by the water-boiling method. Peak of FA in serum was recognized by photodiode-array detection. FA and internal standard were separated completely under the condition described as above. FA was linear in the range of (40.16-8032 ng/ml) (r = 0.9975). The CV was less than 10%, the average recovery was 100.3%, and the limit concentration in serum was 25.1 ng/ml. PK was in accordance with open bicameral model. This method can be applied to clinical pharmacokinetic study of FA.

Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

USDA-ARS?s Scientific Manuscript database

The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

Chemoselective synthesis of sialic acid 1,7-lactones.

PubMed

Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario

2010-08-20

The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.

Automated synthesis of N-(2-[18 F]Fluoropropionyl)-l-glutamic acid as an amino acid tracer for tumor imaging on a modified [18 F]FDG synthesis module.

PubMed

Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua

2017-06-15

N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.

Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.

PubMed

Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E

2017-08-21

Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Mutation for nonsyndromic mental retardation in the trans-2-enoyl-CoA reductase TER gene involved in fatty acid elongation impairs the enzyme activity and stability, leading to change in sphingolipid profile.

PubMed

Abe, Kensuke; Ohno, Yusuke; Sassa, Takayuki; Taguchi, Ryo; Çalışkan, Minal; Ober, Carole; Kihara, Akio

2013-12-20

Very long-chain fatty acids (VLCFAs, chain length >C20) exist in tissues throughout the body and are synthesized by repetition of the fatty acid (FA) elongation cycle composed of four successive enzymatic reactions. In mammals, the TER gene is the only gene encoding trans-2-enoyl-CoA reductase, which catalyzes the fourth reaction in the FA elongation cycle. The TER P182L mutation is the pathogenic mutation for nonsyndromic mental retardation. This mutation substitutes a leucine for a proline residue at amino acid 182 in the TER enzyme. Currently, the mechanism by which the TER P182L mutation causes nonsyndromic mental retardation is unknown. To understand the effect of this mutation on the TER enzyme and VLCFA synthesis, we have biochemically characterized the TER P182L mutant enzyme using yeast and mammalian cells transfected with the TER P182L mutant gene and analyzed the FA elongation cycle in the B-lymphoblastoid cell line with the homozygous TER P182L mutation (TER(P182L/P182L) B-lymphoblastoid cell line). We have found that TER P182L mutant enzyme exhibits reduced trans-2-enoyl-CoA reductase activity and protein stability, thereby impairing VLCFA synthesis and, in turn, altering the sphingolipid profile (i.e. decreased level of C24 sphingomyelin and C24 ceramide) in the TER(P182L/P182L) B-lymphoblastoid cell line. We have also found that in addition to the TER enzyme-catalyzed fourth reaction, the third reaction in the FA elongation cycle is affected by the TER P182L mutation. These findings provide new insight into the biochemical defects associated with this genetic mutation.

Interactions between stepwise-eluted sub-fractions of fulvic acids and protons revealed by fluorescence titration combined with EEM-PARAFAC.

PubMed

Song, Fanhao; Wu, Fengchang; Guo, Fei; Wang, Hao; Feng, Weiying; Zhou, Min; Deng, Yanghui; Bai, Yingchen; Xing, Baoshan; Giesy, John P

2017-12-15

In aquatic environments, pH can control environmental behaviors of fulvic acid (FA) via regulating hydrolysis of functional groups. Sub-fractions of FA, eluted using pyrophosphate buffers with initial pHs of 3.0 (FA 3 ), 5.0 (FA 5 ), 7.0 (FA 7 ), 9.0 (FA 9 ) and 13.0 (FA 13 ), were used to explore interactions between the various, operationally defined, FA fractions and protons, by use of EEM-PARAFAC analysis. Splitting of peaks (FA 3 and FA 13 ), merging of peaks (FA 7 ), disappearance of peaks (FA 9 and FA 13 ), and red/blue-shifting of peaks were observed during fluorescence titration. Fulvic-like components were identified from FA 3 -FA 13 , and protein-like components were observed in fractions FA 9 and FA 13 . There primary compounds (carboxylic-like, phenolic-like, and protein-like chromophores) in PARAFAC components were distinguished based on acid-base properties. Dissociation constants (pK a ) for fulvic-like components with proton ranged from 2.43 to 4.13 in an acidic pH and from 9.95 to 11.27 at basic pH. These results might be due to protonation of di-carboxylate and phenolic functional groups. At basic pH, pK a values of protein-like components (9.77-10.13) were similar to those of amino acids. However, at acidic pH, pK a values of protein-like components, which ranged from 3.33 to 4.22, were 1-2units greater than those of amino acids. Results presented here, will benefit understanding of environmental behaviors of FA, as well as interactions of FA with environmental contaminants. Copyright © 2017 Elsevier B.V. All rights reserved.

Effect of unsaturated fatty acids and triglycerides from soybeans on milk fat synthesis and biohydrogenation intermediates in dairy cattle.

PubMed

Boerman, J P; Lock, A L

2014-11-01

Increased rumen unsaturated fatty acid (FA) load is a risk factor for milk fat depression. This study evaluated if increasing the amount of unsaturated FA in the diet as triglycerides or free FA affected feed intake, yield of milk and milk components, and feed efficiency. Eighteen Holstein cows (132 ± 75 d in milk) were used in a replicated 3 × 3 Latin square design. Treatments were a control (CON) diet, or 1 of 2 unsaturated FA (UFA) treatments supplemented with either soybean oil (FA present as triglycerides; TAG treatment) or soybean FA distillate (FA present as free FA; FFA treatment). The soybean oil contained a higher concentration of cis-9 C18:1 (26.0 vs. 11.8 g/100g of FA) and lower concentrations of C16:0 (9.6 vs. 15.0 g/100g of FA) and cis-9,cis-12 C18:2 (50.5 vs. 59.1g/100g of FA) than the soybean FA distillate. The soybean oil and soybean FA distillate were included in the diet at 2% dry matter (DM) to replace soyhulls in the CON diet. Treatment periods were 21 d, with the final 4 d used for sample and data collection. The corn silage- and alfalfa silage-based diets contained 23% forage neutral detergent fiber and 17% crude protein. Total dietary FA were 2.6, 4.2, and 4.3% of diet DM for CON, FFA, and TAG treatments, respectively. Total FA intake was increased 57% for UFA treatments and was similar between FFA and TAG. The intakes of individual FA were similar, with the exception of a 24 g/d lower intake of C16:0 and a 64 g/d greater intake of cis-9 C18:1 for the TAG compared with the FFA treatment. Compared with CON, the UFA treatments decreased DM intake (1.0 kg/d) but increased milk yield (2.2 kg/d) and milk lactose concentration and yield. The UFA treatments reduced milk fat concentration, averaging 3.30, 3.18, and 3.11% for CON, FFA, and TAG treatments, respectively. Yield of milk fat, milk protein, and 3.5% fat-corrected milk remained unchanged when comparing CON with the UFA treatments. No differences existed in the yield of milk or milk

Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

PubMed Central

Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

2015-01-01

To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

NASA Technical Reports Server (NTRS)

Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

2011-01-01

Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

FANCM-FAAP24 and FANCJ: FA proteins that metabolize DNA

PubMed Central

Ali, Abdullah Mahmood; Singh, Thiyam Ramsing; Meetei, Amom Ruhikanta

2009-01-01

Fanconi anemia (FA) is a rare autosomal recessive or X-linked disorder characterized by aplastic anemia, cancer susceptibility and cellular sensitivity to DNA crosslinking agents. Eight FA proteins (FANCA, -B, -C, -E, -F, -G, -L and –M) and three non-FA proteins (FAAP100, FAAP24 and HES1) form the FA nuclear core complex that is required for monoubiquitination of the FANCD2-FANCI dimer upon DNA damage. The other three FA proteins, FANCD1/BRCA2, FANCJ/BACH1/BRIP1 and FANCN/PALB2, act in parallel or downstream of the FANCD2-FANCI dimer. Despite the isolation and characterization of several FA proteins, the mechanism by which these proteins protect cells from DNA interstrand crosslinking agents has been unclear. This is because a majority of the FA proteins lack any recognizable functional domains that can provide insight into their function. The recently discovered FANCM (Hef) and FANCJ (BRIP1/BACH1) proteins contain helicase domains, providing potential insight into the role of FA proteins in DNA repair. FANCM with its partner, FAAP24, and FANCJ bind and metabolize a variety of DNA substrates. In this review, we focus on the discovery, structure, and function of the FANCM-FAAP24 and FANCJ proteins. PMID:19379763

Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

NASA Astrophysics Data System (ADS)

Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

2014-03-01

MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lake, April D.; Novak, Petr; Shipkova, Petia

2013-04-15

Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile

Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

PubMed Central

Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

2016-01-01

Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

Transfer of omega-3 fatty acids across the blood-brain barrier after dietary supplementation with a docosahexaenoic acid-rich omega-3 fatty acid preparation in patients with Alzheimer's disease: the OmegAD study.

PubMed

Freund Levi, Y; Vedin, I; Cederholm, T; Basun, H; Faxén Irving, G; Eriksdotter, M; Hjorth, E; Schultzberg, M; Vessby, B; Wahlund, L-O; Salem, N; Palmblad, J

2014-04-01

Little is known about the transfer of essential fatty acids (FAs) across the human blood-brain barrier (BBB) in adulthood. In this study, we investigated whether oral supplementation with omega-3 (n-3) FAs would change the FA profile of the cerebrospinal fluid (CSF). A total of 33 patients (18 receiving the n-3 FA supplement and 15 receiving placebo) were included in the study. These patients were participants in the double-blind, placebo-controlled randomized OmegAD study in which 204 patients with mild Alzheimer's disease (AD) received 2.3 g n-3 FA [high in docosahexaenoic acid (DHA)] or placebo daily for 6 months. CSF FA levels were related to changes in plasma FA and to CSF biomarkers of AD and inflammation. At 6 months, the n-3 FA supplement group displayed significant increases in CSF (and plasma) eicosapentaenoic acid (EPA), DHA and total n-3 FA levels (P < 0.01), whereas no changes were observed in the placebo group. Changes in CSF and plasma levels of EPA and n-3 docosapentaenoic acid were strongly correlated, in contrast to those of DHA. Changes in DHA levels in CSF were inversely correlated with CSF levels of total and phosphorylated tau, and directly correlated with soluble interleukin-1 receptor type II. Thus, the more DHA increased in CSF, the greater the change in CSF AD/inflammatory biomarkers. Oral supplementation with n-3 FAs conferred changes in the n-3 FA profile in CSF, suggesting transfer of these FAs across the BBB in adults. © 2013 The Association for the Publication of the Journal of Internal Medicine.

Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

PubMed Central

Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats

2014-01-01

Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.

PubMed

Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo

2017-01-01

Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.

Use of milk fatty acids to estimate plasma nonesterified fatty acid concentrations as an indicator of animal energy balance.

PubMed

Dórea, J R R; French, E A; Armentano, L E

2017-08-01

Negative energy balance is an important part of the lactation cycle, and measuring the current energy balance of a cow is useful in both applied and research settings. The objectives of this study were (1) to determine if milk fatty acid (FA) proportions were consistently related to plasma nonesterified fatty acids (NEFA); (2) to determine if an individual cow with a measured milk FA profile is above or below a NEFA concentration, (3) to test the universality of the models developed within the University of Wisconsin and US Dairy Forage Research Center cows. Blood samples were collected on the same day as milk sampling from 105 Holstein cows from 3 studies. Plasma NEFA was quantified and a threshold of 600 µEq/L was applied to classify animals above this concentration as having high NEFA (NEFA high ). Thirty milk FA proportions and 4 milk FA ratios were screened to evaluate their capacity to classify cows with NEFA high according to determined milk FA threshold. In addition, 6 linear regression models were created using individual milk FA proportions and ratios. To evaluate the universality of the linear relationship between milk FA and plasma NEFA found in the internal data set, 90 treatment means from 21 papers published in the literature were compiled to test the model predictions. From the 30 screened milk FA, the odd short-chain fatty acids (C7:0, C9:0, C11:0, and C13:0) had sensitivity slightly greater than the other short-chain fatty acids (83.3, 94.8, 80.0, and 85.9%, respectively). The sensitivities for milk FA C6:0, C8:0, C10:0, and C12:0 were 78.8, 85.3, 80.1, and 83.9%, respectively. The threshold values to detect NEFA high cows for the last group of milk FA were ≤2.0, ≤0.94, ≤1.4, and ≤1.8 g/100 g of FA, respectively. The milk FA C14:0 and C15:0 had sensitivities of 88.7 and 85.0% and a threshold of ≤6.8 and ≤0.53 g/100 g of FA, respectively. The linear regressions using the milk FA ratios C18:1 to C15:0 and C17:0 to C15:0 presented lower

Polymorphisms in lipogenic genes and milk fatty acid composition in Holstein dairy cattle.

