Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Sayanova, Olga; Haslam, Richard P; Calerón, Monica Venegas; López, Noemi Ruiz; Worthy, Charlotte; Rooks, Paul; Allen, Michael J; Napier, Johnathan A
2011-05-01
The Prymnesiophyceae coccolithophore Emiliania huxleyi is one of the most abundant alga in our oceans and therefore plays a central role in marine foodwebs. E. huxleyi is notable for the synthesis and accumulation of the omega-3 long chain polyunsaturated fatty acid docosahexaenoic acid (DHA; 22:6Δ(4,7,10,13,16,19), n-3) which is accumulated in fish oils and known to have health-beneficial properties to humans, preventing cardiovascular disease and related pathologies. Here we describe the identification and functional characterisation of the five E. huxleyi genes which direct the synthesis of docosahexaenoic acid in this alga. Surprisingly, E. huxleyi does not use the conventional Δ6-pathway, instead using the alternative Δ8-desaturation route which has previously only been observed in a few unrelated microorganisms. Given that E. huxleyi accumulates significant levels of the Δ6-desaturated fatty acid stearidonic acid (18:4Δ(6,9,12,15), n-3), we infer that the biosynthesis of DHA is likely to be metabolically compartmentalised from the synthesis of stearidonic acid. Copyright © 2011 Elsevier Ltd. All rights reserved.
Synthesis, characterisation and applications of coiled carbon nanotubes.
Hanus, Monica J; Harris, Andrew T
2010-04-01
Coiled carbon nanotubes are helical carbon structures formed when heptagonal and pentagonal rings are inserted into the hexagonal backbone of a 'straight' nanotube. Coiled carbon nanotubes have been reported with both regular and irregular helical structures. In this work the structure, growth mechanism(s), synthesis, properties and potential applications of coiled carbon nanotubes are reviewed. Published data suggests that coiled carbon nanotube synthesis occurs due to nonuniform extrusion of carbon from a catalyst surface. To date, coiled carbon nanotubes have been synthesised using catalyst modification techniques including: (i) the addition of S or P containing compounds during synthesis; (ii) the use of binary or ternary metal catalysts; (iii) the use of microwaves to create a local temperature gradient around individual catalyst particles and; (iv) the use of pH control during catalyst preparation. In most instances coiled carbon nanotubes are produced as a by-product; high yield and/or large-scale synthesis of coiled carbon nanotubes remains problematic. The qualitative analysis of coiled carbon nanotubes is currently hindered by the absence of specific characterisation data in the literature, e.g., oxidation profiles measured by thermogravimetric analysis and Raman spectra of pure coiled carbon nanotube samples.
Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando
2018-02-16
The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Purification, amino acid sequence and characterisation of kangaroo IGF-I.
Yandell, C A; Francis, G L; Wheldrake, J F; Upton, Z
1998-01-01
Insulin-like growth factor-I (IGF-I) and IGF-II have been purified to homogeneity from kangaroo (Macropus fuliginosus) serum, thus this represents the first report of the purification, sequencing and characterisation of marsupial IGFs. N-Terminal protein sequencing reveals that there are six amino acid differences between kangaroo and human IGF-I. Kangaroo IGF-II has been partially sequenced and no differences were found between human and kangaroo IGF-II in the 53 residues identified. Thus the IGFs appear to be remarkably structurally conserved during mammalian radiation. In addition, in vitro characterisation of kangaroo IGF-I demonstrated that the functional properties of human, kangaroo and chicken IGF-I are very similar. In an assay measuring the ability of the proteins to stimulate protein synthesis in rat L6 myoblasts, all IGF-I proteins were found to be equally potent. The ability of all three proteins to compete for binding with radiolabelled human IGF-I to type-1 IGF receptors in L6 myoblasts and in Sminthopsis crassicaudata transformed lung fibroblasts, a marsupial cell line, was comparable. Furthermore, kangaroo and human IGF-I react equally in a human IGF-I RIA using a human reference standard, radiolabelled human IGF-I and a polyclonal antibody raised against recombinant human IGF-I. This study indicates that not only is the primary structure of eutherian and metatherian IGF-I conserved, but also the proteins appear to be functionally similar.
Rajeshkumar, S; Bharath, L V
2017-08-01
Engineering a reliable and eco-accommodating methodology for the synthesis of metal nanoparticles is a crucial step in the field of nanotechnology. Plant-mediated synthesis of metal nanoparticles has been developed as a substitute to defeat the limitations of conventional synthesis approaches such as physical and chemical methods. Biomolecules, such as proteins, amino acids, enzymes, flavonoids, and terpenoids from several plant extracts have been used as a stabilising and reducing agents for the synthesis of AgNPs. Regardless of an extensive range of biomolecules assistance in the synthesis procedure, researchers are facing a significant challenge to synthesise stable and geometrically controlled AgNPs. In the past decade, several efforts were made to develop Plant-mediated synthesis methods to produce stable, cost effective and eco-friendly AgNPs. More than hundred different plants extract sources for synthesising AgNPs were described in the last decade by several researchers. Most of the reviews were focused on various plant sources for synthesis, various characterization techniques for characteristic analysis, and antibacterial activity against bacterial. There are many reviews are available for the plant-mediated synthesis of AgNPs as well as antibacterial activity of AgNPs but this is the first review article mainly focused on biomolecules of plants and its various parts and operating conditions involved in the synthesis. Apart from, this review includes the characterisation of AgNPs and antibacterial activity of such nanoparticles with size, shape and method used for this study. Copyright © 2017 Elsevier B.V. All rights reserved.
Electrochemical synthesis, characterisation and phytogenic properties of silver nanoparticles
NASA Astrophysics Data System (ADS)
Singaravelan, R.; Bangaru Sudarsan Alwar, S.
2015-12-01
This work exemplifies a simple and rapid method for the synthesis of silver nanodendrite with a novel electrochemical technique. The antibacterial activity of these silver nanoparticles (Ag NPs) against pathogenic bacteria was investigated along with the routine study of optical and spectral characterisation. The optical properties of the silver nanoparticles were characterised by diffuse reflectance spectroscopy. The optical band gap energy of the electrodeposited Ag NPs was determined from the diffuse reflectance using Kubelka-Munk formula. X-ray diffraction (XRD) studies were carried out to determine the crystalline nature of the silver nanoparticles which confirmed the formation of silver nanocrystals. The XRD pattern revealed that the electrodeposited Ag NPs were in the cubic geometry with dendrite preponderance. The average particle size and the peak broadening were deliberated using Debye-Scherrer equation and lattice strain due to the peak broadening was studied using Williamson-Hall method. Surface morphology of the Ag NPs was characterised by high-resolution scanning electron microscope and the results showed the high degree of aggregation in the particles. The antibacterial activity of the Ag NPs was evaluated and showed unprecedented level antibacterial activity against multidrug resistant strains such as Staphylococcus aureus, Bacillus subtilis, Klebsiella pneumonia and Escherichia coli in combination with Streptomycin.
Green synthesis and characterisation of platinum nanoparticles using quail egg yolk
NASA Astrophysics Data System (ADS)
Nadaroglu, Hayrunnisa; Gungor, Azize Alayli; Ince, Selvi; Babagil, Aynur
2017-02-01
Nanotechnology is extensively used in all parts today. Therefore, nano synthesis is also significant in all explored areas. The results of studies conducted have revealed that nanoparticle synthesis is performed by using both chemical and physical methods. It is well known that these syntheses are carried out at high charge, pressure and temperature in harsh environments. Therefore, this study investigated green synthesis method that sustains more mild conditions. In this study, quail egg yolk having high vitamin and protein content was prepared for green synthesis reaction and used for the synthesis of platinum nanoparticles in the reaction medium. Reaction situations were optimised as a function of pH, temperature, time and concentration by using quail egg yolk. The results showed that the highest platinum nanoparticles were synthesised at 20 °C and pH 6.0 for 4 h. Also, optimal concentration of metal ions was established as 0.5 mM. The synthesised platinum nanoparticles were characterised by using UV spectrum, X-ray diffraction and scanning electron microscope.
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Synthesis of guanidinoacetate and creatine from amino acids by rat pancreas.
da Silva, Robin P; Clow, Kathy; Brosnan, John T; Brosnan, Margaret E
2014-02-01
Creatine is an important molecule involved in cellular energy metabolism. Creatine is spontaneously converted to creatinine at a rate of 1·7% per d; creatinine is lost in the urine. Creatine can be obtained from the diet or synthesised from endogenous amino acids via the enzymes arginine:glycine amidinotransferase (AGAT) and guanidinoacetate N-methyltransferase (GAMT). The liver has high GAMT activity and the kidney has high AGAT activity. Although the pancreas has both AGAT and GAMT activities, its possible role in creatine synthesis has not been characterised. In the present study, we examined the enzymes involved in creatine synthesis in the pancreas as well as the synthesis of guanidinoacetate (GAA) and creatine by isolated pancreatic acini. We found significant AGAT activity and somewhat lower GAMT activity in the pancreas and that pancreatic acini had measurable activities of both AGAT and GAMT and the capacity to synthesise GAA and creatine from amino acids. Creatine supplementation led to a decrease in AGAT activity in the pancreas, though it did not affect its mRNA or protein abundance. This was in contrast with the reduction of AGAT activity and mRNA and protein abundance in the kidney, suggesting that the regulatory mechanisms that control the expression of this enzyme in the pancreas are different from those in the kidney. Dietary creatine increased the concentrations of GAA, creatine and phosphocreatine in the pancreas. Unexpectedly, creatine supplementation decreased the concentrations of S-adenosylmethionine, while those of S-adenosylhomocysteine were not altered significantly.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Martins, Cláudia P B; Freeman, Sally; Alder, John F; Brandt, Simon D
2009-08-14
The psychoactive properties of N,N-dimethyltryptamine (DMT) are known to induce altered states of consciousness in humans. These properties attract great interest from clinical, neuroscientific, clandestine and forensic communities. The Breath of Hope Synthesis was reported on an internet website as a convenient two-step methodology for the preparation of DMT. The analytical characterisation of the first stage was the subject of previous publications by the authors and involved the thermal decarboxylation of tryptophan and the formation of tryptamine. The present study reports on the characterisation of the second step of this procedure which was based on the methylation of tryptamine. This employed methyl iodide and benzyltriethylammonium chloride/sodium hydroxide as a phase transfer catalyst. The reaction product was characterised by liquid chromatography/electrospray ionisation tandem mass spectrometry and orthogonal acceleration time-of-flight mass spectrometry. Quantitative evaluation was carried out in positive multiple reaction monitoring mode (MRM), which included synthesis of the identified reaction products. MRM screening of the product did not lead to the detection of DMT. Instead, 11.1% tryptamine starting material, 21.0% N,N,N-trimethyltryptammonium iodide (TMT) and 47.4% 1-N-methyl-TMT were detected. A 0.5% trace of the monomethylated N-methyltryptamine was also detected. This study demonstrated the impact on product purity of doubtful synthetic methodologies discussed on the internet.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Synthesis and characterisation of mucoadhesive thiolated polyallylamine.
Duggan, Sarah; Hughes, Helen; Owens, Eleanor; Duggan, Elaine; Cummins, Wayne; O' Donovan, Orla
2016-02-29
The thiolation of polyallylamine (PAAm) for use in mucoadhesive drug delivery has been achieved. PAAm was reacted with different ratios of Traut's reagent, yielding products with thiol contents ranging from 134-487μmol/g. Full mucoadhesive characterisation of the thiolated PAAm samples was conducted using swelling studies, mucoadhesive testing on porcine intestinal tissue and rheology. Both swelling and cohesive properties of the thiolated PAAm products were vastly improved in comparison to an unmodified PAAm control. The swelling abilities of the thiolated samples were high and the degree of thiolation of the products affected the initial rate of swelling. High levels of mucoadhesion were demonstrated by the thiolated PAAm samples, with adhesion times of greater than 24h measured for all three samples and, thus, thiol content did not appear to influence mucoadhesion. Rheological studies of the thiolated PAAm samples showed an increase in G' and G″ values upon the addition of a mucin solution which was not observed in the unmodified control, again highlighting the mucoadhesive interactions between these thiolated polymers and mucin. The synthesis of thiolated PAAm by reaction with Traut's reagent and resulting mucoadhesive properties demonstrates its potential for use a mucoadhesive drug delivery device. Copyright © 2016 Elsevier B.V. All rights reserved.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Synthesis, characterisation and DFT studies of three Schiff bases derived from histamine
NASA Astrophysics Data System (ADS)
Touafri, Lasnouni; Hellal, Abdelkader; Chafaa, Salah; Khelifa, Abdellah; Kadri, Abdelaziz.
2017-12-01
In this paper, we report first, the synthesis and characterisation of three Schiff bases derived from histamine by condensation of histamine with various aldehydes. Then, we present a detailed DFT study based on B3LYP/6-31G(d,p) of geometrical structures and electronic properties of these compounds. The study was extended to the HOMO-LUMO analysis to calculate the energy gap (Δ), Ionisation potential (I), Electron Affinity (A), Global Hardness (η), Chemical Potential (μ), Electrophilicity (ω), Electronegativity (χ) and Polarisability (α). The calculated HOMO and LUMO energy reveals that the charge transfers occurring within the molecule. On the basis of vibration analyses, the thermodynamic properties of the titles compound were also calculated.
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Copper resinate: preparation, characterisation and study of degradation.
Colombini, M P; Lanterna, G; Mairani, A; Matteini, M; Modugno, F; Rizzi, M
2001-01-01
This paper describes a method for the synthesis of Copper Resinate, which disappeared from artists' palettes in the eighteenth century. This was carried out by interpreting ancient recipes following a scientific approach. Its characterisation using Fourier Transform-Infrared Spectrometry and Gas Chromatography-Mass Spectrometry demonstrated that it is a mixture containing copper and oxidised abietic acids, mainly dehydroabietic and 7-oxo-dehydroabietic acids, formed during the preparation of the pigment and the curing of the paint layer. The composition of copper resinate paint layers, artificially aged by U.V. irradiation at 365 nm (UV), heating (T), and exposed to atmospheric pollutants (NOX) in a climatic chamber, was investigated. The combination of irradiation and temperature produced a change in colour along with a significant increase in the recovered amount of 7-oxo-dehydroabietic acid. The identification of copper resinate in a sample from an old painting should be related to the presence of the following resin compounds which are stable in the ageing process: dehydroabietic and 7-oxo-dehydroabietic acid pimaradienic acids. Photo-oxidation of the resin acids co-ordinated with copper seem to be the most probable decay mechanism responsible for the colour change in the pigment.
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Paganelli, Fernanda L; van de Kamer, Tim; Brouwer, Ellen C; Leavis, Helen L; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A
2017-03-01
Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA) (1,3-polyglycerol-phosphate linked to glycolipid) in its cell wall. The small-molecule inhibitor 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] specifically blocks the activity of Staphylococcus aureus LtaS synthase, which polymerises 1,3-glycerolphosphate into LTA polymers. Here we characterised the effects of the small-molecule inhibitor 1771 on the growth of E. faecium isolates, alone (28 strains) or in combination with the antibiotics vancomycin, daptomycin, ampicillin, gentamicin or linezolid (15 strains), and on biofilm formation (16 strains). Inhibition of LTA synthesis at the surface of the cell by compound 1771 in combination with current antibiotic therapy abrogates enterococcal growth in vitro but does not affect mature E. faecium biofilms. Targeting LTA synthesis may provide new possibilities to treat MDR E. faecium infections. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Usha, Veeraraghavan; Lloyd, Adrian J.; Roper, David I.; Dowson, Christopher G.; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T.; Blindauer, Claudia A.; Besra, Gurdyal S.
2016-01-01
With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculosis DapE (MtDapE) was cloned, over-expressed and purified as an N-terminal hexahistidine ((His)6) tagged fusion containing one zinc ion per DapE monomer. We redesigned the DAP synthetic pathway to generate L,L-NSDAP and other L,L-NSDAP derivatives and have characterised MtDapE with these substrates. In contrast to its other Gram negative homologues, the MtDapE was insensitive to inhibition by L-captopril which we show is consistent with novel mycobacterial alterations in the binding site of this drug. PMID:26976706
Usha, Veeraraghavan; Lloyd, Adrian J; Roper, David I; Dowson, Christopher G; Kozlov, Guennadi; Gehring, Kalle; Chauhan, Smita; Imam, Hasan T; Blindauer, Claudia A; Besra, Gurdyal S
2016-03-15
With the increased incidence of tuberculosis (TB) caused by Mycobacterium tuberculosis there is an urgent need for new and better anti-tubercular drugs. N-succinyl-L,L-diaminopimelic acid desuccinylase (DapE) is a key enzyme in the succinylase pathway for the biosynthesis of meso-diaminopimelic acid (meso-DAP) and L-lysine. DapE is a zinc containing metallohydrolase which hydrolyses N-succinyl L,L diaminopimelic acid (L,L-NSDAP) to L,L-diaminopimelic acid (L,L-DAP) and succinate. M. tuberculosis DapE (MtDapE) was cloned, over-expressed and purified as an N-terminal hexahistidine ((His)6) tagged fusion containing one zinc ion per DapE monomer. We redesigned the DAP synthetic pathway to generate L,L-NSDAP and other L,L-NSDAP derivatives and have characterised MtDapE with these substrates. In contrast to its other Gram negative homologues, the MtDapE was insensitive to inhibition by L-captopril which we show is consistent with novel mycobacterial alterations in the binding site of this drug.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Synthesis and characterisation of the uranium pyrochlore betafite [(Ca,U)₂(Ti,Nb,Ta)₂O₇].
McMaster, Scott A; Ram, Rahul; Charalambous, Fiona; Pownceby, Mark I; Tardio, James; Bhargava, Suresh K
2014-09-15
Betafite of composition [(Ca,U)2(Ti,Nb,Ta)2O7] was prepared via a solid state synthesis route. The synthesis was shown to be sensitive to initial reactant ratios, the atmosphere used (oxidising, neutral, reducing) and time. The optimum conditions for the synthesis of betafite were found to be heating the reactants required at 1150°C for 48 h under an inert gas atmosphere. XRD characterisation revealed that the synthesised betafite contained minor impurities. EPMA analysis of a sectioned surface showed very small regions of Ca-free betafite on grain boundaries as well as minor rutile impurities. Some heterogeneity between the Nb:Ta ratio was observed by quantitative EPMA but was generally within the nomenclature requirements stated for betafite. SEM analysis revealed the synthesised betafite was comprised mostly of hexaoctohedral crystals of ∼ 3 μm in diameter. XPS analysis of the sample showed that the uranium in the synthesised betafite was predominately present in the U(5+) oxidation state. A minor amount of U(6+) was also detected which was possibly due to surface oxidation. Copyright © 2014 Elsevier B.V. All rights reserved.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Whitney, Heather M; Michaelson, Louise V; Sayanova, Olga; Pickett, John A; Napier, Johnathan A
2003-10-01
The Ranunculaceae are known to accumulate a wide range of unusual fatty acids in their seed lipids, and this variability has been advocated as a taxonomic marker. The Anemone species, Anemone leveillei L. and Anemone rivularis Buch.-Ham., have previously been reported to accumulate Delta5-desaturated fatty acids in their seed tissue [K. Aitzetmüller (1995) Plant Syst Evol 9:229-240]. Two cDNAs, AL1 and AL2, with similarity to plant cytochrome b5-fusion "front-end" desaturases were isolated from developing seeds of A. leveillei and their function identified by expression in Saccharomyces cerevisiae. AL2 was characterised as a sphingolipid long-chain-base Delta8-desaturase, while AL1 acted as a fatty acid desaturase. However, AL1 did not produce Delta5-desaturated fatty acids as expected; instead, when expressed in transgenic S. cerevisiae or Arabidopsis thaliana this enzyme was functionally characterised as a Delta6-desaturase. Northern analysis confirmed the expression of this gene in seed tissue and leaf tissue of A. leveillei, though Delta6-desaturated fatty acids were found to accumulate only in the leaf tissue. The unexpected characterisation of a Delta6-desaturase in A. leveillei has implications for the use of fatty acids in chemotaxonomic studies. This is also the first report of a higher-plant Delta6-desaturase from a family other than the Boraginaceae.
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Mechanochemical synthesis and intercalation of Ca(II)Fe(III)-layered double hydroxides
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ferencz, Zs.; Szabados, M.; Varga, G.
2016-01-15
A mechanochemical method (grinding the components without added water – dry grinding, followed by further grinding in the presence of minute amount of water or NaOH solution – wet grinding) was used in this work for the preparation and intercalation of CaFe-layered double hydroxides (LDHs). Both the pristine LDHs and the amino acid anion (cystinate and tyrosinate) intercalated varieties were prepared by the two-step grinding procedure in a mixer mill. By systematically changing the conditions of the preparation method, a set of parameters could be determined, which led to the formation of close to phase-pure LDH. The optimisation procedure wasmore » also applied for the intercalation processes of the amino acid anions. The resulting materials were structurally characterised by a range of methods (X-ray diffractometry, scanning electron microscopy, energy dispersive analysis, thermogravimetry, X-ray absorption and infra-red spectroscopies). It was proven that this simple mechanochemical procedure was able to produce complex organic–inorganic nanocomposites: LDHs intercalated with amino acid anions. - Graphical abstract: Amino acid anion-Ca(II)Fe(III)-LDHs were successfully prepared by a two-step milling procedure. - Highlights: • Synthesis of pristine and amino acid intercalated CaFe-LDHs by two-step milling. • Identifying the optimum synthesis and intercalation parameters. • Characterisation of the samples with a range of instrumental methods.« less
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
2017-01-01
Summary Bionic acids are bioactive compounds demonstrating numerous interesting properties. They are widely produced by chemical or enzymatic oxidation of disaccharides. This paper focuses on the galactosyl derivative of gluconic acid as a result of a new method of bionic acid synthesis which utilises the transglycosylation properties of β-galactosidase and introduces lactose as a substrate. Products obtained in such a process are characterised by different structures (and, potentially, properties) than those resulting from traditional oxidation of disaccharides. The aim of this study is to determine the effect of selected parameters (concentration and ratio of substrates, dose of the enzyme, time, pH, presence of salts) on the course of the reaction carried out with the enzymatic preparation Lactozym, containing β-galactosidase from Kluyveromyces lactis. Research has shown that increased dry matter content in the baseline solution (up to 50%, by mass per volume) and an addition of NaCl contribute to higher yield. On the other hand, reduced content of the derivative is a result of increased pH from 7.0 to 9.0 and an addition of magnesium and manganese salts. Moreover, exceeding the β-galactosidase dose over approx. 35 000 U per 100 g of lactose also leads to reduced yield of the process. The most favourable molar ratio of sodium gluconate to lactose is 2.225:0.675. Depending on the conditions of the synthesis, the product concentration ranged between 17.3 and 118.3 g/L of the reaction mixture, which corresponded to the mass fraction of 6.64–23.7% of dry matter. The data obtained as a result of the present study may be useful for designing an industrial process. PMID:28867957
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
NASA Astrophysics Data System (ADS)
Aguiló-Aguayo, Noemí; Bechtold, Thomas
2014-05-01
New electrode designs are required for electrochemical applications such as batteries or fuel cells. Embroidered 3D Cu porous electrodes with a geometric surface of 100 cm2 are presented and characterised by means of the anthraquinone-1,5-disfulfonic acid (AQDS2-) redox system in alkaline solution. The electrochemical behaviour of the 3D electrode is established by the comparison of cyclic voltammetry responses using a micro cell and a 100 cm2 plane Cu-plate electrode. Dependencies of the peak currents and peak-to-peak potential separation on scan rate and AQDS2- concentration are studied. The AQDS2- characterisation is also performed by means of spectroelectrochemical experiments.
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
NASA Astrophysics Data System (ADS)
Kamnev, Alexander A.; Calce, Enrica; Tarantilis, Petros A.; Tugarova, Anna V.; De Luca, Stefania
2015-01-01
Chemically modified pectin derivatives obtained by partial esterification of its hydroxyl moieties with fatty acids (FA; oleic, linoleic and palmitic acids), as well as the initial apple peel pectin were comparatively characterised using diffuse reflectance infrared Fourier transform (DRIFT) spectroscopy. Characteristic changes observed in DRIFT spectra in going from pectin to its FA esters are related to the corresponding chemical modifications. Comparing the DRIFT spectra with some reported data on FTIR spectra of the same materials measured in KBr or NaCl matrices has revealed noticeable shifts of several polar functional groups both in pectin and in its FA-esterified products induced by the halide salts. The results obtained have implications for careful structural analyses of biopolymers with hydrophilic functional groups by means of different FTIR spectroscopic methodologies.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
The first proton sponge-based amino acids: synthesis, acid-base properties and some reactivity.
Ozeryanskii, Valery A; Gorbacheva, Anastasia Yu; Pozharskii, Alexander F; Vlasenko, Marina P; Tereznikov, Alexander Yu; Chernov'yants, Margarita S
2015-08-21
The first hybrid base constructed from 1,8-bis(dimethylamino)naphthalene (proton sponge or DMAN) and glycine, N-methyl-N-(8-dimethylamino-1-naphthyl)aminoacetic acid, was synthesised in high yield and its hydrobromide was structurally characterised and used to determine the acid-base properties via potentiometric titration. It was found that the basic strength of the DMAN-glycine base (pKa = 11.57, H2O) is on the level of amidine amino acids like arginine and creatine and its structure, zwitterionic vs. neutral, based on the spectroscopic (IR, NMR, mass) and theoretical (DFT) approaches has a strong preference to the zwitterionic form. Unlike glycine, the DMAN-glycine zwitterion is N-chiral and is hydrolytically cleaved with the loss of glycolic acid on heating in DMSO. This reaction together with the mild decarboxylative conversion of proton sponge-based amino acids into 2,3-dihydroperimidinium salts under air-oxygen was monitored with the help of the DMAN-alanine amino acid. The newly devised amino acids are unique as they combine fluorescence, strongly basic and redox-active properties.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Wang, Biying; Bai, Yajun; Fan, Taiping; Zheng, Xiaohui; Cai, Yujie
2017-10-01
Alpha-keto acid decarboxylases can convert keto acids to their corresponding aldehydes, which are often volatile aroma compounds. The gene encoding α-keto acid decarboxylase in Proteus mirabilis JN458 was cloned, and the enzyme overexpressed in Escherichia coli BL21 (DE3), purified in high yield, and characterised. The molecular weight is 62.291kDa by MALDI-TOF MS, and optimum activity at pH 6.0 and 40-50°C. The enzyme is a typical decarboxylase, dependent on thiamine diphosphate and Mg 2+ as cofactors. For the decarboxylation reaction, the enzyme displayed a broad substrate range. Kinetic parameters were determined using 4-methyl-2-oxopentanoic acid, phenyl pyruvate and 3-methyl-2-oxopentanoic acid as substrates. K m and k cat values for phenyl pyruvate were 0.62mM and 77.38s -1 , respectively, and the k cat /K m value was 124.81mM -1 s -1 . The enzyme properties suggest it may act effectively under cheese ripening conditions. Copyright © 2017. Published by Elsevier Ltd.
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
NASA Astrophysics Data System (ADS)
Filipe Rodrigues, Artur; Newman, Leon; Lozano, Neus; Mukherjee, Sourav P.; Fadeel, Bengt; Bussy, Cyrill; Kostarelos, Kostas
2018-07-01
Graphene-based materials (GBMs) have ignited a revolution in material science and technology, with electronic, optical and mechanical properties that are of relevant interest for a wide range of applications. To support the development of these enabling technologies, a global research effort has been invested to assess their hazard and biocompatibility. Different production methods have however generated a diverse collection of GBMs with different physicochemical properties, leading to a variety of biological outcomes that are still not fully understood. To better understand the biological interactions of GBMs with biological systems and allow the design of safer materials, a thorough physicochemical characterisation is therefore highly recommended. The aim of the present work was to produce a blueprint for the synthesis and characterisation of non-pyrogenic graphene oxide (GO) flakes with three different controlled lateral dimensions, which could be further used for either hazard assessment or biomedical proof-of-concept studies. A battery of techniques used to characterise the physicochemical properties of the GO samples included atomic force microscopy, transmission electron microscopy, Fourier-transformed infra-red spectroscopy, x-ray photoelectron spectroscopy and Raman spectroscopy. The combination of these different techniques confirmed that only the lateral dimension varied among the GO materials produced, without significant change in any other of their fundamental physicochemical properties, such as the thickness or surface chemistry. The proposed systematic approach in GO batch production for biology will hopefully contribute to a better understanding of the material properties that govern their interactions with biological systems and offer a blueprint towards standardisation of biologically relevant 2D materials.
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Synthesis and antioxidant properties of a new lipophilic ascorbic acid analogue.
Cotelle, Philippe; Cotelle, Nicole; Teissier, Elisabeth; Vezin, Hervé
2003-03-20
4-(4-Hydroxyphenyl)-5-(4-hydroxyphenylmethyl)-2-hydroxyfurane-2-one 1 was prepared by an acidic dimerisation of 4-hydroxyphenylpyruvic acid and some of its antioxidant and spectroscopic properties have been measured and compared to that of ascorbic acid. 1 is as good an antioxidant as ascorbic acid in the DPPH (2,2-diphenyl-1-picryl hydrazyl radical) test and the inhibition of hydroxyl radical and a powerful inhibitor of the Cu(2+) or AAPH (2,2'-azobis-(2-amidinopropane) dihydrochloride) induced oxidation of human LDL. 1 gives a stable radical characterised by its ESR spectrum similarly to ascorbic acid but in lower concentration and with a different reactivity towards nitroxides. Theoretical calculations allow us to propose the structure for the radical formed from 1, to explain its lower stability than ascorbyl radical and to evaluate the lipophilicity of 1.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Saranya, T S; Rajan, V K; Biswas, Raja; Jayakumar, R; Sathianarayanan, S
2018-04-15
Curcumin is a diaryl heptanoid of curcuminoids class obtained from Curcuma longa. It possesses various biological activities like anti-inflammatory, hypoglycemic, antioxidant, wound-healing, and antimicrobial activities. Chitosan is a biocompatible, biodegradable and non-toxic natural polymer which enhances the adhesive property of the skin. Chemical conjugation will leads to sustained release action and to enhance the bioavailability. This study aims to synthesis and characterize biocompatible curcumin conjugated chitosan microspheres for bio-medical applications. The Schiff base reaction was carried out for the preparation of curcumin conjugated chitosan by microwave method and it was characterised using FTIR and NMR. Curcumin conjugated chitosan microspheres (CCCMs) were prepared by wet milling solvent evaporation method. SEM analysis showed these CCCMs were 2-5μm spherical particles. The antibacterial activities of the prepared CCCMs were studied against Staphylococcus aureus and Escherichia coli, the zone of inhibition was 28mm and 23mm respectively. Antioxidant activity of the prepared CCCMs was also studied by DPPH and H 2 O 2 method it showed IC 50 esteem value of 216μg/ml and 228μg/ml, and anti-inflammatory activity results showed that CCCMs having IC 50 value of 45μg/ml. The results conclude that the CCCMs having a good antibacterial, antioxidant and anti-inflammatory activities. This, the prepared CCCMs have potential application in preventing skin infections. Copyright © 2017. Published by Elsevier B.V.
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Gasser, Gilles; Brosch, Oliver; Ewers, Alexandra; Weyhermüller, Thomas; Metzler-Nolte, Nils
2009-06-14
The rational, sequential synthesis of two hetero-bimetallic derivatives of the amino acid phenylalanine and one thymine (T) peptide nucleic acid (PNA) monomer is reported. Ferrocene carboxylic acid and (eta-ethene)bis(triphenylphosphine)platinum(0) were successfully reacted with propargylamide amino acid (1a and 1b) or a T PNA monomer derivative (6) to give the expected three bimetallic compounds 4a, 4b and 9 in good yield. An enzymatic route using cross-linked enzyme crystals (CLEC) of subtilopeptidase A in organic solvents gave the ferrocene carboxylate phenylalanine propargylamide precursor (Fc-CO-Phe-NH-CH(2)-CCH, 3a) in comparable yield and purity to the traditional deprotection-peptide coupling sequence. (31)P NMR spectra of these bioorganometallics showed two doublets with (195)Pt satellites corresponding to two chemically different (31)P atoms. Interestingly, in the case of the T PNA monomer derivative 9, these signals were also doubled in a 60 : 40 ratio as a consequence of the existence of two slowly interconverting isomers in solution. Furthermore, the single-crystal X-ray structures of 3a and the hetero-bimetallic phenylalanine derivative 4b were determined, showing the presence of the two organometallics moieties separated by ca. 8.5 A in 4b as well as illustrating the stability of such compounds.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
NASA Astrophysics Data System (ADS)
Amer, Ahcene Ait; Ilikti, Hocine; Maschke, Ulrich
2017-11-01
This article deals with the synthesis and characterisation of seven new functional Schiff base monomers, such as: M1: 1-(3-Pyrrole-1-yl-propylimino-methyl)-naphtalen-2-ol; M2: 2-(3-Pyrrole-1-yl-phenylimino-methyl)-phenol; M3: 1-(3-Pyrrole-1-yl-phenylimino-methyl)-naphtalen-2-ol; M4: N-(pyridin-2-yl-methylene)-2-(pyrrol-1-yl)-benzenamine; M5: N-(pyridin-2-yl-methylene)-3-(pyrrol-1-yl)-propan-1-amine; M6: 2-(3-pyrrol-1-yl-propylimino-methyl)-quinolin-8-ol; M7: 2-(3-pyrrol-1-yl-phenylimino-methyl)-quinolin-8-ol. Two series of compounds emerged from this study, N-propyl pyrrole derivatives (M1, M5, M6) and N-phenyl pyrrole compounds (M2, M3, M4, M7). All monomers were elaborated by condensation reactions between appropriate amines and aldehydes, and their molecular structures were confirmed by spectroscopic analysis methods like FT-IR, 1H NMR, 13C NMR, and GC-MS.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Sol-gel synthesis and characterisation of nano-scale hydroxyapatite
NASA Astrophysics Data System (ADS)
Bilton, M.; Brown, A. P.; Milne, S. J.
2010-07-01
Hydroxyapatite (HAp) forms the main mineral component of bone and teeth. This naturally occurring HAp is in the form of nano-metre sized crystallites of Ca10(PO4)6(OH)2 that contain a number of cation and anion impurities, for example CO32-, F-, Na+, Mg2+ and Sr2+. Synthetic nano-sized HAp particles exhibit favourable biocompatibility and bioactivity and in order to better match the composition to natural HAp there is great interest in producing a range of chemically modified powders. In this study, two HAp powders have been synthesised via a water-based low-temperature sol-gel method and a third, commercial powder from Sigma-Aldrich have been analysed. Subsequent powder calcination has been carried out within the temperature range of 500-700 °C and the products characterised by bulk chemical analysis, X-ray diffraction and electron microscopy. Energy dispersive X-ray spectroscopy (EDX) in the TEM has been used to assess the composition of individual HAp particles. In order to do this accurately it is first necessary to account for the sensitivity of the HAp structure and composition to irradiation by the high energy electron beam of the TEM. This was done by monitoring the estimated Ca/P ratio derived from TEM-EDX of stoichiometric HAp under increasing levels of electron fluence. A fluence threshold (at a given beam energy) was established below which the measured Ca/P ratio can be considered to be stable. Subsequent elemental analysis at or below this threshold has enabled the variation in composition between particles both within and between synthesis batches to be accurately assessed. Compositional variability between particles is also evident, even in the commercial powder, but is far greater in the powders prepared by the sol-gel method.
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Biochemical characterisation of the esterase activities of wine lactic acid bacteria.
Matthews, Angela; Grbin, Paul R; Jiranek, Vladimir
2007-11-01
Esters are an important group of volatile compounds that can contribute to wine flavour. Wine lactic acid bacteria (LAB) have been shown to produce esterases capable of hydrolysing ester substrates. This study aims to characterise the esterase activities of nine LAB strains under important wine conditions, namely, acidic conditions, low temperature (to 10 degrees C) and in the presence of ethanol (2-18% v/v). Esterase substrate specificity was also examined using seven different ester substrates. The bacteria were generally found to have a broad pH activity range, with the majority of strains showing maximum activity close to pH 6.0. Exceptions included an Oenococcus oeni strain that retained most activity even down to a pH of 4.0. Most strains exhibited highest activity across the range 30-40 degrees C. Increasing ethanol concentration stimulated activity in some of the strains. In particular, O. oeni showed an increase in activity up to a maximum ethanol concentration of around 16%. Generally, strains were found to have greater activity towards short-chained esters (C2-C8) compared to long-chained esters (C10-C18). Even though the optimal physicochemical conditions for enzyme activity differed from those found in wine, these findings are of potential importance to oenology because significant activities remained under wine-like conditions.
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Surface characterisation of ethylene propylene diene rubber upon exposure to aqueous acidic solution
NASA Astrophysics Data System (ADS)
Mitra, Susanta; Ghanbari-Siahkali, Afshin; Kingshott, Peter; Hvilsted, Søren; Almdal, Kristoffer
2006-07-01
Two types of pure ethylene propylene diene rubbers were exposed to two different acids for varying period of time. Surface characterisation was carried out using X-ray photoelectron spectroscopy (XPS). Two EPDM rubbers selected for this study were comparable in co-monomer compositions but significantly different with respect to molar mass and the presence of long chain branching. Both rubbers contained 5-ethylidene-2-norbornene (ENB) as diene. Solution cast films of pure EPDM samples were exposed in two different acidic solutions, viz. chromosulphuric (Cr (VI)/H 2SO 4) and sulphuric acid (H 2SO 4) (20%, v/v) at ambient temperature from 1 to 12 weeks. XPS analysis indicated that several oxygenated species were formed on the surface of both rubbers after exposure. It was postulated from the XPS analyses that both aqueous acidic solutions attacked the olefinic double bonds (C dbnd C) of ENB. Furthermore, 20% Cr (VI)/H 2SO 4 also attacked the allylic carbon-hydrogen (C sbnd H) bonds of ENB resulting in more oxygenated species on the surface compared to 20% H 2SO 4 under identical conditions. Cr (VI) in the 20% Cr (VI)/H 2SO 4 was found to play an important role in alteration of surface chemistry. Studies using a model system consisting of EPDM mixed with Cr (VI) and Cr (III) salts revealed that the change of oxidation state from Cr (VI) to Cr (III) as a consequence of direct involvement of Cr (VI) in the chemical alteration of EPDM surfaces. Interestingly, the presence of long chain branching and molar mass did not significantly influence the chemical processes owing to the acid treatment.
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Paseiro-Cerrato, R; Rodríguez-Bernaldo de Quirós, A; Sendón, R; Bustos, J; Sánchez, J J; López-Hernández, J; Paseiro-Losada, P
2015-01-01
It is a well-known fact that amines are not stable in food of a fatty nature. In this study the synthesis and characterisation of the products obtained as a result of the reaction of amines in a fatty medium are reported. Based on the well-known reactions among amines and acid and esters groups, two novel compounds were synthesised using m-xylylenediamine (mXDA), a primary diamine widely used as monomer in the manufacture of food contact materials and two fatty acids, oleic acid and palmitic acid, which occur in most fats. The resulting compounds were two molecules belonging to the family of fatty acid amides, dioleamide and dipalmitamide. A complete characterisation of both products was carried out employing several techniques such as infrared spectroscopy, (1)H- and (13)C-NMR spectroscopy, electron ionisation mass spectrometry, LC-MS/MS and UV spectrometry. The results obtained by the different techniques were well correlated. In the second part of the work, the formation of these compounds in real samples was evaluated. For this purpose a certain volume of olive oil was spiked with a known amount of mXDA. Olive oil was selected as a fatty medium since it is a widely consumed food and additionally is used as a fatty food simulant in migration studies of food contact materials. A method was developed to extract the fatty acid amides from the fatty matrix, which were then identified by LC-MS/MS. The toxicity of the synthesised compounds was predicted using a toxicity estimation software tool.
Wölk, Christian; Drescher, Simon; Meister, Annette; Blume, Alfred; Langner, Andreas; Dobner, Bodo
2013-09-16
A series of novel malonic acid diamides (second generation) with two long hydrophobic alkyl chains and an alkaline polar head group was synthesised and characterised as a new class of amino-functionalised lipids. These peptide-mimic lipids are suitable for polynucleotide transfer. The lipids bear a novel backbone consisting of a lysine unit and a malonic acid unit. Six different head-group structures, which vary in size and number of amino groups that can be protonated, were attached to the backbone structure. Furthermore, different alkyl chains were used to build the lipophilic part (namely tetradecyl, hexadecyl, and oleyl). Phase transitions of the new compounds in aqueous dispersions at pH 10 were analysed and discussed in terms of head group and alkyl chain variations. The shape and size of the formed aggregates of selected lipid dispersions were investigated by dynamic light scattering and transmission electron microscopy. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Bhatt, Ronak; Sreedhar, B; Padmaja, P
2017-11-01
A facile synthesis of Chitosan Supramolecularly cross-linked with Trimesic Acid (CTMA) is reported in this work. The adsorption potential of CTMA for removal of hexavalent chromium was evaluated and the influence of pH, temperature, contact time and adsorbent dose on the adsorption process was investigated. The experimental results showed that CTMA could efficiently adsorb Cr 6+ and partially reduce it to the less toxic Cr 3+ state. The maximum adsorption capacity of CTMA for Cr 6+ was found to be 129.53mg/g at pH 2.0. CTMA and chromium loaded CTMA were characterised by FT-IR, Raman, TGA-DSC, SEM-EDX, XRD, ESR and XPS spectroscopic techniques. Chitosan was observed to be cross- linked with TMA via ionic, hydrogen bonding and pi-pi supramolecular interactions while adsorption of chromium onto CTMA was by electrostatic forces and hydrogen bonding. From the observed results it was evident that CTMA was successfully applied for simultaneous removal of chromium, lead and iron from chrome plating effluent. Copyright © 2017 Elsevier B.V. All rights reserved.
