Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Engineering of Saccharomyces cerevisiae for the synthesis of short chain fatty acids.
Leber, Christopher; Da Silva, Nancy A
2014-02-01
Carbon feedstocks from fossilized sources are being rapidly depleted due to rising demand for industrial and commercial applications. Many petroleum-derived chemicals can be directly or functionally substituted with chemicals derived from renewable feedstocks. Several short chain organic acids may fulfill this role using their functional groups as a target for chemical catalysis. Saccharomyces cerevisiae was engineered to produce short chain carboxylic acids (C6 to C10 ) from glucose using the heterologous Homo sapiens type I fatty acid synthase (hFAS). This synthase was activated by phosphopantetheine transfereases AcpS and Sfp from Escherichia coli and Bacillus subtilis, respectively, both in vitro and in vivo. hFAS was produced in the holo-form and produced carboxylic acids in vitro, confirmed by NADPH and ADIFAB assays. Overexpression of hFAS in a yeast FAS2 knockout strain, deficient in de novo fatty acid synthesis, demonstrated the full functional replacement of the native fungal FAS by hFAS. Two active heterologous short chain thioesterases (TEs) from Cuphea palustris (CpFatB1) and Rattus norvegicus (TEII) were evaluated for short chain fatty acid (SCFA) synthesis in vitro and in vivo. Three hFAS mutants were constructed: a mutant deficient in the native TE domain, a mutant with a linked CpFatB1 TE and a mutant with a linked TEII TE. Using the native yeast fatty acid synthase for growth, the overexpression of the hFAS mutants and the short-chain TEs (linked or plasmid-based) increased in vivo caprylic acid and total SCFA production up to 64-fold (63 mg/L) and 52-fold (68 mg/L), respectively, over the native yeast levels. Combined over-expression of the phosphopantetheine transferase with the hFAS mutant resulted in C8 titers of up to 82 mg/L and total SCFA titers of up to 111 mg/L. © 2013 Wiley Periodicals, Inc.
Kurita-Ochiai, Tomoko; Ochiai, Kuniyasu; Fukushima, Kazuo
2001-01-01
Our previous study demonstrated that butyric acid, an extracellular metabolite of periodontopathic bacteria, induced apoptosis in murine thymocytes, splenic T cells, and human Jurkat cells. In this study, we examined whether CD95 ligand-receptor interaction is involved in butyric acid-induced T-cell apoptosis. Flow cytometry analysis indicated that expression of Fas in Jurkat and T cells from peripheral blood mononuclear cells was not affected by butyric acid treatment. Furthermore, the expression of Fas and FasL protein in Western blotting was not affected by butyric acid treatment. Coincubation with blocking anti-Fas antibodies prevented Fas-induced apoptosis but not butyric acid-induced apoptosis. Anti-FasL antibodies also did not prevent butyric acid-induced apoptosis at any dose examined. Although cytotoxic anti-Fas antibody affected butyric acid-induced apoptosis, a synergistic effect was not seen. Time-dependent activation of caspase-8 and -9 was recognized in butyric acid- as well as Fas-mediated apoptosis. IETD-CHO and LEHD-CHO, specific inhibitors of caspase-8 and -9, respectively, completely blocked Fas-mediated apoptosis and partially prevented butyric acid-induced apoptosis. These results suggest that the Fas-FasL interaction is not involved in butyric acid-induced apoptosis and that caspase-8 and -9-dependent apoptosis plays an important role in butyric acid-induced apoptosis, as well as Fas-induced apoptosis. PMID:11238216
Dysregulation of fatty acid synthesis and glycolysis in non-Hodgkin lymphoma
Bhatt, Aadra P.; Jacobs, Sarah R.; Freemerman, Alex J.; Makowski, Liza; Rathmell, Jeffrey C.; Dittmer, Dirk P.; Damania, Blossom
2012-01-01
The metabolic differences between B-NHL and primary human B cells are poorly understood. Among human B-cell non-Hodgkin lymphomas (B-NHL), primary effusion lymphoma (PEL) is a unique subset that is linked to infection with Kaposi's sarcoma-associated herpesvirus (KSHV). We report that the metabolic profiles of primary B cells are significantly different from that of PEL. Compared with primary B cells, both aerobic glycolysis and fatty acid synthesis (FAS) are up-regulated in PEL and other types of nonviral B-NHL. We found that aerobic glycolysis and FAS occur in a PI3K-dependent manner and appear to be interdependent. PEL overexpress the fatty acid synthesizing enzyme, FASN, and both PEL and other B-NHL were much more sensitive to the FAS inhibitor, C75, than primary B cells. Our findings suggest that FASN may be a unique candidate for molecular targeted therapy against PEL and other B-NHL. PMID:22752304
Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.
2014-01-01
Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902
Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J
2013-11-01
Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. © 2013 John Wiley & Sons Ltd.
Li, J N; Mahmoud, M A; Han, W F; Ripple, M; Pizer, E S
2000-11-25
Endogenous fatty acid synthesis has been observed in certain rapidly proliferating normal and neoplastic tissues. Sterol regulatory element-binding proteins (SREBPs) are transcription factors that regulate the expression of lipogenic genes including fatty acid synthase (FAS), the major biosynthetic enzyme for fatty acid synthesis. We have previously shown that SREBP-1, FAS, and Ki-67, a proliferation marker, colocalized in the crypts of the fetal gastrointestinal tract epithelium. This study sought to determine whether SREBP-1 participates in the regulation of proliferation-associated fatty acid synthesis in colorectal neoplasia. An immunohistochemical analysis of SREBP-1, FAS, and Ki-67 expression in 25 primary human colorectal carcinoma specimens showed colocalization in 22 of these. To elucidate a functional linkage between SREBP-1 activation and proliferation-associated FA synthesis, SREBP-1 and FAS content were assayed during the adaptive response of cultured HCT116 colon carcinoma cells to pharmacological inhibition of FA synthesis. Cerulenin and TOFA each inhibited the endogenous synthesis of fatty acids in a dose-dependent manner and each induced increases in both precursor and mature forms of SREBP-1. Subsequently, both the transcriptional activity of the FAS promoter in a luciferase reporter gene construct and the FAS expression increased. These results demonstrate that tumor cells recognize and respond to a deficiency in endogenous fatty acid synthesis by upregulating both SREBP-1 and FAS expression and support the model that SREBP-1 participates in the transcriptional regulation of lipogenic genes in colorectal neoplasia. Copyright 2000 Academic Press.
Anti-Fas conjugated hyaluronic acid microsphere gels for neural stem cell delivery.
Shendi, Dalia; Albrecht, Dirk R; Jain, Anjana
2017-02-01
Central nervous system (CNS) injuries and diseases result in neuronal damage and loss of function. Transplantation of neural stem cells (NSCs) has been shown to improve locomotor function after transplantation. However, due to the immune and inflammatory response at the injury site, the survival rate of the engrafted cells is low. Engrafted cell viability has been shown to increase when transplanted within a hydrogel. Hyaluronic acid (HA) hydrogels have natural anti-inflammatory properties and the backbone can be modified to introduce bioactive agents, such as anti-Fas, which we have previously shown to promote NSC survival while suppressing immune cell activity in bulk hydrogels in vitro. Although bulk HA hydrogels have shown to promote stem cell survival, microsphere gels for NSC encapsulation and delivery may have additional advantages. In this study, a flow-focusing microfluidic device was used to fabricate either vinyl sulfone-modified HA (VS-HA) or anti-Fas-conjugated HA (anti-Fas HA) microsphere gels encapsulated with NSCs. The majority of encapsulated NSCs remained viable for at least 24 h in the VS-HA and anti-Fas HA microsphere gels. Moreover, T-cells cultured in suspension with the anti-Fas HA microsphere gels had reduced viability after contact with the microsphere gels compared to the media control and soluble anti-Fas conditions. This approach can be adapted to encapsulate various cell types for therapeutic strategies in other physiological systems in order to increase survival by reducing the immune response. © 2016 Wiley Periodicals, Inc. J Biomed Mater Res Part A: 105A: 608-618, 2017. © 2016 Wiley Periodicals, Inc.
PMLRARα binds to Fas and suppresses Fas-mediated apoptosis through recruiting c-FLIP in vivo
Tao, Rong-Hua; Berkova, Zuzana; Wise, Jillian F.; Rezaeian, Abdol-Hossein; Daniluk, Urszula; Ao, Xue; Hawke, David H.; Karp, Judith E.; Lin, Hui-Kuan; Molldrem, Jeffrey J.
2011-01-01
Defective Fas signaling leads to resistance to various anticancer therapies. Presence of potential inhibitors of Fas which could block Fas signaling can explain cancer cells resistance to apoptosis. We identified promyelocytic leukemia protein (PML) as a Fas-interacting protein using mass spectrometry analysis. The function of PML is blocked by its dominant-negative form PML–retinoic acid receptor α (PMLRARα). We found PMLRARα interaction with Fas in acute promyelocytic leukemia (APL)–derived cells and APL primary cells, and PML-Fas complexes in normal tissues. Binding of PMLRARα to Fas was mapped to the B-box domain of PML moiety and death domain of Fas. PMLRARα blockage of Fas apoptosis was demonstrated in U937/PR9 cells, human APL cells and transgenic mouse APL cells, in which PMLRARα recruited c-FLIPL/S and excluded procaspase 8 from Fas death signaling complex. PMLRARα expression in mice protected the mice against a lethal dose of agonistic anti-Fas antibody (P < .001) and the protected tissues contained Fas-PMLRARα-cFLIP complexes. Taken together, PMLRARα binds to Fas and blocks Fas-mediated apoptosis in APL by forming an apoptotic inhibitory complex with c-FLIP. The presence of PML-Fas complexes across different tissues implicates that PML functions in apoptosis regulation and tumor suppression are mediated by direct interaction with Fas. PMID:21803845
Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng
2013-01-01
There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979
Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A
2016-04-01
Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. © 2015 Wiley Periodicals, Inc.
The Btk-dependent PIP5K1γ lipid kinase activation by Fas counteracts FasL-induced cell death.
Rossin, Aurélie; Lounnas, Nadia; Durivault, Jérôme; Miloro, Giorgia; Gagnoux-Palacios, Laurent; Hueber, Anne-Odile
2017-11-01
The Fas/FasL system plays a critical role in death by apoptosis and immune escape of cancer cells. The Fas receptor being ubiquitously expressed in tissues, its apoptotic-inducing function, initiated upon FasL binding, is tightly regulated by several negative regulatory mechanisms to prevent inappropriate cell death. One of them, involving the non-receptor tyrosine kinase Btk, was reported mainly in B cells and only poorly described. We report here that Btk negatively regulates, through its tyrosine kinase activity, the FasL-mediated cell death in epithelial cell lines from colon cancer origin. More importantly, we show that Btk interacts not only with Fas but also with the phosphatidylinositol-4-phosphate 5-kinase, PIP5K1γ, which, upon stimulation by Fas ligand, is responsible of a rapid and transient synthesis of phosphatidylinositol-4,5-bisphosphate (PI(4,5)P 2 ). This production requires both the presence and the tyrosine kinase activity of Btk, and participates in the negative regulation of FasL-mediated cell death since knocking down PIP5K1γ expression significantly strengthens the apoptotic signal upon FasL engagement. Altogether, our data demonstrate the cooperative role of Btk and PIP5K1γ in a FasL-induced PI(4,5)P 2 production, both proteins participating to the threshold setting of FasL-induced apoptotic commitment in colorectal cell lines.
Nihal, Minakshi; Wu, Jianqiang; Wood, Gary S.
2015-01-01
Melanoma, a highly aggressive form of cancer, is notoriously resistant to available therapies. Methotrexate (MTX), an antifolate, competitively inhibits DNA synthesis and is effective for several types of cancer. In cutaneous T-cell lymphoma (CTCL), MTX increases Fas death receptor by decreasing Fas promoter methylation by blocking the synthesis of SAM, the principal methyl donor for DNMTs, resulting in enhanced Fas-mediated apoptosis. The objective of this study was to explore the effects of MTX in human melanoma. MTX variably inhibited the survival of melanoma cells and induced apoptosis as evident by annexin V positivity and senescence associated β-galactosidase activity induction. Furthermore, MTX caused increased transcript and protein levels of extrinsic apoptotic pathway factors Fas and Fas-ligand, albeit at different levels in different cell lines. Our pyrosequencing studies showed that this increased expression of Fas was associated with Fas promoter demethylation. Overall, the ability of MTX to up-regulate Fas/FasL and enhance melanoma apoptosis through extrinsic as well as intrinsic pathways might make it a useful component of novel combination therapies designed to affect multiple melanoma targets simultaneously. In support of this concept, combination therapy with MTX and interferon-alpha (IFNα) induced significantly greater apoptosis in the aggressive A375 cell line than either agent alone. PMID:24862567
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H; Brun, Reto; Carballeira, Néstor M
2010-11-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of Plasmodium yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC(50) value 6.6 μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC(50) value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescence analysis (IC(50) 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory activity against the PfFAS-II enzymes PfFabI and PfFabZ with IC(50) values of 0.38 and 0.58 μg/ml (IC(50) control drugs 14 and 30 ng/ml), respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC(50) values 3.7-31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC(50) 20.2 μg/ml), and Leishmania donovani (IC(50) values 4.1-13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature, and calculated pharmacokinetic properties suggests that 2-HDA could be a useful compound to
Tasdemir, Deniz; Sanabria, David; Lauinger, Ina L.; Tarun, Alice; Herman, Rob; Perozzo, Remo; Zloh, Mire; Kappe, Stefan H.; Brun, Reto; Carballeira, Néstor M.
2010-01-01
Acetylenic fatty acids are known to display several biological activities, but their antimalarial activity has remained unexplored. In this study, we synthesized the 2-, 5-, 6-, and 9-hexadecynoic acids (HDAs) and evaluated their in vitro activity against erythrocytic (blood) stages of Plasmodium falciparum and liver stages of P. yoelii infections. Since the type II fatty acid biosynthesis pathway (PfFAS-II) has recently been shown to be indispensable for liver stage malaria parasites, the inhibitory potential of the HDAs against multiple P. falciparum FAS-II (PfFAS-II) elongation enzymes was also evaluated. The highest antiplasmodial activity against blood stages of P. falciparum was displayed by 5-HDA (IC50 value 6.6. μg/ml), whereas the 2-HDA was the only acid arresting the growth of liver stage P. yoelii infection, in both flow cytometric assay (IC50 value 2-HDA 15.3 μg/ml, control drug atovaquone 2.5 ng/ml) and immunofluorescense analysis (IC50 2-HDA 4.88 μg/ml, control drug atovaquone 0.37 ng/ml). 2-HDA showed the best inhibitory against the PfFAS-II enzymes PfFabI and PfFabZ with IC50 values of 0.38 and 0.58 μg/ml (IC50 control drugs 14 and 30 ng/ml) respectively. Enzyme kinetics and molecular modeling studies revealed valuable insights into the binding mechanism of 2-HDA on the target enzymes. All HDAs showed in vitro activity against Trypanosoma brucei rhodesiense (IC50 values 3.7–31.7 μg/ml), Trypanosoma cruzi (only 2-HDA, IC50 20.2 μg/ml), and Leishmania donovani (IC50 values 4.1–13.4 μg/ml) with generally low or no significant toxicity on mammalian cells. This is the first study to indicate therapeutic potential of HDAs against various parasitic protozoa. It also points out that the malarial liver stage growth inhibitory effect of the 2-HDA may be promoted via PfFAS-II enzymes. The lack of cytotoxicity, lipophilic nature and calculated pharmacokinetic properties suggest that 2-HDA could be a useful compound to study the interaction of fatty
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
Hughes, David T.; Martel, Peter M.; Kinlaw, William B.; Eisenberg, Burton L.
2013-01-01
Liposarcomas constitute a rare group of tumors of mesenchymal origin that are often poorly responsive to therapy. This study characterizes a novel human liposarcoma cell line (LiSa-2) and defines the mechanism of its response to a synthetic triterpenoid. Fatty acid synthase (FAS) is a key enzyme of de-novo fatty acid synthesis and is highly expressed in both human liposarcoma tissue specimens and LiSa-2 cells. Treatment of the LiSa-2 cell line with the synthetic triterpenoid 2-cyano-3,12-dioxooleana-1,9-dien-28-oic imidazolide (CDDO-Im) markedly inhibited FAS mRNA expression, FAS protein production and FAS gene promoter activity. As expected, fatty acid synthesis was down regulated, but there was no effect on cellular fatty acid uptake or glycerol-3-phosphate synthesis suggesting a selective inhibition of endogenous fatty acid synthesis. Importantly, CDDO-Im produced a dose-dependent apoptotic effect in the LiSa-2 cell line, and simultaneous treatment with CDDO-Im and the fatty acid synthase inhibitor Cerulenin produced a synergistic cytotoxic effect. Thus, CDDO-Im and Cerulenin act at different loci to inhibit long chain fatty acid synthesis in liposarcoma cells. This study’s demonstration of CDDO-Im inhibition of FAS and Spot 14 (S14) expression is the first report of triterpenoid compounds affecting the fatty acid synthesis pathway. The observed dependence of liposarcomas on lipogenesis to support their growth and survival provides a novel approach to the treatment of liposarcomas with agents that target fatty acid production. PMID:18259941
Gomes, Andreia; Correia, Gustavo; Coelho, Marisa; Araújo, João Ricardo; Pinho, Maria João; Teixeira, Ana Luisa; Medeiros, Rui; Ribeiro, Laura
2015-05-01
Catecholamines (CA) play an important role in cardiovascular (CDV) disease risk. Namely, noradrenaline (NA) levels positively correlate whereas adrenaline (AD) levels negatively correlate with obesity and/or CDV disease. Western diets, which are tipically rich in Ω-6 fatty acids (FAs) and deficient in Ω-3 FAs, may contribute to the development of obesity, type 2 diabetes and/or coronary artery disease. Taking this into consideration and the fact that our group has already described that saturated FAs affect catecholamine handling by adrenal chromaffin cells, this work aimed to investigate the effect of unsaturated FAs upon catecholamine handling in the same model. Our results showed that chronic exposure to unsaturated FAs differently modulated CA cellular content and release, regardless of both FA series and number of carbon atoms. Namely, the Ω-6 arachidonic and linoleic acids, based on their effect on CA release and cellular content, seemed to impair NA and AD vesicular transport, whereas γ-linolenic acid selectively impaired AD synthesis and release. Within the Ω-9 FAs, oleic acid was devoid of effect, and elaidic acid behaved similarly to γ-linolenic acid. Eicosapentaenoic and docosahexaenoic acids (Ω-3 series) impaired the synthesis and release of both NA and AD. These results deserve attention and future development, namely, in what concerns the mechanisms involved and correlative effects in vivo. Copyright © 2015 Elsevier Inc. All rights reserved.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Arunima, Sakunthala; Rajamohan, Thankappan
2014-05-28
The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.
Wise, Jillian F; Berkova, Zuzana; Mathur, Rohit; Zhu, Haifeng; Braun, Frank K; Tao, Rong-Hua; Sabichi, Anita L; Ao, Xue; Maeng, Hoyoung; Samaniego, Felipe
2013-06-06
Resistance to Fas-mediated apoptosis is associated with poor cancer outcomes and chemoresistance. To elucidate potential mechanisms of defective Fas signaling, we screened primary lymphoma cell extracts for Fas-associated proteins that would have the potential to regulate Fas signaling. An activation-resistant Fas complex selectively included nucleolin. We confirmed the presence of nucleolin-Fas complexes in B-cell lymphoma cells and primary tissues, and the absence of such complexes in B-lymphocytes from healthy donors. RNA-binding domain 4 and the glycine/arginine-rich domain of nucleolin were essential for its association with Fas. Nucleolin colocalized with Fas on the surface of B-cell lymphoma cells. Nucleolin knockdown sensitized BJAB cells to Fas ligand (FasL)-induced and Fas agonistic antibody-induced apoptosis through enhanced binding, suggesting that nucleolin blocks the FasL-Fas interaction. Mice transfected with nucleolin were protected from the lethal effects of agonistic anti-mouse Fas antibody (Jo2) and had lower rates of hepatocyte apoptosis, compared with vector and a non-Fas-binding mutant of nucleolin. Our results show that cell surface nucleolin binds Fas, inhibits ligand binding, and thus prevents induction of Fas-mediated apoptosis in B-cell lymphomas and may serve as a new therapeutic target.
Wise, Jillian F.; Berkova, Zuzana; Mathur, Rohit; Zhu, Haifeng; Braun, Frank K.; Tao, Rong-Hua; Sabichi, Anita L.; Ao, Xue; Maeng, Hoyoung
2013-01-01
Resistance to Fas-mediated apoptosis is associated with poor cancer outcomes and chemoresistance. To elucidate potential mechanisms of defective Fas signaling, we screened primary lymphoma cell extracts for Fas-associated proteins that would have the potential to regulate Fas signaling. An activation-resistant Fas complex selectively included nucleolin. We confirmed the presence of nucleolin-Fas complexes in B-cell lymphoma cells and primary tissues, and the absence of such complexes in B-lymphocytes from healthy donors. RNA-binding domain 4 and the glycine/arginine-rich domain of nucleolin were essential for its association with Fas. Nucleolin colocalized with Fas on the surface of B-cell lymphoma cells. Nucleolin knockdown sensitized BJAB cells to Fas ligand (FasL)-induced and Fas agonistic antibody-induced apoptosis through enhanced binding, suggesting that nucleolin blocks the FasL–Fas interaction. Mice transfected with nucleolin were protected from the lethal effects of agonistic anti-mouse Fas antibody (Jo2) and had lower rates of hepatocyte apoptosis, compared with vector and a non-Fas-binding mutant of nucleolin. Our results show that cell surface nucleolin binds Fas, inhibits ligand binding, and thus prevents induction of Fas-mediated apoptosis in B-cell lymphomas and may serve as a new therapeutic target. PMID:23599269
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael
2017-05-15
Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our
Sanchez, Erica L.; Pulliam, Thomas H.; Dimaio, Terri A.; Thalhofer, Angel B.; Delgado, Tracie
2017-01-01
ABSTRACT Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation
Item, Flurin; Wueest, Stephan; Lemos, Vera; Stein, Sokrates; Lucchini, Fabrizio C; Denzler, Rémy; Fisser, Muriel C; Challa, Tenagne D; Pirinen, Eija; Kim, Youngsoo; Hemmi, Silvio; Gulbins, Erich; Gross, Atan; O'Reilly, Lorraine A; Stoffel, Markus; Auwerx, Johan; Konrad, Daniel
2017-09-07
Nonalcoholic fatty liver disease is one of the most prevalent metabolic disorders and it tightly associates with obesity, type 2 diabetes, and cardiovascular disease. Reduced mitochondrial lipid oxidation contributes to hepatic fatty acid accumulation. Here, we show that the Fas cell surface death receptor (Fas/CD95/Apo-1) regulates hepatic mitochondrial metabolism. Hepatic Fas overexpression in chow-fed mice compromises fatty acid oxidation, mitochondrial respiration, and the abundance of mitochondrial respiratory complexes promoting hepatic lipid accumulation and insulin resistance. In line, hepatocyte-specific ablation of Fas improves mitochondrial function and ameliorates high-fat-diet-induced hepatic steatosis, glucose tolerance, and insulin resistance. Mechanistically, Fas impairs fatty acid oxidation via the BH3 interacting-domain death agonist (BID). Mice with genetic or pharmacological inhibition of BID are protected from Fas-mediated impairment of mitochondrial oxidation and hepatic steatosis. We suggest Fas as a potential novel therapeutic target to treat obesity-associated fatty liver and insulin resistance.Hepatic steatosis is a common disease closely associated with metabolic syndrome and insulin resistance. Here Item et al. show that Fas, a member of the TNF receptor superfamily, contributes to mitochondrial dysfunction, steatosis development, and insulin resistance under high fat diet.
Zhou, Weibo; Han, Wan Fang; Landree, Leslie E; Thupari, Jagan N; Pinn, Michael L; Bililign, Tsion; Kim, Eun Kyoung; Vadlamudi, Aravinda; Medghalchi, Susan M; El Meskini, Rajaa; Ronnett, Gabriele V; Townsend, Craig A; Kuhajda, Francis P
2007-04-01
Fatty acid synthase (FAS), the enzyme responsible for the de novo synthesis of fatty acids, is highly expressed in ovarian cancers and most common human carcinomas. Inhibition of FAS and activation of AMP-activated protein kinase (AMPK) have been shown to be cytotoxic to human cancer cells in vitro and in vivo. In this report, we explore the cytotoxic mechanism of action of FAS inhibition and show that C93, a synthetic FAS inhibitor, increases the AMP/ATP ratio, activating AMPK in SKOV3 human ovarian cancer cells, which leads to cytotoxicity. As a physiologic consequence of AMPK activation, acetyl-CoA carboxylase (ACC), the rate-limiting enzyme of fatty acid synthesis, was phosphorylated and inhibited whereas glucose oxidation was increased. Despite these attempts to conserve energy, the AMP/ATP ratio increased with worsening cellular redox status. Pretreatment of SKOV3 cells with compound C, an AMPK inhibitor, substantially rescued the cells from C93 cytotoxicity, indicating its dependence on AMPK activation. 5-(Tetradecyloxy)-2-furoic acid, an ACC inhibitor, did not activate AMPK despite inhibiting fatty acid synthesis pathway activity and was not significantly cytotoxic to SKOV3 cells. This indicates that substrate accumulation from FAS inhibition triggering AMPK activation, not end-product depletion of fatty acids, is likely responsible for AMPK activation. C93 also exhibited significant antitumor activity and apoptosis against SKOV3 xenografts in athymic mice without significant weight loss or cytotoxicity to proliferating cellular compartments such as bone marrow, gastrointestinal tract, or skin. Thus, pharmacologic FAS inhibition selectively activates AMPK in ovarian cancer cells, inducing cytotoxicity while sparing most normal human tissues from the pleiotropic effects of AMPK activation.
Nikitkova, Anna E.; Haase, Elaine M.; Vickerman, M. Margaret; Gill, Steven R.
2012-01-01
Streptococcus gordonii, an important primary colonizer of dental plaque biofilm, specifically binds to salivary amylase via the surface-associated amylase-binding protein A (AbpA). We hypothesized that a function of amylase binding to S. gordonii may be to modulate the expression of chromosomal genes, which could influence bacterial survival and persistence in the oral cavity. Gene expression profiling by microarray analysis was performed to detect genes in S. gordonii strain CH1 that were differentially expressed in response to the binding of purified human salivary amylase versus exposure to purified heat-denatured amylase. Selected genes found to be differentially expressed were validated by quantitative reverse transcription-PCR (qRT-PCR). Five genes from the fatty acid synthesis (FAS) cluster were highly (10- to 35-fold) upregulated in S. gordonii CH1 cells treated with native amylase relative to those treated with denatured amylase. An abpA-deficient strain of S. gordonii exposed to amylase failed to show a response in FAS gene expression similar to that observed in the parental strain. Predicted phenotypic effects of amylase binding to S. gordonii strain CH1 (associated with increased expression of FAS genes, leading to changes in fatty acid synthesis) were noted; these included increased bacterial growth, survival at low pH, and resistance to triclosan. These changes were not observed in the amylase-exposed abpA-deficient strain, suggesting a role for AbpA in the amylase-induced phenotype. These results provide evidence that the binding of salivary amylase elicits a differential gene response in S. gordonii, resulting in a phenotypic adjustment that is potentially advantageous for bacterial survival in the oral environment. PMID:22247133
Dual Role of Fas/FasL-Mediated Signal in Peripheral Immune Tolerance.
Yamada, Akiko; Arakaki, Rieko; Saito, Masako; Kudo, Yasusei; Ishimaru, Naozumi
2017-01-01
Fas-mediated apoptosis contributes to physiological and pathological cellular processes, such as differentiation and survival. In particular, the roles of Fas in immune cells are complex and critical for the maintenance of immune tolerance. The precise pathways and unique functions associated with Fas/FasL-mediated signaling in the immune system are known. The dual character of Fas/FasL-mediated immune regulation that induces beneficial or harmful effects is associated with the onset or development of immune disorders. Studies on mutations in genes encoding Fas and FasL gene of humans and mice contributed to our understanding of the pathogenesis of autoimmune diseases. Here, we review the opposing functions of Fas/FasL-mediated signaling, bilateral effects of Fas/FasL on in immune cells, and complex pathogenesis of autoimmunity mediated by Fas/FasL.
Dual Role of Fas/FasL-Mediated Signal in Peripheral Immune Tolerance
Yamada, Akiko; Arakaki, Rieko; Saito, Masako; Kudo, Yasusei; Ishimaru, Naozumi
2017-01-01
Fas-mediated apoptosis contributes to physiological and pathological cellular processes, such as differentiation and survival. In particular, the roles of Fas in immune cells are complex and critical for the maintenance of immune tolerance. The precise pathways and unique functions associated with Fas/FasL-mediated signaling in the immune system are known. The dual character of Fas/FasL-mediated immune regulation that induces beneficial or harmful effects is associated with the onset or development of immune disorders. Studies on mutations in genes encoding Fas and FasL gene of humans and mice contributed to our understanding of the pathogenesis of autoimmune diseases. Here, we review the opposing functions of Fas/FasL-mediated signaling, bilateral effects of Fas/FasL on in immune cells, and complex pathogenesis of autoimmunity mediated by Fas/FasL. PMID:28424702
Nutrient-dependent phosphorylation channels lipid synthesis to regulate PPARα
Jensen-Urstad, Anne P. L.; Song, Haowei; Lodhi, Irfan J.; Funai, Katsuhiko; Yin, Li; Coleman, Trey; Semenkovich, Clay F.
2013-01-01
Peroxisome proliferator-activated receptor (PPAR)α is a nuclear receptor that coordinates liver metabolism during fasting. Fatty acid synthase (FAS) is an enzyme that stores excess calories as fat during feeding, but it also activates hepatic PPARα by promoting synthesis of an endogenous ligand. Here we show that the mechanism underlying this paradoxical relationship involves the differential regulation of FAS in at least two distinct subcellular pools: cytoplasmic and membrane-associated. In mouse liver and cultured hepatoma cells, the ratio of cytoplasmic to membrane FAS-specific activity was increased with fasting, indicating higher cytoplasmic FAS activity under conditions associated with PPARα activation. This effect was due to a nutrient-dependent and compartment-selective covalent modification of FAS. Cytoplasmic FAS was preferentially phosphorylated during feeding or insulin treatment at Thr-1029 and Thr-1033, which flank a dehydratase domain catalytic residue. Mutating these sites to alanines promoted PPARα target gene expression. Rapamycin-induced inhibition of mammalian/mechanistic target of rapamycin complex 1 (mTORC1), a mediator of the feeding/insulin signal to induce lipogenesis, reduced FAS phosphorylation, increased cytoplasmic FAS enzyme activity, and increased PPARα target gene expression. Rapamycin-mediated induction of the same gene was abrogated with FAS knockdown. These findings suggest that hepatic FAS channels lipid synthesis through specific subcellular compartments that allow differential gene expression based on nutritional status. PMID:23585690
Neurodevelopmental functioning in children with FAS, pFAS, and ARND.
Chasnoff, Ira J; Wells, Anne M; Telford, Erin; Schmidt, Christine; Messer, Gwendolyn
2010-04-01
The purpose of this article is to compare the neurodevelopmental profiles of 78 foster and adopted children with fetal alcohol syndrome (FAS), partial FAS (pFAS), or alcohol-related neurodevelopmental disorder (ARND). Seventy-eight foster and adopted children underwent a comprehensive diagnostic evaluation. By using criteria more stringent than those required by current guidelines, the children were placed in 1 of 3 diagnostic categories: FAS, pFAS, or ARND. Each child was evaluated across the domains of neuropsychological functioning most frequently affected by prenatal exposure to alcohol. Multivariate analyses of variance were conducted to examine differences in neuropsychological functioning between the 3 diagnostic groups. Descriptive discriminant analyses were performed in follow-up to the multivariate analyses of variance. The children in the 3 diagnostic categories were similar for descriptive and child welfare variables. Children with FAS had significantly decreased mean weight, height, and head circumference. Children with FAS exhibited the most impaired level of general intelligence, significantly worse language-based memory compared with children with ARND, and significantly poorer functional communication skills than children with pFAS. On executive functioning, the FAS group of children performed significantly worse on sequencing and shift than either the pFAS or ARND groups. Children with pFAS and ARND were similar in all neurodevelopmental domains that were tested. The children who met tightly defined physical criteria for a diagnosis of FAS demonstrated significantly poorer neurodevelopmental functioning than children with pFAS and ARND. Children in these latter 2 groups were similar in all neurodevelopmental domains that were tested.
Fas palmitoylation by the palmitoyl acyltransferase DHHC7 regulates Fas stability
Rossin, A; Durivault, J; Chakhtoura-Feghali, T; Lounnas, N; Gagnoux-Palacios, L; Hueber, A-O
2015-01-01
The death receptor Fas undergoes a variety of post-translational modifications including S-palmitoylation. This protein acylation has been reported essential for an optimal cell death signaling by allowing both a proper Fas localization in cholesterol and sphingolipid-enriched membrane nanodomains, as well as Fas high-molecular weight complexes. In human, S-palmitoylation is controlled by 23 members of the DHHC family through their palmitoyl acyltransferase activity. In order to better understand the role of this post-translational modification in the regulation of the Fas-mediated apoptosis pathway, we performed a screen that allowed the identification of DHHC7 as a Fas-palmitoylating enzyme. Indeed, modifying DHHC7 expression by specific silencing or overexpression, respectively, reduces or enhances Fas palmitoylation and DHHC7 co-immunoprecipitates with Fas. At a functional level, DHHC7-mediated palmitoylation of Fas allows a proper Fas expression level by preventing its degradation through the lysosomes. Indeed, the decrease of Fas expression obtained upon loss of Fas palmitoylation can be restored by inhibiting the lysosomal degradation pathway. We describe the modification of Fas by palmitoylation as a novel mechanism for the regulation of Fas expression through its ability to circumvent its degradation by lysosomal proteolysis. PMID:25301068
Schütt, B S; Brummel, M; Schuch, R; Spener, F
1998-06-01
To investigate the role of acyl carrier protein (ACP) in determining the fate of the acyl moieties linked to it in the course of de-novo fatty acid biosynthesis in higher plants, we carried out in vitro experiments to reconstitute the fatty acid synthase (FAS) reaction in extracts of spinach (Spinacia oleracea L.) leaves, rape (Brassica napus L.) seeds and Cuphea lanceolata Ait. seeds. The action of two major C. lanceolata ACP isoforms (ACP 1 and ACP 2) compared to ACP from Escherichia coli was monitored by saponification of the corresponding FAS products with subsequent analysis of the liberated fatty acids by high-performance liquid chromatography. In a second approach the preference of the medium-chain acyl-ACP-specific thioesterase (EC 3.1.2.14) of C. lanceolata seeds for the hydrolysis of acyl-ACPs prepared from the three ACP types was investigated. Both ACP isoforms from C. lanceolata seeds supported the synthesis of medium-chain fatty acids in a reconstituted FAS reaction of spinach leaf extracts. Compared to the isoform ACP 1, ACP 2 was more effective in supporting the synthesis of such fatty acids in the FAS reaction of rape seed extracts and caused a higher accumulation of FAS products in all experiments. No preference of the medium-chain thioesterase for one specific ACP isoform was observed. The results indicate that the presence of ACP 2 is essential for the synthesis of decanoic acid in C. lanceolata seeds, and its expression in the phase of accumulation of high levels of this fatty acid provides an additional and highly efficient cofactor for stimulating the FAS reaction.
Heimer, Gali; Kerätär, Juha M; Riley, Lisa G; Balasubramaniam, Shanti; Eyal, Eran; Pietikäinen, Laura P; Hiltunen, J Kalervo; Marek-Yagel, Dina; Hamada, Jeffrey; Gregory, Allison; Rogers, Caleb; Hogarth, Penelope; Nance, Martha A; Shalva, Nechama; Veber, Alvit; Tzadok, Michal; Nissenkorn, Andreea; Tonduti, Davide; Renaldo, Florence; Kraoua, Ichraf; Panteghini, Celeste; Valletta, Lorella; Garavaglia, Barbara; Cowley, Mark J; Gayevskiy, Velimir; Roscioli, Tony; Silberstein, Jonathon M; Hoffmann, Chen; Raas-Rothschild, Annick; Tiranti, Valeria; Anikster, Yair; Christodoulou, John; Kastaniotis, Alexander J; Ben-Zeev, Bruria; Hayflick, Susan J
2016-12-01
Mitochondrial fatty acid synthesis (mtFAS) is an evolutionarily conserved pathway essential for the function of the respiratory chain and several mitochondrial enzyme complexes. We report here a unique neurometabolic human disorder caused by defective mtFAS. Seven individuals from five unrelated families presented with childhood-onset dystonia, optic atrophy, and basal ganglia signal abnormalities on MRI. All affected individuals were found to harbor recessive mutations in MECR encoding the mitochondrial trans-2-enoyl-coenzyme A-reductase involved in human mtFAS. All six mutations are extremely rare in the general population, segregate with the disease in the families, and are predicted to be deleterious. The nonsense c.855T>G (p.Tyr285 ∗ ), c.247_250del (p.Asn83Hisfs ∗ 4), and splice site c.830+2_830+3insT mutations lead to C-terminal truncation variants of MECR. The missense c.695G>A (p.Gly232Glu), c.854A>G (p.Tyr285Cys), and c.772C>T (p.Arg258Trp) mutations involve conserved amino acid residues, are located within the cofactor binding domain, and are predicted by structural analysis to have a destabilizing effect. Yeast modeling and complementation studies validated the pathogenicity of the MECR mutations. Fibroblast cell lines from affected individuals displayed reduced levels of both MECR and lipoylated proteins as well as defective respiration. These results suggest that mutations in MECR cause a distinct human disorder of the mtFAS pathway. The observation of decreased lipoylation raises the possibility of a potential therapeutic strategy. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Glukhova, Xenia A; Trizna, Julia A; Proussakova, Olga V; Gogvadze, Vladimir; Beletsky, Igor P
2018-01-22
Fas-ligand/CD178 belongs to the TNF family proteins and can induce apoptosis through death receptor Fas/CD95. The important requirement for Fas-ligand-dependent cell death induction is its localization to rafts, cholesterol- and sphingolipid-enriched micro-domains of membrane, involved in regulation of different signaling complexes. Here, we demonstrate that Fas-ligand physically associates with caveolin-1, the main protein component of rafts. Experiments with cells overexpressing Fas-ligand revealed a FasL N-terminal pre-prolin-rich region, which is essential for the association with caveolin-1. We found that the N-terminal domain of Fas-ligand bears two caveolin-binding sites. The first caveolin-binding site binds the N-terminal domain of caveolin-1, whereas the second one appears to interact with the C-terminal domain of caveolin-1. The deletion of both caveolin-binding sites in Fas-ligand impairs its distribution between cellular membranes, and attenuates a Fas-ligand-induced cytotoxicity. These results demonstrate that the interaction of Fas-ligand and caveolin-1 represents a molecular basis for Fas-ligand translocation to rafts, and the subsequent induction of Fas-ligand-dependent cell death. A possibility of a similar association between other TNF family members and caveolin-1 is discussed.
Fas-Fas Ligand: Checkpoint of T Cell Functions in Multiple Sclerosis.
Volpe, Elisabetta; Sambucci, Manolo; Battistini, Luca; Borsellino, Giovanna
2016-01-01
Fas and Fas Ligand (FasL) are two molecules involved in the regulation of cell death. Their interaction leads to apoptosis of thymocytes that fail to rearrange correctly their T cell receptor (TCR) genes and of those that recognize self-antigens, a process called negative selection; moreover, Fas-FasL interaction leads to activation-induced cell death, a form of apoptosis induced by repeated TCR stimulation, responsible for the peripheral deletion of activated T cells. Both control mechanisms are particularly relevant in the context of autoimmune diseases, such as multiple sclerosis (MS), where T cells exert an immune response against self-antigens. This concept is well demonstrated by the development of autoimmune diseases in mice and humans with defects in Fas or FasL. In recent years, several new aspects of T cell functions in MS have been elucidated, such as the pathogenic role of T helper (Th) 17 cells and the protective role of T regulatory (Treg) cells. Thus, in this review, we summarize the role of the Fas-FasL pathway, with particular focus on its involvement in MS. We then discuss recent advances concerning the role of Fas-FasL in regulating Th17 and Treg cells' functions, in the context of MS.
Vāvere, Amy L; Kridel, Steven J; Wheeler, Frances B; Lewis, Jason S
2008-02-01
Although it is accepted that the metabolic fate of 1-(11)C-acetate is different in tumors than in myocardial tissue because of different clearance patterns, the exact pathway has not been fully elucidated. For decades, fatty acid synthesis has been quantified in vitro by the incubation of cells with (14)C-acetate. Fatty acid synthase (FAS) has been found to be overexpressed in prostate carcinomas, as well as other cancers, and it is possible that imaging with 1-(11)C-acetate could be a marker for its expression. In vitro and in vivo uptake experiments in prostate tumor models with 1-(11)C-acetate were performed both with and without blocking of fatty acid synthesis with either C75, an inhibitor of FAS, or 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase (ACC). FAS levels were measured by Western blot and immunohistochemical techniques for comparison. In vitro studies in 3 different prostate tumor models (PC-3, LNCaP, and 22Rv1) demonstrated blocking of 1-(11)C-acetate accumulation after treatment with both C75 and TOFA. This was further shown in vivo in PC-3 and LNCaP tumor-bearing mice after a single treatment with C75. A positive correlation between 1-(11)C-acetate uptake into the solid tumors and FAS expression levels was found. Extensive involvement of the fatty acid synthesis pathway in 1-(11)C-acetate uptake in prostate tumors was confirmed, leading to a possible marker for FAS expression in vivo by noninvasive PET.
Gemcitabine sensitizes lung cancer cells to Fas/FasL system-mediated killing
Siena, Liboria; Pace, Elisabetta; Ferraro, Maria; Di Sano, Caterina; Melis, Mario; Profita, Mirella; Spatafora, Mario; Gjomarkaj, Mark
2014-01-01
Gemcitabine is a chemotherapy agent commonly used in the treatment of non-small cell lung cancer (NSCLC) that has been demonstrated to induce apoptosis in NSCLC cells by increasing functionally active Fas expression. The aim of this study was to evaluate the Fas/Fas ligand (FasL) system involvement in gemcitabine-induced lung cancer cell killing. NSCLC H292 cells were cultured in the presence or absence of gemcitabine. FasL mRNA and protein were evaluated by real-time PCR, and by Western blot and flow cytometry, respectively. Apoptosis of FasL-expressing cells was evaluated by flow cytometry, and caspase-8 and caspase-3 activation by Western blot and a colorimetric assay. Cytotoxicity of lymphokine-activated killer (LAK) cells and malignant pleural fluid lymphocytes against H292 cells was analysed in the presence or absence of the neutralizing anti-Fas ZB4 antibody, by flow cytometry. Gemcitabine increased FasL mRNA and total protein expression, the percentage of H292 cells bearing membrane-bound FasL (mFasL) and of mFasL-positive apoptotic H292 cells, as well as caspase-8 and caspase-3 cleavage. Moreover, gemcitabine increased CH11-induced caspase-8 and caspase-3 cleavage and proteolytic activity. Cytotoxicity of LAK cells and pleural fluid lymphocytes was increased against gemcitabine-treated H292 cells and was partially inhibited by ZB4 antibody. These results demonstrate that gemcitabine: (i) induces up-regulation of FasL in lung cancer cells triggering cell apoptosis via an autocrine/paracrine loop; (ii) induces a Fas-dependent apoptosis mediated by caspase-8 and caspase-3 activation; (iii) enhances the sensitivity of lung cancer cells to cytotoxic activity of LAK cells and malignant pleural fluid lymphocytes, partially via Fas/FasL pathway. Our data strongly suggest an active involvement of the Fas/FasL system in gemcitabine-induced lung cancer cell killing. PMID:24128051
Fas/Fas Ligand pathways gene polymorphisms in pediatric renal allograft rejection.
Fadel, Fatina I; Elshamaa, Manal F; Salah, Ahmed; Nabhan, Marwa; Rasheed, Maha; Kamel, Solaf; Kandil, Dina; Thabet, Eman H
2016-07-01
An essential milestone in pediatric transplantation is to find noninvasive biomarkers to monitor acute rejection (AR). In this retrospective (Case-control) study, we examined the role of Fas -670A/G and Fas Ligand (FasL) -843C/T gene polymorphisms in allograft nephropathy in pediatric renal transplant recipients. In 47 pediatric kidney transplant recipients and 20 healthy controls, Fas -670A/G and FasL -843C/T gene polymorphisms as well as serum soluble Fas Ligand level (sFasL) were measured. Serum sFasL levels were significantly higher in transplant recipients children than that in controls (548.25±298.64pg/ml vs 143.17±44.55pg/ml, p=0.0001). There was no significant difference between patients with AR and those without AR in regards to serum sFasL levels (567.70±279.87pg/ml vs 507.85±342.80pg/ml, p=0.56). Fas -670A/G genotypes or alleles were not significantly different between controls and transplant recipients and among transplant recipients with and without AR. (P>0.05 for all). FasL -843C/T genotypes were not different between transplant recipients and controls and among transplant recipients with and without AR (P>0.05 for all). However, Frequency of C allele in transplant patients was significantly higher than that in the control group (44.68% vs 25%, P=0.03). FasL -843C/T alleles were significantly different between patients with and without AR (P=0.03). The percentages of C allele were higher in children with AR (58.82% vs 36.67%). We found that serum FasL and serum creatinine were variables that were independently associated with AR. This study suggests that FasL gene polymorphisms in peripheral blood might be accurate in detecting cellular AR. Copyright © 2016 Elsevier B.V. All rights reserved.
Yu, Hongliang; He, Jian; Lu, Qian; Huo, Da; Yuan, Shanmei; Zhou, Zhengyang; Xu, Peipei; Hu, Yong
2016-11-09
Emerging evidence suggest that the introduction of Fas ligand (FasL) can enhance the Fas-dependent apoptosis and induce durable immune responses against tumor. However, selective triggering of apoptosis in tumor cells while sparing normal cells remains a great challenge for the application of FasL-based therapeutic strategies. Herein, smart nanoparticles (NPs) with a sandwich structure were fabricated. These NPs consist of a matrix metalloproteinase (MMP) cleavable PEG outer layer, an anti-Fas antibody middle layer, and a camptothecin (CPT)-loaded inner core. They could accumulate at a tumor site by the enhanced permeability and retention (EPR) effect. The removable PEG layer protects the cytotoxic anti-Fas antibody from premature contact with normal tissues, thus avoiding the unexpected lethal side effect before they reach the tumor site. Due to the high level of MMP expressed by tumor cells inside the tumor tissue, these NPs would shed their PEG layers, resulting in the exposure of anti-Fas antibody to bind the Fas receptor and triggering the apoptosis of tumor cells. Results of Western blot confirmed that these NPs could mimic the function of activated cytotoxic lymphocyte (CTL) to activate the Fas-FasL apoptosis pathway of tumor cells. With the aid of CPT payload, these anti-Fas antibody conjugated NPs achieved a high tumor inhibition in the B16 allograft tumor animal model. The design of these NPs provides a method for delivering cytotoxic ligand to targeting tissue, which may be valuable in cancer therapy.
USDA-ARS?s Scientific Manuscript database
Producing unusual fatty acids (FAs) in crop plants has been a long-standing goal of green chemistry. However, expression of the enzymes that catalyze the primary synthesis of these unusual FAs in transgenic plants typically results in low levels of the desired FA. For example, seed-specific expressi...