PubMed

Nafikov, Rafael A; Schoonmaker, Jon P; Korn, Kathleen T; Noack, Kristin; Garrick, Dorian J; Koehler, Kenneth J; Minick-Bormann, Jennifer; Reecy, James M; Spurlock, Diane E; Beitz, Donald C

2014-12-01

Changing bovine milk fatty acid (FA) composition through selection can decrease saturated FA (SFA) consumption, improve human health and provide a means for manipulating processing properties of milk. Our study determined associations between milk FA composition and genes from triacylglycerol (TAG) biosynthesis pathway. The GC dinucleotide allele of diacylglycerol O-acyltransferase 1:g.10433-10434AA >GC was associated with lower palmitic acid (16:0) concentration but higher oleic (18:1 cis-9), linoleic (18:2 cis-9, cis-12) acid concentrations, and elongation index. Accordingly, the GC dinucleotide allele was associated with lower milk fat percentage and SFA concentrations but higher monounsaturated FA and polyunsaturated FA (PUFA) concentrations. The glycerol-3-phosphate acyltransferase, mitochondrial haplotypes were associated with higher myristoleic acid (14:1 cis-9) concentration and C14 desaturation index. The 1-acylglycerol-3-phosphate acyltransferase 1 haplotypes were associated with higher PUFA and linoleic acid concentrations. The results of this study provide information for developing genetic tools to modify milk FA composition in dairy cattle. Copyright © 2014 Elsevier Inc. All rights reserved.

Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

1989-04-01

We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less

Synthesis of Rosin Acid Starch Catalyzed by Lipase

PubMed Central

Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

2014-01-01

Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

Dietary unsaturated fatty acids differently affect catecholamine handling by adrenal chromaffin cells.

PubMed

Gomes, Andreia; Correia, Gustavo; Coelho, Marisa; Araújo, João Ricardo; Pinho, Maria João; Teixeira, Ana Luisa; Medeiros, Rui; Ribeiro, Laura

2015-05-01

Catecholamines (CA) play an important role in cardiovascular (CDV) disease risk. Namely, noradrenaline (NA) levels positively correlate whereas adrenaline (AD) levels negatively correlate with obesity and/or CDV disease. Western diets, which are tipically rich in Ω-6 fatty acids (FAs) and deficient in Ω-3 FAs, may contribute to the development of obesity, type 2 diabetes and/or coronary artery disease. Taking this into consideration and the fact that our group has already described that saturated FAs affect catecholamine handling by adrenal chromaffin cells, this work aimed to investigate the effect of unsaturated FAs upon catecholamine handling in the same model. Our results showed that chronic exposure to unsaturated FAs differently modulated CA cellular content and release, regardless of both FA series and number of carbon atoms. Namely, the Ω-6 arachidonic and linoleic acids, based on their effect on CA release and cellular content, seemed to impair NA and AD vesicular transport, whereas γ-linolenic acid selectively impaired AD synthesis and release. Within the Ω-9 FAs, oleic acid was devoid of effect, and elaidic acid behaved similarly to γ-linolenic acid. Eicosapentaenoic and docosahexaenoic acids (Ω-3 series) impaired the synthesis and release of both NA and AD. These results deserve attention and future development, namely, in what concerns the mechanisms involved and correlative effects in vivo. Copyright © 2015 Elsevier Inc. All rights reserved.

Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis

PubMed Central

Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki

2017-01-01

Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321

Synthesis and properties of fatty acid starch esters.

PubMed

Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik

2013-10-15

Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.

Identification of furan fatty acids in the lipids of common carp (Cyprinus carpio L.).

PubMed

Chvalová, Daniela; Špička, Jiří

2016-06-01

Fatty acid (FA) composition was analyzed in muscle and gonad tissues of marketed common carp (Cyprinus carpio). The extracted lipids were separated into four fractions: polar lipids (PL), diacylglycerols, free fatty acids and triacylglycerols (TAG) using thin layer chromatography. FA content within the lipid fractions was determined by gas chromatography with flame ionization detector (GC/FID). The muscle lipids consisted primarily of TAG (96.9% of total FA), while PL were the major component of both male (67.6%) and female gonad (58.6%) lipids. Polyunsaturated fatty acids predominated in PL of all tissues (52.2-55.8% of total FA); monounsaturated fatty acids were the most abundant FA group in TAG of muscle (51.8%) and female gonads (47.8%) whereas high proportion of furan fatty acids (F-acids) (38.2%) was detected in TAG of male gonads. Eight F-acids were identified by gas chromatography-mass spectrometry (GC/MS) in male gonad samples, including less common 12,15-epoxy-13,14-dimethylnonadeca-12,14-dienoic acid with even-numbered alkyl moiety. Copyright © 2016 Elsevier Ltd. All rights reserved.

Synthesis of a Novel Series of 2-Methylsulfanyl Fatty Acids and their Toxicity on the Human K-562 and U-937 Leukemia Cell Lines

PubMed Central

Carballeira, Néstor M.; Miranda, Carlos; Orellano, Elsie A.; González, Fernando A.

2006-01-01

The hitherto unknown 2-methylsulfanyldecanoic acid and 2-methylsulfanyldodecanoic acid were synthesized from methyl decanoate and methyl dodecanoate, respectively, through the reaction of lithium diisopropylamide and dimethyldisulfide in THF followed by saponification with potassium hydroxide in ethanol. Both α-methylsulfanylated FA were cytotoxic to the human chronic myelogenous leukemia K-562 and the human histiocytic lymphoma U-937 cell lines with EC50 values in the 200-300 μM range, which makes them more cytotoxic to these cell lines than either decanoic acid or dodecanoic acid. The cytotoxicity of the studied FA towards K-562 followed the order: 2-SCH3-12:0 > 2-SCH3-10:0 > 10:0 > 12:0 > 2-OCH3-12:0, while towards U-937 the cytotoxicity was found to be: 2-SCH3-10:0 > 2-SCH3-12:0 > 12:0 > 10:0 > 2-OCH3-12:0. These results indicate that the α-methylsulfanyl substitution increases the cytotoxicity of the C10 and C12 fatty acids towards the studied leukemia cell lines. PMID:16382579

Saturated fatty acids enhance TLR4 immune pathways in human trophoblasts.

PubMed

Yang, Xiaohua; Haghiac, Maricela; Glazebrook, Patricia; Minium, Judi; Catalano, Patrick M; Hauguel-de Mouzon, Sylvie

2015-09-01

What are the effects of fatty acids on placental inflammatory cytokine with respect to toll-like receptor-4/nuclear factor-kappa B (TLR4/NF-kB)? Exogenous fatty acids induce a pro-inflammatory cytokine response in human placental cells in vitro via activation of TLR4 signaling pathways. The placenta is exposed to changes in circulating maternal fatty acid concentrations throughout pregnancy. Fatty acids are master regulators of innate immune pathways through recruitment of toll-like receptors and activation of cytokine synthesis. Trophoblast cells isolated from 14 normal term human placentas were incubated with long chain fatty acids (FA) of different carbon length and degree of saturation. The expression and secretion of interleukin-6 (IL-6), IL-8 and tumor necrosis factor-alpha (TNF-α) were measured by reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay. Antibodies against TLR4 ligand binding domain, downstream signaling and anti-p65 NFkB-inhibitor were used to characterize the pathways of FA action. General approach used primary human term trophoblast cell culture. Methods and end-points used real-time quantitative PCR, cytokine measurements, immunohistochemistry, western blots. The long chain saturated fatty acids, stearic and palmitic (PA), stimulated the synthesis as well as the release of TNF-α, IL-6 and IL-8 by trophoblast cells (2- to 6-fold, P < 0.001). In contrast, the unsaturated (palmitoleic, oleic, linoleic) acids did not modify cytokine expression significantly. Palmitate-induced inflammatory effects were mediated via TLR4 activation, NF-kB phosphorylation and nuclear translocation. TNF-α protein level was close to the limit of detection in the culture medium even when cells were cultured with PA. These mechanisms open the way to a better understanding of how changes in maternal lipid homeostasis may regulate placental inflammatory status. X.Y. was recipient of fellowship award from West China Second University

Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

PubMed

Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

2017-04-01

Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

Metabolomics Reveals that Dietary Ferulic Acid and Quercetin Modulate Metabolic Homeostasis in Rats.

PubMed

Zhang, Limin; Dong, Manyuan; Guangyong Xu; Yuan Tian; Tang, Huiru; Wang, Yulan

2018-02-21

Phenolic compounds ingestion has been shown to have potential preventive and therapeutic effects against various metabolic diseases such as obesity and cancer. To provide a better understanding of these potential benefit effects, we investigated the metabolic alterations in urine and feces of rat ingested ferulic acid (FA) and quercetin (Qu) using NMR-based metabolomics approach. Our results suggested that dietary FA and/or Qu significantly decreased short chain fatty acids and elevated oligosaccharides in the feces, implying that dietary FA and Qu may modulate gut microbial community with inhibition of bacterial fermentation of dietary fibers. We also found that dietary FA and/or Qu regulated several host metabolic pathways including TCA cycle and energy metabolism, bile acid, amino acid, and nucleic acid metabolism. These biological effects suggest that FA and Qu display outstanding bioavailability and bioactivity and could be used for treatment of some metabolic syndromes, such as inflammatory bowel diseases and obesity.

The omega-3 fatty acid nutritional landscape: health benefits and sources.

PubMed

Deckelbaum, Richard J; Torrejon, Claudia

2012-03-01

Dietary fatty acids (FA) are increasingly recognized as major biologic regulators and have properties that relate to health outcomes and disease. The longer chain, more bioactive (n-6) (or omega-6) FA and (n-3) (or omega-3) FA share similar elongation and desaturation enzymes in their conversion from the essential (n-6) FA, linoleic acid, and (n-3) FA, α-linolenic acid (ALA). Conversion from these essential FA is very inefficient. However, now for the (n-3) FA series, soy oil can be enriched with (n-3) stearidonic acid (SDA) to allow for much more efficient conversion to longer chain EPA. EPA and the longer chain DHA possess distinct physical and biological properties that generally impart properties to cells and tissue, which underlie their ability to promote health and prevent disease. Although active in a number of areas of human biology, mechanisms of action of EPA and DHA are perhaps best defined in cardiovascular disease. There is concern that to reach the intake recommendations of EPA and DHA, their supply from cold water fish will be insufficient. Gaps in understanding mechanisms of action of (n-3) FA in a number of health and disease areas as well as optimal sources and intake levels for each need to be defined by further research. Because of the inefficient conversion of ALA, the appearance of SDA in enriched soy oil offers a biologically effective and cost effective approach to providing a sustainable plant source for (n-3) FA in the future.

Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

PubMed Central

Luzzati, Denise

1966-01-01

Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

Ferulic Acid, But Not All Hydroxycinnamic Acids, Is a Novel T3SS Inducer of Ralstonia solanacearum and Promotes Its Infection Process in Host Plants under Hydroponic Condition.

PubMed

Zhang, Yong; Li, Jing; Zhang, Weiqi; Wang, Rongsheng; Qiu, Qiaoqing; Luo, Feng; Hikichi, Yasufumi; Ohnishi, Kouhei; Ding, Wei

2017-01-01

Hydroxycinnamic acids (HCAs) are typical monocyclic phenylpropanoids, including cinnamic acid (Cin), coumaric acid (Cou), caffeic acid (Caf), ferulic acid (FA) and their isomers, and involved in the interactions between pathogens and host plants. Here, we focused on the impact of HCAs on expression of type III secretion system (T3SS) in Ralstonia solanacearum . FA significantly induced the expression of the T3SS and some type III effectors (T3Es) genes in hrp -inducing medium, while did not the other HCAs. However, exogenously supplemented FA did not affect the T3SS expression in planta and the elicitation of the hypersensitive response (HR) in tobacco leaves. Consistent with its central roles in pathogenicity, the FA-induced expression of the T3SS led to significant promotion on infection process of R. solanacearum in tomato plants under hydroponics cultivation. Moreover, the FA-induced expression of the T3SS was specifically mediated by the well-characterized signaling cascade PrhA-prhI/R-PrhJ-HrpG-HrpB, independent of the other known regulatory pathways. In summary, our results demonstrated that FA, a novel inducer of the T3SS in R. solanacearum , was able to promote its infection process in host plants under hydroponics condition.

One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.