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Monroig, Óscar; de Llanos, Rosa; Varó, Inmaculada; Hontoria, Francisco; Tocher, Douglas R.; Puig, Sergi; Navarro, Juan C.
2017-01-01
Polyunsaturated fatty acids (PUFAs) have been acknowledged as essential nutrients for cephalopods but the specific PUFAs that satisfy the physiological requirements are unknown. To expand our previous investigations on characterisation of desaturases and elongases involved in the biosynthesis of PUFAs and hence determine the dietary PUFA requirements in cephalopods, this study aimed to investigate the roles that a stearoyl-CoA desaturase (Scd) and an elongation of very long-chain fatty acid 4 (Elovl4) protein play in the biosynthesis of essential fatty acids (FAs). Our results confirmed the Octopus vulgaris Scd is a ∆9 desaturase with relatively high affinity towards saturated FAs with ≥ C18 chain lengths. Scd was unable to desaturate 20:1n-15 (∆520:1) suggesting that its role in the biosynthesis of non-methylene interrupted FAs (NMI FAs) is limited to the introduction of the first unsaturation at ∆9 position. Interestingly, the previously characterised ∆5 fatty acyl desaturase was indeed able to convert 20:1n-9 (∆1120:1) to ∆5,1120:2, an NMI FA previously detected in octopus nephridium. Additionally, Elovl4 was able to mediate the production of 24:5n-3 and thus can contribute to docosahexaenoic acid (DHA) biosynthesis through the Sprecher pathway. Moreover, the octopus Elovl4 was confirmed to play a key role in the biosynthesis of very long-chain (>C24) PUFAs. PMID:28335553
Monroig, Óscar; de Llanos, Rosa; Varó, Inmaculada; Hontoria, Francisco; Tocher, Douglas R; Puig, Sergi; Navarro, Juan C
2017-03-21
Polyunsaturated fatty acids (PUFAs) have been acknowledged as essential nutrients for cephalopods but the specific PUFAs that satisfy the physiological requirements are unknown. To expand our previous investigations on characterisation of desaturases and elongases involved in the biosynthesis of PUFAs and hence determine the dietary PUFA requirements in cephalopods, this study aimed to investigate the roles that a stearoyl-CoA desaturase (Scd) and an elongation of very long-chain fatty acid 4 (Elovl4) protein play in the biosynthesis of essential fatty acids (FAs). Our results confirmed the Octopus vulgaris Scd is a ∆9 desaturase with relatively high affinity towards saturated FAs with ≥ C 18 chain lengths. Scd was unable to desaturate 20:1 n- 15 ( ∆5 20:1) suggesting that its role in the biosynthesis of non-methylene interrupted FAs (NMI FAs) is limited to the introduction of the first unsaturation at ∆9 position. Interestingly, the previously characterised ∆5 fatty acyl desaturase was indeed able to convert 20:1 n- 9 ( ∆11 20:1) to ∆5,11 20:2, an NMI FA previously detected in octopus nephridium. Additionally, Elovl4 was able to mediate the production of 24:5 n- 3 and thus can contribute to docosahexaenoic acid (DHA) biosynthesis through the Sprecher pathway. Moreover, the octopus Elovl4 was confirmed to play a key role in the biosynthesis of very long-chain (>C 24 ) PUFAs.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hempel, K.
1962-01-01
New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)
Carballeira, N M; Emiliano, A; Hernández-Alonso, N; González, F A
1998-12-01
The total synthesis of the naturally occurring (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid was accomplished using as a key step Mukaiyama's trimethylsilyl cyanide addition to 4- and 5-pentadecenal, respectively. These syntheses further confirm the structures of the natural marine fatty acids and corroborate their cis double-bond stereochemistry. The title compounds were antimicrobial against the Gram-positive bacteria Staphylococcus aureus (MIC 0.35 micromol/mL) and Streptococcus faecalis (MIC 0.35 micromol/mL).
Li, Yang
2011-01-01
We have accomplished an asymmetric synthesis of each enantiomer of 4,4-difluoroglutamic acid. This α-amino acid has been of interest in medicinal chemistry circles. Key features of the synthesis include highly scalable procedures, a Reformatsky-based coupling reaction, and straightforward functional group manipulations to make the parent amino acid. Enantioenrichment derives from an enzymatic resolution of the synthetic material. Conversion of the optically enriched compounds to orthogonally protected forms allows selective formation of peptide bonds. 4,4- Difluoroglutamic acid, in a suitably protected form, is also shown to exhibit enhanced catalytic activity in both an oxidation reaction and a reduction reaction, in comparison to the analogous glutamic acid derivative. PMID:22039908
Cao, Jing; Dong, Shuding; Jiang, Delu; Zhu, Peiyu; Zhang, Han; Li, Rui; Li, Zhanyi; Wang, Xuanyu; Tang, Weifang; Du, Ding
2017-04-21
β-Functionalization of indolin-2-one-derived aliphatic acids has been applied in formal [3 + 2] annualtions for catalyst-free and divergent synthesis of two series of structurally interesting 3,3'-spirooxindole γ-butyrolactones that may be attractive for potential drug discovery. These findings also pave the way for further diversity-oriented synthesis of spirooxindoles starting from indolin-2-one-derived aliphatic acids or their derivatives.
Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa
2018-04-01
In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.
NASA Astrophysics Data System (ADS)
Dodoo-Arhin, D.; Nuamah, R. A.; Jain, P. K.; Obada, D. O.; Yaya, A.
2018-06-01
SnO2 nanoparticles were synthesized using the hydrothermal technique. Well crystalline particles with different morphologies and crystallite size in the range of 2 nm-10 nm were obtained by using Urea and Soduim Borohydride as reducing agents, and deploying Dioctyl Sulfosuccinate Sodium Salt (AOT) and Cetyl Trimethyl ammonium bromide (CTAB) as the surfactants. Samples have been characterised by X-ray diffraction, Scanning Electron microscopy, Energy Dispersive X-ray spectroscopy, specific surface area, porosity, and Fourier Transform Infrared spectroscopy. Preliminary studies on the potential electrochemical properties of the as-produced nanoparticles were investigated using cyclic voltammetry, electrochemical impedance spectroscopy and potentiostatic charge-discharge in aqueous KOH electrolyte. The surfactant and reducing agents used in the synthesis procedure of SnO2 nanoparticles influenced the particle size and the morphology, which in turn influenced the capacitance of the SnO2 nanoparticles. The SnO2 electrode material showed pseudocapacitor properties with a maximum capacitance value of 1.6 Fg-1 at a scan rate of 5 mVs-1, an efficiency of 52% at a current of 1 mA and a maximum capacitance retention of about 40% after 10 cycles at a current of 1 mA. From the Nyquist plot, The ESR for the samples increase accordingly as SCA (31.5 Ω) < SAA (31.85 Ω) < SE (36.3 Ω) < SAT (36.92 Ω) < SCT (40.41 Ω) < SA < SC (53.97 Ω). These values are a confirmation of the low capacitance, efficiencies and capacitance retention recorded. The results obtained demonstrate the potential electrochemical storage applications of SnO2 nanoparticles without the addition of conductive materials.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T
2012-01-01
Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contentsmore » were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.« less
Physicochemical characterisation of four cherry species (Prunus spp.) grown in China.
Cao, Jinping; Jiang, Qing; Lin, Juanying; Li, Xian; Sun, Chongde; Chen, Kunsong
2015-04-15
The physicochemical characteristics of four cherry species (Prunus avium, Prunus cerasus, Prunus pseudocerasus and Prunus tomentosa) were evaluated. Inter-species variability was greater than intra-species differences. Glucose and fructose were the main sugars, and malic acid was the main organic acid in all species. Combining HPLC-DAD and LC-ESI-MS/MS technologies, total 25 phenolic components were preliminarily identified. P. avium was characterised by high fruit weight, edible proportion, sugar content and low acid content, which made it suitable for fresh eating. P. cerasus was high in acid content and anthocyanins content, making it a good processing species. P. pseudocerasus had rich flavonols varieties and high proportion of hydrocinnamic acids. P. tomentosa was characterised by high total phenolics content (especially flavonols and tannins) and antioxidant activity, indicating a great developmental potential as a health fruit. The results of the present study might provide theoretical guidance for the further development and utilisation of cherries. Copyright © 2014 Elsevier Ltd. All rights reserved.
Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies
Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa
2014-01-01
In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356
Abscisic Acid Synthesis and Response
Finkelstein, Ruth
2013-01-01
Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463
Kenny, O; Smyth, T J; Hewage, C M; Brunton, N P; McLoughlin, P
2014-02-01
The combination of hyphenated techniques, LC-SPE-NMR and LC-MS, to isolate and identify minor isomeric compounds from an ethyl acetate fraction of Taraxacum officinale root was employed in this study. Two distinct fractions of 4-hydroxyphenylacetic acid derivatives of inositol were isolated and characterised by spectroscopic methods. The (1)H NMR spectra and MS data revealed two groups of compounds, one of which were derivatives of the di-4-hydroxyphenylacetic acid derivative of the inositol compound tetrahydroxy-5-[2-(4-hydroxyphenyl)acetyl] oxycyclohexyl-2-(4-hydroxyphenyl) acetate, while the other group consisted of similar tri-substituted inositol derivatives. For both fractions the derivatives of inositols vary in the number of 4-hydroxyphenylacetic acid groups present and their position and geometry on the inositol ring. In total, three di-substituted and three tri-substituted 4-hydroxyphenylacetic acid inositol derivates were identified for the first time along with a further two previously reported di-substituted inositol derivatives. Copyright © 2013 Elsevier Ltd. All rights reserved.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.
Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G
2017-04-26
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis
2017-01-01
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050
Bermúdez Moretti, M; Correa García, S; Perotti, C; Batlle, A; Casas, A
2002-01-01
δ-aminolevulinic acid, the precursor of porphyrin biosynthesis has been used to induce the endogenous synthesis of the photosensitiser protoporphyrin IX for photodynamic therapy in the treatment of various tumours. The aim of this work was to characterise the δ-aminolevulinic acid transport system in the murine mammary adenocarcinoma cell line LM3 using 14C-δ-aminolevulinic acid, to finally improve δ-aminolevulinic acid incorporation in mammalian cells. Our results showed that δ-aminolevulinic acid is incorporated into these cells by two different mechanisms, passive diffusion which is important at the beginning of the incubation, and active transport. Specificity assays suggested that the transporter involved in δ-aminolevulinic acid incorporation is a BETA transporter, probably GAT-2. British Journal of Cancer (2002) 87, 471–474. doi:10.1038/sj.bjc.6600481 www.bjcancer.com © 2002 Cancer Research UK PMID:12177786
Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao
2011-01-01
Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122
Odiel River, acid mine drainage and current characterisation by means of univariate analysis.
Sainz, A; Grande, J A; de la Torre, M L
2003-04-01
Water pollution caused by sulfide oxidation responds to two geochemical processes: a natural one of temporal patterns, and the 'acid mine drainage', an accelerated process derived from the extractive activity. The Odiel River is located in Southwestern Spain; it flows to the south and into the Atlantic Ocean after joining the Tinto River near its mouth, forming a common estuary. There are three kinds of metallic mining in the Odiel River Basin: manganese, gold and silver, and pyrite mining, the latter being the most important in this basin, which is the object of this study. The main objective of the present study is centred in the characterisation of the sources responsible for the 'acid mine drainage' processes in the Odiel River Basin, through the sampling and subsequent chemical and statistical analyses of water samples collected in three types of sources: mine dumps, active mines and abandoned mines. The main conclusion is that mean pH values in the target area are remarkably lower than those in other active and abandoned mines outside of the study zone. On the contrary, mean values for heavy metal sulfates are much higher. Regarding mine dumps, mean values for pH, sulfates and heavy metals are within a similar range to those data known for areas outside the study zone. Copyright 2003 Elsevier Science Ltd.
2010-06-11
the cinnamic acid phenyl ring. Although compound 4c proved to be very cytotoxic in HUVEC over a 24 h period, the toxicity is less apparent over a 5 h...drug development process, as it determines how much of the initial dose actually reaches the target site. Cinnamic acid -derived amides are known to...Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl
Nuclear Synthesis of Cytoplasmic Ribonucleic Acid in Amoeba proteus
Prescott, David M.
1959-01-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells. PMID:14434750
Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.
PRESCOTT, D M
1959-10-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.
Lupaşcu, D; Profire, Lenuţa; Dănilă, Gh
2006-01-01
Fibrates are drugs with efficacy in reducing blood cholesterol levels and especially, triglyceride plasma levels. Unfortunately, fibrates have a poor water-solubility and showed some adverse reactions at long treatment. The objective of this study was to obtain some new clofibric acid derivatives with rutin; some of these compounds contain a guanidine moiety, known as effective at cardiovascular level. All the compounds are soluble in water.
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380
USDA-ARS?s Scientific Manuscript database
The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....
PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one
Surface and catalytic properties of acid metal carbons prepared by the sol gel method
NASA Astrophysics Data System (ADS)
Aguado-Serrano, J.; Rojas-Cervantes, M. L.; Martín-Aranda, R. M.; López-Peinado, A. J.; Gómez-Serrano, V.
2006-06-01
The sol-gel method has been applied for the synthesis of a series of acid metal-carbon xerogels (with M = V, Cr, Mo and Ni) by polymerisation of resorcinol with formaldehyde in the presence of metallic precursors. A blank sample was also prepared without any metal addition. The xerogels were heated in nitrogen at 1000 °C to obtain the pyrolysed products. The samples were characterised by different techniques such as thermal-mass spectrometry analysis, gas physisorption, and mercury porosimetry. In addition, the acid character of the pyrolysed products was tested by the Claisen-Schmidt condensation between benzaldehyde and acetophenone for the formation of chalcones.
Malcher-Lopes, Renato; Franco, Alier; Tasker, Jeffrey G.
2008-01-01
Glucocorticoids are capable of exerting both genomic and non-genomic actions in target cells of multiple tissues, including the brain, which trigger an array of electrophysiological, metabolic, secretory and inflammatory regulatory responses. Here, we have attempted to show how glucocorticoids may generate a rapid anti-inflammatory response by promoting arachidonic acid-derived endocannabinoid biosynthesis. According to our hypothesized model, non-genomic action of glucocorticoids results in the global shift of membrane lipid metabolism, subverting metabolic pathways toward the synthesis of the anti-inflammatory endocannabinoids, anandamide (AEA) and 2-arachidonoyl-glycerol (2-AG), and away from arachidonic acid production. Post-transcriptional inhibition of cyclooxygenase-2 (COX2) synthesis by glucocorticoids assists this mechanism by suppressing the synthesis of pro-inflammatory prostaglandins as well as endocannabinoid-derived prostanoids. In the central nervous system (CNS) this may represent a major neuroprotective system, which may cross-talk with leptin signaling in the hypothalamus allowing for the coordination between energy homeostasis and the inflammatory response. PMID:18295199
Hashim, Puziah
2014-03-01
Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.
NASA Astrophysics Data System (ADS)
Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin
2016-03-01
Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 105 for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm-1 could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.
Craig, Sandra
2011-01-01
Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855
Abu-Reidah, Ibrahim M; Arráez-Román, David; Segura-Carretero, Antonio; Fernández-Gutiérrez, Alberto
2013-12-01
The aim of this work was to characterise the phenolic compounds in artichoke (hearts) by using HPLC coupled to DAD-ESI-QTOF-MS, which proved useful in characterising 61 phenolic and other polar compounds. Notably, of the 61 compounds characterised, 34 new phenolic compounds with their isomers have been tentatively characterised in artichoke for the first time, namely: 3 hydroxybenzoic acids, 17 hydroxycinnamic acids, 4 lignans, 7 flavones, 2 flavonols, and 1 phenol derivative. Moreover, a total of 28 isomers of previously described phenolics have also been detected. The data compiled from the qualitative polyphenol characterisation indicate that the artichoke extract analysed (Blanca de Tudela variety) could be regarded as a bioactive functional food and also as a promising source of antioxidant phenolic compounds. Copyright © 2013 Elsevier Ltd. All rights reserved.
Hansen, H O; Grunnet, I; Knudsen, J
1984-01-01
Goat mammary-gland microsomal fraction by itself induces synthesis of medium-chain-length fatty acids by goat mammary fatty acid synthetase and incorporates short- and medium-chain fatty acids into triacylglycerol. Addition of ATP in the absence or presence of Mg2+ totally inhibits triacylglycerol synthesis from short- and medium-chain fatty acids, and severely inhibits synthesis de novo of medium-chain fatty acids. The inhibition by ATP of fatty acid synthesis and triacylglycerol synthesis de novo can be relieved by glycerol 3-phosphate. The effect of ATP could not be mimicked by the non-hydrolysable ATP analogue, adenosine 5'-[beta,gamma-methylene]triphosphate and could not be shown to be caused by inhibition of the diacylglycerol acyltransferase by a phosphorylation reaction. Possible explanations for the mechanism of the inhibition by ATP are discussed, and a hypothetical model for its action is outlined. PMID:6547605
The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.
ERIC Educational Resources Information Center
Simmonds, Richard J.
1987-01-01
Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)
Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.
Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes
2013-11-15
This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K
2015-10-10
Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.
Parsons, Joshua B.; Frank, Matthew W.; Subramanian, Chitra; Saenkham, Panatda; Rock, Charles O.
2011-01-01
The rationale for the pursuit of bacterial type 2 fatty acid synthesis (FASII) as a target for antibacterial drug discovery in Gram-positive organisms is being debated vigorously based on their ability to incorporate extracellular fatty acids. The regulation of FASII by extracellular fatty acids was examined in Staphylococcus aureus and Streptococcus pneumoniae, representing two important groups of pathogens. Both bacteria use the same enzymatic tool kit for the conversion of extracellular fatty acids to acyl-acyl carrier protein, elongation, and incorporation into phospholipids. Exogenous fatty acids completely replace the endogenous fatty acids in S. pneumoniae but support only 50% of phospholipid synthesis in S. aureus. Fatty acids overcame FASII inhibition in S. pneumoniae but not in S. aureus. Extracellular fatty acids strongly suppress malonyl-CoA levels in S. pneumoniae but not in S. aureus, showing a feedback regulatory system in S. pneumoniae that is absent in S. aureus. Fatty acids overcame either a biochemical or a genetic block at acetyl-CoA carboxylase (ACC) in S. aureus, confirming that regulation at the ACC step is the key difference between these two species. Bacteria that possess a stringent biochemical feedback inhibition of ACC and malonyl-CoA formation triggered by environmental fatty acids are able to circumvent FASII inhibition. However, if exogenous fatty acids do not suppress malonyl-CoA formation, FASII inhibitors remain effective in the presence of fatty acid supplements. PMID:21876172
Efficient synthesis of anacardic acid analogues and their antibacterial activities.
Mamidyala, Sreeman K; Ramu, Soumya; Huang, Johnny X; Robertson, Avril A B; Cooper, Matthew A
2013-03-15
Anacardic acid derivatives exhibit a broad range of biological activities. In this report, an efficient method for the synthesis of anacardic acid derivatives was explored, and a small set of salicylic acid variants synthesised retaining a constant hydrophobic element (a naphthyl tail). The naphthyl side chain was introduced via Wittig reaction and the aldehyde installed using directed ortho-metalation reaction of the substituted o-anisic acids. The failure of ortho-metalation using unprotected carboxylic acid group compelled us to use directed ortho-metalation in which a tertiary amide was used as a strong ortho-directing group. In the initial route, tertiary amide cleavage during final step was challenging, but cleaving the tertiary amide before Wittig reaction was beneficial. The Wittig reaction with protected carboxylic group (methyl ester) resulted in side-products whereas using sodium salt resulted in higher yields. The novel compounds were screened for antibacterial activity and cytotoxicity. Although substitution on the salicylic head group enhanced antibacterial activities they also enhanced cytotoxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Meganathan, R; Bentley, R
1983-01-01
Cell-free extracts of various strains of Escherichia coli synthesize the menaquinone biosynthetic intermediate o-succinylbenzoic acid (OSB) when supplied with chorismic acid, 2-ketoglutaric acid, and thiamine pyrophosphate (TPP). To assay for OSB synthesis, 2-[U-14C]ketoglutaric acid was used as substrate, and the synthesized OSB was examined by radiogas chromatography (as the dimethyl ester). [U-14C]Shikimic acid also gave rise to radioactive OSB if the cofactors necessary for enzymatic conversion to chorismic acid were added. Use of 2-[1-14C]ketoglutaric acid does not give rise to labeled OSB. In the absence of TPP during the incubations, OSB synthesis was much reduced; these observations are consistent with the proposed role for the succinic semialdehyde-TPP anion as the reagent adding to chorismic acid. Extracts of cells from menC and menD mutants did not form OSB separately, but did so in combination. There was evidence for formation of a product, X, by extracts of a menC mutant incubated with chorismic acid, TPP, and 2-ketoglutaric acid; X was converted to OSB by extracts of a menD mutant. It appears that the intermediate, X, is formed by one gene product and converted to OSB by the second gene product. PMID:6337125
Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.
Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula
2015-01-01
The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.
Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis
Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet
2011-01-01
Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689
Synthesis and characterisation of new types of side chain cholesteryl polymers.
Wang, Bin; Du, Haiyan; Zhang, Junhua
2011-01-01
A series of cholesterol derivatives have been synthesised via the alkylation reaction of the 3-hydroxyl group with the aliphatic bromide compounds with different chain lengths, namely 3β-alkyloxy-cholesterol. The double bond between the C5 and C6 positions in these cholesterol derivatives was oxidised into epoxy, followed by an epoxy-ring-opening reaction with the treatment with acrylic acid, resulting in a series of 3β-alkyloxy-5α-hydroxy-6β-acryloyloxycholesterol, C(n)OCh (n=1, 2, 4, 6, 8, 10, 12), The acrylate group is connected to the C6 position, which is confirmed by the single crystal structure analysis. The corresponding polymers, PC(n)OCh, were prepared via free radical polymerisation. The structure of monomers and the resulting polymers were characterised with nuclear magnetic resonance (NMR), Fourier transform infrared spectroscopy (FT-IR) and gel permeation chromatography (GPC). The thermal properties of PC(n)OCh were studied using differential scanning calorimetry (DSC) and thermogravimetric analysis (TGA). To determine the secondary structure of polymers, circular dichroism (CD) spectra were performed. It was found that not all monomers produce high-molecular-weight polymers because of steric hindrance. However, all polymers have a helical structure, which can be enhanced by increasing the alkoxy chain length. In addition, increasing the alkoxy chain length decreases the glass transition temperature and increases the decomposition temperature of the polymers. Copyright © 2010 Elsevier Inc. All rights reserved.
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
Modak, Sohan P.; Setlow, Jane K.
1969-01-01
Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934
Ledinko, Nada; Fong, Caroline K. Y.
1969-01-01
Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981
CO- and HCl-free synthesis of acid chlorides from unsaturated hydrocarbons via shuttle catalysis
NASA Astrophysics Data System (ADS)
Fang, Xianjie; Cacherat, Bastien; Morandi, Bill
2017-11-01
The synthesis of carboxylic acid derivatives from unsaturated hydrocarbons is an important process for the preparation of polymers, pharmaceuticals, cosmetics and agrochemicals. Despite its industrial relevance, the traditional Reppe-type carbonylation reaction using pressurized CO is of limited applicability to laboratory-scale synthesis because of: (1) the safety hazards associated with the use of CO, (2) the need for special equipment to handle pressurized gas, (3) the low reactivity of several relevant nucleophiles and (4) the necessity to employ different, often tailor-made, catalytic systems for each nucleophile. Herein we demonstrate that a shuttle-catalysis approach enables a CO- and HCl-free transfer process between an inexpensive reagent, butyryl chloride, and a wide range of unsaturated substrates to access the corresponding acid chlorides in good yields. This new transformation provides access to a broad range of carbonyl-containing products through the in situ transformation of the reactive acid chloride intermediate. In a broader context, this work demonstrates that isodesmic shuttle-catalysis reactions can unlock elusive catalytic reactions.
Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng
2013-01-01
There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979
Sundram, Kalyana; French, Margaret A; Clandinin, M Thomas
2003-08-01
Partial hydrogenation of oil results in fats containing unusual isomeric fatty acids characterized by cis and trans configurations. Hydrogenated fats containing trans fatty acids increase plasma total cholesterol (TC) and LDL-cholesterol while depressing HDL-cholesterol levels. Identifying the content of trans fatty acids by food labeling is overshadowed by a reluctance of health authorities to label saturates and trans fatty acids separately. Thus, it is pertinent to compare the effects of trans to saturated fatty acids using stable isotope methodology to establish if the mechanism of increase in TC and LDL-cholesterol is due to the increase in the rate of endogenous synthesis of cholesterol. Ten healthy normocholesterolemic female subjects consumed each of two diets containing approximately 30% of energy as fat for a fourweek period. One diet was high in palmitic acid (10.6% of energy) from palm olein and the other diet exchanged 5.6% of energy as partially hydrogenated fat for palmitic acid. This fat blend resulted in monounsaturated fatty acids decreasing by 4.9 % and polyunsaturated fats increasing by 2.7%. The hydrogenated fat diet treatment provided 3.1% of energy as elaidic acid. For each dietary treatment, the fractional synthesis rates for cholesterol were measured using deuterium-labeling procedures and blood samples were obtained for blood lipid and lipoprotein measurements. Subjects exhibited a higher total cholesterol and LDL-cholesterol level when consuming the diet containing trans fatty acids while also depressing the HDL-cholesterol level. Consuming the partially hydrogenated fat diet treatment increased the fractional synthesis rate of free cholesterol. Consumption of hydrogenated fats containing trans fatty acids in comparison to a mixtur e of palmitic and oleic acids increase plasma cholesterol levels apparently by increasing endogenous synthesis of cholesterol.
NASA Astrophysics Data System (ADS)
Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri
2017-02-01
Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.
One-step synthesis of hydrothermally stable mesoporous aluminosilicates with strong acidity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Dongjiang; School of Physical and Chemical Sciences, Queensland University of Technology, Brisbane, QLD 4001; Xu Yao
2008-09-15
Using tetraethylorthosilicate (TEOS), polymethylhydrosiloxane (PMHS) and aluminium isopropoxide (AIP) as the reactants, through a one-step nonsurfactant route based on PMHS-TEOS-AIP co-polycondensation, hydrothermally stable mesoporous aluminosilicates with different Si/Al molar ratios were successfully prepared. All samples exclusively showed narrow pore size distribution centered at 3.6 nm. To assess the hydrothermal stability, samples were subjected to 100 deg. C distilled water for 300 h. The boiled mesoporous aluminosilicates have nearly the same N{sub 2} adsorption-desorption isotherms and the same pore size distributions as those newly synthesized ones, indicating excellent hydrothermal stability. The {sup 29}Si MAS NMR spectra confirmed that PMHS and TEOSmore » have jointly condensed and CH{sub 3} groups have been introduced into the materials. The {sup 27}Al MAS NMR spectra indicated that Al atoms have been incorporated in the mesopore frameworks. The NH{sub 3} temperature-programmed desorption showed strong acidity. Due to the existence of large amount of CH{sub 3} groups, the mesoporous aluminosilicates obtained good hydrophobicity. Owing to the relatively large pore and the strong acidity provided by the uniform four-coordinated Al atoms, the excellent catalytic performance for 1,3,5-triisopropylbenzene cracking was acquired easily. The materials may be a profitable complement for the synthesis of solid acid catalysts. - Graphical abstract: Based on the nonsurfactant method, a facile one-step synthesis route has been developed to prepare methyl-modified mesoporous aluminosilicates that possessed hydrothermal stability and strong acidity.« less
Sites of abscisic acid synthesis and metabolism in Ricinus communis L
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeevaart, J.A.D.
1977-05-01
The sites of abscisic acid (ABA) synthesis and metabolism in Ricinus communis L. were investigated by analyzing the levels of ABA and its two metabolites phaseic acid (PA) and dihydrophaseic acid (DPA) in the shoot tips, mature leaves, and phloem sap of stressed and nonstressed plants. Water stress increased the concentration of ABA, PA, and DPA in phloem exudate and also increased the levels of all three compounds in mature leaves and in shoot tips. The latter had a very high DPA content (18.7 ..mu..g/g fresh weight) even in plants not subjected to water stress. When young and mature leavesmore » were excised and allowed to wilt, the level of ABA increased in both, demonstrating that leaves at an early stage of development have the capacity to produce ABA. These results have been interpreted to mean that in mature leaves of nonstressed Ricinus plants, ABA is synthesized and metabolized, and that ABA itself, as well as its metabolites, are translocated in the phloem to the shoot tips (sinks). Since DPA, but not ABA, accumulates in the shoot tips, it follows that ABA is metabolized rapidly in the apical region. To what extent ABA present in young leaves of nonstressed plants is the consequence of synthesis in situ and of import from older leaves remains to be determined.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lynch, Caitlin; Pan, Yongmei; Li, Linhao
Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluatedmore » in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches.
Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids
Cativiela, Carlos; Ordóñez, Mario
2010-01-01
The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments
NASA Astrophysics Data System (ADS)
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Ahmed, Riyadh M.; Yousif, Enaam I.; Al-Jeboori, Mohamad J.
2013-01-01
New monomeric cobalt and cadmium complexes with Schiff-bases, namely, N′-[(E)-(3-hydroxy-4-methoxyphenyl)methylidene]furan-2-carbohydrazide (L1) and N′-[(E)-(3-hydroxy-4-methoxyphenyl)methylidene]thiophene-2-carbohydrazide (L2) are reported. Schiff-base ligands L1 and L2 were derived from condensation of 3-hydroxy-4-methoxybenzaldehyde (iso-vanillin) with furan-2-carboxylic acid hydrazide and thiophene-2-carboxylic acid hydrazide, respectively. Complexes of the general formula [M(L)2]Cl2 (where M = Co(II) or Cd(II), L = L1 or L2) have been obtained from the reaction of the corresponding metal chloride with the ligands. The ligands and their metal complexes were characterised by spectroscopic methods (FTIR, UV-Vis, 1H, and 13C NMR spectra), elemental analysis, metal content, magnetic measurement, and conductance. These studies revealed the formation of four-coordinate complexes in which the geometry about metal ion is tetrahedral. Biological activity of the ligands and their metal complexes against gram positive bacterial strain Bacillus (G+) and gram negative bacteria Pseudomonas (G−) revealed that the metal complexes become less resistive to the microbial activities as compared to the free ligands. PMID:24027449
Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.
Gan, Qinglei; Fan, Chenguang
2017-11-01
Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.
Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids
Matthessen, Roman; Fransaer, Jan; Binnemans, Koen
2014-01-01
Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120
McCune, S A; Durant, P J; Harris, R A
1984-02-01
Hepatocytes were isolated from 3 and 5 month old female genetically obese Zucker rats and their lean littermate controls. An age-dependent loss in sensitivity of fatty acid synthesis to inhibition by both glucagon and dibutyryl cyclic AMP was observed with hepatocytes from the obese rats. Hepatocytes from lean animals were much more sensitive to these agents, regardless of age. Low concentrations of glucagon and dibutyryl cyclic AMP actually produced some stimulation of fatty acid synthesis with hepatocytes prepared from the older obese rats. 5-Tetradecyloxy-2-furoic acid, a compound which inhibits fatty acid synthesis, was a very effective inhibitor of fatty acid synthesis by hepatocytes isolated from all rats used in the study. An inhibition of lactate plus pyruvate accumulation and a strong stimulation of glycogenolysis occurred in response to both glucagon and dibutyryl cyclic AMP with hepatocytes from both age groups of lean and obese rats. The results suggest that with aging of the obese female Zucker rat some step of hepatic fatty acid synthesis becomes progressively less sensitive to inhibition by glucagon and dibutyryl cyclic AMP. This may play an important role in maintenance of obesity in these animals.
NASA Astrophysics Data System (ADS)
Caldarola, Dario; Mitev, Dimitar P.; Marlin, Lucile; Nesterenko, Ekaterina P.; Paull, Brett; Onida, Barbara; Bruzzoniti, Maria Concetta; Carlo, Rosa Maria De; Sarzanini, Corrado; Nesterenko, Pavel N.
2014-01-01
A new complexing adsorbent was prepared by chemical modification of mesoporous silica Kieselgel 60 (dp = 37-63 μm, average pore size 6 nm, specific surface area 425 m2 g-1) with 3-glycidoxypropyltrimethoxysilane and 2-[(phosphonomethyl)amino]acetic acid (PMA), commonly known as glyphosate. The prepared adsorbent was fully characterised using elemental analysis, thermal gravimetric analysis (TGA), acid-base potentiometric titration, Fourier Transform Infrared spectroscopy (FTIR), X-ray photoelectron spectroscopy (XPS), nitrogen adsorption isotherms at 77 K (BET), scanning electron microscopy with energy dispersive X-ray spectroscopy (SEM-EDS). The concentration of bonded PMA groups calculated from the nitrogen content was 0.38 mmol per gram. The adsorption of transition metal ions on PMA functionalised silica (HEPMAS) was studied from aqueous solutions having different pH and the following selectivity was established, Zn(II) < Co(II) < Cd(II) < Mn(II) < Ni(II) < Cu(II). The calculated values of distribution coefficients D for the adsorption of ecotoxic metal ions on HEPMAS are 5.0 × 104, 4.9 × 105 and 2.6 × 104 for Zn(II), Pb(II) and Cd(II), respectively.
Regulation of Lipid Synthesis in Soybeans by Two Benzoic Acid Herbicides 1
Muslih, Raad K.; Linscott, Dean L.
1977-01-01
The effects of 3-nitro-2,5-dichlorobenzoic acid (dinoben) and 3-amino-2,4-dichlorobenzoic acid (chloramben) on lipid formation and on the incorporation of various substrates into lipids by intact seeds and subcellular fractions of germinating soybean (Glycine max [L.] Merr. `Amsoy') were studied. Dinoben (20 μg/ml) inhibited synthesis of total lipids 67%, neutral lipids 73%, glycolipids 51%, and phospholipids 39% in germinating seeds. When polar lipids were analyzed further, inhibition of individual lipid classes was also observed. Chloramben (20 μg/ml) stimulated total lipid synthesis 25%. With the exception of the mitochondrial fraction where malonate thiokinase was absent, dinoben inhibited up to 99% the incorporation of acetate and malonate into lipids, but did not inhibit acetyl-CoA and malonyl-CoA incorporation. Chloramben stimulated the incorporation of all substrates tested into lipids by all fractions except the mitochondrial fraction when malonate was the substrate. When dinoben and chloramben were used in combinations, chloramben did not reverse the inhibitory effect of dinoben. It is concluded that the dinoben inhibitory effect is specific and is associated with the acetate and malonate thiokinase systems. The chloramben effect is stimulatory to either acetyl-CoA carboxylase or fatty acid synthetase or both. PMID:16660173
USDA-ARS?s Scientific Manuscript database
The branched-chain amino acid, leucine, acts as a nutrient signal to stimulate protein synthesis in skeletal muscle of young pigs. However, the chemical structure responsible for this effect has not been identified. We have shown that the other branched-chain amino acids, isoleucine and valine, are ...
Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids.
Leber, Christopher; Da Silva, Nancy A
2014-02-01
Carbon feedstocks from fossilized sources are being rapidly depleted due to rising demand for industrial and commercial applications. Many petroleum-derived chemicals can be directly or functionally substituted with chemicals derived from renewable feedstocks. Several short chain organic acids may fulfill this role using their functional groups as a target for chemical catalysis. Saccharomyces cerevisiae was engineered to produce short chain carboxylic acids (C6 to C10 ) from glucose using the heterologous Homo sapiens type I fatty acid synthase (hFAS). This synthase was activated by phosphopantetheine transfereases AcpS and Sfp from Escherichia coli and Bacillus subtilis, respectively, both in vitro and in vivo. hFAS was produced in the holo-form and produced carboxylic acids in vitro, confirmed by NADPH and ADIFAB assays. Overexpression of hFAS in a yeast FAS2 knockout strain, deficient in de novo fatty acid synthesis, demonstrated the full functional replacement of the native fungal FAS by hFAS. Two active heterologous short chain thioesterases (TEs) from Cuphea palustris (CpFatB1) and Rattus norvegicus (TEII) were evaluated for short chain fatty acid (SCFA) synthesis in vitro and in vivo. Three hFAS mutants were constructed: a mutant deficient in the native TE domain, a mutant with a linked CpFatB1 TE and a mutant with a linked TEII TE. Using the native yeast fatty acid synthase for growth, the overexpression of the hFAS mutants and the short-chain TEs (linked or plasmid-based) increased in vivo caprylic acid and total SCFA production up to 64-fold (63 mg/L) and 52-fold (68 mg/L), respectively, over the native yeast levels. Combined over-expression of the phosphopantetheine transferase with the hFAS mutant resulted in C8 titers of up to 82 mg/L and total SCFA titers of up to 111 mg/L. © 2013 Wiley Periodicals, Inc.
Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus
2012-10-01
Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.
Peng, Pai; Xiong, Jin-Feng; Mo, Guang-Zhen; Zheng, Jia-Li; Chen, Ren-Hong; Chen, Xiao-Yun; Wang, Zhao-Yang
2014-10-01
An efficient method for the synthesis of aminomethyl benzimidazoles is developed by using a one-pot batch reaction between amino acids and o-phenylenediamines. This reaction proceeds smoothly in an unmodified household microwave oven, even though scale-up is to 10 g. A desirable method for the quick synthesis of benzimidazoles, which are used as a kind of important intermediates in drug synthesis, is provided by the scale-up utilization of amino acid resource.
Jumbri, Khairulazhar; Al-Haniff Rozy, Mohd Fahruddin; Ashari, Siti Efliza; Mohamad, Rosfarizan; Basri, Mahiran; Fard Masoumi, Hamid Reza
2015-01-01
Kojic acid is widely used to inhibit the browning effect of tyrosinase in cosmetic and food industries. In this work, synthesis of kojic monooleate ester (KMO) was carried out using lipase-catalysed esterification of kojic acid and oleic acid in a solvent-free system. Response Surface Methodology (RSM) based on central composite rotatable design (CCRD) was used to optimise the main important reaction variables, such as enzyme amount, reaction temperature, substrate molar ratio, and reaction time along with immobilised lipase from Candida Antarctica (Novozym 435) as a biocatalyst. The RSM data indicated that the reaction temperature was less significant in comparison to other factors for the production of a KMO ester. By using this statistical analysis, a quadratic model was developed in order to correlate the preparation variable to the response (reaction yield). The optimum conditions for the enzymatic synthesis of KMO were as follows: an enzyme amount of 2.0 wt%, reaction temperature of 83.69°C, substrate molar ratio of 1:2.37 (mmole kojic acid:oleic acid) and a reaction time of 300.0 min. Under these conditions, the actual yield percentage obtained was 42.09%, which is comparably well with the maximum predicted value of 44.46%. Under the optimal conditions, Novozym 435 could be reused for 5 cycles for KMO production percentage yield of at least 40%. The results demonstrated that statistical analysis using RSM can be used efficiently to optimise the production of a KMO ester. Moreover, the optimum conditions obtained can be applied to scale-up the process and minimise the cost.
Jumbri, Khairulazhar; Al-Haniff Rozy, Mohd Fahruddin; Ashari, Siti Efliza; Mohamad, Rosfarizan; Basri, Mahiran; Fard Masoumi, Hamid Reza
2015-01-01
Kojic acid is widely used to inhibit the browning effect of tyrosinase in cosmetic and food industries. In this work, synthesis of kojic monooleate ester (KMO) was carried out using lipase-catalysed esterification of kojic acid and oleic acid in a solvent-free system. Response Surface Methodology (RSM) based on central composite rotatable design (CCRD) was used to optimise the main important reaction variables, such as enzyme amount, reaction temperature, substrate molar ratio, and reaction time along with immobilised lipase from Candida Antarctica (Novozym 435) as a biocatalyst. The RSM data indicated that the reaction temperature was less significant in comparison to other factors for the production of a KMO ester. By using this statistical analysis, a quadratic model was developed in order to correlate the preparation variable to the response (reaction yield). The optimum conditions for the enzymatic synthesis of KMO were as follows: an enzyme amount of 2.0 wt%, reaction temperature of 83.69°C, substrate molar ratio of 1:2.37 (mmole kojic acid:oleic acid) and a reaction time of 300.0 min. Under these conditions, the actual yield percentage obtained was 42.09%, which is comparably well with the maximum predicted value of 44.46%. Under the optimal conditions, Novozym 435 could be reused for 5 cycles for KMO production percentage yield of at least 40%. The results demonstrated that statistical analysis using RSM can be used efficiently to optimise the production of a KMO ester. Moreover, the optimum conditions obtained can be applied to scale-up the process and minimise the cost. PMID:26657030
Hashimoto, F; Taira, S; Hayashi, H
1998-11-01
We studied whether the peroxisomal proliferation, induction of 3-hydroxy-3-methylglutaryl-CoA reductase (HMG-CoA reductase) and activation of cholesterol synthesis by gemfibrozil shown in whole body (Hashimoto F., Ishikawa T., Hamada S. and Hayashi H., Biochemical. Pharm., 49, 1213-1221 (1995)) is also detected at a culture cell level, and we made a comparative analysis of the effects of clofibric acid. Gemfibrozil at 0.25 mM increased the activity of some peroxisomal enzymes (catalase and the cyanide-insensitive fatty acyl-CoA oxidizing system) after incubation for 72 h. However, contrary to whole body experiments, gemfibrozil decreased the activity of HMG-CoA reductase and cholesterol synthesis from [14C]acetate. At 1 mM, gemfibrozil decreased not only the activity of HMG-CoA reductase and cholesterol synthesis, but also the protein content of the cells and peroxisomal enzyme activity, indicating nonspecific inhibition at this concentration. Clofibric acid (0.25 and 1 mM) increased the activity of peroxisomal enzymes, but decreased the activity of HMG-CoA reductase and cholesterol synthesis. With respect to the direct effect on HMG-CoA reductase in the cell homogenate, gemfibrozil at 0.25 mm did not affect the activity, but it clearly inhibited the activity at 2 mM and above. Clofibric acid at 2 mM hardly affected the activity, but it clearly decreased the activity at 5 mM and over. That is, gemfibrozil directly inhibited the activity more strongly than clofibric acid. The direct inhibition of the enzyme itself required higher concentrations of both agents than did inhibition at the culture cell level. These results suggest that the cytotoxicity of gemfibrozil is greater than that of clofibric acid, and that gemfibrozil, as well as clofibric acid, can induce peroxisomal enzymes in the culture cell level. In contrast to whole body results, gemfibrozil may suppress cholesterol synthesis from [14C]acetate through the inhibition of HMG-CoA reductase at the culture
ERIC Educational Resources Information Center
Cesare, Victor; Sadarangani, Ishwar; Rollins, Janet; Costello, Dennis
2004-01-01
The facile, high yielding synthesis of phenylsuccinamic acids is described and one of these syntheses, the reaction of phenylsuccinic anhydride with tert-butylamine, is successfully modified and adapted for use in the second-semester organic chemistry laboratory at St. John's University. Succinamic acids are compounds that contain both the amide…
Bi, Hongkai; Wang, Haihong; Cronan, John E.