Lee, Wilson D; Flynn, Andrew N; LeBlanc, Justin M; Merrill, John K; Dick, Paul; Morck, Douglas W; Buret, Andre G
2004-01-01
The pathology of bacterial pneumonia, such as seen in the bovine lung infected with Mannheimia haemolytica, is due to pathogen virulence factors and to inflammation initiated by the host. Tilmicosin is a macrolide effective in treating bacterial pneumonia and recent findings suggest that this antibiotic may provide anti-inflammatory benefits by inducing polymorphonuclear neutrophilic leukocyte (PMN) apoptosis. Using an in vitro bovine system, we examined the cell-specificity of tilmicosin, characterized the changes in spontaneous leukotriene B4 (LTB4) synthesis by PMN exposed to the macrolide, and assessed its effects on PMN Fas expression. Previous findings demonstrated that tilmicosin is able to induce PMN apoptosis. These results were confirmed in this study by the Annexin-V staining of externalized phosphatidylserine and the analysis with flow cytometry. The cell-specificity of tilmicosin was assessed by quantification of apoptosis in bovine PMN, mononuclear leukocytes, monocyte-derived macrophages, endothelial cells, epithelial cells, and fibroblasts cultured with the macrolide. The effect of tilmicosin on spontaneous LTB4 production by PMN was evaluated via an enzyme-linked immunosorbent assay. Finally, the mechanisms of tilmicosin-induced PMN apoptosis were examined by assessing the effects of tilmicosin on surface Fas expression on PMN. Tilmicosin-induced apoptosis was found to be at least partially cell-specific, as PMN were the only cell type tested to die via apoptosis in response to incubation with tilmicosin. PMN incubated with tilmicosin under conditions that induce apoptosis spontaneously produced less LTB4, but did not exhibit altered Fas expression. In conclusion, tilmicosin-induced apoptosis is specific to PMN, inhibits spontaneous LTB4 production, and occurs through a pathway independent of Fas upregulation.
Zhang, Yuwen; Rao, Enyu; Zeng, Jun; Hao, Jiaqing; Sun, Yanwen; Liu, Shujun; Sauter, Edward R.; Bernlohr, David A.; Cleary, Margot P.; Suttles, Jill; Li, Bing
2016-01-01
Macrophages play a critical role in obesity-associated chronic inflammation and disorders. However, the molecular mechanisms underlying the response of macrophages to elevated fatty acids (FAs) and their contribution to metabolic inflammation in obesity remain to be fully elucidated. Here, we report a new mechanism by which dietary FAs, in particular saturated FAs, are able to directly trigger macrophage cell death. We demonstrated that excess saturated FAs, but not unsaturated FAs, induced the production of cytotoxic ceramides in macrophage cell lines. Most importantly, expression of adipose fatty acid binding protein (A-FABP) in macrophages facilitated metabolism of excess saturated FAs for ceramide synthesis. Inhibition or deficiency of A-FABP in macrophage cell lines decreased saturated FA-induced ceramide production, thereby resulting in reduced cell death. Furthermore, we validated the role of A-FABP in promoting saturated FA-induced macrophage cell death with primary bone-marrow derived macrophages and high-fat diet-induced obese mice. Altogether, our data reveal that excess dietary saturated FAs may serve as direct triggers in induction of ceramide production and macrophage cell death through elevated expression of A-FABP, thus establishing A-FABP as a new molecular sensor in triggering macrophage-associated sterile inflammation in obesity. PMID:27920274
Involvement of Fas/FasL pathway in the murine model of atopic dermatitis.
Bień, Karolina; Żmigrodzka, Magdalena; Orłowski, Piotr; Fruba, Aleksandra; Szymański, Łukasz; Stankiewicz, Wanda; Nowak, Zuzanna; Malewski, Tadeusz; Krzyżowska, Małgorzata
2017-08-01
The aim of this study was to elucidate the role of apoptosis mediated through Fas/FasL pathway using the mouse model of atopic dermatitis (AD). AD was induced by epicutaneous application of ovalbumin (OVA) in wild-type C57BL/6, B6. MRL-Faslpr/J (Fas-) and B6Smn.C3-Faslgld/J (FasL-) mouse strains. Skin samples were subjected to staining for Fas/FasL expression, M30 epitope and assessment of inflammatory response via immunohistochemical staining. Cytokine and chemokine production was assessed by real-time PCR. In comparison to wild-type mice, OVA sensitization of Fas- and FasL-deficient mice led to increased epidermal and dermal thickness, collagen deposition and local inflammation consisting of macrophages, neutrophils and CD4+ T cells. Fas- and FasL-deficient mice showed increased total counts of regulatory T cells (Tregs) and IgE levels in blood as well as increased expression of IL-1β, IL-4, IL-5, IL-13 and TGF-1β mRNA in comparison to wild-type mice. On the other hand, expression of CXCL9 and CXCL10, IL-17 mRNAs in the skin samples in Fas- and FasL-deficient mice was decreased. Our results show that lack of the Fas-induced apoptosis leads to exacerbation of AD characteristics such as Th2 inflammation and dermal thickening. Therefore, Fas receptor can play an important role in AD pathogenesis by controlling development of the local inflammation.
Relationship between Fas and Fas Ligand gene polymorphisms and pre-eclampsia.
Masoumi, Elham; Tavakkol-Afshari, Jalil; Nikpoor, Amin Reza; Ghaffari-Nazari, Haniyeh; Tahaghoghi-Hajghorbani, Sahar; Jalali, Seyed Amir
2016-10-01
In normal pregnancy, the Th1 subtype, responsible for the production of inflammatory cytokines, is reduced, and the Th2 subtype is increased to prohibit inflammation. In pre-eclampsia, the Th1 cell population is increased; thus, subsequent inflammation and trophoblast destruction occur. Polymorphisms in the Fas and Fas Ligand (FasL) promoter regions can influence Fas and FasL expression and accused to increase of Th1 subtype. DNA samples from 153 pregnant women with pre-eclampsia and 140 controls were genotyped through polymerase chain reaction-restriction fragment length polymorphism. A Fisher's exact test was used to compare the distribution of individual polymorphisms. Fas-1377 AA, AG and GG genotypes were observed in 2.61%, 18.30% and 79.08% in the pre-eclampsia group opposed to 0%, 27.14% and 72.85% in the control group (P = 0.037), respectively. Fas-670 AA, AG and GG genotypes were observed in 37.9%, 41.8% and 20.3% of pre-eclampsia patients compared with 33.6%, 50.7% and 15.7% in healthy pregnant women (P = 0.291), respectively. No statically significant differences in the FasL-844 genotype were observed between the groups (P = 0.69). The Fas-1377G > A polymorphism is associated with a higher risk of pre-eclampsia. © 2016 Japan Society of Obstetrics and Gynecology.
Pizer, E S; Thupari, J; Han, W F; Pinn, M L; Chrest, F J; Frehywot, G L; Townsend, C A; Kuhajda, F P
2000-01-15
A biologically aggressive subset of human breast cancers and other malignancies is characterized by elevated fatty-acid synthase (FAS) enzyme expression, elevated fatty acid (FA) synthesis, and selective sensitivity to pharmacological inhibition of FAS activity by cerulenin or the novel compound C75. In this study, inhibition of FA synthesis at the physiologically regulated step of carboxylation of acetyl-CoA to malonyl-CoA by 5-(tetradecyloxy)-2-furoic acid (TOFA) was not cytotoxic to breast cancer cells in clonogenic assays. FAS inhibitors induced a rapid increase in intracellular malonyl-CoA to several fold above control levels, whereas TOFA reduced intracellular malonyl-CoA by 60%. Simultaneous exposure of breast cancer cells to TOFA and an FAS inhibitor resulted in significantly reduced cytotoxicity and apoptosis. Subcutaneous xenografts of MCF7 breast cancer cells in nude mice treated with C75 showed FA synthesis inhibition, apoptosis, and inhibition of tumor growth to less than 1/8 of control volumes, without comparable toxicity in normal tissues. The data suggest that differences in intermediary metabolism render tumor cells susceptible to toxic fluxes in malonyl-CoA, both in vitro and in vivo.
Prognostic significance of Fas and Fas ligand system-associated apoptosis in gastric cancer.
Ohno, S; Tachibana, M; Shibakita, M; Dhar, D K; Yoshimura, H; Kinugasa, S; Kubota, H; Masunaga, R; Nagasue, N
2000-12-01
Previous studies indicate that gastric carcinomas express Fas ligand and down-regulate Fas to escape from the host immune attack; however, the prognostic importance of Fas/FasL expression in this tumor is yet to be evaluated. Specimens from 87 gastric carcinoma patients of different stages treated in a defined period with curative intent were evaluated for apoptosis, Fas, FasL, and CD8 expression using an immunohistochemical method. The percentage of terminal deoxynucleotidyl transferase-mediated dUTP nick-end labeling (TUNEL)-positive apoptotic cells expressed as apoptotic index (AI) was higher in 43 patients when the cut-off value was set at the median value. There were no significant correlations between AI and clinicopathologic parameters. Thirty-nine patients showed a high number of CD8+ cells within cancer nests. Positive FasL and Fas expression was seen in 53 and 72 patients, respectively. CD8 and FasL expressions were related only to patients' age. Fas expression had significant correlations with tumor invasion and Lauren classification. There were significant direct correlations between AI and number of nest CD8+ cells and between AI and grade of Fas expression. Apoptotic index, pT stage, CD8 expression, and Fas expression were identified as independent prognostic factors. Spontaneous apoptosis in gastric carcinoma may be an independent prognosticator for survival and is significantly influenced by tumor Fas expression and number of nest CD8 + cells.
USDA-ARS?s Scientific Manuscript database
New poly-phenolic branched-chain fatty acid (poly-PBC-FA) products were synthesized from a combination of soybean fatty acids and phenolic materials through a highly efficient zeolite catalyzed arylation method. These poly-PBC-FAs are liquid at room temperature and do not have the unpleasant odor li...
PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one
Dong, Liang; Zou, Hechang; Yuan, Chong; Hong, Yu H.; Kuklev, Dmitry V.; Smith, William L.
2016-01-01
Prostaglandin endoperoxide H synthases (PGHSs), also called cyclooxygenases (COXs), convert arachidonic acid (AA) to PGH2. PGHS-1 and PGHS-2 are conformational heterodimers, each composed of an (Eallo) and a catalytic (Ecat) monomer. Previous studies suggested that the binding to Eallo of saturated or monounsaturated fatty acids (FAs) that are not COX substrates differentially regulate PGHS-1 versus PGHS-2. Here, we substantiate and expand this concept to include polyunsaturated FAs known to modulate COX activities. Non-substrate FAs like palmitic acid bind Eallo of PGHSs stimulating human (hu) PGHS-2 but inhibiting huPGHS-1. We find the maximal effects of non-substrate FAs on both huPGHSs occurring at the same physiologically relevant FA/AA ratio of ∼20. This inverse allosteric regulation likely underlies the ability of PGHS-2 to operate at low AA concentrations, when PGHS-1 is effectively latent. Unlike FAs tested previously, we observe that C-22 FAs, including ω-3 fish oil FAs, have higher affinities for Ecat than Eallo subunits of PGHSs. Curiously, C-20 ω-3 eicosapentaenoate preferentially binds Ecat of huPGHS-1 but Eallo of huPGHS-2. PGE2 production decreases 50% when fish oil consumption produces tissue EPA/AA ratios of ≥0.2. However, 50% inhibition of huPGHS-1 itself is only seen with ω-3 FA/AA ratios of ≥5.0. This suggests that fish oil-enriched diets disfavor AA oxygenation by altering the composition of the FA pool in which PGHS-1 functions. The distinctive binding specificities of PGHS subunits permit different combinations of non-esterified FAs, which can be manipulated dietarily, to regulate AA binding to Eallo and/or Ecat thereby controlling COX activities. PMID:26703471
FAS-antisense 1 lncRNA and production of soluble versus membrane Fas in B-cell lymphoma
Sehgal, Lalit; Mathur, Rohit; Braun, Frank K.; Wise, Jillian F.; Berkova, Zuzana; Neelapu, Sattva; Kwak, Larry W.; Samaniego, Felipe
2018-01-01
Impaired Fas-mediated apoptosis is associated with poor clinical outcomes and cancer chemoresistance. Soluble Fas receptor (sFas), produced by skipping of exon 6, inhibits apoptosis by sequestering Fas ligand. Serum sFas is associated with poor prognosis of non-Hodgkin's lymphomas. We found that the alternative splicing of Fas in lymphomas is tightly regulated by a lncRNA corresponding to an antisense transcript of Fas (FAS-AS1). Levels of FAS-AS1 correlate inversely with production of sFas and FAS-AS1 binding to the RBM5 inhibits RBM5-mediated exon 6 skipping. EZH2, often mutated or overexpressed in lymphomas, hyper-methylates the FAS-AS1 promoter and represses the FAS-AS1 expression. EZH2-mediated repression of FAS-AS1 promoter can be released by DZNeP or overcome by ectopic expression of FAS-AS1, both of which increase levels of FAS-AS1 and correspondingly decrease expression of sFas. Treatment with Bruton’s tyrosine kinase (BTK) inhibitor or EZH2 knockdown decreases the levels of EZH2, RBM5 and sFas thereby enhances Fas-mediated apoptosis. This is the first report showing functional regulation of Fas repression by its antisense RNA. Our results reveal new therapeutic targets in lymphomas and provide a rationale for the use of EZH2 inhibitors or ibrutinib in combination with chemotherapeutic agents that recruit Fas for effective cell killing. PMID:24811343
Acetate Dose-Dependently Stimulates Milk Fat Synthesis in Lactating Dairy Cows.
Urrutia, Natalie L; Harvatine, Kevin J
2017-05-01
Background: Acetate is a short-chain fatty acid (FA) that is especially important to cows because it is the major substrate for de novo FA synthesis. However, the effect of acetate supply on mammary lipid synthesis is not clear. Objective: The objective of this experiment was to determine the effect of increasing acetate supply on milk fat synthesis in lactating dairy cows. Methods: Six multiparous lactating Holstein cows were randomly assigned to treatments in a replicated design to investigate the effect of acetate supply on milk fat synthesis. Treatments were 0 (control), 5, 10, and 15 mol acetate/d continuously infused into the rumen for 4 d. Rumen short-chain FAs, plasma hormones and metabolites, milk fat concentration, and milk FA profile were analyzed on day 4 of each treatment. Polynomial contrasts were used to test the linear and quadratic effects of increasing acetate supply. Results: Acetate increased milk fat yield quadratically ( P < 0.01) by 7%, 16%, and 14% and increased milk fat concentration linearly ( P < 0.001) by 6%, 9%, and 11% for 5, 10, and 15 mol acetate/d, respectively, compared with the control treatment. Increased milk fat yield predominantly was due to a linear increase in 16-carbon FAs ( P < 0.001) and a quadratic increase in de novo synthesized FAs (<16-carbon FAs; P < 0.01), indicating that there was stimulation of de novo synthesis pathways. Apparent transfer of acetate to milk fat was 33.4%, 36.2%, and 20.6% for 5, 10, and 15 mol/d, respectively. Acetate infusion linearly increased the relative concentration of rumen acetate ( P < 0.001) before feeding, but not after feeding. Acetate linearly increased plasma ß-hydroxybutyric acid by 29%, 50%, and 78%, respectively, after feeding compared with the control treatment ( P < 0.01). Conclusions: Increasing acetate supply to lactating cows increases milk fat synthesis, suggesting that nutritional strategies that increase ruminal acetate absorption would be expected to increase milk fat
Inhibition of Fas (CD95) expression and Fas-mediated apoptosis by oncogenic Ras.
Fenton, R G; Hixon, J A; Wright, P W; Brooks, A D; Sayers, T J
1998-08-01
The ras oncogene plays an important role in the multistep progression to cancer by activation of signal transduction pathways that contribute to aberrant growth regulation. Although many of these effects are cell autonomous, the ras oncogene also regulates the expression of genes that alter host/tumor interactions. We now extend the mechanisms through which ras promotes tumor survival by demonstrating that oncogenic Ras inhibits expression of the fas gene and renders Ras-transformed cells resistant to Fas-induced apoptosis. A panel of Ras-transformed clones exhibited a marked inhibition in fas mRNA and Fas cell surface expression as compared with untransformed parental cell lines. Fas expression was induced by culture in the presence of IFN-gamma + tumor necrosis factor alpha; however, the maximal level attained in Ras transformants was approximately 10-fold below the level of untransformed cells. Whereas untransformed cells were sensitive to apoptotic death induced by cross-linking surface Fas (especially after cytokine treatment), Ras-transformed cells were very resistant to Fas-induced death even under the most stringent assay conditions. To demonstrate that this resistance was mediated by oncogenic Ras and not secondary genetic events, pools of Ras-transformed cells were generated using a highly efficient retroviral transduction technique. Transformed pools were assayed 6 days after infection and demonstrated a marked decrease in fas gene expression and Fas-mediated apoptosis. Oncogenic Ras did not promote general resistance to apoptosis, because ectopic expression of a fas cDNA in Ras-transformed cells restored sensitivity to Fas-induced apoptosis. These data indicate that oncogenic Ras inhibits basal levels of expression of the fas gene, and although cytokine signal transduction pathways are functional in these cells, the level of surface Fas expression remains below the threshold required for induction of apoptosis. These data identify a mechanism by which
Radiation and stress-induced apoptosis: A role for Fas/Fas ligand interactions
Reap, Elizabeth A.; Roof, Kevin; Maynor, Kenrick; Borrero, Michelle; Booker, Jessica; Cohen, Philip L.
1997-01-01
The lpr gene encodes a defective form of Fas, a cell surface protein that mediates apoptosis. This defect blocks apoptotic deletion of autoreactive T and B cells, leading to lymphoproliferation and lupus-like autoantibody production. The effects of the lpr Fas mutation on other kinds of physiologically relevant apoptosis are largely undocumented. To assess whether some of the apoptosis known to occur after ionizing radiation might be mediated by Fas/Fas ligand (FasL) interactions, we quantitated in vitro apoptosis by flow cytometry measurement of DNA content in splenic T and B cells from irradiated 5- to 8-month-old B6/lpr mice. Total apoptosis of both lpr and control cells was substantial after treatment; however there was a significant difference between B6 (73%) and lpr (25%) lymphocyte apoptosis. Thy1, CD4, CD8, and IgM cells from lpr showed much lower levels of apoptosis than control cells after irradiation. Apoptosis induced by heat shock was also impaired in lpr. The finding that γ-irradiation increased Fas expression on B6 cells and that irradiation-induced apoptosis could be blocked with a Fas–Fc fusion protein further supported the possible involvement of Fas in this form of apoptosis. Fas/FasL interactions may thus play an important role in identifying and eliminating damaged cells after γ-irradiation and other forms of injury. PMID:9159145
FAS and FAS-L Genotype and Expression in Patients With Recurrent Pregnancy Loss
Banzato, Priscilla Chamelete Andrade; Daher, Silvia; Traina, Évelyn; Torloni, Maria Regina; Gueuvoghlanian-Silva, Bárbara Yasmin; Puccini, Renata Fiorini; Pendeloski, Karen Priscilla Tezotto
2013-01-01
We assessed FAS and FAS-L gene polymorphisms and messenger RNA (mRNA) levels in patients with recurrent pregnancy loss (RPL). This case–control study compared 129 women with RPL with 235 healthy multiparous women (control group). Genomic DNA and total mRNA were extracted from whole blood, and polymorphisms genotyping was performed by polymerase chain reaction (PCR). Messenger RNA expression levels were analyzed by real-time PCR. Data were analyzed by chi-square and Fisher exact tests; P < .05 was considered significant. There were no significant differences in the FAS (670 A/G) genotype or allelic frequencies between the RPL and control groups. We found significant differences in the FAS-L (844 C/T) genotype and allelic frequencies between women with RPL and controls. Patients with RPL had significantly higher FAS-L expression. Our data suggest that FAS-L gene polymorphism is associated with increased susceptibility to RPL. Moreover, women with RPL seem to abnormally express FAS-FAS-L molecules. PMID:23420824
NF-κB Directly Regulates Fas Transcription to Modulate Fas-mediated Apoptosis and Tumor Suppression*
Liu, Feiyan; Bardhan, Kankana; Yang, Dafeng; Thangaraju, Muthusamy; Ganapathy, Vadivel; Waller, Jennifer L.; Liles, Georgia B.; Lee, Jeffrey R.; Liu, Kebin
2012-01-01
Fas is a member of the death receptor family. Stimulation of Fas leads to induction of apoptotic signals, such as caspase 8 activation, as well as “non-apoptotic” cellular responses, notably NF-κB activation. Convincing experimental data have identified NF-κB as a critical promoter of cancer development, creating a solid rationale for the development of antitumor therapy that suppresses NF-κB activity. On the other hand, compelling data have also shown that NF-κB activity enhances tumor cell sensitivity to apoptosis and senescence. Furthermore, although stimulation of Fas activates NF-κB, the function of NF-κB in the Fas-mediated apoptosis pathway remains largely undefined. In this study, we observed that deficiency of either Fas or FasL resulted in significantly increased incidence of 3-methylcholanthrene-induced spontaneous sarcoma development in mice. Furthermore, Fas-deficient mice also exhibited significantly greater incidence of azoxymethane and dextran sodium sulfate-induced colon carcinoma. In addition, human colorectal cancer patients with high Fas protein in their tumor cells had a longer time before recurrence occurred. Engagement of Fas with FasL triggered NF-κB activation. Interestingly, canonical NF-κB was found to directly bind to the FAS promoter. Blocking canonical NF-κB activation diminished Fas expression, whereas blocking alternate NF-κB increased Fas expression in human carcinoma cells. Moreover, although canonical NF-κB protected mouse embryo fibroblast (MEF) cells from TNFα-induced apoptosis, knocking out p65 diminished Fas expression in MEF cells, resulting in inhibition of FasL-induced caspase 8 activation and apoptosis. In contrast, knocking out p52 increased Fas expression in MEF cells. Our observations suggest that canonical NF-κB is a Fas transcription activator and alternate NF-κB is a Fas transcription repressor, and Fas functions as a suppressor of spontaneous sarcoma and colon carcinoma. PMID:22669972
Dysregulation of the Fas/FasL system in an experimental animal model of HELLP syndrome.
Gibbens, Jacob; Morris, Rachael; Bowles, Teylor; Spencer, Shauna-Kay; Wallace, Kedra
2017-04-01
Placental FasL is up-regulated in women with HELLP (hemolysis elevated liver enzyme and low platelet) syndrome and has been proposed to contribute to the liver damage seen in these patients. This study aimed to determine if an experimental rodent model of HELLP also had dysregulation of Fas/FasL compared to normal pregnant (NP) rats. We also set out to determine if blockade of the endothelin system regulated Fas/FasL expression in HELLP rats. On gestational day (GD) 12, sEng (7ug/kg) and sFlt-1 (4.7ug/kg) infusion began via mini-osmotic pump into NP rats. On GD19 plasma and tissue were collected and FasL and Fas were measured via enzyme linked immunosorbent assay and gene expression via real-time PCR. HELLP rats had significantly more circulating and placental FasL compared to NP rats, whereas hepatic FasL was decreased and placental Fas was increased compared to NP rats. Administration of an endothelin A receptor antagonist (ET A ) beginning on GD12 significantly decreased placental expression of Fas in HELLP rats. Liver mRNA transcript of Fas was significantly increased in HELLP rats compared to NP rats. These data suggest that rats in this experimental model of HELLP syndrome have abnormal expression of the Fas/FasL system. Future studies will examine the sources of Fas/FasL dysregulation in this model and if blockade could reduce some of the inflammation and hypertension associated with HELLP syndrome. Copyright © 2017 International Society for the Study of Hypertension in Pregnancy. Published by Elsevier B.V. All rights reserved.
Zepeda-Nuño, José Sergio; Guerrero-Velázquez, Celia; Del Toro-Arreola, Susana; Vega-Magaña, Natali; Ángeles-Sánchez, Julián; Haramati, Jesse; Pereira-Suárez, Ana L; Bueno-Topete, Miriam R
2017-04-01
ADAM10 has been implicated in the progression of various solid tumors. ADAM10 regulates the cleavage of the FasL ectodomain from the plasma membrane of different cell types, generating the soluble FasL fragment (sFasL). Currently, there are few studies in oral squamous cell carcinoma (OSCC) that correlate levels of ADAM10 and FasL in the tumor microenvironment with clinical parameters of the disease. To determine the expression of ADAM10, Fas, FasL and sFasL in patients with OSCC and its association with TNM stage. Twenty-five patients with OSCC and 25 healthy controls were included. Biopsies of tumor tissue from patients with OSCC and buccal mucosa in controls were obtained. ADAM10, Fas, and FasL were analyzed by Western blotting. sFasL was quantified by ELISA. ADAM10 and Fas decreased significantly in OSCC compared with controls. Relatedly, within the OSCC group, Fas and ADAM10 decreased in accordance with tumor disease stage; in stages I/II, as well as in tumors of smaller diameter (T1-T2), ADAM10 showed higher levels when compared to patients with T3-T4 tumors and in stage III-IV. FasL in the tumor microenvironment and serum FasL showed no significant differences between both groups. Levels of complete FasL and cleaved FasL were positively correlated in controls; this correlation is preserved in patients with tumors in early stages (I-II), but is lost in later stage (III-IV). The dysregulation of ADAM10, Fas and FasL could be useful indicators of the progression and severity of OSCC.
Li, Hua; Lü, Qing; Xue, Hui; Dong, Li-hua; Yang, Hui-jun
2008-07-01
To detect the expression of Heart or Muscle Fatty acid binding protein (H-FABP) and fatty acid synthase (FAS) in human breast cancer cells. The expression levels of FAS and H-FABP in 81 ductal infiltrating carcinoma (DIC) were detected by RT-PCR, immunohistochemistry and Western blot analysis. The possible associations of the expression of the two proteins with major clinicopathological factors were analyzed. The expression of both H-FABP and FAS increased in DIC cells than in adjacent normal cells. But less H-FABP and FAS were found in grade III DIC than in grade I and grade II DIC (P < 0.05). There was a positive correlation between the expression of H-FABP and FAS. No correlations between the expressions of two genes with other clinicopathological factors were found. The higher expression of H-FABP in grade I and II DIC suggests an early increased response to the over-expression of FAS. The parallel increase of H-FABP and FAS expressions marks increased breast cancer risk.
Huang, Donghua; Xiao, Jinrong; Deng, Xiangyu; Ma, Kaige; Liang, Hang; Shi, Deyao; Wu, Fashuai; Shao, Zengwu
2018-05-07
It was reported that Fas (rs1800682, rs2234767) and FasL (rs5030772, rs763110) gene polymorphism might be related to the risk of musculoskeletal degenerative diseases (MSDD), such as osteoarthritis (OA), intervertebral disc degeneration (IVDD) and rheumatoid arthritis (RA). However, data from different studies was inconsistent. Here we aim to elaborately summarize and explore the association between the Fas (rs1800682, rs2234767) and FasL (rs5030772, rs763110) and MSDD. Literatures were selected from PubMed, Web of Science, Embase, Scopus and Medline in English and VIP, SinoMed, Wanfang and the China National Knowledge Infrastructure (CNKI) in Chinese up to August 21, 2017. All the researches included are case-control studies about human. We calculated the pooled odds ratios (ORs) with 95% confidence intervals (95% CI) to evaluate the strengths of the associations of Fas (rs1800682, rs2234767) and FasL (rs5030772, rs763110) polymorphisms with MSDD risk. Eleven eligible studies for rs1800682 with 1930 cases and 1720 controls, 6 eligible studies for rs2234767 with 1794 cases and 1909 controls, 3 eligible studies for rs5030772 with 367 cases and 313 controls and 8 eligible studies for rs763110 with 2010 cases and 2105 controls were included in this analysis. The results showed that the G allele of Fas (rs1800682) is associated with an increased risk of IVDD in homozygote and recessive models. The G allele of Fas (rs2234767) is linked to a decreased risk of RA but an enhanced risk of OA in allele and recessive models. In addition, the T allele of FasL (rs763110) is correlated with a reduced risk of IVDD in all of models. However, no relationship was found between FasL (rs5030772) and these three types of MSDD in any models. Fas (rs1800682) and FasL (rs763110) polymorphism were associated with the risk of IVDD and Fas (rs2234767) was correlated to the susceptibility of OA and RA. Fas (rs1800682) and Fas (rs2234767) are more likely to be associated with MSDD for Chinese
Inorganic arsenic exposure increased expression of Fas and Bax gene in vivo and vitro.
He, Yuefeng; Zhang, Ruobing; Xiaoxiao, Song; Li, Shang; Xinan, Wu; Huang, Dahai
2018-06-01
Accumulating evidences have shown that apoptosis plays an important role in mediating the therapeutic effects and toxicity of arsenic. Fas and Bax genes are critical regulatory genes for apoptosis. In this study, we investigated the association between levels of Fas and Bax expression and the three arsenic species (inorganic arsenic (iAs), monomethylarsonic acid (MMA) and dimethylarsinic acid (DMA)) in vivo and vitro. Three arsenic species in urine were measured and levels of Fas and Bax expression were examined by the quantitative real-time PCR (qPCR) for all subjects. We found that Fas and Bax mRNA expression in the exposed group were significantly higher than that in the control group. The levels of gene expression were positively correlated with the concentrations of urinary iAs, MMA and DMA in all subjects. Sodium arsenite induced Fas and Bax mRNA expression, then MMA and DMA did not induce mRNA expression in MDA-MB-231 and XWLC-05 cells. The findings of the present study indicated that iAs, MMA, and DMA had different effects on expression of Bax and Fas gene. Copyright © 2017. Published by Elsevier B.V.
Fas and FasL genetic polymorphisms in women with recurrent pregnancy loss: a case-control study.
Han, Ae Ra; Choi, Young Min; Hong, Min A; Kim, Jin Ju; Lee, Sung Ki; Yang, Kwang Moon; Paik, Eun Chan; Jeong, Hyeon Jeong; Jun, Jong Kwan
2018-05-20
Aberrant apoptosis at the trophoblast-maternal interface and abnormal expression of Fas and Fas ligand (FasL) have been reported in complicated pregnancies with recurrent pregnancy losses (RPL) and preeclampsia. We assessed the prevalence of Fas and FasL genetic polymorphisms in Korean women with RPL and in fertile controls. In total, 306 women with RPL and 298 fertile controls were enrolled. Genotype distributions of Fas and FasL in RPL patients versus fertile controls were examined under the Hardy-Weinberg equilibrium. Fas -670 A/G genotype (AA versus AG versus GG, p = 0.340) and allele frequencies (A versus G, p = 0.412) were not different between the RPL and control groups. There was no difference in each Fas -1377 G/A and FasL -844 C/T genotype, and their allele frequencies. In addition, the unions of two zygosities of each genotype and their combined genotypes did not differ between two groups. No difference in the prevalence of Fas and FasL single-nucleotide polymorphisms (SNPs) was observed between women with RPL and fertile controls among Korean women. To determine the possibility of genetic polymorphisms in Fas and its ligand as risk factors for RPL, further studies in various races and a large study population are needed.
Fas/FasL gene polymorphism in patients with Hashimoto's thyroiditis in Turkish population.
Erdogan, M; Kulaksizoglu, M; Ganidagli, S; Berdeli, A
2017-01-01
Hashimoto's disease is a polygenic disorder with complex etiopathogenesis. Apoptosis is proposed as one of its mechanisms. The Fas/Fas ligand cascade represents a major pathway initiating apoptosis. This study aims to evaluate the influence of Fas and FasL gene polymorphism in Hashimoto's thyroiditis in Turkish population. A total of 112 patients with Hashimoto's thyroiditis and 112 cases of healthy control people were included in this study. The evaluation of genotype for Fas -670 A/G and FasL 843 C/T gene polymorphism was performed by using PCR-RFLP method. The FAS genotype and gene allele frequency distribution did differ between the control group (AA 36.6 %, AG 50.0 %, GG 13.4 %, A 61.6 %, G 38.4 %) and the Hashimoto's thyroiditis patients (AA 21.4 %, AG 50.9 %, GG 27.7 %, A 46.9 %, G 53.1 %) (p < 0.01). The evaluation of FasL genotype and gene allele frequency did not show statistically significant difference between the patient group (CC 27.7 %, CT 45.5 %, TT 26.8 %, C 50.4 %, T 49.6 %) and control group (CC 33.9 %, CT 44.6 %, TT 21,4 %, C 56.3 %, T 43.8 %) (p > 0.05). Gene polymorphism of Fas and G allele frequency may play a role in the regulation of apoptosis in thyroid autoimmune disorders. There is a need for further studies to clarify the genetic role of apoptosis in HT.
Impaired Fas-Fas Ligand Interactions Result in Greater Recurrent Herpetic Stromal Keratitis in Mice
Yin, Xiao-Tang; Keadle, Tammie L.; Hard, Jessicah; Herndon, John; Potter, Chloe A.; Del Rosso, Chelsea R.; Ferguson, Thomas A.; Stuart, Patrick M.
2015-01-01
Herpes simplex virus-1 (HSV-1) infection of the cornea leads to a potentially blinding condition termed herpetic stromal keratitis (HSK). Clinical studies have indicated that disease is primarily associated with recurrent HSK following reactivation of a latent viral infection of the trigeminal ganglia. One of the key factors that limit inflammation of the cornea is the expression of Fas ligand (FasL). We demonstrate that infection of the cornea with HSV-1 results in increased functional expression of FasL and that mice expressing mutations in Fas (lpr) and FasL (gld) display increased recurrent HSK following reactivation compared to wild-type mice. Furthermore, both gld and lpr mice took longer to clear their corneas of infectious virus and the reactivation rate for these strains was significantly greater than that seen with wild-type mice. Collectively, these findings indicate that the interaction of Fas with FasL in the cornea restricts the development of recurrent HSK. PMID:26504854
Impaired Fas-Fas Ligand Interactions Result in Greater Recurrent Herpetic Stromal Keratitis in Mice.
Yin, Xiao-Tang; Keadle, Tammie L; Hard, Jessicah; Herndon, John; Potter, Chloe A; Del Rosso, Chelsea R; Ferguson, Thomas A; Stuart, Patrick M
2015-01-01
Herpes simplex virus-1 (HSV-1) infection of the cornea leads to a potentially blinding condition termed herpetic stromal keratitis (HSK). Clinical studies have indicated that disease is primarily associated with recurrent HSK following reactivation of a latent viral infection of the trigeminal ganglia. One of the key factors that limit inflammation of the cornea is the expression of Fas ligand (FasL). We demonstrate that infection of the cornea with HSV-1 results in increased functional expression of FasL and that mice expressing mutations in Fas (lpr) and FasL (gld) display increased recurrent HSK following reactivation compared to wild-type mice. Furthermore, both gld and lpr mice took longer to clear their corneas of infectious virus and the reactivation rate for these strains was significantly greater than that seen with wild-type mice. Collectively, these findings indicate that the interaction of Fas with FasL in the cornea restricts the development of recurrent HSK.
Bień, K; Sobańska, Z; Sokołowska, J; Bąska, P; Nowak, Z; Winnicka, A; Krzyzowska, M
2016-04-01
Ectromelia virus (ECTV) is an orthopoxvirus (OPV) that causes mousepox, the murine equivalent of human smallpox. Fas receptor-Fas ligand (FasL) signaling is involved in apoptosis of immune cells and virus-specific cytotoxicity. The Fas/FasL pathway also plays an important role in controlling the local inflammatory response during ECTV infection. Here, the immune response to the ECTV Moscow strain was examined in Fas (-) (lpr), FasL (-) (gld) and C57BL6 wild-type mice. During ECTV-MOS infection, Fas- and FasL mice showed increased viral titers, decreased total numbers of NK cells, CD4(+) and CD8(+) T cells followed by decreased percentages of IFN-γ expressing NK cells, CD4(+) and CD8(+) T cells in spleens and lymph nodes. At day 7 of ECTV-MOS infection, Fas- and FasL-deficient mice had the highest regulatory T cell (Treg) counts in spleen and lymph nodes in contrast to wild-type mice. Furthermore, at days 7 and 10 of the infection, we observed significantly higher numbers of PD-L1-expressing dendritic cells in Fas (-) and FasL (-) mice in comparison to wild-type mice. Experiments in co-cultures of CD4(+) T cells and bone-marrow-derived dendritic cells showed that the lack of bilateral Fas-FasL signalling led to expansion of Tregs. In conclusion, our results demonstrate that during ECTV infection, Fas/FasL can regulate development of tolerogenic DCs and Tregs, leading to an ineffective immune response.
Fas and Fas ligand gene polymorphisms in Turkish patients with Familial Mediterranean Fever.
Ozel, Emine Gulce; Duran, Gulay Gulbol; Celik, Muhammet Murat; Duran, Nizami; Gunesacar, Ramazan
2017-08-05
Familial Mediterranean Fever (FMF) is an autosomal recessive autoinflammatory disorder characterized by recurrent fever, serositis, abdominal pain, arthritis, arthralgia and erysipelas like erythema. Fas and Fas ligand molecules play a central role in the apoptosis signaling of various cell types including neutrophils. Neutrophils are the major cell population involved in acute inflammation in patients with FMF and the role of Fas and Fas ligand molecules in this cells of FMF patients may be crucial. Therefore, in the present study, we aimed to investigate whether the Fas cell surface receptor gene (FAS); NM_000043.5: c.-671A>G (rs1800682, MvaI) and Fas ligand gene (FASLG), NM_000639.2: c.-844C>T (rs763110, BsrD1) functional polymorphisms in patients with FMF and their relation to the main clinical features of the disease. The polymorphisms in the promoter regions of FAS c.-671A>G and FASLG c.-844C>T were investigated in 97 non-related FMF patients and 70 non-related healthy controls by using PCR-RFLP technique. The frequencies of FAS c-671AG genotype and G allele were not significantly different between FMF patients and healthy subjects. The frequency of FASLG -844TC genotype was found significantly different between the patients with FMF and healthy controls whereas T or C allele frequency was not significantly different between the groups. Haplotype frequencies of the studied polymorphisms were also not significantly different between FMF patients and controls. There were no correlations between the studied FAS c.-671A>G and FASLG c.-844C>T polymorphisms and the main clinical features of FMF such as fever, arthritis, abdominal and chest pain, arthralgia and erysipelas-like erythema. Our findings suggest that FAS c.-671AG genotype or G allele and FASLG c.-844 allele are not to be a risk factor, whereas FASLG c.-844TC genotype may be protective in the studied Turkish population. According to our results we may suggest that although not statistically significant
The signaling pathways by which the Fas/FasL system accelerates oocyte aging.
Zhu, Jiang; Lin, Fei-Hu; Zhang, Jie; Lin, Juan; Li, Hong; Li, You-Wei; Tan, Xiu-Wen; Tan, Jing-He
2016-02-01
In spite of great efforts, the mechanisms for postovulatory oocyte aging are not fully understood. Although our previous work showed that the FasL/Fas signaling facilitated oocyte aging, the intra-oocyte signaling pathways are unknown. Furthermore, the mechanisms by which oxidative stress facilitates oocyte aging and the causal relationship between Ca2+ rises and caspase-3 activation and between the cell cycle and apoptosis during oocyte aging need detailed investigations. Our aim was to address these issues by studying the intra-oocyte signaling pathways for Fas/FasL to accelerate oocyte aging. The results indicated that sFasL released by cumulus cells activated Fas on the oocyte by increasing reactive oxygen species via activating NADPH oxidase. The activated Fas triggered Ca2+ release from the endoplasmic reticulum by activating phospholipase C-γ pathway and cytochrome c pathway. The cytoplasmic Ca2+ rises activated calcium/calmodulin-dependent protein kinase II (CaMKII) and caspase-3. While activated CaMKII increased oocyte susceptibility to activation by inactivating maturation-promoting factor (MPF) through cyclin B degradation, the activated caspase-3 facilitated further Ca2+releasing that activates more caspase-3 leading to oocyte fragmentation. Furthermore, caspase-3 activation and fragmentation were prevented in oocytes with a high MPF activity, suggesting that an oocyte must be in interphase to undergo apoptosis.
Li, Lei; Yao, Ya-Chao; Fang, Shu-Huan; Ma, Cai-Qi; Cen, Yi; Xu, Zu-Min; Dai, Zhi-Yu; Li, Cen; Li, Shuai; Zhang, Ting; Hong, Hong-Hai; Qi, Wei-Wei; Zhou, Ti; Li, Chao-Yang; Yang, Xia; Gao, Guo-Quan
2014-01-01
Pigment epithelium-derived factor (PEDF), a potent antiangiogenesis agent, has recently attracted attention for targeting tumor cells in several types of tumors. However, less is known about the apoptosis-inducing effect of PEDF on human lung cancer cells and the underlying molecular events. Here we report that PEDF has a growth-suppressive and proapoptotic effect on lung cancer xenografts. Accordingly, in vitro, PEDF apparently induced apoptosis in A549 and Calu-3 cells, predominantly via the Fas-L/Fas death signaling pathway. Interestingly, A549 and Calu-3 cells are insensitive to the Fas-L/Fas apoptosis pathway because of the low level of cell surface Fas. Our results revealed that, in addition to the enhancement of Fas-L expression, PEDF increased the sensitivity of A549 and Calu-3 cells to Fas-L-mediated apoptosis by triggering the translocation of Fas protein to the plasma membrane in a p53- and FAP-1-dependent manner. Similarly, the up-regulation of Fas-L by PEDF was also mediated by p53. Furthermore, peroxisome proliferator-activated receptor γ was determined to be the upstream regulator of p53. Together, these findings uncover a novel mechanism of tumor cell apoptosis induced by PEDF and provide a potential therapeutic strategy for tumors that are insensitive to Fas-L/Fas-dependent apoptosis because of a low level of cell surface Fas. PMID:25225287
Ibeagha-Awemu, Eveline M; Akwanji, Kingsley A; Beaudoin, Frédéric; Zhao, Xin
2014-02-17
Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3'UTR SNP (FADS2-23, rs109772589), and another 3'UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3'UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as potential genetic markers in breeding programs to
Kim, Eun Ju; Jin, Xing-Ji; Kim, Yeon Kyung; Oh, In Kyung; Kim, Ji Eun; Park, Chi-Hyun; Chung, Jin Ho
2010-01-01
Although fatty acids are known to be important in various skin functions, their roles on photoaging in human skin are poorly understood. We investigated the alteration of lipid metabolism in the epidermis by photoaging and acute UV irradiation in human skin. UV irradiated young volunteers (21-33 years, n=6) and elderly volunteers (70-75 years, n=7) skin samples were obtained by punch biopsy. Then the epidermis was separated from dermis and lipid metabolism was investigated. We observed that the amounts of free fatty acids (FFA) and triglycerides (TG) in the epidermis of photoaged or acutely UV irradiated human skin were significantly decreased. The expressions of genes related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element binding proteins (SREBPs), and peroxisome proliferator-activated receptors (PPARgamma) were also markedly decreased. To elucidate the significance of these changes of epidermal lipids in human skin, we investigated the effects of TG or various inhibitors for the enzymes involved in TG synthesis on the expression of matrix metalloproteinase-1 (MMP-1) in cultured human epidermal keratinocytes. We demonstrated that triolein (TG) reduced basal and UV-induced MMP-1 mRNA expression. In addition, each inhibitor for various lipid synthesis enzymes, such as TOFA (ACC inhibitor), cerulenin (FAS inhibitor) and trans-10, cis-12-CLA (SCD inhibitor), increased the MMP-1 expression significantly in a dose-dependent manner. We also demonstrated that triolein could inhibit cerulenin-induced MMP-1 expression. Furthermore, topical application of triolein (10%) significantly prevented UV-induced MMP-13, COX-2, and IL-1beta expression in hairless mice. Our results suggest that TG and FFA may play important roles in photoaging of human skin. Copyright 2009 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Tian, Hua; Yao, Shu-Tong; Yang, Na-Na; Ren, Jie; Jiao, Peng; Zhang, Xiangjian; Li, Dong-Xuan; Zhang, Gong-An; Xia, Zhen-Fang; Qin, Shu-Cun
2017-08-04
This study was designed to explore the protective effect of D4F, an apolipoprotein A-I mimetic peptide, on nuclear factor-κB (NF-κB)-dependent Fas/Fas ligand (FasL) pathway-mediated apoptosis in macrophages induced by oxidized low-density lipoprotein (ox-LDL). Our results showed that ox-LDL induced apoptosis, NF-κB P65 nuclear translocation and the upregulation of Fas/FasL pathway-related proteins, including Fas, FasL, Fas-associated death domain proteins (FADD), caspase-8 and caspase-3 in RAW264.7 macrophages, whereas silencing of Fas blocked ox-LDL-induced macrophage apoptosis. Furthermore, silencing of P65 attenuated macrophage apoptosis and the upregulation of Fas caused by ox-LDL, whereas P65 expression was not significantly affected by treatment with Fas siRNA. D4F attenuated the reduction of cell viability and the increase in lactate dehydrogenase leakage and apoptosis. Additionally, D4F inhibited ox-LDL-induced P65 nuclear translocation and upregulation of Fas/FasL pathway-related proteins in RAW264.7 cells and in atherosclerotic lesions of apoE -/- mice. However, Jo2, a Fas-activating monoclonal antibody, reversed the inhibitory effect of D4F on ox-LDL-induced cell apoptosis and upregulation of Fas, FasL and FADD. These data indicate that NF-κB mediates Fas/FasL pathway activation and apoptosis in macrophages induced by ox-LDL and that D4F protects macrophages from ox-LDL-induced apoptosis by suppressing the activation of NF-κB and the Fas/FasL pathway.
Dou, Rui; Hong, Zhenya; Tan, Xiaosheng; Hu, Fenfen; Ding, Yajie; Wang, Wei; Liang, Zhihui; Zhong, Rongrong; Wu, Xiongwen; Weng, Xiufang
2018-07-01
The rapid antitumor cytokine production and direct cytotoxicity confer invariant NKT (iNKT) cells ideal candidates for cancer therapy. However, the therapeutic potential of iNKT cells in T-cell malignant diseases remains elusive, as antigen presentation by T cells (T-T presentation) has been suggested to induce hyporesponsiveness of iNKT cells. In this study, we found discrepancies in iNKT cell responses against two T cell-origin cell lines (Jurkat and Molt-4). Human iNKT cells exhibited more intensive cytotoxicity and less efficient cytokine production in response to Fas-bearing Jurkat cells than those to the Fas-negative tumor cells (Molt-4 and myeloid-derived K562). The imbalanced cytokine/cytotoxicity responses of iNKT cells against Jurkat cells were CD1d-dependent and relied mostly on Fas/FasL interaction. The impairment in cytokine production could be overcome by Fas/FasL blocking antibodies and exogenous IL-2. Elevated CD1d levels as well as CD1d and Fas co-localization were found in T-cell lymphomas. However, defects in frequency and function of circulating iNKT cells were observed in the patients, which could be partly rescued by exogenous IL-2. Collectively, the Fas/FasL-dependent aberrant iNKT cell responses and the reversibility of the defects suggest the distinct iNKT cell manipulation in CD1d- and Fas-bearing T cell malignancies. Copyright © 2018. Published by Elsevier Ltd.
Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-01-01
ABSTRACT For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI. Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA. These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum. IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis, which use an individual nonaggregating type II fatty
Zhang, Dan-Feng; Jiang, Guang-Bin; Qin, Chuan-Qi; Liu, De-Xi; Hu, Ya-Jun; Zhou, Juan; Niu, Yu-Ming
2018-02-01
Molecular epidemiological studies have demonstrated a closer association between Fas/FasL polymorphisms and head and neck cancer (HNC) risk, and the results of these published studies were inconsistent. We therefore performed this meta-analysis to explore the associations between Fas/FasL polymorphisms and HNC risk. Four online databases (PubMed, Embase, CNKI, and Wanfang) were searched. Odds ratios (ORs) with 95% confidence interval (95% CIs) were calculated to assess the association between Fas -670A>G, Fas -1377G>A, and FasL -844C>T polymorphisms and HNC risk. In addition, heterogeneity, accumulative/sensitivity analysis, and publication bias were conducted to check the statistical power. Overall, 9 related publications (20 independent case-control studies) involving 3179 patients and 4217 controls were identified. Significant association of protective effects was observed between FasL -844C>T polymorphism and HNC risk in codominant and dominant model models (CT vs CC: OR = 0.89, 95% CI = 0.79-1.00, P = .05, I = 38.3%, CT+TT vs CC: OR = 0.88, 95% CI = 0.79-0.98, P = .02, I = 35.8%). Furthermore, the similar protective effects were observed the subgroup analysis of in Asian population and population-based controls group. Our meta-analysis indicated that FasL -844C>T polymorphism plays a protective role against HNC development, but the Fas -670A>G and Fas -1377G>A polymorphisms maybe not associated with HNC risk.