PubMed

Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef

2018-04-01

Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

Catalytic synthesis of biologically important metabolites from formaldehyde and ammonia as a putative way of their prebiotic emergence

NASA Astrophysics Data System (ADS)

Delidovich, Irina; Taran, Oxana; Simonov, Alexander; Parmon, Valentin

The modern `RNA-world' theory considering the primary life as a system of self-replicating informational and catalytic oligomers is the most widespread hypothesis of life's origin. At the same time an alternative major theory antithetic to the genetic one exists. It is based on the primary formation of important metabolites and building blocks of biopolymers and appearance of the primordial autocatalytic cycles in geochemical environment. [1]. Encouraged by this theory, we suggest the putative emergence pathways to biologically relevant metabolites from simple precursors: formaldehyde (FA) and ammonia, which are known to be present in the interstellar space [2]. Based on our earlier [3, 4] and novel findings as well as on the literature data [5, 6] the scheme of conjugate autocatalytic processes including photochemical condensation of FA yielding C-C bond and catalytic formation of pyruvaldehyde, pyruvic acid, sugars, aminoacids catalyzed by minerals (aluminum silicate, phoshates) and by aminoacids themselves is proposed. Acetaldehyde, glyoxal, glycol-and glyceraldehydes (GA and GCA) were identified in this work as products of photolysis of FA aqueous solution with summary selectivity up to 20% and can serve as substrates for the synthesis of more complex organic compounds. In turn, alanine and pyruvic acid are formed during UV-irradiation of aqueous solution of acetaldehyde and ammonium nitrate [6]. Pyruvaldehyde formation from GCA and FA in presence of amino acids was observed by A. Weber [5]. Finally, we revealed the catalytic activity of zeolite HZSM-5-17 in acid form towards formation of pyruvaldehyde from GA and GCA in presence of alanine with the yield about 5%. This observation indicates that the assumption of catalytic activity of silica-alumina towards the synthesis of metabolites could be realistic. Prebiotic synthesis of sugars from lower monosacharides, as we showed earlier, could take place over phosphate catalysts [4]. The substrates and the products

Organic acids for control of Salmonella in different feed materials

PubMed Central

2013-01-01

Background Salmonella control in animal feed is important in order to protect animal and public health. Organic acids is one of the control measures used for treatment of Salmonella contaminated feed or feed ingredients. In the present study, the efficacy of formic acid (FA) and different blends of FA, propionic acid (PA) and sodium formate (SF) was investigated. Four Salmonella strains isolated from feed were assayed for their acid tolerance. Also, the effect of lower temperatures (5°C and 15°C) compared to room temperature was investigated in rape seed and soybean meal. Results The efficacy of acid treatments varied significantly between different feed materials. The strongest reduction was seen in pelleted and compound mash feed (2.5 log10 reduction) followed by rapeseed meal (1 log10 reduction) after 5 days exposure. However, in soybean meal the acid effects were limited (less than 0.5 log10 reduction) even after several weeks’ exposure. In all experiments the survival curves showed a concave shape, with a fast initial death phase followed by reduction at a slower rate during the remaining time of the experiment. No difference in Salmonella reduction was observed between FA and a blend of FA and PA, whereas a commercial blend of FA and SF (Amasil) was slightly more efficacious (0.5-1 log10 reduction) than a blend of FA and PA (Luprocid) in compound mash feed. The Salmonella Infantis strain was found to be the most acid tolerant strain followed by, S. Putten, S. Senftenberg and S. Typhimurium. The tolerance of the S. Infantis strain compared with the S. Typhimurium strain was statistically significant (p<0.05). The lethal effect of FA on the S. Typhimurium strain and the S. Infantis strain was lower at 5°C and 15°C compared to room temperatures. Conclusions Acid treatment of Salmonella in feed is a matter of reducing the number of viable bacterial cells rather than eliminating the organism. Recommendations on the use of acids for controlling Salmonella in

Organic acids for control of Salmonella in different feed materials.

PubMed

Koyuncu, Sevinc; Andersson, Mats Gunnar; Löfström, Charlotta; Skandamis, Panagiotis N; Gounadaki, Antonia; Zentek, Jürgen; Häggblom, Per

2013-04-18

Salmonella control in animal feed is important in order to protect animal and public health. Organic acids is one of the control measures used for treatment of Salmonella contaminated feed or feed ingredients. In the present study, the efficacy of formic acid (FA) and different blends of FA, propionic acid (PA) and sodium formate (SF) was investigated. Four Salmonella strains isolated from feed were assayed for their acid tolerance. Also, the effect of lower temperatures (5°C and 15°C) compared to room temperature was investigated in rape seed and soybean meal. The efficacy of acid treatments varied significantly between different feed materials. The strongest reduction was seen in pelleted and compound mash feed (2.5 log10 reduction) followed by rapeseed meal (1 log10 reduction) after 5 days exposure. However, in soybean meal the acid effects were limited (less than 0.5 log10 reduction) even after several weeks' exposure. In all experiments the survival curves showed a concave shape, with a fast initial death phase followed by reduction at a slower rate during the remaining time of the experiment.No difference in Salmonella reduction was observed between FA and a blend of FA and PA, whereas a commercial blend of FA and SF (Amasil) was slightly more efficacious (0.5-1 log10 reduction) than a blend of FA and PA (Luprocid) in compound mash feed. The Salmonella Infantis strain was found to be the most acid tolerant strain followed by, S. Putten, S. Senftenberg and S. Typhimurium. The tolerance of the S. Infantis strain compared with the S. Typhimurium strain was statistically significant (p<0.05). The lethal effect of FA on the S. Typhimurium strain and the S. Infantis strain was lower at 5°C and 15°C compared to room temperatures. Acid treatment of Salmonella in feed is a matter of reducing the number of viable bacterial cells rather than eliminating the organism. Recommendations on the use of acids for controlling Salmonella in feed should take into account the

Influence of stearic acid on hemostatic risk factors in humans.

PubMed

Tholstrup, Tine

2005-12-01

Stearic acid has been claimed to be prothrombotic. Elevated plasma factor VII coagulant activity (FVIIc) may raise the risk of coronary thrombosis in the event of plaque rupture. Fibrinogen, an acute-phase protein, is necessary for normal blood clotting; however, elevated levels of fibrinogen increase the risk of coronary heart disease (CHD). Here I report the results of three controlled, human dietary intervention studies, which used a randomized crossover design to investigate the hemostatic effects of stearic acid-rich test diets in healthy young men. A diet high in stearic acid (shea butter) resulted in a 13% lower fasting plasma FVIIc than a high palmitic acid diet, and was 18% lower than a diet high in myristic and lauric acids (P = 0.001) after 3 wk of intervention. The stearic acid-rich test fat increased plasma fibrinogen concentrations slightly compared with the myristic-lauric acid diet (P < 0.01). When investigating the acute effects of fatty meals, those high in stearic acid (synthesized test fat) resulted in a smaller postprandial increase in FVII than those high in trans and oleic FA, indicating a smaller increase in activated FVII after ingesting stearic acid compared with fats high in monounsaturated FA, probably caused by lower postprandial lipemia. Thus, the present investigations did not find dietary stearic acid to be more thrombogenic, in either fasting effects compared with other long-chain FA, or in acute effects compared with dietary unsaturated FA, including trans monounsaturated FA. The slightly increased effect on fasting plasma fibrinogen may be biologically insignificant, but it should be investigated further.

Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

USDA-ARS?s Scientific Manuscript database

Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,

DTIC Science & Technology

The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters

Metabolism of ferulic acid during growth of Lactobacillus plantarum and Lactobacillus collinoides.

PubMed

Knockaert, Dries; Raes, Katleen; Wille, Christophe; Struijs, Karin; Van Camp, John

2012-08-30

Food-isolated lactic acid bacteria can transform ferulic acid (FA) into several products. Since quantification of these metabolites during the different bacterial growth phases is lacking, the aim of this study was to identify and quantify conversion products of FA and to follow the kinetics of FA metabolism during growth of Lactobacillus plantarum and Lactobacillus collinoides. Lactobacillus plantarum and Lactobacillus collinoides were incubated in MRS broth, to which different amounts of FA were added (final concentrations of 0, 0.5, 1.5 and 3 mmol L⁻¹), at 30 °C until the late stationary phase. Lactobacillus plantarum metabolised FA into 4-vinylguaiacol (4-VG) and hydroferulic acid (HFA). Conversion to 4-VG started simultaneously with the degradation of FA, while formation of HFA started in the mid-exponential phase. Lactobacillus collinoides only formed 4-VG, mainly in the stationary phase. No significant effect of the different amounts of FA was seen on the growth and fermentation characteristics of both bacteria. The results demonstrate that both bacteria are able to convert FA. However, start of conversion differs between the two strains. The different amounts of FA had no influence on the growth and fermentation characteristics of both bacteria. Copyright © 2012 Society of Chemical Industry.

Synthesis of fatty acids from [1-14C]acetylcoenzyme A in subcellular particles of rat epididymal adipose tissue

PubMed Central

Kanoh, H.; Lindsay, D. B.

1972-01-01

1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795

Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

PubMed

Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

2016-09-01

α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

Effect of supplementing fat to pregnant nonlactating cows on colostral fatty acid profile and passive immunity of the newborn calf.

PubMed

Garcia, M; Greco, L F; Favoreto, M G; Marsola, R S; Martins, L T; Bisinotto, R S; Shin, J H; Lock, A L; Block, E; Thatcher, W W; Santos, J E P; Staples, C R

2014-01-01

The objectives were to evaluate the effect of supplementing saturated or unsaturated long-chain fatty acids (FA) to nulliparous and parous Holstein animals (n=78) during late gestation on FA profile of colostrum and plasma of newborn calves and on production and absorption of IgG. The saturated FA supplement (SAT) was enriched in C18:0 and the unsaturated FA supplement (ESS) was enriched in the essential FA C18:2n-6. Fatty acids were supplemented at 1.7% of dietary dry matter to low-FA diets (1.9% of dietary dry matter) during the last 8 wk of gestation. Calves were fed 4 L of colostrum within 2h of birth from their own dam or from a dam fed the same treatment. Feeding fat did not affect prepartum dry matter intake, body weight change, or gestation length. Parous but not nulliparous dams tended to give birth to heavier calves if fed fat prepartum. Parous dams were less able to synthesize essential FA derivatives, as evidenced by lower desaturase indices, compared with nulliparous dams, suggesting a greater need for essential FA supplementation. The FA profile of colostrum was modified to a greater degree by prepartum fat feeding than was that of neonatal calf plasma. The placental transfer and synthesis of elongated n-3 FA (C20:5, C22:5, and C22:6) were reduced, whereas the n-6 FA (C18:2, C18:3, and C20:3) were increased in plasma of calves born from dams fed ESS rather than SAT. Supplementing unsaturated FA prepartum resulted in elevated concentrations of trans isomers of unsaturated monoene and diene FA, as well as C18:2n-6 in colostrum. Serum concentrations of IgG tended to be increased in calves born from dams fed fat compared with those not fed fat, and prepartum feeding of SAT tended to improve circulating concentrations of IgG in newborn calves above the feeding of ESS. Apparent efficiency of absorption of IgG was improved in calves born from dams fed fat, and SAT supplementation appeared more effective than supplementation with ESS. Feeding SAT prepartum

Morphokinetic Reaction of Cells of Streptococcus faecalis (ATCC 9790) to Specific Inhibition of Macromolecular Synthesis: Dependence of Mesosome Growth on Deoxyribonucleic Acid Synthesis

PubMed Central

Higgins, Michael L.; Daneo-Moore, Lolita

1972-01-01

The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926

In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.

PubMed

Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup

2017-05-18

Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.

Dose- and type-dependent effects of long-chain fatty acids on adipogenesis and lipogenesis of bovine adipocytes.