2015-01-01
SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
Catalá, Angel
2013-01-01
I have been involved in research on polyunsaturated fatty acids since 1964 and this review is intended to cover some of the most important aspects of this work. Polyunsaturated fatty acids have followed me during my whole scientific career and I have published a number of studies concerned with different aspects of them such as chemical synthesis, enzymatic formation, metabolism, transport, physical, chemical, and catalytic properties of a reconstructed desaturase system in liposomes, lipid peroxidation, and their effects. The first project I became involved in was the organic synthesis of [1-14C] eicosa-11,14-dienoic acid, with the aim of demonstrating the participation of that compound as a possible intermediary in the biosynthesis of arachidonic acid “in vivo.” From 1966 to 1982, I was involved in several projects that study the metabolism of polyunsaturated fatty acids. In the eighties, we studied fatty acid binding protein. From 1990 up to now, our laboratory has been interested in the lipid peroxidation of biological membranes from various tissues and different species as well as liposomes prepared with phospholipids rich in PUFAs. We tested the effect of many antioxidants such as alpha tocopherol, vitamin A, melatonin and its structural analogues, and conjugated linoleic acid, among others. PMID:24490074
Crown, Scott B; Marze, Nicholas; Antoniewicz, Maciek R
2015-01-01
The branched chain amino acids (BCAA) valine, leucine and isoleucine have been implicated in a number of diseases including obesity, insulin resistance, and type 2 diabetes mellitus, although the mechanisms are still poorly understood. Adipose tissue plays an important role in BCAA homeostasis by actively metabolizing circulating BCAA. In this work, we have investigated the link between BCAA catabolism and fatty acid synthesis in 3T3-L1 adipocytes using parallel 13C-labeling experiments, mass spectrometry and model-based isotopomer data analysis. Specifically, we performed parallel labeling experiments with four fully 13C-labeled tracers, [U-13C]valine, [U-13C]leucine, [U-13C]isoleucine and [U-13C]glutamine. We measured mass isotopomer distributions of fatty acids and intracellular metabolites by GC-MS and analyzed the data using the isotopomer spectral analysis (ISA) framework. We demonstrate that 3T3-L1 adipocytes accumulate significant amounts of even chain length (C14:0, C16:0 and C18:0) and odd chain length (C15:0 and C17:0) fatty acids under standard cell culture conditions. Using a novel GC-MS method, we demonstrate that propionyl-CoA acts as the primer on fatty acid synthase for the production of odd chain fatty acids. BCAA contributed significantly to the production of all fatty acids. Leucine and isoleucine contributed at least 25% to lipogenic acetyl-CoA pool, and valine and isoleucine contributed 100% to lipogenic propionyl-CoA pool. Our results further suggest that low activity of methylmalonyl-CoA mutase and mass action kinetics of propionyl-CoA on fatty acid synthase result in high rates of odd chain fatty acid synthesis in 3T3-L1 cells. Overall, this work provides important new insights into the connection between BCAA catabolism and fatty acid synthesis in adipocytes and underscores the high capacity of adipocytes for metabolizing BCAA.
Kent, R S; Diedrich, S L; Whorton, A R
1983-01-01
To address the hypothesis that metabolites of arachidonic acid are important regulators of prostaglandin (PG) synthesis in intact vascular tissue, we studied arachidonate metabolism in rabbit aortas in response to a continuous infusion of arachidonic acid, 10 micrograms/ml. Prostacyclin (PGI2; measured as 6-keto-PGF1 alpha) production rate accelerated during the first 2 min, reached peak velocity at 2 min, and then progressively decelerated. The velocity profile of PGI2 production was similar to that previously reported for cyclooxygenase holoenzyme assayed in vitro, and was consistent with progressive inactivation of the enzymes leading to PGI2 synthesis. We determined the specific inhibition of cyclooxygenase and prostacyclin synthetase by measuring PGI2 and PGE2 production rates and by infusing cyclic endoperoxides. Our results indicate preferential inactivation of cyclooxygenase during arachidonate metabolism, most likely due to cyclooxygenase-derived oxidative intermediates. This was a dose-dependent response and resulted in a progressive decrease in the 6-keto-PGF1 alpha/PGE2 ratio. Exogenously added 15-hydroperoxy eicosatetraenoic acid, on the other hand, actually stimulated cyclooxygenase activity at low doses, while markedly inhibiting prostacyclin synthetase. This finding, along with the accelerating nature of arachidonate metabolism, is consistent with the concept of "peroxide tone" as a mediator of cyclooxygenase activity in this system. These results demonstrate that arachidonate metabolites regulate PG synthesis in intact blood vessels. The progressive enzymatic inhibition intrinsic to arachidonate metabolism may be a model for similar changes occurring in states of enhanced lipid peroxidation. These metabolic alterations might greatly influence the numerous vascular functions known to involve arachidonic acid metabolism. PMID:6409932
Lynch, Caitlin; Pan, Yongmei; Li, Linhao; Heyward, Scott; Moeller, Timothy; Swaan, Peter W.; Wang, Hongbing
2014-01-01
Objective Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods Ligand-based structure-activity models were used for virtual screening of the Specs database (www.specs.net) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluated in HPH. Results Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. PMID:24878338
Kelkar, Mandar A; Gogate, Parag R; Pandit, Aniruddha B
2008-03-01
Cavitation results in conditions of turbulence and liquid circulation in the reactor which can aid in eliminating mass transfer resistances. The present work illustrates the use of cavitation for intensification of biodiesel synthesis (esterification) reaction, which is mass transfer limited reaction considering the immiscible nature of the reactants, i.e., fatty acids and alcohol. Esterification of fatty acid (FA) odour cut (C(8)-C(10)) with methanol in the presence of concentrated H(2)SO(4) as a catalyst has been studied in hydrodynamic cavitation reactor as well as in the sonochemical reactor. The different reaction operating parameters such as molar ratio of acid to alcohol, catalyst quantity have been optimized under acoustic as well as hydrodynamic cavitating conditions in addition to the optimization of the geometry of the orifice plate in the case of hydrodynamic cavitation reactors. Few experiments have also been carried out with other acid (lower and higher)/methanol combination viz. caprylic acid and capric acids with methanol with an aim of investigating the efficacy of cavitation for giving the desired yields and also to quantify the degree of process intensification that can be achieved using the same. It has been observed that ambient operating conditions of temperature and pressure and reaction times of <3h, for all the different combinations of acid (lower and higher)/methanol studied in the present work, was sufficient for giving >90% conversion (mol%). This clearly establishes the efficacy of cavitation as an excellent way to achieve process intensification of the biodiesel synthesis process.
NASA Astrophysics Data System (ADS)
Carneiro, Cristine E. A.; Ivashita, Flávio F.; de Souza, Ivan Granemann; de Souza, Cláudio M. D.; Paesano, Andrea; da Costa, Antonio C. S.; di Mauro, Eduardo; de Santana, Henrique; Zaia, Cássia T. B. V.; Zaia, Dimas A. M.
2013-04-01
This study investigated the synthesis of goethite under conditions resembling those of the prebiotic Earth. The artificial seawater used contains all the major elements as well as amino acids (α-Ala, β-Ala, Gly, Cys, AIB) that could be found on the prebiotic Earth. The spectroscopic methods (FT-IR, EPR, Raman), scanning electron microscopy (SEM) and X-ray diffraction showed that in any condition Gly and Cys favoured the formation of goethite, artificial seawater plus β-Ala and distilled water plus AIB favoured the formation of hematite and for the other synthesis a mixture of goethite and hematite were obtained. Thus in general no protein amino acids (β-Ala, AIB) favoured the formation of hematite. As shown by surface enhanced Raman spectroscopy (SERS) spectra the interaction between Cys and Fe3+ of goethite is very complex, involving decomposition of Cys producing sulphur, as well as interaction of carboxylic group with Fe3+. SERS spectra also showed that amino/CN and C-CH3 groups of α-Ala are interacting with Fe3+ of goethite. For the other samples the shifting of several bands was observed. However, it was not possible to say which amino acid groups are interacting with Fe3+. The pH at point of zero charge of goethites increased with artificial seawater and decreased with amino acids. SEM images showed when only goethite was synthesized the images of the samples were acicular and when only hematite was synthesized the images of the samples were spherical. SEM images for the synthesis of goethite with Cys were spherical crystal aggregates with radiating acicular crystals. The highest resonance line intensities were obtained for the samples where only hematite was obtained. Electron paramagnetic resonance (EPR) and Mössbauer spectra showed for the synthesis of goethite with artificial seawater an isomorphic substitution of iron by seawater cations. Mössbauer spectra also showed that for the synthesis goethite in distilled water plus Gly only goethite was
Abc Amino Acids: Design, Synthesis, and Properties of New Photoelastic Amino Acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Standaert, Robert F; Park, Dr Seung Bum
2006-01-01
Photoisomerizable amino acids provide a direct avenue to the experimental manipulation of bioactive polypeptides, potentially allowing real-time, remote control of biological systems and enabling useful applications in nanobiotechnology. Herein, we report a new class of photoisomerizable amino acids intended to cause pronounced expansion and contraction in the polypeptide backbone, i.e., to be photoelastic. These compounds, termed Abc amino acids, employ a photoisomerizable azobiphenyl chromophore to control the relative disposition of aminomethyl and carboxyl substituents. Molecular modeling of nine Abc isomers led to the identification of one with particularly attractive properties, including the ability to induce contractions up to 13A inmore » the backbone upon transa?cis photoisomerization. This isomer, designated mpAbc, has substituents at meta and para positions on the inner (azo-linked) and outer rings, respectively. An efficient synthesis of Fmoc-protected mpAbc was executed in which the biaryl components were formed via Suzuki couplings and the azo linkage was formed via amine/nitroso condensation; protected forms of three other Abc isomers were prepared similarly. A decapeptide incorporating mpAbc was synthesized by conventional solid-phase methods and displayed characteristic azobenzene photochemical behavior with optimal conversion to the cis isomer at 360 nm and a thermal cisa?trans half life of 100 min. at 80 AoC.« less
Francis, Brian R.
2015-01-01
Although analysis of the genetic code has allowed explanations for its evolution to be proposed, little evidence exists in biochemistry and molecular biology to offer an explanation for the origin of the genetic code. In particular, two features of biology make the origin of the genetic code difficult to understand. First, nucleic acids are highly complicated polymers requiring numerous enzymes for biosynthesis. Secondly, proteins have a simple backbone with a set of 20 different amino acid side chains synthesized by a highly complicated ribosomal process in which mRNA sequences are read in triplets. Apparently, both nucleic acid and protein syntheses have extensive evolutionary histories. Supporting these processes is a complex metabolism and at the hub of metabolism are the carboxylic acid cycles. This paper advances the hypothesis that the earliest predecessor of the nucleic acids was a β-linked polyester made from malic acid, a highly conserved metabolite in the carboxylic acid cycles. In the β-linked polyester, the side chains are carboxylic acid groups capable of forming interstrand double hydrogen bonds. Evolution of the nucleic acids involved changes to the backbone and side chain of poly(β-d-malic acid). Conversion of the side chain carboxylic acid into a carboxamide or a longer side chain bearing a carboxamide group, allowed information polymers to form amide pairs between polyester chains. Aminoacylation of the hydroxyl groups of malic acid and its derivatives with simple amino acids such as glycine and alanine allowed coupling of polyester synthesis and protein synthesis. Use of polypeptides containing glycine and l-alanine for activation of two different monomers with either glycine or l-alanine allowed simple coded autocatalytic synthesis of polyesters and polypeptides and established the first genetic code. A primitive cell capable of supporting electron transport, thioester synthesis, reduction reactions, and synthesis of polyesters and
Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives
Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A
2011-01-01
Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513
Clinical Relevance of Type II Fatty Acid Synthesis Bypass in Staphylococcus aureus
Guillemet, Mélanie; Soler, Charles; Morvan, Claire; Halpern, David; Pourcel, Christine; Vu Thien, Hoang; Lamberet, Gilles
2017-01-01
ABSTRACT The need for new antimicrobials to treat bacterial infections has led to the use of type II fatty acid synthesis (FASII) enzymes as front-line targets. However, recent studies suggest that FASII inhibitors may not work against the opportunist pathogen Staphylococcus aureus, as environmental fatty acids favor emergence of multi-anti-FASII resistance. As fatty acids are abundant in the host and one FASII inhibitor, triclosan, is widespread, we investigated whether fatty acid pools impact resistance in clinical and veterinary S. aureus isolates. Simple addition of fatty acids to the screening medium led to a 50% increase in triclosan resistance, as tested in 700 isolates. Moreover, nonculturable triclosan-resistant fatty acid auxotrophs, which escape detection under routine conditions, were uncovered in primary patient samples. FASII bypass in selected isolates correlated with polymorphisms in the acc and fabD loci. We conclude that fatty-acid-dependent strategies to escape FASII inhibition are common among S. aureus isolates and correlate with anti-FASII resistance and emergence of nonculturable variants. PMID:28193654
NASA Technical Reports Server (NTRS)
Lin, B. L.; Raghavan, V.
1991-01-01
The pattern of DNA, RNA, and protein synthesis during lateral root initiation in Marsilea quadrifolia L. was monitored by autoradiography of incorporated of 3H-thymidine, 3H-uridine, and 3H-leucine, respectively. DNA synthesis was associated with the enlargement of the lateral root initial prior to its division. Consistent with histological studies, derivatives of the lateral root initial as well as the cells of the adjacent inner cortex and pericycle of the parent root also continued to synthesize DNA. RNA and protein synthetic activities were found to be higher in the lateral root initials than in the endodermal initials of the same longitudinal layer. The data suggest a role for nucleic acid and protein synthesis during cytodifferentiation of a potential endodermal cell into a lateral root initial.
Inhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster.
Arbeeny, C M; Meyers, D S; Bergquist, K E; Gregg, R E
1992-06-01
The hamster was developed as a model to study very low density lipoprotein (VLDL) metabolism, since, as is the case in humans, the hamster liver was found to synthesize apoB-100 and not apoB-48. The effect of inhibiting fatty acid synthesis on the hepatic secretion of VLDL triglyceride (TG) and apolipoprotein (apo) B-100 in this model was then investigated. In an in vivo study, hamsters were fed a chow diet containing 0.15% TOFA (5-tetradecyloxy-2-furancarboxylic acid), an inhibitor of acetyl-CoA carboxylase. After 6 days of treatment, plasma triglyceride and cholesterol levels were decreased by 30.2% and 11.6%, respectively. When the secretion of VLDL-TG by the liver was measured in vivo after injection of Triton WR 1339, TOFA treatment was found to decrease VLDL-TG secretion by 40%. In subsequent in vitro studies utilizing cultured primary hamster hepatocytes, incubation with 20 microM TOFA for 4 h resulted in 98% and 76% inhibition in fatty acid and triglyceride synthesis, respectively; VLDL-TG secretion was decreased by 90%. When hepatocytes were pulsed with [3H]leucine, incubation with TOFA resulted in a 50% decrease in the incorporation of radiolabel into secreted VLDL apoB-100. The results of this study indicate that inhibition of intracellular triglyceride synthesis decreases the secretion of VLDL-TG and apoB-100, and does not result in the secretion of a dense, triglyceride-depleted lipoprotein.
Hwang, Su Jung; Jun, Sang Hui; Park, Yohan; Cha, Song-Hyun; Yoon, Minho; Cho, Seonho; Lee, Hyo-Jong; Park, Youmie
2015-10-01
Here we developed a novel green synthesis method for gold nanoparticles (CGA-AuNPs) using chlorogenic acid (CGA) as reductants without the use of other chemicals and validated the anti-inflammatory efficacy of CGA-AuNPs in vitro and in vivo. The resulting CGA-AuNPs appeared predominantly spherical in shape with an average diameter of 22.25±4.78nm. The crystalline nature of the CGA-AuNPs was confirmed by high-resolution X-ray diffraction and by selected-area electron diffraction analyses. High-resolution liquid chromatography/electrospray ionization mass spectrometry revealed that the caffeic acid moiety of CGA forms quinone structure through a two-electron oxidation causing the reduction of Au(3+) to Au(0). When compared to CGA, CGA-AuNPs exhibited enhanced anti-inflammatory effects on NF-κB-mediated inflammatory network, as well as cell adhesion. Collectively, green synthesis of CGA-AuNPs using bioactive reductants and mechanistic studies based on mass spectrometry may open up new directions in nanomedicine and CGA-AuNPs can be an anti-inflammatory nanomedicine for future applications. Gold nanoparticles (Au NPs) have been shown to be very useful in many applications due to their easy functionalization capability. In this article, the authors demonstrated a novel method for the synthesis of gold nanoparticles using chlorogenic acid (CGA) as reductants. In-vitro experiments also confirmed biological activity of the resultant gold nanoparticles. Further in-vivo studies are awaited. Copyright © 2015 Elsevier Inc. All rights reserved.
Doğaç, Yasemin Ispirli; Teke, Mustafa
2016-04-01
We reported natural polymer-conjugated magnetic featured urease systems for removal of urea effectively. The optimum temperature (20-60 °C), optimum pH (3.0-10.0), kinetic parameters, thermal stability (4-70 °C), pH stability (4.0-9.0), operational stability (0-250 min), reusability (18 times) and storage stability (24 weeks) were studied for characterisation of the urease-encapsulated biocompatible polymer-conjugated magnetic beads. Also, the surface groups and chemical structure of the magnetic beads were determined by using attenuated total reflectance Fourier transform infrared spectroscopy (ATR-FTIR). The all urease-encapsulated magnetic beads protected their stability of 30-45 % relative activity at 70 °C. A significant increase was observed at their pH stability compared with the free urease for both acidic and alkaline medium. Besides this, their repeatability activity were approximately 100 % during 4(th) run. They showed residual activity of 50 % after 16 weeks. The importance of this work is enhancement stability of immobilised urease by biocompatible polymer-conjugated magnetic beads for the industrial application based on removal of urea.
Bellabarba, Ronan M; Tooze, Robert P; Slawin, Alexandra M Z
2003-08-07
The novel complex (tbpx)PdCO (1), the first example of a structurally characterised sixteen electron, trigonal planar palladium(0) carbonyl complex, was prepared, characterised by NMR spectroscopy and X-ray crystallography, and some unusual aspects of its reactivity were studied.
USDA-ARS?s Scientific Manuscript database
Glycerine and levulinic acid were used alone and in combination for the fermentative synthesis of poly(3-hydroxybutyrate-co-3-hydroxyvalerate) (PHB/V) biopolymers. Shake-flask cultures of Pseudomonas oleovorans NRRL B-14682 containing different glycerine:levulinic acid ratios (1%, w/v total carbon ...
Mertz, J R; Wallman, J
2000-04-01
Research over the past two decades has shown that the growth of young eyes is guided by vision. If near- or far-sightedness is artificially imposed by spectacle lenses, eyes of primates and chicks compensate by changing their rate of elongation, thereby growing back to the pre-lens optical condition. Little is known about what chemical signals might mediate between visual effects on the retina and alterations of eye growth. We present five findings that point to choroidal retinoic acid possibly being such a mediator. First, the chick choroid can convert retinol into all-trans-retinoic acid at the rate of 11 +/- 3 pmoles mg protein(-1) hr(-1), compared to 1.3 +/- 0.3 for retina/RPE and no conversion for sclera. Second, those visual conditions that cause increased rates of ocular elongation (diffusers or negative lens wear) produce a sharp decrease in all-trans-retinoic acid synthesis to levels barely detectable with our assay. In contrast, visual conditions which result in decreased rates of ocular elongation (recovery from diffusers or positive lens wear) produce a four- to five-fold increase in the formation of all-trans-retinoic acid. Third, the choroidal retinoic acid is found bound to a 28-32 kD protein. Fourth, a large fraction of the choroidal retinoic acid synthesized in culture is found in a nucleus-enriched fraction of sclera. Finally, application of retinoic acid to cultured sclera at physiological concentrations produced an inhibition of proteoglycan production (as assessed by measuring sulfate incorporation) with a EC50 of 8 x 10(-7) M. These results show that the synthesis of choroidal retinoic acid is modulated by those visual manipulations that influence ocular elongation and that this retinoic acid may reach the sclera in concentrations adequate to modulate scleral proteoglycan formation.
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-01-01
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544
Synthesis of molecular imprinting polymers for extraction of gallic acid from urine.
Bhawani, Showkat Ahmad; Sen, Tham Soon; Ibrahim, Mohammad Nasir Mohammad
2018-02-21
The molecularly imprinted polymers for gallic acid were synthesized by precipitation polymerization. During the process of synthesis a non-covalent approach was used for the interaction of template and monomer. In the polymerization process, gallic acid was used as a template, acrylic acid as a functional monomer, ethylene glycol dimethacrylate as a cross-linker and 2,2'-azobisisobutyronitrile as an initiator and acetonitrile as a solvent. The synthesized imprinted and non-imprinted polymer particles were characterized by using Fourier-transform infrared spectroscopy and scanning electron microscopy. The rebinding efficiency of synthesized polymer particles was evaluated by batch binding assay. The highly selective imprinted polymer for gallic acid was MIPI1 with a composition (molar ratio) of 1:4:20, template: monomer: cross-linker, respectively. The MIPI1 showed highest binding efficiency (79.50%) as compared to other imprinted and non-imprinted polymers. The highly selective imprinted polymers have successfully extracted about 80% of gallic acid from spiked urine sample.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.
2013-01-01
Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less
NASA Astrophysics Data System (ADS)
Siebert, Agnieszka; Cholewiński, Grzegorz; Garwolińska, Dorota; Olejnik, Adrian; Rachoń, Janusz; Chojnacki, Jarosław
2018-01-01
The synthesis of a potential immunosuppressant, i.e. dimethyl ester of N-mycophenoyl malonic acid was optimized in the reaction of mycophenolic acid (MPA) with amino malonic dimethyl ester in the presence of propanephosphonic anhydride (T3P) as a coupling reagent. The structural properties of the obtained MPA derivative were investigated by NMR, MS and single crystal X-ray diffraction methods. Theoretical considerations of conformational flexibility based on DFT calculations are presented.
Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K
2012-01-15
The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.
Beena, P S; Basheer, Soorej M; Bhat, Sarita G; Bahkali, Ali H; Chandrasekaran, M
2011-07-01
Marine Aspergillus awamori BTMFW032, recently reported by us, produce acidophilic tannase as extracellular enzyme. Here, we report the application of this enzyme for synthesis of propyl gallate by direct transesterification of tannic acid and in tea cream solubilisation besides the simultaneous production of gallic acid along with tannase under submerged fermentation by this fungus. This acidophilic tannase enabled synthesis of propyl gallate by direct transesterification of tannic acid using propanol as organic reaction media under low water conditions. The identity of the product was confirmed with thin layer chromatography and Fourier transform infrared spectroscopy. It was noted that 699 U/ml of enzyme could give 60% solubilisation of tea cream within 1 h. Enzyme production medium was optimized adopting Box-Behnken design for simultaneous synthesis of tannase and gallic acid. Process variables including tannic acid, sodium chloride, ferrous sulphate, dipotassium hydrogen phosphate, incubation period and agitation were recognized as the critical factors that influenced tannase and gallic acid production. The model obtained predicted 4,824.61 U/ml of tannase and 136.206 μg/ml gallic acid after 48 h of incubation, whereas optimized medium supported 5,085 U/ml tannase and 372.6 μg/ml of gallic acid production after 36 and 84 h of incubation, respectively, with a 15-fold increase in both enzyme and gallic acid production. Results indicated scope for utilization of this acidophilic tannase for transesterification of tannic acid into propyl gallate, tea cream solubilisation and simultaneous production of gallic acid along with tannase.
Environmental characterisation of coal mine waste rock in the field: an example from New Zealand
NASA Astrophysics Data System (ADS)
Hughes, J.; Craw, D.; Peake, B.; Lindsay, P.; Weber, P.
2007-08-01
Characterisation of mine waste rock with respect to acid generation potential is a necessary part of routine mine operations, so that environmentally benign waste rock stacks can be constructed for permanent storage. Standard static characterisation techniques, such as acid neutralisation capacity (ANC), maximum potential acidity, and associated acid-base accounting, require laboratory tests that can be difficult to obtain rapidly at remote mine sites. We show that a combination of paste pH and a simple portable carbonate dissolution test, both techniques that can be done in the field in a 15 min time-frame, is useful for distinguishing rocks that are potentially acid-forming from those that are acid-neutralising. Use of these techniques could allow characterisation of mine wastes at the metre scale during mine excavation operations. Our application of these techniques to pyrite-bearing (total S = 1-4 wt%) but variably calcareous coal mine overburden shows that there is a strong correlation between the portable carbonate dissolution technique and laboratory-determined ANC measurements (range of 0-10 wt% calcite equivalent). Paste pH measurements on the same rocks are bimodal, with high-sulphur, low-calcite rocks yielding pH near 3 after 10 min, whereas high-ANC rocks yield paste pH of 7-8. In our coal mine example, the field tests were most effective when used in conjunction with stratigraphy. However, the same field tests have potential for routine use in any mine in which distinction of acid-generating rocks from acid-neutralising rocks is required. Calibration of field-based acid-base accounting characteristics of the rocks with laboratory-based static and/or kinetic tests is still necessary.
Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow
NASA Astrophysics Data System (ADS)
Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.
2017-05-01
Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.
Kennedy, David A; Vembu, Nagarajan; Fronczek, Frank R; Devocelle, Marc
2011-12-02
Reported is the synthesis of azo mutual prodrugs of the nonsteroidal anti-inflammatory agents (NSAIDs) 4-aminophenylacetic acid (4-APAA) or 5-aminosalicylic acid (5-ASA) with peptides, including an antibiotic peptide temporin analogue modified at the amino terminal by an α-aminoisobutyric acid (Aib) residue. These prodrugs are designed for colonic delivery of two agents to treat infection and inflammation by the bacterial pathogen Clostridium difficile . © 2011 American Chemical Society
Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.
Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.
Synthesis of [ 18F]arenes via the copper-mediated [ 18F]fluorination of boronic acids
Mossine, Andrew V.; Brooks, Allen F.; Makaravage, Katarina J.; ...
2015-11-14
Here, a copper-mediated radiofluorination of aryl- and vinylboronic acids with K 18F is described. This method exhibits high functional group tolerance and is effective for the radiofluorination of a range of electron-deficient, -neutral, and -rich aryl-, heteroaryl-, and vinylboronic acids. This method has been applied to the synthesis of [ 18F]FPEB, a PET radiotracer for quantifying metabotropic glutamate 5 receptors.
Clifford, Michael N; Jaganath, Indu B; Ludwig, Iziar A; Crozier, Alan
2017-12-13
Covering: 2000 up to late 2017This review is focussed upon the acyl-quinic acids, the most studied group within the ca. 400 chlorogenic acids so far reported. The acyl-quinic acids, the first of which was characterised in 1846, are a diverse group of plant-derived compounds produced principally through esterification of an hydroxycinnamic acid and 1l-(-)-quinic acid. Topics addressed in this review include the confusing nomenclature, quantification and characterisation by NMR and MS, biosynthesis and role in planta, and the occurrence of acyl-quinic acids in coffee, their transformation during roasting and delivery to the beverage. Coffee is the major human dietary source world-wide of acyl-quinic acids and consideration is given to their absorption and metabolism in the upper gastrointestinal tract, and the colon where the microbiota play a key role in the formation of catabolites. Evidence on the potential of the in vivo metabolites and catabolites of acyl-quinic acids to promote the consumer's health is evaluated.
Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1991-01-01
The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.
NASA Astrophysics Data System (ADS)
Momeni, Shima; Nematollahi, Davood
2017-02-01
Electrochemical behavior of acid orange 7 has been exhaustively studied in aqueous solutions with different pH values, using cyclic voltammetry and constant current coulometry. This study has provided new insights into the mechanistic details, pH dependence and intermediate structure of both electrochemical oxidation and reduction of acid orange 7. Surprisingly, the results indicate that a same redox couple (1-iminonaphthalen-2(1H)-one/1-aminonaphthalen-2-ol) is formed from both oxidation and reduction of acid orange 7. Also, an additional purpose of this work is electrochemical synthesis of three new derivatives of 1-amino-4-(phenylsulfonyl)naphthalen-2-ol (3a-3c) under constant current electrolysis via electrochemical oxidation (and reduction) of acid orange 7 in the presence of arylsulfinic acids as nucleophiles. The results indicate that the electrogenerated 1-iminonaphthalen-2(1 H)-one participates in Michael addition reaction with arylsulfinic acids to form the 1-amino-3-(phenylsulfonyl)naphthalen-2-ol derivatives. The synthesis was carried out in an undivided cell equipped with carbon rods as an anode and cathode.
5[prime] to 3[prime] nucleic acid synthesis using 3[prime]-photoremovable protecting group
Pirrung, M.C.; Shuey, S.W.; Bradley, J.C.
1999-06-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5[prime] to 3[prime] nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5[prime] end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
Li, Junqi; Grillo, Anthony S; Burke, Martin D
2015-08-18
The study and optimization of small molecule function is often impeded by the time-intensive and specialist-dependent process that is typically used to make such compounds. In contrast, general and automated platforms have been developed for making peptides, oligonucleotides, and increasingly oligosaccharides, where synthesis is simplified to iterative applications of the same reactions. Inspired by the way natural products are biosynthesized via the iterative assembly of a defined set of building blocks, we developed a platform for small molecule synthesis involving the iterative coupling of haloboronic acids protected as the corresponding N-methyliminodiacetic acid (MIDA) boronates. Here we summarize our efforts thus far to develop this platform into a generalized and automated approach for small molecule synthesis. We and others have employed this approach to access many polyene-based compounds, including the polyene motifs found in >75% of all polyene natural products. This platform further allowed us to derivatize amphotericin B, the powerful and resistance-evasive but also highly toxic last line of defense in treating systemic fungal infections, and thereby understand its mechanism of action. This synthesis-enabled mechanistic understanding has led us to develop less toxic derivatives currently under evaluation as improved antifungal agents. To access more Csp(3)-containing small molecules, we gained a stereocontrolled entry into chiral, non-racemic α-boryl aldehydes through the discovery of a chiral derivative of MIDA. These α-boryl aldehydes are versatile intermediates for the synthesis of many Csp(3) boronate building blocks that are otherwise difficult to access. In addition, we demonstrated the utility of these types of building blocks in accessing pharmaceutically relevant targets via an iterative Csp(3) cross-coupling cycle. We have further expanded the scope of the platform to include stereochemically complex macrocyclic and polycyclic molecules
ERIC Educational Resources Information Center
Young, Paul E.; Campbell, Andrew
1982-01-01
A simple, three-step procedure for synthesizing a dipeptide from its component amino acids is described. The dipeptide synthesized uses inexpensive amino acids having hydrocarbon side-chains and can be observed in E/Z forms by nuclear magnetic resonance spectroscopy. Each step in the synthesis produces white crystalline products using standard…
EVALUATION OF THE SYNTHESIS AND STRUCTURE OF NEW AZETIDIN-2-ONES OF FERULIC ACID.
Stan, Cătălina Daniela; Drăgan, Maria; Pânzariu, Andreea; Profire, Lenuţa
2016-01-01
To synthesize some new azetidin-2-ones of ferulic acid and to evaluate them from physicochemical and spectral point of view. The synthesis was carried out in several steps: (i) obtaining the ferulic acid chloride; (ii) obtaining the ferulic acid hydrazide with hydrazine hydrate (98%); (iii) condensation of ferulic acid hydrazide with different benzaldehydes (2-hydroxy-/2-nitro-/4-chloro-/4- fluoro-/4-bromo-benzaldehyde) in order to obtain the corresponding hydrazones; (iv) cy- clization of ferulic acid hydrazones with chloroacethyl chloride in freshly distilled toluene medium and in the presence of triethylamine, resulting in the corresponding azetidin-2-ones. Six new azetidin-2-ones of ferulic acid were synthesized. They were characterized in terms of their physicochemical properties and their structure was confirmed by IR and 1H-NMR spectroscopy. Six new azetidin-2-ones of ferulic acid were synthesized, physicochemically characterized and validated spectrally. A
Synthesis and characterization of covalent diphenylalanine nanotube-folic acid conjugates
NASA Astrophysics Data System (ADS)
Castillo, John J.; Rindzevicius, Tomas; Wu, Kaiyu; Schmidt, Michael S.; Janik, Katarzyna A.; Boisen, Anja; Svendsen, Winnie; Rozlosnik, Noemi; Castillo-León, Jaime
2014-07-01
Herein, we describe the synthesis and characterization of a covalent nanoscale assembly formed between diphenylalanine micro/nanotubes (PNT) and folic acid (FA). The conjugate was obtained via chemical functionalization through coupling of amine groups of PNTs and carboxylic groups of FA. The surface analysis of PNT-FA indicated the presence of FA aggregates on the surface of PNTs. The covalent interaction between FA and self-assembled PNTs was further investigated using fluorescence microscopy, Raman and surface-enhanced Raman scattering (SERS) spectroscopies. The SERS experiments were performed on a large area silver-capped (diameter of 62 nm) silicon nanopillars with an approximate height of 400 nm and a width of 200 nm. The results showed that the PNT-FA synthesis procedure preserves the molecular structure of FA. The PNT-FA conjugate presented in this study is a promising candidate for applications in the detection and diagnosis of cancer or tropical diseases such as leishmaniasis and as a carrier nanosystem delivering drugs to malignant tumors that overexpress folate receptors.
Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2
Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing
2016-01-01
Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru–Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry. PMID:27165850
Synthesis of acetic acid via methanol hydrocarboxylation with CO2 and H2.
Qian, Qingli; Zhang, Jingjing; Cui, Meng; Han, Buxing
2016-05-11
Acetic acid is an important bulk chemical that is currently produced via methanol carbonylation using fossil based CO. Synthesis of acetic acid from the renewable and cheap CO2 is of great importance, but state of the art routes encounter difficulties, especially in reaction selectivity and activity. Here we report a route to produce acetic acid from CO2, methanol and H2. The reaction can be efficiently catalysed by Ru-Rh bimetallic catalyst using imidazole as the ligand and LiI as the promoter in 1,3-dimethyl-2-imidazolidinone (DMI) solvent. It is confirmed that methanol is hydrocarboxylated into acetic acid by CO2 and H2, which accounts for the outstanding reaction results. The reaction mechanism is proposed based on the control experiments. The strategy opens a new way for acetic acid production and CO2 transformation, and represents a significant progress in synthetic chemistry.
Gliszczyńska, Anna; Niezgoda, Natalia; Gładkowski, Witold; Czarnecka, Marta; Świtalska, Marta; Wietrzyk, Joanna
2016-01-01
The synthesis of novel phosphatidylcholines with geranic and citronellic acids in sn-1 and sn-2 positions is described. The structured phospholipids were obtained in high yields (59–87%) and evaluated in vitro for their cytotoxic activity against several cancer cell lines of different origin: MV4-11, A-549, MCF-7, LOVO, LOVO/DX, HepG2 and also towards non-cancer cell line BALB/3T3 (normal mice fibroblasts). The phosphatidylcholines modified with monoterpene acid showed a significantly higher antiproliferative activity than free monoterpene acids. The highest activity was observed for the terpene-phospholipids containing the isoprenoid acids in sn-1 position of phosphatidylcholine and palmitic acid in sn-2. PMID:27310666
Castro, Laura; Blázquez, María Luisa; González, Felisa; Muñoz, Jesús Ángel; Ballester, Antonio
2015-10-01
This study focuses on the green synthesis of noble metal nanoparticles (silver (Ag) and platinum (Pt)) and how the size and shape of the nanoparticles produced can be controlled through changes in the initial pH value of the precursor solution. The nanoparticles were characterised by ultra-violet-visible spectroscopy, transmission electron microscopy and X-ray diffraction. This simple and environmentally friendly method allows the synthesis of diverse nanostructures in the absence of a surfactant or polymer to direct nanoparticle growth, and without externally adding seed crystallites. The antibacterial effects of Ag nanoparticles and catalytic properties of Pt nanoparticles were explored for future promising biotechnological approaches in different fields.
Physiological effects of γ-linolenic acid and sesamin on hepatic fatty acid synthesis and oxidation.
Ide, Takashi; Iwase, Haruka; Amano, Saaya; Sunahara, Saki; Tachihara, Ayuka; Yagi, Minako; Watanabe, Tsuyoshi
2017-03-01
Interrelated effects of γ-linolenic acid (GLA) and sesamin, a sesame lignan, on hepatic fatty acid synthesis and oxidation were examined. Rats were fed experimental diets supplemented with 0 or 2 g/kg sesamin (1:1 mixture of sesamin and episesamin) and containing 100 g/kg of palm oil (saturated fat), safflower oil rich in linoleic acid, or oil of evening primrose origin containing 43% GLA (GLA oil) for 18 days. In rats fed sesamin-free diets, GLA oil, compared with other oils, increased the activity and mRNA levels of various enzymes involved in fatty acid oxidation, except for some instances. Sesamin greatly increased these parameters, and the enhancing effects of sesamin on peroxisomal fatty acid oxidation rate and acyl-CoA oxidase, enoyl-CoA hydratase and acyl-CoA thioesterase activities were more exaggerated in rats fed GLA oil than in the animals fed other oils. The combination of sesamin and GLA oil also synergistically increased the mRNA levels of some peroxisomal fatty acid oxidation enzymes and of several enzymes involved in fatty acid metabolism located in other cell organelles. In the groups fed sesamin-free diets, GLA oil, compared with other oils, markedly reduced the activity and mRNA levels of various lipogenic enzymes. Sesamin reduced all these parameters, except for malic enzyme, in rats fed palm and safflower oils, but the effects were attenuated in the animals fed GLA oil. These changes by sesamin and fat type accompanied profound alterations in serum lipid levels. This may be ascribable to the changes in apolipoprotein-B-containing lipoproteins. Copyright © 2016 Elsevier Inc. All rights reserved.
Green Synthesis of Silver Nanoparticles Using Sodium Alginate and Lignosulphonic Acid Blends
NASA Astrophysics Data System (ADS)
Thakur, Amrita; Reddy, Giridhar
2017-08-01
A simple method based on the principles of green chemistry has been developed to synthesize stable silver nanoparticles (AgNP) for possible biomedical applications. Blend of sodium alginate (SA) and lignosulphonic acid (LS) prepared in the ratio of 80/20 mass percent respectively was used as reducing and stabilizing agent. This blend is biocompatible and has shown drug release ability under physiological conditions. Use of blend has an added advantage as LS has the ability to reduce silver while the blend matrix acts as a stabilizing agent. Effect of precursor concentration (AgNO3) and temperature was investigated. Progress of synthesis was monitored using UV-Vis spectroscopy. Higher temperature and lower silver nitrate concentration showed better synthesis of AgNP.