Zhang, Dan-Feng; Jiang, Guang-Bin; Qin, Chuan-Qi; Liu, De-Xi; Hu, Ya-Jun; Zhou, Juan; Niu, Yu-Ming
2018-01-01
Abstract Background: Molecular epidemiological studies have demonstrated a closer association between Fas/FasL polymorphisms and head and neck cancer (HNC) risk, and the results of these published studies were inconsistent. We therefore performed this meta-analysis to explore the associations between Fas/FasL polymorphisms and HNC risk. Methods: Four online databases (PubMed, Embase, CNKI, and Wanfang) were searched. Odds ratios (ORs) with 95% confidence interval (95% CIs) were calculated to assess the association between Fas -670A>G, Fas -1377G>A, and FasL -844C>T polymorphisms and HNC risk. In addition, heterogeneity, accumulative/sensitivity analysis, and publication bias were conducted to check the statistical power. Results: Overall, 9 related publications (20 independent case–control studies) involving 3179 patients and 4217 controls were identified. Significant association of protective effects was observed between FasL -844C>T polymorphism and HNC risk in codominant and dominant model models (CT vs CC: OR = 0.89, 95% CI = 0.79–1.00, P = .05, I2 = 38.3%, CT+TT vs CC: OR = 0.88, 95% CI = 0.79–0.98, P = .02, I2 = 35.8%). Furthermore, the similar protective effects were observed the subgroup analysis of in Asian population and population-based controls group. Conclusion: Our meta-analysis indicated that FasL -844C>T polymorphism plays a protective role against HNC development, but the Fas -670A>G and Fas -1377G>A polymorphisms maybe not associated with HNC risk. PMID:29419701
Ikeda, Masato; Nagashima, Takashi; Nakamura, Eri; Kato, Ryosuke; Ohshita, Masakazu; Hayashi, Mikiro; Takeno, Seiki
2017-10-01
For fatty acid biosynthesis, Corynebacterium glutamicum uses two type I fatty acid synthases (FAS-I), FasA and FasB, in addition to acetyl-coenzyme A (CoA) carboxylase (ACC) consisting of AccBC, AccD1, and AccE. The in vivo roles of the enzymes in supplying precursors for biotin and α-lipoic acid remain unclear. Here, we report genetic evidence demonstrating that the biosynthesis of these cofactors is linked to fatty acid biosynthesis through the FAS-I pathway. For this study, we used wild-type C. glutamicum and its derived biotin vitamer producer BFI-5, which was engineered to express Escherichia coli bioBF and Bacillus subtilis bioI Disruption of either fasA or fasB in strain BFI-5 led to decreased production of biotin vitamers, whereas its amplification contributed to increased production, with a larger impact of fasA in both cases. Double disruptions of fasA and fasB resulted in no biotin vitamer production. The acc genes showed a positive effect on production when amplified simultaneously. Augmented fatty acid biosynthesis was also reflected in pimelic acid production when carbon flow was blocked at the BioF reaction. These results indicate that carbon flow down the FAS-I pathway is destined for channeling into the biotin biosynthesis pathway, and that FasA in particular has a significant impact on precursor supply. In contrast, fasB disruption resulted in auxotrophy for lipoic acid or its precursor octanoic acid in both wild-type and BFI-5 strains. The phenotypes were fully complemented by plasmid-mediated expression of fasB but not fasA These results reveal that FasB plays a specific physiological role in lipoic acid biosynthesis in C. glutamicum IMPORTANCE For the de novo biosynthesis of fatty acids, C. glutamicum exceptionally uses a eukaryotic multifunctional type I fatty acid synthase (FAS-I) system comprising FasA and FasB, in contrast to most bacteria, such as E. coli and B. subtilis , which use an individual nonaggregating type II fatty acid synthase
Musiał, Kinga; Zwolińska, Danuta
2011-07-01
The system of membrane receptor Fas and its ligand FasL compose one of the main pathways triggering apoptosis. However, the role of their soluble forms has not been clarified yet. Although sFasL can be converted from the membrane-bound form by matrix metalloproteinases (MMPs), there are no data on relations between sFas/sFasL, MMPs and their tissue inhibitors (TIMPs) in patients on chronic dialysis--neither children nor adults. The aim of our study was to evaluate serum concentrations of sFas, sFasL, and their potential regulators (MMP-2, MMP-7, MMP-9, TIMP-1, TIMP-2), in children and young adults chronically dialyzed. Twenty-two children on automated peritoneal dialysis (APD), 19 patients on hemodialysis (HD) and 30 controls were examined. Serum concentrations of sFas, sFasL, MMPs and TIMPs were assessed by ELISA. Median values of sFas, sFasL, sFas/sFasL ratio, MMP-2, MMP-7, MMP-9, TIMP-1 and TIMP-2 were significantly elevated in all dialyzed patients vs. controls, the highest values being observed in subjects on HD. A single HD session caused the decrease in values of all parameters to the levels below those seen in children on APD. Regression analysis revealed that MMP-7 and TIMP-1 were the best predictors of sFas and sFasL concentrations. Children and young adults on chronic dialysis are prone to sFas/sFasL system dysfunction, more pronounced in patients on hemodialysis. The correlations between sFas/sFasL and examined enzymes suggest that MMPs and TIMPs take part in the regulation of cell death in the pediatric population on chronic dialysis, triggering both anti- (sFas) and pro-apoptotic (sFasL) mechanisms.
Badie, B; Schartner, J; Vorpahl, J; Preston, K
2000-04-01
Activation of microglia by interferon-gamma (IFN-gamma) has been implicated in a number of central nervous system (CNS) inflammatory disease processes. Because IFN-gamma has also been shown to play a role in programmed cell death, we investigated its cytotoxicity and its effect on the Fas apoptotic pathway in microglia. Flow cytometry was used to quantify the IFN-gamma-mediated apoptotic response and Fas and Fas ligand (FasL) expression in two well-characterized murine microglia cell lines (BV-2 and N9). Nuclear fragmentation, suggestive of apoptosis, was noted within 24 h of incubation of microglia with IFN-gamma (10 U/ml). After a 72-h incubation, almost every BV-2 and N9 microglia, but not GL261 glioma cells, underwent cell death and detached from the culture plates. This cytotoxicity occurred even at low IFN-gamma concentrations (1 U/ml) and was inhibited by BAF, a pan-caspase inhibitor. Incubation of BV-2 and N9 microglia, but not GL261 glioma cells, with IFN-gamma also potentiated the expression of Fas and FasL in a similar dose-response and time-course manner, as seen for the apoptotic response. Whereas Fas expression increased by 100% in both microglia cells, FasL upregulation was more pronounced and increased by as much as 200% in the N9 cells. These findings suggest that in addition to its role as a microglia activator, IFN-gamma may also induce apoptosis of microglia, possibly through simultaneous upregulation of Fas and FasL. Interferon-gamma modulation of the Fas pathway and apoptosis in microglia may be important in the pathogenesis of inflammatory CNS disease processes. Copyright 2000 Academic Press.
Pearl-Yafe, Michal; Yolcu, Esma S; Stein, Jerry; Kaplan, Ofer; Shirwan, Haval; Yaniv, Isaac; Askenasy, Nadir
2007-10-01
The interaction between the Fas receptor and its cognate ligand (FasL) has been implicated in the mutual suppression of donor and host hematopoietic cells after transplantation. Following the observation of deficient early engraftment of Fas and FasL-defective donor cells and recipients, we determined the role of the Fas-FasL interaction. Donor cells were recovered after syngeneic (CD45.1-->CD45.2) transplants from various organs and assessed for expression of Fas/FasL in reference to lineage markers, carboxyfluorescein succinimidyl ester dilution, Sca-1 and c-kit expression. Naïve and bone marrow-homed cells were challenged for apoptosis ex vivo. The Fas receptor and ligand were markedly upregulated to 40% to 60% (p < 0.001 vs 5-10% in naïve cells) within 2 days after syngeneic transplantation, while residual host cells displayed modest and delayed upregulation of these molecules ( approximately 10%). All lin(-)Sca(+)c-kit(+) cells were Fas(+)FasL(+), including 95% of Sca-1(+) and 30% of c-kit(+) cells. Fas and FasL expression varied in donor cells that homed to bone marrow, spleen, liver and lung, and was induced by interaction with the stroma, irradiation, cell cycling, and differentiation. Bone marrow-homed donor cells challenged with supralethal doses of FasL were insensitive to apoptosis (3.2% +/- 1% vs 38% +/- 5% in naïve bone marrow cells), and engraftment was not affected by pretransplantation exposure of donor cells to an apoptotic challenge with FasL. There was no evidence of Fas-mediated suppression of donor and host cell activity after transplantation. Resistance to Fas-mediated apoptosis evolves as a functional characteristic of hematopoietic reconstituting stem and progenitor cells, providing them competitive engraftment advantage over committed progenitors.
Induction of Fas receptor and Fas ligand by nodularin is mediated by NF-{kappa}B in HepG2 cells
DOE Office of Scientific and Technical Information (OSTI.GOV)
Feng Gong, E-mail: gong-feng@northwestern.edu; Anong Biotech Institute, Tianjin; Li Ying
Nodularin is a natural toxin with multiple features, including inhibitor of protein phosphatases 1 and 2A as well as tumor initiator and promoter. One unique feature of nodularin is that this chemical is a hepatotoxin. It can accumulate into the liver after contact and lead to severe damage to hepatocyte, such as apoptosis. Fas receptor (Fas) and Fas ligand (FasL) system is a critical signaling network triggering apoptosis. In current study, we investigated whether nodularin can induce Fas and FasL expression in HepG2 cell, a well used in vitro model for the study of human hepatocytes. Our data showed nodularinmore » induced Fas and FasL expression, at both mRNA and protein level, in a time- and dose-dependent manner. We also found nodularin induced apoptosis at the concentration and incubation time that Fas and FasL were significantly induced. Neutralizing antibody to FasL reduced nodularin-induced apoptosis. Further studies demonstrated that nodularin promoted nuclear translocation and activation of p65 subunit of NF-{kappa}B. By applying siRNA targeting p65, which knocked down p65 in HepG2 cells, we successfully impaired the activation of NF-{kappa}B by nodularin. In these p65 knockdown cells, we observed that Fas and FasL expression and apoptosis induced by nodularin were significantly reduced. These findings suggest the induction of Fas and FasL expression and thus cell apoptosis in HepG2 cells by nodularin is mediated through NF-{kappa}B pathway.« less
2014-01-01
Background Fatty acid desaturase 1 (FADS1) and 2 (FADS2) genes code respectively for the enzymes delta-5 and delta-6 desaturases which are rate limiting enzymes in the synthesis of polyunsaturated omega-3 and omega-6 fatty acids (FAs). Omega-3 and-6 FAs as well as conjugated linoleic acid (CLA) are present in bovine milk and have demonstrated positive health effects in humans. Studies in humans have shown significant relationships between genetic variants in FADS1 and 2 genes with plasma and tissue concentrations of omega-3 and-6 FAs. The aim of this study was to evaluate the extent of sequence variations within these two genes in Canadian Holstein cows as well as the association between sequence variants and health promoting FAs in milk. Results Thirty three SNPs were detected within the studied regions of genes including a synonymous mutation (FADS1-07, rs42187261, 306Tyr > Tyr) in exon 8 of FADS1, a non-synonymous mutation (FADS2-14, rs211580559, 294Ala > Val) within FADS2 exon 7, a splice site SNP (FADS2-05, rs211263660), a 3′UTR SNP (FADS2-23, rs109772589), and another 3′UTR SNP with an effect on a microRNA binding site within FADS2 gene (FADS2-19, rs210169303). Association analyses showed significant relations between three out of seven tested SNPs and several FAs. Significant associations (FDR P < 0.05) were recorded between FADS2-23 (rs109772589) and two omega-6 FAs (dihomogamma linolenic acid [C20:3n6] and arachidonic acid [C20:4n6]), FADS1-07 (rs42187261) and one omega-3 FA (eicosapentaenoic acid, C20:5n3) and tricosanoic acid (C23:0), and one intronic SNP, FADS1-01 (rs136261927) and C20:3n6. Conclusion Our study has demonstrated positive associations between three SNPs within FADS1 and FADS2 genes (a SNP within the 3’UTR, a synonymous SNP and an intronic SNP), with three milk PUFAs of Canadian Holstein cows thus suggesting possible involvement of synonymous and non-coding region variants in FA synthesis. These SNPs may serve as
Wang, Mei; Su, Ping
2018-04-01
The Fas/FasL signaling pathway is one of the major pathways that regulate apoptosis. Increasing studies have shown that the activation of the Fas/FasL signaling pathway is closely associated with testicular cell apoptosis. However, the mechanism involved is still unclear. We discuss recent findings regarding the molecular mechanisms by which environmental toxicants induce testicular pathology via Fas/FasL signaling. These findings suggest that Fas/FasL signaling is employed to impact the sensitivity (a response to external factors) of germ cells, disrupt steroidogenic hormone and cytokine metabolism mediated by Sertoli cells, and elicit the activation of NFAT (nuclear factor of activated T-cells) in Leydig cell apoptosis. Consequently, degeneration of testicular somatic (Sertoli and Leydig) and spermatogenic cells, leads to decreased numbers of mature sperm and subsequently translates into infertility issues. Collectively, these findings illustrate that it is beneficial to develop potential targets for a new generation of new pharmaceutical therapies that would alleviate testicular dysfunctions. BTB: blood-testis barrier; DD: death domains; DR3: death receptor 3; DR4: death receptor 4; DR5: death receptor 5; DED: death effector domain; DISC: death-inducing signaling complex; ERα: estrogen receptor alpha; FADD: Fas-associated death domain; FSH: follicle- stimulating hormone; IL-1β: interleukin 1 beta; LH: luteinizing hormone; LPS: lipopolysaccharide; mFas: membrane Fas; MMP2: matrix metalloproteinase-2; MTA1: metastasis-associated protein 1; NAC: N-acetylcysteine; NCCD: the Nomenclature Committee on Cell Death; NFAT: nuclear factor of activated T-cells; NF-kB: nuclear transcription factor-kappaB; NO: nitric oxide; NP: 4-nonylphenol; PCD: programmed cell death; PP1/PP2A: protein phosphatase 1 and 2A; ROS: reactive oxygen species; sFas: soluble Fas; T: testosterone; TGF-β: transforming growth factor-beta; THD: TNF homology domain; TIMP-2: tissue inhibitor of
Villa-Morales, María; Santos, Javier; Pérez-Gómez, Eduardo; Quintanilla, Miguel; Fernández-Piqueras, José
2007-06-01
The Fas/FasL system mediates induced apoptosis of immature thymocytes and peripheral T lymphocytes, but little is known about its implication in genetic susceptibility to T-cell malignancies. In this article, we report that the expression of FasL increases early in all mice after gamma-radiation treatments, maintaining such high levels for a long time in mice that resisted tumor induction. However, its expression is practically absent in T-cell lymphoblastic lymphomas. Interestingly, there exist significant differences in the level of expression between two mice strains exhibiting extremely distinct susceptibilities that can be attributed to promoter functional polymorphisms. In addition, several functional nucleotide changes in the coding sequences of both Fas and FasL genes significantly affect their biological activity. These results lead us to propose that germ-line functional polymorphisms affecting either the levels of expression or the biological activity of both Fas and FasL genes could be contributing to the genetic risk to develop T-cell lymphoblastic lymphomas and support the use of radiotherapy as an adequate procedure to choose in the treatment of T-cell malignancies.
FAS system deregulation in T-cell lymphoblastic lymphoma
Villa-Morales, M; Cobos, M A; González-Gugel, E; Álvarez-Iglesias, V; Martínez, B; Piris, M A; Carracedo, A; Benítez, J; Fernández-Piqueras, J
2014-01-01
The acquisition of resistance towards FAS-mediated apoptosis may be required for tumor formation. Tumors from various histological origins exhibit FAS mutations, the most frequent being hematological malignancies. However, data regarding FAS mutations or FAS signaling alterations are still lacking in precursor T-cell lymphoblastic lymphomas (T-LBLs). The available data on acute lymphoblastic leukemia, of precursor origin as well, indicate a low frequency of FAS mutations but often report a serious reduction in FAS-mediated apoptosis as well as chemoresistance, thus suggesting the occurrence of mechanisms able to deregulate the FAS signaling pathway, different from FAS mutation. Our aim at this study was to determine whether FAS-mediated apoptotic signaling is compromised in human T-LBL samples and the mechanisms involved. This study on 26 T-LBL samples confirms that the FAS system is impaired to a wide extent in these tumors, with 57.7% of the cases presenting any alteration of the pathway. A variety of mechanisms seems to be involved in such alteration, in order of frequency the downregulation of FAS, the deregulation of other members of the pathway and the occurrence of mutations at FAS. Considering these results together, it seems plausible to think of a cumulative effect of several alterations in each T-LBL, which in turn may result in FAS/FASLG system deregulation. Since defective FAS signaling may render the T-LBL tumor cells resistant to apoptotic cell death, the correct prognosis, diagnosis and thus the success of anticancer therapy may require such an in-depth knowledge of the complete scenario of FAS-signaling alterations. PMID:24603338
DOE Office of Scientific and Technical Information (OSTI.GOV)
Husain, Zaheed; Department of Pathology, Harvard Medical School, Boston, MA; Almeciga, Ingrid
Clozapine has been associated with a 1% incidence of agranulocytosis. The formation of an oxidized intermediate clozapine metabolite has been implicated in direct polymorphonuclear (PMN) toxicity. We utilized two separate systems to analyze the role of oxidized clozapine in inducing apoptosis in treated cells. Human PMN cells incubated with clozapine (0-10 {mu}M) in the presence of 0.1 mM H{sub 2}O{sub 2} demonstrated a progressive decrease of surface CD16 expression along with increased apoptosis. RT-PCR analysis showed decreased CD16 but increased FasL gene expression in clozapine-treated PMN cells. No change in constitutive Fas expression was observed in treated cells. In HL-60more » cells induced to differentiate with retinoic acid (RA), a similar increase in FasL expression, but no associated changes in CD16 gene expression, was observed following clozapine treatments. Our results demonstrate increased FasL gene expression in oxidized clozapine-induced apoptotic neutrophils suggesting that apoptosis in granulocytes treated with clozapine involves Fas/FasL interaction that initiates a cascade of events leading to clozapine-induced agranulocytosis.« less
Improved synthesis and characterization of saturated branched-chain fatty acid isomers
USDA-ARS?s Scientific Manuscript database
The development of viable technologies for producing green products from renewable fats and oils is highly desirable since such materials can serve as replacements for non-renewable and poorly biodegradable petroleum-based products. Mixtures of saturated branched-chain fatty acid isomers (sbc-FAs),...
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Liu, Zhipeng; Liu, Rui; Chou, Jing; Yu, Jiaying; Liu, Xiaowei; Sun, Changhao; Li, Ying; Liu, Liyan
2018-07-15
Maternal diet during pregnancy can influence offspring's health by affecting development and metabolism. This study aimed to analyze the influence of maternal folic acid (FA) supplementation on the metabolism of rat pups using targeted metabolomics. Twenty female rats were randomly assigned to a FA supplementation (FAS group, n = 10) or control group (n = 10), which were fed AIN93G diet with 2 or 10 mg/kg FA, respectively. We then measured amino acids and their derivatives, biogenic amines, and fatty acids in the female rats and their pups by ultra-high performance liquid chromatography-triple quadrupole mass spectrometry (UHPLC/MS-MS) and gas chromatography-mass spectrometry (GC/MS-MS). In maternal rats, the significant changes of three metabolites (proline, γ-aminobutyric acid and esterified octadecatetraenoic acid, P < 0.05) were observed in FAS group. For the rat pups, FAS pups had significantly lower homocysteine and higher FA levels than control pups. The lower levels of amino acids (leucine, isoleucine, serine, proline) were obtained in FAS pups. Furthermore, there were the decreased esterified fatty acids (arachidonic acid, eicosapentaenoic acid, and docosatetraenoic acid) and free fatty acids (oleic acid, linoleic acid, γ-linolenic acid, octadecatetraenoic acid, arachidonic acid, eicosapentaenoic acid and selacholeic acid) in FAS pups. Metabolic changes in the FAS pups were characterized by changes in fatty acids and amino acids. These results suggested that FA supplementation during pregnancy influenced amino acids and fatty acids metabolism in rat pups. This study provides new insights into the regulation of amino acids and fatty acids metabolism during early life. Copyright © 2018 Elsevier B.V. All rights reserved.
Hartley, Jane E K; Levin, Kate; Currie, Candace
A critical review of the Family Affluence Scale (FAS) concluded that FAS II was no longer discriminatory within very rich or very poor countries, where a very high or a very low proportion of children were categorised as high FAS or low FAS respectively (Currie et al. 2008). The review concluded that a new version of FAS - FAS III - should be developed to take into account current trends in family consumption patterns across the European region, the US and Canada. In 2012, the FAS Development and Validation Study was conducted in eight countries - Denmark, Greenland, Italy, Norway, Poland, Romania, Slovakia and Scotland. This paper describes the Scottish qualitative findings from this study. The Scottish qualitative fieldwork comprising cognitive interviews and focus groups sampled from 11, 13 and 15 year-old participants from 18 of the most- and least- economically deprived schools. These qualitative results were used to inform the final FAS III recommendations.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Steer, Colin D; Hibbeln, Joseph R; Golding, Jean; Davey Smith, George
2012-04-01
Minor alleles of polymorphisms in the fatty acid desaturase (FADS) gene cluster have been associated with reduced desaturation of the precursor polyunsaturated fatty acids (FAs) in small studies. The effects of these polymorphisms during progressive developmental stages have not previously been reported. Data from blood samples for 4342 pregnant women, 3343 umbilical cords reflecting the newborn's blood supply and 5240 children aged 7 years were analysed to investigate the associations of polyunsaturated FAs with rs1535 and rs174575-two polymorphisms in the FADS2 gene. Strong positive associations were observed between the minor G allele for these two markers, especially rs1535, and the substrates linoleic (18:2n-6) and α-linolenic (18:3n-3) acid. Negative associations were observed for the more highly unsaturated FAs such as arachidonic acid (20:4n-6), timnodonic acid (EPA, 20:5n-3) and cervonic acid (DHA, 22:6n-3). Bivariable genetic associations using the mother and child genotypes suggested that the newborn metabolism had a greater capacity to synthesize the more highly unsaturated omega-6 FAs than the more highly unsaturated omega-3 FAs. Nevertheless, despite the immaturity of the neonate, there was evidence that synthesis of DHA was occurring. However, by 7 years, no associations were observed with the maternal genotype. This suggested that the children's FA levels were related only to their own metabolism with no apparent lasting influences of the in utero environment.
Fas/Fas ligand regulation mediates cell death in human Ewing's sarcoma cells treated with melatonin
García-Santos, G; Martin, V; Rodríguez-Blanco, J; Herrera, F; Casado-Zapico, S; Sánchez-Sánchez, A M; Antolín, I; Rodríguez, C
2012-01-01
Background: Despite recent advances in cancer therapy, the 5-year survival rate for Ewing's sarcoma is still very low, and new therapeutic approaches are necessary. It was found previously that melatonin induces cell death in the Ewing's sarcoma cell line, SK-N-MC, by activating the extrinsic apoptotic pathway. Methods: Melatonin actions were analysed by metabolic viability/survival cell assays, flow cytometry, quantitative PCR for mRNA expression, western blot for protein activation/expression and electrophoretic mobility shift assay for transcription factor activation. Results: Melatonin increases the expression of Fas and its ligand Fas L, this increase being responsible for cell death induced by the indolamine. Melatonin also produces a transient increase in intracellular oxidants and activation of the redox-regulated transcription factor Nuclear factor-kappaB. Inhibition of such activation prevents cell death and Fas/Fas L upregulation. Cytotoxic effect and Fas/Fas L regulation occur in all Ewing's cell lines studied, and do not occur in the other tumour cell lines studied where melatonin does not induce cell death. Conclusion: Our data offers new insights in the study of alternative therapeutic strategies in the treatment of Ewing's sarcoma. Further attention deserves to be given to the differences in the cellular biology of sensitive tumours that could explain the cytotoxic effect of melatonin and the increase in the level of free radicals caused by this molecule, in particular cancer types. PMID:22382690
Mitochondrial free cholesterol loading sensitizes to TNF- and Fas-mediated steatohepatitis.
Marí, Montserrat; Caballero, Francisco; Colell, Anna; Morales, Albert; Caballeria, Juan; Fernandez, Anna; Enrich, Carlos; Fernandez-Checa, José C; García-Ruiz, Carmen
2006-09-01
The etiology of progression from steatosis to steatohepatitis (SH) remains unknown. Using nutritional and genetic models of hepatic steatosis, we show that free cholesterol (FC) loading, but not free fatty acids or triglycerides, sensitizes to TNF- and Fas-induced SH. FC distribution in endoplasmic reticulum (ER) and plasma membrane did not cause ER stress or alter TNF signaling. Rather, mitochondrial FC loading accounted for the hepatocellular sensitivity to TNF due to mitochondrial glutathione (mGSH) depletion. Selective mGSH depletion in primary hepatocytes recapitulated the susceptibility to TNF and Fas seen in FC-loaded hepatocytes; its repletion rescued FC-loaded livers from TNF-mediated SH. Moreover, hepatocytes from mice lacking NPC1, a late endosomal cholesterol trafficking protein, or from obese ob/ob mice, exhibited mitochondrial FC accumulation, mGSH depletion, and susceptibility to TNF. Thus, we propose a critical role for mitochondrial FC loading in precipitating SH, by sensitizing hepatocytes to TNF and Fas through mGSH depletion.
Lead induces apoptosis in mouse TM3 Leydig cells through the Fas/FasL death receptor pathway.
He, Xiuyuan; Wu, Jing; Yuan, Liyun; Lin, Feng; Yi, Jine; Li, Jing; Yuan, Hui; Shi, Jinling; Yuan, Tingting; Zhang, Shufang; Fan, Yongheng; Zhao, Zhihang
2017-12-01
The study was aimed to investigate the effect of Pb toxicity on mouse Leydig cells and its molecular mechanism. The TM3 cells were cultured in vitro and exposed to Pb at different concentrations for 24h. The effects of Pb on cell proliferation and apoptosis were analyzed with MTT and Annexin V-FITC/PI via flow cytometry, respectively. Expression levels of Fas, Fas-L and caspase-8 in TM3 cells were determined by western blot. As well as the inhibitory effect of the caspase-8 inhibitor Z-IETD-FMK on cell apoptosis. We found that Pb treatment significantly decreased the cellar viability (P<0.05), increased the apoptosis (P<0.01) and the Fas, FasL, and caspase-8 expression levels in Pb-treated cells as compared to the control cells (P<0.05 or P<0.01). Furthermore, the caspase-8 inhibitor effectively block the Pb-induced cell apoptosis. Taken together, our data suggest that Pb-induced TM3 cell toxic effect may involve in the Fas/FasL death receptor signaling pathway. Copyright © 2017. Published by Elsevier B.V.
Involvement of the Fas and Fas ligand in testicular germ cell apoptosis by zearalenone in rat
Jee, Youngheun; Noh, Eun-Mi; Cho, Eun-Sang
2010-01-01
Zearalenone (ZEA), a nonsteroidal estrogenic mycotoxin, is known to cause testicular toxicity in animals. In the present study, the effects of ZEA on spermatogenesis and possible mechanisms involved in germ cell injury were examined in rats. Ten-week-old Sprague-Dawley rats were treated with 5 mg/kg i.p. of ZEA and euthanized 3, 6, 12, 24 or 48 h after treatment. Histopathologically, spermatogonia and spermatocytes were found to be affected selectively. They were TUNEL-positive and found to be primarily in spermatogenic stages I-VI tubules from 6 h after dosing, increasing gradually until 12 h and then gradually decreasing. Western blot analysis revealed an increase in Fas and Fas ligand (Fas-L) protein levels in the ZEA-treated rats. However, the estrogen receptor (ER)α expression was not changed during the study. Collectively, our data suggest that acute exposure of ZEA induces apoptosis in germ cells of male rats and that this toxicity of ZEA is partially mediated through modulation of Fas and Fas-L systems, though ERα may not play a significant role. PMID:20458151
Ursodeoxycholyl Lysophosphatidylethanolamide Protects Against CD95/FAS-Induced Fulminant Hepatitis.
Utaipan, Tanyarath; Otto, Ann-Christin; Gan-Schreier, Hongying; Chunglok, Warangkana; Pathil, Anita; Stremmel, Wolfgang; Chamulitrat, Walee
2017-08-01
Increased activation of CD95/Fas by Fas ligand in viral hepatitis and autoimmunity is involved in pathogenesis of fulminant hepatitis and liver failure. We designed a bile-acid phospholipid conjugate ursodeoxycholyl lysophosphatidylethanolamide (UDCA-LPE with LPE containing oleate at the sn-1) as a hepatoprotectant that was shown to protect against fulminant hepatitis induced by endotoxin. We herein further assessed the ability of UDCA-LPE to prevent death receptor CD95/Fas-induced fulminant hepatitis. C57BL/6 mice were intravenously administered with CD95/Fas agonistic monoclonal antibody (Jo-2) with or without 1 h pretreatment with 50 mg/kg UDCA-LPE. Jo-2 administration caused massive hepatocyte damage as seen by histology, and this was associated with a significant decrease in hepatic phosphatidylcholine (PC), lysoPC, and lysophosphatidylethanolamine levels. By histology, UDCA-LPE pretreatment improved hepatocyte damage and restored the loss of these phospholipids in part by a mechanism involving an inhibition of cytosolic phospholipaseA2 expression. Accordingly, Jo-2 treatment increased hepatic expression of cleaved caspase 8, caspase 3, and poly (ADP-Ribose) polymerase-1, and on the other hand decreased that of anti-apoptotic cellular FLICE-inhibitory protein. UDCA-LPE pretreatment was able to reverse all these changes. Moreover, UDCA-LPE attenuated inflammatory response by lowering the levels of Jo-2-induced proinflammatory cytokines TNF-α, IL-6, and IL-1β in liver and serum. UDCA-LPE was also able to decrease the levels of stimulated Th1/Th17 cytokines in Jo-2-primed isolated splenocytes. Taken together, UDCA-LPE exhibited potent anti-inflammatory effects against CD95/Fas-induced fulminant hepatitis.
Mao, Jia-Ding; Wu, Pei; Yang, Ying-Lin; Wu, Jian; Huang, He
2008-05-14
To explore the correlation between the mRNAs and protein expression of gastrin (GAS), somatostatin (SS) and apoptosis index (AI), apoptosis regulation gene Fas/FasL and caspases in large intestinal carcinoma (LIC). Expression of GAS and SS mRNAs were detected by nested RT-PCR in 79 cases of LIC. Cell apoptosis was detected by molecular biology in situ apoptosis detecting methods (TUNEL). Immunohistochemical staining for GAS, SS, Fas/FasL, caspase-3 and caspase-8 was performed according to the standard streptavidin-biotin-peroxidase (S-P) method. There was a significant positive correlation between mRNA and protein expression of GAS and SS (GASrs = 0.99, P < 0.01; SSrs = 0.98, P < 0.01). There was significant difference in positive expression rates of GAS, SS mRNAs and protein among different histological differentiation, histological types and Dukes' stage of LIC. The AI in GAS high and moderate expression groups was significantly lower than that in low expression groups (3.75 +/- 2.38 vs 7.82 +/- 2.38, P < 0.01; 5.51 +/- 2.66 vs 7.82 +/- 2.38, P < 0.01), and the AI in SS high and moderate expression groups was significantly higher than that in low expression groups (9.03 +/- 1.76 vs 5.35 +/- 3.00, P < 0.01; 7.44 +/- 2.67 vs 5.35 +/- 3.00, P < 0.01). There was a significant negative correlation between the integral ratio of GAS to SS and the AI (r(s) = -0.41, P < 0.01). The positive expression rate of FasL in GAS high and moderate expression groups was higher than that in low expression group (90.9% and 81.0% vs 53.2%, P < 0.05). The positive expression rates of Fas, caspase-8 and caspase-3 in SS high (90.0%, 90.0% and 100%) and moderate (80.0%, 70.0%, 75.0%) expression groups were higher than that in low expression group (53.1%, 42.9%, 49.0%) (90.0% and 80.0% vs 53.1%, P < 0.05; 90.0% and 70.0% vs 42.9%, P < 0.05; 100.0% and 75.0% vs 49.0%, P < 0.05). There was a significant positive correlation between the integral ratio of GAS to SS and the semiquantitative
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
A comparison of the metabolic fate of Fatty acids of different chain lengths in developing oilseeds.
Battey, J F; Ohlrogge, J B
1989-07-01
To determine if medium and long chain fatty acids can be appropriately metabolized by species that normally produce 16 and 18 carbon fatty acids, homogenates of developing Cuphea wrightii, Carthamus tinctorius, and Crambe abyssinica seeds were incubated with radiolabeled lauric, palmitic, oleic, and erucic acids. In all three species, acyl-CoA synthetase showed broad substrate specificity in synthesis of acyl-coenzyme A (CoA) from any of the fatty acids presented. In Carthamus, two- to fivefold less of the foreign FAs, lauric, and erucic acid was incorporated into acyl-CoAs than palmitic and oleic acid. Lauric and erucic acid also supported less glycerolipid synthesis in Carthamus than palmitic and oleic acid, but the rate of acyl-CoA synthesis did not control rate of glycerolipid synthesis. In all species examined, medium and long chain fatty acids were incorporated predominantly into triacylglycerols and were almost excluded from phospholipid synthesis, whereas palmitic and oleic acid were found predominantly in polar lipids. However, the rate of esterification of unusual fatty acids to triacylglycerol is slow in species that do not normally synthesize these acyl substrates.
A Comparison of the Metabolic Fate of Fatty Acids of Different Chain Lengths in Developing Oilseeds
Battey, James F.; Ohlrogge, John B.
1989-01-01
To determine if medium and long chain fatty acids can be appropriately metabolized by species that normally produce 16 and 18 carbon fatty acids, homogenates of developing Cuphea wrightii, Carthamus tinctorius, and Crambe abyssinica seeds were incubated with radiolabeled lauric, palmitic, oleic, and erucic acids. In all three species, acyl-CoA synthetase showed broad substrate specificity in synthesis of acyl-coenzyme A (CoA) from any of the fatty acids presented. In Carthamus, two- to fivefold less of the foreign FAs, lauric, and erucic acid was incorporated into acyl-CoAs than palmitic and oleic acid. Lauric and erucic acid also supported less glycerolipid synthesis in Carthamus than palmitic and oleic acid, but the rate of acyl-CoA synthesis did not control rate of glycerolipid synthesis. In all species examined, medium and long chain fatty acids were incorporated predominantly into triacylglycerols and were almost excluded from phospholipid synthesis, whereas palmitic and oleic acid were found predominantly in polar lipids. However, the rate of esterification of unusual fatty acids to triacylglycerol is slow in species that do not normally synthesize these acyl substrates. PMID:16666885
Yang, Yuanzheng; Huang, Gangxiong; Zhou, Zhichao; Fewell, Jason G; Kleinerman, Eugenie S
2018-01-01
The metastatic potential of osteosarcoma cells is inversely correlated to cell surface FAS expression. Downregulation of FAS allows osteosarcoma cells to escape FAS ligand-mediated apoptosis when they enter a FAS ligand-positive microenvironment such as the lung. We have previously demonstrated that miR-20a, encoded by the miR-17-92 cluster, downregulates FAS expression in osteosarcoma. We further demonstrated an inverse correlation between FAS expression and miR-20a expression. However, the mechanism of FAS regulation by miR-20a was still unclear. The purpose of the current study was to evaluate the mechanism of FAS regulation by miR-20a in vitro and test the effect of targeting miR-20a in vivo We investigated whether miR-20a's downregulation of FAS was mediated by binding to the 3'-untranslated region (3'-UTR) of FAS mRNA with the consequent induction of mRNA degradation or translational suppression. We identified and mutated two miR-20a binding sites on the FAS mRNA 3'-UTR. Using luciferase reporter assays, we demonstrated that miR-20a did not bind to either the wild-type or mutated FAS 3'-UTR. In contrast, overexpression of miR-20a resulted in downregulation of FAS promoter activity. Similarly, the inhibition of miR-20a increased FAS promoter activity. The critical region identified on the FAS promoter was between -240 bp and -150 bp. Delivery of anti-miR-20a in vivo using nanoparticles in mice with established osteosarcoma lung metastases resulted in upregulation of FAS and tumor growth inhibition. Taken together, our data suggest that miR-20a regulates FAS expression through the modulation of the FAS promoter and that targeting miR-20a using anti-miR-20a has therapeutic potential. Mol Cancer Ther; 17(1); 130-9. ©2017 AACR . ©2017 American Association for Cancer Research.
Pan, Yuqin; Gao, Tianyi; Deng, Qiwen; Sun, Huiling; Song, Guoqi; Wang, Shukui
2014-01-01
Fas and its ligand (FasL) play an important role in apoptosis and carcinogenesis. Therefore, the potential association of polymorphisms in the Fas (-670A>G, rs1800682; -1377G>A, rs2234767) and FasL (-844C>T, rs763110) with cancer risk has been widely investigated. However, all the currently available results are not always consistent. In this work, we performed a meta-analysis to further determine whether carriers of the polymorphisms in Fas and FasL of interest could confer an altered susceptibility to cancer. All relevant data were retrieved by PubMed and Web of Science, and 52 eligible studies were chosen for this meta-analysis. There was no association of the Fas -670A>G polymorphism with cancer risk in the pooled data. For the Fas -1377G>A and FasL -844C>T polymorphisms, results revealed that the homozygotes of -1377A and -844C were associated with elevated risk of cancer as a whole. Further stratified analysis indicated markedly increased risk for developing breast cancer, gastric cancer, and esophageal cancer, in particular in Asian population. We conclude that carriers of the Fas-1377A and the FasL -844C are more susceptible to the majority of cancers than non-carriers. PMID:24598538
Kovacs, Peter; Harper, Inge; Hanson, Robert L; Infante, Aniello M; Bogardus, Clifton; Tataranni, P Antonio; Baier, Leslie J
2004-07-01
Inhibition of fatty acid synthase (FAS) induces a rapid decline in fat stores in mice, suggesting a role for this enzyme in energy homeostasis. The human FAS gene (FAS) maps to chromosome 17q25, a region previously shown to have suggestive linkage to adiposity in a genome-wide linkage scan for genetic determinants of obesity in Pima Indians. To investigate the potential role of FAS in the pathophysiology of human obesity, the FAS gene was sequenced and 13 single nucleotide polymorphisms (SNPs) were identified. Five representative SNPs were genotyped in 216 full-blooded, nondiabetic Pima Indians for association analyses. A Val1483Ile polymorphism (GTC to ATC; allele frequency of A = 0.10) was associated with percentage of body fat and 24-h substrate oxidation rates measured in a respiratory chamber. Compared with homozygotes for the Val variant, subjects with Ile/x had a lower mean percentage of body fat (30 +/- 1 vs. 33 +/- 1%, P = 0.002; adjusted for age, sex, and family membership) and a lower mean carbohydrate oxidation rate (983 +/- 41 vs. 1,094 +/- 19 kcal/day, P = 0.03), which resulted in a lower mean 24-h respiratory quotient (0.845 +/- 0.01 vs. 0.850 +/- 0.01 kcal/day, P = 0.04; both adjusted for age, sex, family membership, percentage of body fat, and energy balance). Our findings indicate that the Val1483Ile substitution in FAS is protective against obesity in Pima Indians, an effect possibly explained by the role of this gene in the regulation of substrate oxidation.
Liu, Qiuyan; Tan, Qinchun; Zheng, Yuanyuan; Chen, Kun; Qian, Cheng; Li, Nan; Wang, Qingqing; Cao, Xuetao
2014-01-01
Mechanisms for cancer-related inflammation remain to be fully elucidated. Non-apoptotic functions of Fas signaling have been proposed to play an important role in promoting tumor progression. It has yet to be determined if targeting Fas signaling can control tumor progression through suppression of cancer-related inflammation. In the current study we found that breast cancer cells with constitutive Fas expression were resistant to apoptosis induction by agonistic anti-Fas antibody (Jo2) ligation or Fas ligand cross-linking. Higher expression of Fas in human breast cancer tissue has been significantly correlated with poorer prognosis in breast cancer patients. To determine whether blockade of Fas signaling in breast cancer could suppress tumor progression, we prepared an orthotopic xenograft mouse model with mammary cancer cells 4T1 and found that blockade of Fas signaling in 4T1 cancer cells markedly reduced tumor growth, inhibited tumor metastasis in vivo, and prolonged survival of tumor-bearing mice. Mechanistically, blockade of Fas signaling in cancer cells significantly decreased systemic or local recruitment of myeloid derived suppressor cells (MDSCs) in vivo. Furthermore, blockade of Fas signaling markedly reduced IL-6, prostaglandin E2 production from breast cancer cells by impairing p-p38, and activity of the NFκB pathway. In addition, administration of a COX-2 inhibitor and anti-IL-6 antibody significantly reduced MDSC accumulation in vivo. Therefore, blockade of Fas signaling can suppress breast cancer progression by inhibiting proinflammatory cytokine production and MDSC accumulation, indicating that Fas signaling-initiated cancer-related inflammation in breast cancer cells may be a potential target for treatment of breast cancer. PMID:24627480
Astley, S J; Bailey, D; Talbot, C; Clarren, S K
2000-01-01
A 5-year, fetal alcohol syndrome (FAS) primary prevention study was conducted in Washington State to: (1) assess the feasibility of using a FAS diagnostic and prevention clinic as a centre for identifying and targeting primary prevention intervention to high-risk women; (2) generate a comprehensive, lifetime profile of these women; (3) identify factors that have enhanced and/or hindered their ability to achieve abstinence. The results of this study are presented in two parts. Objective 1 is summarized in the preceding paper and objectives 2 and 3 are summarized here. Comprehensive interviews were conducted with 80 women, who had given birth to a child diagnosed with FAS, to document their sociodemographics, reproductive and family planning history, social and healthcare utilization patterns, adverse social experiences, social support network, alcohol use and treatment history, mental health, and intelligence quotient (IQ). These high-risk women were diverse in racial, educational and economic backgrounds, were often victims of abuse, and challenged by mental health issues. Despite their rather harsh psychosocial profile, many demonstrated the ability to overcome their alcohol dependence over time. Relative to the women who had not achieved abstinence, the women who had achieved abstinence had significantly higher IQs, higher household incomes, larger more satisfactory social support networks, were more likely to report a religious affiliation, and were more likely to be receiving mental health treatment for their mental health disorders. The rate of unintended pregnancies and alcohol-exposed pregnancies was substantial. Key barriers to achieving effective family planning were maternal alcohol and drug use, lack of access to birth control and lack of support by their partner to use birth control. A FAS diagnostic and prevention clinic can be used to identify women at high risk for producing children damaged by prenatal alcohol exposure. Primary prevention programmes
Melatonin partially protects 661W cells from H2O2-induced death by inhibiting Fas/FasL-caspase-3.
Sánchez-Bretaño, Aída; Baba, Kenkichi; Janjua, Uzair; Piano, Ilaria; Gargini, Claudia; Tosini, Gianluca
2017-01-01
Previous studies have shown that melatonin (MEL) signaling is involved in the modulation of photoreceptor viability during aging. Recent work by our laboratory suggested that MEL may protect cones by modulating the Fas/FasL-caspase-3 pathway. In this study, we first investigated the presence of MEL receptors (MT 1 and MT 2 ) in 661W cells, then whether MEL can prevent H 2 O 2 -induced cell death, and last, through which pathway MEL confers protection. The mRNA and proteins of the MEL receptors were detected with quantitative PCR (q-PCR) and immunocytochemistry, respectively. To test the protective effect of MEL, 661W cells were treated with H 2 O 2 for 2 h in the presence or absence of MEL, a MEL agonist, and an antagonist. To study the pathways involved in H 2 O 2 -mediated cell death, a Fas/FasL antagonist was used before the exposure to H 2 O 2 . Finally, Fas/FasL and caspase-3 mRNA was analyzed with q-PCR and immunocytochemistry in cells treated with H 2 O 2 and/or MEL. Cell viability was analyzed by using Trypan Blue. Both MEL receptors (MT 1 and MT 2 ) were detected at the mRNA and protein levels in 661W cells. MEL partially prevented H 2 O 2 -mediated cell death (20-25%). This effect was replicated with IIK7 (a melatonin receptor agonist) when used at a concentration of 1 µM. Preincubation with luzindole (a melatonin receptor antagonist) blocked MEL protection. Kp7-6, an antagonist of Fas/FasL, blocked cell death caused by H 2 O 2 similarly to what was observed for MEL. Fas, FasL, and caspase-3 expression was increased in cells treated with H 2 O 2 , and this effect was prevented by MEL. Finally, MEL treatment partially prevented the activation of caspase-3 caused by H 2 O 2 . The results demonstrate that MEL receptors are present and functional in 661W cells. MEL can prevent photoreceptor cell death induced by H 2 O 2 via the inhibition of the proapoptotic pathway Fas/FasL-caspase-3.
Toda, Keisuke; Shiraishi, Tetsuya; Hirotsu, Tatsumi; Fukuyama, Kouzou; Mineta, Toshihiro; Kawaguchi, Shojiro; Tabuchi, Kazuo
1996-01-01
We have been applying an adoptive immunotherapy protocol to patients with malignant brain tumors using OK‐432‐activated peripheral blood mononuclear cells (OK‐MCs). In order to elucidate the mechanism of OK‐MCs' cytotoxicity, we examined the expression of Fas ligand mRNA in OK‐MCs and the cytocidal activity of these cells against a human glioma cell line, T98G which expresses a high level of Fas. The expression of Fas ligand mRNA was low in non‐treated peripheral blood mononuclear cells and was elevated by treatment with OK‐432, irrespective of the dose employed. Apoptosis of T98G cells induced by OK‐MCs was unequivocally inhibited by the pretreatment of T98G cells with ZB4 monoclonal antibody, which binds to Fas and blocks the binding of Fas ligand to Fas. These data indicate that the cytotoxic activity of OK‐MCs via apoptosis seems to be at least partly mediated by the Fas ligand/Fas system. Adoptive immunotherapy using the Fas ligand/Fas system could be a new treatment modality for human malignant brain tumors. PMID:8878461
Gonadal steroids modulate Fas-induced apoptosis of lactotropes and somatotropes.
Jaita, Gabriela; Zárate, Sandra; Ferrari, Luciana; Radl, Daniela; Ferraris, Jimena; Eijo, Guadalupe; Zaldivar, Verónica; Pisera, Daniel; Seilicovich, Adriana
2011-02-01
We have previously reported that Fas activation induces apoptosis of anterior pituitary cells from rats at proestrus but not at diestrus and in an estrogen-dependent manner. In this study, we evaluated the effect of Fas activation on apoptosis of lactotropes and somatotropes during the estrous cycle and explored the action of gonadal steroids on Fas-induced apoptosis. Also, we studied whether changes in Fas expression are involved in the apoptotic response of anterior pituitary cells. Fas activation increased the percentage of TUNEL-positive lactotropes and somatotropes at proestrus but not at diestrus. FasL triggered apoptosis of somatotropes only when cells from ovariectomized rats were cultured in the presence of 17 β-estradiol (E2). Progesterone (P4) blocked the apoptotic action of the Fas/FasL system in lactotropes and somatotropes incubated with E2. Both E2 and P4 increased the percentage of cells expressing Fas at the cell membrane. Our results show that Fas activation induces apoptosis of lactotropes and somatotropes at proestrus but not at diestrus. Gonadal steroids may be involved in the apoptotic response of lactotropes and somatotropes, suggesting that Fas activation is implicated in the renewal of these pituitary subpopulations during the estrous cycle. The effect of gonadal steroids on Fas expression may be only partially involved in regulation of the Fas/FasL apoptotic pathway in the anterior pituitary gland.