PubMed

Yanting, Chen; Yang, Q Y; Ma, G L; Du, M; Harrison, J H; Block, E

2018-02-01

Differentiation and lipid metabolism of adipocytes have a great influence on milk performance, health, and feed efficiency of dairy cows. The effects of dietary long-chain fatty acids (FA) on adipogenesis and lipogenesis of dairy cows are often confounded by other nutritional and physiological factors in vivo. Therefore, this study used an in vitro approach to study the effect of dose and type of long-chain FA on adipogenesis and lipogenesis of bovine adipocytes. Stromal vascular cells were isolated from adipose tissue of dairy cows and induced into mature adipocytes in the presence of various long-chain FA including myristic, palmitic, stearic, oleic, or linoleic acid. When concentrations of myristic, palmitic, and oleic acids in adipogenic mediums were 150 and 200 μM, the induced mature adipocytes had greater lipid content compared with other concentrations of FA. In addition, mature adipocytes induced at 100 μM stearic acid and 300 μM linoleic acid had the greatest content of lipid than at other concentrations. High concentrations of saturated FA were more toxic for cells than the same concentration of unsaturated FA during the induction. When commitment stage was solely treated with FA, the number of differentiated mature adipocytes was greater for oleic and linoleic acids than other FA. When the maturation stage was treated with FA, the number of mature adipocytes was not affected, but the lipid content in adipocytes was affected and ranked oleic > linoleic > myristic > stearic > palmitic. In summary, this study showed that adipogenesis and lipogenesis of bovine adipocytes were differentially affected by long-chain FA, with unsaturated FA more effective than saturated FA. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Relationship between Erythrocyte Fatty Acid Composition and Psychopathology in the Vienna Omega-3 Study

PubMed Central

Kim, Sung-Wan; Jhon, Min; Kim, Jae-Min; Smesny, Stefan; Rice, Simon; Berk, Michael; Klier, Claudia M.; McGorry, Patrick D.; Schäfer, Miriam R.; Amminger, G. Paul

2016-01-01

This study investigated the relationship between erythrocyte membrane fatty acid (FA) levels and the severity of symptoms of individuals at ultra-high risk (UHR) for psychosis. Subjects of the present study consisted of 80 neuroleptic-naïve UHR patients. Partial correlation coefficients were calculated between baseline erythrocyte membrane FA levels, measured by gas chromatography, and scores on the Positive and Negative Syndrome Scale (PANSS), Global Assessment of Functioning Scale, and Montgomery–Asberg Depression Rating Scale (MADRS) after controlling for age, sex, smoking and cannabis use. Subjects were divided into three groups according to the predominance of positive or negative symptoms based on PANSS subscale scores; membrane FA levels in the three groups were then compared. More severe negative symptoms measured by PANSS were negatively correlated with two saturated FAs (myristic and margaric acids), one ω-9 monounsaturated FA (MUFA; nervonic acid), and one ω-3 polyunsaturated FA (PUFA; docosapentaenoic acid), and were positively correlated with two ω-9 MUFAs (eicosenoic and erucic acids) and two ω-6 PUFAs (γ-linolenic and docosadienoic acids). More severe positive symptoms measured by PANSS were correlated only with nervonic acid. No associations were observed between FAs and MADRS scores. In subjects with predominant negative symptoms, the sum of the ω-9 MUFAs and the ω-6:ω-3 FA ratio were both significantly higher than in those with predominant positive symptoms, whereas the sum of ω-3 PUFAs was significantly lower. In conclusion, abnormalities in FA metabolism may contribute to the neurobiology of psychopathology in UHR individuals. In particular, membrane FA alterations may play a role in negative symptoms, which are primary psychopathological manifestations of schizophrenia-related disability. PMID:26963912

Ligand-functionalized degradable polyplexes formed by cationic poly(aspartic acid)-grafted chitosan-cyclodextrin conjugates

NASA Astrophysics Data System (ADS)

Song, Hai-Qing; Li, Rui-Quan; Duan, Shun; Yu, Bingran; Zhao, Hong; Chen, Da-Fu; Xu, Fu-Jian

2015-03-01

Polypeptide-based degradable polyplexes attracted considerable attention in drug delivery systems. Polysaccharides including cyclodextrin (CD), dextran, and chitosan (CS) were readily grafted with cationic poly(aspartic acid)s (PAsps). To further enhance the transfection performances of PAsp-based polyplexes, herein, different types of ligand (folic acid, FA)-functionalized degradable polyplexes were proposed based on the PAsp-grafted chitosan-cyclodextrin conjugate (CCPE), where multiple β-CDs were tied on a CS chain. The FA-functionalized CCPE (i.e., CCPE-FA) was obtained via a host-guest interaction between the CD units of CCPE and the adamantane (Ad) species of Ad-modified FA (Ad-FA). The resulting CCPE/pDNA, CCPE-FA/pDNA, and ternary CCPE-FA/CCPE/pDNA (prepared by layer-by-layer assembly) polyplexes were investigated in detail using different cell lines. The CCPE-based polyplexes displayed much higher transfection efficiencies than the CS-based polyplexes reported earlier by us. The ternary polyplexes of CCPE-FA/CCPE/pDNA produced excellent gene transfection abilities in the folate receptor (FR)-positive tumor cells. This work would provide a promising means to produce highly efficient polyplexes for future gene therapy applications.Polypeptide-based degradable polyplexes attracted considerable attention in drug delivery systems. Polysaccharides including cyclodextrin (CD), dextran, and chitosan (CS) were readily grafted with cationic poly(aspartic acid)s (PAsps). To further enhance the transfection performances of PAsp-based polyplexes, herein, different types of ligand (folic acid, FA)-functionalized degradable polyplexes were proposed based on the PAsp-grafted chitosan-cyclodextrin conjugate (CCPE), where multiple β-CDs were tied on a CS chain. The FA-functionalized CCPE (i.e., CCPE-FA) was obtained via a host-guest interaction between the CD units of CCPE and the adamantane (Ad) species of Ad-modified FA (Ad-FA). The resulting CCPE/pDNA, CCPE-FA

Levels of Red Blood Cell Fatty Acids in Patients With Psychosis, Their Unaffected Siblings, and Healthy Controls

PubMed Central

Medema, Suzanne; Mocking, Roel J. T.; Koeter, Maarten W. J.; Vaz, Frédéric M.; Meijer, Carin; de Haan, Lieuwe; van Beveren, Nico J. M.; Kahn, René; de Haan, Lieuwe; van Os, Jim; Wiersma, Durk; Bruggeman, Richard; Cahn, Wiepke; Meijer, Carin; Myin-Germeys, Inez

2016-01-01

Background: Two recent meta-analyses showed decreased red blood cell (RBC) polyunsaturated fatty acids (FA) in schizophrenia and related disorders. However, both these meta-analyses report considerable heterogeneity, probably related to differences in patient samples between studies. Here, we investigated whether variations in RBC FA are associated with psychosis, and thus may be an intermediate phenotype of the disorder. Methods: For the present study, a total of 215 patients (87% outpatients), 187 siblings, and 98 controls were investigated for multiple FA analyses. Based on previous studies, we investigated docosahexaenoic acid (DHA), docosapentaenoic acid (DPA), arachidonic acid (AA), linoleic acid (LA), nervonic acid (NA), and eicasopentaenoic acid (EPA). On an exploratory basis, a large number of additional FA were investigated. Multilevel mixed models were used to compare the FA between the 3 groups. Results: Compared to controls, both patients and siblings showed significantly increased DHA, DPA, AA, and NA. LA was significantly higher in siblings compared to controls. EPA was not significantly different between the 3 groups. Also the exploratory FA were increased in patients and siblings. Conclusions: We found increased RBC FA DHA, DPA, AA, and NA in patients and siblings compared to controls. The direction of change is similar in both patients and siblings, which may suggest a shared environment and/or an intermediate phenotype. Differences between patient samples reflecting stage of disorder, dietary patterns, medication use, and drug abuse are possible modifiers of FA, contributing to the heterogeneity in findings concerning FA in schizophrenia patients. PMID:26385764

Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reich, I.L.; Reich, H.J.; Menahan, L.A.

1987-01-01

Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

Canola Oil in Lactating Dairy Cow Diets Reduces Milk Saturated Fatty Acids and Improves Its Omega-3 and Oleic Fatty Acid Content

PubMed Central

2016-01-01

To produce milk that is healthier for human consumption, the present study evaluated the effect of including canola oil in the diet of dairy cows on milk production and composition as well as the nutritional quality of this milk fat. Eighteen Holstein cows with an average daily milk yield of 22 (± 4) kg/d in the middle stage of lactation were used. The cows were distributed in 6 contemporary 3x3 Latin squares consisting of 3 periods and 3 treatments: control diet (without oil), 3% inclusion of canola oil in the diet and 6% inclusion of canola oil in the diet (dry matter basis). The inclusion of 6% canola oil in the diet of lactating cows linearly reduced the milk yield by 2.51 kg/d, short-chain fatty acids (FA) by 41.42%, medium chain FA by 27.32%, saturated FA by 20.24%, saturated/unsaturated FA ratio by 39.20%, omega-6/omega-3 ratio by 39.45%, and atherogenicity index by 48.36% compared with the control treatment. Moreover, with the 6% inclusion of canola oil in the diet of cows, there was an increase in the concentration of long chain FA by 45.91%, unsaturated FA by 34.08%, monounsaturated FA by 40.37%, polyunsaturated FA by 17.88%, milk concentration of omega-3 by 115%, rumenic acid (CLA) by 16.50%, oleic acid by 44.87% and h/H milk index by 94.44% compared with the control treatment. Thus, the inclusion of canola oil in the diet of lactating dairy cows makes the milk fatty acid profile nutritionally healthier for the human diet; however, the lactating performance of dairy cows is reduce. PMID:27015405

Canola Oil in Lactating Dairy Cow Diets Reduces Milk Saturated Fatty Acids and Improves Its Omega-3 and Oleic Fatty Acid Content.

PubMed

Welter, Katiéli Caroline; Martins, Cristian Marlon de Magalhães Rodrigues; de Palma, André Soligo Vizeu; Martins, Mellory Martinson; Dos Reis, Bárbara Roqueto; Schmidt, Bárbara Laís Unglaube; Saran Netto, Arlindo

2016-01-01

To produce milk that is healthier for human consumption, the present study evaluated the effect of including canola oil in the diet of dairy cows on milk production and composition as well as the nutritional quality of this milk fat. Eighteen Holstein cows with an average daily milk yield of 22 (± 4) kg/d in the middle stage of lactation were used. The cows were distributed in 6 contemporary 3x3 Latin squares consisting of 3 periods and 3 treatments: control diet (without oil), 3% inclusion of canola oil in the diet and 6% inclusion of canola oil in the diet (dry matter basis). The inclusion of 6% canola oil in the diet of lactating cows linearly reduced the milk yield by 2.51 kg/d, short-chain fatty acids (FA) by 41.42%, medium chain FA by 27.32%, saturated FA by 20.24%, saturated/unsaturated FA ratio by 39.20%, omega-6/omega-3 ratio by 39.45%, and atherogenicity index by 48.36% compared with the control treatment. Moreover, with the 6% inclusion of canola oil in the diet of cows, there was an increase in the concentration of long chain FA by 45.91%, unsaturated FA by 34.08%, monounsaturated FA by 40.37%, polyunsaturated FA by 17.88%, milk concentration of omega-3 by 115%, rumenic acid (CLA) by 16.50%, oleic acid by 44.87% and h/H milk index by 94.44% compared with the control treatment. Thus, the inclusion of canola oil in the diet of lactating dairy cows makes the milk fatty acid profile nutritionally healthier for the human diet; however, the lactating performance of dairy cows is reduce.

Absolute versus relative measures of plasma fatty acids and health outcomes: example of phospholipid omega-3 and omega-6 fatty acids and all-cause mortality in women.

PubMed

Miura, Kyoko; Hughes, Maria Celia B; Ungerer, Jacobus P J; Smith, David D; Green, Adèle C

2018-03-01

In a well-characterised community-based prospective study, we aimed to systematically assess the differences in associations of plasma omega-3 and omega-6 fatty acid (FA) status with all-cause mortality when plasma FA status is expressed in absolute concentrations versus relative levels. In a community sample of 564 women aged 25-75 years in Queensland, Australia, baseline plasma phospholipid FA levels were measured using gas chromatography. Specific FAs analysed were eicosapentaenoic acid, docosapentaenoic acid, docosahexaenoic acid, total long-chain omega-3 FAs, linoleic acid, arachidonic acid, and total omega-6 FAs. Levels of each FA were expressed in absolute amounts (µg/mL) and relative levels (% of total FAs) and divided into thirds. Deaths were monitored for 17 years and hazard ratios and 95% confidence intervals calculated to assess risk of death according to absolute versus relative plasma FA levels. In total 81 (14%) women died during follow-up. Agreement between absolute and relative measures of plasma FAs was higher in omega-3 than omega-6 FAs. The results of multivariate analyses for risk of all-cause mortality were generally similar with risk tending to inverse associations with plasma phospholipid omega-3 FAs and no association with omega-6 FAs. Sensitivity analyses examining effects of age and presence of serious medical conditions on risk of mortality did not alter findings. The directions and magnitude of associations with mortality of absolute versus relative FA levels were comparable. However, plasma FA expressed as absolute concentrations may be preferred for ease of comparison and since relative units can be deduced from absolute units.

Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.

PubMed

Knipprath, W G; Stein, R A

1966-01-01

Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.

Modification of Erythrocyte Membrane Fatty Acid Contents After Kidney Transplantation: A Prospective Study.