Sheng, Lili; Jena, Prasant Kumar; Hu, Ying; Liu, Hui-Xin; Nagar, Nidhi; Kalanetra, Karen M; French, Samuel William; French, Samuel Wheeler; Mills, David A; Wan, Yu-Jui Yvonne
2017-12-01
Dysregulated bile acid (BA) synthesis or reduced farnesoid X receptor (FXR) levels are found in patients having metabolic diseases, autoimmune hepatitis, and liver cirrhosis or cancer. The objective of this study was to establish the relationship between butyrate and dysregulated BA synthesis-induced hepatitis as well as the effect of butyrate in reversing the liver pathology. Wild-type (WT) and FXR knockout (KO) male mice were placed on a control (CD) or western diet (WD) for 15 months. In the presence or absence of butyrate supplementation, feces obtained from 15-month-old WD-fed FXR KO mice, which had severe hepatitis and liver tumors, were transplanted to 7-month-old WD-fed FXR KO for 3 months. Hepatic phenotypes, microbiota profile, and BA composition were analyzed. Butyrate-generating bacteria and colonic butyrate concentration were reduced due to FXR inactivation and further reduced by WD intake. In addition, WD-fed FXR KO male mice had the highest concentration of hepatic β-muricholic acid (β-MCA) and bacteria-generated deoxycholic acid (DCA) accompanied by serious hepatitis. Moreover, dysregulated BA and reduced SCFA signaling co-existed in both human liver cancers and WD-fed FXR KO mice. Microbiota transplantation using butyrate-deficient feces derived from 15-month-old WD-fed FXR KO mice increased hepatic lymphocyte numbers as well as hepatic β-MCA and DCA concentrations. Furthermore, butyrate supplementation reduced hepatic β-MCA as well as DCA and eliminated hepatic lymphocyte infiltration. In conclusion, reduced butyrate contributes to the development of hepatitis in the FXR KO mouse model. In addition, butyrate reverses dysregulated BA synthesis and its associated hepatitis. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd. Copyright © 2017 Pathological Society of Great Britain and Ireland. Published by John Wiley & Sons, Ltd.
Sabbaghan, Maryam; Yavari, Issa; Hossaini, Zinatossadat
2010-11-01
An efficient synthesis of 4-alkyl-4-methyl-3,4-dihydro-2H,5H-pyrano[3,2-c]chromene-2,5-dione or 4-aryl-3,4-dihydro-2H,5H-pyrano[3,2-c]chromene-2,5-diones via reaction 4-hydroxycoumarin with Meldrum's acid and ketones or aldehydes is described.
Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B
2011-07-01
A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.
Liu, Jun; Pu, Huimin; Liu, Shuang; Kan, Juan; Jin, Changhai
2017-10-15
In recent years, increasing attention has been paid to the grafting of phenolic acid onto chitosan in order to enhance the bioactivity and widen the application of chitosan. Here, we present a comprehensive overview on the recent advances of phenolic acid grafted chitosan (phenolic acid-g-chitosan) in many aspects, including the synthetic method, structural characterization, biological activity, physicochemical property and potential application. In general, four kinds of techniques including carbodiimide based coupling, enzyme catalyzed grafting, free radical mediated grafting and electrochemical methods are frequently used for the synthesis of phenolic acid-g-chitosan. The structural characterization of phenolic acid-g-chitosan can be determined by several instrumental methods. The physicochemical properties of chitosan are greatly altered after grafting. As compared with chitosan, phenolic acid-g-chitosan exhibits enhanced antioxidant, antimicrobial, antitumor, anti-allergic, anti-inflammatory, anti-diabetic and acetylcholinesterase inhibitory activities. Notably, phenolic acid-g-chitosan shows potential applications in many fields as coating agent, packing material, encapsulation agent and bioadsorbent. Copyright © 2017 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 hr increases skeletal muscle protein synthesis in neonatal pigs, but this is not sustained for 2 h unless the leucine-induced fall in amino acids is prevented. We aimed to determine whether continuous leucine infusion can stimulate protein synthesis for a prolonged period whe...
Powers, C. D.; Miller, B. A.; Kurtz, H.; Ackermann, W. W.
1969-01-01
Inhibition of HeLa cell deoxyribonucleic acid (DNA) synthesis, which occurred by the 4th to 5th hr after infection with poliovirus, could be blocked completely by guanidine only when it was present before the 2nd hr. At the 2nd hr, there was no significant ribonucleic acid (RNA)-replicase activity, and addition of guanidine inhibited all production of virus but allowed 57% of maximal DNA inhibition to develop. Maximum DNA inhibition developed in cells infected for 4 hr in the presence of guanidine when the guanidine was removed for a 10-min interval. RNA-replicase activity was not enzymatically detectable and viral multiplication did not develop in these cells unless the interval without guanidine was extended to 60 min. The interpretation of the data was that the effect of guanidine on viral-induced inhibition of DNA synthesis was distinct and not a consequence of the inhibition of RNA-replicase. PMID:4305675
Plummer, Christopher M; Breadon, Thomas W; Pearson, James R; Jones, Oliver A H
2016-05-01
This work examines the chemical synthesis of 3,4-methylenedioxy-N-methylamphetamine (MDMA) from piperonal prepared via a catalytic ruthenium tetroxide oxidation of piperine extracted from black pepper. A variety of oxidation conditions were experimented with including different solvent systems and co-oxidants. A sample of prepared piperonal was successfully converted into MDMA via 3,4-methylenedioxyphenyl-2-nitropropene (MDP2NP) and 3,4-methylenedioxyphenyl-2-propanone (MDP2P) and the impurities within each product characterised by GC-MS to give a contaminant profile of the synthetic pathway. Interestingly, it was discovered that a chlorinated analogue of piperonal (6-chloropiperonal) was created during the oxidation process by an as yet unknown mechanism. This impurity reacted alongside piperonal to give chlorinated analogues of each precursor, ultimately yielding 2-chloro-4,5-methylenedioxymethamphetamine (6-Cl-MDMA) as an impurity within the MDMA sample. The methodology developed is a simple way to synthesise a substantial amount of precursor material with easy to obtain reagents. The results also show that chlorinated MDMA analogues, previously thought to be deliberately included adulterants, may in fact be route specific impurities with potential application in determining the origin and synthesis method of seized illicit drugs. Copyright © 2016 The Chartered Society of Forensic Sciences. Published by Elsevier Ireland Ltd. All rights reserved.
Rapid Synthesis of Flavor Compound 4-Ethyloctanoic Acid under Microwave Irradiation
Liu, Yu-Ping; Yin, De-Cai; Chen, Hai-Tao; Sun, Bao-Guo
2010-01-01
Rapid synthesis of 4-ethyloctanoic acid by means of microwave irradiation is described. Diethyl malonate reacted with 2-ethyl-1-bromohexane in the presence of sodium ethoxide to give diethyl (2-ethylhexyl)malonate (1b). 1b was saponified in the solution of ethanol and potassium hydroxide and then acidified to form (2-ethylhexyl)propanedioic acid (1c), and 1c was heated and decarboxylized to give 4-ethyloctanoic acid (1d). The influence of reaction temperature and reaction time on the yield of 1b and the effect of reaction time on the yield of 1c and 1d were investigated in order to optimize the synthetic conditions. The relative optimal conditions for the synthesis of 1b were a mole ratio of sodium to diethyl malonate to 2-ethylhexyl bromide of 0.1:0.11:0.11, a reaction temperature of 80–85 °C, and a reaction time of 2–2.5 h. The yield of 1b was about 79%. 1b was saponified for 30 min and then acidified to form 1c, and the yield of 1c was 96%. 1c was heated for 16 min at 180°C to give 1d, and the yield of 1d was about 90%. The overall yield of 1d is 70% under microwave irradiation. The reaction time was reduced greatly. In order to compare the result of microwave irradiation with that of an oil bath, the reactions were also performed in an oil bath. The structures of intermediates, product and by-product were confirmed by HRMS, 1H NMR, 13C-NMR and IR. PMID:21152328
Greener synthesis of Cu-MOF-74 and its catalytic use for the generation of vanillin.
Flores, J Gabriel; Sánchez-González, Elí; Gutiérrez-Alejandre, Aída; Aguilar-Pliego, Julia; Martínez, Ana; Jurado-Vázquez, Tamara; Lima, Enrique; González-Zamora, Eduardo; Díaz-García, Manuel; Sánchez-Sánchez, Manuel; Ibarra, Ilich A
2018-03-26
A greener synthesis of Cu-MOF-74 was obtained, for the first time, in methanol as the unique solvent and at room temperature. Full characterisation of the MOF material showed its purity and also its nanocrystalline nature. Complete activation (150 °C for 1 h and 10-3 bar) of Cu-MOF-74 afforded unsaturated Cu metal sites and this was corroborated by in situ DRIFT spectroscopy. The access to these Cu open metal sites was tested for the catalytic transformation of trans-ferulic acid to vanillin (yield of 71% and 97% selectivity) and a plausible catalytic reaction mechanism was postulated based on quantum chemical calculations.
Synthesis and Agonistic Activity at the GPR35 of 5,6-Dihydroxyindole-2-carboxylic Acid Analogues
2012-01-01
5,6-Dihydroxyindole-2-carboxylic acid (DHICA), an intermediate of melanin synthesis and an eumelanin building block, was recently discovered to be a GPR35 agonist with moderate potency. Here, we report the synthesis and pharmacological characterization of a series of DHICA analogues against GPR35 using both label-free dynamic mass redistribution and Tango β-arrestin translocation assays. This led to identification of novel GPR35 agonists with improved potency and/or having biased agonism. PMID:24900508
Data for the synthesis of resorcinol-formaldehyde aerogels in acidic and basic media.
Molina-Campos, Daniel F; Fonseca-Correa, Rafael A; Vargas-Delgadillo, Diana P; Giraldo, Liliana; Moreno-Piraján, Juan Carlos
2017-06-01
The aim of this research is to synthesise carbon aerogels and to compare the differences in their textural, morphological and chemical properties when synthesised in basic and acidic media, and with two different types of pretreatment carbonization and activation with CO 2 . Four samples are prepared and characterised using TGA-DTA, SEM, DRX, isotherm determination of N 2 adsorption-desorption at -196 °C and immersion calorimetry. The data for pore distribution are reported using non-local density functional theory and quenched solid density functional theory. Finally, with the immersion calorimetry data, the consistency between the results using this technique and those obtained using the nitrogen isotherms is analysed.
Lage, Sandra; Gentili, Francesco G
2018-06-01
A systematic qualitative and quantitative analysis of fatty acid methyl esters (FAMEs) is crucial for microalgae species selection for biodiesel production. The aim of this study is to identify the best method to assess microalgae FAMEs composition and content. A single-step method, was tested with and without purification steps-that is, separation of lipid classes by thin-layer chromatography (TLC) or solid-phase extraction (SPE). The efficiency of a direct transesterification method was also evaluated. Additionally, the yield of the FAMEs and the profiles of the microalgae samples with different pretreatments (boiled in isopropanol, freezing, oven-dried and freeze-dried) were compared. The application of a purification step after lipid extraction proved to be essential for an accurate FAMEs characterisation. The purification methods, which included TLC and SPE, provided superior results compared to not purifying the samples. Freeze-dried microalgae produced the lowest FAMEs yield. However, FAMEs profiles were generally equivalent among the pretreatments. Copyright © 2018 Elsevier Ltd. All rights reserved.
de Azevedo, Mariangela de Burgos M; de Melo, Vitor H S; Soares, Carlos Roberto J; Miyamoto, Douglas M; Katayama, Ricardo A; Squair, Peterson L; Barros, Caio H N; Tasic, Ljubica
2018-06-14
Biodegradable polymers containing radioactive isotopes such as Holmium 166 ( 166 Ho) have potential applications as beta particle emitters in tumour tissues. It is also a gamma ray emitter, allowing nuclear imaging of any tissue to be acquired. It is frequently used in the form of complexes such as holmium acetylacetonate (HoAcAc), which may cause damages in tissues next to the targets cancer cells, as it is difficult to control its linkage or healthy tissues radiotherapy effects. Poly(d,l-lactic acid), PDLLA, was used to encapsulate holmium acetylacetonate (HoAcAc) using an emulsion solvent extraction/evaporation technique. Microspheres with sizes between 20-53 µm were extensively characterised. HoAcAc release from the microspheres was assessed through studies using Inductively Coupled Plasma - Optical Emission Spectroscopy, and the microspheres showed no holmium leakage after a period of 10 half-lives and following gamma irradiation. Thus, HoAcAc loaded microspheres are here presented as a potential system for brachytherapy and imaging purposes.
Synthesis of glycerol mono-laurate from lauric acid and glycerol for food antibacterial additive
NASA Astrophysics Data System (ADS)
Setianto, W. B.; Wibowo, T. Y.; Yohanes, H.; Illaningtyas, F.; Anggoro, D. D.
2017-05-01
Synthesis of glycerol mono-laurate (GML) has been performed using esterification reaction of glycerol and lauric acid. The reaction was performed at the condition of temperature of 120-140 °C within 7 hour, variation of molar ratio of glycerol - lauric acid, and was using heterogeneous catalyst of zeolist Y. Without catalyst dealumination the maximum acid conversion was 78%, with GML contained in the sample was 38.6%, and it was obtained at the reaction condition of 140 oC, 15wt% catalyst, and 8:1 molar ratio of glycerol - lauric acid. At the same condition, using dealuminated catalyst, the maximum acid conversion was increased up to 98%, with GML contained in the sample was 50.4%. The GML antibacterial activity was examined. It was observed that the GML has antibacterial activity against gram positive bacterial such as B. cereus and S. aureus.
Integrated process of distillation with side reactors for synthesis of organic acid esters
DOE Office of Scientific and Technical Information (OSTI.GOV)
Panchal, Chandrakant B; Prindle, John C; Kolah, Aspri
An integrated process and system for synthesis of organic-acid esters is provided. The method of synthesizing combines reaction and distillation where an organic acid and alcohol composition are passed through a distillation chamber having a plurality of zones. Side reactors are used for drawing off portions of the composition and then recycling them to the distillation column for further purification. Water is removed from a pre-reactor prior to insertion into the distillation column. An integrated heat integration system is contained within the distillation column for further purification and optimizing efficiency in the obtaining of the final product.
An oxazetidine amino acid for chemical protein synthesis by rapid, serine-forming ligations
NASA Astrophysics Data System (ADS)
Pusterla, Ivano; Bode, Jeffrey W.
2015-08-01
Amide-forming ligation reactions allow the chemical synthesis of proteins by the union of unprotected peptide segments, and enable the preparation of protein derivatives not accessible by expression or bioengineering approaches. The native chemical ligation (NCL) of thioesters and N-terminal cysteines is unquestionably the most successful approach, but is not ideal for all synthetic targets. Here we describe the synthesis of an Fmoc-protected oxazetidine amino acid for use in the α-ketoacid-hydroxylamine (KAHA) amide ligation. When incorporated at the N-terminus of a peptide segment, this four-membered cyclic hydroxylamine can be used for rapid serine-forming ligations with peptide α-ketoacids. This ligation operates at low concentration (100 μM-5 mM) and mild temperatures (20-25 °C). The utility of the reaction was demonstrated by the synthesis of S100A4, a 12 kDa calcium-binding protein not easily accessible by NCL or other amide-forming reactions due to its primary sequence and properties.
The high-throughput synthesis and phase characterisation of amphiphiles: a sweet case study.
Feast, George C; Hutt, Oliver E; Mulet, Xavier; Conn, Charlotte E; Drummond, Calum J; Savage, G Paul
2014-03-03
A new method for the discovery of amphiphiles by using high-throughput (HT) methods to synthesise and characterise a library of galactose- and glucose-containing amphiphilic compounds is presented. The copper-catalysed azide–alkyne cycloaddition (CuAAC) “click” reaction between azide-tethered simple sugars and alkyne-substituted hydrophobic tails was employed to synthesise a library of compounds with systematic variations in chain length and unsaturation in a 24-vial array format. The liquid–crystalline phase behaviour was characterised in a HT manner by using synchrotron small-angle X-ray scattering (SSAXS). The observed structural variation with respect to chain parameters, including chain length and degree of unsaturation, is discussed, as well as hydration effects and degree of hydrogen bonding between head groups. The validity of our HT screening approach was verified by resynthesising a short-chain glucose amphiphile. A separate phase analysis of this compound confirmed the presence of numerous lyotropic liquid–crystalline phases.
Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo
2018-01-20
Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Kawasoko, Cristiane Y; Foletto, Patricia; Rodrigues, Oscar E D; Dornelles, Luciano; Schwab, Ricardo S; Braga, Antonio L
2013-08-21
The synthesis of new chiral seleno-, telluro-, and thio-N-Boc-γ-amino acids is described herein. These new compounds were prepared through a simple and short synthetic route, from the inexpensive and commercially-available amino acid L-glutamic acid. The products, with a highly modular character, were obtained in good to excellent yields, via hydrolysis of chalcogen pyroglutamic derivatives with overall retention of the L-glutamic acid stereochemistry. Also, an L-diselenide-N-Boc-γ-amino acid was prepared in good yield. This new synthetic route represents an efficient method for preparing new L-chalcogen- and L-diselenide-γ-amino acids with biological potential.
Bridging bioinorganic chemistry with asymmetric synthesis: a naturally occurring metalloprotein is used for the structure-based evolution of chiral auxiliaries that prove to be effective in the synthesis of Fmoc-L-γ-carboxyglutamic acid.
Synthesis of boron suboxide from boron and boric acid under mild pressure and temperature conditions
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jiao, Xiaopeng; Jin, Hua; Ding, Zhanhui
2011-05-15
Graphical abstract: Well-crystallized and icosahedral B{sub 6}O crystals were prepared by reacting boron and boric acid at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work.. Research highlights: {yields} Well-crystallized icosahedral B{sub 6}O was synthesized by reacting boric acid and boron. {yields} The synthesis conditions (1 GPa and 1300 {sup o}C for 2 h) are milder in comparison with previous work. {yields} The more practical synthesis method may make B{sub 6}O as a potential substitute for diamond in industry. -- Abstract: Boron suboxide (B{sub 6}O) was synthesized by reacting boron and boricmore » acid (H{sub 3}BO{sub 3}) at pressures between 1 and 10 GPa, and at temperatures between 1300 and 1400 {sup o}C. The B{sub 6}O samples prepared were icosahedral with diameters ranging from 20 to 300 nm. Well-crystallized and icosahedral crystals with an average size of {approx}100 nm can be obtained at milder reaction conditions (1 GPa and 1300 {sup o}C for 2 h) as compared to previous work. The bulk B{sub 6}O sample was stable in air at 600 {sup o}C and then slowly oxidized up to 1000 {sup o}C. The relatively mild synthetic conditions developed in this study provide a more practical synthesis of B{sub 6}O, which may potentially be used as a substitute for diamond in industry as a new superhard material.« less
Kojima, Yuzo; Sakuradani, Eiji; Shimizu, Sakayu
2006-09-01
Enzymatic acidolysis and glyceride synthesis using polyunsaturated fatty acids (PUFAs) with lipases from Pseudomonas fluorescens HU380 (HU-lipase), P. fluorescens AK102 (AK-lipase), and Candida rugosa (CR-lipase) were studied. The acidolysis of triolein with eicosapentaenoic acid (EPA) or docosahexaenoic acid (DHA) in n-hexane was evaluated with lipases immobilized on Celite 545. HU-lipase showed the highest incorporation rate at a low temperature (10 degrees C) with either EPA or DHA as the acyl donor, and the rate decreased with increasing reaction temperature. At 45 degrees C, the rates for EPA and DHA were 7.1 and 0.5 relative to those at 10 degrees C, respectively. The EPA incorporation rate was even higher at a low temperature (10 degrees C), and the DHA incorporation rate increased with decreasing temperature. Although AK-lipase showed the reverse tendency for incorporation rate, the DHA incorporation rate increased with increasing reaction temperature with both PUFAs. HU-lipase reacted well with PUFAs such as DHA, EPA, arachidonic acid (AA), mead acid (MA), and dihomo-gamma-linolenic acid (DGLA) on acidolysis and glyceride synthesis. The reactivities of AK-lipase toward these PUFAs except for DGLA, i.e., MA, AA, EPA, and DHA, were low for both reactions. The unique substrate specificities of the lipases from the Pseudomonas strains will enable us to use these lipases for the modification of fats and oils containing PUFAs such as fish oil.
Piazzon, A; Vrhovsek, U; Masuero, D; Mattivi, F; Mandoj, F; Nardini, M
2012-12-19
The main metabolites of caffeic and ferulic acids (ferulic acid-4'-O-sulfate, caffeic acid-4'-O-sulfate, and caffeic acid-3'-O-sulfate), the most representative phenolic acids in fruits and vegetables, and the acyl glucuronide of ferulic acid were synthesized, purified, and tested for their antioxidant activity in comparison with those of their parent compounds and other related phenolics. Both the ferric reducing antioxidant power (FRAP) assay and the 2,2'-azino-bis(3-ethylbenzothiazoline-6-sulfonic acid) (ABTS) radical scavenging method were used. Ferulic acid-4'-O-sulfate and ferulic acid-4'-O-glucuronide exhibited very low antioxidant activity, while the monosulfate derivatives of caffeic acid were 4-fold less efficient as the antioxidant than caffeic acid. The acyl glucuronide of ferulic acid showed strong antioxidant action. The antioxidant activity of caffeic acid-3'-O-glucuronide and caffeic acid-4'-O-glucuronide was also studied. Our results demonstrate that some of the products of phenolic acid metabolism still retain strong antioxidant properties. Moreover, we first demonstrate the ex vivo synthesis of the acyl glucuronide of ferulic acid by mouse liver microsomes, in addition to the phenyl glucuronide.
Fox, Simon R.; Rawsthorne, Stephen; Hills, Matthew J.
2001-01-01
The uptake in vitro of glucose (Glc)-6-phosphate (Glc-6-P) into plastids from the roots of 10- to 14-d-old pea (Pisum sativum L. cv Puget) plants was inhibited by oleoyl-coenzyme A (CoA) concentrations in the low micromolar range (1–2 μm). The IC50 (the concentration of inhibitor that reduces enzyme activity by 50%) for the inhibition of Glc-6-P uptake was approximately 750 nm; inhibition was reversed by recombinant rapeseed (Brassica napus) acyl-CoA binding protein. In the presence of ATP (3 mm) and CoASH (coenzyme A; 0.3 mm), Glc-6-P uptake was inhibited by 60%, due to long-chain acyl-CoA synthesis, presumably from endogenous sources of fatty acids present in the preparations. Addition of oleoyl-CoA (1 μm) decreased carbon flux from Glc-6-P into the synthesis of starch and through the oxidative pentose phosphate (OPP) pathway by up to 73% and 40%, respectively. The incorporation of carbon from Glc-6-P into fatty acids was not detected under any conditions. Oleoyl-CoA inhibited the incorporation of acetate into fatty acids by 67%, a decrease similar to that when ATP was excluded from incubations. The oleoyl-CoA-dependent inhibition of fatty acid synthesis was attributable to a direct inhibition of the adenine nucleotide translocator by oleoyl-CoA, which indirectly reduced fatty acid synthesis by ATP deprivation. The Glc-6-P-dependent stimulation of acetate incorporation into fatty acids was reversed by the addition of oleoyl-CoA. PMID:11457976
Nikoloski, Zoran
2015-01-01
Plants as sessile organisms cannot escape their environment and have to adapt to any changes in the availability of sunlight and nutrients. The quantification of synthesis costs of metabolites, in terms of consumed energy, is a prerequisite to understand trade-offs arising from energetic limitations. Here, we examine the energy consumption of amino acid synthesis in Arabidopsis thaliana. To quantify these costs in terms of the energy equivalent ATP, we introduce an improved cost measure based on flux balance analysis and apply it to three state-of-the-art metabolic reconstructions to ensure robust results. We present the first systematic in silico analysis of the effect of nitrogen supply (nitrate/ammonium) on individual amino acid synthesis costs as well as of the effect of photoautotrophic and heterotrophic growth conditions, integrating day/night-specific regulation. Our results identify nitrogen supply as a key determinant of amino acid costs, in agreement with experimental evidence. In addition, the association of the determined costs with experimentally observed growth patterns suggests that metabolite synthesis costs are involved in shaping regulation of plant growth. Finally, we find that simultaneous uptake of both nitrogen sources can lead to efficient utilization of energy source, which may be the result of evolutionary optimization. PMID:25706533
Arnold, Anne; Sajitz-Hermstein, Max; Nikoloski, Zoran
2015-01-01
Plants as sessile organisms cannot escape their environment and have to adapt to any changes in the availability of sunlight and nutrients. The quantification of synthesis costs of metabolites, in terms of consumed energy, is a prerequisite to understand trade-offs arising from energetic limitations. Here, we examine the energy consumption of amino acid synthesis in Arabidopsis thaliana. To quantify these costs in terms of the energy equivalent ATP, we introduce an improved cost measure based on flux balance analysis and apply it to three state-of-the-art metabolic reconstructions to ensure robust results. We present the first systematic in silico analysis of the effect of nitrogen supply (nitrate/ammonium) on individual amino acid synthesis costs as well as of the effect of photoautotrophic and heterotrophic growth conditions, integrating day/night-specific regulation. Our results identify nitrogen supply as a key determinant of amino acid costs, in agreement with experimental evidence. In addition, the association of the determined costs with experimentally observed growth patterns suggests that metabolite synthesis costs are involved in shaping regulation of plant growth. Finally, we find that simultaneous uptake of both nitrogen sources can lead to efficient utilization of energy source, which may be the result of evolutionary optimization.
Characterisation of lactic acid bacteria isolated from naturally fermented Greek dry salami.
Samelis, J; Maurogenakis, F; Metaxopoulos, J
1994-10-01
A total of 348 lactic acid bacteria isolated from five batches of naturally fermented dry salami at various stages of ripening were characterised. The majority of the strains were assigned to two main phylogenetic groups of species: (i) the psychrotrophic, formerly called atypical, meat streptobacteria (169 strains) and (ii) a new genus Weissella (120), which was recently proposed (Collins et al., 1993) to include Leuconostoc paramesenteroides and some other closely related species. Meat streptobacteria were identified as Lactobacillus curvatus (88 strains) and L. sake (76), whereas 5 strains were indistinguishable and, thus designated L. sake/curvatus. Non-psychrotrophic streptobacteria were also isolated and identified as L. plantarum (34 strains), L. farciminis (10), L. coryniformis (1) and L. casei subsp. pseudoplantarum (1). The majority of the Weissella strains (86) were leuconostoc-like bacteria; four of them were identified as W. viridescens, 11 belonged to the newly described W. hellenica (Collins et al., 1993), another 11 resembled W. paramesenteroides, whereas 60 isolates were not classified to any species. The latter group comprised strains that produced D(L)-lactate. The remaining Weissella were gas-forming, arginine-positive rods assigned to W. minor (31) and W. halotolerans (3). Other species identified were Enterococcus faecium (10), Leuconostoc mesenteroides (1), L. brevis (1) and Pediococcus sp. (1). The main criteria used to distinguish between above species as well as their distribution on the five salami batches in relation to their succession with time and suitability as starters were discussed.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
The existence of an intricate interplay of nucleic acids and nucleotides in the chain of events leading from free amino acid to completed polypeptide chain has been determined. To this was added another participant to the nucleotides in protein synthesis - diadenosine-5', 5''', p'p/sup 4/-tetraphosphate (Ap4A). Ap/sub 4/A serves as an initiation primer for DNA synthesis in a eukaryotic system catalyzed by DNA polymerase ..cap alpha... Thus the initial step in protein synthesis is linked to the first step in DNA synthesis by a small molecular weight, unique dinucleotide signal. Advances in the methodology of nucleic acid sequencing have mademore » it possible to examine the relationship between specific short segments of DNA and RNA and their function in the metabolism of the living cell. The triester method of synthesizing deoxynucleotide polymers has made it feasible to synthesize and use specific oligomeric deoxynucleotide sequences as probes of genetic function and potential viral inhibitors. The synthesis of ribonucleotide polymers has been more difficult, due almost entirely to the presence of the 2' ribosyl hydroxyl group. The possibility is now emerging, however, of employing ribonucleotide polymers as specific RNA-virus inhibitors.« less
Giustiniano, Mariateresa; Meneghetti, Fiorella; Mercalli, Valentina; Varese, Monica; Giustiniano, Francesco; Novellino, Ettore; Tron, Gian Cesare
2014-10-17
A novel one-pot multicomponent synthesis of α-aminocarbonyl N-acylhydrazones starting from readily available hydrazonoyl chlorides, isocyanides, and carboxylic acids is reported. The strategy exploits the ability of the carboxylic acid as a third component to suppress all competing reactions between nitrile imines and isocyanides, channeling the course of the reaction toward the formation of this novel class of compounds.
Faiella, Marina; Maglio, Ornella; Nastri, Flavia; Lombardi, Angela; Lista, Liliana; Hagen, Wilfred R; Pavone, Vincenzo
2012-12-07
A new artificial metalloenzyme, MP3 (MiniPeroxidase 3), designed by combining the excellent structural properties of four-helix bundle protein scaffolds with the activity of natural peroxidases, was synthesised and characterised. This new hemeprotein model was developed by covalently linking the deuteroporphyrin to two peptide chains of different compositions to obtain an asymmetric helix-loop-helix/heme/helix-loop-helix sandwich arrangement, characterised by 1) a His residue on one chain that acts as an axial ligand to the iron ion; 2) a vacant distal site that is able to accommodate exogenous ligands or substrates; and 3) an Arg residue in the distal site that should assist in hydrogen peroxide activation to give an HRP-like catalytic process. MP3 was synthesised and characterised as its iron complex. CD measurements revealed the high helix-forming propensity of the peptide, confirming the appropriateness of the model procedure; UV/Vis, MCD and EPR experiments gave insights into the coordination geometry and the spin state of the metal. Kinetic experiments showed that Fe(III)-MP3 possesses peroxidase-like activity comparable to R38A-hHRP, highlighting the possibility of mimicking the functional features of natural enzymes. The synergistic application of de novo design methods, synthetic procedures, and spectroscopic characterisation, described herein, demonstrates a method by which to implement and optimise catalytic activity for an enzyme mimetic. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Montoya, A; Gómez-Lechón, M J; Castell, J V
1989-04-01
Supplementation of Ham's F12 culture medium with essential amino acids (EAA) up to the rat plasma levels increased the rates of synthesis of albumin and transferrin by cultured rat hepatocytes by 1.3 and 1.7, respectively. Fifty percent of this increase could be attributed to three of the EAA: the branched-chain amino acids (BCAA: Leu Ile and Val). Non-branched-chain essential amino acids (non-BC-EAA) stimulated only 25% of the increase produced by the whole EAA mixture. When each EAA was tested individually, none of them caused an appreciable increase in albumin and transferrin in culture medium. When the concentrations of all EAA were raised to rat postprandial portal levels, albumin and transferrin synthesis rates reached a maximum, increasing by 3.2 and 3.5, respectively. Supplementation with BCAA at postprandial portal concentrations increased albumin and transferrin synthesis rates by 2.2 and 2.0, respectively, and had no noteworthy effect on the synthesis of cellular proteins. Non-BC-EAA at their postprandial portal concentrations increased albumin and transferrin synthesis rates by 1.7 and 1.9, respectively. Supplementation with alanine to reach a nitrogen content equal to that of the modified EAA-enriched medium had no stimulatory effect. Our results show that EAA have a specific effect on the synthesis of plasma proteins by cultured hepatocytes, and that BCAA at physiologic concentrations account for the major part of this stimulatory effect. Consequently, EAA and particularly BCAA concentration should be elevated in serum-free nutrient media to sustain maximum plasma protein synthesis.
Synthesis and characterization of an anomeric sulfur analogue of CMP-sialic acid.
Cohen, S B; Halcomb, R L
2000-09-22
alpha-2,3-Sialyltransferase catalyzes the transfer of sialic acid from CMP-sialic acid (1) to a lactose acceptor. An analogue of 1 was synthesized in which the anomeric oxygen atom was replaced with a sulfur atom (1S). The key step in the synthesis of 1S was a tetrazole-promoted coupling of a cytidine-5'-phosphoramidite with a glycosyl thiol of a protected sialic acid. Compounds 1 and 1S were characterized for their activity in a sialyl transfer assay. The rate of solvolysis in aqueous buffer of analogue 1S was 50-fold slower than that of 1. Analogue 1S was found to be substrate for alpha-2,3-sialyltransferase. The K(m) of 1S was just 3-fold higher than that of 1, while the k(cat) of 1S was 2 orders of magnitude lower compared to 1.
Smith, Stuart; Witkowski, Andrzej; Moghul, Ayesha; Yoshinaga, Yuko; Nefedov, Michael; de Jong, Pieter; Feng, Dejiang; Fong, Loren; Tu, Yiping; Hu, Yan; Young, Stephen G.; Pham, Thomas; Cheung, Carling; Katzman, Shana M.; Brand, Martin D.; Quinlan, Casey L.; Fens, Marcel; Kuypers, Frans; Misquitta, Stephanie; Griffey, Stephen M.; Tran, Son; Gharib, Afshin; Knudsen, Jens; Hannibal-Bach, Hans Kristian; Wang, Grace; Larkin, Sandra; Thweatt, Jennifer; Pasta, Saloni
2012-01-01
A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor. PMID:23077570
Pirali, Tracey; Mossetti, Riccardo; Galli, Simona; Tron, Gian Cesare
2011-07-15
A stereospecific multicomponent reaction among isocyanides, syn-chlorooximes, and carboxylic acids provides an efficient synthesis of biologically relevant syn-α-oximinoamides. © 2011 American Chemical Society
Enantioselective Synthesis of α-Oxy Amides via Umpolung Amide Synthesis
Leighty, Matthew W.; Shen, Bo
2012-01-01
α-Oxy amides are prepared through enantioselective synthesis using a sequence beginning with a Henry addition of bromonitromethane to aldehydes, and finishing with Umpolung Amide Synthesis (UmAS). Key to high enantioselection is the finding that ortho-iodo benzoic acid salts of the chiral copper(II) bis(oxazoline) catalyst deliver both diastereomers of the Henry adduct with high enantiomeric excess, homochiral at the oxygen-bearing carbon. Overall, this approach to α-oxy amides provides an innovative complement to alternatives that focus almost entirely on the enantioselective synthesis of α-oxy carboxylic acids. PMID:22967461
Enantioselective synthesis of α-oxy amides via Umpolung amide synthesis.
Leighty, Matthew W; Shen, Bo; Johnston, Jeffrey N
2012-09-19
α-Oxy amides are prepared through enantioselective synthesis using a sequence beginning with a Henry addition of bromonitromethane to aldehydes and finishing with Umpolung Amide Synthesis (UmAS). Key to high enantioselection is the finding that ortho-iodo benzoic acid salts of the chiral copper(II) bis(oxazoline) catalyst deliver both diastereomers of the Henry adduct with high enantiomeric excess, homochiral at the oxygen-bearing carbon. Overall, this approach to α-oxy amides provides an innovative complement to alternatives that focus almost entirely on the enantioselective synthesis of α-oxy carboxylic acids.
Gorissen, Stefan H M; Witard, Oliver C
2018-02-01
The age-related loss of skeletal muscle mass and function is caused, at least in part, by a reduced muscle protein synthetic response to protein ingestion. The magnitude and duration of the postprandial muscle protein synthetic response to ingested protein is dependent on the quantity and quality of the protein consumed. This review characterises the anabolic properties of animal-derived and plant-based dietary protein sources in older adults. While approximately 60 % of dietary protein consumed worldwide is derived from plant sources, plant-based proteins generally exhibit lower digestibility, lower leucine content and deficiencies in certain essential amino acids such as lysine and methionine, which compromise the availability of a complete amino acid profile required for muscle protein synthesis. Based on currently available scientific evidence, animal-derived proteins may be considered more anabolic than plant-based protein sources. However, the production and consumption of animal-derived protein sources is associated with higher greenhouse gas emissions, while plant-based protein sources may be considered more environmentally sustainable. Theoretically, the lower anabolic capacity of plant-based proteins can be compensated for by ingesting a greater dose of protein or by combining various plant-based proteins to provide a more favourable amino acid profile. In addition, leucine co-ingestion can further augment the postprandial muscle protein synthetic response. Finally, prior exercise or n-3 fatty acid supplementation have been shown to sensitise skeletal muscle to the anabolic properties of dietary protein. Applying one or more of these strategies may support the maintenance of muscle mass with ageing when diets rich in plant-based protein are consumed.
Liu, Q; Wang, C; Guo, G; Huo, W J; Zhang, S L; Pei, C X; Zhang, Y L; Wang, H
2018-02-12
Branched-chain volatile fatty acids (BCVFA) supplements could promote lactation performance and milk quality by improving ruminal fermentation and milk fatty acid synthesis. This study was conducted to evaluate the effects of BCVFA supplementation on milk performance, ruminal fermentation, nutrient digestibility and mRNA expression of genes related to fatty acid synthesis in mammary gland of dairy cows. A total of 36 multiparous Chinese Holstein cows averaging 606±4.7 kg of BW, 65±5.2 day in milk (DIM) with daily milk production of 30.6±0.72 kg were assigned to one of four groups blocked by lactation number, milk yield and DIM. The treatments were control, low-BCVFA (LBCVFA), medium-BCVFA (MBCVFA) and high-BCVFA (HBCVFA) with 0, 30, 60 and 90 g BCVFA per cow per day, respectively. Experimental periods were 105 days with 15 days of adaptation and 90 days of data collection. Dry matter (DM) intake tended to increase, but BW changes were similar among treatments. Yields of actual milk, 4% fat corrected milk, milk fat and true protein linearly increased, but feed conversion ratio (FCR) linearly decreased with increasing BCVFA supplementation. Milk fat content linearly increased, but true protein content tended to increase. Contents of C4:0, C6:0, C8:0, C10:0, C12:0, C14:0 and C15:0 fatty acids in milk fat linearly increased, whereas other fatty acids were not affected with increasing BCVFA supplementation. Ruminal pH, ammonia N concentration and propionate molar proportion linearly decreased, but total VFA production and molar proportions of acetate and butyrate linearly increased with increasing BCVFA supplementation. Consequently, acetate to propionate ratios linearly increased. Digestibilities of DM, organic matter, CP, NDF and ADF also linearly increased. In addition, mRNA expressions of peroxisome proliferator-activated receptor γ, sterol regulatory element-binding factor 1 and fatty acid-binding protein 3 linearly increased, mRNA expressions of acetyl
NASA Astrophysics Data System (ADS)
Rasappan, Ramesh; Aggarwal, Varinder K.
2014-09-01
In planning organic syntheses, disconnections are most often made adjacent to functional groups, which assist in C-C bond formation. For molecules devoid of obvious functional groups this approach presents a problem, and so functionalities must be installed temporarily and then removed. Here we present a traceless strategy for organic synthesis that uses a boronic ester as such a group in a one-pot lithiation-borylation-protodeboronation sequence. To realize this strategy, we developed a methodology for the protodeboronation of alkyl pinacol boronic esters that involves the formation of a boronate complex with a nucleophile followed by oxidation with Mn(OAc)3 in the presence of the hydrogen-atom donor 4-tert-butylcatechol. Iterative lithiation-borylation-protodeboronation allows the coupling of smaller fragments to build-up long alkyl chains. We employed this strategy in the synthesis of hydroxyphthioceranic acid, a key component of the cell-wall lipid of the virulent Mycobacterium tuberculosis, in just 14 steps (longest linear sequence) with full stereocontrol.
Asymmetric synthesis of propargylamines as amino acid surrogates in peptidomimetics
Wünsch, Matthias; Schröder, David; Fröhr, Tanja; Teichmann, Lisa; Hedwig, Sebastian; Janson, Nils; Belu, Clara; Simon, Jasmin; Heidemeyer, Shari; Holtkamp, Philipp; Rudlof, Jens; Klemme, Lennard; Hinzmann, Alessa; Neumann, Beate; Stammler, Hans-Georg
2017-01-01
The amide moiety of peptides can be replaced for example by a triazole moiety, which is considered to be bioisosteric. Therefore, the carbonyl moiety of an amino acid has to be replaced by an alkyne in order to provide a precursor of such peptidomimetics. As most amino acids have a chiral center at Cα, such amide bond surrogates need a chiral moiety. Here the asymmetric synthesis of a set of 24 N-sulfinyl propargylamines is presented. The condensation of various aldehydes with Ellman’s chiral sulfinamide provides chiral N-sulfinylimines, which were reacted with (trimethylsilyl)ethynyllithium to afford diastereomerically pure N-sulfinyl propargylamines. Diverse functional groups present in the propargylic position resemble the side chain present at the Cα of amino acids. Whereas propargylamines with (cyclo)alkyl substituents can be prepared in a direct manner, residues with polar functional groups require suitable protective groups. The presence of particular functional groups in the side chain in some cases leads to remarkable side reactions of the alkyne moiety. Thus, electron-withdrawing substituents in the Cα-position facilitate a base induced rearrangement to α,β-unsaturated imines, while azide-substituted propargylamines form triazoles under surprisingly mild conditions. A panel of propargylamines bearing fluoro or chloro substituents, polar functional groups, or basic and acidic functional groups is accessible for the use as precursors of peptidomimetics. PMID:29234470
Yan, Rui; Zhang, Yaoyao; Wang, Xiaohui; Xu, Jianxiong; Wang, Da; Zhang, Wangqing
2012-02-15
Synthesis of porous poly(styrene-co-acrylic acid) (PS-co-PAA) microspheres through one-step soap-free emulsion polymerization is reported. Various porous PS-co-PAA microspheres with the particle size ranging from 150 to 240 nm and with the pore size ranging from 4 to 25 nm are fabricated. The porous structure of the microspheres is confirmed by the transmission electron microscopy measurement and Brunauer-Emmett-Teller (BET) analysis. The reason for synthesis of the porous PS-co-PAA microspheres is discussed, and the phase separation between the encapsulated hydrophilic poly(acrylic acid) segment and the hydrophobic polystyrene domain within the PS-co-PAA microspheres is ascribed to the pore formation. The present synthesis of the porous PS-co-PAA microspheres is anticipated to be a new and convenient way to fabricate porous polymeric particles. Copyright © 2011 Elsevier Inc. All rights reserved.