Galenkamp, Koen Mo; Carriba, Paulina; Urresti, Jorge; Planells-Ferrer, Laura; Coccia, Elena; Lopez-Soriano, Joaquín; Barneda-Zahonero, Bruna; Moubarak, Rana S; Segura, Miguel F; Comella, Joan X
2015-03-19
Patients with high-risk neuroblastoma (NBL) tumors have a high mortality rate. Consequently, there is an urgent need for the development of new treatments for this condition. Targeting death receptor signaling has been proposed as an alternative to standard chemo- and radio-therapies in various tumors. In NBL, this therapeutic strategy has been largely disregarded, possibly because ~50-70% of all human NBLs are characterized by caspase-8 silencing. However, the expression of caspase-8 is detected in a significant group of NBL patients, and they could therefore benefit from treatments that induce cell death through death receptor activation. Given that cytokines, such as TNFα, are able to upregulate Fas expression, we sought to address the therapeutic relevance of co-treatment with TNFα and FasL in NBL. For the purpose of the study we used a set of eight NBL cell lines. Here we explore the cell death induced by TNFα, FasL, cisplatin, and etoposide, or a combination thereof by Hoechst staining and calcein viability assay. Further assessment of the signaling pathways involved was performed by caspase activity assays and Western blot experiments. Characterization of Fas expression levels was achieved by qRT-PCR, cell surface biotinylation assays, and cytometry. We have found that TNFα is able to increase FasL-induced cell death by a mechanism that involves the NF-κB-mediated induction of the Fas receptor. Moreover, TNFα sensitized NBL cells to DNA-damaging agents (i.e. cisplatin and etoposide) that induce the expression of FasL. Priming to FasL-, cisplatin-, and etoposide-induced cell death could only be achieved in NBLs that display TNFα-induced upregulation of Fas. Further analysis denotes that the high degree of heterogeneity between NBLs is also manifested in Fas expression and modulation thereof by TNFα. In summary, our findings reveal that TNFα sensitizes NBL cells to FasL-induced cell death by NF-κB-mediated upregulation of Fas and unveil a new
Sawai, H.; Domae, N.
2010-01-01
Mouse monoclonal anti-Fas (CD95) antibody clone CH-11 has been widely used in research on apoptosis. CH-11 has the ability to bind to Fas protein on cell surface and induce apoptosis. Here, we used polystyrene beads coated with CH-11 to investigate the role of lipid rafts in Fas-mediated apoptosis in SKW6.4 cells. Unexpectedly, by treatment of the cells with CH-11-coated beads Fas protein was detached from cell surface and transferred to the surface of CH-11-coated beads. Western blot analysis showed that Fas protein containing both extracellular and intracellular domains was attached to the beads. Fas protein was not transferred from the cells to the surface of the beads coated with other anti-Fas antibodies or Fas ligand. Similar phenomenon was observed in Jurkat T cells. Furthermore, CH-11-induced apoptosis was suppressed by pretreatment with CH-11-coated beads in Jurkat cells. These results suggest that CH-11 might possess distinct properties on Fas protein compared with other anti-Fas antibodies or Fas ligand, and also suggest that caution should be needed to use polystyrene beads coated with antibodies such as CH-11. PMID:20353915
Identification of the Calmodulin-Binding Domains of Fas Death Receptor
Chang, Bliss J.; Samal, Alexandra B.; Vlach, Jiri; Fernandez, Timothy F.; Brooke, Dewey; Prevelige, Peter E.; Saad, Jamil S.
2016-01-01
The extrinsic apoptotic pathway is initiated by binding of a Fas ligand to the ectodomain of the surface death receptor Fas protein. Subsequently, the intracellular death domain of Fas (FasDD) and that of the Fas-associated protein (FADD) interact to form the core of the death-inducing signaling complex (DISC), a crucial step for activation of caspases that induce cell death. Previous studies have shown that calmodulin (CaM) is recruited into the DISC in cholangiocarcinoma cells and specifically interacts with FasDD to regulate the apoptotic/survival signaling pathway. Inhibition of CaM activity in DISC stimulates apoptosis significantly. We have recently shown that CaM forms a ternary complex with FasDD (2:1 CaM:FasDD). However, the molecular mechanism by which CaM binds to two distinct FasDD motifs is not fully understood. Here, we employed mass spectrometry, nuclear magnetic resonance (NMR), biophysical, and biochemical methods to identify the binding regions of FasDD and provide a molecular basis for the role of CaM in Fas–mediated apoptosis. Proteolytic digestion and mass spectrometry data revealed that peptides spanning residues 209–239 (Fas-Pep1) and 251–288 (Fas-Pep2) constitute the two CaM-binding regions of FasDD. To determine the molecular mechanism of interaction, we have characterized the binding of recombinant/synthetic Fas-Pep1 and Fas-Pep2 peptides with CaM. Our data show that both peptides engage the N- and C-terminal lobes of CaM simultaneously. Binding of Fas-Pep1 to CaM is entropically driven while that of Fas-Pep2 to CaM is enthalpically driven, indicating that a combination of electrostatic and hydrophobic forces contribute to the stabilization of the FasDD–CaM complex. Our data suggest that because Fas-Pep1 and Fas-Pep2 are involved in extensive intermolecular contacts with the death domain of FADD, binding of CaM to these regions may hinder its ability to bind to FADD, thus greatly inhibiting the initiation of apoptotic signaling
Dalton, Jane E; Howell, Gareth; Pearson, Jayne; Scott, Phillip; Carding, Simon R
2004-09-15
Gammadelta T cells have a direct role in resolving the host immune response to infection by eliminating populations of activated macrophages. Macrophage reactivity resides within the Vgamma1/Vdelta6.3 subset of gammadelta T cells, which have the ability to kill activated macrophages following infection with Listeria monocytogenes (Lm). However, it is not known how gammadelta T cell macrophage cytocidal activity is regulated, or what effector mechanisms gammadelta T cells use to kill activated macrophages. Using a macrophage-T cell coculture system in which peritoneal macrophages from naive or Lm-infected TCRdelta-/- mice were incubated with splenocytes from wild-type and Fas ligand (FasL)-deficient mice (gld), the ability of Vgamma1 T cells to bind macrophages was shown to be dependent upon Fas-FasL interactions. Combinations of anti-TCR and FasL Abs completely abolished binding to and killing of activated macrophages by Vgamma1 T cells. In addition, confocal microscopy showed that Fas and the TCR colocalized on Vgamma1 T cells at points of contact with macrophages. Collectively, these studies identify an accessory or coreceptor-like function for Fas-FasL that is essential for the interaction of Vgamma1 T cells with activated macrophages and their elimination during the resolution stage of pathogen-induced immune responses. Copyright 2004 The American Association of Immunologists, Inc.
Fas/APO-1 (CD95) expression in myelodysplastic syndromes.
Lepelley, P; Grardel, N; Erny, O; Iaru, T; Obein, V; Cosson, A; Fenaux, P
1998-07-01
Increased apoptosis of myeloid precursors appears to contribute to the pathophysiology of cytopenias in myelodysplastic syndromes (MDS). Fas /APO-1(CD95) is a cell surface protein inducing an apoptotic signal after its binding to Fas ligand or to a functional anti-Fas antibody. Here we studied Fas expression by immunocytochemistry on marrow slides from 30 cases of MDS. Increased Fas expression in erythroblasts and/or immature granulocytes, compared to controls, was seen in 12 (40%) of the cases. In addition, in 16 of the 18 cases with > or = 5% marrow blasts, a variable proportion of blasts expressed Fas. Increased apoptosis was found by morphological analysis and/or TUNEL technique in marrow cells from 8 of the 26 cases analyzed (31%) The ability of Fas antigen to trigger apoptosis was studied after addition of a functional anti Fas antibody in 5 of the patients with Fas overexpression. Addition of this antibody, however, only lead to mild increase of apoptosis in immature granulocytes (but not other myeloid cells) in 2 of the 5 cases. Thus, increased Fas expression is seen in myeloid and/or blast cells in the majority of MDS cases. However, the relationship between this finding and increased apoptosis in MDS still remains to be established.
Mao, Jia-Ding; Wu, Pei; Yang, Ying-Lin; Wu, Jian; Huang, He
2008-01-01
AIM: To explore the correlation between the mRNAs and protein expression of gastrin (GAS), somatostatin (SS) and apoptosis index (AI), apoptosis regulation gene Fas/FasL and caspases in large intestinal carcinoma (LIC). METHODS: Expression of GAS and SS mRNAs were detected by nested RT-PCR in 79 cases of LIC. Cell apoptosis was detected by molecular biology in situ apoptosis detecting methods (TUNEL). Immunohistochemical staining for GAS, SS, Fas/FasL, caspase-3 and caspase-8 was performed according to the standard streptavidin-biotin-peroxidase (S-P) method. RESULTS: There was a significant positive correlation between mRNA and protein expression of GAS and SS (GASrs=0.99, P < 0.01; SSrs = 0.98, P < 0.01). There was significant difference in positive expression rates of GAS, SS mRNAs and protein among different histological differentiation, histological types and Dukes’ stage of LIC. The AI in GAS high and moderate expression groups was significantly lower than that in low expression groups (3.75 ± 2.38 vs 7.82 ± 2.38, P < 0.01; 5.51 ± 2.66 vs 7.82 ± 2.38, P < 0.01), and the AI in SS high and moderate expression groups was significantly higher than that in low expression groups (9.03 ± 1.76 vs 5.35 ± 3.00, P < 0.01; 7.44 ± 2.67 vs 5.35 ± 3.00, P < 0.01). There was a significant negative correlation between the integral ratio of GAS to SS and the AI (rs = -0.41, P < 0.01). The positive expression rate of FasL in GAS high and moderate expression groups was higher than that in low expression group (90.9% and 81.0% vs 53.2%, P < 0.05). The positive expression rates of Fas, caspase-8 and caspase-3 in SS high (90.0%, 90.0% and 100%) and moderate (80.0%, 70.0%, 75.0%) expression groups were higher than that in low expression group (53.1%, 42.9%, 49.0%) (90.0% and 80.0% vs 53.1%, P < 0.05; 90.0% and 70.0% vs 42.9%, P < 0.05; 100.0% and 75.0% vs 49.0%, P < 0.05). There was a significant positive correlation between the integral ratio of GAS to SS and the
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Li, Qian; Peng, Jie; Liu, Ting; Zhang, Guiying
2017-09-01
Fas, which is an apoptotic-related protein, has an important role in cell apoptosis. Fas ligand (FasL) binds to Fas and activates apoptosis signal transduction. We previously demonstrated that the efficiency of celecoxib inhibited the proliferation and apoptosis of HT-29 colon cancer cell line. The BGC823 cell line was used as an experimental model to evaluate the potential role of celecoxib on gastric cancer cell apoptosis. Inhibitory effects of celecoxib on cell viability were determined by MTT assay. Cell apoptosis was evaluated by flow cytometric analysis and laser confocal microscopy. The results of the present study demonstrated that celecoxib inhibited the viability of BGC823 cells in a concentration- and time-dependent manner. Furthermore, the effect of BGC823 cells apoptosis was increased in a concentration-dependent manner. Western blotting was used to determine the protein expression levels of Fas, FasL, and B-cell lymphoma-2 (Bcl-2). During the celecoxib-induced apoptosis of BGC823 cells, celecoxib upregulated Fas expression and downregulated FasL and Bcl-2 expression in a concentration-dependent manner. These results suggest that celecoxib inhibited the growth and induced apoptosis of BGC823 gastric cancer cells by regulating the protein expression of Fas, FasL and Bcl-2.
Transcriptional regulation of fatty acid biosynthesis in mycobacteria
Mondino, S.; Gago, G.; Gramajo, H.
2013-01-01
SUMMARY The main purpose of our study is to understand how mycobacteria exert control over the biosynthesis of their membrane lipids and find out the key components of the regulatory network that control fatty acid biosynthesis at the transcriptional level. In this paper we describe the identification and purification of FasR, a transcriptional regulator from Mycobacterium sp. that controls the expression of the fatty acid synthase (fas) and the 4-phosphopantetheinyl transferase (acpS) encoding genes, whose products are involved in the fatty acid and mycolic acid biosynthesis pathways. In vitro studies demonstrated that fas and acpS genes are part of the same transcriptional unit and that FasR specifically binds to three conserved operator sequences present in the fas-acpS promoter region (Pfas). The construction and further characterization of a fasR conditional mutant confirmed that FasR is a transcriptional activator of the fas-acpS operon and that this protein is essential for mycobacteria viability. Furthermore, the combined used of Pfas-lacZ fusions in different fasR backgrounds and electrophoretic mobility shift assays experiments, strongly suggested that long-chain acyl-CoAs are the effector molecules that modulate the affinity of FasR for its DNA binding sequences and therefore the expression of the essential fas-acpS operon. PMID:23721164
7 CFR 1484.70 - Must Cooperators report to FAS?
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484... AGRICULTURAL COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a... contribution report is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on...
7 CFR 1484.70 - Must Cooperators report to FAS?
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484... AGRICULTURAL COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a... contribution report is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on...
Inhibition of Isolated Mycobacterium tuberculosis Fatty Acid Synthase I by Pyrazinamide Analogs▿
Ngo, Silvana C.; Zimhony, Oren; Chung, Woo Jin; Sayahi, Halimah; Jacobs, William R.; Welch, John T.
2007-01-01
An analog of pyrazinamide (PZA), 5-chloropyrazinamide (5-Cl-PZA), has previously been shown to inhibit mycobacterial fatty acid synthase I (FASI). FASI has been purified from a recombinant strain of M. smegmatis (M. smegmatis Δfas1 attB::M. tuberculosis fas1). Following purification, FASI activity and inhibition were assessed spectrophotometrically by monitoring NADPH oxidation. The observed inhibition was both concentration and structure dependent, being affected by both substitution at the 5 position of the pyrazine nucleus and the nature of the ester or N-alkyl group. Under the conditions studied, both 5-Cl-PZA and PZA exhibited concentration and substrate dependence consistent with competitive inhibition of FASI with Kis of 55 to 59 μM and 2,567 to 2,627 μM, respectively. The results were validated utilizing a radiolabeled fatty acid synthesis assay. This assay showed that FASI was inhibited by PZA and pyrazinoic acid as well as by a series of PZA analogs. PMID:17485499
7 CFR 1484.70 - Must Cooperators report to FAS?
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484... COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a) End-of-year... is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on the Internet...
7 CFR 1484.70 - Must Cooperators report to FAS?
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484... COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a) End-of-year... is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on the Internet...
7 CFR 1484.70 - Must Cooperators report to FAS?
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Must Cooperators report to FAS? 1484.70 Section 1484... COMMODITIES Reporting, Evaluation, and Compliance § 1484.70 Must Cooperators report to FAS? (a) End-of-year... is available on the FAS home page (http://www.fas.usda.gov/mos/programs/fnotice.html) on the Internet...
Dellomonaco, Clementina; Rivera, Carlos; Campbell, Paul; Gonzalez, Ramon
2010-01-01
Although lignocellulosic sugars have been proposed as the primary feedstock for the biological production of renewable fuels and chemicals, the availability of fatty acid (FA)-rich feedstocks and recent progress in the development of oil-accumulating organisms make FAs an attractive alternative. In addition to their abundance, the metabolism of FAs is very efficient and could support product yields significantly higher than those obtained from lignocellulosic sugars. However, FAs are metabolized only under respiratory conditions, a metabolic mode that does not support the synthesis of fermentation products. In the work reported here we engineered several native and heterologous fermentative pathways to function in Escherichia coli under aerobic conditions, thus creating a respiro-fermentative metabolic mode that enables the efficient synthesis of fuels and chemicals from FAs. Representative biofuels (ethanol and butanol) and biochemicals (acetate, acetone, isopropanol, succinate, and propionate) were chosen as target products to illustrate the feasibility of the proposed platform. The yields of ethanol, acetate, and acetone in the engineered strains exceeded those reported in the literature for their production from sugars, and in the cases of ethanol and acetate they also surpassed the maximum theoretical values that can be achieved from lignocellulosic sugars. Butanol was produced at yields and titers that were between 2- and 3-fold higher than those reported for its production from sugars in previously engineered microorganisms. Moreover, our work demonstrates production of propionate, a compound previously thought to be synthesized only by propionibacteria, in E. coli. Finally, the synthesis of isopropanol and succinate was also demonstrated. The work reported here represents the first effort toward engineering microorganisms for the conversion of FAs to the aforementioned products. PMID:20525863
Fatty acid synthase inhibition triggers apoptosis during S phase in human cancer cells.
Zhou, Weibo; Simpson, P Jeanette; McFadden, Jill M; Townsend, Craig A; Medghalchi, Susan M; Vadlamudi, Aravinda; Pinn, Michael L; Ronnett, Gabriele V; Kuhajda, Francis P
2003-11-01
C75, an inhibitor of fatty acid synthase (FAS), induces apoptosis in cultured human cancer cells. Its proposed mechanism of action linked high levels of malonyl-CoA after FAS inhibition to potential downstream effects including inhibition of carnitine palmitoyltransferase-1 (CPT-1) with resultant inhibition of fatty acid oxidation. Recent data has shown that C75 directly stimulates CPT-1 increasing fatty acid oxidation in MCF-7 human breast cancer cells despite inhibitory concentrations of malonyl-CoA. In light of these findings, we have studied fatty acid metabolism in MCF7 human breast cancer cells to elucidate the mechanism of action of C75. We now report that: (a) in the setting of increased fatty acid oxidation, C75 inhibits fatty acid synthesis; (b) C273, a reduced form of C75, is unable to inhibit fatty acid synthesis and is nontoxic to MCF7 cells; (c) C75 and 5-(tetradecyloxy)-2-furoic acid (TOFA), an inhibitor of acetyl-CoA carboxylase, both cause a significant reduction of fatty acid incorporation into phosphatidylcholine, the major membrane phospholipid, within 2 h; (d) pulse chase studies with [(14)C]acetate labeling of membrane lipids show that both C75 and TOFA accelerate the decay of (14)C-labeled lipid from membranes within 2 h; (e) C75 also promotes a 2-3-fold increase in oxidation of membrane lipids within 2 h; and (f) because interference with phospholipid synthesis during S phase is known to trigger apoptosis in cycling cells, we performed double-labeled terminal deoxynucleotidyltransferase-mediated nick end labeling and BrdUrd analysis with both TOFA and C75. C75 triggered apoptosis during S phase, whereas TOFA did not. Moreover, application of TOFA 2 h before C75 blocked the C75 induced apoptosis, whereas etomoxir did not. Taken together these data indicate that FAS inhibition and its downstream inhibition of phospholipid production is a necessary part of the mechanism of action of C75. CPT-1 stimulation does not likely play a role in the
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Singh, Narendra P.; Singh, Udai P.; Nagarkatti, Prakash S.
2012-01-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions. PMID:22888145
Singh, Narendra P; Singh, Udai P; Nagarkatti, Prakash S; Nagarkatti, Mitzi
2012-11-01
Prenatal exposure to diethylstilbestrol (DES) is known to cause altered immune functions and increased susceptibility to autoimmune disease in humans. In the current study, we investigated the effect of prenatal exposure to DES on thymocyte differentiation involving apoptotic pathways. Prenatal DES exposure caused thymic atrophy, apoptosis, and up-regulation of Fas and Fas ligand (FasL) expression in thymocytes. To examine the mechanism underlying DES-mediated regulation of Fas and FasL, we performed luciferase assays using T cells transfected with luciferase reporter constructs containing full-length Fas or FasL promoters. There was significant luciferase induction in the presence of Fas or FasL promoters after DES exposure. Further analysis demonstrated the presence of several cis-regulatory motifs on both Fas and FasL promoters. When DES-induced transcription factors were analyzed, estrogen receptor element (ERE), nuclear factor κB (NF-κB), nuclear factor of activated T cells (NF-AT), and activator protein-1 motifs on the Fas promoter, as well as ERE, NF-κB, and NF-AT motifs on the FasL promoter, showed binding affinity with the transcription factors. Electrophoretic mobility-shift assays were performed to verify the binding affinity of cis-regulatory motifs of Fas or FasL promoters with transcription factors. There was shift in mobility of probes (ERE or NF-κB2) of both Fas and FasL in the presence of nuclear proteins from DES-treated cells, and the shift was specific to DES because these probes failed to shift their mobility in the presence of nuclear proteins from vehicle-treated cells. Together, the current study demonstrates that prenatal exposure to DES triggers significant alterations in apoptotic molecules expressed on thymocytes, which may affect T-cell differentiation and cause long-term effects on the immune functions.
Gallic Acid Induces Apoptosis in Human Gastric Adenocarcinoma Cells.
Tsai, Chung-Lin; Chiu, Ying-Ming; Ho, Tin-Yun; Hsieh, Chin-Tung; Shieh, Dong-Chen; Lee, Yi-Ju; Tsay, Gregory J; Wu, Yi-Ying
2018-04-01
Gastric cancer is one of the most common malignant cancers with a poor prognosis and high mortality rate worldwide. Current treatment of gastric cancer includes surgery and chemotherapy as the main modalities, but the potentially severe side-effects of chemotherapy present a considerable challenge. Gallic acid is a trihydroxybenzoic acid found to exert an anticancer effect against a variety of cancer cells. The purpose of this study was to determine the anti-cancer activity of Galla chinensis and its main component gallic acid on human gastric adenocarcinoma cells. MTT assay and cell death ELISA were used to determine the apoptotic effect of Gallic Chinensis and gallic acid on human gastric adenocarcinoma cells. To determine the pathway and relevant components by which gallic acid-induced apoptosis is mediated through, cells were transfected with siRNA (Fas, FasL, DR5, p53) using Lipofectamine 2000. Reults: Gallic Chinensis and gallic acid induced apoptosis of human gastric adenocarcinoma cells. Gallic acid induced up-regulation of Fas, FasL, and DR5 expression in AGS cells. Transfection of cells with Fas, FasL, or DR5 siRNA reduced gallic acid-induced cell death. In addition, p53 was shown to be involved in gallic acid-mediated Fas, FasL, and DR5 expression as well as cell apoptosis in AGS cells. These results suggest that gallic acid has a potential role in the treatment of gastric cancer. Copyright© 2018, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
Trifluoperazine Regulation of Calmodulin Binding to Fas: A Computational Study
Pan, Di; Yan, Qi; Chen, Yabing; McDonald, Jay M; Song, Yuhua
2011-01-01
Death-inducing signaling complex (DISC) formation is a critical step in Fas-mediated signaling for apoptosis. Previous experiments have demonstrated that the calmodulin (CaM) antagonist, trifluoperazine (TFP) regulates CaM-Fas binding and affects Fas-mediated DISC formation. In this study, we investigated the anti-cooperative characteristics of TFP binding to CaM and the effect of TFP on the CaM-Fas interaction from both structural and thermodynamic perspectives using combined molecular dynamics simulations and binding free energy analyses. We studied the interactions of different numbers of TFP molecules with CaM and explored the effects of the resulting conformational changes in CaM on CaM-Fas binding. Results from these analyses showed that the number of TFP molecules bound to CaM directly influenced α-helix formation and hydrogen bond occupancy within the α-helices of CaM, contributing to the conformational and motion changes in CaM. These changes affected CaM binding to Fas, resulting in secondary structural changes in Fas and conformational and motion changes of Fas in CaM-Fas complexes, potentially perturbing the recruitment of Fas-associated death domain (FADD) for DISC formation. The computational results from this study reveal the structural and molecular mechanisms that underlie the role of the CaM antagonist, TFP, in regulation of CaM-Fas binding and Fas-mediated DISC formation in a concentration-dependent manner. PMID:21656570
Fas Binding to Calmodulin Regulates Apoptosis in Osteoclasts*
Wu, Xiaojun; Ahn, Eun-Young; McKenna, Margaret A.; Yeo, Hyeonju; McDonald, Jay M.
2005-01-01
Promotion of osteoclast apoptosis is one therapeutic approach to osteoporosis. Calmodulin, the major intracellular Ca2+ receptor, modulates both osteoclastogenesis and bone resorption. The calmodulin antagonist, trifluoperazine, rescues bone loss in ovariectomized mice (Zhang, L., Feng, X., and McDonald, J. M. (2003) Endocrinology 144, 4536–4543). We show here that a 3-h treatment of mouse osteoclasts with either of the calmodulin antagonists, tamoxifen or trifluoperazine, induces osteoclast apoptosis dose-dependently. Tamoxifen, 10 μm, and trifluoperazine, 10 μm, induce 7.3 ± 1.8-fold and 5.3 ± 0.9-fold increases in osteoclast apoptosis, respectively. In Jurkat cells, calmodulin binds to Fas, the death receptor, and this binding is regulated during Fas-mediated apoptosis (Ahn, E. Y., Lim, S. T., Cook, W. J., and McDonald, J. M. (2004) J. Biol. Chem. 279, 5661–5666). In osteoclasts, calmodulin also binds Fas. When osteoclasts are treated with 10 μm trifluoperazine, the binding between Fas and calmodulin is dramatically decreased at 15 min and gradually recovers by 60 min. A point mutation of the Fas death domain in the Lpr−cg mouse renders Fas inactive. Using glutathione S-transferase fusion proteins, the human Fas cytoplasmic domain is shown to bind calmodulin, whereas a point mutation (V254N) comparable with the Lpr−cg mutation in mice has markedly reduced calmodulin binding. Osteoclasts derived from Lpr−cg mice have diminished calmodulin/Fas binding and are more sensitive to calmodulin antagonist-induced apoptosis than those from wild-type mice. Both tamoxifen- and trifluoperazine-induced apoptosis are increased 1.6 ± 0.2-fold in Lpr−cg-derived osteoclasts compared with osteoclasts derived from wild-type mice. In summary, calmodulin antagonists induce apoptosis in osteoclasts by a mechanism involving interference with calmodulin binding to Fas. The effects of calmodulin/Fas binding on calmodulin antagonist-induced apoptosis may open a new
Afford, S C; Randhawa, S; Eliopoulos, A G; Hubscher, S G; Young, L S; Adams, D H
1999-01-18
We propose that a novel mechanism of hepatocyte apoptosis, involving a cooperative interaction between CD40 and Fas, is involved in the hepatocyte loss of chronic liver allograft rejection. We detected increased hepatocyte expression of Fas, Fas ligand (FasL), and CD40 associated with dropout of centrilobular (acinar zone 3) hepatocytes in chronic allograft rejection. Expression of CD40 ligand (CD40L) was also increased but was largely restricted to CD68(+) macrophages. A functional role for CD40 and Fas in hepatocyte apoptosis was demonstrated in vitro using primary human hepatocytes and the HepG2 cell line in both of which apoptosis was induced, not only by cross-linking Fas directly but also via CD40 activation. Our data suggest that CD40 activation induces apoptosis via Fas because (a) ligation of CD40 upregulated hepatocyte FasL expression, and (b) apoptosis induced via activation of CD40 was prevented by a neutralizing monoclonal antibody to FasL. Thus, CD40 engagement triggers apoptosis of human hepatocytes and might amplify Fas-dependent hepatocyte apoptosis in chronic rejection and other inflammatory liver diseases in which Fas-mediated apoptosis is involved.
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Tsutamoto, T; Wada, A; Maeda, K; Mabuchi, N; Hayashi, M; Tsutsui, T; Ohnishi, M; Fujii, M; Matsumoto, T; Yamamoto, T; Takayama, T; Kinoshita, M
2001-12-01
Cardiac natriuretic peptides may induce apoptosis in myocytes; however, the relationship between plasma levels of cardiac natriuretic peptides and those of soluble Fas (sFas) and tumor necrosis factor (TNF)-alpha remains unknown in patients with congestive heart failure (CHF). We measured plasma levels of sFas and TNF-alpha and those of atrial natriuretic peptide (ANP), brain natriuretic peptide (BNP), norepinephrine, and endothelin 1 in 96 patients with CHF (ejection fraction < 45%). The patients were monitored for 3 years. Plasma levels of sFas and TNF-alpha increased with the severity of CHF. There was no significant correlation between sFas plasma levels and those of ANP and BNP. Cox proportional hazard analysis showed that high levels of sFas (P = .009) and BNP (P < .0001) and a low ejection fraction (P = .019) were independent significant prognostic predictors. There is no significant correlation between cardiac natriuretic peptide and sFas levels in plasma. Plasma sFas is a useful prognostic marker independent of neurohumoral factors, suggesting that immune activation and/or apoptosis play a significant role in the pathogenesis of CHF.
Hirata, Akiko; Kishino, Shigenobu; Park, Si-Bum; Takeuchi, Michiki; Kitamura, Nahoko; Ogawa, Jun
2015-01-01
Hydroxy FAs, one of the gut microbial metabolites of PUFAs, have attracted much attention because of their various bioactivities. The purpose of this study was to identify lactic acid bacteria with the ability to convert linoleic acid (LA) to hydroxy FAs. A screening process revealed that a gut bacterium, Lactobacillus acidophilus NTV001, converts LA mainly into 13-hydroxy-cis-9-octadecenoic acid and resulted in the identification of the hydratase responsible, fatty acid hydratase 1 (FA-HY1). Recombinant FA-HY1 was purified, and its enzymatic characteristics were investigated. FA-HY1 could convert not only C18 PUFAs but also C20 and C22 PUFAs. C18 PUFAs with a cis carbon-carbon double bond at the Δ12 position were converted into the corresponding 13-hydroxy FAs. Arachidonic acid and DHA were converted into the corresponding 15-hydroxy FA and 14-hydroxy FA, respectively. To the best of our knowledge, this is the first report of a bacterial FA hydratase that can convert C20 and C22 PUFAs into the corresponding hydroxy FAs. These novel hydroxy FAs produced by using FA-HY1 should contribute to elucidating the bioactivities of hydroxy FAs. PMID:25966711
Aguirre, Adam; Shoji, Kenji F; Sáez, Juan C; Henríquez, Mauricio; Quest, Andrew F G
2013-02-01
Fas ligation via the ligand FasL activates the caspase-8/caspase-3-dependent extrinsic death pathway. In so-called type II cells, an additional mechanism involving tBid-mediated caspase-9 activation is required to efficiently trigger cell death. Other pathways linking FasL-Fas interaction to activation of the intrinsic cell death pathway remain unknown. However, ATP release and subsequent activation of purinergic P2X(7) receptors (P2X(7)Rs) favors cell death in some cells. Here, we evaluated the possibility that ATP release downstream of caspase-8 via pannexin1 hemichannels (Panx1 HCs) and subsequent activation of P2X(7)Rs participate in FasL-stimulated cell death. Indeed, upon FasL stimulation, ATP was released from Jurkat cells in a time- and caspase-8-dependent manner. Fas and Panx1 HCs colocalized and inhibition of the latter, but not connexin hemichannels, reduced FasL-induced ATP release. Extracellular apyrase, which hydrolyzes ATP, reduced FasL-induced death. Also, oxidized-ATP or Brilliant Blue G, two P2X(7)R blockers, reduced FasL-induced caspase-9 activation and cell death. These results represent the first evidence indicating that the two death receptors, Fas and P2X(7)R connect functionally via caspase-8 and Panx1 HC-mediated ATP release to promote caspase-9/caspase-3-dependent cell death in lymphoid cells. Thus, a hitherto unsuspected route was uncovered connecting the extrinsic to the intrinsic pathway to amplify death signals emanating from the Fas receptor in type II cells. Copyright © 2012 Wiley Periodicals, Inc.
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Dysregulation of hepatic fatty acid metabolism in chronic kidney disease.
Jin, Kyubok; Norris, Keith; Vaziri, Nosratola D
2013-02-01
Chronic kidney disease (CKD) results in hypertriglyceridemia which is largely due to impaired clearance of triglyceride-rich lipoproteins occasioned by downregulation of lipoprotein lipase and very low-density lipoprotein (LDL) receptor in the skeletal muscle and adipose tissue and of hepatic lipase and LDL receptor-related protein in the liver. However, data on the effect of CKD on fatty acid metabolism in the liver is limited and was investigated here. Male Sprague-Dawley rats were randomized to undergo 5/6 nephrectomy (CRF) or sham operation (control) and observed for 12 weeks. The animals were then euthanized and their liver tissue tested for nuclear translocation (activation) of carbohydrate-responsive element binding protein (ChREBP) and sterol-responsive element binding protein-1 (SREBP-1) which independently regulate the expression of key enzyme in fatty acid synthesis, i.e. fatty acid synthase (FAS) and acyl-CoA carboxylase (ACC) as well as nuclear Peroxisome proliferator-activated receptor alpha (PPARα) which regulates the expression of enzymes involved in fatty acid oxidation and transport, i.e. L-FABP and CPT1A. In addition, the expression of ATP synthase α, ATP synthase β, glycogen synthase and diglyceride acyltransferase 1 (DGAT1) and DGAT2 were determined. Compared with controls, the CKD rats exhibited hypertriglyceridemia, elevated plasma and liver tissue free fatty acids, increased nuclear ChREBP and reduced nuclear SREBP-1 and PPARα, upregulation of ACC and FAS and downregulation of L-FABP, CPT1A, ATP synthase α, glycogen synthase and DGAT in the liver tissue. Liver in animals with advanced CKD exhibits ChREBP-mediated upregulation of enzymes involved in fatty acid synthesis, downregulation of PPARα-regulated fatty acid oxidation system and reduction of DGAT resulting in reduced fatty acid incorporation in triglyceride.
2015-01-01
The Fas death receptor-activated death-inducing signaling complex (DISC) regulates apoptosis in many normal and cancer cells. Qualitative biochemical experiments demonstrate that calmodulin (CaM) binds to the death domain of Fas. The interaction between CaM and Fas regulates Fas-mediated DISC formation. A quantitative understanding of the interaction between CaM and Fas is important for the optimal design of antagonists for CaM or Fas to regulate the CaM–Fas interaction, thus modulating Fas-mediated DISC formation and apoptosis. The V254N mutation of the Fas death domain (Fas DD) is analogous to an identified mutant allele of Fas in lpr-cg mice that have a deficiency in Fas-mediated apoptosis. In this study, the interactions of CaM with the Fas DD wild type (Fas DD WT) and with the Fas DD V254N mutant were characterized using isothermal titration calorimetry (ITC), circular dichroism spectroscopy (CD), and molecular dynamics (MD) simulations. ITC results reveal an endothermic binding characteristic and an entropy-driven interaction of CaM with Fas DD WT or with Fas DD V254N. The Fas DD V254N mutation decreased the association constant (Ka) for CaM–Fas DD binding from (1.79 ± 0.20) × 106 to (0.88 ± 0.14) × 106 M–1 and slightly increased a standard state Gibbs free energy (ΔG°) for CaM–Fas DD binding from −8.87 ± 0.07 to −8.43 ± 0.10 kcal/mol. CD secondary structure analysis and MD simulation results did not show significant secondary structural changes of the Fas DD caused by the V254N mutation. The conformational and dynamical motion analyses, the analyses of hydrogen bond formation within the CaM binding region, the contact numbers of each residue, and the electrostatic potential for the CaM binding region based on MD simulations demonstrated changes caused by the Fas DD V254N mutation. These changes caused by the Fas DD V254N mutation could affect the van der Waals interactions and electrostatic interactions between CaM and Fas DD, thereby
Yao, Yinan; Lu, Shan; Lu, Guohua
2012-01-01
To investigate whether low doses of exogenous interferon (IFN)-γ attenuate airway inflammation, and the underlying mechanisms, in asthma. C57BL/6 mice (n=42), after intraperitoneal ovalbumin (OVA) sensitization on day 0 and day 12, were challenged with OVA aerosol for 6 consecutive days. Different doses of IFN-γ were then administered intraperitoneally 5 min before each inhalation during OVA challenge. Airway hyperresponsiveness, airway inflammatory cells, cytokine profiles, and Fas/FasL expression on CD4+ T cells were evaluated in an asthma model. The effect of various IFN-γ doses on Fas/FasL expression and CD4+ T cell apoptosis were assessed in vitro. We demonstrated that low doses of IFN-γ reduced pulmonary infiltration of inflammatory cells, Th2 cytokine production, and goblet cells hyperplasia (P<0.05), while high doses of endogenous IFN-γ had almost no effect. We also found that low doses of IFN-γ relocated Fas/FasL to the CD4+ T cell surface in the asthma model (P<0.05) and increased FasL-induced apoptosis in vitro (P<0.05). Furthermore, treatment with MFL-3, an anti-FasL antibody, partially abolished the anti- inflammatory properties of IFN-γ in the airway rather than affecting the Th1/Th2 balance. This research has revealed an alternative mechanism in asthma that involves low doses of IFN-γ, which attenuate airway inflammation through enhancing Fas/FasL-induced CD4+ T cell apoptosis. PMID:22994871
Kopf, Thomas; Schaefer, Hans-Ludwig; Troetzmueller, Martin; Koefeler, Harald; Broenstrup, Mark; Konovalova, Tatiana; Schmitz, Gerd
2014-01-01
Fenofibrate (FF) lowers plasma triglycerides via PPARα activation. Here, we analyzed lipidomic changes upon FF treatment of fructose fed rats. Three groups with 6 animals each were defined as control, fructose-fed and fructose-fed/FF treated. Male Wistar Unilever Rats were subjected to 10% fructose-feeding for 20 days. On day 14, fenofibrate treatment (100 mg/kg p.o.) was initiated and maintained for 7 days. Lipid species in serum were analyzed using mass spectrometry (ESI-MS/MS; LC-FT-MS, GC-MS) on days 0, 14 and 20 in all three groups. In addition, lipid levels in liver and intestine were determined. Short-chain TAGs increased in serum and liver upon fructose-feeding, while almost all TAG-species decreased under FF treatment. Long-chain unsaturated DAG-levels (36:1, 36:2, 36:4, 38:3, 38:4, 38:5) increased upon FF treatment in rat liver and decreased in rat serum. FAs, especially short-chain FAs (12:0, 14:0, 16:0) increased during fructose-challenge. VLDL secretion increased upon fructose-feeding and together with FA-levels decreased to control levels during FF treatment. Fructose challenge of de novo fatty acid synthesis through fatty acid synthase (FAS) may enhance the release of FAs ≤ 16:0 chain length, a process reversed by FF-mediated PPARα-activation.
FAS grafted superhydrophobic ceramic membrane
NASA Astrophysics Data System (ADS)
Lu, Jun; Yu, Yun; Zhou, Jianer; Song, Lixin; Hu, Xingfang; Larbot, Andre
2009-08-01
The hydrophobic properties of γ-Al 2O 3 membrane have been obtained by grafting fluoroalkylsilane (FAS) on the surface of the membrane. The following grafting parameters were studied: the eroding time of the original membrane, the grafting time, the concentration of FAS solution and the multiplicity of grafting. Hydrophobicity of the membranes was characterized by contact angle (CA) measurement. The thermogravimetric analysis (TGA) was used to investigate the weight loss process (25-800 °C) of the fluoroalkylsilane grafted on Al 2O 3 powders under different grafting conditions. The morphologies of the membranes modified under different parameters were examined by field emission scanning electron microscopy (FE-SEM) and the surface roughness (Ra) was measured using white light interferometers. A needle-like structure was observed on the membrane surface after modification, which causes the change of Ra. On the results above, we speculated a model to describe the reaction between FAS and γ-Al 2O 3 membrane surface as well as the formed surface morphology.
Grygorczuk, Sambor; Osada, Joanna; Moniuszko, Anna; Świerzbińska, Renata; Kondrusik, Maciej; Zajkowska, Joanna; Dunaj, Justyna; Dąbrowska, Milena; Pancewicz, Sławomir
2015-03-01
Apoptosis of the lymphocytes plays an essential role in the regulation of inflammatory/immune responses and its abnormalities may contribute to a chronic infection, persistent inflammation and autoimmunity. Its role in the pathogenesis of the late Lyme borreliosis manifestations has not been studied so far. We have measured Th lymphocyte apoptosis rate, membrane expression of pro-apoptotic Fas receptor, and supernatant concentrations of selected soluble pro- and anti-apoptotic mediators in cultures of peripheral blood mononuclear cells from 16 patients with disseminated Lyme borreliosis (6 with osteoarticular symptoms, 7 with neuroborreliosis and 3 with acrodermatitis chronica atrophicans) and 8 healthy controls. The cultures stimulated for 48h with live Borrelia burgdorferi sensu stricto, B. garinii or B. afzelii spirochetes. Fraction of the apoptotic Th (CD3+CD4+) lymphocytes and expression of Fas in this cell population was measured cytometrically and concentrations of soluble Fas, soluble Fas ligand, IL-10, IL-12 and TGF-β in culture supernatant with ELISA assays. The expression of IL-10, soluble and membrane Fas and soluble Fas ligand was increased under stimulation and higher in the presence of B. burgdorferi sensu stricto than the other species. Apoptosis rate was not affected. There was no difference between Lyme borreliosis patients and controls. IL-10 concentration correlated negatively with the membrane Fas expression and apoptosis under stimulation with B. afzelii and B. garinii. Expression of Fas/FasL system is up-regulated under stimulation with B. burgdorferi, but without corresponding increase in lymphocyte apoptosis. Variable responses observed with different B. burgdorferi species may reflect differences in the pathogenesis of the infection in vivo. Copyright © 2014 Elsevier GmbH. All rights reserved.
Matsuzawa, Akio; Shimizu, Motomu; Takeda, Yasutaka; Nagase, Hisashi; Sayama, Kazutoshi; Kimura, Mikio
2002-01-01
The functional differences between two mutations of the Fas (CD95) locus, Faslpr (lpr) and Faslprcg (lprcg), were investigated using bone marrow (BM) transplantation on the C3H mouse background. Both lpr/lpr and lprcg/lprcg BM transferred caused lymph node (LN) hyperplasia in lpr/+ and lprcg/+ recipients, although it was clearly smaller than that in lpr/lpr and lprcg/lprcg recipients of lpr/lpr and lprcg/lprcg BM. In addition, both BM induced significantly larger LN hyperplasia in lprcg/+ than lpr/+ recipients. Appearance of CD4− CD8−[double negative (DN)] T cells in the periphery is the most consistent phenotype of Fas mutations. Importantly, the proportion of DN T cells was higher in larger LN hyperplasia in the order of lpr/+, lprcg/+ and lpr/lpr or lprcg/lprcg recipients. On the other hand, both lpr/lpr and lprcg/lprcg BM transferred into wild-type (+/+) mice caused marked LN atrophy. The former, but not the latter, induced wasting syndrome. Faslg1d (gld)-homozygous lpr/lpr BM transferred into +/+ mice elicited LN hyperplasia of the same extent as that in lpr/lpr mice transferred with lpr/lpr BM, but not wasting syndrome. Taken together with the fact that DN T cells massively express Fas ligand (FasL), this study implied that FasL overexpressed on DN cells may be involved in the accumulation of DN T cells in LN, LN atrophy and wasting syndrome, and that lprcg Fas, which can bind to Fas ligand but not transduce apoptosis signal into cells, may modulate these pathological conditions by interfering with the binding of FasL to Fas. PMID:12153509
Fatty Acid Synthesis and Oxidation in Cumulus Cells Support Oocyte Maturation in Bovine
Sanchez-Lazo, Laura; Brisard, Daphné; Elis, Sébastien; Maillard, Virginie; Uzbekov, Rustem; Labas, Valérie; Desmarchais, Alice; Papillier, Pascal; Monget, Philippe
2014-01-01
Oocyte meiotic maturation requires energy from various substrates including glucose, amino acids, and lipids. Mitochondrial fatty acid (FA) β-oxidation (FAO) in the oocyte is required for meiotic maturation, which is accompanied by differential expression of numerous genes involved in FAs metabolism in surrounding cumulus cells (CCs) in vivo. The objective was to elucidate components involved in FAs metabolism in CCs during oocyte maturation. Twenty-seven genes related to lipogenesis, lipolysis, FA transport, and FAO were chosen from comparative transcriptome analysis of bovine CCs before and after maturation in vivo. Using real-time PCR, 22 were significantly upregulated at different times of in vitro maturation (IVM) in relation to oocyte meiosis progression from germinal vesicle breakdown to metaphase-II. Proteins FA synthase, acetyl-coenzyme-A carboxylase, carnitine palmitoyltransferase, perilipin 2, and FA binding protein 3 were detected by Western blot and immunolocalized to CCs and oocyte cytoplasm, with FA binding protein 3 concentrated around oocyte chromatin. By mass spectrometry, CCs lipid profiling was shown to be different before and after IVM. FAO inhibitors etomoxir and mildronate dose-dependently decreased the oocyte maturation rate in vitro. In terms of viability, cumulus enclosed oocytes were more sensitive to etomoxir than denuded oocytes. In CCs, etomoxir (150μM) led to downregulation of lipogenesis genes and upregulated lipolysis and FAO genes. Moreover, the number of lipid droplets decreased, whereas several lipid species were more abundant compared with nontreated CCs after IVM. In conclusion, FAs metabolism in CCs is important to maintain metabolic homeostasis and may influence meiosis progression and survival of enclosed oocytes. PMID:25058602
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
Kiso, Minako; Manabe, Noboru; Komatsu, Kohji; Shimabe, Munetake; Miyamoto, Hajime
2003-12-01
Senescence accelerated mouse-prone (SAMP) mice with a shortened life span show accelerated changes in many of the signs of aging and a shorter reproductive life span than SAM-resistant (SAMR) controls. We previously showed that functional regression (progesterone dissimilation) occurs in abnormally accumulated luteal bodies (aaLBs) of SAMP mice, but structural regression of luteal cells in aaLB is inhibited. A deficiency of luteal cell apoptosis causes the abnormal accumulation of LBs in SAMP ovaries. In the present study, to show the abnormality of Fas ligand (FasL)/Fas-mediated apoptosis signal transducing factors in the aaLBs of the SAMP ovaries, we assessed the changes in the expression of FasL, Fas, caspase-8 and caspase-3 mRNAs by reverse transcription-polymerase chain reaction, and in the expression and localization of FasL, Fas and activated caspase-3 proteins by Western blotting and immunohistochemistry, respectively, during the estrus cycle/luteolysis. These mRNAs and proteins were expressed in normal LBs of both SAMP and SAMR ovaries, but not at all or only in trace amounts in aaLBs of SAMP, indicating that structural regression is inhibited by blockage of the expression of these transducing factors in luteal cells of aaLBs in SAMP mice.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Liu, Yang; Liu, Xiuheng; Wang, Lei; Du, Yang; Chen, Zhiyuan; Chen, Hui; Guo, Jia; Weng, Xiaodong; Wang, Xiao; Wang, Ming; Wang, Zhishun
2017-12-01
The aim of the present study was to investigate the effect and possible mechanism of apigenin on renal ischemia-reperfusion (I/R) injury in rats, as well as in in vitro experiments. In total, 36 rats were subjected to 45 min of renal ischemia, with or without treatment prior to ischemia with different concentrations of apigenin (2, 10 and 50 mg/kg) administered intravenously. All rats were sacrificed at 24 h after I/R injury. The serum creatinine (Cr) and blood urea nitrogen (BUN) levels were analyzed, and histological examination was conducted. In addition, the expression levels of B-cell lymphoma 2 (Bcl-2) and Fas/Fas ligand (FasL) were detected by immunohistochemistry, reverse transcription-quantitative polymerase chain reaction and western blot analysis. For in vitro experiments, the NRK-52E cell line was employed. The viability, apoptosis and expression levels of Fas, FasL and Bcl-2 were examined in the culture of NRK-52E cells following the I/R. The results indicated that apigenin significantly decreased the levels of serum Cr and BUN induced by renal I/R, demonstrating an improvement in renal function. The histological evidence of renal damage associated with I/R was also mitigated by apigenin in vivo . Furthermore, apigenin increased the cell viability and decreased cell apoptosis in the culture of NRK52E after I/R in vitro . Compared with the I/R group, the expression of Bcl-2 was upregulated and the expression levels of Fas and FasL were downregulated by apigenin at the mRNA and protein levels in vivo and in vitro . In conclusion, apigenin appeared to increase the expression of Bcl-2 and reduce Fas/FasL expression in renal I/R injury, providing evident protection against renal I/R injury in rats.