PubMed

Son, Y K; Kwon, H; Lee, H W; Jeong, E G; Lee, S M; Kim, S E; Park, Y; An, W S

2018-06-01

Modifications of erythrocyte membrane fatty acid (FA) contents may affect cellular function or transmembrane receptors. One cross-sectional study has shown that kidney transplant (KTP) recipients have lower erythrocyte membrane oleic acid content than dialysis patients do. Therefore, we prospectively tested whether erythrocyte membrane contents of FA including oleic acid change after KTP. We recruited 23 KTP recipients (September 2011 through May 2014). Blood samples were obtained immediately before KTP and 6 months after. Erythrocyte membrane FA contents were measured by gas chromatography. Mean age of the enrolled KTP recipients was 45.3 ± 10.9 years, and men represented 66.7% of the cases. ABO-incompatible KTPs constituted 14.3% and cadaver donors 42.9% of the cases. Steroids, mycophenolate mofetil, and tacrolimus were used as immunosuppressive treatment. There was no significant difference in dietary consumption between time points before and 6 months after KTP. Total cholesterol and low-density lipoprotein cholesterol levels were significantly higher at 6 months after KTP as compared with baseline. Erythrocyte membrane contents of polyunsaturated FA, ω-3 FA, ω-6 FA, and the ω-3 index were significantly higher, but erythrocyte membrane contents of total saturated FAs, total monounsaturated FAs, including oleic acid, total trans-FA, palmitoleic acid, and the ω-6-to-ω-3 ratio were significantly lower at 6 months after KTP. Erythrocyte membrane FA contents significantly changed toward a more favorable cardiovascular profile after KTP. These changes in erythrocyte membrane FA contents may be related to improved renal function because of the absence of significant dietary changes. Copyright © 2018 Elsevier Inc. All rights reserved.

Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.

PubMed

Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco

2002-07-01

We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.

Kinetic resolution and stereoselective synthesis of 3-substituted aspartic acids by using engineered methylaspartate ammonia lyases.

PubMed

Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J

2013-08-19

Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Folic acid conjugated mPEG-PEI600 as an efficient non-viral vector for targeted nucleic acid delivery.

PubMed

Xu, Zhenhua; Jin, Jiefu; Siu, Leo K S; Yao, Hong; Sze, Johnny; Sun, Hongzhe; Kung, Hsiang-Fu; Poon, Wai Sang; Ng, Samuel S M; Lin, Marie C

2012-04-15

In this study we describe a novel polymer, mPPS-FA, synthesized as a potential gene transfer vector. To complete mPPS-FA, folic acid was conjugated to a backbone (named mPPS) consisting of a copolymer of methyl PEG-2000, PEI-600, and sebacoyl chloride. (1)H NMR, FT-IR, and UV spectroscopy were used to characterize the structure of mPPS-FA. It was revealed that mPPS-FA holds the ability to bind plasmid DNA yielding positively charged particles (polyplexes). Dynamic light scattering (DLS) and TEM techniques were used to study the size and morphology of the formed mPPS-FA/DNA nanocomplexes. The mPPS-FA/DNA nanoparticles exhibited low cytotoxicity as transfection of B16-F0, U87MG, CHO-1, and Ho-8910 cells produced >80% viability indicating low cytotoxicity of the polymer. The ability of mPPS-FA to deliver EGFP plasmid to melanoma B16-F0, U87, CHO-1, Ho-8910, and A549 cells was investigated in vitro as compared to the lipid-based transfection agent Lipofectamine2000 and Linear PEI 22 kDa (L-PEI 22 kDa). We found that mPPS-FA/DNA complexes yielded the highest GFP transfection efficiency in B16-F0, U87, CHO-1, and Ho-8910 cells, which all highly express folate receptors (FR), at an mPPS-FA/DNA ratio (w/w) of 15. Furthermore, the transfection of mPPS-FA/DNA complexes in CHO-1 cells could be competitively blocked by free folic acid molecules. In contrast, in low FR expressing A549 cells, mPPS-FA showed similar low transfection efficiency as mPPS. Taken together, mPPS-FA showed the highest efficiency in vitro and the potential to be developed as a nonviral gene carrier. Copyright © 2012 Elsevier B.V. All rights reserved.

Transport and fate of Herbaspirillum chlorophenolicum FA1 in saturated porous media

NASA Astrophysics Data System (ADS)

Li, X.; Xu, H.; Wu, J.

2016-12-01

For the bioremediation of contaminated groundwater, sufficient dispersal of functional microorganisms is one of the most important factors that determine the remediation efficiency. There are extensive studies on the transport of microbes in porous media, while most of them focus on pathogenic bacteria and little attention has been given toward functional bacteria that being used in bioremediation process. Therefore, accurate knowledge of the mechanisms that govern the transport and distribution of such bacteria in groundwater is needed to develop efficient treatment techniques. Herbaspirillum chlorophenolicum FA1, a pure bacterial strain capable of absorbing heavy metals and degrading polycyclic aromatic hydrocarbons (PAHs), was selected as the representative functional bacterium in this study. A series of batch and column experiments were conducted to investigate the transport and deposition behavior of strain FA1 in saturated porous media. The effects of physical (grain size), chemical (ionic strength, humic acid), and biological factors (living/dead cells) were studied in detail. In addition, numerical simulations of breakthrough curve (BTC) data were also performed for information gathering. Results of this study could advance our understanding of functional bacteria transport and help to develop successful bioremediation strategies. This work was financially supported by the National Natural Science Foundation of China -Xinjiang Project (U1503282), the National Natural Science Foundation of China (41030746, 41102148), and the Natural Science Foundation of Jiangsu Province (BK20151385). Keywords: Herbaspirillum chlorophenolicum FA1, bacteria, porous media, transport, modeling

Novel Palm Fatty Acid Functionalized Magnetite Nanoparticles for Magnetic Solid-Phase Extraction of Trace Polycyclic Aromatic Hydrocarbons from Environmental Samples.

PubMed

Rozi, Siti Khalijah Mahmad; Nodeh, Hamid Rashidi; Kamboh, Muhammad Afzal; Manan, Ninie Suhana Abdul; Mohamad, Sharifah

2017-07-01

A novel adsorbent, palm fatty acid coated magnetic Fe 3 O 4 nanoparticles (MNP-FA) was successfully synthesized with immobilization of the palm fatty acid onto the surface of MNPs. The successful synthesis of MNP-FA was further confirmed by X-Ray diffraction (XRD), transmission electron microscopy (TEM), Fourier transform infrared spectroscopy (FT-IR) and Energy dispersive X-Ray spectroscopy (EDX) analyses and water contact angle (WCA) measurement. This newly synthesized MNP-FA was applied as magnetic solid phase extraction (MSPE) adsorbent for the enrichment of polycyclic aromatic hydrocarbons (PAHs), namely fluoranthene (FLT), pyrene (Pyr), chrysene (Cry) and benzo(a)pyrene (BaP) from environmental samples prior to High Performance Liquid Chromatography- Diode Array Detector (HPLC-DAD) analysis. The MSPE method was optimized by several parameters such as amount of sorbent, desorption solvent, volume of desorption solvent, extraction time, desorption time, pH and sample volume. Under the optimized conditions, MSPE method provided a low detection limit (LOD) for FLT, Pyr, Cry and BaP in the range of 0.01-0.05 ng mL -1 . The PAHs recoveries of the spiked leachate samples ranged from 98.5% to 113.8% with the RSDs (n = 5) ranging from 3.5% to 12.2%, while for the spiked sludge samples, the recoveries ranged from 81.1% to 119.3% with the RSDs (n = 5) ranging from 3.1% to 13.6%. The recyclability study revealed that MNP-FA has excellent reusability up to five times. Chromatrographic analysis demonstrated the suitability of MNP-FA as MSPE adsorbent for the efficient extraction of PAHs from environmental samples.

Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

PubMed

Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

2016-08-01

The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.

PubMed

Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D

1995-01-01

The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.

Surface characterization of colloidal-sol gel derived biphasic HA/FA coatings.

PubMed

Cheng, Kui; Zhang, Sam; Weng, Wenjian

2007-10-01

Hydroxyapatite (HA) powders are ultrasonically dispersed in the precursor of fluoridated hydroxyapatite (FHA) or fluorapatite (FA) to form a "colloidal sol". HA/FA biphasic coatings are prepared on Ti6Al4V substrate via dip coating, 150 degrees C drying and 600 degrees C firing. The coatings show homogenous distribution of HA particles in the FA matrix. The relative phase proportion can be tailored by the amount of HA in the colloidal sol. The surfaces of the coatings consist of two kinds of distinct domains: HA and FA, resulting in a compositionally heterogeneous surface. The biphasic coating surface becomes increasingly rougher with HA powders, from around 200 nm of pure FA to 400-600 nm in Ra of biphasic coatings. The rougher biphasic HA/FA surfaces with chemically controllable domains will favor cell attachment, apatite layer deposition and necessary dissolution in clinical applications.

Effects of folic acid deficiency and MTHFRC677T polymorphisms on cytotoxicity in human peripheral blood lymphocytes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Wu Xiayu; Liang Ziqing; Zou Tianning

2009-02-13

Apoptosis (APO) and necrosis (NEC) are two different types of cell death occurring in response to cellular stress factors. Cells with DNA damage may undergo APO or NEC. Folate is an essential micronutrient associated with DNA synthesis, repair and methylation. Methylenetetrahydrofolate reductase (MTHFR) regulates intracellular folate metabolism. Folate deficiency and MTHFR C677T polymorphisms have been shown to be related to DNA damage. To verify the cytotoxic effects of folate deficiency on cells with different MTHFR C677T genotypes, 15 human peripheral lymphocyte cases with different MTHFR C677T genotypes were cultured in folic acid (FA)-deficient and -sufficient media for 9 days. Cytotoxicitymore » was quantified using the frequencies of APO and NEC as endpoints, the nuclear division index (NDI), and the number of viable cells (NVC). These results showed that FA is an important factor in reducing cytotoxicity and increasing cell proliferation. Lymphocytes with the TT genotype proliferated easily under stress and exhibited different responses to FA deficiency than lymphocytes with the CC and CT genotypes. A TT individual may accumulate more cytotoxicity under cytotoxic stress, suggesting that the effects of FA deficiency on cytotoxicity are greater than the effects in individuals with the other MTHFR C677T variants.« less

Isomers of hexadecenoic and hexadecadienoic acids in Androsace septentrionalis (Primulaceae) seed oil.

PubMed

Tsevegsuren, N; Aitzetmuller, K; Vosmann, K

2003-11-01

Seeds of Androsace septentrionalis of the genus Androsace (tribus Primuleae) from the plant family Primulaceae were studied for their oil content and FA composition. The seed oil of A. septentrionalis was found to contain two unusual FA rarely occurring in plants: 11-cis-hexadecenoic acid (16:1delta11c or 16:1n-5) and 9-cis,12-cis-hexadecadienoic acid (16:2delta9c,12c or 16:2n-4). It also contained an unusually high amount (21.4%) of 9-cis-hexadecenoic acid (palmitoleic acid; 16:1delta9c or 16:1n-7), i.e., at a level higher than that of oleic acid, in addition to common FA. Compared with most plant seed oils, at 3.8% the level of 18:1delta11c (or 18:1n-7) also was elevated. The nonidentity of the Androsace 16:2-acid with the 16:2-acid, which is very typical for Ranunculus spp., as well as its identity with the 16:2-acid typically found in Asclepiadaceae was established by co-chromatography. The structure and composition of the constituent FA of A. septentrionalis were also determined by various chromatographic methods (TLC, Ag+-TLC, capillary GLC) and spectroscopic methods (IR, GC-MS). The significant deviation of the Androsace FA pattern from that of other Primuleae, indicating a separate phylogenetic position of Androsace, is discussed.

Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

PubMed

Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

2015-09-01

Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.

Changes in behavioural parameters, oxidative stress and neurotrophins in the brain of adult offspring induced to an animal model of schizophrenia: The effects of FA deficient or FA supplemented diet during the neurodevelopmental phase.