Chaudhari, Pramod S; Pathare, Sagar P; Akamanchi, Krishnacharaya G
2012-04-20
A systematic exploration of thiophilic ability of o-iodoxybenzoic acid (IBX) for oxidative desulfurization to trigger domino reactions leading to new methodologies for synthesis of different azoles is described. A variety of highly substituted oxadiazoles, thiadiazoles, triazoles, and tetrazoles have been successfully synthesized in good to excellent yields, starting from readily accessible thiosemicarbazides, bis-diarylthiourea, 1,3-disubtituted thiourea, and thioamides. © 2012 American Chemical Society
Yajima, Tomoko; Yoshida, Eriko; Hamano, Masako
2013-01-01
The cis- and trans-stereoselective radical additions to α-methylene-γ-alkyl- γ-lactams were investigated and the scope and limitation of the reaction were also revealed. This stereoselective radical reaction was used for synthesis of chiral pyroglutamic acid derivatives starting from a commercially available chiral amino acid.
Carbon Catalyst Synthesis - Sucrose was treated directly with excess sulfuric acid sulfuric acid (9:1 mol/mol, 25°C). A carbon foam (nearly 20 fold increase in bulk volume) was immediately formed. The foam was then washed until no sulfate was dete...
My, L.; Ghandour Achkar, N.; Viala, J. P.
2015-01-01
ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator
NASA Technical Reports Server (NTRS)
Nelson, Kevin E.; Miller, Stanley L.
1992-01-01
The polymerization of ribonucleic acids or their precursors constitutes an important event in prebiotic chemistry. The various problems using ribonucleotides to make RNA suggest that there may have been a precursor. An attractive possibility are the peptide nucleic acids (PNA). PNAs are nucleotide analogs that make use of a polymer of ethylenediamine monoacetic acid (EDMA or 2-amninoethyl glycine) with the bases attached by an acetic acid. EDMA is an especially attractive alternative to the ribose phosphate or deoxyribose phosphate backbone because it contains no chiral centers and is potentially prebiotic, but there is no reported prebiotic synthesis. We have synthesized both EDMA and ethylenediamine diacetic acid (EDDA) from the prebiotic compounds ethylenediamine, formaldehyde, and hydrogen cyanide. The yields of EDMA range from 11 to 79% along with some sEDDA and uEDDA. These reactions work with concentrations of 10(exp -1)M and as low as 10(exp -4)M, and the reaction is likely to be effective at even lower concentrations. Ethylenediamine is a likely prebiotic compound, but it has not yet been demonstrated, although compounds such as ethanolamine and cysteamine have been proven to be prebiotic. Under neutral pH and heating at l00 C, EDMA is converted to the lactam, monoketopiperazine (MKP). The cyclization occurs and has an approximate ratio of MKP/EDMA = 3 at equilibrium. We have measured the solubilities of EDMA center dot H20 as 6.4 m, EDMA center dot HCl center dot H20 as 13.7 m, and EDMA center dot 2HCl center dot H20 as 3.4 m. These syntheses together with the high solubility of EDMA suggest that EDMA would concentrate in drying lagoons and might efficiently form polymers. Given the instability of ribose and the poor polymerizability of nucleotides, the prebiotic presence of EDMA and the possibility of its polymerization raises the possibility that PNAs are the progenitors of present day nucleic acids. A pre-RNA world may have existed in which PNAs or
Ishak, Nurazwa; Lajis, Ahmad Firdaus B; Mohamad, Rosfarizan; Ariff, Arbakariya B; Mohamed, Mohd Shamzi; Halim, Murni; Wasoh, Helmi
2018-02-24
The synthesis of kojic acid derivative (KAD) from kojic and palmitic acid (C16:0) in the presence of immobilized lipase from Rhizomucor miehei (commercially known as Lipozyme RMIM), was studied using a shake flask system. Kojic acid is a polyfunctional heterocycles that acts as a source of nucleophile in this reaction allowing the formation of a lipophilic KAD. In this study, the source of biocatalyst, Lipozyme RMIM, was derived from the lipase of Rhizomucor miehei immobilized on weak anion exchange macro-porous Duolite ES 562 by the adsorption technique. The effects of solvents, enzyme loading, reaction temperature, and substrate molar ratio on the reaction rate were investigated. In one-factor-at-a-time (OFAT) experiments, a high reaction rate (30.6 × 10 -3 M·min -1 ) of KAD synthesis was recorded using acetone, enzyme loading of 1.25% ( w / v ), reaction time of 12 h, temperature of 50 °C and substrate molar ratio of 5:1. Thereafter, a yield of KAD synthesis was optimized via the response surface methodology (RSM) whereby the optimized molar ratio (fatty acid: kojic acid), enzyme loading, reaction temperature and reaction time were 6.74, 1.97% ( w / v ), 45.9 °C, and 20 h respectively, giving a high yield of KAD (64.47%). This condition was reevaluated in a 0.5 L stirred tank reactor (STR) where the agitation effects of two impellers; Rushton turbine (RT) and pitch-blade turbine (PBT), were investigated. In the STR, a very high yield of KAD synthesis (84.12%) was achieved using RT at 250 rpm, which was higher than the shake flask, thus indicating better mixing quality in STR. In a rheological study, a pseudoplastic behavior of KAD mixture was proposed for potential application in lotion formulation.
Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C; Dedmon, William L; Katsanos, Christos S
2016-10-01
Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg -1 ·min -1 ), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA. Copyright © 2016 the American Physiological Society.
Everman, Sarah; Meyer, Christian; Tran, Lee; Hoffman, Nyssa; Carroll, Chad C.; Dedmon, William L.
2016-01-01
Insulin stimulates muscle protein synthesis when the levels of total amino acids, or at least the essential amino acids, are at or above their postabsorptive concentrations. Among the essential amino acids, branched-chain amino acids (BCAA) have the primary role in stimulating muscle protein synthesis and are commonly sought alone to stimulate muscle protein synthesis in humans. Fourteen healthy young subjects were studied before and after insulin infusion to examine whether insulin stimulates muscle protein synthesis in relation to the availability of BCAA alone. One half of the subjects were studied in the presence of postabsorptive BCAA concentrations (control) and the other half in the presence of increased plasma BCAA (BCAA). Compared with that prior to the initiation of the insulin infusion, fractional synthesis rate of muscle protein (%/h) did not change (P > 0.05) during insulin in either the control (0.04 ± 0.01 vs 0.05 ± 0.01) or the BCAA (0.05 ± 0.02 vs. 0.05 ± 0.01) experiments. Insulin decreased (P < 0.01) whole body phenylalanine rate of appearance (μmol·kg−1·min−1), indicating suppression of muscle proteolysis, in both the control (1.02 ± 0.04 vs 0.76 ± 0.04) and the BCAA (0.89 ± 0.07 vs 0.61 ± 0.03) experiments, but the change was not different between the two experiments (P > 0.05). In conclusion, insulin does not stimulate muscle protein synthesis in the presence of increased circulating levels of plasma BCAA alone. Insulin's suppressive effect on proteolysis is observed independently of the levels of circulating plasma BCAA. PMID:27530230
Donepudi, Ajay C.; Ferrell, Jessica M.; Boehme, Shannon; Choi, Hueng‐Sik
2017-01-01
Alcoholic fatty liver disease (AFLD) is a major risk factor for cirrhosis‐associated liver diseases. Studies demonstrate that alcohol increases serum bile acids in humans and rodents. AFLD has been linked to cholestasis, although the physiologic relevance of increased bile acids in AFLD and the underlying mechanism of increasing the bile acid pool by alcohol feeding are still unclear. In this study, we used mouse models either deficient of or overexpressing cholesterol 7α‐hydroxylase (Cyp7a1), the rate‐limiting and key regulatory enzyme in bile acid synthesis, to study the effect of alcohol drinking in liver metabolism and inflammation. Mice were challenged with chronic ethanol feeding (10 days) plus a binge dose of alcohol by oral gavage (5 g/kg body weight). Alcohol feeding reduced bile acid synthesis gene expression but increased the bile acid pool size, hepatic triglycerides and cholesterol, and inflammation and injury in wild‐type mice and aggravated liver inflammation and injury in Cyp7a1‐deficient mice. Interestingly, alcohol‐induced hepatic inflammation and injury were ameliorated in Cyp7a1 transgenic mice. Conclusion: Alcohol feeding alters hepatic bile acid and cholesterol metabolism to cause liver inflammation and injury, while maintenance of bile acid and cholesterol homeostasis protect against alcohol‐induced hepatic inflammation and injury. Our findings indicate that CYP7A1 plays a key role in protection against alcohol‐induced steatohepatitis. (Hepatology Communications 2018;2:99–112) PMID:29404516
Yoshida, Eriko; Hamano, Masako
2013-01-01
Summary The cis- and trans-stereoselective radical additions to α-methylene-γ-alkyl- γ-lactams were investigated and the scope and limitation of the reaction were also revealed. This stereoselective radical reaction was used for synthesis of chiral pyroglutamic acid derivatives starting from a commercially available chiral amino acid. PMID:23946839
Barlos, K; Gatos, D; Hatzi, O; Koch, N; Koutsogianni, S
1996-03-01
S-4-methoxytrityl cysteine was synthesized and converted into the corresponding Fmoc-Cys(Mmt)-OH by its reaction with Fmoc-OSu. As compared to the corresponding Fmoc-Cys(Trt)-OH, the S-Mmt-function was found to be considerably more acid labile. Quantitative S-Mmt-removal occurs selectively in the presence of groups of the tert butyl type and S-Trt by treatment with 0.5-1.0% TFA. The new derivative was successfully utilized in the SPPS of Tyr1-somatostatin on 2-chlorotrityl resin. In this synthesis groups of the Trt-type were exclusively used for amino acid side-chain protection. Quantitative cleavage from the resin and complete deprotection was performed by treatment with 3% TFA in DCM-TES (95:5) for 30 min at RT. We observed no reduction of tryptophan under these conditions.
Midzak, Andrew; Papadopoulos, Vassilios
2014-09-01
Steroid hormones, bioactive oxysterols and bile acids are all derived from the biological metabolism of lipid cholesterol. The enzymatic pathways generating these compounds have been an area of intense research for almost a century, as cholesterol and its metabolites have substantial impacts on human health. Owing to its high degree of hydrophobicity and the chemical properties that it confers to biological membranes, the distribution of cholesterol in cells is tightly controlled, with subcellular organelles exhibiting highly divergent levels of cholesterol. The manners in which cells maintain such sterol distributions are of great interest in the study of steroid and bile acid synthesis, as limiting cholesterol substrate to the enzymatic pathways is the principal mechanism by which production of steroids and bile acids is regulated. The mechanisms by which cholesterol moves within cells, however, remain poorly understood. In this review, we examine the subcellular machinery involved in cholesterol metabolism to steroid hormones and bile acid, relating it to both lipid- and protein-based mechanisms facilitating intracellular and intraorganellar cholesterol movement and delivery to these pathways. In particular, we examine evidence for the involvement of specific protein domains involved in cholesterol binding, which impact cholesterol movement and metabolism in steroidogenesis and bile acid synthesis. A better understanding of the physical mechanisms by which these protein- and lipid-based systems function is of fundamental importance to understanding physiological homeostasis and its perturbation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
NASA Astrophysics Data System (ADS)
Dat, Lai Quoc; Ngan, Tran Thi Kim; Nu, Nguyen Thi Xuan
2017-09-01
This research focused on the synthesis of GABA by Lactobacillus bacteria in fermentation of defatted rice bran extract without adding glutamate. Two strains of Lactobacillus were investigated into capacity of GABA synthesis. Result indicates that, Lactobacillus brevis VTCC - B - 454 exhibited the higher capacity of GABA synthesis in fermentation of defatted rice bran extract than that of Lactobacillus plantarum VTCC - B - 890. Total dissolved solid (TDS), free amino acids (AA) and reducing sugar (RS) contents in fermentation of defatted rice bran extract with two strains also significantly decreased. At pH 5 and 9 %w/w of TDS content in defatted rice bran extract, Lactobacillus brevis VTCC - B - 454 accumulated 2,952 ppm of GABA in 24 hours of fermentation. The result implies that fermentation with Lactobacillus brevis VTCC - B - 454 can be applied for GABA production from defatted rice bran extract.
NASA Astrophysics Data System (ADS)
Patel, Nipun; Katheriya, Deepak; Dadhania, Harsh; Dadhania, Abhishek
2018-05-01
Magnetic nanoparticle supported phosphotungstic acid (Fe3O4@SiO2-HPW) was applied as a highly efficient catalyst for the synthesis of 14H-dibenzoxanthene derivatives via condensation reaction of 2-naphthol and aryl aldehydes. The catalyst was found highly efficient for the synthesis of xanthene derivatives under solvent free condition. The catalyst showed high activity and stability during the reaction and provided excellent yield of the corresponding products in short reaction time. All the synthesized compounds were characterized through FT-IR, 1H-NMR and 13C-NMR spectroscopic techniques. Furthermore, the catalyst is magnetically recoverable and can be reused several times without significant loss of its catalytic activity.
Gälman, Cecilia; Miquel, Juan Francisco; Pérez, Rosa Maria; Einarsson, Curt; Ståhle, Lars; Marshall, Guillermo; Nervi, Flavio; Rudling, Mats
2004-03-01
Gallstone disease is an important, costly health-care problem in Western societies. It is still unclear whether hepatic lipid regulatory enzymes play primary or secondary roles in gallstone formation. In this study, the aim was to investigate whether the synthesis of bile acids and cholesterol is increased in gallstone disease and to test whether such a metabolic change, if present, might occur before gallstone formation. A total of 125 Chilean Hispanic women (80 without gallstones and 45 with gallstones) matched for age and body mass index were investigated, along with 40 Chilean Mapuche Indian women (20 without gallstones and 20 with gallstones), a population group in which the prevalence for gallstone disease is very high. Fasting blood plasma samples were assayed for 7 alpha-hydroxy-4-cholesten-3-one and lathosterol, 2 strong indicators for hepatic bile acid and body cholesterol synthesis, respectively. Plasma 7 alpha-hydroxy-4-cholesten-3-one levels, corrected for plasma cholesterol, were significantly increased by 50% in Hispanic women with gallstones as compared with gallstone-free Hispanics (P < 0.006). As compared with Hispanic women without gallstones, plasma 7 alpha-hydroxy-4-cholesten-3-one levels were increased by > or =100% (P < 0.002) in Mapuche Indian women, independently of whether gallstones were present. Plasma lathosterol, corrected for plasma cholesterol, was significantly increased by 22% in Hispanic women with gallstones and in Mapuche Indian women compared with Hispanic women. The results indicate that the synthesis of bile acids and cholesterol is induced in gallstone disease and precedes gallstone development. These inductions presumably occur as a response to an increased intestinal loss of bile acids.
NASA Astrophysics Data System (ADS)
Chen, Huide; Liu, Chunxiu; Xia, Yunsheng
2017-03-01
This study is the first to report one-step synthesis of boronic acid functionalized gold nanoclusters (AuNCs) using mixed ligands of 4-mercaptophenylboronic acid (MPBA) and glutathione. Furthermore, the emission color of the products can be fancily tuned from green to near-infrared by simply changing the proportion of the two stabilizers. In basic media, dopamine (DA) molecules themselves polymerize each other and form polydopamine with large amounts of cis-diol groups, which then react with boronic acid groups on the AuNC’s surface based on the formation of boronate esters. As a result, the photoluminescence of the AuNCs is well quenched by the electron transfer effect. Accordingly, DA molecules are assayed from 0.5 to 9 μM, and the detection limit is as low as 0.1 μM. The as-prepared AuNCs exhibit high selectivity; the existing biomolecules including various amino acids, ascorbic acid, uric acid, glucose, etc, do not interfere with the assay. The proposed method is successfully applied to the assay of DA in human serum, indicating its practical potential.
Cosgrove, J W; Brown, I R
1984-05-01
An initiating cell-free protein synthesis system derived from brain was utilized to demonstrate that the intravenous injection of D-lysergic acid diethylamide (LSD) to rabbits resulted in a lesion at the initiation stage of brain protein synthesis. Three inhibitors of initiation, edeine, poly(I), and aurintricarboxylic acid were used to demonstrate a reduction in initiation-dependent amino acid incorporation in the brain cell-free system. One hour after LSD injection, there was also a measurable decrease in the formation of 40S and 80S initiation complexes in vitro, using either [35S]methionine or [35S]Met-tRNAf. Analysis of the methionine pool size after LSD administration indicated there was no change in methionine levels. Analysis of the formation of initiation complexes in the brain cell-free protein synthesis system prepared 6 h after LSD administration indicated that there was a return to control levels at this time. The effects of LSD on steps in the initiation process are thus reversible.
Physicochemical characterisation and radical-scavenging activity of Cucurbitaceae seed oils.
Jorge, Neuza; da Silva, Ana Carolina; Malacrida, Cassia Roberta
2015-01-01
Oils extracted from Cucurbitaceae seeds were characterised for their fatty acid and tocopherol compositions. In addition, some physicochemical characteristics, total phenolic contents and the radical-scavenging activities were determined. Oil content amounted to 23.9% and 27.1% in melon and watermelon seeds, respectively. Physicochemical characteristics were similar to those of other edible oils and the oils showed significant antioxidant activities. Fatty acid composition showed total unsaturated fatty acid content of 85.2-83.5%, with linoleic acid being the dominant fatty acid (62.4-72.5%), followed by oleic acid (10.8-22.7%) and palmitic acid (9.2-9.8%). The oils, especially watermelon seed oil, showed high total tocopherol and phenolic contents. The γ-tocopherol was the predominant tocopherol in both oils representing 90.9 and 95.6% of the total tocopherols in melon and watermelon seed oils, respectively. The potential utilisation of melon and watermelon seed oils as a raw material for food, chemical and pharmaceutical industries appears to be favourable.
Schulze, G; Jung, K; Kunze, D; Egger, E
1976-01-01
The preparation of PC with the 14C-fatty acids palmitic, stearic, oleic and linoleic acid at OH-group in position 2 is described. The starting material is egg yolk lecithin. By the attack of snake venom phospholiphase lyso-PC is produced which is reacylated by the appropriate fatty acid anhydride. In comparison with the methods published up to now this preparation has the advantage of higher yields and greater simplicity. By means of in vivo synthesis it is impossible to get PC species with only one fatty acid in a defined position. Working with radioactive fatty acids the specific radioactivity can be adapted to the requirements. The procedure can be made on a semi-technical scale.
Arunima, Sakunthala; Rajamohan, Thankappan
2014-05-28
The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.
Tan, Lianjiang; Liu, Yazhi; Li, Xiaowei; Wu, Xin-Yan; Gong, Bing; Shen, Yu-Mei; Shao, Zhifeng
2016-02-11
An acid-cleavable linker based on a dimethylketal moiety was synthesized and used to connect a nucleotide with a fluorophore to produce a 3'-OH unblocked nucleotide analogue as an excellent reversible terminator for DNA sequencing by synthesis.
USDA-ARS?s Scientific Manuscript database
Moschamine is a safflomide-type phenylpropenoic acid amide originally isolated from Centaurea cyanus. This paper describes the synthesis, detection of serotoninergic and COX inhibitory activities, and bioavailability of moschamine. Moschamine was chemically synthesized and identified using NMR spect...
Synthesis of (125) I-lamivudine and (125) I-lamivudine-ursodeoxycholic acid codrug.
Motaleb, M A; Abo-Kul, M; Ibrahim, Samy M; Saad, Shokry M; Arafat, Muhammad
2016-09-01
The preparation of (125) I-lamivudine ((125) I-3TC) and (125) I-lamivudine-ursodeoxycholic acid codrug ((125) I-3TC-UDCA), suitable for comparative biodistribution studies, is described. The synthesis of the unlabeled precursor 3TC-UDCA proceeds in an 11.6% yield, and the radiolabelling yields for (125) I-3TC and (125) I-3TC-UDCA were 89 and 92%, respectively. The final products are radiochemically pure (greater than 98%). Copyright © 2016 John Wiley & Sons, Ltd.
Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.
2013-01-01
All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be
DOE Office of Scientific and Technical Information (OSTI.GOV)
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Gu, Huiya; Jinkerson, Robert E.; Davies, Fiona K.; ...
2016-05-26
The isolation or engineering of algal cells synthesizing high levels of medium-chain fatty acids (MCFAs) is attractive to mitigate the high clouding point of longer chain fatty acids in algal based biodiesel. To develop a more informed understanding of MCFA synthesis in photosynthetic microorganisms, we isolated several algae from Great Salt Lake and screened this collection for MCFA accumulation to identify strains naturally accumulating high levels of MCFA. A diatom, Chaetoceros sp. GSL56, accumulated particularly high levels of C14 (up to 40%), with the majority of C14 fatty acids allocated in triacylglycerols. Using whole cell transcriptome sequencing and de novomore » assembly, putative genes encoding fatty acid synthesis enzymes were identified. Enzymes from this Chaetoceros sp. were expressed in the cyanobacterium Synechococcus sp. PCC 7002 to validate gene function and to determine whether eukaryotic enzymes putatively lacking bacterial evolutionary control mechanisms could be used to improve MCFA production in this promising production strain. Replacement of the Synechococcus 7002 native FabH with a Chaetoceros ketoacyl-ACP synthase Ill increased MCFA synthesis up to fivefold. In conclusion, the level of increase is dependent on promoter strength and culturing conditions.« less
Characterisation of methionine adenosyltransferase from Mycobacterium smegmatis and M. tuberculosis
Berger, Bradley J; Knodel, Marvin H
2003-01-01
Background Tuberculosis remains a serious world-wide health threat which requires the characterisation of novel drug targets for the development of future antimycobacterials. One of the key obstacles in the definition of new targets is the large variety of metabolic alterations that occur between cells in the active growth and chronic/dormant phases of tuberculosis. The ideal biochemical target should be active in both growth phases. Methionine adenosyltransferase, which catalyses the formation of S-adenosylmethionine from methionine and ATP, is involved in polyamine biosynthesis during active growth and is also required for the methylation and cyclopropylation of mycolipids necessary for survival in the chronic phase. Results The gene encoding methionine adenosyltransferase has been cloned from Mycobacterium tuberculosis and the model organism M. smegmatis. Both enzymes retained all amino acids known to be involved in catalysing the reaction. While the M. smegmatis enzyme could be functionally expressed, the M. tuberculosis homologue was insoluble and inactive under a large variety of expression conditions. For the M. smegmatis enzyme, the Vmax for S-adenosylmethionine formation was 1.30 μmol/min/mg protein and the Km for methionine and ATP was 288 μM and 76 μM respectively. In addition, the enzyme was competitively inhibited by 8-azaguanine and azathioprine with a Ki of 4.7 mM and 3.7 mM respectively. Azathioprine inhibited the in vitro growth of M. smegmatis with a minimal inhibitory concentration (MIC) of 500 μM, while the MIC for 8-azaguanine was >1.0 mM. Conclusion The methionine adenosyltransferase from both organisms had a primary structure very similar those previously characterised in other prokaryotic and eukaryotic organisms. The kinetic properties of the M. smegmatis enzyme were also similar to known prokaryotic methionine adenosyltransferases. Inhibition of the enzyme by 8-azaguanine and azathioprine provides a starting point for the synthesis of
Chu, Lingling; Lipshultz, Jeffrey M.
2015-01-01
The direct decarboxylative arylation of α-oxo acids has been achieved via synergistic visible light-mediated photoredox and nickel catalyses. This method offers rapid entry to aryl and alkyl ketone architectures from simple α-oxo acid precursors via an acyl radical intermediate. Significant substrate scope is observed with respect to both the oxo acid and arene coupling partners. This mild decarboxylative arylation can also be utilized to efficiently access medicinal agents, as demonstrated by the rapid synthesis of fenofibrate. PMID:26014029
Hu, Q; Agarwal, U; Bequette, B J
2017-02-01
We aimed to quantify the rate of gluconeogenesis (GNG), non-essential amino-acid (NEAA) synthesis, and substrate partitioning to the Krebs cycle in embryonic (e) day e14 and e19 chicken embryos. An in ovo continuous tracer infusion approach was employed to test the hypotheses that GNG and NEAA synthesis in developing chicken embryo increases from e14 to e19. [ 13 C 6 ]Glucose or [ 13 C 3 ]glycerol was continuously infused (8 h) into the chorio-allantoic compartment of eggs on e14 and e19. Glucose entry rate, Cori cycling, and GNG were higher (P < 0.05) in e19 compared to e14 embryos, presumably to support higher glycogen deposition in liver and muscle. Whereas de novo synthesis of alanine, aspartate, and glutamate via glycolysis and the Krebs cycle was higher (P < 0.01) in e14 embryos, synthesis of these NEAA from glycerol was higher (P < 0.05) in e19 compared to e14 embryos. These patterns of glucose and glycerol utilization suggest a metabolic shift to conserve glucose for glycogen synthesis and an increased utilization of yolk glycerol (from triacylglyceride) after e14. Although the contribution of glycerol to GNG in e19 embryos was higher (P < 0.05) than that in e14 embryos, the contribution of glycerol to GNG (1.3 to 6.0%) was minor. Based on [ 13 C 6 ]glucose tracer kinetics, the activities of both pyruvate carboxylase (PC) and pyruvate dehydrogenase (PDH) in the liver were higher (P < 0.05) in e19 embryos; whereas the higher (P < 0.01) relative activity of liver PC compared to PDH in e14 embryos suggests a greater anaplerotic flux into the Krebs cycle. In summary, the in ovo continuous tracer infusion approach allowed for a measurement of chicken embryo whole body and liver metabolism over a shorter window of development. This study provided quantitative estimates of the developmental shifts in substrate utilization, GNG, and NEAA synthesis by chicken embryos, as well as qualitative estimates of the activities of enzymes central to the Krebs cycle
Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo
2014-07-01
Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.
Tetraethylene glycol promoted two-step, one-pot rapid synthesis of indole-3-[1- 11C]acetic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lee, Sojeong; Qu, Wenchao; Alexoff, David L.
2014-12-12
An operationally friendly, two-step, one-pot process has been developed for the rapid synthesis of carbon-11 labeled indole-3-acetic acid ([ 11]IAA or [ 11]auxin). By replacing an aprotic polar solvent with tetraethylene glycol, nucleophilic [ 11]cyanation and alkaline hydrolysis reactions were performed consecutively in a single pot without a time-consuming intermediate purification step. The entire production time for this updated procedure is 55 min, which dramatically simplifies the entire synthesis and reduces the starting radioactivity required for a whole plant imaging study.
Dickinson, Jared M; Fry, Christopher S; Drummond, Micah J; Gundermann, David M; Walker, Dillon K; Glynn, Erin L; Timmerman, Kyle L; Dhanani, Shaheen; Volpi, Elena; Rasmussen, Blake B
2011-05-01
The relationship between mammalian target of rapamycin complex 1 (mTORC1) signaling and muscle protein synthesis during instances of amino acid surplus in humans is based solely on correlational data. Therefore, the goal of this study was to use a mechanistic approach specifically designed to determine whether increased mTORC1 activation is requisite for the stimulation of muscle protein synthesis following L-essential amino acid (EAA) ingestion in humans. Examination of muscle protein synthesis and signaling were performed on vastus lateralis muscle biopsies obtained from 8 young (25 ± 2 y) individuals who were studied prior to and following ingestion of 10 g of EAA during 2 separate trials in a randomized, counterbalanced design. The trials were identical except during 1 trial, participants were administered a single oral dose of a potent mTORC1 inhibitor (rapamycin) prior to EAA ingestion. In response to EAA ingestion, an ~60% increase in muscle protein synthesis was observed during the control trial, concomitant with increased phosphorylation of mTOR (Ser(2448)), ribosomal S6 kinase 1 (Thr(389)), and eukaryotic initiation factor 4E binding protein 1 (Thr(37/46)). In contrast, prior administration of rapamycin completely blocked the increase in muscle protein synthesis and blocked or attenuated activation of mTORC1-signaling proteins. The inhibition of muscle protein synthesis and signaling was not due to differences in either extracellular or intracellular amino acid availability, because these variables were similar between trials. These data support a fundamental role for mTORC1 activation as a key regulator of human muscle protein synthesis in response to increased EAA availability. This information will be useful in the development of evidence-based nutritional therapies targeting mTORC1 to counteract muscle wasting associated with numerous clinical conditions.
NASA Astrophysics Data System (ADS)
Gautam, Poonam; Gautam, Deepika; Chaudhary, R. P.
2018-05-01
1-Arylidene-2-tetralone (2), obtained from condensation of 2-tetralone and aromatic aldehydes in acetic acid and HCl, on condensation with thiosemicarbazide in acidic and alkaline medium afforded tetrahydro-2H-benzo[e]indazole-2-carbothioamide as trans (3) and cis (4) diastereoisomers of 1-H and 9b-H respectively. The synthesis of new indazolyl-thiazol-4(5H)-ones (5) from trans isomer (3) and α-halo acids is reported. A DFT study along with single crystal X-ray diffraction data of a representative compound (5a) is presented. The chemistry of the reaction of indazole-2-carbothioamides with methyl iodide, DMAD and acetic anhydride is described. Eight newly synthesised compounds were screened for their antibacterial and antifungal activities. Some of the compounds have shown promising antimicrobial activities.
Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L
2017-04-07
Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the
Impheng, Hathaichanok; Richert, Lysiane; Pekthong, Dumrongsak; Scholfield, C Norman; Pongcharoen, Sutatip; Pungpetchara, Ittipon; Srisawang, Piyarat
2015-01-01
The de novo fatty acid synthesis catalyzed by key lipogenic enzymes, including fatty acid synthase (FASN) has emerged as one of the novel targets of anti-cancer approaches. The present study explored the possible inhibitory efficacy of [6]-gingerol on de novo fatty acid synthesis associated with mitochondrial-dependent apoptotic induction in HepG2 cells. We observed a dissipation of mitochondrial membrane potential accompanied by a reduction of fatty acid levels. [6]-gingerol administration manifested inhibition of FASN expression, indicating FASN is a major target of [6]-gingerol inducing apoptosis in HepG2 cells. Indeed, we found that increased ROS generation could likely be a mediator of the anti-cancer effect of [6]-gingerol. A reduction of fatty acid levels and induction of apoptosis were restored by inhibition of acetyl-CoA carboxylase (ACC) activity, suggesting an accumulation of malonyl-CoA level could be the major cause of apoptotic induction of [6]-gingerol in HepG2 cells. The present study also showed that depletion of fatty acid following [6]-gingerol treatment caused an inhibitory effect on carnitine palmitoyltransferase-1 activity (CPT-1), whereas C75 augmented CPT-1 activity, indicating that [6]-gingerol exhibits the therapeutic benefit on suppression of fatty acid β-oxidation.
van der Meijden, Maarten W; Balandina, Tatyana; Ivasenko, Oleksandr; De Feyter, Steven; Wurst, Klaus; Kellogg, Richard M
2016-10-04
A convergent synthesis of racemic [6]hexahelicene-7-carboxylic acid by cross-coupling of a bicyclic and a tricyclic component is described. A metal-catalyzed ring-closure is also a fundamental component of the synthetic approach. Scanning tunneling microscopy (STM) measurements of the racemate self-assembled on Au(111) at liquid-solid interface revealed the formation of ordered racemic 2D crystals. © 2016 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis of triazole-based unnatural amino acids, triazole bisaminoacids and β-amino triazole has been described via stereo and regioselective one-pot multi-component reaction of sulfamidates, sodium azide, and alkynes under MW irradiation conditions. The developed method is app...
Amino acid metabolism in dairy cows and their regulation in milk synthesis.
Wang, Feiran; Shi, Haitao; Wang, Shuxiang; Wang, Yajing; Cao, Zhijun; Li, Shengli
2018-06-10
Reducing dietary crude protein (CP) and supplementing with certain amino acids (AAs) has been known as a potential solution to improve nitrogen (N) efficiency in dairy production. Thus understanding how AAs are utilized in various sites along the gut is critical. AA flow from the intestine to portal-drained viscera (PDV) and liver then to the mammary gland was elaborated in this article. Recoveries in individual AA in PDV and liver seem to share similar AA pattern with input: output ratio in mammary gland, which subdivides essential AA (EAA) into two groups, lysine (Lys) and branched-chain AA (BCAA) in group 1, input: output ratio > 1; methionine (Met), histidine (His), phenylalanine (Phe) etc. in group 2, input: output ratio close to 1. AAs in the mammary gland are either utilized for milk protein synthesis or retained as body tissue, or catabolized. The fractional removal of AAs and the number and activity of AA transporters together contribute to the ability of AAs going through mammary cells. Mammalian target of rapamycin (mTOR) pathway is closely related to milk protein synthesis and provides alternatives for AA regulation of milk protein synthesis, which connects AA with lactose synthesis via α-lactalbumin (gene: LALBA) and links with milk fat synthesis via sterol regulatory element-binding transcription protein 1 (SREBP1) and peroxisome proliferator-activated receptor (PPAR). Overall, AA flow across various tissues reveal AA metabolism and utilization in dairy cows on one hand. While the function of AA in the biosynthesis of milk protein, fat and lactose at both transcriptional and posttranscriptional level from another angle provides the possibility for us to regulate them for higher efficiency. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Raso, María José; Muñoz, Alfonso; Pineda, Manuel; Piedras, Pedro
2007-10-01
In tropical legumes like French bean (Phaseolus vulgaris) or soybean (Glycine max), most of the atmospheric nitrogen fixed in nodules is used for synthesis of the ureides allantoin and allantoic acid, the major long distance transport forms of organic nitrogen in these species. The purpose of this investigation was to characterise the allantoate degradation step in Phaseolus vulgaris. The degradation of allantoin, allantoate and ureidoglycolate was determined "in vivo" using small pieces of chopped seedlings. With allantoate and ureidoglycolate as substrates, the determination of the reaction products required the addition of phenylhydrazine to the assay mixture. The protein associated with the allantoate degradation has been partially purified 22-fold by ultracentrifugation and batch separation with DEAE-Sephacel. This enzyme was specific for allantoate and could not use ureidoglycolate as substrate. The activity was completely dependent on phenylhydrazine, which acts as an activator at low concentrations and decreases the affinity of the enzyme for the substrate at higher concentrations. The optimal pH for the activity of the purified protein was 7.0 and the optimal temperature was 37 degrees C. The activity was completely inhibited by EDTA and only manganese partially restored the activity. The level of activity was lower in extracts obtained from leaves and fruits of French bean grown with nitrate than in plants actively fixing nitrogen and, therefore, relying on ureides as nitrogen supply. This is the first time that an allantoate-degrading activity has been partially purified and characterised from a plant extract. The allosteric regulation of the enzyme suggests a critical role in the regulation of ureide degradation.
Model of the synthesis of trisporic acid in Mucorales showing bistability.
Werner, S; Schroeter, A; Schimek, C; Vlaic, S; Wöstemeyer, J; Schuster, S
2012-12-01
An important substance in the signalling between individuals of Mucor-like fungi is trisporic acid (TA). This compound, together with some of its precursors, serves as a pheromone in mating between (+)- and (-)-mating types. Moreover, intermediates of the TA pathway are exchanged between the two mating partners. Based on differential equations, mathematical models of the synthesis pathways of TA in the two mating types of an idealised Mucor-fungus are here presented. These models include the positive feedback of TA on its own synthesis. The authors compare three sub-models in view of bistability, robustness and the reversibility of transitions. The proposed modelling study showed that, in a system where intermediates are exchanged, a reversible transition between the two stable steady states occurs, whereas an exchange of the end product leads to an irreversible transition. The reversible transition is physiologically favoured, because the high-production state of TA must come to an end eventually. Moreover, the exchange of intermediates and TA is compared with the 3-way handshake widely used by computers linked in a network.
Effect of penicillin on fatty acid synthesis and excretion in Streptococcus mutans BHT
DOE Office of Scientific and Technical Information (OSTI.GOV)
Brissette, J.L.; Pieringer, R.A.
Treatment of exponentially growing cultures of Streptococcus mutans BHT with growth-inhibitory concentrations (0.2 microgram/ml) of benzylpenicillin stimulates the incorporation of (2-/sup 14/C) acetate into lipids excreted by the cells by as much as 69-fold, but does not change the amount of /sup 14/C incorporated into intracellular lipids. At this concentration of penicillin cellular lysis does not occur. The radioactive label is incorporated exclusively into the fatty acid moieties of the glycerolipids. During a 4-hr incubation in the presence of penicillin, the extracellular fatty acid ester concentration increases 1.5 fold, even though there is no growth or cellular lysis. An indicationmore » of the relative rate of fatty acid synthesis was most readily obtained by placing S. mutans BHT in a buffer containing /sup 14/C-acetate. Under these nongrowing conditions free fatty acids are the only lipids labeled, a factor which simplifies the assay. The addition of glycerol to the buffer causes all of the nonesterified fatty acids to be incorporated into glycerolipid. The cells excrete much of the lipid whether glycerol is present or not. Addition of penicillin to the nongrowth supporting buffer system does not stimulate the incorporation of (/sup 14/C)-acetate into fatty acids.« less
Kinetics of photoirradiation-induced synthesis of soy oil-conjugated linoleic acid isomers.
Jain, Vishal P; Proctor, Andrew
2007-02-07
Photoirradiation of soy oil with UV/visible light has been shown to produce significant amounts of trans,trans conjugated linoleic acid (CLA) isomers through conversion of various synthesized intermediate cis,trans isomers. The objective of this study was to determine the kinetics of CLA isomers synthesis to better understand the production of various isomers. Soy oil was irradiated with UV/visible light for 144 h in the presence of an iodine catalyst and CLA isomers analyzed by gas chromatography (GC). Arrhenius plots were developed for the conversion of soy oil linoleic acid (A) to form cis-, trans/trans-, cis-CLA (B), conversion of cis-, trans/trans-, cis-CLA to form trans,trans-CLA (C) with respect to B, and formation of trans,trans-CLA isomers with respect to C. The kinetics of consumption of linoleic acid (LA) to form cis-, trans/trans-, cis-CLA was found to be of second-order with a rate constant of 9.01 x 10-7 L/mol s. The rate of formation of cis-, trans/trans-, cis-CLA isomers depends on the rate of formation from LA and its rate of consumption to form trans,trans-CLA isomers. The conversion of cis-, trans/trans-, cis-CLA isomers to trans,trans-CLA isomers was found to be of first-order with a rate constant of 2.75 x 10-6 s-1. However, the formation of thermodynamically stable trans,trans-CLA isomers (C) with respect to C was found to be a zero-order reaction with a rate constant of 10.66 x 10-7 mol/L s. The consumption of LA was found to be the rate-determining step in the CLA isomers formation reaction mechanism. The findings provide a better understanding of the mechanism of CLA isomers synthesis by photoirradiation and the factors controlling the ratio of various isomers.
Characterisation of serpin polymers in vitro and in vivo.
Belorgey, Didier; Irving, James A; Ekeowa, Ugo I; Freeke, Joanna; Roussel, Benoit D; Miranda, Elena; Pérez, Juan; Robinson, Carol V; Marciniak, Stefan J; Crowther, Damian C; Michel, Claire H; Lomas, David A
2011-03-01
Neuroserpin is a member of the serine protease inhibitor or serpin superfamily of proteins. It is secreted by neurones and plays an important role in the regulation of tissue plasminogen activator at the synapse. Point mutations in the neuroserpin gene cause the autosomal dominant dementia familial encephalopathy with neuroserpin inclusion bodies or FENIB. This is one of a group of disorders caused by mutations in the serpins that are collectively known as the serpinopathies. Others include α(1)-antitrypsin deficiency and deficiency of C1 inhibitor, antithrombin and α(1)-antichymotrypsin. The serpinopathies are characterised by delays in protein folding and the retention of ordered polymers of the mutant serpin within the cell of synthesis. The clinical phenotype results from either a toxic gain of function from the inclusions or a loss of function, as there is insufficient protease inhibitor to regulate important proteolytic cascades. We describe here the methods required to characterise the polymerisation of neuroserpin and draw parallels with the polymerisation of α(1)-antitrypsin. It is important to recognise that the conditions in which experiments are performed will have a major effect on the findings. For example, incubation of monomeric serpins with guanidine or urea will produce polymers that are not found in vivo. The characterisation of the pathological polymers requires heating of the folded protein or alternatively the assessment of ordered polymers from cell and animal models of disease or from the tissues of humans who carry the mutation. Copyright © 2010 Elsevier Inc. All rights reserved.
Organic Phosphorus Characterisation in Agricultural Soils by Enzyme Addition Assays
NASA Astrophysics Data System (ADS)
Jarosch, Klaus; Frossard, Emmanuel; Bünemann, Else K.
2013-04-01
Phosphorus (P) is a non-renewable resource and it is a building block of many molecules indispensable for life. Up to 80 per cent of total soil P can be in organic form. Hydrolysability and thereby availability to plants and microorganisms differ strongly among the multitude of chemical forms of soil organic P. A recent approach to characterise organic P classes is the addition of specific enzymes which hydrolyse organic P to inorganic orthophosphate, making it detectable by colorimetry. Based on the substrate specificity of the added enzymes, conclusions about the hydrolysed forms of organic P can then be made. The aim of this study was to determine the applicability of enzyme addition assays for the characterisation of organic P species in soil:water suspensions of soils with differing properties. To this end, ten different soil samples originating from four continents, with variable pH (in water) values (4.2-8.0), land management (grassland or cropped land) and P fertilization intensity were analysed. Three different enzymes were used (acid phosphatase, nuclease and phytase). Acid phosphatase alone or in combination with nuclease was applied to determine the content of P in simple monoesters (monoester-like P) and P in DNA (DNA-like P), while P hydrolysed from myo-inositol hexakisphosphate (Ins6P-like P) was calculated from P release after incubation with phytase minus P release by acid phosphatase. To reduce sorption of inorganic P on soil particles of the suspension, especially in highly weathered soils, soil specific EDTA additions were determined in extensive pre-tests. The results of these pre-tests showed that recoveries of at least 30 per cent could be achieved in all soils. Thus, detection of even small organic P pools, such as DNA-like P, was possible in all soils if a suitable EDTA concentration was chosen. The enzyme addition assays provided information about the hydrolysable quantities of the different classes of soil organic P compounds as affected
Domenichiello, Anthony F; Chen, Chuck T; Trepanier, Marc-Olivier; Stavro, P Mark; Bazinet, Richard P
2014-01-01
Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain.