Liu, Yang; Liu, Xiuheng; Wang, Lei; Du, Yang; Chen, Zhiyuan; Chen, Hui; Guo, Jia; Weng, Xiaodong; Wang, Xiao; Wang, Ming; Wang, Zhishun
2017-01-01
The aim of the present study was to investigate the effect and possible mechanism of apigenin on renal ischemia-reperfusion (I/R) injury in rats, as well as in in vitro experiments. In total, 36 rats were subjected to 45 min of renal ischemia, with or without treatment prior to ischemia with different concentrations of apigenin (2, 10 and 50 mg/kg) administered intravenously. All rats were sacrificed at 24 h after I/R injury. The serum creatinine (Cr) and blood urea nitrogen (BUN) levels were analyzed, and histological examination was conducted. In addition, the expression levels of B-cell lymphoma 2 (Bcl-2) and Fas/Fas ligand (FasL) were detected by immunohistochemistry, reverse transcription-quantitative polymerase chain reaction and western blot analysis. For in vitro experiments, the NRK-52E cell line was employed. The viability, apoptosis and expression levels of Fas, FasL and Bcl-2 were examined in the culture of NRK-52E cells following the I/R. The results indicated that apigenin significantly decreased the levels of serum Cr and BUN induced by renal I/R, demonstrating an improvement in renal function. The histological evidence of renal damage associated with I/R was also mitigated by apigenin in vivo. Furthermore, apigenin increased the cell viability and decreased cell apoptosis in the culture of NRK52E after I/R in vitro. Compared with the I/R group, the expression of Bcl-2 was upregulated and the expression levels of Fas and FasL were downregulated by apigenin at the mRNA and protein levels in vivo and in vitro. In conclusion, apigenin appeared to increase the expression of Bcl-2 and reduce Fas/FasL expression in renal I/R injury, providing evident protection against renal I/R injury in rats. PMID:29285062
Wang, Shih-Wei; Chen, Yun-Ru; Chow, Jyh-Ming; Chien, Ming-Hsien; Yang, Shun-Fa; Wen, Yu-Ching; Lee, Wei-Jiunn; Tseng, Tsui-Hwa
2018-07-01
Luteolin (3',4',5,7-tetrahydroxyflavone), which exists in fruits, vegetables, and medicinal herbs, is used in Chinese traditional medicine for treating various diseases, such as hypertension, inflammatory disorders, and cancer. However, the gene-regulatory role of luteolin in cancer prevention and therapy has not been clarified. Herein, we demonstrated that treatment with luteolin resulted in a significant decrease in the viability of human leukemia cells. In the present study, by evaluating fragmentation of DNA and poly (ADP-ribose) polymerase (PARP), we found that luteolin was able to induce PARP cleavage and nuclear fragmentation as well as an increase in the sub-G 0 /G 1 fraction. In addition, luteolin also induced Fas and Fas ligand (FasL) expressions and subsequent activation of caspases-8 and -3, which can trigger the extrinsic apoptosis pathway, while knocking down Fas-associated protein with death domain (FADD) prevented luteolin-induced PARP cleavage. Immunoblot and chromatin immunoprecipitation (ChIP) analyses revealed that luteolin increased acetylation of histone H3, which is involved in the upregulation of Fas and FasL. Moreover, both the extracellular signal-regulated kinase (ERK) and c-Jun N-terminal kinase (JNK) pathways are involved in luteolin-induced histone H3 acetylation. Finally, luteolin also activated the c-Jun signaling pathway, which contributes to FasL, but not Fas, gene expression and downregulation of c-Jun expression by small interfering RNA transfection which resulted in a significant decrease in luteolin-induced PARP cleavage. Thus, our results demonstrate that luteolin induced apoptosis of HL-60 cells, and this was associated with c-Jun activation and histone H3 acetylation-mediated Fas/FasL expressions. © 2018 Wiley Periodicals, Inc.
Mutation in the Fas Pathway Impairs CD8+ T Cell Memory1
Dudani, Renu; Russell, Marsha; van Faassen, Henk; Krishnan, Lakshmi; Sad, Subash
2014-01-01
Fas death pathway is important for lymphocyte homeostasis, but the role of Fas pathway in T cell memory development is not clear. We show that whereas the expansion and contraction of CD8+ T cell response against Listeria monocytogenes were similar for wild-type (WT) and Fas ligand (FasL) mutant mice, the majority of memory CD8+ T cells in FasL mutant mice displayed an effector memory phenotype in the long-term in comparison with the mainly central memory phenotype displayed by memory CD8+ T cells in WT mice. Memory CD8+ T cells in FasL mutant mice expressed reduced levels of IFN-γ and displayed poor homeostatic and Ag-induced proliferation. Impairment in CD8+ T cell memory in FasL mutant hosts was not due to defective programming or the expression of mutant FasL on CD8+ T cells, but was caused by perturbed cytokine environment in FasL mutant mice. Although adoptively transferred WT memory CD8+ T cells mediated protection against L. monocytogenes in either the WT or FasL mutant hosts, FasL mutant memory CD8+ T cells failed to mediate protection even in WT hosts. Thus, in individuals with mutation in Fas pathway, impairment in the function of the memory CD8+ T cells may increase their susceptibility to recurrent/latent infections. PMID:18292515
Acid-base properties of humic and fulvic acids formed during composting.
Plaza, César; Senesi, Nicola; Polo, Alfredo; Brunetti, Gennaro
2005-09-15
The soil acid-base buffering capacity and the biological availability, mobilization, and transport of macro- and micronutrients, toxic metal ions, and xenobiotic organic cations in soil are strongly influenced by the acid-base properties of humic substances, of which humic and fulvic acids are the major fractions. For these reasons, the proton binding behavior of the humic acid-like (HA) and fulvic acid-like (FA) fractions contained in a compost are believed to be instrumental in its successful performance in soil. In this work, the acid-base properties of the HAs and FAs isolated from a mixture of the sludge residue obtained from olive oil mill wastewater (OMW) evaporated in an open-air pond and tree cuttings (TC) at different stages of composting were investigated by a current potentiometric titration method and the nonideal competitive adsorption (NICA)-Donnan model. The NICA-Donnan model provided an excellent description of the acid-base titration data, and pointed out substantial differences in site density and proton-binding affinity between the HAs and FAs examined. With respect to FAs, HAs were characterized by a smaller content of carboxylic- and phenolic-type groups and their larger affinities for proton binding. Further, HAs featured a greater heterogeneity in carboxylic-type groups than FAs. The composting process increased the content and decreased the proton affinity of carboxylic- and phenolic-type groups of HAs and FAs, and increased the heterogeneity of phenolic-type groups of HAs. As a whole, these effects indicated that the composting process could produce HA and FA fractions with greater cation binding capacities. These results suggest that composting of organic materials improves their agronomic and environmental value by increasing their potential to retain and exchange macro- and micronutrients, and to reduce the bioavailability of organic and inorganic pollutants.
Kim, Ryungsa; Emi, Manabu; Tanabe, Kazuaki; Uchida, Yoko; Toge, Tetsuya
2004-06-01
Despite the fact that expression of Fas ligand (FasL) in cytotoxic T lymphocytes (CTLs) and in natural killer (NK) cells plays an important role in Fas-mediated tumor killing, During tumor progression FasL-expressing tumor cells are involved in counterattacking to kill tumor-infiltrating lymphocytes (TILs). Soluble FasL levels also increase with tumor progression in solid tumors, and this increase inhibits Fas-mediated tumor killing by CTLs and NK cells. The increased expression of FasL in tumor cells is associated with decreased expression of Fas; and the promoter region of the FASL gene is regulated by transcription factors, such as neuronal factor kappaB (NF-kappaB) and AP-1, in the tumor microenvironment. Although the ratio of FasL expression to Fas expression in tumor cells is not strongly related to the induction of apoptosis in TILs, increased expression of FasL is associated with decreased Fas levels in tumor cells that can escape immune surveillance and facilitate tumor progression and metastasis. Transforming growth factor beta (TGF-beta) is a potent growth inhibitor and has tumor-suppressing activity in the early phases of carcinogenesis. During subsequent tumor progression, the increased secretion of TGF-beta by both tumor cells and, in a paracrine fashion, stromal cells, is involved in the enhancement of tumor invasion and metastasis accompanied by immunosuppression. Herein, the authors review the clinical significance of FasL and TGF-beta expression patterns as features of immune privilege accompanying tumor progression in the tumor microenvironment. Potential strategies for identifying which molecules can serve as targets for effective antitumor therapy also are discussed. Copyright 2004 American Cancer Society.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Sun, Zilong; Nie, Qingli; Zhang, Lianjie; Niu, Ruiyan; Wang, Jundong; Wang, Shaolin
2017-02-01
Previous investigations have demonstrated the adverse impacts of fluoride on Sertoli cells (SCs), such as oxidative stress and apoptosis. SCs are the crucial cellular components that can create the immune privileged environment in testis. However, the effect of fluoride on SCs immune privilege is unknown. In this study, mouse SCs were exposed to sodium fluoride with varying concentrations of 10 -5 , 10 -4 , and 10 -3 mol/L to establish the model of fluoride-treated SCs (F-SCs) in vitro. After 48 h of incubation, F-SCs were transplanted underneath the kidney capsule of mice for 21 days, or cocultured with spleen lymphocytes for another 48 h. Immunohistochemical analysis of GATA4 in SCs grafts underneath kidney capsule presented less SCs distribution and obvious immune cell infiltration in F-SCs groups. In addition, the levels of FasL protein and mRNA in non-cocultured F-SCs decreased with the increase of fluoride concentration. When cocultured with F-SCs, lymphocytes presented significantly high cell viability and low apoptosis in F-SCs groups. Protein and mRNA expressions of FasL in cocultured F-SCs and Fas in lymphocytes were reduced, and the caspase 8 and caspase 3 mRNA levels were also decreased in fluoride groups in a dose-dependent manner. These findings indicated that fluoride influenced the testicular immune privilege through disturbing the Fas/FasL system. Copyright © 2016 Elsevier Ltd. All rights reserved.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Crosstalk between Fas and JNK determines lymphocyte apoptosis after ionizing radiation.
Praveen, Koganti; Saxena, Nandita
2013-06-01
Radiation simultaneously activate Fas and JNK pathway in lymphocytes but their precise interaction is not clearly understood. Activation of Fas pathway is required for radiation induced apoptosis, however induction of JNK pathway may or may not contribute in apoptosis. Here we report that Fas, Fas associated death domain and total JNK are activated in a dose- and time-dependent radiation exposure. A biphasic pattern of phospho-JNK was found at lower doses (1 and 2 Gy), however at higher doses of radiation phospho-JNK was continuously activated. Interestingly, Fas ligand expression remained biphasic at all the doses of radiation. Our results suggest that the Fas pathway is the major player in radiation-induced apoptosis, with JNK playing a contributory role. We also observed that Fas ligand expression by radiation is dependent on JNK activation. We also propose that radiation activates JNK pathway, but sustained activation is required for maximal induction of apoptosis at later times. Our findings define a mechanism for crosstalk between JNK and Fas pathway in radiation-induced apoptosis, which may lead to the development of new therapeutic strategies.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Islam, Zhahirul; Jahan, Israt; Ahammad, Rijwan U; Shahnaij, Mohammad; Nahar, Shamsun; Mohammad, Quazi D
2018-01-01
Guillain-Barré syndrome (GBS) is an autoimmune disorder of the peripheral nervous system triggered by molecular mimicry between pathogen lipopolysaccharides and host nerve gangliosides. Polymorphisms in the Fas receptor (FAS) and Fas ligand (FASL) genes may potentially alter the elimination of autoreactive immune cells and affect disease susceptibility or disease severity in GBS. We detected single nucleotide polymorphisms (SNPs) in FAS (-1377G/A and -670A/G) and FASL (-843C/T) in a prospective cohort of 300 patients with GBS and 300 healthy controls from the Bangladeshi population. Genotype distributions were not significantly different between patients with GBS and healthy controls. The FAS -670 AG heterozygous (P = 0.0005, OR = 2.5, 95% CI = 1.5-4.2) and GG homozygous (P = 0.0048, OR = 2.6, 95% CI = 1.3-5.0) genotypes were more common in patients with anti-GM1 antibodies than patients without anti-GM1 antibodies. The FAS -670 G allele was more prevalent in anti-GM1 antibody-positive than -negative patients (P = 0.0002, OR = 1.9, 95% CI = 1.4-2.7) and also in patients with the axonal subtype than demyelinating subtype (P < 0.0001, OR = 4.8, 95% CI = 2.3-10.1). The 1377G/-670G GG haplotype was significantly associated with the axonal subtype (P < 0.0001) and anti-ganglioside antibody-positivity (P = 0.0008) in GBS. Serum sFas (237.5 pg/mL vs. 159.5 pg/mL; P < 0.0001) and sFasL (225.1 pg/mL vs. 183.4 pg/mL; P = 0.0069) were elevated in patients with GBS compared to healthy controls, and among patients with high serum sFas was associated with severe GBS (P = 0.0406). In conclusion, this study indicates FAS-FASL promoter SNPs may promote the production of cross-reactive anti-ganglioside antibodies in GBS.
Liu, Pei-Ying; Chang, Dun-Cheng; Lo, Yu-Sheng; Hsi, Yi-Ting; Lin, Chia-Chieh; Chuang, Yi-Ching; Lin, Shu-Hui; Hsieh, Ming-Ju; Chen, Mu-Kuan
2018-04-01
Nasopharyngeal carcinoma (NPC) is endemic in Southern China and Southeast Asia. The present study investigated the activity of osthole in suppressing NPC along with the underlying mechanism. Cell growth inhibition was measured using the MTT assay. Apoptosis was detected through 4',6-diamidino-2-phenylindole staining and flow cytometry. Western blotting was used to identify the signaling pathway. Osthole markedly inhibited cell proliferation and induced apoptosis in the NPC cell line. Western blotting results revealed the increased activation of caspases 3, 8, and 9 and poly (ADP-ribose) polymerase. Osthole treatment significantly reduced the expression of the antiapoptotic protein Bcl-2 and increased the expression of the proapoptotic proteins Bax, Bak, BimL, BimS, and t-Bid. Osthole treatment also increased the expression of Fas, FADD, TNF-R1, TNF-R2, DcR2, RIP, and DR5. In addition, osthole treatment significantly increased the expression levels of phosphorylated ERK1/2 and JNK1/2. These results suggested that osthole exerts cytotoxic effects on NPC cell lines mainly through apoptosis mediated by the Fas-Fas ligand and mitochondrial pathway. Osthole could be a potential anticancer agent for NPC. © 2018 Wiley Periodicals, Inc.
Fatty acids linked to cardiovascular mortality are associated with risk factors
Ebbesson, Sven O. E.; Voruganti, Venkata S.; Higgins, Paul B.; Fabsitz, Richard R.; Ebbesson, Lars O.; Laston, Sandra; Harris, William S.; Kennish, John; Umans, Benjamin D.; Wang, Hong; Devereux, Richard B.; Okin, Peter M.; Weissman, Neil J.; MacCluer, Jean W.; Umans, Jason G.; Howard, Barbara V.
2015-01-01
Background Although saturated fatty acids (FAs) have been linked to cardiovascular mortality, it is not clear whether this outcome is attributable solely to their effects on low-density lipoprotein cholesterol (LDL-C) or whether other risk factors are also associated with FAs. The Western Alaskan Native population, with its rapidly changing lifestyles, shift in diet from unsaturated to saturated fatty acids and dramatic increase in cardiovascular disease (CVD), presents an opportunity to elucidate any associations between specific FAs and known CVD risk factors. Objective We tested the hypothesis that the specific FAs previously identified as related to CVD mortality are also associated with individual CVD risk factors. Methods In this community-based, cross-sectional study, relative proportions of FAs in plasma and red blood cell membranes were compared with CVD risk factors in a sample of 758 men and women aged ≥35 years. Linear regression analyses were used to analyze relations between specific FAs and CVD risk factors (LDL-C, high-density lipoprotein cholesterol, triglycerides, C-reactive protein, systolic blood pressure, diastolic blood pressure, heart rate, body mass index, fasting glucose and fasting insulin, 2-hour glucose and 2-hour insulin). Results The specific saturated FAs previously identified as related to CVD mortality, the palmitic and myristic acids, were adversely associated with most CVD risk factors, whereas unsaturated linoleic acid (18:2n-6) and the marine n-3 FAs were not associated or were beneficially associated with CVD risk factors. Conclusions The results suggest that CVD risk factors are more extensively affected by individual FAs than hitherto recognized, and that risk for CVD, MI and stroke can be reduced by reducing the intake of palmitate, myristic acid and simple carbohydrates and improved by greater intake of linoleic acid and marine n-3 FAs. PMID:26274054
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Regulation of fibroblast Fas expression by soluble and mechanical pro-fibrotic stimuli.
Dodi, Amos E; Ajayi, Iyabode O; Chang, Christine; Beard, Meghan; Ashley, Shanna L; Huang, Steven K; Thannickal, Victor J; Tschumperlin, Daniel J; Sisson, Thomas H; Horowitz, Jeffrey C
2018-05-10
Fibroblast apoptosis is a critical component of normal repair and the acquisition of an apoptosis-resistant phenotype contributes to the pathogenesis of fibrotic repair. Fibroblasts from fibrotic lungs of humans and mice demonstrate resistance to apoptosis induced by Fas-ligand and prior studies have shown that susceptibility to apoptosis is enhanced when Fas (CD95) expression is increased in these cells. Moreover, prior work shows that Fas expression in fibrotic lung fibroblasts is reduced by epigenetic silencing of the Fas promoter. However, the mechanisms by which microenvironmental stimuli such as TGF-β1 and substrate stiffness affect fibroblast Fas expression are not well understood. Primary normal human lung fibroblasts (IMR-90) were cultured on tissue culture plastic or on polyacrylamide hydrogels with Young's moduli to recapitulate the compliance of normal (400 Pa) or fibrotic (6400 Pa) lung tissue and treated with or without TGF-β1 (10 ng/mL) in the presence or absence of protein kinase inhibitors and/or inflammatory cytokines. Expression of Fas was assessed by quantitative real time RT-PCR, ELISA and Western blotting. Soluble Fas (sFas) was measured in conditioned media by ELISA. Apoptosis was assessed using the Cell Death Detection Kit and by Western blotting for cleaved PARP. Fas expression and susceptibility to apoptosis was diminished in fibroblasts cultured on 6400 Pa substrates compared to 400 Pa substrates. TGF-β1 reduced Fas mRNA and protein in a time- and dose-dependent manner dependent on focal adhesion kinase (FAK). Surprisingly, TGF-β1 did not significantly alter cell-surface Fas expression, but did stimulate secretion of sFas. Finally, enhanced Fas expression and increased susceptibility to apoptosis was induced by combined treatment with TNF-α/IFN-γ and was not inhibited by TGF-β1. Soluble and matrix-mediated pro-fibrotic stimuli promote fibroblast resistance to apoptosis by decreasing Fas transcription while stimulating soluble
Mandal, Samir; Mukherjee, Sudip; Chowdhury, Kaustav Dutta; Sarkar, Avik; Basu, Kankana; Paul, Soumosish; Karmakar, Debasish; Chatterjee, Mahasweta; Biswas, Tuli; Sadhukhan, Gobinda Chandra; Sen, Gargi
2012-01-01
Chronic lead (Pb(2+)) exposure leads to the reduced lifespan of erythrocytes. Oxidative stress and K(+) loss accelerate Fas translocation into lipid raft microdomains inducing Fas mediated death signaling in these erythrocytes. Pathophysiological-based therapeutic strategies to combat against erythrocyte death were evaluated using garlic-derived organosulfur compounds like diallyl disulfide (DADS), S allyl cysteine (SAC) and imidazole based Gardos channel inhibitor clotrimazole (CLT). Morphological alterations in erythrocytes were evaluated using scanning electron microscopy. Events associated with erythrocyte death were evaluated using radio labeled probes, flow cytometry and activity gel assay. Mass spectrometry was used for detection of GSH-4-hydroxy-trans-2-nonenal (HNE) adducts. Fas redistribution into the lipid rafts was studied using immunoblotting technique and confocal microscopy. Combination of SAC and CLT was better than DADS and CLT combination and monotherapy with these agents in prolonging the survival of erythrocytes during chronic Pb(2+) exposure. Combination therapy with SAC and CLT prevented redistribution of Fas into the lipid rafts of the plasma membrane and downregulated Fas-dependent death events in erythrocytes of mice exposed to Pb(2+). Ceramide generation was a critical component of Fas receptor-induced apoptosis, since inhibition of acid sphingomyelinase (aSMase) interfered with Fas-induced apoptosis during Pb(2+) exposure. Combination therapy with SAC and CLT downregulated apoptotic events in erythrocytes by antagonizing oxidative stress and Gardos channel that led to suppression of ceramide-initiated Fas aggregation in lipid rafts. Hence, combination therapy with SAC and CLT may be a potential therapeutic option for enhancing the lifespan of erythrocytes during Pb(2+) toxicity. Copyright © 2011 Elsevier B.V. All rights reserved.
Okazaki, Akihito; Hiraga, Nobuhiko; Imamura, Michio; Hayes, C Nelson; Tsuge, Masataka; Takahashi, Shoichi; Aikata, Hiroshi; Abe, Hiromi; Miki, Daiki; Ochi, Hidenori; Tateno, Chise; Yoshizato, Katsutoshi; Ohdan, Hideki; Chayama, Kazuaki
2012-08-01
The necroinflammatory reaction plays a central role in hepatitis B virus (HBV) elimination. Cluster of differentiation (CD)8-positive cytotoxic T lymphocytes (CTLs) are thought to be a main player in the elimination of infected cells, and a recent report suggests that natural killer (NK) cells also play an important role. Here, we demonstrate the elimination of HBV-infected hepatocytes by NK cells and dendritic cells (DCs) using urokinase-type plasminogen activator/severe combined immunodeficiency mice, in which the livers were highly repopulated with human hepatocytes. After establishing HBV infection, we injected human peripheral blood mononuclear cells (PBMCs) into the mice and analyzed liver pathology and infiltrating human immune cells with flow cytometry. Severe hepatocyte degeneration was observed only in HBV-infected mice transplanted with human PBMCs. We provide the first direct evidence that massive liver cell death can be caused by Fas/Fas ligand (FasL) interaction provided by NK cells activated by DCs. Treatment of mice with anti-Fas antibody completely prevented severe hepatocyte degeneration. Furthermore, severe hepatocyte death can be prevented by depletion of DCs, whereas depletion of CD8-positive CTLs did not disturb the development of massive liver cell apoptosis. Our findings provide the first direct evidence that DC-activated NK cells induce massive HBV-infected hepatocyte degeneration through the Fas/FasL system and may indicate new therapeutic implications for acute severe/fulminant hepatitis B. Copyright © 2012 American Association for the Study of Liver Diseases.
Lee, Patricia J.; Bhonsle, Jayendra B.; Gaona, Heather W.; Huddler, Donald P.; Heady, Tiffany N.; Kreishman-Deitrick, Mara; Bhattacharjee, Apurba; McCalmont, William F.; Gerena, Lucia; Lopez-Sanchez, Miriam; Roncal, Norma E.; Hudson, Thomas H.; Johnson, Jacob D.; Prigge, Sean T.; Waters, Norman C.
2009-01-01
The importance of fatty acids to the human malaria parasite, Plasmodium falciparum, and differences due to a type I fatty acid synthesis (FAS) pathway in the parasite, make it an attractive drug target. In the present study, we developed and a utilized a pharmacophore to select compounds for testing against PfKASIII, the initiating enzyme of FAS. This effort identified several PfKASIII inhibitors that grouped into various chemical classes of sulfides, sulfonamides, and sulfonyls. Approximately 60% of the submicromolar inhibitors of PfKASIII inhibited in vitro growth of the malaria parasite. These compounds inhibited both drug sensitive and resistant parasites and testing against a mammalian cell line revealed an encouraging in vitro therapeutic index for the most active compounds. Docking studies into the active site of PfKASIII suggest a potential binding mode that exploits amino acid residues at the mouth of the substrate tunnel. PMID:19191586
Methotrexate Induces Apoptosis in Organ-Cultured Nasal Polyps Via the Fas Pathway.
Heo, Kyung Wook; Park, Seong Kook; Lee, Yeo Myeong; Choe, Si Hong; Gu, Pyung Mo; Hong, Tae Ui; Hur, Dae Young
2017-05-01
Methotrexate (MTX) is very effective when used to treat chronic inflammatory diseases, and also induces apoptosis in nasal polyps (NPs). Increasing evidence suggests that Fas-Fas ligand (FasL) interactions activate multiple pathways involved in the regulation of immune and inflammatory cell functions. The aim of the present study was to identify pathways activated by Fas signaling when NPs were treated with MTX. Nasal polyps tissues were cultured using an air-liquid interface organ culture method. Cultures were maintained in the absence or presence of MTX (10 or 100 μM) for 24 hours. The authors used the reverse transcription-polymerase chain reaction method and Western blotting to identify pathways activated by Fas when NPs were treated with MTX. The Fas mRNA expression ratio was unchanged upon MTX treatment, but the FasL mRNA expression ratio was significantly higher in MTX-treated than nontreated polyps. In addition, the expression levels of the Fas and FasL proteins were significantly higher in polyps treated with both 10 and 100 μM MTX compared with nontreated polyps. Methotrexate induces apoptosis in NPs via the Fas pathway. Future studies should explore the topical use of MTX for NP control. Methotrexate may be a useful alternative steroid-sparing agent for the treatment of NPs.
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Fas/APO-1 protein is increased in spaceflown lymphocytes (Jurkat)
NASA Technical Reports Server (NTRS)
Cubano, L. A.; Lewis, M. L.
2000-01-01
Human lymphocytes flown on the Space Shuttle respond poorly to mitogen stimulation and populations of the lymphoblastoid T cell line, Jurkat, manifest growth arrest, increase in apoptosis and time- and microgravity-dependent increases in the soluble form of the cell death factor, Fas/APO-1 (sFas). The potential role of apoptosis in population dynamics of space-flown lymphocytes has not been investigated previously. We flew Jurkat cells on Space Transportation System (STS)-80 and STS-95 to determine whether apoptosis and the apparent microgravity-related release of sFas are characteristic of lymphocytes in microgravity. The effects of spaceflight and ground-based tests simulating spaceflight experimental conditions, including high cell density and low serum concentration, were assessed. Immunofluorescence microscopy showed increased cell associated Fas in flown cells. Results of STS-80 and STS-95 confirmed increase in apoptosis during spaceflight and the release of sFas as a repeatable, time-dependent and microgravity-related response. Ground-based tests showed that holding cells at 1.5 million/ml in medium containing 2% serum before launch did not increase sFas. Reports of increased Fas in cells of the elderly and the increases in spaceflown cells suggest possible similarities between aging and spaceflight effects on lymphocytes.
Long noncoding RNA Saf and splicing factor 45 increase soluble Fas and resistance to apoptosis
Riberdy, Janice M.; Persons, Derek A.; Wilber, Andrew
2016-01-01
In multicellular organisms, cell growth and differentiation is controlled in part by programmed cell death or apoptosis. One major apoptotic pathway is triggered by Fas receptor (Fas)-Fas ligand (FasL) interaction. Neoplastic cells are frequently resistant to Fas-mediated apoptosis, evade Fas signals through down regulation of Fas and produce soluble Fas proteins that bind FasL thereby blocking apoptosis. Soluble Fas (sFas) is an alternative splice product of Fas pre-mRNA, commonly created by exclusion of transmembrane spanning sequences encoded within exon 6 (FasΔEx6). Long non-coding RNAs (lncRNAs) interact with other RNAs, DNA, and proteins to regulate gene expression. One lncRNA, Fas-antisense or Saf, was shown to participate in alternative splicing of Fas pre-mRNA through unknown mechanisms. We show that Saf is localized in the nucleus where it interacts with Fas receptor pre-mRNA and human splicing factor 45 (SPF45) to facilitate alternative splicing and exclusion of exon 6. The product is a soluble Fas protein that protects cells against FasL-induced apoptosis. Collectively, these studies reveal a novel mechanism to modulate this critical cell death program by an lncRNA and its protein partner. PMID:26885613
Wang, Meng; Wang, Zheng; Wang, Xi-Jing; Jin, Tian-Bo; Dai, Zhi-Ming; Kang, Hua-Feng; Guan, Hai-Tao; Ma, Xiao-Bin; Liu, Xing-Han; Dai, Zhi-Jun
2016-01-01
In recent years, studies have demonstrated that polymorphisms in the promoters of Fas and FasL are significantly associated with breast cancer risk. However, the results of these studies were inconsistent. This case-control study was performed to explore the associations between Fas rs1800682 and FasL rs763110 polymorphisms and breast cancer. A hospital-based case-control study of 560 Han Chinese females with breast cancer (583 controls) was conducted. The MassARRAY system was used to search for a possible association between the disease risk and the two single nucleotide polymorphisms, Fas rs1800682 and FasL rs763110. Statistical analyses were performed using SNPStats software to conduct Pearson's chi-square tests in five different genetic models. Odds ratios (ORs) and 95% confidence intervals (CIs) were calculated after adjustment to age and body mass index. PHASE v2.1 software was used to reconstruct all common haplotypes. A statistically significant association was found between Fas rs1800682 and increased breast cancer risk (AG vs AA: OR =1.37, 95% CI =1.06-1.78; AA+AG vs GG: OR =1.32, 95% CI =1.04-1.66), and also it was found that the FasL rs763110 polymorphism may decrease the risk. Stratified analyses demonstrated that the rs763110 polymorphism was associated with lower breast cancer risk among postmenopausal females (heterozygote model: OR =0.69, 95% CI =0.49-0.97; dominant model: OR =0.70, 95% CI =0.51-0.96). The T allele of rs763110 was also associated with a decreased risk of lymph node metastasis (allele model: OR =0.75, 95% CI =0.57-0.97) and an increased risk of the breast cancer being human epidermal growth factor receptor 2 positive (allele model: OR =1.37, 95% CI =1.03-1.18). Moreover, haplotype analysis showed that Ars1800682Trs763110 was associated to a statistically significant degree with lower risk of breast cancer (OR =0.70, 95% CI =0.53-0.91). These data suggest that the presence of Fas rs1800683 is an important risk factor for breast
Anna Dyląg, Katarzyna; Sikora-Sporek, Aleksanda; Bańdo, Bożena; Boroń-Zyss, Joanna; Drożdż, Dorota; Dumnicka, Paulina; Przybyszewska, Katarzyna; Sporek, Mateusz; Walocha, Jerzy W; Wojciechowski, Wadim; Urbanik, Andrzej
The aim of the study was to analyze the findings in MRI (magnetic resonance imaging) of the brain amongst children diagnosed with fetal alcohol syndrome (FAS), partial fetal alcohol syndrome (pFAS) or alcohol related neurodevelopmental disorders (ARND). The issue has been studied in several researches previously but the experts agree that there is still few data on the MRI results in the group of younger children. MRI results of 121 patients with either FAS or pFAS or ARND diagnosed with Canadian criteria were analyzed regarding the presence of abnormalities. The group consisted of 71 patients diagnosed with FAS, 33 diagnosed with pFAS and 17 diagnosed with ARND. The mean age of the patients was 8.03 years (standard deviation 4.07). In the total group of FASD patients 61.98% of the patients’ MRI results were abnormal. The most common abnormality in MRI of the patients were demyelination plaques (incidence 23.1%) and corpus callosum narrowing (20.7%) as well as ventricular asymmetry (18.8%).The demyelination plaques and corpus callosum narrowing were more frequent among children ≤4 years old (41.7% vs 18.6%; p=0.016 and 50.0% vs.13.4%; p<0.001, respectively). Age ≤4 years predicted the presence of demyelination plaques and corpus callosum narrowing independently of FAS diagnosis. Among younger children, multiple central nervous system abnormalities were observed more often than in the older age group (54.2% vs. 14.4%; p<0.001). Odds ratio for multiple changes was 0.84 per one-year increase in age (95% CI 0.73-0.97), p=0.016. Furthermore, in the analysis according to the specific diagnosis, among the patients diagnosed with FAS, multiple anomalies were more common than in pFAS and ARND. Both age ≤4 years and FAS diagnosis were independent predictors for multiple anomalies in multiple logistic regression. In structural brain MRI of younger children, multiple anomalies were found more frequently than among older children. Demyelination plaques and corpus
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Clinical utility of urinary soluble Fas in screening for bladder cancer.
Srivastava, Anupam Kumar; Singh, Pankaj Kumar; Singh, Dhramveer; Dalela, Divakar; Rath, Srikanta Kumar; Bhatt, Madan Lal Brahma
2016-06-01
Early diagnosis of carcinoma of urinary bladder remains a challenge. Urine cytology, as an adjunct to cystoscopy, is less sensitive for low-grade tumors. Soluble Fas (sFas), a cell-surface receptor and member of the tumor necrosis factor superfamily, is frequently expressed in urinary bladder carcinoma. The objective of this study was to investigate the urinary sFas for diagnosis of transitional cell carcinoma (TCC) of urinary bladder. We examined urinary sFas concentration in 74 controls and 117 cases of TCC, both primary and recurrent disease, by using enzyme-linked immunosorbent assay and compared it with urinary cytology. Urinary sFas concentration was found to be significantly higher in the patient as compared to control group (P < 0.05). An optimal cutoff value of 174.0 pg/mL was proposed. The urinary sFas level was found to have an approximate sensitivity and specificity of 88.03% and 89.19% (P < 0.001), whereas urine cytology had sensitivity of 66.67% and specificity of 95.95%. sFas had better sensitivity in higher grade and both primary and recurrent cases of urinary bladder cancer in comparison with cytology. Out of 15 node positive bladder cancer cases, 13 had high urinary sFas levels, whereas 12 were urinary cytology positive for malignancy. Urinary sFas can be used as a non-invasive diagnostic biomarker for TCC of urinary bladder, both for primary and recurrent disease. © 2014 Wiley Publishing Asia Pty Ltd.
Fas–Fas Ligand: Checkpoint of T Cell Functions in Multiple Sclerosis
Volpe, Elisabetta; Sambucci, Manolo; Battistini, Luca; Borsellino, Giovanna
2016-01-01
Fas and Fas Ligand (FasL) are two molecules involved in the regulation of cell death. Their interaction leads to apoptosis of thymocytes that fail to rearrange correctly their T cell receptor (TCR) genes and of those that recognize self-antigens, a process called negative selection; moreover, Fas–FasL interaction leads to activation-induced cell death, a form of apoptosis induced by repeated TCR stimulation, responsible for the peripheral deletion of activated T cells. Both control mechanisms are particularly relevant in the context of autoimmune diseases, such as multiple sclerosis (MS), where T cells exert an immune response against self-antigens. This concept is well demonstrated by the development of autoimmune diseases in mice and humans with defects in Fas or FasL. In recent years, several new aspects of T cell functions in MS have been elucidated, such as the pathogenic role of T helper (Th) 17 cells and the protective role of T regulatory (Treg) cells. Thus, in this review, we summarize the role of the Fas–FasL pathway, with particular focus on its involvement in MS. We then discuss recent advances concerning the role of Fas–FasL in regulating Th17 and Treg cells’ functions, in the context of MS. PMID:27729910
Oxidative Processing of Latent Fas in the Endoplasmic Reticulum Controls the Strength of Apoptosis
Anathy, Vikas; Roberson, Elle; Cunniff, Brian; Nolin, James D.; Hoffman, Sidra; Spiess, Page; Guala, Amy S.; Lahue, Karolyn G.; Goldman, Dylan; Flemer, Stevenson; van der Vliet, Albert; Heintz, Nicholas H.; Budd, Ralph C.; Tew, Kenneth D.
2012-01-01
We recently demonstrated that S-glutathionylation of the death receptor Fas (Fas-SSG) amplifies apoptosis (V. Anathy et al., J. Cell Biol. 184:241–252, 2009). In the present study, we demonstrate that distinct pools of Fas exist in cells. Upon ligation of surface Fas, a separate pool of latent Fas in the endoplasmic reticulum (ER) underwent rapid oxidative processing characterized by the loss of free sulfhydryl content (Fas-SH) and resultant increases in S-glutathionylation of Cys294, leading to increases of surface Fas. Stimulation with FasL rapidly induced associations of Fas with ERp57 and glutathione S-transferase π (GSTP), a protein disulfide isomerase and catalyst of S-glutathionylation, respectively, in the ER. Knockdown or inhibition of ERp57 and GSTP1 substantially decreased FasL-induced oxidative processing and S-glutathionylation of Fas, resulting in decreased death-inducing signaling complex formation and caspase activity and enhanced survival. Bleomycin-induced pulmonary fibrosis was accompanied by increased interactions between Fas-ERp57-GSTP1 and S-glutathionylation of Fas. Importantly, fibrosis was largely prevented following short interfering RNA-mediated ablation of ERp57 and GSTP. Collectively, these findings illuminate a regulatory switch, a ligand-initiated oxidative processing of latent Fas, that controls the strength of apoptosis. PMID:22751926
Soto-Ramírez, Nelís; Karmaus, Wilfried; Zhang, Hongmei; Liu, Jihong; Billings, Deborah; Gangur, Venugopal; Amrol, David; da Costa, Kerry-Ann; Davis, Susan; Goetzl, Laura
2012-11-01
The relationship between fatty acids (FAs) in breast milk and the risk of childhood allergies is controversial. We prospectively investigated the relationship between FAs in colostrum and breast milk and asthma-like symptoms (AS) and atopy in infancy. Pregnant women were recruited in Columbia and Charleston, South Carolina. Colostrum and mature milk samples were collected. The concentrations of n-3 FAs (eicosapentaenoic acid, α-linolenic acid, docosapentaenoic acid, and docosahexaenoic acid) and n-6 FAs (linoleic acid, arachidonic acid, and eicosadienoic acid) were determined by gas chromatography. AS were ascertained at 6 and 12 months of age and atopy (skin prick test) at 12 months. FAs were dichotomized (high vs. median and low). Generalized estimating equations were used to determine the effect of FAs on repeated AS, compensating for intra-individual correlations and adjusting for confounders. Log-linear regression was used to analyze atopy. FAs were analyzed in 24 colostrum and 78 breast milk samples. High levels of total n-6 (lipid based) FAs in breast milk were associated with an increased risk of AS in infants (risk ratio (RR) = 2.91; 95% confidence interval (CI): 1.37, 6.18), even after controlling for total n-3 FAs (RR = 2.07, 95% CI: 1.12, 3.85). High levels of total n-3 FAs controlling for n-6 FAs decreased the risk of atopy at the age of 12 months. High levels of total n-6 polyunsaturated fatty acids (PUFAs) in breast milk are associated with an increased risk for AS, whereas high levels of total n-3 PUFAs decreased the risk of atopy. These data suggest that the effects of n-3 and n-6 PUFAs on allergic disorders should be further explored.
Incrocci, Ryan; Hussain, Samira; Stone, Amanda; Bieging, Kathryn; Alt, Lauren A.C.; Fay, Michael J.; Swanson-Mungerson, Michelle
2015-01-01
Epstein-Barr virus Latent Membrane Protein 2A (LMP2A) is expressed in EBV-infected B cells in the germinal center, a site of significant apoptosis induced by engagement of Fas on activated B cells. Signals from the B cell receptor (BCR) protect germinal center B cells from Fas-mediated apoptosis, and since LMP2A is a BCR mimic, we hypothesized that LMP2A would also protect B cells from Fas-mediated apoptosis. Surprisingly, latently-infected human and murine B cell lines expressing LMP2A were more sensitive to Fas-mediated apoptosis, as determined by increases in Annexin-V staining, and cleavage of caspase-8, −3 and PARP. Additional studies show that LMP2A-expressing B cell lines demonstrate a Lyn- and Syk-dependent increase in sensitivity to Fas-mediated apoptosis, due to an LMP2A-dependent enhancement in Fas expression. These findings demonstrate the ability for LMP2A to directly increase a pro-apoptotic molecule and have implications for EBV latency as well as the treatment of EBV-associated malignancies. PMID:26255694
Expression of miR-625 and Fas in cervical vertebral cartilage endplate.
Zhan, Beilei; Zhan, Yan; Wang, Wei; Zhan, Yunzhong; Liu, Bingsheng
2018-01-01
The aim of the present study was to assess miR-625 and Fas expression in normal and degenerative cervical cartilage endplate (CEP) tissues. Following biof-informatics analysis, the Fas gene was predicted to be one of the targets of miR-625. Quantitative PCR (qPCR) and western blotting were used to detect miR-625 and Fas expression in normal and degenerative CEP. A luciferase reporter assay was used to identify whether miR-625 could directly target the 3' untranslated region (3'-UTR) of Fas. Lentiviral overexpression and/or inhibition vectors of miR-625 (pre-miR-625)/antigomiR-625 were constructed to determine whether overexpression or inhibition of miR-625 could affect Fas and B-cell lymphoma 2 (Bcl-2) expression in cartilaginous endplate cells (CECs) and tissues. qPCR analysis demonstrated that miR-625 expression in degenerative CEP was significantly lower than in normal CEP tissue, while the production of Fas in degenerated CEP was significantly higher. Results from western blotting also showed a significant increase in Fas expression in degenerative CEP. miR-625 can bind directly to the 3'-UTR of the Fas gene. However, this inhibition was attenuated by a target mutation in the miR-625-binding site of the 3'-UTR of Fas mRNA. In addition, following transfection of CECs with pre-miR-625 and antigomiR-625, expression of Fas significantly decreased and increased, respectively, and Bcl-2 expression was upregulated and downregulated, respectively. Upregulation of miR-625 can inhibit Fas expression and further affect Bcl-2 expression in CEP degeneration, suggesting that miR-625-mediated inhibition of the Fas gene is important in cervical degeneration.
Ivanova, Olga K; Sharapova, Tatiana N; Romanova, Elena A; Soshnikova, Natalia V; Sashchenko, Lidia P; Yashin, Denis V
2017-10-01
An important problem in cellular immunology is to identify new populations of cytotoxic lymphocytes capable of killing tumor cells that have lost classical components of MHC-machinery and to understand mechanisms of the death of these cells. We have previously found that CD4 + CD25 + lymphocytes appear in the lymphokine-activated killer (LAK) cell culture, which carry Tag7 (PGRP-S) and FasL proteins on their surface and can kill Hsp70- and Fas-expressing HLA-negative cells. In this work, we have continued to study the mechanisms of killing of the HLA-negative tumor cells, focusing this time on the CD8 + lymphocytes. We show that after a tumor antigen contact the IL-2 activated CD8 + lymphocytes acquire ability to lyse tumor cells bearing this antigen. However, activation of the CD8 + lymphocytes in the absence of antigen causes appearance of a cytotoxic population of CD8 + NKG2D + lymphocytes, which are able to lyse HLA-negative cancer cells that have lost the classic mechanism of antigen presentation. These cells recognize the noncanonical MicA antigen on the surface of HLA-negative K562 cells but kill them via the FasL-Fas interaction, as do cytotoxic T lymphocytes. FasL presented on the lymphocyte surface can trigger both apoptosis and necroptosis. Unlike in the case of TNFR1, another cell death receptor, no switching to alternative processes has been observed upon induction of Fas-dependent cell death. It may well be that the apoptotic and necroptotic signals are transduced separately in the latter case, with the ability of FasL + lymphocytes to induce necroptosis allowing them to kill tumor cells that escape apoptosis. J. Cell. Biochem. 118: 3359-3366, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Fas activity mediates airway inflammation during mouse adenovirus type 1 respiratory infection.
Adkins, Laura J; Molloy, Caitlyn T; Weinberg, Jason B
2018-06-13
CD8 T cells play a key role in clearance of mouse adenovirus type 1 (MAV-1) from the lung and contribute to virus-induced airway inflammation. We tested the hypothesis that interactions between Fas ligand (FasL) and Fas mediate the antiviral and proinflammatory effects of CD8 T cells. FasL and Fas expression were increased in the lungs of C57BL/6 (B6) mice during MAV-1 respiratory infection. Viral replication and weight loss were similar in B6 and Fas-deficient (lpr) mice. Histological evidence of pulmonary inflammation was similar in B6 and lpr mice, but lung mRNA levels and airway proinflammatory cytokine concentrations were lower in MAV-1-infected lpr mice compared to infected B6 mice. Virus-induced apoptosis in lungs was not affected by Fas deficiency. Our results suggest that the proinflammatory effects of CD8 T cells during MAV-1 infection are mediated in part by Fas activation and are distinct from CD8 T cell antiviral functions. Copyright © 2018 Elsevier Inc. All rights reserved.
Fas-L promotes the stem cell potency of adipose-derived mesenchymal cells.
Solodeev, Inna; Meilik, Benjamin; Volovitz, Ilan; Sela, Meirav; Manheim, Sharon; Yarkoni, Shai; Zipori, Dov; Gur, Eyal; Shani, Nir
2018-06-11
Fas-L is a TNF family member known to trigger cell death. It has recently become evident that Fas-L can transduce also non-apoptotic signals. Mesenchymal stem cells (MSCs) are multipotent cells that are derived from various adult tissues. Although MSCs from different tissues display common properties they also display tissue-specific characteristics. Previous works have demonstrated massive apoptosis following Fas-L treatment of bone marrow-derived MSCs both in vitro and following their administration in vivo. We therefore set to examine Fas-L-induced responses in adipose-derived stem cells (ASCs). Human ASCs were isolated from lipoaspirates and their reactivity to Fas-L treatment was examined. ASCs responded to Fas-L by simultaneous apoptosis and proliferation, which yielded a net doubling of cell quantities and a phenotypic shift, including reduced expression of CD105 and increased expression of CD73, in association with increased bone differentiation potential. Treatment of freshly isolated ASCs led to an increase in large colony forming unit fibroblasts, likely produced by early stem cell progenitor cells. Fas-L-induced apoptosis and proliferation signaling were found to be independent as caspase inhibition attenuated Fas-L-induced apoptosis without impacting proliferation, whereas inhibition of PI3K and MEK, but not of JNK, attenuated Fas-L-dependent proliferation, but not apoptosis. Thus, Fas-L signaling in ASCs leads to their expansion and phenotypic shift toward a more potent stem cell state. We speculate that these reactions ensure the survival of ASC progenitor cells encountering Fas-L-enriched environments during tissue damage and inflammation and may also enhance ASC survival following their administration in vivo.
Al-Sebaei, Maisa O; Daukss, Dana M; Belkina, Anna C; Kakar, Sanjeev; Wigner, Nathan A; Cusher, Daniel; Graves, Dana; Einhorn, Thomas; Morgan, Elise; Gerstenfeld, Louis C
2014-01-01
Previous studies showed that loss of tumor necrosis factor α (TNFα) signaling delayed fracture healing by delaying chondrocyte apoptosis and cartilage resorption. Mechanistic studies showed that TNFα induced Fas expression within chondrocytes; however, the degree to which chondrocyte apoptosis is mediated by TNFα alone or dependent on the induction of Fas is unclear. This question was addressed by assessing fracture healing in Fas-deficient B6.MRL/Faslpr/J mice. Loss of Fas delayed cartilage resorption but also lowered bone fraction in the calluses. The reduced bone fraction was related to elevated rates of coupled bone turnover in the B6.MRL/Faslpr/J calluses, as evidenced by higher osteoclast numbers and increased osteogenesis. Analysis of the apoptotic marker caspase 3 showed fewer positive chondrocytes and osteoclasts in calluses of B6.MRL/Faslpr/J mice. To determine if an active autoimmune state contributed to increased bone turnover, the levels of activated T cells and Treg cells were assessed. B6.MRL/Faslpr/J mice had elevated Treg cells in both spleens and bones of B6.MRL/Faslpr/J but decreased percentage of activated T cells in bone tissues. Fracture led to ∼30% to 60% systemic increase in Treg cells in both wild-type and B6.MRL/Faslpr/J bone tissues during the period of cartilage formation and resorption but either decreased (wild type) or left unchanged (B6.MRL/Faslpr/J) the numbers of activated T cells in bone. These results show that an active autoimmune state is inhibited during the period of cartilage resorption and suggest that iTreg cells play a functional role in this process. These data show that loss of Fas activity specifically in chondrocytes prolonged the life span of chondrocytes and that Fas synergized with TNFα signaling to mediate chondrocyte apoptosis. Conversely, loss of Fas systemically led to increased osteoclast numbers during later periods of fracture healing and increased osteogenesis. These findings suggest that retention
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
miR-212-5p suppresses lipid accumulation by targeting FAS and SCD1.