PubMed

Canever, L; Freire, T G; Mastella, G A; Damázio, L; Gomes, S; Fachim, I; Michels, C; Carvalho, G; Godói, A K; Peterle, B R; Gava, F F; Valvassori, S S; Budni, J; Quevedo, J; Zugno, A I

2018-05-18

A deficiency of maternal folic acid (FA) can compromise the function and development of the brain, and may produce a susceptibility to diseases such as schizophrenia (SZ) in the later life of offspring. The aim of this study was to evaluate the effects of both FA deficient and FA supplemented diets during gestation and lactation on behavioural parameters, the markers of oxidative stress and neurotrophic factors in adult offspring which had been subjected to an animal model of SZ. Female mother rats (Dam's) were separated into experimental maternal groups, which began receiving a special diet (food) consisting of the AIN-93 diet, a control diet, or an FA deficient diet during the periods of pregnancy and lactation. Dam's receiving the control diet were further subdivided into four groups: one group received only control diet, while three groups to receive supplementation with FA at different doses (5, 10 and 50 mg/kg). Adult offspring bred from the Dam's were divided into ten groups for induction of the animal model of SZ through the administration of ketamine (Ket) (25 mg/kg). After the last administration of the drug, the animals were subjected to the behavioural tests and were then euthanized. The frontal cortex (FC) and hippocampus (Hip) were then dissected for later biochemical analysis. Our data demonstrates that Ket induced the model of SZ by altering the behavioural parameters (e.g. hyperlocomotion, social impairment, deficits in the sensory-motor profile and memory damage in the adult animals); and also caused changes in the parameters of oxidative stress (lipid hydroperoxide - LPO; 8-isoprostane - 8-ISO; 4-hydroxynonenal - 4-HNE; protein carbonyl content; superoxide dismutase - SOD and catalase - CAT) as well as in the levels of neurotrophic factors (brain-derived neurotrophic factor - BDNF and nerve growth factor - NGF) particularly within the FC of adult offspring. A deficiency in maternal FA, alone or in combination with ket, was able to induce

FA-SAT Is an Old Satellite DNA Frozen in Several Bilateria Genomes

PubMed Central

Chaves, Raquel; Ferreira, Daniela; Mendes-da-Silva, Ana; Meles, Susana; Adega, Filomena

2017-01-01

Abstract In recent years, a growing body of evidence has recognized the tandem repeat sequences, and specifically satellite DNA, as a functional class of sequences in the genomic “dark matter.” Using an original, complementary, and thus an eclectic experimental design, we show that the cat archetypal satellite DNA sequence, FA-SAT, is “frozen” conservatively in several Bilateria genomes. We found different genomic FA-SAT architectures, and the interspersion pattern was conserved. In Carnivora genomes, the FA-SAT-related sequences are also amplified, with the predominance of a specific FA-SAT variant, at the heterochromatic regions. We inspected the cat genome project to locate FA-SAT array flanking regions and revealed an intensive intermingling with transposable elements. Our results also show that FA-SAT-related sequences are transcribed and that the most abundant FA-SAT variant is not always the most transcribed. We thus conclude that the DNA sequences of FA-SAT and their transcripts are “frozen” in these genomes. Future work is needed to disclose any putative function that these sequences may play in these genomes. PMID:29608678

Se@SiO2-FA-CuS nanocomposites for targeted delivery of DOX and nano selenium in synergistic combination of chemo-photothermal therapy.

PubMed

Wang, Yeying; Liu, Xijian; Deng, Guoying; Sun, Jian; Yuan, Haikuan; Li, Qi; Wang, Qiugeng; Lu, Jie

2018-02-08

In this study, a versatile tumor-targeted and multi-stimuli-responsive drug delivery vehicle (Se particle@porous silica-folic acid-copper sulfide/doxorubicin (Se@SiO 2 -FA-CuS/DOX)) was fabricated for combined photothermal therapy with chemotherapy in cancer treatment. Due to excellent targeting ability, the Se@SiO 2 -FA-CuS/DOX nanocomposites actively accumulated in tumor tissues and thus provided photothermal therapy under NIR irradiation and chemotherapy through the release of DOX and Se. Owing to the synergistic effect of chemotherapy (Se and DOX) and photothermal therapy, the Se@SiO 2 -FA-CuS/DOX nanocomposites could efficiently inhibit cancer cells both in vitro and in vivo and even completely eliminate tumors. Moreover, as the toxicity of DOX could be reduced by Se, the treatment using Se@SiO 2 -FA-CuS/DOX nanocomposites exhibited no appreciable adverse reactions. Thus, the Se@SiO 2 -FA-CuS/DOX nanocomposites have great potential as a multifunctional nanoplatform in future clinical applications.

TRIM.FaTE Evaluation Report

EPA Pesticide Factsheets

The TRIM.FaTE Evaluation Report is composed of three volumes. Volume I presents conceptual, mechanistic, and structural complexity evaluations of various aspects of the model. Volumes II and III present performance evaluation.

Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

NASA Technical Reports Server (NTRS)

Nakashima, T.; Fox, S. W.

1980-01-01

The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

Plasma and erythrocyte phospholipid fatty acid profile in professional basketball and football players.

PubMed

Tepsic, Jasna; Vucic, Vesna; Arsic, Aleksandra; Blazencic-Mladenovic, Vera; Mazic, Sanja; Glibetic, Marija

2009-10-01

The effect of intensive long-term physical activity on phospholipid fatty acid (FA) composition has not been studied thoroughly. We determined plasma and erythrocyte phospholipid FA status of professional basketball and football players. Our results showed differences in plasma FA profile not only between sportsmen and sedentary subjects, but also between two groups of sportsmen. Plasma FA profile in basketball players showed significantly higher proportion of n-6 FA (20:3, 20:4, and 22:4) and total polyunsaturated FA (PUFA) than controls, while football players had higher palmitoleic acid (16:1) than basketball players and controls. Total PUFA and 22:4 were also higher in basketball than in football players. Erythrocyte FA profile showed no differences between football players and controls. However, basketball players had higher proportion of 18:0 than controls, higher saturated FA and lower 18:2 than two other groups, and higher 22:4 than football players. These findings suggest that long-term intensive exercise and type of sport influence FA profile.

Probiotic supplementation effects on milk fatty acid profile in ewes.

PubMed

Payandeh, Shahab; Kafilzadeh, Farokh; Juárez, Manuela; de la Fuente, Miguel Angel; Ghadimi, Darab; Martínez Marín, Andrés L

2017-05-01

We hypothesised that probiotic feeding would alter the fatty acid (FA) profile of sheep's milk. Sixteen lactating ewes, kept under the same feeding and management practices, were randomly allocated to receive either a control diet or the same diet supplemented with a commercial multi-strain bacterial probiotic. Milk fat FA contents were monitored fortnightly for eight consecutive weeks from 14 d after lambing. Probiotic supplementation increased the contents of butyric and caproic acids in milk fat and had no negative effects on other relevant FA from the human's health point of view (i.e., no differences in branched chain, vaccenic, rumenic and n-3 FA were observed). Under the conditions assayed in the present work, the contents of milk FA originated from rumen microbial metabolism were scantly altered, which suggests that the rumen conversion pathways of FA were not substantially modified by the probiotics.

Comparative studies on the interaction of caffeic acid, chlorogenic acid and ferulic acid with bovine serum albumin

NASA Astrophysics Data System (ADS)

Li, Shuang; Huang, Kelong; Zhong, Ming; Guo, Jun; Wang, Wei-zheng; Zhu, Ronghua

2010-10-01

The substitution of the hydrogen on aromatic and esterification of carboxyl group of the phenol compounds plays an important role in their bio-activities. In this paper, caffeic acid (CaA), chlorogenic acid (ChA) and ferulic acid (FA) were selected to investigate the binding to bovine serum albumin (BSA) using UV absorption spectroscopy, fluorescence spectroscopy and synchronous fluorescence spectroscopy. It was found that the methoxyl group substituting for the 3-hydroxyl group of CaA decreased the affinity for BSA and the esterification of carboxyl group of CaA with quinic acid increased the affinities. The affinities of ChA and FA with BSA were more sensitive to the temperature than that of CaA with BSA. Synchronous fluorescence spectroscopy and time-resolved fluorescence indicated that the Stern-Volmer plots largely deviated from linearity at high concentrations and were caused by complete quenching of the tyrosine fluorescence of BSA.

A fermentative approach towards optimizing directed biosynthesis of fumaric acid by Rhizopus oryzae 1526 utilizing apple industry waste biomass.

PubMed

Das, Ratul Kumar; Brar, Satinder Kaur; Verma, Mausam

2015-12-01

The present research account deals with the bioproduction of fumaric acid (FA) from apple pomace ultrafiltration sludge (APUS) and apple pomace (AP) through fermentation. The filamentous fungus Rhizopus oryzae 1526 was used as a biocatalyst and its morphological impact on FA production was analysed in detail. For submerged fermentation, 40 g L(-1) of total solids concentration of APUS, pH 6.0, 30 °C, 200 rpm flask shaking speed and 72 h of incubation were found to be optimum for FA production (25.2 ± 1.0 g L(-1), 0.350 g (L(-1) h(-1))). Broth viscosity (cP), residual reducing sugar (g L(-1)) and ethanol (g L(-1)) produced as by-product, were also analysed. Plastic trays were used for solid state fermentation and at optimized level of moisture and incubation period, 52 ± 2.67 g FA per kg dry weight of AP was obtained. Changes in the total phenolic content (mg g(-1) dry weight of AP) were monitored at regular intervals. Utilization of APUS and AP for the directed synthesis of the high-value platform chemical FA by the fungal strain R. oryzae 1526 was an excellent display of fungal physiological and morphological control over a fermentative product. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

Fatty acid transfer in the food web of a coastal Mediterranean lagoon: Evidence for high arachidonic acid retention in fish

NASA Astrophysics Data System (ADS)

Koussoroplis, Apostolos-Manuel; Bec, Alexandre; Perga, Marie-Elodie; Koutrakis, Emmanuil; Bourdier, Gilles; Desvilettes, Christian

2011-02-01

The transfer of fatty acids (FAs) in the food web of a Mediterranean lagoon was studied using FA compositional patterns across several trophic levels. The structure of the food web was inferred from C and N stable isotopes values and an isotope mixing model was used in order to estimate the relative contribution of the different potential food sources to the biomass of consumers. Bidimensional plots of FA composition of food web components against their δ 15N values indicated a general trend of increasing proportions of highly unsaturated fatty acids (HUFAs) with increasing trophic levels while the proportions of saturated fatty acids (SAFAs) and 18-carbon polyunsaturated fatty acids (PUFAs) decreased. Using the relative contributions of food sources to consumers and their FA compositions, a model was built in order to estimate the PUFA composition of consumer mixed diets which was compared to consumer PUFA profiles. The latter allowed the identification of the PUFAs which were mostly enriched/retained in consumer lipids. There was a surprisingly high retention of arachidonic acid (ARA), a trend which challenges the idea of low ARA needs in marine fish and suggests the important physiological role of this essential FA for fish in estuarine environments.

Characterization of interaction between amino acids and fulvic-like organic matter by fluorescence spectroscopy combining thermodynamic calculation.

PubMed

Lin, Tao; Hou, Bingwei; Wang, Jian; Xu, Yaqun; Chen, Wei

2017-03-01

Dissolved organic matter (DOM), as a very fine colloidal suspension, could inevitably affect the transformation process of dissolved organic nitrogen (DON) in drinking water treatment. Tryptophan and tyrosine were used as representatives of DON to investigate the interactions between amino acids and fulvic-like components of fluorescent DOM using titration experiments. The fluorescence intensity decreased significantly with the increasing fulvic acid (FA) concentration, suggesting that FA could greatly quench the intrinsic fluorescence of amino acids such as tryptophan and tyrosine. The absolute spectrum peaks of amino acids (AA) were changed in the presence of FA, possibly being resulted from non-covalent interactions between amino acids and FA. The specific hydrogen bonding and van der Waals forces played dominant roles in the interactions according to the results of theoretical analysis and thermodynamic calculation. The distance between donor and acceptor was 1.25 and 1.14 nm for the FA-tyrosine and FA-tryptophan system, indicating the energy transfer from tyrosine or tryptophan to FA. The association constant (K) decreased with the increase of temperature and pH value, while the change of ionic strength had no obvious influence on K value.

Levels of Red Blood Cell Fatty Acids in Patients With Psychosis, Their Unaffected Siblings, and Healthy Controls.

PubMed

Medema, Suzanne; Mocking, Roel J T; Koeter, Maarten W J; Vaz, Frédéric M; Meijer, Carin; de Haan, Lieuwe; van Beveren, Nico J M; Kahn, René; de Haan, Lieuwe; van Os, Jim; Wiersma, Durk; Bruggeman, Richard; Cahn, Wiepke; Meijer, Carin; Myin-Germeys, Inez

2016-03-01

Two recent meta-analyses showed decreased red blood cell (RBC) polyunsaturated fatty acids (FA) in schizophrenia and related disorders. However, both these meta-analyses report considerable heterogeneity, probably related to differences in patient samples between studies. Here, we investigated whether variations in RBC FA are associated with psychosis, and thus may be an intermediate phenotype of the disorder. For the present study, a total of 215 patients (87% outpatients), 187 siblings, and 98 controls were investigated for multiple FA analyses. Based on previous studies, we investigated docosahexaenoic acid (DHA), docosapentaenoic acid (DPA), arachidonic acid (AA), linoleic acid (LA), nervonic acid (NA), and eicasopentaenoic acid (EPA). On an exploratory basis, a large number of additional FA were investigated. Multilevel mixed models were used to compare the FA between the 3 groups. Compared to controls, both patients and siblings showed significantly increased DHA, DPA, AA, and NA. LA was significantly higher in siblings compared to controls. EPA was not significantly different between the 3 groups. Also the exploratory FA were increased in patients and siblings. We found increased RBC FA DHA, DPA, AA, and NA in patients and siblings compared to controls. The direction of change is similar in both patients and siblings, which may suggest a shared environment and/or an intermediate phenotype. Differences between patient samples reflecting stage of disorder, dietary patterns, medication use, and drug abuse are possible modifiers of FA, contributing to the heterogeneity in findings concerning FA in schizophrenia patients. © The Author 2015. Published by Oxford University Press on behalf of the Maryland Psychiatric Research Center. All rights reserved. For permissions, please email: journals.permissions@oup.com.