Green synthesis of carbon dots from pork and application as nanosensors for uric acid detection
NASA Astrophysics Data System (ADS)
Zhao, Chunxi; Jiao, Yang; Hu, Feng; Yang, Yaling
2018-02-01
In this work, a green, simple, economical method was developed in the synthesis of fluorescent carbon dots using pork as carbon source. The as-prepared carbon dots exhibit exceptional advantages including high fluorescent quantum yield (17.3%) and satisfactory chemical stability. The fluorescence of carbon dots based nanosensor can be selectively and efficiently quenched by uric acid. This phenomenon was used to develop a fluorescent method for facile detection of uric acid within a linear range of 0.1-100 μM and 100-500 μM, with a detection limit of 0.05 μM (S/N = 3). Finally, the proposed method was successfully applied in the determination of uric acid in human serum and urine samples with satisfactory recoveries, which suggested that the new nanosensors have great prospect toward the detection of uric acid in human fluids.
Chen, Zhe-Ning; Chan, Kwong-Yu; Pulleri, Jayasree K; Kong, Jing; Hu, Hao
2015-02-16
Because formic acid can be effectively decomposed by catalysis into very pure hydrogen gas, the synthesis of formic acid, especially using CO and H2O as an intermediate of the water gas shift reaction (WGSR), bears important application significance in industrial hydrogen gas production. Here we report a theoretical study on the mechanism of efficient preparation of formic acid using CO and H2O catalyzed by a water-soluble [Ru(3+)]-EDTA complex. To determine the feasibility of using the [Ru(3+)]-EDTA catalyst to produce CO-free hydrogen gas in WGSR, two probable reaction paths have been examined: one synthesizes formic acid, while the other converts the reactants directly into CO2 and H2, the final products of WGSR. Our calculation results provide a detailed mechanistic rationalization for the experimentally observed selective synthesis of HCOOH by the [Ru(3+)]-EDTA catalyst. The results support the applicability of using the [Ru(3+)]-EDTA catalyst to efficiently synthesize formic acid for hydrogen production. Careful analyses of the electronic structure and interactions of different reaction complexes suggest that the selectivity of the reaction processes is achieved through the proper charge/valence state of the metal center of the [Ru(3+)]-EDTA complex. With the catalytic roles of the ruthenium center and the EDTA ligand being carefully understood, the detailed mechanistic information obtained in this study will help to design more efficient catalysts for the preparation of formic acid and further to produce CO-free H2 at ambient temperature.
Glaser, Robert; Venus, Joachim
2017-07-25
Three Bacillus coagulans strains were characterised in terms of their ability to grow in lignin-containing fermentation media and to consume the lignocellulose-related sugars glucose, xylose, and arabinose. An optical-density high-throughput screening was used for precharacterisation by means of different mathematical models for comparison (Logistic, Gompertz, Baranyi, Richards & Stannard, and Schnute). The growth response was characterised by the maximum growth rate and lag time. For a comparison of the screening and fermentation results, an unstructured mathematical model was proposed to characterise the lactate production, bacterial growth and substrate consumption. The growth model was then applied to fermentation procedures using wheat straw hydrolysates. The results indicated that the unstructured growth model can be used to evaluate lactate producing fermentation. Under the experimental fermentation conditions, one strain showed the ability to tolerate a high lignin concentration (2.5g/L) but lacked the capacity for sufficient pentose uptake. The lactate yield of the strains that were able to consume all sugar fractions of glucose, xylose and arabinose was ∼83.4%. A photometric measurement at 280nm revealed a dynamic change in alkali-lignin concentrations during lactate producing fermentation. A test of decolourisation of vanillin, ferulic acid, and alkali-lignin samples also showed the decolourisation performance of the B. coagulans strains under study. Copyright © 2017 The Author(s). Published by Elsevier B.V. All rights reserved.
Calcium regulates glutamate dehydrogenase and poly-γ-glutamic acid synthesis in Bacillus natto.
Meng, Yonghong; Dong, Guiru; Zhang, Chen; Ren, Yuanyuan; Qu, Yuling; Chen, Weifeng
2016-04-01
To study the effect of Ca(2+) on glutamate dehydrogenase (GDH) and its role in poly-γ-glutamic acid (γ-PGA) synthesis in Bacillus natto HSF 1410. When the concentration of Ca(2+) varied from 0 to 0.1 g/l in the growth medium of B. natto HSF 1410, γ-PGA production increased from 6.8 to 9.7 g/l, while GDH specific activity and NH4Cl consumption improved from 183 to 295 U/mg and from 0.65 to 0.77 g/l, respectively. GDH with α-ketoglutarate as substrate primarily used NADPH as coenzyme with a K m of 0.08 mM. GDH was responsible for the synthesis of endogenous glutamate. The specific activity of GDH remained essentially unchanged in the presence of CaCl2 (0.05-0.2 g/l) in vitro. However, the specific activity of GDH and its expression was significantly increased by CaCl2 in vivo. Therefore, the regulation of GDH and PGA synthesis by Ca(2+) is an intracellular process. Calcium regulation may be an effective approach for producing γ-PGA on an industrial scale.
Synthesis of triazole based unnatural amino acids and β-amino triazole has been described via stereo and regioselective one-pot multi-component reaction of sulfamidates, sodium azide, and alkynes under MW conditions. The developed method is applicable to a broad substrate scope a...
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-06-15
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N-H groups are tolerated on the barbituric acid, with no complications arising from N-H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
Primordial synthesis of amines and amino acids in a 1958 Miller H2S-rich spark discharge experiment
Parker, Eric T.; Cleaves, Henderson J.; Dworkin, Jason P.; Glavin, Daniel P.; Callahan, Michael; Aubrey, Andrew; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Archived samples from a previously unreported 1958 Stanley Miller electric discharge experiment containing hydrogen sulfide (H2S) were recently discovered and analyzed using high-performance liquid chromatography and time-of-flight mass spectrometry. We report here the detection and quantification of primary amine-containing compounds in the original sample residues, which were produced via spark discharge using a gaseous mixture of H2S, CH4, NH3, and CO2. A total of 23 amino acids and 4 amines, including 7 organosulfur compounds, were detected in these samples. The major amino acids with chiral centers are racemic within the accuracy of the measurements, indicating that they are not contaminants introduced during sample storage. This experiment marks the first synthesis of sulfur amino acids from spark discharge experiments designed to imitate primordial environments. The relative yield of some amino acids, in particular the isomers of aminobutyric acid, are the highest ever found in a spark discharge experiment. The simulated primordial conditions used by Miller may serve as a model for early volcanic plume chemistry and provide insight to the possible roles such plumes may have played in abiotic organic synthesis. Additionally, the overall abundances of the synthesized amino acids in the presence of H2S are very similar to the abundances found in some carbonaceous meteorites, suggesting that H2S may have played an important role in prebiotic reactions in early solar system environments. PMID:21422282
Primordial Synthesis of Amines and Amino Acids in a 1958 Miller H2S-Rich Spark Discharge Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, Henderson J.; Dworkin, Jason P.; Glavin, Daniel P.; Callahan, Michael; Aubrey, Andrew; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Archived samples from a previously unreported 1958 Stanley Miller electric discharge experiment containing hydrogen sulfide (H2S) were recently discovered and analyzed using high-performance liquid chromatography and time-of-flight mass spectrometry. We report here the detection and quantification of primary amine-containing compounds in the original sample residues, which were produced via spark discharge using a gaseous mixture of H2S, CH4, NH3, and CO2. A total of 23 amino acids and 4 amines, including 7 organosulfur compounds, were detected in these samples. The major amino acids with chiral centers are racemic within the accuracy of the measurements, indicating that they are not contaminants introduced during sample storage. This experiment marks the first synthesis of sulfur amino acids from spark discharge experiments designed to imitate primordia! environments. The relative yield of some amino acids, in particular the isomers of aminobutyric acid, are the highest ever found in a spark discharge experiment. The simulated primordial conditions used by Miller may serve as a model for early volcanic plume chemistry and provide insight to the possible roles such plumes may have played in abiotic organic synthesis. Additionally, the overall abundances of the synthesized amino acids in the presence of H2S are very similar to the abundances found in some carbonaceous meteorites, suggesting that H2S may have played an important role in prebiotic reactions in early solar system environments.
Synthesis and Characterization of Chitosan-p-t-Butylcalix[4]arene acid
NASA Astrophysics Data System (ADS)
Handayani, D. S.; Frimadasi, W.; Kusumaningsih, T.; Pranoto
2018-03-01
The synthesis of chitosan-p-t-butylcalix[4]arene acid was done with DIC (N, N’-diisopropylcarbodiimide) as the coupling agent. The structural analysis of the chitosan-p-t-butylcalix[4]arene acid was conducted by spectrophotometer Fourier Transform Infra Red (FTIR) and X-Ray Diffraction (XRD). Meanwhile, the surface area was investigated by Surface Area Analysis, the Scanning Electrone Microscope (SEM) analysed the surface morphology, and also the melting point temperature was determined. FTIR analysis on Chitosan-p-t-butylcalix[4]arene provides an overlapped absorption of -OH and -NH groups at 3438.26 cm-1. Meanwhile, a C = C aromatic bond present at 1480.43 cm-1. XRD analysis shows some broaden peaks due to the amorphous phase of the prepared material. The prepared material is a brownish yellow solid, odorless and porous. The melting point, surface area, and the average pore radius are above 300 °C, 9.42 m2 / g, and 52.5938 Å, respectively.
Synthesis and characterization of hydrolysed starch-g-poly(methacrylic acid) composite.
Zahran, Magdy K; Ahmed, Enas M; El-Rafie, Mohamed H
2016-06-01
A novel method for the synthesis of starch-g-poly(methacrylic acid) composite was adopted by graft polymerization of hydrolysed starch (HS) and methacrylic acid (MAA) in aqueous medium using an efficient sodium perborate (SPB)-thiourea (TU) redox initiation system. The parameters influencing the redox system efficiency and thence the polymerization method were considered. These parameters comprehended the concentrations of MAA, SPB, TU and SPB/TU molar ratio as well as the polymerization temperature. The polymerization reaction was scrutinized through calculation of the MAA total conversion percent (TC%). The resultant poly(MAA-HS) composite was assessed by evaluating the polymer criteria (the graft yield, GY%; the grafting efficiency, GE%; the homopolymer, HP%; and the total conversion). The comportment of the apparent viscosity of the cooked poly(MAA)-starch composite paste, obtained under diverse polymerization conditions, was examined. Tentative mechanisms, which depict all occasions that happen amid the entire course of the polymerization reaction, have been proffered. Copyright © 2016 Elsevier B.V. All rights reserved.
Dysregulation of fatty acid synthesis and glycolysis in non-Hodgkin lymphoma
Bhatt, Aadra P.; Jacobs, Sarah R.; Freemerman, Alex J.; Makowski, Liza; Rathmell, Jeffrey C.; Dittmer, Dirk P.; Damania, Blossom
2012-01-01
The metabolic differences between B-NHL and primary human B cells are poorly understood. Among human B-cell non-Hodgkin lymphomas (B-NHL), primary effusion lymphoma (PEL) is a unique subset that is linked to infection with Kaposi's sarcoma-associated herpesvirus (KSHV). We report that the metabolic profiles of primary B cells are significantly different from that of PEL. Compared with primary B cells, both aerobic glycolysis and fatty acid synthesis (FAS) are up-regulated in PEL and other types of nonviral B-NHL. We found that aerobic glycolysis and FAS occur in a PI3K-dependent manner and appear to be interdependent. PEL overexpress the fatty acid synthesizing enzyme, FASN, and both PEL and other B-NHL were much more sensitive to the FAS inhibitor, C75, than primary B cells. Our findings suggest that FASN may be a unique candidate for molecular targeted therapy against PEL and other B-NHL. PMID:22752304
Tujioka, Kazuyo; Lyou, Sunok; Sano, Atushi; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2004-10-01
The purpose of present study was to determine whether the regulation of urea synthesis is mediated through changes in supply of amino acids by protein synthesis and whether the concentration of ammonia, or activities of amino acid catabolizing enzymes, regulate urea synthesis when the dietary protein quality is manipulated. Experiments were done on three groups of rats given diets containing 10 g gluten, 10 g casein or 10 g whole egg protein/100 g for 10 d. The urinary excretion of urea, and the liver concentrations of glutamate, serine and alanine increased with a decrease in quality of dietary protein. The fractional and absolute rates of protein synthesis in tissues declined with the decrease in quality of dietary protein quality. The ammonia concentration in plasma and liver, and activities of hepatic amino acid catabolizing enzymes was not related to urea excretion under these conditions. These results suggest that the lower protein synthesis seen in tissues of rats given the lower quality of protein is likely to be one of the factors to increasing the supply of amino acids and stimulating urea synthesis.
All-trans retinoic acid regulates hepatic bile acid homeostasis
Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne
2014-01-01
Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738
Ribonucleic Acid Synthesis by Cucumber Chromatin
Johnson, Kenneth D.; Purves, William K.
1970-01-01
When intact etiolated 2-day cucumber (Cucumis sativus) embryos were treated with indoleacetic acid (IAA), gibberellin A7 (GA7), or kinetin, chromatin derived from the embryonic axes exhibited an increased capacity to support RNA synthesis in either the presence or the absence of bacterial RNA polymerase. An IAA effect on cucumber RNA polymerase activity was evident after 4 hours of hormone treatment; the IAA effect on DNA template activity (bacterial RNA polymerase added) occurred after longer treatments (12 hours). GA7 also promoted template activity, but again only after a prior stimulation of endogenous chromatin activity. After 12 hours of kinetin treatment, both endogenous chromatin and DNA template activities were substantially above control values, but longer kinetin treatments caused these activities to decline in magnitude. When chromatin was prepared from hypocotyl segments that were floated on a GA7 solution, a GA-induced increase in endogenous chromatin activity occurred, but only if cotyledon tissue was left attached to the segments during the period of hormone treatment. Age of the seedling tissue had a profound influence on the chromatin characteristics. With progression of development from the 2-day to the 4-day stage, the endogenous chromatin activity declined while the DNA template activity increased. PMID:16657509
Konas, D W; Coward, J K
2001-12-28
Electrophilic fluorination of enantiomerically pure 2-pyrrolidinones (4) derived from (L)-glutamic acid has been investigated as a method for the synthesis of single stereoisomers of 4-fluorinated glutamic acids. Reaction of the lactam enolate derived from 9 with NFSi results in a completely diastereoselective monofluorination reaction to yield the monocyclic trans-substituted alpha-fluoro lactam product 21. Unfortunately, a decreased kinetic acidity in 21 and other structurally related monofluorinated products renders them resistant to a second fluorination. In contrast, the bicyclic lactam 12 is readily difluorinated under the standard conditions described to yield the alpha,alpha-difluoro lactam 24. The difference in reactivity between the two types of related lactams is attributed mainly to the presence or lack of a steric interaction between the base used for deprotonation and the protecting group present in the pyrrolidinone substrates. This conclusion was reached based on analysis of the X-ray crystal structure of 21, molecular modeling, and experimental evidence. The key intermediates 21 and 24 are converted to (2S,4R)-4-fluoroglutamic acid and (2S)-4,4-difluoroglutamic acid, respectively.
Conjugated Fatty Acid Synthesis
Rawat, Richa; Yu, Xiao-Hong; Sweet, Marie; Shanklin, John
2012-01-01
Conjugated linolenic acids (CLNs), 18:3 Δ9,11,13, lack the methylene groups found between the double bonds of linolenic acid (18:3 Δ9,12,15). CLNs are produced by conjugase enzymes that are homologs of the oleate desaturases FAD2. The goal of this study was to map the domain(s) within the Momordica charantia conjugase (FADX) responsible for CLN formation. To achieve this, a series of Momordica FADX-Arabidopsis FAD2 chimeras were expressed in the Arabidopsis fad3fae1 mutant, and the transformed seeds were analyzed for the accumulation of CLN. These experiments identified helix 2 and the first histidine box as a determinant of conjugase product partitioning into punicic acid (18:3 Δ9cis,11trans,13cis) or α-eleostearic acid (18:3 Δ9cis,11trans,13trans). This was confirmed by analysis of a FADX mutant containing six substitutions in which the sequence of helix 2 and first histidine box was converted to that of FAD2. Each of the six FAD2 substitutions was individually converted back to the FADX equivalent identifying residues 111 and 115, adjacent to the first histidine box, as key determinants of conjugase product partitioning. Additionally, expression of FADX G111V and FADX G111V/D115E resulted in an approximate doubling of eleostearic acid accumulation to 20.4% and 21.2%, respectively, compared with 9.9% upon expression of the native Momordica FADX. Like the Momordica conjugase, FADX G111V and FADX D115E produced predominantly α-eleostearic acid and little punicic acid, but the FADX G111V/D115E double mutant produced approximately equal amounts of α-eleostearic acid and its isomer, punicic acid, implicating an interactive effect of residues 111 and 115 in punicic acid formation. PMID:22451660
NASA Astrophysics Data System (ADS)
Swami, Anuradha; Mittal, Sherry; Chopra, Adity; Sharma, Rohit K.; Wangoo, Nishima
2018-03-01
In recent years, the synthesis of gold nanostructures of controllable shapes and dimensions has become a subject of intensive and interesting studies. Especially, anisotropic gold nanostructures such as nanoplates, nanoribbons, nanoprisms and nanorods have attracted much attention due to their striking optical properties and promising applications in electronics, photonics, sensing and biomedicine. Keeping this in mind, in the present report, an unprecedented, facile and one pot synthesis of isotropic (spherical) and anisotropic (triangular, pentagonal, hexagonal, rod shaped) gold nanomaterials via pH controlled shape modulation using hydroxyl moeity containing α-amino acids (Serine, Threonine, Tyrosine) as both reducing and capping agents is reported. The synthesized nanostructures have been further characterized by UV-Vis spectroscopy and transmission electron microscopy. It was deduced from these studies that pH played a key role in the anisotropic growth of gold nanostructures. These gold nanoparticles can be further used for applications in biosensing, plasmonics, and electrocatalysis and others involving surface enhanced raman scattering. This study is therefore, important from the point of view of using amino acids for the synthesis of gold nanoparticles of different shapes and sizes leading towards the development of inventive biosensors and biocompatible nanoconstructs.
Catalytic chemical amide synthesis at room temperature: one more step toward peptide synthesis.
Mohy El Dine, Tharwat; Erb, William; Berhault, Yohann; Rouden, Jacques; Blanchet, Jérôme
2015-05-01
An efficient method has been developed for direct amide bond synthesis between carboxylic acids and amines via (2-(thiophen-2-ylmethyl)phenyl)boronic acid as a highly active bench-stable catalyst. This catalyst was found to be very effective at room temperature for a large range of substrates with slightly higher temperatures required for challenging ones. This methodology can be applied to aliphatic, α-hydroxyl, aromatic, and heteroaromatic acids as well as primary, secondary, heterocyclic, and even functionalized amines. Notably, N-Boc-protected amino acids were successfully coupled in good yields with very little racemization. An example of catalytic dipeptide synthesis is reported.
Wang, Jingxuan; Zhao, Peng; Li, Ying; Xu, Lida; Tian, Pingfang
2018-04-05
Klebsiella pneumoniae is a promising industrial species for bioproduction of bulk chemicals such as 1,3-propanediol, 2,3-butanediol and 3-hydroxypropionic acid (3-HP). However, lactic acid is a troublesome by-product when optimizing for 3-HP production. Therefore, it is highly desirable to minimize lactic acid. Here, we show that lactic acid synthesis can be largely blocked by an engineered CRISPR interference (CRISPRi) system in K. pneumoniae. EGFP was recruited as a reporter of this CRISPRi system. Fluorescence assay of this CRISPRi system showed that enhanced green fluorescent protein (EGFP) expression level was repressed by 85-90%. To further test this CRISPRi system, guide RNAs were designed to individually or simultaneously target four lactate-producing enzyme genes. Results showed that all lactate-producing enzyme genes were significantly repressed. Notably, D-lactate dehydrogenase (ldhA) was shown to be the most influential enzyme for lactic acid formation in micro-aerobic conditions, as inhibiting ldhA alone led to lactic acid level similar to simultaneously repressing four genes. In shake flask cultivation, the strain coexpressing puuC (an aldehyde dehydrogenase catalyzing 3-hydroxypropionaldehyde to 3-HP) and dCas9-sgRNA inhibiting ldhA produced 1.37-fold 3-HP relative to the reference strain. Furthermore, in bioreactor cultivation, this CRISPRi strain inhibiting ldhA produced 36.7 g/L 3-HP, but only generated 1 g/L lactic acid. Clearly, this engineered CRISPRi system largely simplified downstream separation of 3-HP from its isomer lactic acid, an extreme challenge for 3-HP bioprocess. This study offers a deep understanding of lactic acid metabolism in diverse species, and we believe that this CRISPRi system will facilitate biomanufacturing and functional genome studies of K. pneumoniae or beyond.
Šalomskienė, Joana; Abraitienė, Asta; Jonkuvienė, Dovilė; Mačionienė, Irena; Repečkienė, Jūratė
2015-07-01
The aim of the study was a detail evaluation of genetic diversity among the lactic acid bacteria (LAB) strains having an advantage of a starter culture in order to select genotypically diverse strains with enhanced antimicrobial effect on some harmfull and pathogenic microorganisms. Antimicrobial activity of LAB was performed by the agar well diffusion method and was examined against the reference strains and foodborne isolates of Bacillus cereus, Listeria monocytogenes, Escherichia coli, Staphylococcus aureus and Salmonella Typhimurium. Antifungal activity was tested against the foodborne isolates of Candida parapsilosis, Debaromyces hansenii, Kluyveromyces marxianus, Pichia guilliermondii, Yarowia lipolytica, Aspergillus brasiliensis, Aspergillus versicolor, Cladosporium herbarum, Penicillium chrysogenum and Scopulariopsis brevicaulis. A total 40 LAB strains representing Lactobacillus (23 strains), Lactococcus (13 strains) and Streptococcus spp. (4 strains) were characterised by repetitive sequence based polymerase chain reaction fingerprinting which generated highly discriminatory profiles, confirmed the identity and revealed high genotypic heterogeneity among the strains. Many of tested LAB demonstrated strong antimicrobial activity specialised against one or few indicator strains. Twelve LAB strains were superior in suppressing growth of the whole complex of pathogenic bacteria and fungi. These results demonstrated that separate taxonomic units offered different possibilities of selection for novel LAB strains could be used as starter cultures enhancing food preservation.
Sugahara, Haruna; Meinert, Cornelia; Nahon, Laurent; Jones, Nykola C; Hoffmann, Søren V; Hamase, Kenji; Takano, Yoshinori; Meierhenrich, Uwe J
2018-07-01
Living organisms on the Earth almost exclusively use l-amino acids for the molecular architecture of proteins. The biological occurrence of d-amino acids is rare, although their functions in various organisms are being gradually understood. A possible explanation for the origin of biomolecular homochirality is the delivery of enantioenriched molecules via extraterrestrial bodies, such as asteroids and comets on early Earth. For the asymmetric formation of amino acids and their precursor molecules in interstellar environments, the interaction with circularly polarized photons is considered to have played a potential role in causing chiral asymmetry. In this review, we summarize recent progress in the investigation of chirality transfer from chiral photons to amino acids involving the two major processes of asymmetric photolysis and asymmetric synthesis. We will discuss analytical data on cometary and meteoritic amino acids and their potential impact delivery to the early Earth. The ongoing and future ambitious space missions, Hayabusa2, OSIRIS-REx, ExoMars 2020, and MMX, are scheduled to provide new insights into the chirality of extraterrestrial organic molecules and their potential relation to the terrestrial homochirality. This article is part of a Special Issue entitled: d-Amino acids: biology in the mirror, edited by Dr. Loredano Pollegioni, Dr. Jean-Pierre Mothet and Dr. Molla Gianluca. Copyright © 2018 Elsevier B.V. All rights reserved.
Domenichiello, Anthony F.; Chen, Chuck T.; Trepanier, Marc-Olivier; Stavro, P. Mark; Bazinet, Richard P.
2014-01-01
Docosahexaenoic acid (DHA) is important for brain function, however, the exact amount required for the brain is not agreed upon. While it is believed that the synthesis rate of DHA from α-linolenic acid (ALA) is low, how this synthesis rate compares with the amount of DHA required to maintain brain DHA levels is unknown. The objective of this work was to assess whether DHA synthesis from ALA is sufficient for the brain. To test this, rats consumed a diet low in n-3 PUFAs, or a diet containing ALA or DHA for 15 weeks. Over the 15 weeks, whole body and brain DHA accretion was measured, while at the end of the study, whole body DHA synthesis rates, brain gene expression, and DHA uptake rates were measured. Despite large differences in body DHA accretion, there was no difference in brain DHA accretion between rats fed ALA and DHA. In rats fed ALA, DHA synthesis and accretion was 100-fold higher than brain DHA accretion of rats fed DHA. Also, ALA-fed rats synthesized approximately 3-fold more DHA than the DHA uptake rate into the brain. This work indicates that DHA synthesis from ALA may be sufficient to supply the brain. PMID:24212299
The synthesis of mycosporine-like amino acids (MAAs) by cultured, symbiotic dinoflagellates.
T Banaszak1 A; LaJeunesse; Trench
2000-06-28
We tested the hypothesis that there is a relation between phylotypes (phylogenetic types, as determined by restriction fragment length polymorphism (RFLP) and partial sequence analysis of the small subunit ribosomal RNA gene (SSUrDNA)) and the synthesis of mycosporine-like amino acids (MAAs) by symbiotic dinoflagellates under the influence of ultraviolet radiation (UV-B/A) and photosynthetically active radiation (PAR). We exposed 27 isolates of symbiotic dinoflagellates simultaneously to UV-B/A and PAR, and subsequently determined the MAAs present in cell extracts and in the media. The algae used included 24 isolates of Symbiodinium spp. originating from jellyfishes, sea anemones, zoanthids, scleractinians, octocorals, and bivalves, and three others in the genera Gymnodinium, Gloeodinium and Amphidinium from a jellyfish, an hydrocoral and a flatworm, respectively. In this study, all of the phylotype A Symbiodinium spp. synthesized up to three identified MAAs. None of the 11 cultured phylotypes B and C Symbiodinium spp. synthesized MAAs. The three non-Symbiodinium symbionts also synthesized up to three MAAs. The results support a conclusion that phylotype A Symbiodinium spp. have a high predilection for the synthesis of MAAs, while phylotypes B and C do not. Synthesis of MAAs by symbiotic dinoflagellates in culture does not appear to relate directly to depths or to the UV exposure regimes from which the consortia were collected.
Ragoussis, Valentine; Giannikopoulos, Alexandros; Skoka, Efthymia; Grivas, Panagiotis
2007-06-27
(+/-)-4-Methyloctanoic acid and its ethyl ester are aggregation pheromones of many rhinoceros beetles of the genus Oryctes and are investigated for the control of these pests by olfactory trapping. A simple, economical, and high-yield (>50%) synthesis of (+/-)-4-methyloctanoic acid and its ethyl ester is presented starting from n-hexanal. The key step in this sequence is an orthoester Claisen rearrangement for the elongation of the carbon chain by two.
Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J
2014-04-25
Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Brodsky, V Y; Malchenko, L A; Lazarev, D S; Butorina, N N; Dubovaya, T K; Zvezdina, N D
2018-03-01
The kinetics of protein synthesis was investigated in primary cultures of hepatocytes from old rats in serum-free medium. The rats were fed mixed fodder supplemented with glutamic acid and then transferred to a regular mixed fodder. The amplitude of protein synthesis rhythm in hepatocytes isolated from these rats increased on average 2-fold in comparison with the rats not receiving glutamic acid supplement. Based on this indicator reflecting the degree of cell-cell interactions, the cells from old rats were not different from those of young rats. The effect was preserved for 3-4 days. These results are discussed in connection with our previous data on preservation of the effect of single administration of gangliosides, noradrenaline, serotonin, and other synchronizers on various cell populations. In contrast to the other investigated factors, glutamic acid is capable of penetrating the blood-brain barrier, which makes its effect possible not only in the case of hepatocytes and other non-brain cells, but also in neurons.
Plant cellulose synthesis: CESA proteins crossing kingdoms.
Kumar, Manoj; Turner, Simon
2015-04-01
Cellulose is a biopolymer of considerable economic importance. It is synthesised by the cellulose synthase complex (CSC) in species ranging from bacteria to higher plants. Enormous progress in our understanding of bacterial cellulose synthesis has come with the recent publication of both the crystal structure and biochemical characterisation of a purified complex able to synthesis cellulose in vitro. A model structure of a plant CESA protein suggests considerable similarity between the bacterial and plant cellulose synthesis. In this review article we will cover current knowledge of how plant CESA proteins synthesise cellulose. In particular the focus will be on the lessons learned from the recent work on the catalytic mechanism and the implications that new data on cellulose structure has for the assembly of CESA proteins into the large complex that synthesis plant cellulose microfibrils. Copyright © 2014 The Authors. Published by Elsevier Ltd.. All rights reserved.
Growth and Synthesis of Nucleic Acid and Protein by Excised Radish Cotyledons 1
Nieman, R. H.; Poulsen, L. L.
1967-01-01
Nutritional and light requirements for growth and synthesis of RNA, DNA, and protein by cotyledons excised from 5-day-old seedlings of Raphanus sativus L. were investigated, and the course of synthesis was followed through the cell cycle. The minimum requirements for a net increase in nucleic acid and protein were sugar, nitrate, and light. The cotyledons used nitrite at low concentration, but not ammonium ion. Light was required for preliminary steps in synthesis of RNA, DNA, and protein, but the actual polymerization reactions occurred in the dark. The cotyledons contained sufficient endogenous growth factors for about half of the cells to complete 1 cycle on a medium of 1% sucrose, 80 mm KNO3. The increase in DNA was limited to about 50% and was accompanied by a comparable increase in cell number. Fresh weight, RNA, and protein tended to increase in proportion to DNA. Growth of the isolated cotyledons commenced with cell enlargement. RNA began to increase after about 4 hours, DNA after about 12. The major increase in protein also began at about 12 hours. The maximum rate of increase for all 3 occurred between 12 and 16 hours. Cell counts indicated that by 28 hours most of the cells which had replicated DNA had also completed cell division. PMID:16656601
Abad, José-Luis; Serra, Montserrat; Camps, Francisco; Fabriàs, Gemma
2007-02-02
The synthesis of two hexadeuterated palmitic acids differing in the position of the diagnostic labels, and their use to decipher the cryptoregiochemistry of a Delta13 desaturation are described. A dithiane and a triple bond functionalities were used to introduce the diagnostic (C13 or C14) and tagging (C8 and C9) labels, respectively, in the palmitic acid skeleton. Using these probes, the cryptoregiochemistry of the Delta13 desaturation involved in the biosynthesis of Thaumetopoea pityocampa sex pheromone was studied by means of kinetic isotope effect determinations. Transformation of both (Z)-11-hexadecenoic and 11-hexadecynoic acids into (Z, Z)-11,13-hexadecadienoic and (Z)-13-hexadecen-11-ynoic acids, respectively, is initiated by abstraction of the hydrogen atom at the C13 position, followed by the fast elimination of the C14 hydrogen to give the double bond.
NASA Technical Reports Server (NTRS)
Kozlov, I. A.; Politis, P. K.; Van Aerschot, A.; Busson, R.; Herdewijn, P.; Orgel, L. E.; Bada, J. L. (Principal Investigator); Dolan, M. (Principal Investigator)
1999-01-01
Hexitol nucleic acid (HNA) is an analogue of DNA containing the standard nucleoside bases, but with a phosphorylated 1,5-anhydrohexitol backbone. HNA oligomers form duplexes having the nucleic acid A structure with complementary DNA or RNA oligomers. The HNA decacytidylate oligomer is an efficient template for the oligomerization of the 5'-phosphoroimidazolides of guanosine or deoxyguanosine. Comparison of the oligomerization efficiencies on HNA, RNA, and DNA decacytidylate templates under various conditions suggests strongly that only nucleic acid double helices with the A structure support efficient template-directed synthesis when 5'-phosphoroimidazolides of nucleosides are used as substrates.
Cheng, Juanli; Ma, Jincheng; Lin, Jinshui; Fan, Zhen-Chuan; Cronan, John E.
2012-01-01
Ralstonia solanacearum, a major phytopathogenic bacterium, causes a bacterial wilt disease in diverse plants. Although fatty acid analyses of total membranes of R. solanacearum showed that they contain primarily palmitic (C16:0), palmitoleic (C16:1) and cis-vaccenic (C18:1) acids, little is known regarding R. solanacearum fatty acid synthesis. The R. solanacearum GMI1000 genome is unusual in that it contains four genes (fabF1, fabF2, fabF3, and fabF4) annotated as encoding 3-ketoacyl-acyl carrier protein synthase II homologues and one gene (fabB) annotated as encoding 3-ketoacyl-acyl carrier protein synthase I. We have analyzed this puzzling apparent redundancy and found that only one of these genes, fabF1, encoded a long-chain 3-ketoacyl-acyl carrier protein synthase, whereas the other homologues did not play roles in R. solanacearum fatty acid synthesis. Mutant strains lacking fabF1 are nonviable, and thus, FabF1 is essential for R. solanacearum fatty acid biosynthesis. Moreover, R. solanacearum FabF1 has the activities of both 3-ketoacyl-acyl carrier protein synthase II and 3-ketoacyl-acyl carrier protein synthase I. PMID:22194290
Semenenko, S; Tymofiychuk, I; Boreyko, L; Karatieieva, S; Slobodian, K
2017-10-01
The objective of research is to study the peculiarities of melatonin effect on chronorhythmic organization of the kidney acid-regulating function influenced by nitrogen monoxide (NO) synthesis blockade under conditions of pineal gland (PG) hypofunction. The experiments were conducted on 72 mature non-linear albino male rats with their body mass 0,15-0,18 kg. The animals were kept under vivarium conditions at a stable temperature and air humidity fed on a standard dietary intake. The control group included animals (n=36) kept under conditions of usual light regimen (12.00С:12.00Т) during 7 days. The experimental group included animals (n=36) injected with N-nitro-L-arginine (L-NNA) in the dose of 20 mg/kg during 7 days under conditions of continuous light (12.00С:12.00С) and melatonin in the dose of 0,5 mg/kg during 7 days simultaneously. On the 8th day the animals were exposed to 5% water load with heated to room temperature water supplied and the parameters of the kidney acid-regulating function under conditions of forced diuresis were investigated. Kidney functions in the control animals are subordinated to accurate circadian organization. Daily rhythms of the parameters of kidney acid-regulating functions reflect similar changes of the renal processes. Chronorhythmic transformations of the kidney acid-regulating functions in animals with blocked NO synthesis against continuous light and parallel injection of melatonin enable to suggest that NO synthesis blockade under conditions of melatonin correction reduces daily mean pH level as compared to the control. Although, it was higher than that in the animals with blocked NO synthesis against the ground of physiological function of the pineal gland, and animals with PG hypofunction under conditions of NO synthesis blockadeю Therefore, under conditions of L-NNA blockade of NO synthesis and injection of melatonin influenced by PG hypofunction chronorhythmic transformations of architectonics and phase structure of
Yin, Qian; Yin, Lichen; Wang, Hua; Cheng, Jianjun
2015-07-21
Poly(α-hydroxy acids) (PAHAs) are a class of biodegradable and biocompatible polymers that are widely used in numerous applications. One drawback of these conventional polymers, however, is their lack of side-chain functionalities, which makes it difficult to conjugate active moieties to PAHA or to fine-tune the physical and chemical properties of PAHA-derived materials through side-chain modifications. Thus, extensive efforts have been devoted to the development of methodology that allows facile preparation of PAHAs with controlled molecular weights and a variety of functionalities for widespread utilities. However, it is highly challenging to introduce functional groups into conventional PAHAs derived from ring-opening polymerization (ROP) of lactides and glycolides to yield functional PAHAs with favorable properties, such as tunable hydrophilicity/hydrophobicity, facile postpolymerization modification, and well-defined physicochemical properties. Amino acids are excellent resources for functional polymers because of their low cost, availability, and structural as well as stereochemical diversity. Nevertheless, the synthesis of functional PAHAs using amino acids as building blocks has been rarely reported because of the difficulty of preparing large-scale monomers and poor yields during the synthesis. The synthesis of functionalized PAHAs from O-carboxyanhydrides (OCAs), a class of five-membered cyclic anhydrides derived from amino acids, has proven to be one of the most promising strategies and has thus attracted tremendous interest recently. In this Account, we highlight the recent progress in our group on the synthesis of functional PAHAs via ROP of OCAs and their self-assembly and biomedical applications. New synthetic methodologies that allow the facile preparation of PAHAs with controlled molecular weights and various functionalities through ROP of OCAs are reviewed and evaluated. The in vivo stability, side-chain functionalities, and/or trigger
Exogenous fatty acid metabolism in bacteria.
Yao, Jiangwei; Rock, Charles O
2017-10-01
Bacterial type II fatty acid synthesis (FASII) is a target for novel antibiotic development. All bacteria encode for mechanisms to incorporate exogenous fatty acids, and some bacteria can use exogenous fatty acids to bypass FASII inhibition. Bacteria encode three different mechanisms for activating exogenous fatty acids for incorporation into phospholipid synthesis. Exogenous fatty acids are converted into acyl-CoA in Gammaproteobacteria such as E. coli. Acyl-CoA molecules constitute a separate pool from endogenously synthesized acyl-ACP. Acyl-CoA can be used for phospholipid synthesis or broken down by β-oxidation, but cannot be used for lipopolysaccharide synthesis. Exogenous fatty acids are converted into acyl-ACP in some Gram-negative bacteria. The resulting acyl-ACP undergoes the same fates as endogenously synthesized acyl-ACP. Exogenous fatty acids are converted into acyl-phosphates in Gram-positive bacteria, and can be used for phospholipid synthesis or become acyl-ACP. Only the order Lactobacillales can use exogenous fatty acids to bypass FASII inhibition. FASII shuts down completely in presence of exogenous fatty acids in Lactobacillales, allowing Lactobacillales to synthesize phospholipids entirely from exogenous fatty acids. Inhibition of FASII cannot be bypassed in other bacteria because FASII is only partially down-regulated in presence of exogenous fatty acid or FASII is required to synthesize essential metabolites such as β-hydroxyacyl-ACP. Certain selective pressures such as FASII inhibition or growth in biofilms can select for naturally occurring one step mutations that attenuate endogenous fatty acid synthesis. Although attempts have been made to estimate the natural prevalence of these mutants, culture-independent metagenomic methods would provide a better estimate. Copyright © 2017 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Engineer, Anupama S; Dhakephalkar, Anita P; Gaikaiwari, Raghavendra P; Dhakephalkar, Prashant K
2013-12-01
Hydantoinase-mediated enzymatic synthesis of optically pure carbamoyl amino acids was investigated as an environmentally friendly, energy-efficient alternative to the otherwise energy-intensive, polluting chemical synthesis. Hydantoinase-producing bacterial strain was identified as Pseudomonas aeruginosa by 16S rRNA gene sequencing and biochemical profiling using the BIOLOG Microbial Identification System. Hydantoinase activity was assessed using hydantoin analogs and 5-monosubstituted hydantoins as substrates in a colorimetric assay. The hydantoinase gene was PCR amplified using gene-specific primers and sequenced on an automated gene analyzer. Hydantoinase gene sequence of P. aeruginosa MCM B-887 revealed maximum homology of only 87 % with proven hydantoinase gene sequences in GenBank. MCM B-887 resting cells converted >99 % of substrate into N-carbamoyl amino acids under optimized condition at 42 °C, pH 8.0, and 100 mM substrate concentration in <120 min. Hydantoin hydrolyzing activity was D-selective and included broad substrate profile of 5-methyl hydantoin, 5-phenyl hydantoin, 5-hydroxyphenyl hydantoin, o-chlorophenyl hydantoin, as well as hydantoin analogs such as allantoin, dihydrouracil, etc. MCM B-887 resting cells may thus be suitable for bio-transformations leading to the synthesis of optically pure, unnatural carbamoyl amino acids of industrial importance.