Guo, Yajie; Yu, Junjie; Wang, Chunxia; Li, Kai; Liu, Bin; Du, Ying; Xiao, Fei; Chen, Shanghai; Guo, Feifan
2017-10-01
MicroRNAs, a class of small noncoding RNAs, are implicated in controlling a variety of biological processes. We have shown that leucine deprivation suppresses lipogenesis by inhibiting fatty acid synthase (FAS) expression in the liver previously; the aim of our current study is to investigate which kind of microRNA is involved in the regulation of FAS expression in response to leucine deprivation. Here, we indicated that microRNA-212-5p specifically binds to mouse FAS 3'UTR and inhibits its activity. Leucine deficiency significantly increased the mRNA levels of miR-212-5p in the livers of mice. Further studies proved that miR-212-5p also directly binds to the 3'UTR of stearoyl-CoA desaturase-1 (SCD1) to inhibit its activity. Overexpression of miR-212-5p decreases the protein levels of FAS and SCD1 in vitro and in vivo , and silencing of miR-212-5p has the opposite effects in mouse primary hepatocytes. Moreover, overexpression of miR-212-5p significantly decreases triglyceride (TG) accumulation in primary hepatocytes and in the livers of mice injected with adenovirus-mediated overexpressing of miR-212-5p (Ad-miR-212). Interestingly, inhibition of miR-212-5p reverses the suppressive effects of leucine deficiency on FAS and SCD1 expression, as well as TG accumulation in mouse primary hepatocytes. Finally, we demonstrate that leucine deficiency induces the expression of miR-212-5p in a GCN2/ATF4-dependent manner. Taken together, our results demonstrate a novel function of hepatic miR-212-5p in the regulation of lipid metabolism which represents a potential therapeutic target for the treatment of non-alcohol fatty liver diseases (NAFLD). © 2017 Society for Endocrinology.
Miura, Kyoko; Hughes, Maria Celia B; Ungerer, Jacobus P J; Smith, David D; Green, Adèle C
2018-03-01
In a well-characterised community-based prospective study, we aimed to systematically assess the differences in associations of plasma omega-3 and omega-6 fatty acid (FA) status with all-cause mortality when plasma FA status is expressed in absolute concentrations versus relative levels. In a community sample of 564 women aged 25-75 years in Queensland, Australia, baseline plasma phospholipid FA levels were measured using gas chromatography. Specific FAs analysed were eicosapentaenoic acid, docosapentaenoic acid, docosahexaenoic acid, total long-chain omega-3 FAs, linoleic acid, arachidonic acid, and total omega-6 FAs. Levels of each FA were expressed in absolute amounts (µg/mL) and relative levels (% of total FAs) and divided into thirds. Deaths were monitored for 17 years and hazard ratios and 95% confidence intervals calculated to assess risk of death according to absolute versus relative plasma FA levels. In total 81 (14%) women died during follow-up. Agreement between absolute and relative measures of plasma FAs was higher in omega-3 than omega-6 FAs. The results of multivariate analyses for risk of all-cause mortality were generally similar with risk tending to inverse associations with plasma phospholipid omega-3 FAs and no association with omega-6 FAs. Sensitivity analyses examining effects of age and presence of serious medical conditions on risk of mortality did not alter findings. The directions and magnitude of associations with mortality of absolute versus relative FA levels were comparable. However, plasma FA expressed as absolute concentrations may be preferred for ease of comparison and since relative units can be deduced from absolute units.
Fas-Antisense Long Noncoding RNA and Acute Myeloid Leukemia: Is There any Relation?
Sayad, Arezou; Hajifathali, Abbas; Hamidieh, Amir Ali; Esfandi, Farbod; Taheri, Mohammad
2018-01-27
In recent years, lncRNAs have been considered as potential predictive biomarkers for prognosis of different human cancers. One example is the FAS antisense RNA 1 (FAS-AS1) located in the 10q23.31 region which is transcribed from the opposite strand of the FAS gene. FAS has an important role in regulation of apoptotic pathways and there is an inverse correlation between FAS-AS1 expression level and production of the soluble form of Fas, so that it might have potential as a therapeutic target to improve chemotherapy effectiveness. In the present study we therefore evaluated FAS-AS1 expression in blood samples of de novo AML patients and healthy controls using real-time quantitative reverse transcription-PCR (qRT-PCR). Our results indicated that the expression level of FAS-AS1 lncRNA demonstrated no significant difference between AML patients and healthy individuals. We conclude from the obtained data that FAS-AS1 is not an informative and reliable biomarker for AML diagnosis, although our results need to be confirmed in further studies. Creative Commons Attribution License
Expression of Fas ligand by microglia: possible role in glioma immune evasion.
Badie, B; Schartner, J; Prabakaran, S; Paul, J; Vorpahl, J
2001-11-01
The immune-privileged status of the central nervous system is thought to limit the application of immunotherapy for treatment of malignant brain tumors. Because the Fas pathway has been proposed to play a role in immune evasion, we examined the effect of tumor environment on the expression of Fas ligand (FasL) in a mouse glioma model. Immunoblotting revealed the expression of membrane-bound FasL to nearly double when murine G26 gliomas were propagated intracranially (IC) as compared to subcutaneously (SC). Further analysis by flow cytometry revealed microglia, which were absent in the SC tumors, to account for half of the FasL expression in the IC tumors. Interestingly, when FasL activity was inhibited in IC tumors, the proportion of tumor-infiltrating leukocytes increased three-fold, reaching the same frequency as the SC tumors. These observations suggest that microglia are a major source of FasL expression in brain tumors and possibly contribute to the local immunosuppressive milieu of malignant gliomas.
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Menezes, Soraya Maria; Leal, Fabio E; Dierckx, Tim; Khouri, Ricardo; Decanine, Daniele; Silva-Santos, Gilvaneia; Schnitman, Saul V; Kruschewsky, Ramon; López, Giovanni; Alvarez, Carolina; Talledo, Michael; Gotuzzo, Eduardo; Nixon, Douglas F; Vercauteren, Jurgen; Brassat, David; Liblau, Roland; Vandamme, Anne Mieke; Galvão-Castro, Bernardo; Van Weyenbergh, Johan
2017-01-01
Human T-cell lymphotropic virus (HTLV)-1 was the first human retrovirus to be associated to cancer, namely adult T-cell leukemia (ATL), but its pathogenesis remains enigmatic, since only a minority of infected individuals develops either ATL or the neuroinflammatory disorder HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). A functional FAS -670 polymorphism in an interferon (IFN)-regulated STAT1-binding site has been associated to both ATL and HAM/TSP susceptibility. Fas hi T stem cell memory (Tscm) cells have been identified as the hierarchical apex of ATL, but have not been investigated in HAM/TSP. In addition, both FAS and STAT1 have been identified in an IFN-inducible HAM/TSP gene signature, but its pathobiological significance remains unclear. We comprehensively explored Fas expression (protein/mRNA) and function in lymphocyte activation, apoptosis, proliferation, and transcriptome, in PBMC from a total of 47 HAM/TSP patients, 40 asymptomatic HTLV-1-infected individuals (AC), and 58 HTLV-1 -uninfected healthy controls. Fas surface expression followed a two-step increase from HC to AC and from AC to HAM/TSP. In HAM/TSP, Fas levels correlated positively to lymphocyte activation markers, but negatively to age of onset, linking Fas hi cells to earlier, more aggressive disease. Surprisingly, increased lymphocyte Fas expression in HAM/TSP was linked to decreased apoptosis and increased lymphoproliferation upon in vitro culture, but not to proviral load. This Fas hi phenotype is HAM/TSP-specific, since both ex vivo and in vitro Fas expression was increased as compared to multiple sclerosis (MS), another neuroinflammatory disorder. To elucidate the molecular mechanism underlying non-apoptotic Fas signaling in HAM/TSP, we combined transcriptome analysis with functional assays, i.e., blocking vs. triggering Fas receptor in vitro with antagonist and agonist-, anti-Fas mAb, respectively. Treatment with agonist anti-Fas mAb restored apoptosis
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
Fas signaling induces stemness properties in colorectal cancer by regulation of Bmi1.
Chen, Jiaxuan; Wang, Yadong; Zhuo, Linghao; Liu, Zhizhong; Liu, Tao; Li, Wenjing; Cai, Yidong; Zheng, Haoxuan
2017-10-01
Fas signaling promotes colorectal cancer (CRC) metastasis by inducing epithelial-mesenchymal transition (EMT). The acquisition of EMT properties in turn induces stemness but the mechanism by which Fas signaling contributes to it still remains unclear. Hence, the aim of this study was to investigate how Fas signaling regulates CRC stemness. For this purpose, soft agar assay, sphere formation assay, cell survival analysis, immunoblot, qRT-PCR, chromatin immunoprecipitation, and luciferase reporter assay were performed. Expression of FasL, Bmi1, and the miR-200c in CRC specimens was examined through immunohistochemistry, qRT-PCR, and immunoblot. In our study, Fas signaling induced stem cell properties in CRC specimens, relying on ERK1/2 MAPK pathway, with Bmi1 being mainly responsible for FasL-induced stemness. FasL treatment promoted Bmi1 expression by inhibiting miR-200c, which targets Bmi1 3'UTR region. Furthermore, FasL-induced Zeb1 binded with miR-200c promoter and inhibited its expression. Moreover, FasL-induced β-catenin nuclear expression promoted Zeb1 expression by binding with Zeb1 promoter. GSK-3β, which regulates β-catenin, was inhibited by FasL-induced ERK1/2 MAPK signaling. Finally, FasL and Bmi1 expression in clinical samples increased during CRC progression, and a positive correlation between them was observed. Patients with high FasL and Bmi1 expression had a worse prognosis than patients with low expression. In conclusion, our results showed that Fas signaling can promote stemness in CRC through the modulation of Bmi1 expression via the ERK1/2 MAPK/GSK-3β/β-catenin/Zeb1/miR-200c axis, suggesting that Fas signaling-based cancer therapies should be administered cautiously, as the activation of this pathway not only leads to apoptosis but also induces stemness in CRC. © 2017 Wiley Periodicals, Inc.
Dunn, Simon R.; Thomas, Michael C.; Nette, Geoffrey W.; Dove, Sophie G.
2012-01-01
The cnidarian-dinoflagellate symbiosis is arguably one of the most important within the marine environment in that it is integral to the formation of coral reefs. However, the regulatory processes that perpetuate this symbiosis remain unresolved. It is essential to understand these processes, if we are to elucidate the mechanisms that support growth and resource accumulation by coral host, and conversely, recently observed reduction and/or mortality of corals in response to rapid environmental change. This study specifically focused on one area of metabolic activity within the symbiosis, that of free fatty acid synthesis within both the dinoflagellate symbionts and cnidarian host. The main model system used was Aiptasia pulchella and Symbiodinium sp. in combination with aposymbiotic A. pulchella, the symbiotic coral Acropora millepora system and dinoflagellate culture. Fatty acids (FAs) were selected because of their multiple essential roles inclusive of energy storage (resource accumulation), membrane structure fluidity and cell signaling. The study addressed free FA lipogenesis by using a new method of enriched stable isotopic (13C) incorporation from dissolved inorganic carbon (DI13C) combined with HPLC-MS. FAs derived from DI13C aligned with a mixture of known lipogenesis pathways with the addition of some unusual FAs. After 120 hr, 13C-enriched FA synthesis rates were attributed to only a complex integration of both n–3 and n–6 lipogenesis pathways within the dinoflagellate symbionts. Furthermore, there was no detectible evidence of symbiont derived enriched isotope fatty acids, catabolized 13C derivatives or DI13C being directly utilized, in host late n–6 pathway long-chain FA lipogenesis. These findings do not align with a popular mutualistic translocation model with respect to the use of translocated symbiont photoassimilates in host long-chain FA lipogenesis, which has important connotations for linking nutrient sources with metabolite production and
Dunn, Simon R; Thomas, Michael C; Nette, Geoffrey W; Dove, Sophie G
2012-01-01
The cnidarian-dinoflagellate symbiosis is arguably one of the most important within the marine environment in that it is integral to the formation of coral reefs. However, the regulatory processes that perpetuate this symbiosis remain unresolved. It is essential to understand these processes, if we are to elucidate the mechanisms that support growth and resource accumulation by coral host, and conversely, recently observed reduction and/or mortality of corals in response to rapid environmental change. This study specifically focused on one area of metabolic activity within the symbiosis, that of free fatty acid synthesis within both the dinoflagellate symbionts and cnidarian host. The main model system used was Aiptasia pulchella and Symbiodinium sp. in combination with aposymbiotic A. pulchella, the symbiotic coral Acropora millepora system and dinoflagellate culture. Fatty acids (FAs) were selected because of their multiple essential roles inclusive of energy storage (resource accumulation), membrane structure fluidity and cell signaling. The study addressed free FA lipogenesis by using a new method of enriched stable isotopic ((13)C) incorporation from dissolved inorganic carbon (DI(13)C) combined with HPLC-MS. FAs derived from DI(13)C aligned with a mixture of known lipogenesis pathways with the addition of some unusual FAs. After 120 hr, (13)C-enriched FA synthesis rates were attributed to only a complex integration of both n-3 and n-6 lipogenesis pathways within the dinoflagellate symbionts. Furthermore, there was no detectible evidence of symbiont derived enriched isotope fatty acids, catabolized (13)C derivatives or DI(13)C being directly utilized, in host late n-6 pathway long-chain FA lipogenesis. These findings do not align with a popular mutualistic translocation model with respect to the use of translocated symbiont photoassimilates in host long-chain FA lipogenesis, which has important connotations for linking nutrient sources with metabolite
HAT1 induces lung cancer cell apoptosis via up regulating Fas.
Han, Na; Shi, Lei; Guo, Qiuyun; Sun, Wei; Yu, Yang; Yang, Li; Zhang, Xiaoxi; Zhang, Mengxian
2017-10-27
The dysfunction of apoptosis is one of the factors contributing to lung cancer (LC) growth. Histone acetyltransferase HAT1 can up regulate cell apoptosis. This study aims to investigate the mechanism by which HAT1 induces LC cell (LCC) apoptosis via up regulating the expression of Fas. In this study, the surgically removed human LC tissues were collected. LCCs were isolated from the LC tissues and analyzed for the expression of HAT1 and Fas by RT-qPCR and Western blotting. We observed that the expression of Fas was negatively correlated with PAR2 in LCCs. Activation of PAR2 suppressed the expression of Fas in normal lung epithelial cells. The expression of HAT1 was lower and positively correlated with Fas expression and negatively correlated with PAR2 expression in LCCs. Activation of PAR2 suppressed Fas expression in lung epithelial cells via inhibiting HAT1. Restoration of HAT1 expression restored Fas expression in LCCs and induced LCC apoptosis. In conclusion, less expression of HAT1 in LCCs was associated with the pathogenesis of LC. Up regulation of HAT1 expression in LCCs can induce LCCs apoptosis, which may be a potential novel therapy for the treatment of LC.
Sejima, Takehiro; Morizane, Shuichi; Hinata, Nobuyuki; Yao, Akihisa; Isoyama, Tadahiro; Saito, Motoaki; Takenaka, Atsushi
2012-01-01
To investigate Fas, Fas ligand (FasL) and Bcl-2 expression, which are considered to be important apoptotic regulatory factors in renal cell carcinomas (RCCs). mRNA quantification and immunohistochemistry allowed for the determination of the expression of these three factors in surgically resected tumors from 82 patients with RCC. The correlation of protein and gene expression with more than 10 years of survival data following nephrectomy (along with clinical and pathologic parameters) was analyzed using uni- and multivariate statistical models. A significantly poorer outcome was observed in patients with tumors expressing high levels of Fas mRNA in the multivariate analysis (p = 0.0002). In addition, patient survival was significantly worse in FasL mRNA-positive tumor cases when compared with FasL mRNA-negative cases (p = 0.0345). Ten cases relapsed more than 5 years after nephrectomy. Among them, the tumors of 8 cases (80%) did not express FasL mRNA. Analysis of Bcl-2 did not show statistical significance of Bcl-2 expression as a prognostic indicator. The data suggest that pronounced Fas expression is a surrogate biomarker of active cancer cell proliferation. Given the FasL tumor counterattack theory, FasL overexpression in RCC may be one of the host immune deficiencies, consequently leading to poor prognosis. Copyright © 2012 S. Karger AG, Basel.
Unique response of lung acetyl-CoA carboxylase to inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patterson, C.E.; Davis, K.S.; Rhoades, R.A.
1986-05-01
Fatty acid synthesis (FAS) in lung is not inhibited by c-AMP analogs or aminophylline although these agents inhibit FAS in other lipogenic tissues. To further characterize FAS in lung, the authors examined the response of cultured fetal lung explants to known inhibitors of FAS in liver: t-butyl benzoic acid (tBB-which binds CoA and inhibits acetyl-CoA carboxylase) and palmitate (an allosteric effector of acetyl-CoA carboxylase). Explants derived from d18 fetuses (term=22d) were cultured 2d in F12k media containing 10mM lactate, 2mM glucose, and 10mM Hepes. At 48h, FAS was determined by incubation with /sup 3/H/sub 2/O (control = 3892 +/- 755more » nmoles C2 units/g/h) and surfactant lipid production estimated by incorporation of /sup 14/C-choline into DSPC (control = 35.8 +/- 9.0 nmoles/g/h). Addition of tBB (50uM) did not significantly alter FAS or choline incorporation. Addition of palmitate (0.15mM) in either ethanol (1% final conc.) or albumin (3% final conc.) did not result in diminished FAS. Palmitate did increase DSPC labeling 20%, indicating that in these cultures the rate of surfactant synthesis is partially dependent upon palmitate availability. These data show that lung is unique in its unresponsiveness to various inhibitors of FAS which act at the level acetyl-CoA carboxylase and suggest that FAS is maintained in order to insure a de novo palmitate supply for surfactant lipid synthesis.« less
Li, Jian-sheng; Liu, Jing-xia; Tian, Yu-shou; Ren, Wei-hong; Zhang, Xin-feng; Wang, Ding-chao
2009-09-01
To observe the effects of Naomaitong, a compound traditional Chinese herbal medicine, combined with mobilization of bone marrow mesenchymal stem cells (BMSCs) on neuron apoptosis in rats with cerebral ischemia, and to explore the possible mechanism by detecting the expressions of Fas, FasL and caspase-3 proteins. Two hundred and two SD rats were divided into sham-operated group, untreated group, recombinant granulocyte colony-stimulating factor (rG-CSF) group, Naomaitong group and Naomaitong plus rG-CSF group (combination group). Focal cerebral ischemia was induced by intraluminal middle cerebral artery occlusion using a nylon thread with some modification. Rats in the rG-CSF group and the untreated group were administered with rG-CSF 10 microg/(kg x d) by subcutaneous injection 3 d before and 2 d after the operation respectively, once a day, and rats in the Naomaitong group and the combination group were intragastrically administered Naomaitong before and after the operation until sacrificed. Two, three, seven and fourteen days after operation, count of CD34-positive cells in peripheral blood and CD34 expression in brain tissue were determined. General neural function score (GNFS) was evaluated. Neuron apoptosis, expressions of Fas, FasL and caspase-3 in rat's brain were all measured. Count of CD34-positive cells in peripheral blood and CD34 expression in brain tissue were high in the untreated group, and reached the peak at 3 d and 7 d respectively. CD34 expression in brain tissue was increased in each treated group, especially in the combination group. GNFS was increased at 3 d and 7 d in the untreated group, 7 d and 14 d in the rG-CSF group and the combination group. Expressions of Fas, FasL and caspase-3 were increased 2, 3 and 7 d after operation, while expression of FasL at 2 d in the rG-CSF group, expressions of Fas, FasL and caspase-3 in the combination group were decreased. Expressions of Fas, FasL and caspase-3 at 7 d and 14 d in the combination group
Szarvas, Tibor; Sevcenco, Sabina; Módos, Orsolya; Keresztes, Dávid; Nyirády, Péter; Csizmarik, Anita; Ristl, Robin; Puhr, Martin; Hoffmann, Michèle J; Niedworok, Christian; Hadaschik, Boris; Maj-Hes, Agnieszka; Shariat, Shahrokh F; Kramer, Gero
2018-05-26
To assess the predictive value of pre-chemotherapy MMP-7, sFas, FasL serum levels as well as their changes during therapy. Serum levels of MMP-7, Fas and FasL were determined by ELISA in 96 CRPC patients; 21 docetaxel-resistant who received one single series and 75 docetaxel-sensitive who received repeated series of docetaxel. In addition to the 96 pretreatment serum samples, 987 sera collected during chemotherapy were also analysed. Higher pretreatment serum MMP-7, sFas and PSA levels were significantly associated with both docetaxel-resistance (p=0.007, p=0.001, p<0.001, respectively) and shorter cancer-specific survival (p<0.001, p=0.041, p<0.001, respectively). High MMP-7 remained an independent predictor of both docetaxel resistance (HR: 2.298, 95% CI: 1.354-3.899, p=0.002) and poor cancer-specific survival (HR=2.11, 95%Cl 1.36-3.30, p=0.001) in multivariable analyses. Higher increase of MMP-7 levels in the 2 nd treatment holiday and higher increase of PSA levels in the 1 st and 2 nd holidays were predictive of survival. Pretreatment serum MMP-7 levels may help to select CRPC patients who are likely to benefit from docetaxel chemotherapy. Furthermore, MMP-7 alone or in combination with PSA could be used for therapy monitoring. Correlative studies embedded in clinical trials are necessary to validate these biomarkers for clinical decision-making. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights reserved.
Lack of FasL-mediated killing leads to in vivo tumor promotion in mouse Lewis lung cancer.
Lee, J-K; Sayers, T J; Back, T C; Wigginton, J M; Wiltrout, R H
2003-03-01
Lewis lung carcinoma (3LL) cells were constitutively resistant to Fas-mediated apoptosis, but overexpression of Fas on 3LL cells allowed Fas-mediated apoptosis after crosslinking with agonist anti-Fas antibody (Jo2) in vitro. Surprisingly, Fas-overexpressing 3LL cells showed enhanced in vivo tumor progression, whereas no promotion of in vivo tumor growth was observed for dominant negative (DN) Fas-overexpressing 3LL transfectants in which the cytoplasmic death domain was deleted. In addition, the promotion of in vivo tumor growth by Fas-overexpression was reduced in gld (FasL-mutation) mice compared to normal mice. These data indicate that intact Fas/FasL cell signaling is required for the promotion of in vivo tumor growth by Fas overexpression in 3LL cells. In contrast to the efficient Fas-mediated killing induced in vitro by crosslinking with anti-Fas antibody, Fas-overexpressing 3LL cells were resistant in vitro to Fas-mediated apoptosis by activated T cells or transient FasL transfection. These data suggest that agonist anti-Fas antibody and natural FasL can transmit qualitatively different signals, and crosslinking of Fas with natural FasL on 3LL cells does not deliver the expected death signal. Thus, our results demonstrate that in some cases overexpression of Fas can result in a survival advantage for tumor cells in vivo.
Ma, Tai-yang; Wu, Jin-ying; Gao, Xiao-ke; Wang, Jing-yuan; Zhan, Xu-liang; Li, Wen-sheng
2014-10-01
FasL is the most extensively studied apoptosis ligand. In 2000, tilapia FasL was identified using anti-human FasL monoclonal antibody by Evans's research group. Recently, a tilapia FasL-like protein of smaller molecule weight was predicted in Genbank (XM_003445156.2). Based on several clues drawn from previous studies, we cast doubt on the authenticity of the formerly identified tilapia FasL. Conversely, using reverse transcription polymerase chain reaction (RT-PCR), the existence of the predicted FasL-like was verified at the mRNA level (The Genbank accession number of the FasL mRNA sequence we cloned is KM008610). Through multiple alignments, this FasL-like protein was found to be highly similar to the FasL of the Japanese flounder. Moreover, we artificially expressed the functional region of the predicted protein and later confirmed its apoptosis-inducing activity using a methyl thiazolyl tetrazolium (MTT) assay, Annexin-V/Propidium iodide (PI) double staining, and DNA fragment detection. Supported by these evidences, we suggest that the predicted protein is the authentic tilapia FasL. To advance this research further, tilapia FasL mRNA and its protein across different tissues were quantified. High expression levels were identified in the tilapia immune system and sites where active cell turnover conservatively occurs. In this regard, FasL may assume an active role in the immune system and cell homeostasis maintenance in tilapia, similar to that shown in other species. In addition, because the distribution pattern of FasL mRNA did not synchronize with that of the protein, post-transcriptional expression regulation is suggested. Such regulation may be dominated by potential adenylate- and uridylate-rich elements (AREs) featuring AUUUA repeats found in the 3' untranslated region (UTR) of tilapia FasL mRNA. Copyright © 2014 Elsevier Ltd. All rights reserved.
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Lai, J H; Ho, L J; Lu, K C; Chang, D M; Shaio, M F; Han, S H
2001-06-01
Spontaneous or therapeutic induction of T cell apoptosis plays a critical role in establishing transplantation tolerance and maintaining remission of autoimmune diseases. We investigated the mechanisms of apoptosis induced by Chinese and Western antirheumatic drugs (ARDs) in human T cells. We found that hydroxychloroquine, Tripterygium wilfordii hook F, and tetrandrine (Tet), but not methotrexate, at therapeutic concentrations can cause T cell death. In addition, Tet selectively killed T cells, especially activated T cells. Although ARD-induced cytotoxicity was mediated through apoptotic mechanisms, Fas/Fas ligand interaction was not required. We further demonstrated that the processes of phosphatidylserine externalization and DNA damage along the ARD-induced T cell apoptotic pathway could operate independently, and that selective inhibition of DNA damage by caspase inhibitors did not prevent T cells from undergoing cell death. Moreover, we found that Tet- and Tripterygium wilfordii hook F-induced T cell DNA damage required caspase-3 activity, and hydroxychloroquine-induced T cell DNA damage was mediated through a caspase-3- and caspase-8-independent, but Z-Asp-Glu-Val-Asp-fluomethyl ketone-sensitive, signaling pathway. Finally, the observation that ARD-induced activation of caspase-3 in both Fas-sensitive and Fas-resistant Jurkat T cells indicates that Fas/Fas ligand interaction plays no role in ARD-induced T cell apoptosis. Our observations provide new information about the complex apoptotic mechanisms of ARDs, and have implications for combining Western and Chinese ARDs that have different immunomodulatory mechanisms in the therapy of autoimmune diseases and transplantation rejection.
Behzad, Hayedeh; Jamil, Sarwat; Denny, Trisha A; Duronio, Vincent
2007-05-01
We have investigated phosphatidylinositol 3-kinase (PI3K)-dependent survival signalling pathways using several cytokines in three different hemopoietic cell lines, MC/9, FDC-P1, and TF-1. Cytokines caused PI3K- and PKB-dependent phosphorylation of FOXO3a (previously known as FKHRL1) at three distinct sites. Following cytokine withdrawal or PI3K inhibition, both of which are known to lead to apoptosis, there was a loss of FOXO3a phosphorylation, and a resulting increase in forkhead transcriptional activity, along with increased expression of Fas Ligand (FasL), which could be detected at the cell surface. Concurrently, an increase in cell surface expression of Fas was also detected. Despite the presence of both FasL and Fas, there was no detectable evidence that activation of Fas-mediated apoptotic events was contributing to apoptosis resulting from cytokine starvation or inhibition of PI3K activity. Thus, inhibition of FOXO3a activity is mediated by the PI3K-PKB pathway, but regulation of FasL is not the primary means by which cell survival is regulated in cytokine-dependent hemopoietic cells. We were also able to confirm increased expression of known FOXO3a targets, Bim and p27kip1. Together, these results support the conclusion that mitochondrial-mediated signals play the major role in apoptosis of hemopoietic cells due to loss of cytokine signalling.
Steer, Colin D; Lattka, Eva; Koletzko, Berthold; Golding, Jean; Hibbeln, Joseph R
2013-12-01
Brain tissue is selectively enriched with highly unsaturated fatty acids (FAs). Altering the maternal FA status in pregnancy may improve fetal neural development with lasting consequences for child development. We explored whether maternal FAs in erythrocytes, either measured directly or indirectly by maternal FADS genetic variants, are associated with child intelligence quotient (IQ). Linear regression analyses, adjusted for 18 confounders, were used to investigate the associations in 2839 mother-child pairs from the population-based Avon Longitudinal Study of Parents and Children cohort. Low levels of arachidonic acid (20:4n-6) were associated with lower performance IQ (-2.0 points; 95% CI: -3.5, -0.6 points; P = 0.007, increased R² = 0.27%), high levels of osbond acid (22:5n-6) were associated with verbal IQ (-1.8 points; 95% CI: -3.2, -0.4 points; P = 0.014, R² = 0.20%), and high levels of adrenic acid (22:4n-6) were associated with verbal IQ (-1.7 points; 95% CI:-3.1, -0.3 points; P = 0.016, R² = 0.19%). There was some evidence to support a negative association of low docosahexaenoic acid (DHA; 22:6n-3) with full-scale IQ (R² = 0.15%). Novel weak associations were also observed for low levels of osbond acid (R² ≤ 0.29%) and FADS variants with opposite effects for intron variants and variants in the promoter region such as rs3834458 (R² ≤ 0.38%). These results support the positive role of maternal arachidonic acid and DHA on fetal neural development, although the effects on child IQ by 8 y of age were small (0.1 SD), with other factors contributing more substantially. The endogenous synthesis of these FAs by FADS genes, especially FADS2, may also be important. The replication of these results is recommended.
Pothoulakis, Charalabos; Torre-Rojas, Monica; Duran-Padilla, Marco A; Gevorkian, Jonathan; Zoras, Odysseas; Chrysos, Emmanuel; Chalkiadakis, George; Baritaki, Stavroula
2018-01-15
Colorectal cancer (CRC) responds poorly to immuno-mediated cytotoxicity. Underexpression of corticotropin-releasing-hormone-receptor-2 (CRHR2) in CRC, promotes tumor survival, growth and Epithelial to Mesenchymal Transition (EMT), in vitro and in vivo. We explored the role of CRHR2 downregulation in CRC cell resistance to Fas/FasL-mediated apoptosis and the underlying molecular mechanism. CRC cell sensitivity to CH11-induced apoptosis was compared between Urocortin-2 (Ucn2)-stimulated parental and CRHR2-overexpressing CRC cell lines and targets of CRHR2/Ucn2 signaling were identified through in vitro and ex vivo analyses. Induced CRHR2/Ucn2 signaling in SW620 and DLD1 cells increased specifically their sensitivity to CH11-mediated apoptosis, via Fas mRNA and protein upregulation. CRC compared to control tissues had reduced Fas expression that was associated with lost CRHR2 mRNA, poor tumor differentiation and high risk for distant metastasis. YY1 silencing increased Fas promoter activity in SW620 and re-sensitized them to CH11-apoptosis, thus suggesting YY1 as a putative transcriptional repressor of Fas in CRC. An inverse correlation between Fas and YY1 expression was confirmed in CRC tissue arrays, while elevated YY1 mRNA was clinically relevant with advanced CRC grade and higher risk for distant metastasis. CRHR2/Ucn2 signaling downregulated specifically YY1 expression through miR-7 elevation, while miR-7 modulation in miR-7 high SW620-CRHR2+ and miR-7 low HCT116 cells, had opposite effects on YY1 and Fas expressions and cell sensitivity to CH11-killing. CRHR2/Ucn2 signaling is a negative regulator of CRC cell resistance to Fas/FasL-apoptosis via targeting the miR-7/YY1/Fas circuitry. CRHR2 restoration might prove effective in managing CRC response to immune-mediated apoptotic stimuli. © 2017 UICC.
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Cruz, Anthony C.; Ramaswamy, Madhu; Ouyang, Claudia; Klebanoff, Christopher A.; Sengupta, Prabuddha; Yamamoto, Tori N.; Meylan, Françoise; Thomas, Stacy K.; Richoz, Nathan; Eil, Robert; Price, Susan; Casellas, Rafael; Rao, V. Koneti; Lippincott-Schwartz, Jennifer; Restifo, Nicholas P.; Siegel, Richard M.
2016-01-01
Mutations affecting the apoptosis-inducing function of the Fas/CD95 TNF-family receptor result in autoimmune and lymphoproliferative disease. However, Fas can also costimulate T-cell activation and promote tumour cell growth and metastasis. Palmitoylation at a membrane proximal cysteine residue enables Fas to localize to lipid raft microdomains and induce apoptosis in cell lines. Here, we show that a palmitoylation-defective Fas C194V mutant is defective in inducing apoptosis in primary mouse T cells, B cells and dendritic cells, while retaining the ability to enhance naive T-cell differentiation. Despite inability to efficiently induce cell death, the Fas C194V receptor prevents the lymphoaccumulation and autoimmunity that develops in Fas-deficient mice. These findings indicate that induction of apoptosis through Fas is dependent on receptor palmitoylation in primary immune cells, and Fas may prevent autoimmunity by mechanisms other than inducing apoptosis. PMID:28008916
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Expression of TRAIL and Fas in Primary Hyperparathyroidism.
Segiet, Oliwia Anna; Deska, Mariusz; Mielańczyk, Łukasz; Brzozowa-Zasada, Marlena; Buła, Grzegorz; Gawrychowski, Jacek; Wojnicz, Romuald
2017-08-01
Differentiating between parathyroid lesions is still difficult and ambiguous. In cases of primary hyperparathyroidism, appropriate and prompt diagnosis is of great importance for effective treatment and follow-up. A great amount of mechanisms contribute to the pathogenesis of primary hyperparathyroidism, such as disturbance in balance between pro- and anti-apoptotic factors. Therefore, we examined whether immunohistochemical expression of apoptotic factors, TNF-related apoptosis-inducing ligand (TRAIL) and Fas, could have clinical utility as a marker of proliferative lesions of parathyroid gland. Parathyroid specimens of 58 consecutive patients who had undertaken surgery due to primary hyperparathyroidism were incubated with purified mouse monoclonal antihuman antibodies: anti-TRAIL and anti-Fas. Staining was considered positive when at least 5% of the cells showed immunoreactivity. The percentage of cells which were positively stained for TRAIL in parathyroid hyperplasia was 9.65%, in parathyroid adenoma 8.31%, and in normal controls 2.24%. Immunoreactivity for TRAIL was detected in 91.89% of parathyroid hyperplasias, 85.71% of parathyroid adenomas, and none in healthy glands. The percentage of cells with a positive reaction to Fas in parathyroid hyperplasia was 8.92%, in parathyroid adenoma 8.09%, and in normal tissue 1.9%. The expression of Fas was found in 94.59% of parathyroid hyperplasias, 90.48% of parathyroid adenomas, and none in healthy glands. In our study, hyperplasias demonstrated the highest expression of TRAIL and Fas, whereas in adenomas it was increased compared to normal tissue, but lower than in hyperplasias. These factors could be an additive tool in the differential diagnosis of parathyroid lesions.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Dockrell, D H; Badley, A D; Villacian, J S; Heppelmann, C J; Algeciras, A; Ziesmer, S; Yagita, H; Lynch, D H; Roche, P C; Leibson, P J; Paya, C V
1998-01-01
Fas/Fas Ligand (FasL) interactions play a significant role in peripheral T lymphocyte homeostasis and in certain pathological states characterized by T cell depletion. In this study, we demonstrate that antigen-presenting cells such as monocyte-derived human macrophages (MDM) but not monocyte-derived dendritic cells express basal levels of FasL. HIV infection of MDM increases FasL protein expression independent of posttranslational mechanisms, thus highlighting the virus-induced transcriptional upregulation of FasL. The in vitro relevance of these observations is confirmed in human lymphoid tissue. FasL protein expression is constitutive and restricted to tissue macrophages and not dendritic cells. Moreover, a significant increase in macrophage-associated FasL is observed in lymphoid tissue from HIV (+) individuals (P < 0.001), which is further supported by increased levels of FasL mRNA using in situ hybridization. The degree of FasL protein expression in vivo correlates with the degree of tissue apoptosis (r = 0.761, P < 0. 001), which is significantly increased in tissue from HIV-infected patients (P < 0.001). These results identify human tissue macrophages as a relevant source for FasL expression in vitro and in vivo and highlight the potential role of FasL expression in the immunopathogenesis of HIV infection. PMID:9616211
Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia; Durand, Thierry; Galano, Jean-Marie; Cortelazzo, Alessio; Zollo, Gloria; Guerranti, Roberto; Gonnelli, Stefano; Caffarelli, Carla; Rossi, Marcello; Pecorelli, Alessandra; Valacchi, Giuseppe; Ciccoli, Lucia; Hayek, Joussef
2014-11-01
This study mainly aims at examining the erythrocyte membrane fatty acid (FAs) profile in Rett syndrome (RTT), a genetically determined neurodevelopmental disease. Early reports suggest a beneficial effects of omega-3 polyunsaturated fatty acids (ω-3 PUFAs) on disease severity in RTT. A total of 24 RTT patients were assigned to ω-3 PUFAs-containing fish oil for 12 months in a randomized controlled study (average DHA and EPA doses of 72.9, and 117.1mg/kgb.w./day, respectively). A distinctly altered FAs profile was detectable in RTT, with deficient ω-6 PUFAs, increased saturated FAs and reduced trans 20:4 FAs. FAs changes were found to be related to redox imbalance, subclinical inflammation, and decreased bone density. Supplementation with ω-3 PUFAs led to improved ω-6/ω-3 ratio and serum plasma lipid profile, decreased PUFAs peroxidation end-products, normalization of biochemical markers of inflammation, and reduction of bone hypodensity as compared to the untreated RTT group. Our data indicate that a significant FAs abnormality is detectable in the RTT erythrocyte membranes and is partially rescued by ω-3 PUFAs. Copyright © 2014 Elsevier Ltd. All rights reserved.
7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false Will FAS make advance payments to a Cooperator? 1484... FOR AGRICULTURAL COMMODITIES Contributions and Reimbursements § 1484.57 Will FAS make advance payments to a Cooperator? (a) Policy. In general, FAS operates the Cooperator program on a reimbursable basis...
7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false Will FAS make advance payments to a Cooperator? 1484... FOR AGRICULTURAL COMMODITIES Contributions and Reimbursements § 1484.57 Will FAS make advance payments to a Cooperator? (a) Policy. In general, FAS operates the Cooperator program on a reimbursable basis...
7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false Will FAS make advance payments to a Cooperator? 1484... FOR AGRICULTURAL COMMODITIES Contributions and Reimbursements § 1484.57 Will FAS make advance payments to a Cooperator? (a) Policy. In general, FAS operates the Cooperator program on a reimbursable basis...
7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false How does FAS formalize its working relationship with... FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final disposition of its application. FAS will send a program agreement, allocation...
Ashton, Sandra V.; Whitley, Guy St. J.; Dash, Philip R.; Wareing, Mark; Crocker, Ian P.; Baker, Philip N.; Cartwright, Judith E.
2014-01-01
Objective Invasion of uterine spiral arteries by extravillous trophoblasts in the first trimester of pregnancy results in loss of endothelial and musculoelastic layers. This remodeling is crucial for an adequate blood supply to the fetus with a failure to remodel implicated in the etiology of the hypertensive disorder preeclampsia. The mechanism by which trophoblasts induce this key process is unknown. This study gives the first insights into the potential mechanisms involved. Methods and Results Spiral arteries were dissected from nonplacental bed biopsies obtained at Caesarean section, and a novel model was used to mimic in vivo events. Arteries were cultured with trophoblasts in the lumen, and apoptotic changes in the endothelial layer were detected after 20 hours, leading to loss of endothelium by 96 hours. In vitro, coculture experiments showed that trophoblasts stimulated apoptosis of primary decidual endothelial cells and an endothelial cell line. This was blocked by caspase inhibition and NOK2, a FasL blocking antibody. NOK2 also abrogated trophoblast-induced endothelial apoptosis in the vessel model. Conclusions Extravillous trophoblast induction of endothelial apoptosis is a possible mechanism by which the endothelium is removed, and vascular remodeling may occur in uterine spiral arteries. Fas/FasL interactions have an important role in trophoblast-induced endothelial apoptosis. PMID:15499040
Inhibition of Prolyl Hydroxylase Attenuates Fas Ligand-Induced Apoptosis and Lung Injury in Mice.
Nagamine, Yusuke; Tojo, Kentaro; Yazawa, Takuya; Takaki, Shunsuke; Baba, Yasuko; Goto, Takahisa; Kurahashi, Kiyoyasu
2016-12-01
Alveolar epithelial injury and increased alveolar permeability are hallmarks of acute respiratory distress syndrome. Apoptosis of lung epithelial cells via the Fas/Fas ligand (FasL) pathway plays a critical role in alveolar epithelial injury. Activation of hypoxia-inducible factor (HIF)-1 by inhibition of prolyl hydroxylase domain proteins (PHDs) is a possible therapeutic approach to attenuate apoptosis and organ injury. Here, we investigated whether treatment with dimethyloxalylglycine (DMOG), an inhibitor of PHDs, could attenuate Fas/FasL-dependent apoptosis in lung epithelial cells and lung injury. DMOG increased HIF-1α protein expression in vitro in MLE-12 cells, a murine alveolar epithelial cell line. Treatment of MLE-12 cells with DMOG significantly suppressed cell surface expression of Fas and attenuated FasL-induced caspase-3 activation and apoptotic cell death. Inhibition of the HIF-1 pathway by echinomycin or small interfering RNA transfection abolished these antiapoptotic effects of DMOG. Moreover, intraperitoneal injection of DMOG in mice increased HIF-1α expression and decreased Fas expression in lung tissues. DMOG treatment significantly attenuated caspase-3 activation, apoptotic cell death in lung tissue, and the increase in alveolar permeability in mice instilled intratracheally with FasL. In addition, inflammatory responses and histopathological changes were also significantly attenuated by DMOG treatment. In conclusion, inhibition of PHDs protects lung epithelial cells from Fas/FasL-dependent apoptosis through HIF-1 activation and attenuates lung injury in mice.
NASA Astrophysics Data System (ADS)
Xu, Qinzeng; Gao, Fei; Xu, Qiang; Yang, Hongsheng
2014-11-01
Fatty acids (FAs) provide energy and also can be used to trace trophic relationships among organisms. Sea cucumber Apostichopus japonicus goes into a state of aestivation during warm summer months. We examined fatty acid profiles in aestivated and non-aestivated A. japonicus using multivariate analyses (PERMANOVA, MDS, ANOSIM, and SIMPER). The results indicate that the fatty acid profiles of aestivated and non-aestivated sea cucumbers differed significantly. The FAs that were produced by bacteria and brown kelp contributed the most to the differences in the fatty acid composition of aestivated and nonaestivated sea cucumbers. Aestivated sea cucumbers may synthesize FAs from heterotrophic bacteria during early aestivation, and long chain FAs such as eicosapentaenoic (EPA) and docosahexaenoic acid (DHA) that produced from intestinal degradation, are digested during deep aestivation. Specific changes in the fatty acid composition of A. japonicus during aestivation needs more detailed study in the future.
7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false Will FAS make advance payments to a Cooperator? 1484... DEVELOP FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Contributions and Reimbursements § 1484.57 Will FAS make advance payments to a Cooperator? (a) Policy. In general, FAS operates the Cooperator program on a...
7 CFR 1484.57 - Will FAS make advance payments to a Cooperator?
Code of Federal Regulations, 2011 CFR
2011-01-01
... 7 Agriculture 10 2011-01-01 2011-01-01 false Will FAS make advance payments to a Cooperator? 1484... DEVELOP FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Contributions and Reimbursements § 1484.57 Will FAS make advance payments to a Cooperator? (a) Policy. In general, FAS operates the Cooperator program on a...
USDA-ARS?s Scientific Manuscript database
One goal of green chemistry is the production of industrially useful fatty acids (FAs) in crop plants. We focus on the engineering of industrial FAs, specifically hydroxy fatty acids (HFA) and conjugated polyenoic fatty acids (a-eleostearic acid, ESA), using Arabidopsis (Arabidopsis thaliana) as a m...
Rare splicing defects of FAS underly severe recessive autoimmune lymphoproliferative syndrome.
Agrebi, N; Ben-Mustapha, I; Matoussi, N; Dhouib, N; Ben-Ali, M; Mekki, N; Ben-Ahmed, M; Larguèche, B; Ben Becher, S; Béjaoui, M; Barbouche, M R
2017-10-01
Autoimmune lymphoproliferative syndrome (ALPS) is a prototypic disorder of impaired apoptosis characterized by autoimmune features and lymphoproliferation. Heterozygous germline or somatic FAS mutations associated with preserved protein expression have been described. Very rare cases of homozygous germline FAS mutations causing severe autosomal recessive form of ALPS with a complete defect of Fas expression have been reported. We report two unrelated patients from highly inbred North African population showing a severe ALPS phenotype and an undetectable Fas surface expression. Two novel homozygous mutations have been identified underlying rare splicing defects mechanisms. The first mutation breaks a branch point sequence and the second alters a regulatory exonic splicing site. These splicing defects induce the skipping of exon 6 encoding the transmembrane domain of CD95. Our findings highlight the requirement of tight regulation of FAS exon 6 splicing for balanced alternative splicing and illustrate the importance of such studies in highly consanguineous populations. Copyright © 2017 Elsevier Inc. All rights reserved.
Crystallization and X-ray diffraction studies of a complete bacterial fatty-acid synthase type I
DOE Office of Scientific and Technical Information (OSTI.GOV)
Enderle, Mathias; Max-Planck-Institute of Biochemistry, Am Klopferspitz 18, 82152 Martinsried; McCarthy, Andrew
Bacterial and fungal type I fatty-acid synthases (FAS I) are evolutionarily connected, as bacterial FAS I is considered to be the ancestor of fungal FAS I. In this work, the production, crystallization and X-ray diffraction data analysis of a bacterial FAS I are reported. While a deep understanding of the fungal and mammalian multi-enzyme type I fatty-acid synthases (FAS I) has been achieved in recent years, the bacterial FAS I family, which is narrowly distributed within the Actinomycetales genera Mycobacterium, Corynebacterium and Nocardia, is still poorly understood. This is of particular relevance for two reasons: (i) although homologous to fungalmore » FAS I, cryo-electron microscopic studies have shown that bacterial FAS I has unique structural and functional properties, and (ii) M. tuberculosis FAS I is a drug target for the therapeutic treatment of tuberculosis (TB) and therefore is of extraordinary importance as a drug target. Crystals of FAS I from C. efficiens, a homologue of M. tuberculosis FAS I, were produced and diffracted X-rays to about 4.5 Å resolution.« less
Menezes, Soraya Maria; Leal, Fabio E.; Dierckx, Tim; Khouri, Ricardo; Decanine, Daniele; Silva-Santos, Gilvaneia; Schnitman, Saul V.; Kruschewsky, Ramon; López, Giovanni; Alvarez, Carolina; Talledo, Michael; Gotuzzo, Eduardo; Nixon, Douglas F.; Vercauteren, Jurgen; Brassat, David; Liblau, Roland; Vandamme, Anne Mieke; Galvão-Castro, Bernardo; Van Weyenbergh, Johan
2017-01-01
Human T-cell lymphotropic virus (HTLV)-1 was the first human retrovirus to be associated to cancer, namely adult T-cell leukemia (ATL), but its pathogenesis remains enigmatic, since only a minority of infected individuals develops either ATL or the neuroinflammatory disorder HTLV-1-associated myelopathy/tropical spastic paraparesis (HAM/TSP). A functional FAS -670 polymorphism in an interferon (IFN)-regulated STAT1-binding site has been associated to both ATL and HAM/TSP susceptibility. Fashi T stem cell memory (Tscm) cells have been identified as the hierarchical apex of ATL, but have not been investigated in HAM/TSP. In addition, both FAS and STAT1 have been identified in an IFN-inducible HAM/TSP gene signature, but its pathobiological significance remains unclear. We comprehensively explored Fas expression (protein/mRNA) and function in lymphocyte activation, apoptosis, proliferation, and transcriptome, in PBMC from a total of 47 HAM/TSP patients, 40 asymptomatic HTLV-1-infected individuals (AC), and 58 HTLV-1 -uninfected healthy controls. Fas surface expression followed a two-step increase from HC to AC and from AC to HAM/TSP. In HAM/TSP, Fas levels correlated positively to lymphocyte activation markers, but negatively to age of onset, linking Fashi cells to earlier, more aggressive disease. Surprisingly, increased lymphocyte Fas expression in HAM/TSP was linked to decreased apoptosis and increased lymphoproliferation upon in vitro culture, but not to proviral load. This Fashi phenotype is HAM/TSP-specific, since both ex vivo and in vitro Fas expression was increased as compared to multiple sclerosis (MS), another neuroinflammatory disorder. To elucidate the molecular mechanism underlying non-apoptotic Fas signaling in HAM/TSP, we combined transcriptome analysis with functional assays, i.e., blocking vs. triggering Fas receptor in vitro with antagonist and agonist-, anti-Fas mAb, respectively. Treatment with agonist anti-Fas mAb restored apoptosis, indicating
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Fas ligand expression by astrocytoma in vivo: maintaining immune privilege in the brain?