Antibacterial activity of lichen secondary metabolite usnic acid is primarily caused by inhibition of RNA and DNA synthesis.

PubMed

Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata

2014-04-01

Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

2-methoxylated fatty acids in marine sponges: defense mechanism against mycobacteria?

PubMed

Carballeira, Néstor M; Cruz, Heidyleen; Kwong, Cecil D; Wan, Baojie; Franzblau, Scott

2004-07-01

A series of saturated 2-methoxylated FA having even-numbered chains with 8-14 carbons were synthesized, and their spectroscopic data are presented for the first time. The 2-methoxylated C10-C14 acids were prepared from the corresponding 2-hydroxylated FA, whereas the 2-methoxyoctanoic acid was synthesized starting with heptaldehyde. All of the methoxylated FA displayed some degree of inhibition (between 2 and 99%) of Mycobacterium tuberculosis H(37)Rv at 6.25 microg/mL. The most inhibitory FA was 2-methoxydecanoic acid, with a minimum inhibitory concentration of 200-239 microM against M. tuberculosis H(37)Rv as determined by both the microplate Alamar Blue assay and the green fluorescent protein microplate assay. These results are discussed in terms of the possible role of the 2-methoxylated FA as antimicrobial lipids produced either by marine sponges, or the associated marine symbiotic bacteria, as a defense mechanism in a highly competitive environment.

Hypothalamic fatty acid sensing in Senegalese sole (Solea senegalensis): response to long-chain saturated, monounsaturated, and polyunsaturated (n-3) fatty acids.

PubMed

Conde-Sieira, Marta; Bonacic, Kruno; Velasco, Cristina; Valente, Luisa M P; Morais, Sofia; Soengas, José L

2015-12-15

We assessed the presence of fatty acid (FA)-sensing mechanisms in hypothalamus of Senegalese sole (Solea senegalensis) and investigated their sensitivity to FA chain length and/or level of unsaturation. Stearate (SA, saturated FA), oleate (OA, monounsaturated FA of the same chain length), α-linolenate [ALA, a n-3 polyunsaturated fatty acid (PUFA) of the same chain length], and eicosapentanoate (EPA, a n-3 PUFA of a larger chain length) were injected intraperitoneally. Parameters related to FA sensing and neuropeptide expression in the hypothalamus were assessed after 3 h and changes in accumulated food intake after 4, 24, and 48 h. Three FA sensing systems characterized in rainbow trout were also found in Senegalese sole and were activated by OA in a way similar to that previously characterized in rainbow trout and mammals. These hypothalamic FA sensing systems were also activated by ALA, differing from mammals, where n-3 PUFAs do not seem to activate FA sensors. This might suggest additional roles and highlights the importance of n-3 PUFA in fish diets, especially in marine species. The activation of FA sensing seems to be partially dependent on acyl chain length and degree of saturation, as no major changes were observed after treating fish with SA or EPA. The activation of FA sensing systems by OA and ALA, but not SA or EPA, is further reflected in the expression of hypothalamic neuropeptides involved in the control of food intake. Both OA and ALA enhanced anorexigenic capacity compatible with the activation of FA sensing systems. Copyright © 2015 the American Physiological Society.

Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.

PubMed

Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song

2018-04-01

Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

USDA-ARS?s Scientific Manuscript database

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...

Nutritional enhancement of sheep meat fatty acid profile for human health and wellbeing.

PubMed

Chikwanha, Obert C; Vahmani, Payam; Muchenje, Voster; Dugan, Michael E R; Mapiye, Cletos

2018-02-01

Dietary fatty acids (FA) consumed by sheep, like other ruminants, can undergo biohydrogenation resulting in high proportions of saturated FA (SFA) in meat. Biohydrogenation is typically less extensive in sheep than cattle, and consequently, sheep meat can contain higher proportions of omega (n)-3 polyunsaturated FA (PUFA), and PUFA biohydrogenation intermediates (PUFA-BHI) including conjugated linoleic acid (CLA) and trans-monounsaturated FAs (t-MUFA). Sheep meat is also noted for having characteristically higher contents of branched chain FA (BCFA). From a human health and wellness perspective, some SFA and trans-MUFA have been found to negatively affect blood lipid profiles, and are associated with increased risk of cardiovascular disease (CVD). On the other hand, n-3 PUFA, BCFA and some PUFA-BHI may have many potential beneficial effects on human health and wellbeing. In particular, vaccenic acid (VA), rumenic acid (RA) and BCFA may have potential for protecting against cancer and inflammatory disorders among other human health benefits. Several innovative strategies have been evaluated for their potential to enrich sheep meat with FA which may have human health benefits. To this end, dietary manipulation has been found to be the most effective strategy of improving the FA profile of sheep meat. However, there is a missing link between the FA profile of sheep meat, human consumption patterns of sheep FA and chronic diseases. The current review provides an overview of the nutritional strategies used to enhance the FA profile of sheep meat for human consumption. Copyright © 2017 Elsevier Ltd. All rights reserved.

The carboxyl terminus of FANCE recruits FANCD2 to the Fanconi Anemia (FA) E3 ligase complex to promote the FA DNA repair pathway.

PubMed

Polito, David; Cukras, Scott; Wang, Xiaozhe; Spence, Paige; Moreau, Lisa; D'Andrea, Alan D; Kee, Younghoon

2014-03-07

Fanconi anemia (FA) is a genome instability syndrome characterized by bone marrow failure and cellular hypersensitivity to DNA cross-linking agents. In response to DNA damage, the FA pathway is activated through the cooperation of 16 FA proteins. A central player in the pathway is a multisubunit E3 ubiquitin ligase complex or the FA core complex, which monoubiquitinates its substrates FANCD2 and FANCI. FANCE, a subunit of the FA core complex, plays an essential role by promoting the integrity of the complex and by directly recognizing FANCD2. To delineate its role in substrate ubiquitination from the core complex assembly, we analyzed a series of mutations within FANCE. We report that a phenylalanine located at the highly conserved extreme C terminus, referred to as Phe-522, is a critical residue for mediating the monoubiquitination of the FANCD2-FANCI complex. Using the FANCE mutant that specifically disrupts the FANCE-FANCD2 interaction as a tool, we found that the interaction-deficient mutant conferred cellular sensitivity in reconstituted FANCE-deficient cells to a similar degree as FANCE null cells, suggesting the significance of the FANCE-FANCD2 interaction in promoting cisplatin resistance. Intriguingly, ectopic expression of the FANCE C terminus fragment alone in FA normal cells disrupts DNA repair, consolidating the importance of the FANCE-FANCD2 interaction in the DNA cross-link repair.

The Carboxyl Terminus of FANCE Recruits FANCD2 to the Fanconi Anemia (FA) E3 Ligase Complex to Promote the FA DNA Repair Pathway*

PubMed Central

Polito, David; Cukras, Scott; Wang, Xiaozhe; Spence, Paige; Moreau, Lisa; D'Andrea, Alan D.; Kee, Younghoon

2014-01-01

Fanconi anemia (FA) is a genome instability syndrome characterized by bone marrow failure and cellular hypersensitivity to DNA cross-linking agents. In response to DNA damage, the FA pathway is activated through the cooperation of 16 FA proteins. A central player in the pathway is a multisubunit E3 ubiquitin ligase complex or the FA core complex, which monoubiquitinates its substrates FANCD2 and FANCI. FANCE, a subunit of the FA core complex, plays an essential role by promoting the integrity of the complex and by directly recognizing FANCD2. To delineate its role in substrate ubiquitination from the core complex assembly, we analyzed a series of mutations within FANCE. We report that a phenylalanine located at the highly conserved extreme C terminus, referred to as Phe-522, is a critical residue for mediating the monoubiquitination of the FANCD2-FANCI complex. Using the FANCE mutant that specifically disrupts the FANCE-FANCD2 interaction as a tool, we found that the interaction-deficient mutant conferred cellular sensitivity in reconstituted FANCE-deficient cells to a similar degree as FANCE null cells, suggesting the significance of the FANCE-FANCD2 interaction in promoting cisplatin resistance. Intriguingly, ectopic expression of the FANCE C terminus fragment alone in FA normal cells disrupts DNA repair, consolidating the importance of the FANCE-FANCD2 interaction in the DNA cross-link repair. PMID:24451376

Supplemental fructose attenuates postprandial glycemia in Zucker fatty fa/fa rats.

PubMed

Wolf, Bryan W; Humphrey, Phillip M; Hadley, Craig W; Maharry, Kati S; Garleb, Keith A; Firkins, Jeffrey L

2002-06-01

Experiments were conducted to evaluate the effects of supplemental fructose on postprandial glycemia. After overnight food deprivation, Zucker fatty fa/fa rats were given a meal glucose tolerance test. Plasma glucose response was determined for 180 min postprandially. At a dose of 0.16 g/kg body, fructose reduced (P < 0.05) the incremental area under the curve (AUC) by 34% when supplemented to a glucose challenge and by 32% when supplemented to a maltodextrin (a rapidly digested starch) challenge. Similarly, sucrose reduced (P = 0.0575) the incremental AUC for plasma glucose when rats were challenged with maltodextrin. Second-meal glycemic response was not affected by fructose supplementation to the first meal, and fructose supplementation to the second meal reduced (P < 0.05) postprandial glycemia when fructose had been supplemented to the first meal. In a dose-response study (0.1, 0.2, and 0.5 g/kg body), supplemental fructose reduced (P < 0.01) the peak rise in plasma glucose (linear and quadratic effects). In the final experiment, a low dose of fructose (0.075 g/kg body) reduced (P < 0.05) the incremental AUC by 18%. These data support the hypothesis that small amounts of oral fructose or sucrose may be useful in lowering the postprandial blood glucose response.

Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.

PubMed

McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A

2012-01-06

The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.

Low-Dose Creatine Supplementation Lowers Plasma Guanidinoacetate, but Not Plasma Homocysteine, in a Double-Blind, Randomized, Placebo-Controlled Trial.

PubMed

Peters, Brandilyn A; Hall, Megan N; Liu, Xinhua; Parvez, Faruque; Siddique, Abu B; Shahriar, Hasan; Uddin, Mohammad Nasir; Islam, Tariqul; Ilievski, Vesna; Graziano, Joseph H; Gamble, Mary V

2015-10-01

Creatine synthesis from guanidinoacetate consumes ~50% of s-adenosylmethionine (SAM)-derived methyl groups, accounting for an equivalent proportion of s-adenosylhomocysteine (SAH) and total homocysteine (tHcys) synthesis. Dietary creatine inhibits the synthesis of guanidinoacetate, thereby lowering plasma tHcys in rats. We tested the hypotheses that creatine supplementation lowers plasma guanidinoacetate, increases blood SAM, lowers blood SAH, and lowers plasma tHcys. Bangladeshi adults were randomly assigned to receive 1 of 4 treatments for 12 wk: placebo (n = 101), 3 g/d creatine (Cr; n = 101), 400 μg/d folic acid (FA; n = 153), or 3 g/d creatine plus 400 μg/d folic acid (Cr+FA; n = 103). The outcomes of plasma guanidinoacetate and tHcys, as well as whole blood SAM and SAH, were analyzed at baseline and week 12 by HPLC. Treatment effects of creatine supplementation were examined with the use of the group comparisons of Cr vs. placebo and Cr+FA vs. FA. Plasma guanidinoacetate declined by 10.6% (95% CI: 4.9, 15.9) in the Cr group while increasing nonsignificantly in the placebo group (3.7%; 95% CI: -0.8, 8.5) (Pgroup difference = 0.0002). Similarly, plasma guanidinoacetate declined by 9.0% (95% CI: 3.4, 14.2) in the Cr+FA group while increasing in the FA group (7.0%; 95% CI: 2.0, 12.2) (Pgroup difference < 0.0001). Plasma tHcys declined by 23.4% (95% CI: 19.5, 27.1) and 21.0% (95% CI: 16.4, 25.2) in the FA and Cr+FA groups, respectively (Pgroup difference = 0.41), with no significant changes in the placebo or Cr groups (Pgroup difference = 0.35). A decrease in guanidinoacetate over time was associated with a decrease in tHcys over time in the Cr+FA group (β = 0.30; 95% CI: 0.17, 0.43; P < 0.0001). Our findings indicate that whereas creatine supplementation downregulates endogenous creatine synthesis, this may not on average lower plasma tHcys in humans. However, tHcys did decrease in those participants who experienced a decline in plasma guanidinoacetate while

Effective depolymerization of concentrated acid hydrolysis lignin using a carbon-supported ruthenium catalyst in ethanol/formic acid media.