Martin, Rey W; Des Soye, Benjamin J; Kwon, Yong-Chan; Kay, Jennifer; Davis, Roderick G; Thomas, Paul M; Majewska, Natalia I; Chen, Cindy X; Marcum, Ryan D; Weiss, Mary Grace; Stoddart, Ashleigh E; Amiram, Miriam; Ranji Charna, Arnaz K; Patel, Jaymin R; Isaacs, Farren J; Kelleher, Neil L; Hong, Seok Hoon; Jewett, Michael C
2018-03-23
Cell-free protein synthesis has emerged as a powerful approach for expanding the range of genetically encoded chemistry into proteins. Unfortunately, efforts to site-specifically incorporate multiple non-canonical amino acids into proteins using crude extract-based cell-free systems have been limited by release factor 1 competition. Here we address this limitation by establishing a bacterial cell-free protein synthesis platform based on genomically recoded Escherichia coli lacking release factor 1. This platform was developed by exploiting multiplex genome engineering to enhance extract performance by functionally inactivating negative effectors. Our most productive cell extracts enabled synthesis of 1,780 ± 30 mg/L superfolder green fluorescent protein. Using an optimized platform, we demonstrated the ability to introduce 40 identical p-acetyl-L-phenylalanine residues site specifically into an elastin-like polypeptide with high accuracy of incorporation ( ≥ 98%) and yield (96 ± 3 mg/L). We expect this cell-free platform to facilitate fundamental understanding and enable manufacturing paradigms for proteins with new and diverse chemistries.
NASA Astrophysics Data System (ADS)
Gorbyk, P. P.; Dubrovin, I. V.; Demchenko, Yu. A.
The main principles and methods of synthesis of hollow structures with inorganic nanomaterials are described. Synthesis of hollow spherical silica particles was based on hydrolysis of Si(CH3)2Cl2 and SiCl4 in nonpolar solvents at a surface of aerosol drops. To synthesise hollow magnetite nano- and microparticles with magnetite, saturated solution of iron chlorides in acetone was used. Phase and element composition, morphology and structure of samples were studied using XRD, Auger electron spectroscopy, scanning electron and atom force microscopies.
Mitchell, Robin E
2010-03-15
The four stereomers of 2-imino-3-methylene-5-L(carboxy-L-valyl)pyrrolidine, a bacterial metabolite that is inhibitory to the fire blight bacterium Erwinia amylovora, were synthesised and compared for antibacterial activity. Several alternative amino acid conjugates with L,L-stereochemistry were also prepared, and the synthesis was extended to 3-methylenepiperidine-6-L-carboxylic acid and a selection of 2-imino-3-methylenepiperidine-6-L-carboxy-L-amino acid conjugates. All synthetic amino acid conjugates (L,L-stereomers) were inhibitory to the growth of E. amylovora. The likely participation of the conjugated iminomethylene moiety as a Michael acceptor is implicated. Copyright 2010 Elsevier Ltd. All rights reserved.
Effect of synthesis parameters on polymethacrylic acid xerogel structures and equilibrium swelling
NASA Astrophysics Data System (ADS)
Panić, V.; Jovanović, J.; Adnadjević, B.; Velicković, S.
2009-09-01
Hydrogels based on crosslinked polymethacrylic acid were synthesized via free-radical polymerization in aqueous solution, using N,N'-methylene bisacrylamide as a crosslinking agent and 2,2'-azobis-[2-(2-imidazolin-2-yl)propane] dihydrochloride as an initiator. The influence of the reaction parameters (the neutralization degree of methacrylic acid and the initial monomer concentration) on the equilibrium swelling degree, the swelling kinetic parameters and the basic structural properties of xerogels was investigated. The change of synthesis parameters leads to the change of the basic structural parameters of xerogel, as well as the equilibrium swelling degree and the initial swelling rate of the hydrogels. It is found that there are power form relationships between the equilibrium swelling degree, the initial swelling rate and the structural xerogel’s properties and the change of the neutralization degree of monomer, i.e. the monomer concentration. The examined correlations proved that the crosslinking density is the crucial parameter which determines all the other investigated structural and swelling parameters.
Fatty acid carbon is essential for dNTP synthesis in endothelial cells
Missiaen, Rindert; Queiroz, Karla CS; Borgers, Gitte; Elia, Ilaria; Zecchin, Annalisa; Cantelmo, Anna Rita; Christen, Stefan; Goveia, Jermaine; Heggermont, Ward; Goddé, Lucica; Vinckier, Stefan; Van Veldhoven, Paul P.; Eelen, Guy; Schoonjans, Luc; Gerhardt, Holger; Dewerchin, Mieke; Baes, Myriam; De Bock, Katrien; Ghesquière, Bart; Lunt, Sophia Y.; Fendt, Sarah-Maria; Carmeliet, Peter
2015-01-01
The metabolism of endothelial cells (ECs) during vessel sprouting remains poorly studied. Here, we report that endothelial loss of CPT1a, a rate-limiting enzyme of fatty acid oxidation (FAO), caused vascular sprouting defects due to impaired proliferation, not migration of ECs. Reduction of FAO in ECs did not cause energy depletion or disturb redox homeostasis, but impaired de novo nucleotide synthesis for DNA replication. Isotope labeling studies in control ECs showed that fatty acid carbons substantially replenished the Krebs cycle, and were incorporated into aspartate (a nucleotide precursor), uridine monophosphate (a precursor of pyrimidine nucleoside triphosphates) and DNA. CPT1a silencing reduced these processes and depleted EC stores of aspartate and deoxyribonucleoside triphosphates. Acetate (metabolized to acetyl-CoA, thereby substituting for the depleted FAO-derived acetyl-CoA) or a nucleoside mix rescued the phenotype of CPT1a-silenced ECs. Finally, CPT1 blockade inhibited pathological ocular angiogenesis, suggesting a novel strategy for blocking angiogenesis. PMID:25830893
Lozano-Sanchez, Pablo; Elliott, Joanne M
2008-02-01
Using the technique of liquid crystal templating a rotating disc electrode (RDE) was modified with a high surface area mesoporous platinum film. The surface area of the electrode was characterised by acid voltammetry, and found to be very high (ca. 86 cm(2)). Acid characterisation of the electrode produced distorted voltammograms was interpreted as being due to the extremely large surface area which produced a combination of effects such as localised pH change within the pore environment and also ohmic drop effects. Acid voltammetry in the presence of two different types of surfactant, namely Tween 20 and Triton X-100, suggested antifouling properties associated with the mesoporous deposit. Further analysis of the modified electrode using a redox couple in solution showed typical RDE behaviour although extra capacitive currents were observed due to the large surface area of the electrode. The phenomenon of underpotential deposition was exploited for the purpose of anodic stripping voltammetry and results were compared with data collected for microelectrodes. Underpotential deposition of metal ions at the mesoporous RDE was found to be similar to that at conventional platinum electrodes and mesoporous microelectrodes although the rate of surface coverage was found to be slower at a mesoporous RDE. It was found that a mesoporous RDE forms a suitable system for quantification of silver ions in solution.
Partial characterisation of digestive proteases of the Mayan cichlid Cichlasoma urophthalmus.
Cuenca-Soria, C A; Álvarez-González, C A; Ortiz-Galindo, J L; Nolasco-Soria, H; Tovar-Ramírez, D; Guerrero-Zárate, R; Castillo-Domínguez, A; Perera-García, M A; Hernández-Gómez, R; Gisbert, E
2014-06-01
The characterisation of digestive proteases in native freshwater fish such as the Mayan cichlid Cichlasoma urophthalmus provides scientific elements that may be used to design balanced feed that matches with the digestive capacity of the fish. The purpose of this study was to characterise the digestive proteases, including the effect of the pH and the temperature on enzyme activity and stability, as well as the effect of inhibitors using multienzymatic extracts of the stomach and intestine of C. urophthalmus juveniles. Results showed that the optimum activities of the acid and alkaline proteases occurred at pH values of 3 and 9, respectively, whereas their optimum temperatures were 55 and 65 °C, respectively. The acid proteases were most stable at pH values of 2–3 and at temperatures of 35–45 °C, whereas the alkaline proteases were most stable at pH values of 6–9 and at 25–55 °C. The inhibition assays recorded a residual activity of 4% with pepstatin A for the acid proteases. The inhibition of the alkaline proteases was greater than 80% with TPCK, TLCK, EDTA and ovalbumin, and of 60 and 43.8% with PMSF and SBT1, respectively. The results obtained in this study make it possible to state that C. urophthalmus has a sufficiently complete digestive enzyme machinery to degrade food items characteristic of an omnivorous fish species, although specimens showed a tendency to carnivory.
Limb defects induced by retinoic acid signaling antagonism and synthesis inhibition are consistent with ethanol-induced limb defects
Johnson CS1, Sulik KK1,2, Hunter, ES III3
1Department of Cell and Developmental Biology, University of North Carolina at Chapel Hill, NC....
Macromolecular Synthesis During the Germination of Saccharomyces cerevisiae Spores
Rousseau, Paul; Halvorson, Harlyn O.
1973-01-01
After the dormancy of Saccharomyces cerevisiae ascospores had been broken, the synthesis of proteins was observed first, followed rapidly by synthesis of ribonucleic acid (RNA) and much later by deoxyribonucleic acid (DNA) synthesis. Phosphoglucomutase activity increased in a periodic (step) fashion, whereas the activity of five other enzymes increased linearly during germination and outgrowth. The rate of synthesis of these enzymes was highest at about the period of DNA replication. The amino acid pools of dormant spores contained high levels of proline, glutamic acid, and histidine. At 2 h after onset of germination, the pools of phenylalanine and methionine had disappeared and the other components had decreased significantly. By 3.5 h, with the exception of proline and cystine, most amino acid pool components had significantly increased. PMID:4570780
Laufenberg, Lacee; Kazi, Abid A.; Lang, Charles H.
2014-01-01
Small molecule nonpeptidyl molecules are potentially attractive drug candidates as adjunct therapies in the treatment of sepsis-induced metabolic complications. As such, the current study investigates the use of aurintricarboxylic acid (ATA), which stimulates insulin-like growth factor (IGF)-I receptor and AKT signaling, for its ability to ameliorate the protein metabolic effects of endotoxin (LPS) + interferon (IFN)γ in C2C12 myotubes and sepsis in skeletal muscle. ATA dose- and time-dependently increases mTOR-dependent protein synthesis. Pretreatment with ATA prevents the LPS/IFNγ-induced decrease in protein synthesis at least in part by maintaining mTOR kinase activity, while post-treatment with ATA is able to increase protein synthesis when added up to 6 h after LPS/IFNγ. ATA also reverses the amino acid resistance which is detected in response to nutrient deprivation. Conversely, ATA decreases the basal rate of protein degradation and prevents the LPS/IFNγ-increase in proteolysis, and the latter change is associated reduced atrogin-1 and MuRF1 mRNA. The ability of ATA to antagonize LPS/IFNγ-induced changes in protein metabolism were associated with its ability to prevent the increases in IL-6 and NOS2 and decreases in IGF-I. In vivo studies indicate ATA acutely increases skeletal muscle, but not cardiac, protein synthesis, and attenuates the loss of lean body mass over 5 days. These data suggest ATA and other small molecule agonists of endogenous anabolic hormones may prove beneficial in treating sepsis by decreasing the inflammatory response and improving muscle protein balance. PMID:24430547
Lee, Ho-Joo; Choi, Mun Hwan; Kim, Tae-Un; Yoon, Sung Chul
2001-01-01
A psychrotrophic bacterium, Pseudomonas fluorescens BM07, which is able to accumulate polyhydroxyalkanoic acid (PHA) containing large amounts of 3-hydroxy-cis-5-dodecenoate unit up to 35 mol% in the cell from unrelated substrates such as fructose, succinate, etc., was isolated from an activated sludge in a municipal wastewater treatment plant. When it was grown on heptanoic acid (C7) to hexadecanoic acid (C16) as the sole carbon source, the monomer compositional characteristics of the synthesized PHA were similar to those observed in other fluorescent pseudomonads belonging to rRNA homology group I. However, growth on stearic acid (C18) led to no PHA accumulation, but instead free stearic acid was stored in the cell. The existence of the linkage between fatty acid de novo synthesis and PHA synthesis was confirmed by using inhibitors such as acrylic acid and two other compounds, 2-bromooctanoic acid and 4-pentenoic acid, which are known to inhibit β-oxidation enzymes in animal cells. Acrylic acid completely inhibited PHA synthesis at a concentration of 4 mM in 40 mM octanoate-grown cells, but no inhibition of PHA synthesis occurred in 70 mM fructose-grown cells in the presence of 1 to 5 mM acrylic acid. 2-Bromooctanoic acid and 4-pentenoic acid were found to much inhibit PHA synthesis much more strongly in fructose-grown cells than in octanoate-grown cells over concentrations ranging from 1 to 5 mM. However, 2-bromooctanoic acid and 4-pentenoic acid did not inhibit cell growth at all in the fructose media. Especially, with the cells grown on fructose, 2-bromooctanoic acid exhibited a steep rise in the percent PHA synthesis inhibition over a small range of concentrations below 100 μM, a finding indicative of a very specific inhibition, whereas 4-pentenoic acid showed a broad, featureless concentration dependence, suggesting a rather nonspecific inhibition. The apparent inhibition constant Ki (the concentration for 50% inhibition of PHA synthesis) for 2
Ishihara, Hirofumi; Obata, Toshihiro; Sulpice, Ronan; Fernie, Alisdair R; Stitt, Mark
2015-05-01
Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied (13)CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%-4% d(-1)), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. © 2015 American Society of Plant Biologists. All Rights Reserved.
Dirks, Marlou L; Groen, Bart B L; Franssen, Rinske; van Kranenburg, Janneau; van Loon, Luc J C
2017-01-01
Short periods of muscle disuse result in substantial skeletal muscle atrophy. Recently, we showed that both neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. In this study, we test our hypothesis that NMES can augment the use of presleep protein-derived amino acids for overnight muscle protein synthesis in older men. Twenty healthy, older [69 ± 1 (SE) yr] men were subjected to 24 h of bed rest, starting at 8:00 AM. In the evening, volunteers were subjected to 70-min 1-legged NMES, while the other leg served as nonstimulated control (CON). Immediately following NMES, 40 g of intrinsically l-[1- 13 C]-phenylalanine labeled protein was ingested prior to sleep. Blood samples were taken throughout the night, and muscle biopsies were obtained from both legs in the evening and the following morning (8 h after protein ingestion) to assess dietary protein-derived l-[1- 13 C]-phenylalanine enrichments in myofibrillar protein. Plasma phenylalanine concentrations and plasma l-[1- 13 C]-phenylalanine enrichments increased significantly following protein ingestion and remained elevated for up to 6 h after protein ingestion (P < 0.05). During overnight sleep, myofibrillar protein-bound l-[1- 13 C]-phenylalanine enrichments (MPE) increased to a greater extent in the stimulated compared with the control leg (0.0344 ± 0.0019 vs. 0.0297 ± 0.0016 MPE, respectively; P < 0.01), representing 18 ± 6% greater incorporation of presleep protein-derived amino acids in the NMES compared with CON leg. In conclusion, application of NMES prior to presleep protein feeding stimulates the use of dietary protein-derived amino acids for overnight muscle protein synthesis in older men. Neuromuscular electrical stimulation (NMES) as well as presleep dietary protein ingestion represent effective strategies to stimulate muscle protein synthesis rates. Here we demonstrate that in older
NASA Astrophysics Data System (ADS)
Bergamini, F. R. G.; Ribeiro, M. A.; Lancellotti, M.; Machado, D.; Miranda, P. C. M. L.; Cuin, A.; Formiga, A. L. B.; Corbi, P. P.
2016-09-01
This article describes the synthesis and characterization of the 1-ethyl-7-methyl-4-oxo-1,4-dihydro-1,8-naphthyridine-3-carbohydrazide (hzd) and six carbonyl hydrazones derivatives of the nalidixic with 1H-pyrrol-2-ylmethylidene (hpyrr), 1H-imidazol-2-ylmethylidene (h2imi), pyridin-2-ylmethylidene (h2py), pyridin-3-ylmethylidene (h3py), pyridin-4-ylmethylidene(h4py) and (2-hydroxyphenyl)methylidene (hsali). The carbonyl hydrazones were characterized by elemental and ESI-QTOF-MS analyses, IR and detailed NMR spectroscopic measurements. The 2D NMR experiments allowed the unambiguous assignment of the hydrogen, carbon and nitrogen atoms, which have not been reported for nalidixic acid carbonyl hydrazone derivatives so far. Crystal structures of hzd and the new carbonyl hydrazones h2imi, hpyrr and h3py were determined by X-ray diffraction studies. Although the synthesis of hzd was reported decades ago, the hzd crystal structure have not been reported yet. Geometric optimizations of all the characterized structures were performed with the aid of DFT studies. Despite the fact that the hydrazones with 2-pyridine carboxylic acid (h2py) and salicyl aldehyde (hsali) were already reported by literature, a detailed spectroscopic study followed by DFT studies are also reported for such compounds in this manuscript. Antimicrobial studies of the compounds are also presented.
Kawashima, Aki; Shu, Shuangjie; Takeda, Ryosuke; Kawamura, Akie; Sato, Tatsunori; Moriwaki, Hiroki; Wang, Jiang; Izawa, Kunisuke; Aceña, José Luis; Soloshonok, Vadim A; Liu, Hong
2016-04-01
Asymmetric synthesis of (1R,2S)-1-amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is in extremely high demand due to the pharmaceutical importance of this tailor-made, sterically constrained α-amino acid. Here we report the development of an advanced procedure for preparation of the target amino acid via two-step SN2 and SN2' alkylation of novel axially chiral nucleophilic glycine equivalent. Excellent yields and diastereoselectivity coupled with reliable and easy scalability render this method of immediate use for practical synthesis of (1R,2S)-vinyl-ACCA.
Synthesis of L-ascorbic acid in the phloem
Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto
2003-01-01
Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288
Ma, LiWei; Steindal, Arnfinn E; Juzeniene, Asta; Iani, Vladimir; Moan, Johan
2006-08-01
5-Aminolevulinic acid (ALA) or its derivative methyl 5-aminolevulinate (MAL) combined with folic acid was applied in nude mice bearing human colon adenocarcinoma. The aim of the study is to see whether folic acid may increase biosynthesis of porphyrins in tumor tissue after systemic or topical administration of ALA or MAL. The production of porphyrins was determined by spectrofluorometric measurements with an optical fibre probe. It was found that the porphyrin production after i.p injection of 200 mg kg(-1) ALA or MAL was significantly increased by i.p injection of 100 mg kg(-1) folic acid. However, in the case of topically applied 20% ALA, folic acid had no effect. In the case of topically applied 20% MAL, folic acid (i.p or topically applied) reduced the porphyrin synthesis. This might be used for the protection of normal skin against photosensitization. The effects of folic acid were similar in tumors and normal skin. Two mechanisms may explain the results: enhancement of the efficiency of the rate-limiting enzyme porphobilinogen deaminase by folic acid or interference of folic acid with the transport of ALA and MAL to and into the cells synthesizing porphyrins in the tissues. The present data seem to favour the latter mechanism. Folic acid may have a role as an adjuvant in photodynamic therapy with systemically administered ALA and its derivatives.
NASA Astrophysics Data System (ADS)
Garg, Kavita; Shanmugam, Ramakrishanan; Ramamurthy, Praveen C.
2018-02-01
Tetrathia-rubyrin and graphene oxide (GO) covalent adduct was synthesized, characterised and optical properties were studied. GO-Rubyrin adducts showed fluorescence quenching of rubyrin due to electron or energy transfer from rubyrin to graphene oxide, which also reflected in UV-vis absorbance spectroscopy. The non-linear optical responses were measured through Z scan technique in nano-second regime. The enhanced optical non-linearity was observed after attachment of GO with rubyrin, can be ascribed to the photo-induced electron or energy transfer from the electron rich rubyrin moiety to the electron deficient GO.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Wang, Cai-Feng; Cheng, Yu-Peng; Xie, He-Yi
2011-01-01
This paper describes the chemical synthesis of cadmium sulfide (CdS) polymer nanocomposites by covalently grafting poly(lactic acid) (PLA) onto the surfaces of CdS nanocrystals (NCs). Synthesis of the nanocomposites involved two steps. Lactic acid (LA) capped CdS NCs were first prepared by reacting cadmium chloride (CdCl2) with sodium sulfide (Na2S) using LA as the organic ligand in H2O/N,N-dimethylformamide (DMF) solution. Next CdS PLA nanocomposites were formed by in situ ring-opening polymerization of lactide on the surface of modified CdS NCs. Transparent fluorescent films were then successfully prepared by blending as-prepared CdS PLA nanocomposites with high-molecular-weight PLA. The as-prepared CdS NCsmore » and their nanocomposites were studied by transmission electron microscopic imaging, thermogravimetric analyses, and spectroscopic measurements (ultraviolet-visible absorption and photoluminescence). The spectroscopic studies revealed that the CdS polymer nanocomposites exhibited good optical properties in terms of their photoluminescence and transparency.« less
Merad, Jérémy; Lalli, Claudia; Bernadat, Guillaume; Maury, Julien; Masson, Géraldine
2018-03-15
Synthesis of biologically active molecules (whether at laboratory or industrial scale) remains a highly appealing area of modern organic chemistry. Nowadays, the need to access original bioactive scaffolds goes together with the desire to improve synthetic efficiency, while reducing the environmental footprint of chemical activities. Long neglected in the field of total synthesis, enantioselective organocatalysis has recently emerged as an environmentally friendly and indispensable tool for the construction of relevant bioactive molecules. Notably, enantioselective Brønsted acid catalysis has offered new opportunities in terms of both retrosynthetic disconnections and controlling stereoselectivity. The present report attempts to provide an overview of enantioselective total or formal syntheses designed around Brønsted acid-catalyzed transformations. To demonstrate the versatility of the reactions promoted and the diversity of the accessible motifs, this Minireview draws a systematic parallel between methods and retrosynthetic analysis. The manuscript is organized according to the main reaction types and the nature of newly-formed bonds. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Xie, Wenping; Zhang, Wenpeng; Ren, Juan; Li, Wentao; Zhou, Lili; Cui, Yuan; Chen, Huiming; Yu, Wenlian; Zhuang, Xiaomei; Zhang, Zhenqing; Shen, Guolin; Li, Haishan
2018-02-14
Triclocarban (TCC) has been identified as a new environmental pollutant that is potentially hazardous to human health; however, the effects of short-term TCC exposure on cardiac function are not known. The aim of this study was to use metabonomics and molecular biology techniques to systematically elucidate the molecular mechanisms of TCC-induced effects on cardiac function in mice. Our results show that TCC inhibited the uptake, synthesis, and oxidation of fatty acids, suppressed the tricarboxylic acid (TCA) cycle, and increased aerobic glycolysis levels in heart tissue after short-term TCC exposure. TCC also inhibited the nuclear peroxisome proliferator-activated receptor α (PPARα), confirming its inhibitory effects on fatty acid uptake and oxidation. Histopathology and other analyses further confirm that TCC altered mouse cardiac physiology and pathology, ultimately affecting normal cardiac metabolic function. We elucidate the molecular mechanisms of TCC-induced harmful effects on mouse cardiac metabolism and function from a new perspective, using metabonomics and bioinformatics analysis data.
Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.
2016-01-01
Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735
Characterisation of source-separated household waste intended for composting
Sundberg, Cecilia; Franke-Whittle, Ingrid H.; Kauppi, Sari; Yu, Dan; Romantschuk, Martin; Insam, Heribert; Jönsson, Håkan
2011-01-01
Large-scale composting of source-separated household waste has expanded in recent years in the Nordic countries. One problem can be low pH at the start of the process. Incoming biowaste at four composting plants was characterised chemically, physically and microbiologically. The pH of food waste ranged from 4.7 to 6.1 and organic acid concentration from 24 to 81 mmol kg−1. The bacterial diversity in the waste samples was high, with all samples dominated by Gammaproteobacteria, particularly Pseudomonas and Enterobacteria (Escherichia coli, Klebsiella, Enterobacter). Lactic acid bacteria were also numerically important and are known to negatively affect the composting process because the lactic acid they produce lowers the pH, inhibiting other bacteria. The bacterial groups needed for efficient composting, i.e. Bacillales and Actinobacteria, were present in appreciable amounts. The results indicated that start-up problems in the composting process can be prevented by recycling bulk material and compost. PMID:21075618
Characterisation of source-separated household waste intended for composting.
Sundberg, Cecilia; Franke-Whittle, Ingrid H; Kauppi, Sari; Yu, Dan; Romantschuk, Martin; Insam, Heribert; Jönsson, Håkan
2011-02-01
Large-scale composting of source-separated household waste has expanded in recent years in the Nordic countries. One problem can be low pH at the start of the process. Incoming biowaste at four composting plants was characterised chemically, physically and microbiologically. The pH of food waste ranged from 4.7 to 6.1 and organic acid concentration from 24 to 81 mmol kg(-1). The bacterial diversity in the waste samples was high, with all samples dominated by Gammaproteobacteria, particularly Pseudomonas and Enterobacteria (Escherichia coli, Klebsiella, Enterobacter). Lactic acid bacteria were also numerically important and are known to negatively affect the composting process because the lactic acid they produce lowers the pH, inhibiting other bacteria. The bacterial groups needed for efficient composting, i.e. Bacillales and Actinobacteria, were present in appreciable amounts. The results indicated that start-up problems in the composting process can be prevented by recycling bulk material and compost. Copyright © 2010 Elsevier Ltd. All rights reserved.
Harrington, Catriona; Reen, F Jerry; Mooij, Marlies J; Stewart, Fiona A; Chabot, Jean-Baptiste; Guerra, Antonio F; Glöckner, Frank O; Nielsen, Kristian F; Gram, Lone; Dobson, Alan D W; Adams, Claire; O'Gara, Fergal
2014-12-10
The search for new antimicrobial compounds has gained added momentum in recent years, paralleled by the exponential rise in resistance to most known classes of current antibiotics. While modifications of existing drugs have brought some limited clinical success, there remains a critical need for new classes of antimicrobial compound to which key clinical pathogens will be naive. This has provided the context and impetus to marine biodiscovery programmes that seek to isolate and characterize new activities from the aquatic ecosystem. One new antibiotic to emerge from these initiatives is the antibacterial compound tropodithietic acid (TDA). The aim of this study was to provide insight into the bioactivity of and the factors governing the production of TDA in marine Pseudovibrio isolates from a collection of marine sponges. The TDA produced by these Pseudovibrio isolates exhibited potent antimicrobial activity against a broad spectrum of clinical pathogens, while TDA tolerance was frequent in non-TDA producing marine isolates. Comparative genomics analysis suggested a high degree of conservation among the tda biosynthetic clusters while expression studies revealed coordinated regulation of TDA synthesis upon transition from log to stationary phase growth, which was not induced by TDA itself or by the presence of the C10-acyl homoserine lactone quorum sensing signal molecule.
Harrington, Catriona; Reen, F. Jerry; Mooij, Marlies J.; Stewart, Fiona A.; Chabot, Jean-Baptiste; Guerra, Antonio F.; Glöckner, Frank O.; Nielsen, Kristian F.; Gram, Lone; Dobson, Alan D. W.; Adams, Claire; O’Gara, Fergal
2014-01-01
The search for new antimicrobial compounds has gained added momentum in recent years, paralleled by the exponential rise in resistance to most known classes of current antibiotics. While modifications of existing drugs have brought some limited clinical success, there remains a critical need for new classes of antimicrobial compound to which key clinical pathogens will be naive. This has provided the context and impetus to marine biodiscovery programmes that seek to isolate and characterize new activities from the aquatic ecosystem. One new antibiotic to emerge from these initiatives is the antibacterial compound tropodithietic acid (TDA). The aim of this study was to provide insight into the bioactivity of and the factors governing the production of TDA in marine Pseudovibrio isolates from a collection of marine sponges. The TDA produced by these Pseudovibrio isolates exhibited potent antimicrobial activity against a broad spectrum of clinical pathogens, while TDA tolerance was frequent in non-TDA producing marine isolates. Comparative genomics analysis suggested a high degree of conservation among the tda biosynthetic clusters while expression studies revealed coordinated regulation of TDA synthesis upon transition from log to stationary phase growth, which was not induced by TDA itself or by the presence of the C10-acyl homoserine lactone quorum sensing signal molecule. PMID:25513851
Synthesis of ent-kaurane diterpene monoglycosides.
Chaturvedula, Venkata Sai Prakash; Klucik, Josef; Upreti, Mani; Prakash, Indra
2011-10-03
Synthesis of two ent-kaurane diterpene glycosides, steviol 19-O-β-D-glucopyranosiduronic acid (steviol glucuronide, 5), and 13-hydroxy ent-kaur-16-en-19-oic acid-β-D-glucopyranosyl ester (7) has been achieved from a common starting material, steviol, using phase transfer catalyst. Also, synthesis of an additional 17-nor-ent-kaurane glycoside, namely 13-methyl-16-oxo-17-nor-ent-kauran-19-oic acid-β-D-glucopyranosyl ester (10) was performed using the starting material isosteviol and similar synthetic methodology. Synthesis of all three steviol glycosides was performed using straightforward chemistry and their structures were characterized on the basis of 1D and 2D NMR as well as mass spectral (MS) data.
Mass spectrometry characterisation of fatty acids from metabolically engineered soybean seeds.
Murad, André M; Vianna, Giovanni R; Machado, Alex M; da Cunha, Nicolau B; Coelho, Cíntia M; Lacerda, Valquiria A M; Coelho, Marly C; Rech, Elibio L
2014-05-01
Improving the quality and performance of soybean oil as biodiesel depends on the chemical composition of its fatty acids and requires an increase in monounsaturated acids and a reduction in polyunsaturated acids. Despite its current use as a source of biofuel, soybean oil contains an average of 25 % oleic acid and 13 % palmitic acid, which negatively impacts its oxidative stability and freezing point, causing a high rate of nitrogen oxide emission. Gas chromatography and ion mobility mass spectrometry were conducted on soybean fatty acids from metabolically engineered seed extracts to determine the nature of the structural oleic and palmitic acids. The soybean genes FAD2-1 and FatB were placed under the control of the 35SCaMV constitutive promoter, introduced to soybean embryonic axes by particle bombardment and down-regulated using RNA interference technology. Results indicate that the metabolically engineered plants exhibited a significant increase in oleic acid (up to 94.58 %) and a reduction in palmitic acid (to <3 %) in their seed oil content. No structural differences were observed between the fatty acids of the transgenic and non-transgenic oil extracts.
Amino Acid Synthesis in Seafloor Environments on Icy Worlds
NASA Astrophysics Data System (ADS)
Flores, Erika; Barge, Laura; VanderVelde, David; Kallas, Kayo; Baum, Marc M.; Russell, Michael J.; Kanik, Isik
2016-10-01
In 2005, the Cassini mission detected plumes erupting from Enceladus' surface, containing carbon dioxide, methane, silica, and possibly ammonia. Subsequent laboratory experiments indicated that the silica particles in the plumes were generated under alkaline conditions and at moderate temperatures of ~90°C (Hsu et al., 2015); one scenario for such conditions would be the existence of alkaline (serpentinization-driven) hydrothermal activity within Enceladus. Alkaline vents are significant since they have been proposed as a likely environment for the emergence of metabolism on the early Earth (Russell et al. 2014) and thus could also provide a mechanism for origin of life on ocean worlds with a water-rock interface. Alkaline vents in an acidic, iron-containing ocean could produce mineral precipitates that could act as primitive enzymes or catalysts mediating organic reactions; for example, metal sulfides can catalyze the reductive amination of pyruvate to alanine (Novikov and Copley 2013). We have conducted experiments testing the synthesis of amino acids catalyzed by other iron minerals that might be expected to precipitate on the seafloor of early Earth or Enceladus. Preliminary results indicate that amino acids as well as other organic products can be synthesized in 1-3 days under alkaline hydrothermal conditions. We also find that the yield and type of organic products is highly dependent on pH and temperature, implying that understanding the specifics of the geochemical hydrothermal gradients on Enceladus (or other ocean worlds) will be significant in determining their potential for synthesizing building blocks for life.Hsu, H.-W. et al. (2015), Nature 519, 207-210.Russell, M. J. et al. (2014), Astrobiology, 14, 308-43.Novikov Y. and Copley S. D. (2013) PNAS 110, 33, 13283-13288.
Amarasekara, Ananda S
2016-05-25
Ionic liquid with acidic properties is an important branch in the wide ionic liquid field and the aim of this article is to cover all aspects of these acidic ionic liquids, especially focusing on the developments in the last four years. The structural diversity and synthesis of acidic ionic liquids are discussed in the introduction sections of this review. In addition, an unambiguous classification system for various types of acidic ionic liquids is presented in the introduction. The physical properties including acidity, thermo-physical properties, ionic conductivity, spectroscopy, and computational studies on acidic ionic liquids are covered in the next sections. The final section provides a comprehensive review on applications of acidic ionic liquids in a wide array of fields including catalysis, CO2 fixation, ionogel, electrolyte, fuel-cell, membrane, biomass processing, biodiesel synthesis, desulfurization of gasoline/diesel, metal processing, and metal electrodeposition.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Amber Wright; Edward Mausolf; Keri Campbell
2010-05-01
Acetohydroxamic acid (AHA) is an organic ligand planned for use in the Uranium Extraction (UREX) process. It reduces neptunium and plutonium, and the resultant hydrophilic complexes are separated from uranium by extraction with tributyl phosphate (TBP) in a hydrocarbon diluent. AHA undergoes hydrolysis to acetic acid which will impede the recycling of nitric acid. During recent discussions of the UREX process, it has been proposed to replace AHA by formohydroxamic acid (FHA). FHA will undergo hydrolysis to formic acid which is volatile, thus allowing the recycling of nitric acid. The reported reduction potentials of AHA and pertechnetate (TcO{sub 4}{sup -})more » indicated that it may be possible for AHA to reduce technetium, altering its fate in the fuel cycle. At UNLV, it has been demonstrated that TcO{sub 4}{sup -} undergoes reductive nitrosylation by AHA under a variety of conditions. The resulting divalent technetium is complexed by AHA to form the pseudo-octahedral trans-aquonitrosyl (diacetohydroxamic)-technetium(II) complex ([Tc{sup II}(NO)(AHA){sub 2}H{sub 2}O]{sup +}). In this paper, we are reporting the synthesis of FHA and its complex formation with technetium along with the characterization of FHA crystals achieved by NMR and IR spectroscopy. Two experiments were conducted to investigate the complexation of FHA with Tc and the results were compared with previous data on AHA. The first experiment involved the elution of Tc from a Reillex HP anion exchange resin, and the second one monitored the complexation of technetium with FHA by UV-visible spectrophotometry.« less
Protecting‐Group‐Free Amidation of Amino Acids using Lewis Acid Catalysts
Sabatini, Marco T.; Karaluka, Valerija; Lanigan, Rachel M.; Boulton, Lee T.; Badland, Matthew
2018-01-01
Abstract Amidation of unprotected amino acids has been investigated using a variety of ‘classical“ coupling reagents, stoichiometric or catalytic group(IV) metal salts, and boron Lewis acids. The scope of the reaction was explored through the attempted synthesis of amides derived from twenty natural, and several unnatural, amino acids, as well as a wide selection of primary and secondary amines. The study also examines the synthesis of medicinally relevant compounds, and the scalability of this direct amidation approach. Finally, we provide insight into the chemoselectivity observed in these reactions. PMID:29505683
Zhang, Qingju; Howell, P Lynne; Overkleeft, Herman S; Filippov, Dmitri V; van der Marel, Gijsbert A; Codée, Jeroen D C
2017-10-10
Described is the first synthesis of guanosine diphosphate mannuronic acid (GDP-ManA), the sugar donor used by algae and bacteria for the production of alginate, an anionic polysaccharide composed of β-d-mannuronic acid (ManA) and α-l-guluronic acid (GulA). Understanding the biosynthesis of these polyanionic polysaccharides on the molecular level, opens up avenues to use and modulate the biosynthesis machinery for biotechnological and therapeutic applications. The synthesis reported here delivers multi-milligram amounts of the GDP-ManA donor that can be used to study the polymerase (Alg8 in Pseudomonas aeruginosa) that generates the poly-ManA chain. Also reported is the assembly of two close analogues of GDP-ManA: the first bears a C-4-O-methyl group, while the second has been deoxygenated at this position. Both molecules may be used as "chain stoppers" in future enzymatic ManA polymerisation reactions. The crucial pyrophosphate linkage of the GDP-mannuronic acids has been constructed by the phosphorylation of the appropriate ManA-1-phosphates with a guanosine phosphoramidite. Copyright © 2017 Elsevier Ltd. All rights reserved.
Fernie, Alisdair R.; Stitt, Mark
2015-01-01
Protein synthesis and degradation represent substantial costs during plant growth. To obtain a quantitative measure of the rate of protein synthesis and degradation, we supplied 13CO2 to intact Arabidopsis (Arabidopsis thaliana) Columbia-0 plants and analyzed enrichment in free amino acids and in amino acid residues in protein during a 24-h pulse and 4-d chase. While many free amino acids labeled slowly and incompletely, alanine showed a rapid rise in enrichment in the pulse and a decrease in the chase. Enrichment in free alanine was used to correct enrichment in alanine residues in protein and calculate the rate of protein synthesis. The latter was compared with the relative growth rate to estimate the rate of protein degradation. The relative growth rate was estimated from sequential determination of fresh weight, sequential images of rosette area, and labeling of glucose in the cell wall. In an 8-h photoperiod, protein synthesis and cell wall synthesis were 3-fold faster in the day than at night, protein degradation was slow (3%–4% d−1), and flux to growth and degradation resulted in a protein half-life of 3.5 d. In the starchless phosphoglucomutase mutant at night, protein synthesis was further decreased and protein degradation increased, while cell wall synthesis was totally inhibited, quantitatively accounting for the inhibition of growth in this mutant. We also investigated the rates of protein synthesis and degradation during leaf development, during growth at high temperature, and compared synthesis rates of Rubisco large and small subunits of in the light and dark. PMID:25810096
Latest development in the synthesis of ursodeoxycholic acid (UDCA): a critical review
Tonin, Fabio
2018-01-01
Ursodeoxycholic acid (UDCA) is a pharmaceutical ingredient widely used in clinics. As bile acid it solubilizes cholesterol gallstones and improves the liver function in case of cholestatic diseases. UDCA can be obtained from cholic acid (CA), which is the most abundant and least expensive bile acid available. The now available chemical routes for the obtainment of UDCA yield about 30% of final product. For these syntheses several protection and deprotection steps requiring toxic and dangerous reagents have to be performed, leading to the production of a series of waste products. In many cases the cholic acid itself first needs to be prepared from its taurinated and glycilated derivatives in the bile, thus adding to the complexity and multitude of steps involved of the synthetic process. For these reasons, several studies have been performed towards the development of microbial transformations or chemoenzymatic procedures for the synthesis of UDCA starting from CA or chenodeoxycholic acid (CDCA). This promising approach led several research groups to focus their attention on the development of biotransformations with non-pathogenic, easy-to-manage microorganisms, and their enzymes. In particular, the enzymatic reactions involved are selective hydrolysis, epimerization of the hydroxy functions (by oxidation and subsequent reduction) and the specific hydroxylation and dehydroxylation of suitable positions in the steroid rings. In this minireview, we critically analyze the state of the art of the production of UDCA by several chemical, chemoenzymatic and enzymatic routes reported, highlighting the bottlenecks of each production step. Particular attention is placed on the precursors availability as well as the substrate loading in the process. Potential new routes and recent developments are discussed, in particular on the employment of flow-reactors. The latter technology allows to develop processes with shorter reaction times and lower costs for the chemical and
Sahu, Supriya; Ghosh, Surajit Kumar; Kalita, Junmoni; Dutta, Mayurakhi; Bhat, Hans Raj
2016-04-01
Existing antifolate antimalarial drugs have shown resistance due to the mutations at some amino acid positions of Plasmodium falciparum DHFR-TS. In the present study, to overcome this resistance, a new series of hybrid 4-aminoquinoline-triazine derivatives were designed and docked into the active site of Pf-DHFR-TS (PDB i.d. 1J3K) using validated CDOCKER protocol. Binding energy was calculated by applying CHARMm forcefield. Binding energy and the pattern of interaction of the docked compounds were analysed. Fifteen compounds were selected for synthesis based on their binding energy values and docking poses. Synthesized compounds were characterised by FTIR, (1)H NMR, (13)C NMR, mass spectroscopy and were screened for antimalarial activity against 3D7 strain of Plasmodium falciparum. Copyright © 2016 Elsevier Inc. All rights reserved.
Barrows, Brian R; Timlin, Maureen T; Parks, Elizabeth J
2005-09-01
The present study quantified dietary fatty acid flux in healthy men (n = 6) who were fed a liquid formula through a duodenal feeding tube (continuous feeding group) or who consumed the same formula in meals (meal feeding group). A triacylglycerol (TAG) stable isotope was added to the formula to determine the entry of dietary fatty acids into the serum and its clearance to the liver and resecretion into serum via VLDL. The contribution of dietary fatty acids to serum nonesterified fatty acids (NEFAs) was higher with meal feeding (24.4 +/- 2.6%) compared with continuous feeding (10.8 +/- 2.9%, P < 0.01) and, when multiplied by the NEFA concentration, resulted in similar absolute fatty acid spillover. Diet-derived NEFAs subsequently represented 10.6 +/- 1.2% and 4.7 +/- 1.3% of hepatic VLDL-TAG (meal feeding vs. continuous feeding, respectively, P = 0.004). Chylomicron remnant uptake by the liver contributed 9.3 +/- 1.9% of fatty acids to hepatic VLDL-TAG synthesis with meal feeding compared with continuous feeding (4.4 +/- 0.8%, P < 0.03). These data suggest that the extent of dietary fatty acid recycling via serum NEFAs and VLDL-TAG is determined by the rate of delivery of dietary fat to the intestine. The inefficient removal of dietary fat from the circulation may maintain VLDL-TAG production but may also result in prolonged postprandial lipemia.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.