Saas, P; Walker, P R; Hahne, M; Quiquerez, A L; Schnuriger, V; Perrin, G; French, L; Van Meir, E G; de Tribolet, N; Tschopp, J; Dietrich, P Y
1997-01-01
Astrocytomas are among the most common brain tumors that are usually fatal in their malignant form. They appear to progress without significant impedance from the immune system, despite the presence of intratumoral T cell infiltration. To date, this has been thought to be the result of T cell immunosuppression induced by astrocytoma-derived cytokines. Here, we propose that cell contact-mediated events also play a role, since we demonstrate the in vivo expression of Fas ligand (FasL/CD95L) by human astrocytoma and the efficient killing of Fas-bearing cells by astrocytoma lines in vitro and by tumor cells ex vivo. Functional FasL is expressed by human, mouse, and rat astrocytoma and hence may be a general feature of this nonlymphoid tumor. In the brain, astrocytoma cells can potentially deliver a death signal to Fas+ cells which include infiltrating leukocytes and, paradoxically, astrocytoma cells themselves. The expression of FasL by astrocytoma cells may extend the processes that are postulated to occur in normal brain to maintain immune privilege, since we also show FasL expression by neurons. Overall, our findings suggest that FasL-induced apoptosis by astrocytoma cells may play a significant role in both immunosuppression and the regulation of tumor growth within the central nervous system. PMID:9077524
Fernandez, Timothy F.; Samal, Alexandra B.; Bedwell, Gregory J.; Chen, Yabing; Saad, Jamil S.
2013-01-01
The extrinsic apoptotic pathway is initiated by cell surface death receptors such as Fas. Engagement of Fas by Fas ligand triggers a conformational change that allows Fas to interact with adaptor protein Fas-associated death domain (FADD) via the death domain, which recruits downstream signaling proteins to form the death-inducing signaling complex (DISC). Previous studies have shown that calmodulin (CaM) is recruited into the DISC in cholangiocarcinoma cells, suggesting a novel role of CaM in Fas-mediated signaling. CaM antagonists induce apoptosis through a Fas-related mechanism in cholangiocarcinoma and other cancer cell lines possibly by inhibiting Fas-CaM interactions. The structural determinants of Fas-CaM interaction and the underlying molecular mechanisms of inhibition, however, are unknown. Here we employed NMR and biophysical techniques to elucidate these mechanisms. Our data show that CaM binds to the death domain of Fas (FasDD) with an apparent dissociation constant (Kd) of ∼2 μm and 2:1 CaM:FasDD stoichiometry. The interactions between FasDD and CaM are endothermic and entropically driven, suggesting that hydrophobic contacts are critical for binding. We also show that both the N- and C-terminal lobes of CaM are important for binding. NMR and surface plasmon resonance data show that three CaM antagonists (N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide, tamoxifen, and trifluoperazine) greatly inhibit Fas-CaM interactions by blocking the Fas-binding site on CaM. Our findings provide the first structural evidence for Fas-CaM interactions and mechanism of inhibition and provide new insight into the molecular basis for a novel role of CaM in regulating Fas-mediated apoptosis. PMID:23760276
Natural history of autoimmune lymphoproliferative syndrome associated with FAS gene mutations
Price, Susan; Shaw, Pamela A.; Seitz, Amy; Joshi, Gyan; Davis, Joie; Niemela, Julie E.; Perkins, Katie; Hornung, Ronald L.; Folio, Les; Rosenberg, Philip S.; Puck, Jennifer M.; Hsu, Amy P.; Lo, Bernice; Pittaluga, Stefania; Jaffe, Elaine S.; Fleisher, Thomas A.; Lenardo, Michael J.
2014-01-01
Autoimmune lymphoproliferative syndrome (ALPS) presents in childhood with nonmalignant lymphadenopathy and splenomegaly associated with a characteristic expansion of mature CD4 and CD8 negative or double negative T-cell receptor αβ+ T lymphocytes. Patients often present with chronic multilineage cytopenias due to autoimmune peripheral destruction and/or splenic sequestration of blood cells and have an increased risk of B-cell lymphoma. Deleterious heterozygous mutations in the FAS gene are the most common cause of this condition, which is termed ALPS-FAS. We report the natural history and pathophysiology of 150 ALPS-FAS patients and 63 healthy mutation-positive relatives evaluated in our institution over the last 2 decades. Our principal findings are that FAS mutations have a clinical penetrance of <60%, elevated serum vitamin B12 is a reliable and accurate biomarker of ALPS-FAS, and the major causes of morbidity and mortality in these patients are the overwhelming postsplenectomy sepsis and development of lymphoma. With longer follow-up, we observed a significantly greater relative risk of lymphoma than previously reported. Avoiding splenectomy while controlling hypersplenism by using corticosteroid-sparing treatments improves the outcome in ALPS-FAS patients. This trial was registered at www.clinicaltrials.gov as #NCT00001350. PMID:24398331
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Induction of apoptosis in breast cancer cells in vitro by Fas ligand reverse signaling.
Kolben, Thomas; Jeschke, Udo; Reimer, Toralf; Karsten, Nora; Schmoeckel, Elisa; Semmlinger, Anna; Mahner, Sven; Harbeck, Nadia; Kolben, Theresa M
2018-02-01
The Fas-antigen is a cell surface receptor that transduces apoptotic signals into cells. The purpose of this study was to evaluate FasL expression in breast cancer and to elucidate the role of its signaling in different breast cancer cell lines. T47D and MCF7 cells were used and cultured in Dulbecco's modified Eagle's medium. FasL translocation to the membrane was achieved by culturing the cells in the presence of human interferon-γ (IFNγ). Translocation was detected by immunofluorescence. The ability of a Fas:Fc fusion protein to trigger apoptosis in these cells was investigated by cell death detection ELISA. After incubation with IFNγ for 4 h and 18 h, apoptosis was assessed in response to treatment with Fas:Fc. Immunofluorescence revealed that the used cell lines were positive for FasL which was increased and changed to more membrane-bound FasL expression after IFNγ stimulation. After stimulation with 50 IU/ml IFNγ, Fas:Fc significantly increased MCF7 apoptosis (1.39 ± 0.06-fold, p = 0.0004) after 18 h. After stimulation with 100 IU/ml, Fas:Fc significantly increased apoptosis both after 4 h (1.49 ± 0.15-fold, p = 0.018) and 18 h (1.30 ± 0.06-fold, p = 0.013). In T47D cells this effect was seen after 4 h of stimulation with 50 IU/ml and addition of Fas:Fc (1.6 ± 0.08-fold, p = 0.03). Membrane-bound FasL expression could be induced by IFNγ in a breast cancer cell model. More importantly, in the presence of IFNγ the Fas:Fc fusion protein was able to transmit pro-apoptotic signals to T47D and MCF7 cells, significantly inducing apoptosis. The current findings support further in vivo studies regarding FasL activation as a potential target for therapeutic intervention in breast cancer.
Optimization of odd chain fatty acid production by Yarrowia lipolytica.
Park, Young-Kyoung; Dulermo, Thierry; Ledesma-Amaro, Rodrigo; Nicaud, Jean-Marc
2018-01-01
Odd chain fatty acids (odd FAs) have a wide range of applications in therapeutic and nutritional industries, as well as in chemical industries including biofuel. Yarrowia lipolytica is an oleaginous yeast considered a preferred microorganism for the production of lipid-derived biofuels and chemicals. However, it naturally produces negligible amounts of odd chain fatty acids. The possibility of producing odd FAs using Y. lipolytica was investigated. Y. lipolytica wild-type strain was shown able to grow on weak acids; acetate, lactate, and propionate. Maximal growth rate on propionate reached 0.24 ± 0.01 h -1 at 2 g/L, and growth inhibition occurred at concentration above 10 g/L. Wild-type strain accumulated lipids ranging from 7.39 to 8.14% (w/w DCW) depending on the carbon source composition, and odd FAs represented only 0.01-0.12 g/L. We here proved that the deletion of the PHD1 gene improved odd FAs production, which reached a ratio of 46.82% to total lipids. When this modification was transferred to an obese strain, engineered for improving lipid accumulation, further increase odd FAs production reaching a total of 0.57 g/L was shown. Finally, a fed-batch co-feeding strategy was optimized for further increase odd FAs production, which generated 0.75 g/L, the best production described so far in Y. lipolytica . A Y. lipolytica strain able to accumulate high level of odd chain fatty acids, mainly heptadecenoic acid, has been successfully developed. In addition, a fed-batch co-feeding strategy was optimized to further improve lipid accumulation and odd chain fatty acid content. These lipids enriched in odd chain fatty acid can (1) improve the properties of the biodiesel generated from Y. lipolytica lipids and (2) be used as renewable source of odd chain fatty acid for industrial applications. This work paves the way for further improvements in odd chain fatty acids and fatty acid-derived compound production.
Lack of correlation between serum soluble Fas/APO-1 levels and autoimmune disease.
Goel, N; Ulrich, D T; St Clair, E W; Fleming, J A; Lynch, D H; Seldin, M F
1995-12-01
To determine whether elevated soluble Fas/APO-1 (sFas/APO-1) levels are associated with either autoimmune disease or evidence of flares in autoimmune disease. Thirty-seven serum samples were retrospectively obtained from normal controls and patients with laboratory evidence of autoimmune disease activity. These samples were assayed for sFas/APO-1 levels by an enzyme-linked immunosorbent assay, and hospital medical records were retrospectively reviewed for clinical and laboratory characteristics of the patients. Soluble Fas/APO-1 levels did not correlate with clinical diagnoses or laboratory abnormalities. The mean and range of sFas/APO-1 levels were similar in systemic lupus erythematosus patients (including those with active disease), patients with other autoimmune diseases, and normal controls. These data strongly suggest that measurement of sFas/APO-1 levels is unlikely to hold clinical value or play a role in the pathogenesis of autoimmune disease.
Robciuc, Marius R; Skrobuk, Paulina; Anisimov, Andrey; Olkkonen, Vesa M; Alitalo, Kari; Eckel, Robert H; Koistinen, Heikki A; Jauhiainen, Matti; Ehnholm, Christian
2012-01-01
Peroxisome proliferator-activated receptor (PPAR) delta is an important regulator of fatty acid (FA) metabolism. Angiopoietin-like 4 (Angptl4), a multifunctional protein, is one of the major targets of PPAR delta in skeletal muscle cells. Here we investigated the regulation of Angptl4 and its role in mediating PPAR delta functions using human, rat and mouse myotubes. Expression of Angptl4 was upregulated during myotubes differentiation and by oleic acid, insulin and PPAR delta agonist GW501516. Treatment with GW501516 or Angptl4 overexpression inhibited both lipoprotein lipase (LPL) activity and LPL-dependent uptake of FAs whereas uptake of BSA-bound FAs was not affected by either treatment. Activation of retinoic X receptor (RXR), PPAR delta functional partner, using bexarotene upregulated Angptl4 expression and inhibited LPL activity in a PPAR delta dependent fashion. Silencing of Angptl4 blocked the effect of GW501516 and bexarotene on LPL activity. Treatment with GW501516 but not Angptl4 overexpression significantly increased palmitate oxidation. Furthermore, Angptl4 overexpression did not affect the capacity of GW501516 to increase palmitate oxidation. Basal and insulin stimulated glucose uptake, glycogen synthesis and glucose oxidation were not significantly modulated by Angptl4 overexpression. Our findings suggest that FAs-PPARdelta/RXR-Angptl4 axis controls the LPL-dependent uptake of FAs in myotubes, whereas the effect of PPAR delta activation on beta-oxidation is independent of Angptl4.
Robciuc, Marius R.; Skrobuk, Paulina; Anisimov, Andrey; Olkkonen, Vesa M.; Alitalo, Kari; Eckel, Robert H.; Koistinen, Heikki A.; Jauhiainen, Matti; Ehnholm, Christian
2012-01-01
Peroxisome proliferator-activated receptor (PPAR) delta is an important regulator of fatty acid (FA) metabolism. Angiopoietin-like 4 (Angptl4), a multifunctional protein, is one of the major targets of PPAR delta in skeletal muscle cells. Here we investigated the regulation of Angptl4 and its role in mediating PPAR delta functions using human, rat and mouse myotubes. Expression of Angptl4 was upregulated during myotubes differentiation and by oleic acid, insulin and PPAR delta agonist GW501516. Treatment with GW501516 or Angptl4 overexpression inhibited both lipoprotein lipase (LPL) activity and LPL-dependent uptake of FAs whereas uptake of BSA-bound FAs was not affected by either treatment. Activation of retinoic X receptor (RXR), PPAR delta functional partner, using bexarotene upregulated Angptl4 expression and inhibited LPL activity in a PPAR delta dependent fashion. Silencing of Angptl4 blocked the effect of GW501516 and bexarotene on LPL activity. Treatment with GW501516 but not Angptl4 overexpression significantly increased palmitate oxidation. Furthermore, Angptl4 overexpression did not affect the capacity of GW501516 to increase palmitate oxidation. Basal and insulin stimulated glucose uptake, glycogen synthesis and glucose oxidation were not significantly modulated by Angptl4 overexpression. Our findings suggest that FAs-PPARdelta/RXR-Angptl4 axis controls the LPL-dependent uptake of FAs in myotubes, whereas the effect of PPAR delta activation on beta-oxidation is independent of Angptl4. PMID:23056264
Low concentrations of doxycycline attenuates FasL-induced apoptosis in HeLa cells.
Yoon, Jung Mi; Koppula, Sushruta; Huh, Se Jong; Hur, Sun Jin; Kim, Chan Gil
2015-07-24
Doxycycline (DC) has been shown to possess non-antibiotic properties including Fas/Fas Ligand (FasL)-mediated apoptosis against several tumor types in the concentration range of 10-40 µg/mL. However, the effect of DC in apoptotic signaling at much low concentrations was not studied. The present study investigated the attenuation effect of low dose of DC on FasL-induced apoptosis in HeLa cell by the methods of MTT assay, fluorescence microscopy, DNA fragmentation, flow cytometry analysis, and western blotting. In the present findings we showed that low concentration of DC (<2.0 µg/mL) exhibited protective effects against FasL-induced apoptosis in HeLa cells. FasL treatment to HeLa cells resulted in a concentration-dependent induction of cell death, and treatment with low concentrations of DC (0.1-2 µg/mL) significantly (p < 0.001) attenuated the FasL-induced cell death as measured by 3-(4,5-Dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) assay. Further, the FasL-induced apoptotic features in HeLa cells, such as morphological changes, DNA fragmentation and cell cycle arrest was also inhibited by DC (0.5 µg/mL). Tetracycline and minocycline also showed similar anti-apoptotic effects but were not significant when compared to DC, tested at same concentrations. Further, DC (0.01-16 µg/mL) did not influence the hydrogen peroxide- or cisplatin-induced intrinsic apoptotic pathway in HeLa cells. Protein analysis using Western blotting confirmed that FasL-induced cleavage/activation of caspase-8 and caspase-3, were inhibited by DC treatment at low concentration (0.5 µg/mL). Considering the overall data, we report for the first time that DC exhibited anti-apoptotic effects at low concentrations in HeLa cells by inhibition of caspase activation via FasL-induced extrinsic pathway.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jang, Byeong-Churl, E-mail: jangbc123@gw.kmu.ac.kr
Differentiation of preadipocyte, also called adipogenesis, leads to the phenotype of mature adipocyte. However, excessive adipogenesis is closely linked to the development of obesity. Artesunate, one of artemisinin-type sesquiterpene lactones from Artemisia annua L., is known for anti-malarial and anti-cancerous activities. In this study, we investigated the effect of artesunate on adipogenesis in 3T3-L1 preadipocytes. Artesunate strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes at 5 μM concentration. Artesunate at 5 μM also reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A butmore » also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during adipocyte differentiation. Moreover, artesunate at 5 μM reduced leptin, but not adiponectin, mRNA expression during adipocyte differentiation. Taken together, these findings demonstrate that artesunate inhibits adipogenesis in 3T3-L1 preadipoytes through the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. -- Highlights: •Artesunate, an artemisinin derivative, inhibits adipogenesis. •Artesunate inhibits C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3 in 3T3-L1 adipocytes. •Artesunate reduces leptin, but not adiponectin, expression in 3T3-L1 adipocytes. •Artesunate thus may have therapeutic potential against obesity.« less
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
MCT1 promotes the cisplatin-resistance by antagonizing Fas in epithelial ovarian cancer.
Yan, Chunxiao; Yang, Fan; Zhou, Chunxia; Chen, Xuejun; Han, Xuechuan; Liu, Xueqin; Ma, Hongyun; Zheng, Wei
2015-01-01
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP cells compared with sensitive ovarian cancer tissue and cell lines A2780. And in A2780 cells treated with Cisplatin, the expression of MCT1 increased in a concentration-dependent manner, MCT1 knockdown attenuates cisplatin-induced cell viability. In A2780 and A2780/CP cells transfected with MCT1 siRNA, the activation of several downstream targets of Fas, including FasL and FAP-1 were largely prevented, whereas the expression of Caspase-3 was increased, accompanying with increased abundance of Fas. Coimmunoprecipitation and immunofluorescence showed that there is interaction between endogenous MCT1 with Fas in vivo and in vitro. In vivo, depletion of MCT1 by shRNA reverses cisplatin-resistance and the expression of Fas. This study showed that down regulation of MCT1 promote the sensibility to Cisplatin in ovarian cancer cell line. And this effect appeared to be mediated via antagonizing the effect of Fas.
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Gonçalves Albuquerque, Tânia; Sanches-Silva, Ana; Santos, Lèlita; Costa, Helena S
2012-09-01
Eighteen brands of potato crisps, frequently consumed, were analyzed to establish their nutritional value in relation to salt, fat and fatty acid (FA) composition. The purpose of the present study was to determine moisture, total fat, salt contents and FA profiles (including trans-FAs), and to identify the oil/fat used for frying of the 18 brands of potato crisps. Our results show that salt content ranged from 0.127 to 2.77 g/100 g and total fat content of potato crisps varied between 20.0 and 42.8 g/100 g. With respect to FAs analysis, palmitic acid (C16:0), oleic acid (C18:1) and linoleic acid (C18:2) were the major FAs found in the analyzed potato crisps. It is clear from our work that nowadays most potato crisps are currently produced using oils with high contents in unsaturated FAs, which can be considered as healthier from a nutritional point of view. Nevertheless, some brands of potato crisps still use palm oil or a blend of palm oil and other fats/oils, which are very rich in saturated FAs.
Chronic methamphetamine exposure induces cardiac fas-dependent and mitochondria-dependent apoptosis.
Liou, Cher-Ming; Tsai, Shiow-Chwen; Kuo, Chia-Hua; Williams, Timothy; Ting, Hua; Lee, Shin-Da
2014-06-01
Very limited information regarding the influence of chronic methamphetamine exposure on cardiac apoptosis is available. In this study, we evaluate whether chronic methamphetamine exposure will increase cardiac Fas-dependent (type I) and mitochondria-dependent (type II) apoptotic pathways. Thirty-two male Wistar rats at 3-4 months of age were randomly divided into a vehicle-treated group [phosphate-buffered saline (PBS) 0.5 ml SQ per day] and a methamphetamine-treated group (MA 10 mg/kg SQ per day) for 3 months. We report that after 3 months of exposure, abnormal myocardial architecture, more minor cardiac fibrosis and cardiac TUNEL-positive apoptotic cells were observed at greater frequency in the MA group than in the PBS group. Protein levels of TNF-α, Fas ligand, Fas receptor, Fas-associated death domain, activated caspase-8, and activated caspase-3 (Fas-dependent apoptosis) extracted from excised hearts were significantly increased in the MA group, compared to the PBS group. Protein levels of cardiac Bak, t-Bid, Bak to Bcl-xL ratio, activated caspase-9, and activated caspase-3 (mitochondria-dependent apoptosis) were significantly increased in the MA group, compared with the PBS group. The results from this study reveal that chronic methamphetamine exposure will activate cardiac Fas-dependent and mitochondria-dependent apoptotic pathways, which may indicate a possible mechanism for developing cardiac abnormalities in humans with chronic methamphetamine abuse.
7 CFR 1580.203 - Determination of eligibility and certification by the Administrator (FAS).
Code of Federal Regulations, 2012 CFR
2012-01-01
... Administrator (FAS). 1580.203 Section 1580.203 Agriculture Regulations of the Department of Agriculture... § 1580.203 Determination of eligibility and certification by the Administrator (FAS). (a) As soon as... Administrator (FAS) shall certify a group of producers as eligible to apply for adjustment assistance under this...
7 CFR 1580.203 - Determination of eligibility and certification by the Administrator (FAS).
Code of Federal Regulations, 2014 CFR
2014-01-01
... Administrator (FAS). 1580.203 Section 1580.203 Agriculture Regulations of the Department of Agriculture... § 1580.203 Determination of eligibility and certification by the Administrator (FAS). (a) As soon as... Administrator (FAS) shall certify a group of producers as eligible to apply for adjustment assistance under this...
7 CFR 1580.203 - Determination of eligibility and certification by the Administrator (FAS).
Code of Federal Regulations, 2013 CFR
2013-01-01
... Administrator (FAS). 1580.203 Section 1580.203 Agriculture Regulations of the Department of Agriculture... § 1580.203 Determination of eligibility and certification by the Administrator (FAS). (a) As soon as... Administrator (FAS) shall certify a group of producers as eligible to apply for adjustment assistance under this...
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase.
Pandey, Puspa R; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C; Watabe, Kounosuke
2011-11-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24(-)/CD44(+)/ESA(+)) that were isolated from both ER+ and ER- breast cancer cell lines was examined. The authors found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, the results of this study indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol.
Resveratrol suppresses growth of cancer stem-like cells by inhibiting fatty acid synthase
Pandey, Puspa R.; Okuda, Hiroshi; Watabe, Misako; Pai, Sudha K.; Liu, Wen; Kobayashi, Aya; Xing, Fei; Fukuda, Koji; Hirota, Shigeru; Sugai, Tamotsu; Wakabayashi, Go; Koeda, Keisuke; Kashiwaba, Masahiro; Suzuki, Kazuyuki; Chiba, Toshimi; Endo, Masaki; Fujioka, Tomoaki; Tanji, Susumu; Mo, Yin-Yuan; Cao, Deliang; Wilber, Andrew C.; Watabe, Kounosuke
2012-01-01
Resveratrol is a natural polyphenolic compound and has been shown to exhibit cardio-protective as well as anti-neoplastic effects on various types of cancers. However, the exact mechanism of its anti-tumor effect is not clearly defined. Resveratrol has been shown to have strong hypolipidemic effect on normal adipocytes and as hyper-lipogenesis is a hallmark of cancer cell physiology, we examined the effect of resveratrol on lipid synthesis in cancer stem-like cells (CD24−/CD44+/ESA+) that were isolated from both ER+ and ER− breast cancer cell lines. We found that resveratrol significantly reduced the cell viability and mammosphere formation followed by inducing apoptosis in cancer stem-like cells. This inhibitory effect of resveratrol is accompanied by a significant reduction in lipid synthesis which is caused by the down-regulation of the fatty acid synthase (FAS) gene followed by up-regulation of pro-apoptotic genes, DAPK2 and BNIP3. The activation of apoptotic pathway in the cancer stem-like cells was suppressed by TOFA and by Fumonisin B1, suggesting that resveratrol-induced apoptosis is indeed through the modulation of FAS-mediated cell survival signaling. Importantly, resveratrol was able to significantly suppress the growth of cancer stem-like cells in an animal model of xenograft without showing apparental toxicity. Taken together, our results indicate that resveratrol is capable of inducing apoptosis in the cancer stem-like cells through suppression of lipogenesis by modulating FAS expression, which highlights a novel mechanism of anti-tumor effect of resveratrol. PMID:21188630
Werner, Jan-Michael; Kuhl, Saskia; Stavrinou, Pantelis; Röhn, Gabriele; Krischek, Boris; Blau, Tobias; Goldbrunner, Roland; Timmer, Marco
2017-12-01
The tumor necrosis factor FAS is overexpressed in high-grade gliomas (HGG). Only little is known about FAS or FAS ligand (FAS-L) in low-grade gliomas (LGG). We explored FAS/FAS-L expression in LGG, focusing on differences in primary and relapsed LGG and on its prognostic value. A total of 133 glioma samples (73 LGG, 60 HGG) were collected. The LGG samples included 15 matched pairs of primary and relapsed tumors. RT-PCR was performed to measure FAS/FAS-L expression, using subunit A, flavoprotein variant (SDHA) as housekeeper. Clinical data included progression free- (PFS) and overall survival (OS). LGG showed significantly lower FAS but higher FAS-L expression than HGG. The FAS-L expression was higher in primary compared to relapsed LGG and had a positive prognostic value concerning PFS (median 45.20 vs. 31.37 months). FAS-L could act as a prognostic marker and potential target in primary LGG. Copyright© 2017, International Institute of Anticancer Research (Dr. George J. Delinasios), All rights reserved.
FAS/FASL gene polymorphisms in Turkish patients with chronic myeloproliferative disorders.
Ozdemirkiran, Fusun Gediz; Nalbantoglu, Sinem; Gokgoz, Zafer; Payzin, Bahriye Kadriye; Vural, Filiz; Cagirgan, Seckin; Berdeli, Afig
2017-03-01
Chronic myeloproliferative disorders (CMPD) are chronic myeloid hematological disorders, characterized by increased myeloid cell proliferation and fibrosis. Impaired apoptotic mechanisms, increased cell proliferation, uncontrolled hematopoietic cell proliferation and myeloaccumulation may contribute to the pathogenesis of CMPD. The aim of our study was to show the possible role of FAS/FASL gene polymorphisms in CMPD pathogenesis and investigate the association with clinical parameters and susceptibility to disease. We included 101 (34 polycythemia vera (PV), 23 primary myelofibrosis (PMF), 44 essential thrombocythemia (ET)) CMPD patients diagnosed according to the WHO classification criteria and 95 healthy controls in this study. All the patients and the controls were investigated for FAS/FASL gene expression, allele frequencies and phenotype features, and also FAS mRNA levels were analyzed. Chronic myeloproliferative disorders patients showed increased FAS-670AG + GG genotype distribution compared with the control group ( p < 0.05). While the A allele was more frequent in both groups, AG genotype was more frequent in CMPD patients. There was no association between FAS-670A>G gene polymorphism and some clinical parameters such as splenomegaly and thrombosis ( p > 0.05). No statistically significant difference in FASL+843C>T genotype or allele frequency was found between groups ( p > 0.05). Moreover, no statistically significant difference was detected in FASL and JAK2V617F mutations ( p > 0.05). FAS mRNA expression was 1.5-fold reduced in patients compared to healthy subjects. According to our findings, FAS/FASL gene expression may contribute to the molecular and immunological pathogenesis of CMPD. More investigations are needed to support these data.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Rao, Shobha; Joshi, Sadhana; Kale, Anvita; Hegde, Mahabaleshwar; Mahadik, Sahebarao
2006-05-01
Studies on fetal programming of adult diseases have highlighted the importance of maternal nutrition during pregnancy. Folic acid and long-chain essential polyunsaturated fatty acids (LC-PUFAs) have independent effects on fetal growth. However, folic acid effects may also involve alteration of LC-PUFA metabolism. Because marginal deficiency of LC-PUFAs during critical periods of brain growth and development is associated with risks for adult diseases, it is highly relevant to investigate how maternal supplementation of such nutrients can alter brain fatty acid levels. We examined the impact of folic acid supplementation, conventionally used in maternal intervention, on brain essential fatty acid levels and plasma corticosterone concentrations in adult offspring at 11 months of age. Pregnant female rats from 4 groups (6 in each) were fed with casein diets either with 18 g protein/100 g diet (control diet) or treatment diets that were marginal in protein (MP), such as 12 g protein/100 g diet supplemented with 8 mg folic acid (FAS/MP), 12 g protein/100 g diet without folic acid (FAD/MP), or 12 g protein/100 g diet (MP) with 2 mg folic acid. Pups were weaned to a standard laboratory diet with 18 g protein/100 g diet. All male adult offspring in the FAS/MP group showed lower docosahexaenoic acid (P<.05) as compared with control adult offspring (6.04+/-2.28 vs 10.33+/-0.86 g/100 g fatty acids) and higher n-6/n-3 ratio (P<.05). Docosahexaenoic acid levels in FAS/MP adult offspring were also lower (P<.05) when compared with the MP group. Plasma corticosterone concentrations were higher (P<.05) in male adult offspring from the FAS/MP group compared with control as well as the MP adult offspring. Results suggest that maternal folic acid supplementation at MP intake decreased brain docosahexaenoic acid levels probably involving corticosterone increase.
2018-01-01
Objective The aim of this experiment was to evaluate the effect of dietary supplementation with the docosahexaenoic acid (DHA)-rich microalgae, Aurantiochytrium limacinum (AURA) on pig performance, carcass traits, and the fatty acid composition of pork Longissimus lumborum (LL) and backfat. Methods A total of 144 Pig Improvement Company (PIC)×Goland finishing pigs (72 females and 72 castrated males) of mean weight 117.1 (±13.1) kg were blocked by sex and body weight and provided with 0% or 1% AURA in isonutritive and isocaloric diets. A total of 24 pens provided 12 replicates per treatment. Animals were weighed on day 0 and 28 with feed and water intake recorded per pen. After 31 days supplementation (28 days of study and 3 days until the slaughtering date) three animals per pen (n = 72) were slaughtered and the LL and backfat thickness, lean meat content and dressing percentage were recorded for the carcasses. The fatty acid (FA) profile of the LL and backfat was established by direct FA methyl ester synthesis. Results No differences were observed for any performance parameters or carcass traits. Supplementation with AURA resulted in significant changes to the FA profiles of both the LL and backfat with male and female pigs responding differently to supplementation in terms of particular FAs. Overall, pork LL samples had significantly higher eicosapentaenoic acid (p<0.001) and DHA concentrations (p<0.001), and higher omega-3 (n-3) FAs (p<0.001), as well as an increased omega3:omega6 (n-3:n-6) ratio (p = 0.001). For backfat, supplementation resulted in significantly higher amounts of DHA (p<0.001) and n-3 FAs (p<0.001). Conclusion These results indicate that dietary supplementation with 1% AURA over a 31 day period can increase the FA composition of pork LL and backfat, specifically the DHA, with no major impact on growth performance and carcass traits. PMID:29381901
Moran, Colm A; Morlacchini, Mauro; Keegan, Jason D; Fusconi, Giorgio
2018-05-01
The aim of this experiment was to evaluate the effect of dietary supplementation with the docosahexaenoic acid (DHA)-rich microalgae, Aurantiochytrium limacinum (AURA) on pig performance, carcass traits, and the fatty acid composition of pork Longissimus lumborum (LL) and backfat. A total of 144 Pig Improvement Company (PIC)×Goland finishing pigs (72 females and 72 castrated males) of mean weight 117.1 (±13.1) kg were blocked by sex and body weight and provided with 0% or 1% AURA in isonutritive and isocaloric diets. A total of 24 pens provided 12 replicates per treatment. Animals were weighed on day 0 and 28 with feed and water intake recorded per pen. After 31 days supplementation (28 days of study and 3 days until the slaughtering date) three animals per pen (n = 72) were slaughtered and the LL and backfat thickness, lean meat content and dressing percentage were recorded for the carcasses. The fatty acid (FA) profile of the LL and backfat was established by direct FA methyl ester synthesis. No differences were observed for any performance parameters or carcass traits. Supplementation with AURA resulted in significant changes to the FA profiles of both the LL and backfat with male and female pigs responding differently to supplementation in terms of particular FAs. Overall, pork LL samples had significantly higher eicosapentaenoic acid (p<0.001) and DHA concentrations (p<0.001), and higher omega-3 (n-3) FAs (p<0.001), as well as an increased omega3:omega6 (n-3:n-6) ratio (p = 0.001). For backfat, supplementation resulted in significantly higher amounts of DHA (p<0.001) and n-3 FAs (p<0.001). These results indicate that dietary supplementation with 1% AURA over a 31 day period can increase the FA composition of pork LL and backfat, specifically the DHA, with no major impact on growth performance and carcass traits.
Mutation in Fas Ligand Impairs Maturation of Thymocytes Bearing Moderate Affinity T Cell Receptors
Boursalian, Tamar E.; Fink, Pamela J.
2003-01-01
Fas ligand, best known as a death-inducer, is also a costimulatory molecule required for maximal proliferation of mature antigen-specific CD4+ and CD8+ T cells. We now extend the role of Fas ligand by showing that it can also influence thymocyte development. T cell maturation in some, but not all, strains of TCR transgenic mice is severely impaired in thymocytes expressing mutant Fas ligand incapable of interacting with Fas. Mutant Fas ligand inhibits neither negative selection nor death by neglect. Instead, it appears to modulate positive selection of thymocytes expressing both class I– and class II–restricted T cell receptors of moderate affinity for their positively selecting ligands. Fas ligand is therefore an inducer of death, a costimulator of peripheral T cell activation, and an accessory molecule in positive selection. PMID:12860933
7 CFR 1484.54 - What expenditures may FAS reimburse under the Cooperator program?
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false What expenditures may FAS reimburse under the... may FAS reimburse under the Cooperator program? (a) A Cooperator may seek reimbursement for an... source. (b) Subject to paragraph (a) of this section, FAS will reimburse, in whole or in part, the cost...
7 CFR 1484.54 - What expenditures may FAS reimburse under the Cooperator program?
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false What expenditures may FAS reimburse under the... may FAS reimburse under the Cooperator program? (a) A Cooperator may seek reimbursement for an... source. (b) Subject to paragraph (a) of this section, FAS will reimburse, in whole or in part, the cost...
7 CFR 1484.54 - What expenditures may FAS reimburse under the Cooperator program?
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false What expenditures may FAS reimburse under the... may FAS reimburse under the Cooperator program? (a) A Cooperator may seek reimbursement for an... source. (b) Subject to paragraph (a) of this section, FAS will reimburse, in whole or in part, the cost...
Bennett, M W; O'connell, J; O'sullivan, G C; Roche, D; Brady, C; Kelly, J; Collins, J K; Shanahan, F
1999-02-01
Despite being immunogenic, gastric cancers overcome antitumour immune responses by mechanisms that have yet to be fully elucidated. Fas ligand (FasL) is a molecule that induces Fas receptor mediated apoptosis of activated immunocytes, thereby mediating normal immune downregulatory roles including immune response termination, tolerance acquisition, and immune privilege. Colon cancer cell lines have previously been shown to express FasL and kill lymphoid cells by Fas mediated apoptosis in vitro. Many diverse tumours have since been found to express FasL suggesting that a "Fas counterattack" against antitumour immune effector cells may contribute to tumour immune escape. To ascertain if human gastric tumours express FasL in vivo, as a potential mediator of immune escape in stomach cancer. Thirty paraffin wax embedded human gastric adenocarcinomas. FasL protein was detected in gastric tumours using immunohistochemistry; FasL mRNA was detected in the tumours using in situ hybridisation. Cell death was detected in situ in tumour infiltrating lymphocytes using terminal deoxynucleotidyl transferase mediated dUTP nick end labelling (TUNEL). Prevalent expression of FasL was detected in all 30 resected gastric adenocarcinomas examined. In the tumours, FasL protein and mRNA were co-localised to neoplastic gastric epithelial cells, confirming expression by the tumour cells. FasL expression was independent of tumour stage, suggesting that it may be expressed throughout gastric cancer progression. TUNEL staining disclosed a high level of cell death among lymphocytes infiltrating FasL positive areas of tumour. Human gastric adenocarcinomas express the immune downregulatory molecule, FasL. The results suggest that FasL is a prevalent mediator of immune privilege in stomach cancer.
De Tonnac, A; Labussière, E; Vincent, A; Mourot, J
2016-07-01
The regulation of lipogenesis mechanisms related to consumption of n-3 PUFA is poorly understood. The aim of the present study was to find out whether α-linolenic acid (ALA) or DHA uptake can have an effect on activities and gene expressions of enzymes involved in lipid metabolism in the liver, subcutaneous adipose tissue and longissimus dorsi (LD) muscle of growing-finishing pigs. Six groups of ten pigs received one of six experimental diets supplemented with rapeseed oil in the control diet, extruded linseed, microalgae or a mixture of both to implement different levels of ALA and DHA with the same content in total n-3. Results were analysed for linear and quadratic effects of DHA intake. The results showed that activities of malic enzyme (ME) and fatty acid synthase (FAS) decreased linearly in the liver with dietary DHA. Although the expression of the genes of these enzymes and their activities were poorly correlated, ME and FAS expressions also decreased linearly with DHA intake. The intake of DHA down-regulates the expressions of other genes involved in fatty acid (FA) metabolism in some tissues of pigs, such as fatty acid desaturase 2 and sterol-regulatory element binding transcription factor 1 in the liver and 2,4-dienoyl CoA reductase 2 in the LD muscle. FA oxidation in the LD muscle and FA synthesis decreased in the liver with increasing amount of dietary DHA, whereas a retroconversion of DHA into EPA seems to be set up in this last tissue.
MCT1 promotes the cisplatin-resistance by antagonizing Fas in epithelial ovarian cancer
Yan, Chunxiao; Yang, Fan; Zhou, Chunxia; Chen, Xuejun; Han, Xuechuan; Liu, Xueqin; Ma, Hongyun; Zheng, Wei
2015-01-01
This study was designed to investigate the role of MCT1 in the development of cisplatin-resistant ovarian cancer and its possible relationship with Fas. We found the expression of MCT1 was obviously increased both in cisplatin-resistant ovarian cancer tissue and A2780/CP cells compared with sensitive ovarian cancer tissue and cell lines A2780. And in A2780 cells treated with Cisplatin, the expression of MCT1 increased in a concentration-dependent manner, MCT1 knockdown attenuates cisplatin-induced cell viability. In A2780 and A2780/CP cells transfected with MCT1 siRNA, the activation of several downstream targets of Fas, including FasL and FAP-1 were largely prevented, whereas the expression of Caspase-3 was increased, accompanying with increased abundance of Fas. Coimmunoprecipitation and immunofluorescence showed that there is interaction between endogenous MCT1 with Fas in vivo and in vitro. In vivo, depletion of MCT1 by shRNA reverses cisplatin-resistance and the expression of Fas. This study showed that down regulation of MCT1 promote the sensibility to Cisplatin in ovarian cancer cell line. And this effect appeared to be mediated via antagonizing the effect of Fas. PMID:26045776
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Manoochehri, Mehdi; Borhani, Nasim; Karbasi, Ashraf; Koochaki, Ameneh; Kazemi, Bahram
2016-07-01
Aberrant DNA methylation has been investigated in carcinogenesis and as biomarker for the early detection of colorectal cancer (CRC). The present study aimed to define the methylation status in the regulatory elements of two proapoptotic genes, Fas cell surface death receptor (FAS) and BCL2-associated X protein (BAX). DNA methylation analysis was performed in tumor and adjacent normal tissue using Hpa II/ Msp I restriction digestion and methylation-specific polymerase chain reaction (PCR). The results observed downregulation of the FAS and BAX genes in the CRC tissues compared with the adjacent normal samples. Furthermore, demethylation using 5-aza-2'-deoxycytidine treatment followed by reverse-transcription quantitative PCR were performed on the HT-29 cell line to measure BAX and FAS mRNA expression following demethylation. The 5-aza-2'-deoxycytidine treatment resulted in significant FAS gene upregulation in the HT-29 cell line, but no significant difference in BAX expression. Furthermore, analysis of CpG islands in the FAS gene promoter revealed that the FAS promoter was significantly hypermethylated in 53.3% of tumor tissues compared with adjacent normal samples. Taken together, the results indicate that decreased expression of the FAS gene due to hypermethylation of its promoter may lead to apoptotic resistance, and acts as an important step during colorectal carcinogenesis.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Ben-Mustapha, Imen; Agrebi, Nourhen; Barbouche, Mohamed-Ridha
2018-03-01
Autoimmune lymphoproliferative syndrome (ALPS) is a primary immunodeficiency disease due to impaired Fas-Fas ligand apoptotic pathway. It is characterized by chronic nonmalignant, noninfectious lymphadenopathy and/or splenomegaly associated with autoimmune manifestations primarily directed against blood cells. Herein, we review the heterogeneous ALPS molecular bases and discuss recent findings revealed by the study of consanguineous patients. Indeed, this peculiar genetic background favored the identification of a novel form of AR ALPS-FAS associated with normal or residual protein expression, expanding the spectrum of ALPS types. In addition, rare mutational mechanisms underlying the splicing defects of FAS exon 6 have been identified in AR ALPS-FAS with lack of protein expression. These findings will help decipher critical regions required for the tight regulation of FAS exon 6 splicing. We also discuss the genotype-phenotype correlation and disease severity in AR ALPS-FAS. Altogether, the study of ALPS molecular bases in endogamous populations helps to better classify the disease subgroups and to unravel the Fas pathway functioning. ©2017 Society for Leukocyte Biology.
SAWADA, TAKAHIRO; KOJI, TAKEHIKO; HISHIKAWA, YOSHITAKA; KISHIMOTO, KOJI; NAGAYASU, TAKESHI; TAKAHASHI, TAKAO; OKA, TADAYUKI; AYABE, HIROYOSHI
2001-01-01
Certain anti-Fas antibodies, such as RMF2, induce apoptosis of Fas-expressing cells. We applied the Fas/anti-Fas system to induce killing of Fas-expressing immunocytes with resultant immunosuppression. W7TM-1 tumour cells, a rat T-cell line, were inoculated subcutaneously in BALB/c mice and tumour growth was monitored in untreated mice and in mice treated with RMF2. Prior to treatment with RMF2, we examined the expression of Fas in isolated splenocytes and in tumour-infiltrating lymphocytes by flow cytometry and immunohistochemistry, respectively. There was a remarkable increase in Fas-positive lymphocytes, including natural killer (NK) cells, among splenocytes at day 5 after tumour cell inoculation. The number of Fas-positive infiltrating lymphocytes also increased markedly, from day 5 to day 10. We then examined whether RMF2 could induce apoptosis of Fas-positive activated lymphocytes isolated from the spleen at day 5 in vitro. Terminal deoxy (d) -UTP nick end labelling (TUNEL) and Annexin V staining methods showed apoptosis of isolated cells when incubated with RMF2, and typical apoptotic features were confirmed by 4′,6-diamidino-2-phenylindole dihydrochloride (DAPI) staining. Furthermore, suppression of cellular and humoral immunity was noted in RMF2-treated mice by mixed lymphocyte reaction and assay of serum levels of immunoglobulin G, respectively. Finally, treatment of animals with RMF2 daily from day 5 to day 9 could maintain the tumour size, while the tumour mass began to diminish in untreated mice immediately after reaching a maximum size. We confirmed the enhancing effects of long-term treatment with RMF2, through the induction of immunosuppression, on the growth of unvascularized xenogeneic tumour cell grafts. PMID:11380695
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Park, Jong-Beom; Park, Chanjoo
2017-10-01
In vitro cell culture model. To investigate the effect of small interfering RNA (siRNA) on Fas expression, apoptosis, and proliferation in serum-deprived rat disc cells. Synthetic siRNA can trigger an RNA interference (RNAi) response in mammalian cells and precipitate the inhibition of specific gene expression. However, the potential utility of siRNA technology in downregulation of specific genes associated with disc cell apoptosis remains unclear. Rat disc cells were isolated and cultured in the presence of either 10% fetal bovine serum (FBS) (normal control) or 0% FBS (serum deprivation to induce apoptosis) for 48 hours. Fas expression, apoptosis, and proliferation were determined. Additionally, siRNA oligonucleotides against Fas (Fas siRNA) were transfected into rat disc cells to suppress Fas expression. Changes in Fas expression were assessed by reverse transcription-polymerase chain reaction and semiquantitatively analyzed using densitometry. The effect of Fas siRNA on apoptosis and proliferation of rat disc cells were also determined. Negative siRNA and transfection agent alone (Mock) were used as controls. Serum deprivation increased apoptosis by 40.3% ( p <0.001), decreased proliferation by 45.3% ( p <0.001), and upregulated Fas expression. Additionally, Fas siRNA suppressed Fas expression in serum-deprived cultures, with 68.5% reduction at the mRNA level compared to the control cultures ( p <0.001). Finally, Fas siRNA-mediated suppression of Fas expression significantly inhibited apoptosis by 9.3% and increased proliferation by 21% in serum-deprived cultures ( p <0.05 for both). The observed dual positive effect of Fas siRNA might be a powerful therapeutic approach for disc degeneration by suppression of harmful gene expression.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Jang, Byeong-Churl, E-mail: jangbc123@gw.kmu.ac.kr
Tetrandrine is a bisbenzylisoquinoline alkaloid isolated from the roots of Stephania tetrandra S. Moore and has been shown to possess anti-inflammatory and anti-cancerous activities. In this study, the effect of tetrandrine on adipogenesis in 3T3-L1 preadipocytes was investigated. Tetrandrine at 10 μM concentration strongly inhibited lipid accumulation and triglyceride (TG) synthesis during the differentiation of 3T3-L1 preadipocytes into adipocytes. On mechanistic levels, tetrandrine reduced not only the expressions of CCAAT/enhancer-binding protein-α (C/EBP-α), peroxisome proliferator-activated receptor-γ (PPAR-γ), fatty acid synthase (FAS), and perilipin A but also the phosphorylation levels of signal transducer and activator of transcription-3 (STAT-3) during 3T3-L1 adipocyte differentiation. Tetrandrinemore » also reduced the mRNA expression of leptin, but not adiponectin, during 3T3-L1 adipocyte differentiation. Collectively, these findings show that tetrandrine has strong anti-adipogenic effect on 3T3-L1 preadipocytes and the effect is largely attributable to the reduced expression and/or phosphorylation levels of C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3. - Highlights: • Tetrandrine, a bisbenzylisoquinoline alkaloid, inhibits adipogenesis. • Tetrandrine inhibits C/EBP-α, PPAR-γ, FAS, perilipin A, and STAT-3 in 3T3-L1 adipocytes. • Tetrandrine reduces leptin, but not adiponectin, expression in 3T3-L1 adipocytes. • Tetrandrine may thus have therapeutic potential against obesity.« less
Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui
2015-01-01
Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular
Yan, Jing; Liao, Kai; Wang, Tianjiao; Mai, Kangsen; Xu, Wei; Ai, Qinghui
2015-01-01
Ectopic lipid accumulation has been observed in fish fed a high-lipid diet. However, no information is available on the mechanism by which dietary lipid levels comprehensively regulate lipid transport, uptake, synthesis and catabolism in fish. Therefore, the present study aimed to gain further insight into how dietary lipids affect lipid deposition in the liver of large yellow croaker(Larimichthys crocea). Fish (150.00±4.95 g) were fed a diet with a low (6%), moderate (12%, the control diet) or high (18%) crude lipid content for 10 weeks. Growth performance, plasma biochemical indexes, lipid contents and gene expression related to lipid deposition, including lipoprotein assembly and clearance, fatty acid uptake and triacylglycerol synthesis and catabolism, were assessed. Growth performance was not significantly affected. However, the hepato-somatic and viscera-somatic indexes as well as plasma triacylglycerol, non-esterified fatty acids and LDL-cholesterol levels were significantly increased in fish fed the high-lipid diet. In the livers of fish fed the high-lipid diet, the expression of genes related to lipoprotein clearance (LDLR) and fatty acid uptake (FABP11) was significantly up-regulated, whereas the expression of genes involved in lipoprotein assembly (apoB100), triacylglycerol synthesis and catabolism (DGAT2, CPT I) was significantly down-regulated compared with fish fed the control diet, and hepatic lipid deposition increased. In fish fed the low-lipid diet, the expression of genes associated with lipoprotein assembly and clearance (apoB100, LDLR, LRP-1), fatty acid uptake (CD36, FATP1, FABP3) and triacylglycerol synthesis (FAS) was significantly increased, whereas the expression of triacylglycerol catabolism related genes (ATGL, CPT I) was reduced compared with fish fed the control diet. However, hepatic lipid content in fish fed the low-lipid diet decreased mainly due to low dietary lipid intake. In summary, findings of this study provide molecular
Balomenos, Dimitrios; Shokri, Rahman; Daszkiewicz, Lidia; Vázquez-Mateo, Cristina; Martínez-A, Carlos
2017-01-01
Fas induces massive apoptosis in T cells after repeated in vitro T cell receptor (TCR) stimulation and is critical for lymphocyte homeostasis in Fas-deficient ( lpr ) mice. Although the in vitro Fas apoptotic mechanism has been defined, there is a large conceptual gap between this in vitro phenomenon and the pathway that leads to in vivo development of lymphadenopathy and autoimmunity. A striking abnormality in lpr mice is the excessive proliferation of CD4 + and CD8 + T cells, and more so of the double-negative TCR + CD4 - CD8 - B220 + T cells. The basis of lpr T cell hyperproliferation remains elusive, as it cannot be explained by Fas-deficient apoptosis. T cell-directed p21 overexpression reduces hyperactivation/hyperproliferation of all lpr T cell subtypes and lymphadenopathy in lpr mice. p21 controls expansion of repeatedly stimulated T cells without affecting apoptosis. These results confirm a direct link between hyperactivation/hyperproliferation, autoreactivity, and lymphadenopathy in lpr mice and, with earlier studies, suggest that Fas apoptosis-independent pathways control lpr T cell hyperproliferation. lpr T cell hyperproliferation could be an indirect result of the defective apoptosis of repeatedly stimulated lpr T cells. Nonetheless, in this perspective, we argue for an alternative setting, in which lack of Fas would directly cause lpr T cell hyperactivation/hyperproliferation in vivo . We propose that Fas/Fas ligand (FasL) acts as an activation inhibitor of recurrently stimulated T cells, and that its disruption causes overexpansion of T cells in lpr mice. Research to define the underlying mechanism of this Fas/FasL effect could resolve the phenotype of lpr mice and lead to therapeutics for related human syndromes.