PubMed

Kristianto, Ivan; Limarta, Susan Olivia; Lee, Hyunjoo; Ha, Jeong-Myeong; Suh, Dong Jin; Jae, Jungho

2017-06-01

Lignin isolated by two-step concentrated acid hydrolysis of empty fruit bunch (EFB) was effectively depolymerized into a high-quality bio-oil using formic acid (FA) as an in-situ hydrogen source and Ru/C as a catalyst in supercritical ethanol. A bio-oil yield of 66.3wt% with an average molecular weight of 822g/mol and an aromatic monomer content of 6.1wt% was achieved at 350°C and a FA-to-lignin mass ratio of 3 after a reaction time of 60min. The combination of Ru/C and FA also resulted in a significant reduction in the oxygen content of the bio-oil by ∼60% and a corresponding increase in the higher heating value (HHV) to 32.7MJ/kg due to the enhanced hydrodeoxygenation activity. An examination of the FA decomposition characteristics revealed that Ru/C provides a greater increase in the rate of hydrogen production from FA, explaining the efficient depolymerization of lignin in a combined system. Copyright © 2017 Elsevier Ltd. All rights reserved.

Characterization of folic acid-PAMAM conjugates: drug loading efficacy and dendrimer morphology.

PubMed

Chanphai, P; Tajmir-Riahi, H A

2018-05-01

We report the loading efficacy of folic acid (FA) by polyamidoamine (PAMAM-G3 and PAMAM-G4) nanoparticles in aqueous solution at physiological pH. Thermodynamic parameters ΔH = -47.57 (kJ Mol -1 ), ΔS = -122.78 (J Mol -1 , K -1 ) and ΔG = -10.96 (kJ Mol -1 ) showed FA-PAMAM bindings occur via H-bonding and van der Waals contacts. The stability of acid-PAMAM conjugate increased as polymer size increased. The acid loading efficacy was 40 to 50%. TEM images exhibited major polymer morphological changes upon acid encapsulation. PAMAM dendrimers are capable of FA delivery in vitro.

Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bai, Xupeng; Hong, Weipeng; Cai, Peiheng

Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the

Co-expression analysis identifies CRC and AP1 the regulator of Arabidopsis fatty acid biosynthesis.

PubMed

Han, Xinxin; Yin, Linlin; Xue, Hongwei

2012-07-01

Fatty acids (FAs) play crucial rules in signal transduction and plant development, however, the regulation of FA metabolism is still poorly understood. To study the relevant regulatory network, fifty-eight FA biosynthesis genes including de novo synthases, desaturases and elongases were selected as "guide genes" to construct the co-expression network. Calculation of the correlation between all Arabidopsis thaliana (L.) genes with each guide gene by Arabidopsis co-expression dating mining tools (ACT) identifies 797 candidate FA-correlated genes. Gene ontology (GO) analysis of these co-expressed genes showed they are tightly correlated to photosynthesis and carbohydrate metabolism, and function in many processes. Interestingly, 63 transcription factors (TFs) were identified as candidate FA biosynthesis regulators and 8 TF families are enriched. Two TF genes, CRC and AP1, both correlating with 8 FA guide genes, were further characterized. Analyses of the ap1 and crc mutant showed the altered total FA composition of mature seeds. The contents of palmitoleic acid, stearic acid, arachidic acid and eicosadienoic acid are decreased, whereas that of oleic acid is increased in ap1 and crc seeds, which is consistent with the qRT-PCR analysis revealing the suppressed expression of the corresponding guide genes. In addition, yeast one-hybrid analysis and electrophoretic mobility shift assay (EMSA) revealed that CRC can bind to the promoter regions of KCS7 and KCS15, indicating that CRC may directly regulate FA biosynthesis. © 2012 Institute of Botany, Chinese Academy of Sciences.

FA composition of heart and skeletal muscle during embryonic development of the king penguin.

PubMed

Decrock, Frederic; Groscolas, Rene; Speake, Brian K

2002-04-01

Since the yolk lipids of the king penguin (Aptenodytes patagonicus) naturally contain the highest concentrations of DHA and EPA yet reported for the eggs of any avian species, the effects of this (n-3)-rich yolk on the FA profiles of the embryonic heart and skeletal muscle were investigated. The concentrations (mg/g wet tissue) of phospholipid (PL) in the developing heart and leg muscle of the penguin doubled between days 27 and 55 from the beginning of egg incubation (i.e., from the halfway stage of embryonic development to 2 d posthatch), whereas no net increase occurred in pectoral muscle. During this period, the concentration of TAG in heart decreased by half but increased two- and sixfold in leg and pectoral muscle, respectively. The most notable change in cholesteryl ester concentration occurred in pectoral muscle, increasing ninefold between days 27 and 55. Arachidonic acid (ARA) was the major polyunsaturate in PL of the penguin's heart, where it formed about 20% (w/w) of FA at day 55. At the equivalent developmental stage, the heart PL of the chicken contained a 1.3-fold greater proportion of ARA, contained a fifth less DHA, and was almost devoid of EPA, whereas the latter FA was a significant component (7% of FA) of penguin heart PL. Similarly, in PL of leg and pectoral muscle, the chicken displayed about 1.4-fold more ARA, up to 50% less DHA, and far less EPA in comparison with the penguin. Thus, although ARA-rich PL profiles are achieved in the heart and muscle of the penguin embryo, these profiles are significantly affected by the high n-3 content of the yolk.

Ferulic acid ameliorates TNBS-induced ulcerative colitis through modulation of cytokines, oxidative stress, iNOs, COX-2, and apoptosis in laboratory rats

PubMed Central

Sadar, Smeeta S.; Vyawahare, Niraj S.; Bodhankar, Subhash L.

2016-01-01

Ulcerative colitis (UC) is a chronic immune-inflammatory disorder characterized by oxido-nitrosative stress, the release of pro-inflammatory cytokines and apoptosis. Ferulic acid (FA), a phenolic compound is considered to possess potent antioxidant, anti-apoptotic and anti-inflammatory activities. The aim is to evaluate possible mechanism of action of FA against trinitrobenzensulfonic acid (TNBS) induced ulcerative colitis (UC) in rats. UC was induced in Sprague-Dawley rats (150-200 g) by intrarectal administration of TNBS (100 mg/kg). FA was administered (10, 20 and 40 mg/kg, p.o.) for 14 days after colitis was induced. Various biochemical, molecular and histological changes were assessed in the colon. Intrarectal administration of TNBS caused significant induction of ulcer in the colon with an elevation of oxido-nitrosative stress, myeloperoxidase and hydroxyproline activity in the colon. Administration of FA (20 and 40 mg/kg) significantly decrease oxido-nitrosative stress, myeloperoxidase, and hydroxyproline activities. Up-regulated mRNA expression of TNF-α, IL-1β, IL-6, COX-2, and iNOs, as well as down-regulated IL-10 mRNA expressions after TNBS administration, were significantly inhibited by FA (20 and 40 mg/kg) treatment. Flow cytometric analysis revealed that intrarectal administration of TNBS-induced significantly enhanced the colonic apoptosis whereas administration of FA (20 and 40 mg/kg) significantly restored the elevated apoptosis. FA administration also significantly restored the histopathological aberration induced by TNBS. The findings of the present study demonstrated that FA ameliorates TNBS-induced colitis via inhibition of oxido-nitrosative stress, apoptosis, proinflammatory cytokines production, and down- regulation of COX-2 synthesis. Graphical Abstract: TNBS caused activation of T cells which interact with CD40 on antigen presenting cells i.e. dendritic cells (DC) that induce the key Interleukin 12 (IL-12)-mediated Th1 T cell immune

Organic matter in sediments of an acidic mining lake as assessed by lipid analysis. Part I: fatty acids.

PubMed

Poerschmann, Juergen; Koschorreck, Matthias; Górecki, Tadeusz

2012-01-01

Fatty acid (FA) patterns of sediments collected from the bottom of an acidic mine pit lake (AML) at different depths (surface sediment: 0 to 1cm; deep sediment: 4 to 5 cm) were studied to characterize microbial communities and the sources of sedimentary organic matter (SOM). Studies were performed on the molecular level utilizing source-specific, diagnostic FA biomarkers. The biomarker-based approach has been used widely in marine sediment studies, but has not been applied for sediments from AMLs so far. Combined FA concentrations in the surface sediment were higher compared to those in the deep sediment (497 vs. 127 μg g(-1)d.w., respectively). This was related to deposition of autochthonous biomass and higher terrestrial plants onto the surface sediment, as well as--to lesser extent--with higher bacterial activity on the sediment-water interface. The FA distribution in both sediments was characterized by a strong even-over-odd preference and was bimodal in nature: there was a cluster at nC(14)-nC(18) characteristic of chiefly autochthonous (algal and bacterial) SOM production, and another cluster at nC(22-28) related to input from higher plants. The FA distribution in the surface sediment pointed to higher terrestrial input compared to autochthonous contribution to SOM (67%:33%) as an estimate. Fingerprinting of viable bacteria was accomplished through signature FA markers including branched C(15) and C(17) surrogates, cyclopropanoic acids, 3-hydroxy (OH) acids and monounsaturated surrogates with unusual double bond localization. The abundance of Gram-negative bacteria was higher in the surface sediment as evidenced by total diagnostic 3-OH-fatty acids (37 μg g(-1) versus 25 μg g(-1)). Potential source taxa in both sediment layers included acidophilic iron- and sulfur-oxidizing bacteria including Acidithiobacillus ferrooxidans. High abundances of terminally branched C(15) and C(17) surrogates in both sediments pointed to sulfate- and iron-reducing bacteria

Adaptive Façade: Variant-Finding using Shape Grammar

NASA Astrophysics Data System (ADS)

Tomasowa, Riva; Utama Sjarifudin, Firza

2017-12-01

Modular façade construction has never been better since the birth of computer-aided manufacturing which bridges the modeling phase into the manufacturing phase for escalating the mass production. This comes to a result that the identity of a product or a building façade will commonly generate in the same way that the initial design was intended to. Rectifying the early model will then greatly impact the process later. The aim of this paper is to propose a way to solve these two challenges, without risking the manufacturing process, but more to explore the potential designs. Shape grammar is used to conceive more designs in the early stage, derived from the initial product - the modular adaptive façade system. The derivations are then tested through simulation to state the efficacy of the models. We find that the workflow somehow contributes to the better design and engineering process as well as the solution allows diversification in the façade expressions.

Formic acid catalyzed hydrolysis of SO3 in the gas phase: a barrierless mechanism for sulfuric acid production of potential atmospheric importance.

PubMed

Hazra, Montu K; Sinha, Amitabha

2011-11-02

Computational studies at the B3LYP/6-311++G(3df,3pd) and MP2/6-311++G(3df,3pd) levels are performed to explore the changes in reaction barrier height for the gas phase hydrolysis of SO(3) to form H(2)SO(4) in the presence of a single formic acid (FA) molecule. For comparison, we have also performed calculations for the reference reaction involving water assisted hydrolysis of SO(3) at the same level. Our results show that the FA assisted hydrolysis of SO(3) to form H(2)SO(4) is effectively a barrierless process. The barrier heights for the isomerization of the SO(3)···H(2)O···FA prereactive collision complex, which is the rate limiting step in the FA assisted hydrolysis, are found to be respectively 0.59 and 0.08 kcal/mol at the B3LYP/6-311++G(3df,3pd) and MP2/6-311++G(3df,3pd) levels. This is substantially lower than the ~7 kcal/mol barrier for the corresponding step in the hydrolysis of SO(3) by two water molecules--which is currently the accepted mechanism for atmospheric sulfuric acid production. Simple kinetic analysis of the relative rates suggests that the reduction in barrier height facilitated by FA, combined with the greater stability of the prereactive SO(3)···H(2)O···FA collision complex compared to SO(3)···H(2)O···H(2)O and the rather plentiful atmospheric abundance of FA, makes the formic acid mediated hydrolysis reaction a potentially important pathway for atmospheric sulfuric acid production.

5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group

DOEpatents

Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude

1999-01-01

The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.

FaStore - a space-saving solution for raw sequencing data.

PubMed

Roguski, Lukasz; Ochoa, Idoia; Hernaez, Mikel; Deorowicz, Sebastian