1981-08-01
In this paper, isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO 2 fixation for more than 60 hours. The incorporation of 14CO 2 under saturating CO 2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acidsmore » indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. Finally, the data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis.« less
Kinetics of enzymatic synthesis of liquid wax ester from oleic acid and oleyl alcohol.
Radzi, Salina Mat; Mohamad, Rosfarizan; Basri, Mahiran; Salleh, Abu Bakar; Ariff, Arbakariya; Rahman, Mohammad Basyaruddin Abdul; Rahman, Raja Noor Zaliha Raja Abdul
2010-01-01
The kinetics of wax ester synthesis from oleic acid and oleyl alcohol using immobilized lipase from Candida antartica as catalyst was studied with different types of impeller (Rushton turbine and AL-hydrofoil) to create different mixing conditions in 2l stirred tank reactor. The effects of catalyst concentration, reaction temperature, and impeller tip speed on the synthesis were also evaluated. Rushton turbine impeller exhibited highest conversion rate at lower impeller tip speed as compared to AL-hydrofoil impeller. A second-order reversible kinetic model from single progress curve for the prediction of fractional conversion at given reaction time was proposed and the corresponding kinetic parameter values were calculated by non-linear regression method. The results from the simulation using the proposed model showed satisfactory agreement with the experimental data. Activation energy shows a value of 21.77 Kcal/mol. The thermodynamic parameters of the process, enthalpy and entropy, were 21.15 Kcal/mol and 52.07 cal/mol.K, respectively.
Campeotto, Ivan; Percy, Matthew G.; MacDonald, James T.; Förster, Andreas; Freemont, Paul S.; Gründling, Angelika
2014-01-01
Lipoteichoic acid (LTA) is an important cell wall component required for proper cell growth in many Gram-positive bacteria. In Listeria monocytogenes, two enzymes are required for the synthesis of this polyglycerolphosphate polymer. The LTA primase LtaPLm initiates LTA synthesis by transferring the first glycerolphosphate (GroP) subunit onto the glycolipid anchor and the LTA synthase LtaSLm extends the polymer by the repeated addition of GroP subunits to the tip of the growing chain. Here, we present the crystal structures of the enzymatic domains of LtaPLm and LtaSLm. Although the enzymes share the same fold, substantial differences in the cavity of the catalytic site and surface charge distribution contribute to enzyme specialization. The eLtaSLm structure was also determined in complex with GroP revealing a second GroP binding site. Mutational analysis confirmed an essential function for this binding site and allowed us to propose a model for the binding of the growing chain. PMID:25128528
Mandal, Pijus Kumar; Kaluarachchi, Kumar K; Ogrin, Douglas; Bott, Simon G; McMurray, John S
2005-11-25
[reaction: see text] Azabicyclo[X.Y.0]alkane amino acids are rigid dipeptide mimetics that are useful tools for structure-activity studies in peptide-based drug discovery. Herein, we report an efficient synthesis of three diastereomers of 9-tert-butoxycarbonyl-2-oxo-3-(N-tert-butoxycarbonylamino)-1-azabicyclo[4.3.0]nonane (3S,6S,9S, 3S,6R,9R, and 3S,6R,9S). Methyl N-Boc-pyroglutamate is cleaved with vinylmagnesium bromide to produce an acyclic gamma-vinyl ketone. Michael addition of N-diphenylmethyleneglycine tert-butyl ester produces the N-Boc-delta-oxo-alpha,omega-diaminoazelate intermediate, which, on hydrogenloysis, gives the fused ring system. Acidolytic deprotection followed by Fmoc-protection provided building blocks suitable for solid-phase synthesis.
Fillion, Eric; Wilsily, Ashraf
2006-03-08
The asymmetric synthesis of all-carbon benzylic quaternary stereocenters has been successfully achieved through copper-catalyzed addition of dialkylzinc reagents to 5-(1-arylalkylidene) and 5-(dihydroindenylidene) Meldrum's acids in the presence of phosphoramidite ligand. The resulting benzyl-substituted Meldrum's acids and 1,1-disubstituted indanes were obtained in good yields and up to 99% ee. The significance of substituting the position para, meta, and ortho to the electrophilic benzylic center was highlighted. A benzyl Meldrum's acid product was further transformed to a 3,3-disubstituted 1-indanone and a beta,beta-disubstituted pentanoic acid.
Structural characterisation of some vanillic Mannich bases: Experimental and theoretical study
NASA Astrophysics Data System (ADS)
Petrović, Vladimir P.; Simijonović, Dušica; Novaković, Sladjana B.; Bogdanović, Goran A.; Marković, Svetlana; Petrović, Zorica D.
2015-10-01
In this paper, synthesis and structural determination of 2-[1-(N-4-fluorophenylamino)-1-(4-hydroxy-3-methoxyphenyl)]methylcyclohexanone (MB-F) is presented. To determine the structure of this new compound, IR and NMR spectral characterisation was performed experimentally and theoretically. Simulation of spectral data was carried out using three functionals: B3LYP, B3LYP-D2, and M06-2X. The results obtained for MB-F were compared to those attained for similar, known compound 2-[1-(N-phenylamino)-1-(4-hydroxy-3-methoxyphenyl)]methylcyclohexanone (MB-H), whose crystal structure is presented here. Taking into account all experimental and theoretical findings, the structure of MB-F was proposed.
Bond, Thomas E H; Sorenson, Alanna E; Schaeffer, Patrick M
2017-06-01
Burkholderia pseudomallei (Bp) is the causative agent of melioidosis. The bacterium is responsible for 20% of community-acquired sepsis cases and 40% of sepsis-related mortalities in northeast Thailand, and is intrinsically resistant to aminoglycosides, macrolides, rifamycins, cephalosporins, and nonureidopenicillins. There is no vaccine and its diagnosis is problematic. Biotin protein ligase (BirA) which is essential for fatty acid synthesis has been proposed as a drug target in bacteria. Very few bacterial BirA have been characterized, and a better understanding of these enzymes is necessary to further assess their value as drug targets. BirA within the Burkholderia genus have not yet been investigated. We present for the first time the cloning, expression, purification and functional characterisation of the putative Bp BirA and orthologous B. thailandensis (Bt) biotin carboxyl carrier protein (BCCP) substrate. A GFP-tagged Bp BirA was produced and applied for the development of a high-throughput (HT) assay based on our differential scanning fluorimetry of GFP-tagged proteins (DSF-GTP) principle as well as an electrophoretic mobility shift assay. Our biochemical data in combination with the new HT DSF-GTP and biotinylation activity assay could facilitate future drug screening efforts against this drug-resistant organism. Copyright © 2017 Elsevier GmbH. All rights reserved.
Schneider, Séverine; Ftouni, Hussein; Niu, Songlin; Schmitt, Martine; Simonin, Frédéric; Bihel, Frédéric
2015-07-07
We report a selective ruthenium catalyzed reduction of tertiary amides on the side chain of Fmoc-Gln-OtBu derivatives, leading to innovative unnatural α,β or γ-amino acids functionalized with tertiary amines. Rapid and scalable, this process allowed us to build a library of basic unnatural amino acids at the gram-scale and directly usable for liquid- or solid-phase peptide synthesis. The diversity of available tertiary amines allows us to modulate the physicochemical properties of the resulting amino acids, such as basicity or hydrophobicity.
Gotsbacher, Michael P; Telfer, Thomas J; Witting, Paul K; Double, Kay L; Finkelstein, David I; Codd, Rachel
2017-07-19
Parkinson's disease (PD) is a neurodegenerative disorder characterised by the death of dopaminergic neurons in the substantia nigra pars compacta (SNpc) region of the brain and formation of α-synuclein-containing intracellular inclusions. Excess intraneuronal iron in the SNpc increases reactive oxygen species (ROS), which identifies removing iron as a possible therapeutic strategy. Desferrioxamine B (DFOB, 1) is an iron chelator produced by bacteria. Its high Fe(iii) affinity, water solubility and low chronic toxicity is useful in removing iron accumulated in plasma from patients with transfusion-dependent blood disorders. Here, lipophilic analogues of DFOB with increased potential to cross the blood-brain barrier (BBB) have been prepared by conjugating ancillary compounds onto the amine terminus. The ancillary compounds included the antioxidants rac-6-hydroxy-2,5,7,8-tetramethylchromane-2-carboxylic acid (rac-trolox, rac-TLX (a truncated vitamin E variant)), R-TLX, S-TLX, methylated derivatives of 3-(6-hydroxy-2-methylchroman-2-yl)propionic acid (α-CEHC, γ-CEHC, δ-CEHC), or 4-(5-hydroxy-3-methyl-1H-pyrazol-1-yl)benzoic acid (carboxylic acid derivative of edaravone, EDA). Compounds 2-8 could have dual function in attenuating ROS by chelating Fe(iii) and via the antioxidant ancillary group. A conjugate between DFOB and an ancillary unit without antioxidant properties (3,5-dimethyladamantane-1-carboxylic acid (AdA dMe )) was included (9). Compounds 2-9 were more lipophilic (log P -0.05 to 3.39) than DFOB (log P -2.62) and showed an average plasma protein binding 6 times greater than DFOB. The ABTS˙ + radical assay indicated 2-8 had antioxidant activity ascribable to the ancillary fragment. Administration of 2 and 9 in the mouse model of PD using the neurotoxin prodrug 1-methyl-4-phenyl-1,2,3,6-tetrahydropyridine (MPTP), which recapitulates elevated iron of human PD, resulted in significant neuronal protection (p < 0.05; up to 89% of that in non
Danil de Namor, Angela F; Al Nuaim, Maan; Villanueva Salas, Jose A; Bryant, Sophie; Howlin, Brendan
2017-03-30
The synthesis and characterisation of a partially substituted calix[4]arene, namely, 5,11,17,23-tetra-tert-butyl,25,27-bis[aminoethoxy] 26,28-dihydroxycalix[4]arene are reported. Its interaction with commonly used pharmaceuticals (clofibric acid, diclofenac and aspirin) was investigated by spectroscopic ( 1 H NMR and UV), electrochemical (conductance measurements) and thermal (titration calorimetry) techniques. It is concluded on the basis of the experimental work and molecular simulation studies that the receptor interacts selectively with these drugs. Preliminary studies on the selective extraction of these pharmaceuticals from water by the calix receptor are reported and the potential for a carrier mediated sensor based on this ligand for 'on site' monitoring of pharmaceuticals is discussed. Copyright © 2017 Elsevier B.V. All rights reserved.
Abraham, R T; Benson, L M; Jardine, I
1983-10-01
Previous studies have shown that 6-thiopurine is metabolically activated by hepatic cytochrome P-450 to an intermediate capable of binding to proteins by a mixed disulfide linkage. The identity of the active metabolite was postulated to be purine-6-sulfenic acid. In the present report, we describe the synthesis of the sulfenic acid derivatives of 6-thiopurine and two structurally similar compounds, 9-methyl-6-thiopurine and 4-mercapto-1H-pyrazolo[3,4-d]-pyrimidine. The unusual pH-dependent stability profiles of these compounds in buffered aqueous media are presented and explained on the basis of a disproportionation mechanism of sulfenic acid decomposition. Studies with radiolabeled purine-6-sulfenic acid demonstrate that this species binds directly to hepatic microsomal protein. These results support the proposed involvement of purine-6-sulfenic acid in the metabolic activation and tissue binding of 6-thiopurine.
Knudsen, J
1979-01-01
The concentration of medium-chain acyl thioester hydrolase and of fatty acid synthetase was determined by rocket immunoelectrophoresis in nine different particle-free supernatant fractions from lactating-rabbit mammary gland. The molar ratio of the hydrolase to fatty acid synthetase was 1.99 +/- 0.66 (mean +/- S.D.). A rate-limiting concentration of malonyl-CoA was required to ensure the predominant synthesis of medium-chain fatty acids when 2 mol of the hydrolase was added per mol of fatty acid synthetase. The interaction of the hydrolase with fatty acid synthetase was concentration-dependent, though an optimum concentration of hydrolase to synthetase could not be obtained. The lactating-rabbit mammary gland hydrolase altered the pattern of fatty acids synthesized by fatty acid synthetases prepared from cow, goat, sheep and rabbit lactating mammary glands, rabbit liver and cow adipose tissue. PMID:574008
Nayak, Debasis; Ashe, Sarbani; Rauta, Pradipta Ranjan; Nayak, Bismita
2015-10-01
Green synthesis of metallic nanoparticles has lured the world from the chemical and physical approaches owing to its rapid, non-hazardous and economic aspect of production mechanism. In this study, silver nanoparticles (AgNPs) were synthesised using petal extracts of Hibiscus rosa-sinensis. The AgNPs displayed characteristic surface plasmon resonance peak at around 421 nm having a mean particle size of 76.25±0.17 nm and carried a charge of -41±0.2 mV. The X-ray diffraction patterns displayed typical peaks of face centred cubic crystalline silver. The surface morphology was characterised by scanning electron microscopy and atomic force microscopy. Fourier transform infrared spectroscopy studies confirmed the surface modifications of the functional groups for the synthesis of AgNPs. Furthermore, the synthesised AgNPs displayed proficient antimicrobial activity against pathogenic strains of Vibrio cholerae, Escherichia coli, Klebsiella pneumoniae and Staphylococcus aureus.
Metabolism of trans-3-hexadecenoic acid in broad bean.
Harwood, J L; James, A T
1975-01-02
1. Broad bean (Vicia faba) leaves contain rather high concentrations (about 4% of total fatty acids) of the trans-3-hexadecenoic acid. 2. Amounts of the acid increase with the age of the leaves and are absent from etiolated tissue. 3. Changes in the levels of trans-delta-4-hexadecenoic acid can be produced by subjecting the intact plants to various light/dark periods. 4. Chloroplasts isolated from broad-bean leaves show high rates of fatty acid synthesis from [1-14C]acetate. Synthesis is dependent on coenzyme A and ATP but is insensitive to the addition of exogenous acyl carrier protein. 5. The pattern of acids made includes about 20% palmitic, 5% hexadeconoic, 10% stearic and 60% oleic. trans-3-Hexadecenoic acid synthesis was most active in chloroplasts from plants exposed to the dark for 5 days and light for 3 days. 6. Arsenite addition inhibited stearate formation by isolated chloroplasts but resulted in a two-fold stimulation of overall synthesis. 7. The rate of fatty acid synthesis by isolated chloroplasts paralleled the changes in endogenous trans-3-hexadecenoic acid levels in the leaves from which they were isolated.
Qian, Keduo; Kuo, Reen-Yun; Chen, Chin-Ho; Huang, Li; Morris-Natschke, Susan L; Lee, Kuo-Hsiung
2010-04-22
In our continuing study of triterpene derivatives as potent anti-HIV agents, different C-3 conformationally restricted betulinic acid (BA, 1) derivatives were designed and synthesized in order to explore the conformational space of the C-3 pharmacophore. 3-O-Monomethylsuccinyl-betulinic acid (MSB) analogues were also designed to better understand the contribution of the C-3' dimethyl group of bevirimat (2), the first-in-class HIV maturation inhibitor, which is currently in phase IIb clinical trials. In addition, another triterpene skeleton, moronic acid (MA, 3), was also employed to study the influence of the backbone and the C-3 modification toward the anti-HIV activity of this compound class. This study enabled us to better understand the structure-activity relationships (SAR) of triterpene-derived anti-HIV agents and led to the design and synthesis of compound 12 (EC(50): 0.0006 microM), which displayed slightly better activity than 2 as a HIV-1 maturation inhibitor.
Synthesis and Surface Activity of Cationic Amino Acid-Based Surfactants in Aqueous Solution.
Greber, Katarzyna E
2017-01-01
I studied the possibility of using amino acid-based surfactants as emulsifiers at the same time as preservatives. Fourteen lipopeptides were synthesized employing a solid phase peptide synthesis procedure. All compounds were designed to be positively charged from +1 to +4 and acylated with fatty acid chain-palmitic and miristic. The surface activity of the obtained lipopeptides was tested using a semi-automatic tensiometer to calculate parameters describing the behavior of lipopeptides in the air/water interface. Such parameters as CMC, surface tension at the CMC point ( σ CMC ), effectiveness ( π CMC ), and efficiency (pC20) were measured. Emulsifying properties of all lipopeptides were also examined. The studies reveal that the surface active properties of synthesized compounds strongly depend on the length of alkyl chains as well as on the composition of amino acid polar heads. The critical micelle concentration decreases with increasing alkyl chain length of lipopeptides with the same polar head. The effectiveness and efficiency decrease when the number of amino acids in the polar head increases. All lipopeptides established a very weak emulsification power and created unstable water/Miglyol 812 and water/paraffin oil emulsions. Results suggest that lipopeptides cannot be used as emulsifiers; nonetheless, it is possible to use them as auxiliary surfactants with disinfectant properties in combination with more potent emulsifiers.
Aparecida de França, Suélem; Pavani Dos Santos, Maísa; Nunes Queiroz da Costa, Roger Vinícius; Froelich, Mendalli; Buzelle, Samyra Lopes; Chaves, Valéria Ernestânia; Giordani, Morenna Alana; Pereira, Mayara Peron; Colodel, Edson Moleta; Marlise Balbinotti Andrade, Cláudia; Kawashita, Nair Honda
2014-04-01
The aim of this study was to evaluate glucose uptake and the contribution of glucose to fatty acid (FA) synthesis and the glycerol-3-phosphate (G3P) of triacylglycerol synthesis by interscapular brown adipose tissue (IBAT) of low-protein, high-carbohydrate (LPHC) diet-fed rats. LPHC (6% protein; 74% carbohydrate) or control (17% protein; 63% carbohydrate) diets were administered to rats (∼ 100 g) for 15 d. Total FA and G3P synthesis and the synthesis of FA and G3P from glucose were evaluated in vivo by (3)H2O and (14)C-glucose. Sympathetic neural contribution for FA synthesis was evaluated by comparing the synthesis in denervated (7 d before) IBAT with that of the contralateral innervated side. The insulin signaling and β3 adrenergic receptor (β3-AR) contents, as well as others, were determined by Western blot (Student's t test or analysis of variance; P ≤ 0.05). Total FA synthesis in IBAT was 133% higher in the LPHC group and was reduced 85% and 70% by denervation for the LPHC and control groups, respectively. Glucose uptake was 3.5-fold higher in the IBAT of LPHC rats than in that of the control rats, and the contribution of glucose to the total FA synthesis increased by 12% in control rats compared with 18% in LPHC rats. The LPHC diet increased the G3P generation from glucose by 270% and the insulin receptor content and the p-AKT insulin stimulation in IBAT by 120% and reduced the β3-AR content by 50%. The LPHC diet stimulated glucose uptake, both the total rates and the rates derived from glucose-dependent FA and G3P synthesis, by increasing the insulin sensitivity and the sympathetic flux, despite a reduction in the β3-AR content. Copyright © 2014 Elsevier Inc. All rights reserved.
Salum, María L; Itovich, Lucia M; Erra-Balsells, Rosa
2013-11-01
Successful application of matrix-assisted laser desorption/ionization (MALDI) MS started with the introduction of efficient matrices such as cinnamic acid derivatives (i.e. 3,5-dimethoxy-4-hydroxycinnamic acid, SA; α-cyano-4-hydroxycinnamic acid). Since the empirical founding of these matrices, other commercial available cinnamic acids with different nature and location of substituents at benzene ring were attempted. Rational design and synthesis of new cinnamic acids have been recently described too. Because the presence of a rigid double bond in its molecule structure, cinnamic acids can exist as two different geometric isomers, the E-form and Z-form. Commercial available cinnamic acids currently used as matrices are the geometric isomers trans or E (E-cinnamic and trans-cinnamic acids). As a new rational design of MALDI matrices, Z-cinnamic acids were synthesized, and their properties as matrices were studied. Their performance was compared with that of the corresponding E-isomer and classical crystalline matrices (3,5-dihydroxybenzoic acid; norharmane) in the analysis of neutral/sulfated carbohydrates. Herein, we demonstrate the outstanding performance for Z-SA. Sulfated oligosaccharides were detected in negative ion mode, and the dissociation of sulfate groups was almost suppressed. Additionally, to better understand the quite different performance of each geometric isomer as matrix, the physical and morphological properties as well as the photochemical stability in solid state were studied. The influence of the E/Z photoisomerization of the matrix during MALDI was evaluated. Finally, molecular modeling (density functional theory study) of the optimized geometry and stereochemistry of E-cinnamic and Z-cinnamic acids revealed some factors governing the analyte-matrix interaction. Copyright © 2013 John Wiley & Sons, Ltd.
Synthesis and pharmacological evaluation of the stereoisomers of 3-carba cyclic-phosphatidic acid.
Gupte, Renuka; Siddam, Anjaih; Lu, Yan; Li, Wei; Fujiwara, Yuko; Panupinthu, Nattapon; Pham, Truc-Chi; Baker, Daniel L; Parrill, Abby L; Gotoh, Mari; Murakami-Murofushi, Kimiko; Kobayashi, Susumu; Mills, Gordon B; Tigyi, Gabor; Miller, Duane D
2010-12-15
Cyclic phosphatidic acid (CPA) is a naturally occurring analog of lysophosphatidic acid (LPA) in which the sn-2 hydroxy group forms a five-membered ring with the sn-3 phosphate. Here, we describe the synthesis of R-3-CCPA and S-3-CCPA along with their pharmacological properties as inhibitors of lysophospholipase D/autotaxin, agonists of the LPA(5) GPCR, and blockers of lung metastasis of B16-F10 melanoma cells in a C57BL/6 mouse model. S-3CCPA was significantly more efficacious in the activation of LPA(5) compared to the R-stereoisomer. In contrast, no stereoselective differences were found between the two isomers toward the inhibition of autotaxin or lung metastasis of B16-F10 melanoma cells in vivo. These results extend the potential utility of these compounds as potential lead compounds warranting evaluation as cancer therapeutics. Copyright © 2010 Elsevier Ltd. All rights reserved.
Synthesis and stereochemical analysis of β-nitromethane substituted γ-amino acids and peptides.
Ganesh Kumar, Mothukuri; Mali, Sachitanand M; Gopi, Hosahudya N
2013-02-07
The high diastereoselectivity in the Michael addition of nitromethane to α,β-unsaturated γ-amino esters, crystal conformations of β-nitromethane substituted γ-amino acids and peptides are studied. Results suggest that the N-Boc protected amide NH, conformations of α,β-unsaturated γ-amino esters and alkyl side chains play a crucial role in dictating the high diastereoselectivity of nitromethane addition to E-vinylogous amino esters. Investigation of the crystal conformations of both α,β-unsaturated γ-amino esters and the Michael addition products suggests that an H-C(γ)-C(β)=C(α) eclipsed conformer of the unsaturated amino ester leads to the major (anti) product compared to that of an N-C(γ)-C(β)=C(α) eclipsed conformer. The major diastereomers were separated and subjected to the peptide synthesis. The single crystal analysis of the dipeptide containing β-nitromethane substituted γ-amino acids reveals a helical type of folded conformation with an isolated H-bond involving a nine-atom pseudocycle.
Yao, Jiangwei; Dodson, V. Joshua; Frank, Matthew W.; Rock, Charles O.
2015-01-01
The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Lyu, Huisheng; Liu, Jiatao; Chen, Yifei; Li, Guiming; Jiang, Haoxi; Zhang, Minhua
2018-03-07
Developing a new type of low-cost and high-efficiency non-noble metal catalyst is beneficial for industrially massive synthesis of alcohols from carboxylic acids which can be obtained from renewable biomass. In this work, the effect of active oxygen vacancies on ethanol synthesis from acetic acid hydrogenation over defective In 2 O 3 (110) surfaces has been studied using periodic density functional theory (DFT) calculations. The relative stabilities of six surface oxygen vacancies from O v1 to O v6 on the In 2 O 3 (110) surface were compared. D1 and D4 surfaces with respective O v1 and O v4 oxygen vacancies were chosen to map out the reaction paths from acetic acid to ethanol. A reaction cycle mechanism between the perfect and defective states of the In 2 O 3 surface was found to catalyze the formation of ethanol from acetic acid hydrogenation. By H 2 reduction the oxygen vacancies on the In 2 O 3 surface play key roles in promoting CH 3 COO* hydrogenation and C-O bond breaking in acetic acid hydrogenation. The acetic acid, in turn, benefits the creation of oxygen vacancies, while the C-O bond breaking of acetic acid refills the oxygen vacancy and, thereby, sustains the catalytic cycle. The In 2 O 3 based catalysts were shown to be advantageous over traditional noble metal catalysts in this paper by theoretical analysis.
Le, Quang Anh Tuan; Kim, Hee Gon; Kim, Yong Hwan
2018-09-01
The electro-biocatalytic conversion of CO 2 into formic acid using whole-cell and isolated biocatalysts is useful as an alternative route for CO 2 sequestration. In this study, Shewanella oneidensis MR-1 (S. oneidensis MR-1), a facultative aerobic bacterium that has been extensively studied for its utility as biofuel cells as well as for the detoxification of heavy metal oxides (i.e., MnO 2 , uranium), has been applied for the first time as a whole-cell biocatalyst for formic acid synthesis from gaseous CO 2 and electrons supplied from an electrode. S. oneidensis MR-1, when aerobically grown in Luria-Bertani (LB) medium, exhibited its ability as a whole-cell biocatalyst for the conversion of CO 2 into formic acid with moderate productivity of 0.59 mM h -1 for 24 h. In addition, an optimization of growth conditions of S. oneidensis MR-1 resulted in a remarkable increase in productivity. The CO 2 reduction reaction catalyzed by S. oneidensis MR-1, when anaerobically grown in newly optimized LB medium supplemented with fumarate and nitrate, exhibited 3.2-fold higher productivity (1.9 mM h -1 for 72 h) compared to that grown aerobically in only LB medium. Furthermore, the average conversion rate of formic acid synthesis catalyzed by S. oneidensis MR-1 when grown in the optimal medium over a period of 72 h was 3.8 mM h -1 g -1 wet-cell, which is 9.6-fold higher than that catalyzed by Methylobacterium extorquens AM1 whole-cells in our previous study. Copyright © 2018 Elsevier Inc. All rights reserved.
Sawada, Daijo; Ogawa, Takaaki; Miyake, Minoru; Hasui, Yoshinori; Yamaguchi, Fuminori; Izumori, Ken; Tokuda, Masaaki
2015-01-01
We examined and compared the inhibitory effects of D-tagatose on the growth, acid production, and water-insoluble glucan synthesis of GS5, a bacterial strain of Streptococcus mutans, with those of xylitol, D-psicose, L-psicose and L-tagatose. GS5 was cultured for 12h in a medium containing 10% (w/v) of xylitol, D-psicose, L-psicose, D-tagatose or L-tagatose, and the inhibitory effect of GS5 growth was assessed. Each sugar showed different inhibitory effects on GS5. Both D-tagatose and xylitol significantly inhibited the acid production and water-insoluble glucan synthesis of GS5 in the presence of 1% (w/v) sucrose. However, the inhibitory effect of acid production by D-tagatose was significantly stronger than that of xylitol in presence of sucrose.
Spectroscopic characterisation of interaction of ferulic acid with aldehyde dehydrogenase (ALDH).
Kolawole, Ayodele O; Agaba, Ruth J; Oluwole, Matthew O
2017-05-01
Interaction of a pharmacological important phenolic, ferulic acid, with Aldehyde dehydrogenase (ALDH) at the simulative pH condition, was studied using spectroscopic approach. Ferulic acid caused a decrease in the fluorescence intensity formed from ALDH-ferulic acid complex resulting in mixed inhibition of ALDH activity (IC 50 =30.65μM). The intrinsic quenching was dynamic and induced altered conformation of ALDH and made the protein less compact but might not unfold it. ALDH has two binding sites for ferulic acid at saturating concentrations having association constant of 1.35×10 3 Lmol -1 and a dissociation constant of 9.7×10 7 Lmol -1 at 25°C indicating ALDH-ferulic acid complex formation is more favourable than its dissociation. The interaction was not spontaneous and endothermic and suggests the involvement of hydrophobic interactions with a FRET binding distance of 4.49nm. Change in pH near and far from isoelectric points of ferulic acid did not affect the bonding interaction. Using trehalose as viscosogen, the result from Stoke-Einstein hypothesis showed that ferulic acid-ALDH binding and dissociation equilibrium was diffusion controlled. These results clearly suggest the unique binding properties and lipophilicity influence of ferulic acid. Copyright © 2017 Elsevier B.V. All rights reserved.
Acid-Base Chemistry of White Wine: Analytical Characterisation and Chemical Modelling
Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe
2012-01-01
A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic “wine” especially adapted for testing. PMID:22566762
Acid-base chemistry of white wine: analytical characterisation and chemical modelling.
Prenesti, Enrico; Berto, Silvia; Toso, Simona; Daniele, Pier Giuseppe
2012-01-01
A chemical model of the acid-base properties is optimized for each white wine under study, together with the calculation of their ionic strength, taking into account the contributions of all significant ionic species (strong electrolytes and weak one sensitive to the chemical equilibria). Coupling the HPLC-IEC and HPLC-RP methods, we are able to quantify up to 12 carboxylic acids, the most relevant substances responsible of the acid-base equilibria of wine. The analytical concentration of carboxylic acids and of other acid-base active substances was used as input, with the total acidity, for the chemical modelling step of the study based on the contemporary treatment of overlapped protonation equilibria. New protonation constants were refined (L-lactic and succinic acids) with respect to our previous investigation on red wines. Attention was paid for mixed solvent (ethanol-water mixture), ionic strength, and temperature to ensure a thermodynamic level to the study. Validation of the chemical model optimized is achieved by way of conductometric measurements and using a synthetic "wine" especially adapted for testing.
Chen, Ying-Ying; Chang, Li-Te; Chen, Hung-Wei; Yang, Chia-Ying; Hsin, Ling-Wei
2017-03-13
A fast and facile synthesis of a series of 4-nitrophenyl 2-azidoethylcarbamate derivatives as activated urea building blocks was developed. The N-Fmoc-protected 2-aminoethyl mesylates derived from various commercially available N-Fmoc-protected α-amino acids, including those having functionalized side chains with acid-labile protective groups, were directly transformed into 4-nitrophenyl 2-azidoethylcarbamate derivatives in 1 h via a one-pot two-step reaction. These urea building blocks were utilized for the preparation of a series of urea moiety-containing mitoxantrone-amino acid conjugates in 75-92% yields and parallel solution-phase synthesis of a urea compound library consisted of 30 members in 38-70% total yields.
Prebiotic synthesis of adenine and amino acids under Europa-like conditions
NASA Technical Reports Server (NTRS)
Levy, M.; Miller, S. L.; Brinton, K.; Bada, J. L.
2000-01-01
In order to simulate prebiotic synthetic processes on Europa and other ice-covered planets and satellites, we have investigated the prebiotic synthesis of organic compounds from dilute solutions of NH4CN frozen for 25 years at -20 and -78 degrees C. In addition, the aqueous products of spark discharge reactions from a reducing atmosphere were frozen for 5 years at -20 degrees C. We find that both adenine and guanine, as well as a simple set of amino acids dominated by glycine, are produced in substantial yields under these conditions. These results indicate that some of the key components necessary for the origin of life may have been available on Europa throughout its history and suggest that the circumstellar zone where life might arise may be wider than previously thought.
Prebiotic synthesis of adenine and amino acids under Europa-like conditions.
Levy, M; Miller, S L; Brinton, K; Bada, J L
2000-06-01
In order to simulate prebiotic synthetic processes on Europa and other ice-covered planets and satellites, we have investigated the prebiotic synthesis of organic compounds from dilute solutions of NH4CN frozen for 25 years at -20 and -78 degrees C. In addition, the aqueous products of spark discharge reactions from a reducing atmosphere were frozen for 5 years at -20 degrees C. We find that both adenine and guanine, as well as a simple set of amino acids dominated by glycine, are produced in substantial yields under these conditions. These results indicate that some of the key components necessary for the origin of life may have been available on Europa throughout its history and suggest that the circumstellar zone where life might arise may be wider than previously thought.
Prebiotic Synthesis of Adenine and Amino Acids Under Europa-like Conditions
NASA Technical Reports Server (NTRS)
Levy, Matthew; Miller, Stanley L.; Brinton, Karen; Bada, Jeffrey L.
2003-01-01
In order to simulate prebiotic synthetic processes on Europa and other ice-covered planets and satellites. we have investigated the prebiotic synthesis of organic compounds from dilute solutions of NH4CN frozen for 25 year at -20 and -78 C. In addition the aqueous products of spark discharge reactions from a reducing atmosphere were frozen for 5 years at -20%. We find that both adenine and guanine, as well as a simple set of amino acids dominated by glycine, are produced in substantial yields under these conditions. These results indicate that some of the key components necessary for the origin of life may have been available on Europa throughout its history and suggest that the circumstellar zone where life might arise may be m der than previously thought.
Kostinek, M; Specht, I; Edward, V A; Pinto, C; Egounlety, M; Sossa, C; Mbugua, S; Dortu, C; Thonart, P; Taljaard, L; Mengu, M; Franz, C M A P; Holzapfel, W H
2007-03-20
A total of 375 lactic acid bacteria were isolated from fermenting cassava in South Africa, Benin, Kenya and Germany, and were characterised by phenotypic and genotypic tests. These could be divided into five main groups comprising strains of facultatively heterofermentative rods, obligately heterofermentative rods, heterofermentative cocci, homofermentative cocci and obligately homofermentative rods, in decreasing order of predominance. Most of the facultatively heterofermentative rods were identified by phenotypic tests as presumptive Lactobacillus plantarum-group strains, which also comprised the most predominant bacteria (54.4% of strains) isolated in the study. The next predominant group of lactic acid bacteria (14.1% of total isolates) consisted of obligately heterofermentative rods belonging either to the genus Lactobacillus or Weissella, followed by the heterofermentative cocci (13.9% of isolates) belonging to the genera Weissella or Leuconostoc. Homofermentative cocci were also isolated (13.3% of isolates). Biochemical properties such as production of alpha-amylase, beta-glucosidase, tannase, antimicrobials (presumptive bacteriocin and H(2)O(2)-production), acidification and fermentation of the indigestible sugars raffinose and stachyose, were evaluated in vitro for selection of potential starter strains. A total of 32 strains with one or more desirable biochemical properties were pre-selected and identified using rep-PCR fingerprinting in combination with 16S rRNA sequencing of representative rep-PCR cluster isolates. Of these strains, 18 were identified as L. plantarum, four as Lactobacillus pentosus, two each as Leuconostoc fallax, Weissella paramesenteroides and Lactobacillus fermentum, one each as Leuconostoc mesenteroides subsp. mesenteroides and Weissella cibaria, while two remained unidentified but could be assigned to the L. plantarum-group. These strains were further investigated for clonal relationships, using RAPD-PCR with three primers, and of
NASA Astrophysics Data System (ADS)
Pandey, Archana; Verma, Chandrabhan; Singh, B.; Ebenso, Eno E.
2018-03-01
The present study deals with the synthesis of two new compounds namely, benzamide - 2-chloro-4-nitrobenzoic acid (BENCNBA) and anthranilic acid-2-chloro-4-nitrobenzoic acid (AACNBA) using solid phase reactions. The phase diagram studies revealed that formation of the investigated compounds occurs in 1:1 molar ratio. The synthesized compounds were characterized using several spectral techniques such as FT-IR, 1H and 13C NMR, UV-Vis, powder X-ray diffraction (PXRD). Single crystal XRD (SCXRD) study showed that both BENCNBA and AACNBA compounds crystallize in triclinic crystal system with P-1 space group. Further, the presence of intermolecular hydrogen bonding between the constituent components was also supported by single crystal X-ray diffraction (SCXRD) method. Heat of mixing, entropy of fusion, roughness parameter, interfacial energy and excess thermodynamic functions have also been computed using the enthalpy of fusion values derived from differential scanning calorimeter (DSC) study. The inhibition effect of BENCNBA and AACNBA on the mild steel corrosion in hydrochloric acid solution was tested using electrochemical methods. Electrochemical impedance spectroscopy (EIS) study revealed that both BENCNBA and AACNBA behaved as interface corrosion inhibitors and showed maximum inhibition efficiencies of 95.71% and 96.42%, respectively at 400 ppm (1.23 × 10-3 M) concentration. Potentiodynamic polarization (PDP) measurements suggested that BENCNBA and AACNBA acted as mixed type corrosion inhibitors. EIS and PDP results showed that BENCNBA and AACNBA act as efficient corrosion inhibitors for mild steel and their inhibition efficiencies enhances on increasing their concentrations.
ERIC Educational Resources Information Center
Hasenekoglu, Ismet; Timucin, Melih
2007-01-01
The aim of this study is to collect and evaluate opinions of CAI experts and biology teachers about a high school level Computer Assisted Biology Instruction Material presenting computer-made modelling and simulations. It is a case study. A material covering "Nucleic Acids and Protein Synthesis" topic was developed as the…
Jiang, Qing; Xu, Bin; Jia, Jing; Zhao, An; Zhao, Yu-Rou; Li, Ying-Ying; He, Na-Na; Guo, Can-Cheng
2014-08-15
A copper-catalyzed aerobic decarboxylative sulfonylation of alkenyl carboxylic acids with sodium sulfinates is developed. This study offers a new and expedient strategy for stereoselective synthesis of (E)-alkenyl sulfones that are widely present in biologically active natural products and therapeutic agents. Moreover, the transformation is proposed to proceed via a radical process and exhibits a broad substrate scope and good functional group tolerance.
Sikalidis, Angelos K.; Mazor, Kevin M.; Lee, Jeong-In; Roman, Heather B.; Hirschberger, Lawrence L.; Stipanuk, Martha H.
2014-01-01
Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser51 phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597
Chamakuri, Srinivas; Jain, Prashi; Guduru, Shiva Krishna Reddy; Arney, Joseph Winston; MacKenzie, Kevin; Santini, Conrad; Young, Damian W
2018-05-11
Amino acids from the chiral pool have been used to produce a 24-member branch of 2,6-disubstituted piperazine scaffolds suitable for use in compound library production. Each scaffold was obtained as a single absolute stereoisomer in multi-gram quantities. Stereochemistry was confirmed by 2D NMR protocols and enantiomeric purity was determined by chiral HPLC. The scaffolds are intended for use as intermediates in parallel synthesis of small-molecule libraries.
NASA Technical Reports Server (NTRS)
Stein, T. P.; Settle, R. G.; Albina, J. A.; Dempsey, D. T.; Melnick, G.
1991-01-01
Eight N-15 labeled nonessential amino acids plus (15)NH4Cl were administered over a 10 h period to four healthy adult males using a primed-constant dosage regimen. The amount of N-15 excreted in the urine and the urinary ammonia, hippuric acid, and plasma alanine N-15 enrichments were measured. There was a high degree of consistency across subjects in the ordering of the nine compounds based on the fraction of N-15 excreted (Kendall coefficient of concordance W = 0.83, P is less than 0.01). Protein synthesis rates were calculated from the urinary ammonia plateau enrichment and the cumulative excretion of N-15. Glycine was one of the few amino acids that gave similar values by both methods.
Costigan, M G; Gilchrist, T L; Lindup, W E
1996-06-01
The furan dicarboxylic acid, 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (5-propyl FPA) accumulates in the plasma of patients with chronic renal failure and is a major contributor to the drug binding defect of uraemic plasma. This acid has also been implicated in several other aspects of the uraemic syndrome: anaemia, irregularities of thyroid function, neurological symptoms and inhibition of active tubular secretion. The acid is not commercially available and its synthesis, starting with Meldrum's acid and methyl succinyl chloride, is described. The pKa values were measured by titration and values of 3.2 and 3.6 respectively were assigned to the carboxylic acid groups attached directly to the ring at position 3 and at position 2 (on the side-chain). The partition coefficient (log P) between hydrochloric acid and octanol was 1.2 and the distribution coefficient (log D; octanol-phosphate buffer pH 7.4) was -0.59. The pKa values and the degree of hydrophobic character of 5-propyl FPA are consistent with those of other protein-bound acids which undergo active tubular secretion by the kidney and this substance may serve as an endogenous marker for the effects of drugs and disease on this process.
Meesapyodsuk, Dauenpen; Chen, Yan; Ng, Siew Hon; Chen, Jianan; Qiu, Xiao
2015-11-01
Ricinoleic acid (12-hydroxyoctadec-cis-9-enoic acid) has many specialized uses in bioproduct industries, while castor bean is currently the only commercial source for the fatty acid. This report describes metabolic engineering of a microbial system (Pichia pastoris) to produce ricinoleic acid using a "push" (synthesis) and "pull" (assembly) strategy. CpFAH, a fatty acid hydroxylase from Claviceps purpurea, was used for synthesis of ricinoleic acid, and CpDGAT1, a diacylglycerol acyl transferase for the triacylglycerol synthesis from the same species, was used for assembly of the fatty acid. Coexpression of CpFAH and CpDGAT1 produced higher lipid contents and ricinoleic acid levels than expression of CpFAH alone. Coexpression in a mutant haploid strain defective in the Δ12 desaturase activity resulted in a higher level of ricinoleic acid than that in the diploid strain. Intriguingly, the ricinoleic acid produced was mainly distributed in the neutral lipid fractions, particularly the free fatty acid form, but with little in the polar lipids. This work demonstrates the effectiveness of the metabolic engineering strategy and excellent capacity of the microbial system for production of ricinoleic acid as an alternative to plant sources for industrial uses. Copyright © 2015 by the American Society for Biochemistry and Molecular Biology, Inc.