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
Milanovic, Desanka; Pesic, Vesna; Loncarevic-Vasiljkovic, Natasa; Pavkovic, Zeljko; Popic, Jelena; Kanazir, Selma; Jevtovic-Todorovic, Vesna; Ruzdijic, Sabera
2016-10-01
A number of experimental studies have reported that exposure to common, clinically used anesthetics induce extensive neuroapoptosis and cognitive impairment when applied to young rodents, up to 2 weeks old, in phase of rapid synaptogenesis. Propofol is the most used general anesthetic in clinical practice whose mechanisms of neurotoxicity on the developing brain remains to be examined in depth. This study investigated effects of different exposures to propofol anesthesia on Fas receptor and Fas ligand expressions, which mediate proapoptotic and proinflammation signaling in the brain. Propofol (20 mg/kg) was administered to 7-day-old rats in multiple doses sufficient to maintain 2-, 4- and 6-h duration of anesthesia. Animals were sacrificed at 0, 4, 16 and 24 h after termination of anesthesia. It was found that propofol anesthesia induced Fas/FasL and downstream caspase-8 expression more prominently in the thalamus than in the cortex. Opposite, Bcl-2 and caspase-9, markers of intrinsic pathway activation, were shown to be more influenced by propofol treatment in the cortex. Further, we have established upregulation of caspase-1 and IL-1β cytokine transcription as well as subsequent activation of microglia that is potentially associated with brain inflammation. Behavioral analyses revealed that P35 and P60 animals, neonatally exposed to propofol, had significantly higher motor activity during three consecutive days of testing in the open field, though formation of the intersession habituation was not prevented. This data, together with our previous results, contributes to elucidation of complex mechanisms of propofol toxicity in developing brain.
MANOOCHEHRI, MEHDI; BORHANI, NASIM; KARBASI, ASHRAF; KOOCHAKI, AMENEH; KAZEMI, BAHRAM
2016-01-01
Aberrant DNA methylation has been investigated in carcinogenesis and as biomarker for the early detection of colorectal cancer (CRC). The present study aimed to define the methylation status in the regulatory elements of two proapoptotic genes, Fas cell surface death receptor (FAS) and BCL2-associated X protein (BAX). DNA methylation analysis was performed in tumor and adjacent normal tissue using HpaII/MspI restriction digestion and methylation-specific polymerase chain reaction (PCR). The results observed downregulation of the FAS and BAX genes in the CRC tissues compared with the adjacent normal samples. Furthermore, demethylation using 5-aza-2′-deoxycytidine treatment followed by reverse-transcription quantitative PCR were performed on the HT-29 cell line to measure BAX and FAS mRNA expression following demethylation. The 5-aza-2′-deoxycytidine treatment resulted in significant FAS gene upregulation in the HT-29 cell line, but no significant difference in BAX expression. Furthermore, analysis of CpG islands in the FAS gene promoter revealed that the FAS promoter was significantly hypermethylated in 53.3% of tumor tissues compared with adjacent normal samples. Taken together, the results indicate that decreased expression of the FAS gene due to hypermethylation of its promoter may lead to apoptotic resistance, and acts as an important step during colorectal carcinogenesis. PMID:27347139
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
FAS 33: accurately recording effects of changing prices.
Sage, L G
1987-02-01
FAS 33 addresses the problem of distortion in conventional historical cost financial statements because of changing prices. It requires 1300 business enterprises to report selected changing price data on a supplementary basis. It has been demonstrated that it is also feasible and beneficial for hospitals to present price disclosures as supplementary information to their financial statements. The possible application of FAS 33 is supported on the basis that the accounting and reporting methods of healthcare institutions are similar to the accounting and reporting practices of profit-seeking entities.
Balkan, Mahmut; Atar, Murat; Erdal, Mehmet Emin; Rustemoğlu, Aydin; Yildiz, Ismail; Gunesacar, Ramazan; Hatipoğlu, Namık Kemal; Bodakçi, Mehmet Nuri; Ay, Ozlem Izci; Çevik, Kenan
2014-06-01
To investigate the association of the genetic variants of FAS/FASLG cell death pathway genes in male infertility, we genotyped the FAS -670A/G, -1377G/A, and FASLG -124A/G single-nucleotide polymorphisms (SNPs) by real-time polymerase chain reaction in 108 infertile men with idiopathic azoospermia and in 125 proven fertile controls. The distribution of genotypes and alleles for SNPs at FAS -1377G/A and FASLG -124A/G loci were determined not to be statistically different between the case and control groups. However, the genotype frequencies of SNPs, FAS -670AA and FAS -670AG, were found to be significantly different between the case and control groups. Whereas the FAS -670AA genotype might be regarded as a higher predisposition for idiopathic azoospermia, FAS -670AG could be interpreted to mean that this genotype provides protection against idiopathic azoospermia. The study of combined genotype and haplotype frequencies has found statistically significant differences between case and control subjects for some combinations. The AA-GG binary genotype for the FAS670 and FAS1377 loci couple, in particular, may have a high degree of predisposition to idiopathic azoospermia. Our results suggest that FAS -670A/G SNP may be a genetic predisposing factor of idiopathic azoospermia among southeastern Anatolian men. Larger studies are needed to verify these findings. Furthermore, our data indicated a possible linkage between the FAS and FASLG genes and idiopathic azoospermia.
7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?
Code of Federal Regulations, 2010 CFR
2010-01-01
... 7 Agriculture 10 2010-01-01 2010-01-01 false How does FAS formalize its working relationship with... FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in... sign the program agreement and submit the signed agreement to the Director, Marketing Operations Staff...
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Chakrabandhu, Krittalak; Hueber, Anne-Odile
2016-01-01
The Fas/FasL system is known, first and foremost, as a potent apoptosis activator. While its proapoptotic features have been studied extensively, evidence that the Fas/FasL system can elicit non-death signals has also accumulated. These non-death signals can promote survival, proliferation, migration, and invasion of cells. The key molecular mechanism that determines the shift from cell death to non-death signals had remained unclear until the recent identification of the tyrosine phosphorylation in the death domain of Fas as the reversible signaling switch. In this review, we present the connection between the recent findings regarding the control of Fas multi-signals and the context-dependent signaling choices. This information can help explain variable roles of Fas signaling pathway in different pathologies. PMID:27799932
Headen, Devon M; Woodward, Kyle B; Coronel, María M; Shrestha, Pradeep; Weaver, Jessica D; Zhao, Hong; Tan, Min; Hunckler, Michael D; Bowen, William S; Johnson, Christopher T; Shea, Lonnie; Yolcu, Esma S; García, Andrés J; Shirwan, Haval
2018-06-04
Islet transplantation is a promising therapy for type 1 diabetes. However, chronic immunosuppression to control rejection of allogeneic islets induces morbidities and impairs islet function. T effector cells are responsible for islet allograft rejection and express Fas death receptors following activation, becoming sensitive to Fas-mediated apoptosis. Here, we report that localized immunomodulation using microgels presenting an apoptotic form of the Fas ligand with streptavidin (SA-FasL) results in prolonged survival of allogeneic islet grafts in diabetic mice. A short course of rapamycin treatment boosted the immunomodulatory efficacy of SA-FasL microgels, resulting in acceptance and function of allografts over 200 days. Survivors generated normal systemic responses to donor antigens, implying immune privilege of the graft, and had increased CD4 + CD25 + FoxP3 + T regulatory cells in the graft and draining lymph nodes. Deletion of T regulatory cells resulted in acute rejection of established islet allografts. This localized immunomodulatory biomaterial-enabled approach may provide an alternative to chronic immunosuppression for clinical islet transplantation.
STARD13 promotes hepatocellular carcinoma apoptosis by acting as a ceRNA for Fas.
Zhang, Hai; Wang, Fang; Hu, Yahua
2017-02-01
To study the roles of STARD13 in cellular apoptosis of hepatocellular carcinoma (HCC). Quantitative real-time PCR and immunohistochemistry analyses showed that the expression levels of STARD13 and Fas were lower in clinical HCC tissues than in normal tissues and were positively correlated, which is consistent with the results analyzed by The Cancer Genome Atlas (TCGA) data. Patients with higher STARD13 or Fas expression levels had longer overall survival. Additionally, STARD13 3'-UTR enhanced cellular apoptosis and the 3'-UTRs of STARD13 and Fas were predicted to harbor nine similar miRNA binding sites. And STARD13 3'-UTR promoted Fas expression in a 3'-UTR- and miRNA-dependent way and increased the sensitivity of HCC cells to chemotherapy. Importantly, the coding sequence of STARD13 did not increase Fas expression. STARD13 3'-UTR promotes HCC apoptosis through acting as a ceRNA for Fas.
Mezek, Tadej; Sverko, Ed; Ruddy, Martina D.; Zaruk, Donna; Capretta, Alfredo; Hebert, Craig E.; Fisk, Aaron T.; McGoldrick, Daryl J.; Newton, Teresa J.; Sutton, Trent M.; Koops, Marten A.; Muir, Andrew M.; Johnson, Timothy B.; Ebener, Mark P.; Arts, Michael T.
2011-01-01
Freshwater organisms synthesize a wide variety of fatty acids (FAs); however, the ability to synthesize and/or subsequently modify a particular FA is not universal, making it possible to use certain FAs as biomarkers. Herein we document the occurrence of unusual FAs (polymethylene-interrupted fatty acids; PMI-FAs) in select freshwater organisms in the Laurentian Great Lakes. We did not detect PMI-FAs in: (a) natural seston from Lake Erie and Hamilton Harbor (Lake Ontario), (b) various species of laboratory-cultured algae including a green alga (Scenedesmus obliquus), two cyanobacteria (Aphanizomenon flos-aquae and Synechococystis sp.), two diatoms (Asterionella formosa, Diatoma elongatum) and a chrysophyte (Dinobryon cylindricum) or, (c) zooplankton (Daphnia spp., calanoid or cyclopoid copepods) from Lake Ontario, suggesting that PMI-FAs are not substantively incorporated into consumers at the phytoplankton–zooplankton interface. However, these unusual FAs comprised 4-6% of total fatty acids (on a dry tissue weight basis) of native fat mucket (Lampsilis siliquoidea) and plain pocketbook (L. cardium) mussels and in invasive zebra (Dreissena polymorpha) and quagga (D. bugensis) mussels. We were able to clearly partition Great Lakes' mussels into three separate groups (zebra, quagga, and native mussels) based solely on their PMI-FA profiles. We also provide evidence for the trophic transfer of PMI-FAs from mussels to various fishes in Lakes Ontario and Michigan, further underlining the potential usefulness of PMI-FAs for tracking the dietary contribution of mollusks in food web and contaminant-fate studies.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Del Sorbo, Lorenzo; Costamagna, Andrea; Muraca, Giuseppe; Rotondo, Giuseppe; Civiletti, Federica; Vizio, Barbara; Bosco, Ornella; Martin Conte, Erica L; Frati, Giacomo; Delsedime, Luisa; Lupia, Enrico; Fanelli, Vito; Ranieri, V Marco
2016-08-01
Lung ischemia-reperfusion injury is the main cause of primary graft dysfunction after lung transplantation and results in increased morbidity and mortality. Fas-mediated apoptosis is one of the pathologic mechanisms involved in the development of ischemia-reperfusion injury. We hypothesized that the inhibition of Fas gene expression in lungs by intratracheal administration of small interfering RNA could reduce lung ischemia-reperfusion injury in an ex vivo model reproducing the procedural sequence of lung transplantation. Prospective, randomized, controlled experimental study. University research laboratory. C57/BL6 mice weighing 28-30 g. Ischemia-reperfusion injury was induced in lungs isolated from mice, 48 hours after treatment with intratracheal small interfering RNA targeting Fas, control small interfering RNA, or vehicle. Isolated lungs were exposed to 6 hours of cold ischemia (4°C), followed by 2 hours of warm (37°C) reperfusion with a solution containing 10% of fresh whole blood and mechanical ventilation with constant low driving pressure. Fas gene expression was significantly silenced at the level of messenger RNA and protein after ischemia-reperfusion in lungs treated with small interfering RNA targeting Fas compared with lungs treated with control small interfering RNA or vehicle. Silencing of Fas gene expression resulted in reduced edema formation (bronchoalveolar lavage protein concentration and lung histology) and improvement in lung compliance. These effects were associated with a significant reduction of pulmonary cell apoptosis of lungs treated with small interfering RNA targeting Fas, which did not affect cytokine release and neutrophil infiltration. Fas expression silencing in the lung by small interfering RNA is effective against ischemia-reperfusion injury. This approach represents a potential innovative strategy of organ preservation before lung transplantation.
7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?
Code of Federal Regulations, 2012 CFR
2012-01-01
... 7 Agriculture 10 2012-01-01 2012-01-01 false How does FAS formalize its working relationship with... FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Program Operations § 1484.30 How does FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final...
7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?
Code of Federal Regulations, 2014 CFR
2014-01-01
... 7 Agriculture 10 2014-01-01 2014-01-01 false How does FAS formalize its working relationship with... FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Program Operations § 1484.30 How does FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final...
7 CFR 1484.30 - How does FAS formalize its working relationship with approved Cooperators?
Code of Federal Regulations, 2013 CFR
2013-01-01
... 7 Agriculture 10 2013-01-01 2013-01-01 false How does FAS formalize its working relationship with... FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Program Operations § 1484.30 How does FAS formalize its working relationship with approved Cooperators? FAS will notify each applicant in writing of the final...
Raqib, Rubhana; Ekberg, Caroline; Sharkar, Protim; Bardhan, Pradip K; Zychlinsky, Arturo; Sansonetti, Philippe J; Andersson, Jan
2002-06-01
Shigella dysenteriae type 1-induced apoptotic cell death in rectal tissues from patients infected with Shigella dysenteriae type 1 was studied by the terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) technique and annexin V staining. Expression of proteins and cytokines participating in the apoptotic process (caspase-1, caspase-3, Fas [CD95], Fas ligand [Fas-L], perforin, granzyme A, Bax, WAF-1, Bcl-2, interleukin-2 [IL-2], IL-18, and granulocyte-macrophage colony-stimulating factor) in tissue in the acute and convalescent stages of dysentery was quantified at the single-cell level by in situ immunostaining. Apoptotic cell death in the lamina propria was markedly up-regulated at the acute stage (P < 0.05), where an increased number of necrotic cells were also seen. Phenotypic analysis of apoptotic cells revealed that 43% of T cells (CD3), 10% of granulocytes (CD15), and 5% of macrophages (CD56) underwent apoptosis. Increased activity of caspase-1 persisted in the rectum up to 1 month after onset. More-extensive expression of Fas, Fas-L, perforin, caspase-3, and IL-18, but not IL-2, at the acute stage than at the convalescent stage was observed. Increased expression of caspase-3 and IL-18 in tissues with severe inflammation compared to expression in those with mild inflammation was evident, implying a possible role in the perpetuation of inflammation. Significantly reduced cell death during convalescence was associated with a significant up-regulation of Bcl-2, Bax, and WAF-1 expression in the rectum compared to that in the acute phase of infection. Thus, induction of apoptosis at the local site in the early phase of S. dysenteriae type 1 infection was associated with a significant up-regulation of Fas/Fas-L and perforin and granzyme A expression and a down-regulation of Bcl-2 and IL-2, which promote cell survival.
Muraki, Michiro; Honda, Shinya
2011-11-01
To achieve an efficient isolation of human Fas receptor extracellular domain (hFasRECD), a fusion protein of hFasRECD with human IgG1 heavy chain Fc domain containing thrombin cleavage sequence at the junction site was overexpressed using baculovirus-silkworm larvae expression system. The hFasRECD part was separated from the fusion protein by the effective cleavage of the recognition site with bovine thrombin. Protein G column treatment of the reaction mixture and the subsequent cation-exchange chromatography provided purified hFasRECD with a final yield of 13.5mg from 25.0 ml silkworm hemolymph. The functional activity of the product was examined by size-exclusion chromatography analysis. The isolated hFasRECD less strongly interacted with human Fas ligand extracellular domain (hFasLECD) than the Fc domain-bridged counterpart, showing the contribution of antibody-like avidity in the latter case. The purified glycosylated hFasRECD presented several discrete bands in the disulphide-bridge non-reducing SDS-PAGE analysis, and virtually all of the components were considered to participate in the binding to hFasLECD. The attached glycans were susceptible to PNGase F digestion, but mostly resistant to Endo Hf digestion under denaturing conditions. One of the components exhibited a higher susceptibility to PNGase F digestion under non-denaturing conditions. Copyright © 2011 Elsevier Inc. All rights reserved.
Mahapatra, Ananya; Gupta, Rishi; Patnaik, Kuppili Pooja; Pattanaik, Raman Deep; Khandelwal, Sudhir Kumar
2017-10-01
Family accommodation (FA) is the phenomenon whereby caregivers assist or facilitate rituals or behaviours related to obsessive compulsive disorder (OCD). There is a need for a self-rated instrument to assess this construct in resource-strained clinical settings of India. To explore the factor structure of Hindi version of Family Accommodation Scale-Self Rated version (FAS-SR) and compare its validity with the gold standard Family Accommodation Scale-Interviewer Rated (FAS-IR) scale. The Hindi version of FAS-SR scale and FAS-IR scale was applied on 105 caregivers of patients with OCD. The initial factor analysis yielded three-factor models with an eigenvalue of >1 and the total variance explained by these factors was 72.017%. The internal consistency of the 19-item scale was 0.93 indicating good inter-item correlation. There was a significant positive correlation between FAS-IR scale total score and all the factors of the FAS-SR Scale. The average measure ICC was 0.889 with a 95% confidence interval from 0.783 to 0.981 (F (62,84)=37.547, p<001) indicating high degree of reliability between the Hindi version of FAS-SR and the FAS-IR scale. FAS-SR is a practical alternative to FAS-IR and has the potential to be used widely in an Indian setting. Copyright © 2017 Elsevier B.V. All rights reserved.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Yan, Yiqing; Jiang, Wei; Spinetti, Thibaud; Tardivel, Aubry; Castillo, Rosa; Bourquin, Carole; Guarda, Greta; Tian, Zhigang; Tschopp, Jurg; Zhou, Rongbin
2013-06-27
Omega-3 fatty acids (ω-3 FAs) have potential anti-inflammatory activity in a variety of inflammatory human diseases, but the mechanisms remain poorly understood. Here we show that stimulation of macrophages with ω-3 FAs, including eicosapentaenoic acid (EPA), docosahexaenoic acid (DHA), and other family members, abolished NLRP3 inflammasome activation and inhibited subsequent caspase-1 activation and IL-1β secretion. In addition, G protein-coupled receptor 120 (GPR120) and GPR40 and their downstream scaffold protein β-arrestin-2 were shown to be involved in inflammasome inhibition induced by ω-3 FAs. Importantly, ω-3 FAs also prevented NLRP3 inflammasome-dependent inflammation and metabolic disorder in a high-fat-diet-induced type 2 diabetes model. Our results reveal a mechanism through which ω-3 FAs repress inflammation and prevent inflammation-driven diseases and suggest the potential clinical use of ω-3 FAs in gout, autoinflammatory syndromes, or other NLRP3 inflammasome-driven inflammatory diseases. Copyright © 2013 Elsevier Inc. All rights reserved.
Increased hepatocyte fas expression and apoptosis in HIV and hepatitis C virus coinfection.
Macias, Juan; Japón, Miguel A; Sáez, Carmen; Palacios, Rosa B; Mira, José A; García-García, José A; Merchante, Nicolás; Vergara, Salvador; Lozano, Fernando; Gómez-Mateos, Jesús; Pineda, Juan A
2005-11-01
Chronic hepatitis C disease (CHC) follows an accelerated course in human immunodeficiency virus (HIV) coinfection. The reasons for this are unclear. Fas-mediated hepatocyte apoptosis is involved in the pathogenesis of hepatitis C virus (HCV) infection. We sought to compare the expression of Fas on hepatocytes and irreversible apoptosis of hepatocytes among patients with CHC with and without HCV/HIV coinfection. Fas-immunostained hepatocytes were semiquantified, and apoptotic hepatocytes were detected by staining caspase-cleaved cytokeratin 18 filaments and counted across the entire section of liver-biopsy specimens from HCV-infected patients with and without HCV/HIV coinfection. One hundred thirty-four HCV/HIV-coinfected and 100 HCV-infected patients were included. HCV/HIV coinfection was associated with both diffuse distribution of Fas-stained hepatocytes (adjusted odds ratio [AOR], 7.4 [95% confidence interval {CI}, 3.8-14.4]) and with apoptotic hepatocyte counts greater than the median (AOR, 2.5 [95% CI, 1.5-4.5]). In HCV/HIV-coinfected patients, CD4+ cell nadir<200 cells/mL was associated with both Fas expression (AOR, 2.9 [95% CI, 1.3-6.8]) and hepatocyte apoptosis (AOR, 2.3 [95% CI, 1.1-4.9]). HCV/HIV-coinfected patients show higher levels of hepatocytes expressing Fas and undergoing irreversible apoptosis than do HCV-infected patients. However, low CD4+ cell nadirs in coinfected patients are associated with hepatocyte Fas expression and apoptosis.
Pawar, Mercy; Busov, Boris; Chandrasekhar, Aaruran; Yao, Jingyu; Zacks, David N; Besirli, Cagri G
2017-10-01
We report the neuroprotective role of FAS apoptotic inhibitory molecule 2 (FAIM2), an inhibitor of the FAS signaling pathway, during stress-induced photoreceptor apoptosis. Retinal detachment resulted in increased FAIM2 levels in photoreceptors with higher amounts detected at the tips of outer segments. Activation of FAS death receptor via FAS-ligand led to JNK-mediated FAIM2 phosphorylation, decreased proteasome-mediated degradation and increased association with the FAS receptor. Photoreceptor apoptosis was accelerated in Faim2 knockout mice following experimental retinal detachment. We show that FAIM2 is primarily involved in reducing stress-induced photoreceptor cell death but this effect was transient. FAIM2 was found to interact with both p53 and HSP90 following the activation of the FAS death pathway and FAIM2/HSP90 interaction was dependent on the phosphorylation of FAIM2. Lack of FAIM2 led to increased expression of proadeath genes Fas and Ripk1 in the retina under physiologic conditions. These results demonstrate that FAIM2 is an intrinsic neuroprotective factor activated by stress in photoreceptors and delays FAS-mediated photoreceptor apoptosis. Modulation of this pathway to increase FAIM2 expression may be a potential therapeutic option to prevent photoreceptor death.
Paschall, Amy V.; Yang, Dafeng; Lu, Chunwan; Choi, Jeong-Hyeon; Li, Xia; Liu, Feiyan; Figueroa, Mario; Oberlies, Nicholas H.; Pearce, Cedric; Bollag, Wendy B.; Nayak-Kapoor, Asha; Liu, Kebin
2015-01-01
The Fas-FasL effector mechanism plays a key role in cancer immune surveillance by host T cells, but metastatic human colon carcinoma often uses silencing Fas expression as a mechanism of immune evasion. The molecular mechanism under FAS transcriptional silencing in human colon carcinoma is unknown. We performed genome-wide ChIP-Sequencing analysis and identified that the FAS promoter is enriched with H3K9me3 in metastatic human colon carcinoma cells. H3K9me3 level in the FAS promoter region is significantly higher in metastatic than in primary cancer cells, and is inversely correlated with Fas expression level. We discovered that verticillin A is a selective inhibitor of histone methyltransferases SUV39H1, SUV39H2 and G9a/GLP that exhibit redundant functions in H3K9 trimethylation and FAS transcriptional silencing. Genome-wide gene expression analysis identified FAS as one of the verticillin A target genes. Verticillin A treatment decreased H3K9me3 level in the FAS promoter and restored Fas expression. Furthermore, verticillin A exhibited greater efficacy than Decitabine and Vorinostat in overcoming colon carcinoma resistance to FasL-induced apoptosis. Verticillin A also increased DR5 expression and overcame colon carcinoma resistance to DR5 agonist drozitumab-induced apoptosis. Interestingly, verticillin A overcame metastatic colon carcinoma resistance to 5-Fluouracil in vitro and in vivo. Using an orthotopic colon cancer mouse model, we demonstrated that tumor-infiltrating cytotoxic T lymphocytes are FasL+ and FasL-mediated cancer immune surveillance is essential for colon carcinoma growth control in vivo. Our findings determine that H3K9me3 of the FAS promoter is a dominant mechanism underlying FAS silencing and resultant colon carcinoma immune evasion and progression. PMID:26136424
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Drosophila fatty acid taste signals through the PLC pathway in sugar-sensing neurons.
Masek, Pavel; Keene, Alex C
2013-01-01
Taste is the primary sensory system for detecting food quality and palatability. Drosophila detects five distinct taste modalities that include sweet, bitter, salt, water, and the taste of carbonation. Of these, sweet-sensing neurons appear to have utility for the detection of nutritionally rich food while bitter-sensing neurons signal toxicity and confer repulsion. Growing evidence in mammals suggests that taste for fatty acids (FAs) signals the presence of dietary lipids and promotes feeding. While flies appear to be attracted to fatty acids, the neural basis for fatty acid detection and attraction are unclear. Here, we demonstrate that a range of FAs are detected by the fly gustatory system and elicit a robust feeding response. Flies lacking olfactory organs respond robustly to FAs, confirming that FA attraction is mediated through the gustatory system. Furthermore, flies detect FAs independent of pH, suggesting the molecular basis for FA taste is not due to acidity. We show that low and medium concentrations of FAs serve as an appetitive signal and they are detected exclusively through the same subset of neurons that sense appetitive sweet substances, including most sugars. In mammals, taste perception of sweet and bitter substances is dependent on phospholipase C (PLC) signaling in specialized taste buds. We find that flies mutant for norpA, a Drosophila ortholog of PLC, fail to respond to FAs. Intriguingly, norpA mutants respond normally to other tastants, including sucrose and yeast. The defect of norpA mutants can be rescued by selectively restoring norpA expression in sweet-sensing neurons, corroborating that FAs signal through sweet-sensing neurons, and suggesting PLC signaling in the gustatory system is specifically involved in FA taste. Taken together, these findings reveal that PLC function in Drosophila sweet-sensing neurons is a conserved molecular signaling pathway that confers attraction to fatty acids.
Chloral Hydrate Treatment Induced Apoptosis of Macrophages via Fas Signaling Pathway.
Cai, Jun; Peng, Yanxia; Chen, Ting; Liao, Huanjin; Zhang, Lifang; Chen, Qiuhua; He, Yiming; Wu, Ping; Xie, Tong; Pan, Qingjun
2016-12-10
BACKGROUND There are recent reports on several anesthetics that have anti-inflammatory and anti-infective effects apart from their uses for pain relief and muscle relaxation. Chloral hydrate is a clinical anesthetic drug and sedative that has also been reported to attenuate inflammatory response, but the mechanisms are not clearly understood. MATERIAL AND METHODS This study investigated the effect of chloral hydrate treatment on the apoptosis of macrophages and explored the underlying mechanisms. RAW264.7 macrophages were treated with various concentrations of chloral hydrate for various lengths of time. Morphological changes were observed under a light microscope and apoptosis was detected with annexin-V-FITC/PI double-staining assay, Hochest 33258 and DNA ladder assay, the expression of Fas/FasL was detected with a flow cytometer, and the Fas signaling pathway was assessed by Western blotting. RESULTS The results showed that chloral hydrate treatment induced the morphology of RAW264.7 macrophages to change shape from typical fusiform to round in a concentration- and time-dependent manner, and was finally suspended in the supernatant. For the induction of apoptosis, chloral hydrate treatment induced the apoptosis of RAW264.7 macrophages from early-to-late stage apoptosis in a concentration- and time-dependent manner. For the mechanism, chloral hydrate treatment induced higher expression of Fas on RAW264.7 macrophages, and was also associated with changes in the expression of proteins involved in Fas signaling pathways. CONCLUSIONS Chloral hydrate treatment can induce the apoptosis of RAW264.7 macrophages through the Fas signaling pathway, which may provide new options for adjunctive treatment of acute inflammation.
Chloral Hydrate Treatment Induced Apoptosis of Macrophages via Fas Signaling Pathway
Cai, Jun; Peng, Yanxia; Chen, Ting; Liao, Huanjin; Zhang, Lifang; Chen, Qiuhua; He, Yiming; Wu, Ping; Xie, Tong; Pan, Qingjun
2016-01-01
Background There are recent reports on several anesthetics that have anti-inflammatory and anti-infective effects apart from their uses for pain relief and muscle relaxation. Chloral hydrate is a clinical anesthetic drug and sedative that has also been reported to attenuate inflammatory response, but the mechanisms are not clearly understood. Material/Methods This study investigated the effect of chloral hydrate treatment on the apoptosis of macrophages and explored the underlying mechanisms. RAW264.7 macrophages were treated with various concentrations of chloral hydrate for various lengths of time. Morphological changes were observed under a light microscope and apoptosis was detected with annexin-V-FITC/PI double-staining assay, Hochest 33258 and DNA ladder assay, the expression of Fas/FasL was detected with a flow cytometer, and the Fas signaling pathway was assessed by Western blotting. Results The results showed that chloral hydrate treatment induced the morphology of RAW264.7 macrophages to change shape from typical fusiform to round in a concentration- and time-dependent manner, and was finally suspended in the supernatant. For the induction of apoptosis, chloral hydrate treatment induced the apoptosis of RAW264.7 macrophages from early-to-late stage apoptosis in a concentration- and time-dependent manner. For the mechanism, chloral hydrate treatment induced higher expression of Fas on RAW264.7 macrophages, and was also associated with changes in the expression of proteins involved in Fas signaling pathways. Conclusions Chloral hydrate treatment can induce the apoptosis of RAW264.7 macrophages through the Fas signaling pathway, which may provide new options for adjunctive treatment of acute inflammation. PMID:27941708
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Changes in membrane lipids drive increased endocytosis following Fas ligation.
Degli Esposti, Mauro; Matarrese, Paola; Tinari, Antonella; Longo, Agostina; Recalchi, Serena; Khosravi-Far, Roya; Malorni, Walter; Misasi, Roberta; Garofalo, Tina; Sorice, Maurizio
2017-05-01
Once activated, some surface receptors promote membrane movements that open new portals of endocytosis, in part to facilitate the internalization of their activated complexes. The prototypic death receptor Fas (CD95/Apo1) promotes a wave of enhanced endocytosis that induces a transient intermixing of endosomes with mitochondria in cells that require mitochondria to amplify death signaling. This initiates a global alteration in membrane traffic that originates from changes in key membrane lipids occurring in the endoplasmic reticulum (ER). We have focused the current study on specific lipid changes occurring early after Fas ligation. We analyzed the interaction between endosomes and mitochondria in Jurkat T cells by nanospray-Time-of-flight (ToF) Mass Spectrometry. Immediately after Fas ligation, we found a transient wave of lipid changes that drives a subpopulation of early endosomes to merge with mitochondria. The earliest event appears to be a decrease of phosphatidylcholine (PC), linked to a metabolic switch enhancing phosphatidylinositol (PI) and phosphoinositides, which are crucial for the formation of vacuolar membranes and endocytosis. Lipid changes occur independently of caspase activation and appear to be exacerbated by caspase inhibition. Conversely, inhibition or compensation of PC deficiency attenuates endocytosis, endosome-mitochondria mixing and the induction of cell death. Deficiency of receptor interacting protein, RIP, also limits the specific changes in membrane lipids that are induced by Fas activation, with parallel reduction of endocytosis. Thus, Fas activation rapidly changes the interconversion of PC and PI, which then drives enhanced endocytosis, thus likely propagating death signaling from the cell surface to mitochondria and other organelles.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
[Plasma fatty acids profile and lipids in Tunisian male elite athletes].
Omar, Souheil; Sethom, Mohamed M; Feki-Mhiri, Sondes; Hadj-Taeib, Sameh; Ben Ayed, Ikram; Feki, Moncef; Kaabachi, Naziha
2010-05-01
Growing interest is accorded to polyunsaturated fatty acids (PUFAs) omega3, which are considered beneficial for health. to investigate the effect of sports on plasma lipids and fatty acids (FAs), especially omega6 and omega3 PUFAs and the omega6/omega3 ratio. The study included 75 Tunisian male elite athletes, practicing team sport and 70 sedentary healthy men as controls. Plasma FAs profile was analyzed by gas chromatography. Comparison between groups was performed using a univariate GLM analysis, with adjustment on age, body mass and energy intake. Athletes showed lower triglycerides and saturated FAs (27.64% +/- 2.17% vs. 30.41% +/- 4.35%) and increased HDL cholesterol and monounsaturated FAs (21.19% +/- 2 44% vs. 19.12% +/- 3.03%). However, there was no significant difference in total PUFAs, omega6 and omega3 families and omega6/omega3 ratio (10.15% +/- 3.24% vs. 10.20% +/- 3.37%) between athletes and sedentary. Sport favorably modifies the profile of plasma FAs by increasing monounsaturated FAs at the expense of saturated FAs, but has no effect on total PUFAs, and omega6 and omega3 families. A diet rich in omega3 PUFAs would lower the omega6/omega3 ratio, in order to improve the health and probably the performance of athletes.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Proteases in Fas-mediated apoptosis.
Zhivotovsky, B; Burgess, D H; Schlegel, J; Pörn, M I; Vanags, D; Orrenius, S
1997-01-01
Involvement of a unique family of cysteine proteases in the multistep apoptotic process has been documented. Cloning of several mammalian genes identifies some components of this cellular response. However, it is currently unclear which protease plays a role as a signal and/or effector of apoptosis. We summarize contributions to the data concerning proteases in Fas-mediated apoptosis.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
LncRNA FAS-AS1 promotes the degradation of extracellular matrix of cartilage in osteoarthritis.
Zhu, J-K; He, T-D; Wei, Z-X; Wang, Y-M
2018-05-01
To investigate the expression of long non-coding RNA (lncRNA) FAS-AS1 in osteoarthritis cartilage and to explore its effect on articular cartilage cells. A total of 20 tissue samples of primary knee joint osteoarthritis and 20 tissue samples of knee joint cartilage after traumatic amputation were collected. Fluorescence quantitative polymerase chain reaction (PCR) was performed to detect the expression of FAS-AS1, MMP1, MMP13, and COL2A1 in cartilage. FAS-AS1 small interfering RNA (siRNA) was transfected to chondrocytes transiently to observe its effects on proliferation, apoptosis of chondrocytes, and the expressions of MMP1, MMP13, and COL2A1. The expressions of FAS-AS1, MMP1, and MMP13 in osteoarthritis tissues increased significantly, while COL2A1 presented a low expression. Reducing the expression of FAS-AS1 inhibited cell apoptosis and promote cell proliferation. Additionally, in vitro experiments showed that low expression of FAS-AS1 decreased the expressions of MMP1 and MMP13, but increased the expression of COL2A1. The expression of FAS-AS1 was increased in osteoarthritis, and FAS-AS1 could be involved in the development of the disease by regulating the proliferation, apoptosis of chondrocytes and promoting the degradation of extracellular matrix.
Chen, Jun; Su, Xian-Shi; Jiang, Yong-Fang; Gong, Guo-Zhong; Zheng, Yu-Huang; Li, Gui-Yuan
2005-01-01
AIM: To evaluate the expression of apoptosis related gene Fas ligand (FasL) in human hepatocellular carcinoma (HCC) cells HepG2 and its significance in apoptosis. METHODS: Levels of soluble Fas ligand (sFasL) in a group of patients with hepatitis B virus (HBV)-induced chronic hepatitis, HBV-positive liver cirrhosis and HCC were evaluated. In a further study, the recombinant eukaryotic expression plasmid pcDNA3.1hisB-FasL was transfected into HCC cells HepG2 by lipofection, and then soluble FasL was examined in the supernatant of culture cells by EIA, FasL expression in HepG2 cells was detected by immuohistochemistry. After being stained by annexin V and propidium iodine, cells were passed through a flow cytometer and examined by a fluorescence microscope and a laser scanning microscope. RESULTS: The sFasL levels were significantly lower in patients with HCC when compared to the patients with hepatitis or liver cirrhosis. In comparison with untransfected cells, the soluble FasL could be detected in the supernatant of transfected cells. FasL was expressed on the membranes and cytoplasm of transfected cells. The apoptotic cell rate was 36.30% in transfected cells, and was 11.53% in untransfected cells. Moreover, the different stage of apoptotic cells could be distinguished by annexin V and propidium iodine staining. CONCLUSION: Fas ligand is an apoptotic pathway of HCC cells. PMID:15849828
Pentadecanoic and Heptadecanoic Acids: Multifaceted Odd-Chain Fatty Acids12
Pfeuffer, Maria; Jaudszus, Anke
2016-01-01
The odd-chain fatty acids (OCFAs) pentadecanoic acid (15:0) and heptadecanoic acid (17:0), which account for only a small proportion of total saturated fatty acids in milk fat and ruminant meat, are accepted biomarkers of dairy fat intake. However, they can also be synthesized endogenously, for example, from gut-derived propionic acid (3:0). A number of studies have shown an inverse association between OCFA concentrations in human plasma phospholipids or RBCs and risk of type 2 diabetes and cardiovascular disease. We propose a possible involvement in metabolic regulation from the assumption that there is a link between 15:0 and 17:0 and the metabolism of other short-chain, medium-chain, and longer-chain OCFAs. The OCFAs 15:0 and 17:0 can be elongated to very-long-chain FAs (VLCFAs) such as tricosanoic acid (23:0) and pentacosanoic acid (25:0) in glycosphingolipids, particularly found in brain tissue, or can be derived from these VLCFAs. Their chains can be shortened, yielding propionyl-coenzyme A (CoA). Propionyl-CoA, by succinyl-CoA, can replenish the citric acid cycle (CAC) with anaplerotic intermediates and, thus, improve mitochondrial energy metabolism. Mitochondrial function is compromised in a number of disorders and may be impaired with increasing age. Optimizing anaplerotic intermediate availability for the CAC may help to cope with demands in times of increased metabolic stress and with aging. OCFAs may serve as substrates for synthesis of both odd-numbered VLCFAs and propionyl-CoA or store away excess propionic acid. PMID:27422507
Crystal Structure of the Complex of Human FasL and Its Decoy Receptor DcR3.
Liu, Weifeng; Ramagopal, Udupi; Cheng, Huiyong; Bonanno, Jeffrey B; Toro, Rafael; Bhosle, Rahul; Zhan, Chenyang; Almo, Steven C
2016-11-01
The apoptotic effect of FasL:Fas signaling is disrupted by DcR3, a unique secreted member of the tumor necrosis factor receptor superfamily, which also binds and neutralizes TL1A and LIGHT. DcR3 is highly elevated in patients with various tumors and contributes to mechanisms by which tumor cells to evade host immune surveillance. Here we report the crystal structure of FasL in complex with DcR3. Comparison of FasL:DcR3 structure with our earlier TL1A:DcR3 and LIGHT:DcR3 structures supports a paradigm involving the recognition of invariant main-chain and conserved side-chain functionalities, which is responsible for the recognition of multiple TNF ligands exhibited by DcR3. The FasL:DcR3 structure also provides insight into the FasL:Fas recognition surface. We demonstrate that the ability of recombinant FasL to induce Jurkat cell apoptosis is significantly enhanced by native glycosylation or by structure-inspired mutations, both of which result in reduced tendency to aggregate. All of these activities are efficiently inhibited by recombinant DcR3. Copyright © 2016 Elsevier Ltd. All rights reserved.
Adipocyte fatty acid binding protein 4 (FABP4) inhibitors. A comprehensive systematic review.
Floresta, Giuseppe; Pistarà, Venerando; Amata, Emanuele; Dichiara, Maria; Marrazzo, Agostino; Prezzavento, Orazio; Rescifina, Antonio
2017-09-29
Small molecule inhibitors of adipocyte fatty acid binding protein 4 (FABP4) have attracted interest following the recent publications of beneficial pharmacological effects of these compounds. FABP4 is predominantly expressed in macrophages and adipose tissue where it regulates fatty acids (FAs) storage and lipolysis and is an important mediator of inflammation. In the past years, hundreds FABP4 inhibitors have been synthesized for effective atherosclerosis and diabetes treatments, including derivatives of niacin, quinoxaline, aryl-quinoline, bicyclic pyridine, urea, aromatic compounds and other novel heterocyclic compounds. This review provides an overview of the synthesized and discovered molecules as adipocyte fatty acid binding protein 4 inhibitors (FABP4is) since the synthesis of the putative FABP4i, BMS309403, highlighting the interactions of the different classes of inhibitors with the targets. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Nath, Shalini; Mandal, Chhabinath; Chatterjee, Uttara; Mandal, Chitra
2018-02-12
Modulation of sialylation by sialyltransferases and sialidases plays essential role in carcinogenesis. There are few reports on sialyltransferase, however, the contribution of cytosolic sialidase (Neu2) remains unexplored in pancreatic ductal adenocarcinoma (PDAC). We observed lower expression of Neu2 in different PDAC cells, patient tissues, and a significant strong association with clinicopathological characteristics. Neu2 overexpression guided drug-resistant MIAPaCa2 and AsPC1 cells toward apoptosis as evidenced by decreased Bcl2/Bax ratio, activation of caspase-3/caspase-6/caspase-8, PARP reduction, reduced CDK2/CDK4/CDK6, and cyclin-B1/cyclin-E with unaffected caspase-9. Neu2-overexpressed cells exhibited higher expression of Fas/CD95-death receptor, FasL, FADD, and Bid cleavage confirming extrinsic pathway-mediated apoptosis. α2,6-linked sialylation of Fas helps cancer cells to survive, which is a substrate for Neu2. Therefore, their removal should enhance Fas-mediated apoptosis. Neu2-overexpressed cells indeed showed increased enzyme activity even on membrane. Interestingly, this membrane-bound Neu2 exhibited enhanced association with Fas causing its desialylation and activation as corroborated by decreased association of Fas with α2,6-sialic acid-binding lectin. Additionally, enhanced cytosolic Neu2 inhibited the expression of several growth factor-mediated signaling molecules involved in PI3K/Akt-mTOR pathway probably through desialylation which in turn also causes Fas activation. Furthermore, Neu2-overexpressed cells exhibited reduced cell migration, invasion with decreased VEGF, VEGFR, and MMP9 levels. To the best of our knowledge, this is the first report of cytosolic Neu2 on membrane, its association with Fas, enhanced desialylation, activation, and Fas-mediated apoptosis. Taken together, our study ascertains a novel concept by which the function of Fas/CD95 could be modulated indicating a critical role of upstream Neu2 as a promising target for
Adachi, Keiko; Osaki, Mitsuhiko; Kase, Satoru; Takeda, Ami; Ito, Hisao
2003-09-01
The Fas-Fas ligand system is one of the factors involved in cell death signaling. Aberrations in the signaling pathways leading to Fas-mediated apoptosis in tumor cells have been reported in a variety of human malignant tumors. However, the Fas-mediated apoptotic pathway has not been sufficiently elucidated in human gastric carcinomas. We examined the apoptotic pathway induced by anti-Fas antibody using seven human gastric carcinoma cell lines. Apoptosis was induced in a delayed fashion and the apoptotic indices (AI) after 48 h were approximately 30-40% in MKN-45 and KATO-III cells, which both showed cleavage of the Bid protein and release of Cytochrome c from the mitochondria. Our data also demonstrated no significant relationship between the expressions of various apoptosis-related proteins and the sensitivity or resistance to anti-Fas antibody-induced apoptosis, as far as we examined. Furthermore, the apoptosis signal was inhibited by treatment with Caspase-9 and -3 inhibitors in MKN-45 and KATO-III. These findings suggest that anti-Fas antibody induced apoptosis through the type II signaling pathway in the human gastric carcinoma cell lines, MKN-45 and KATO-III.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Jarc, Eva; Kump, Ana; Malavašič, Petra; Eichmann, Thomas O; Zimmermann, Robert; Petan, Toni
2018-03-01
Cancer cells driven by the Ras oncogene scavenge unsaturated fatty acids (FAs) from their environment to counter nutrient stress. The human group X secreted phospholipase A 2 (hGX sPLA 2 ) releases FAs from membrane phospholipids, stimulates lipid droplet (LD) biogenesis in Ras-driven triple-negative breast cancer (TNBC) cells and enables their survival during starvation. Here we examined the role of LDs, induced by hGX sPLA 2 and unsaturated FAs, in protection of TNBC cells against nutrient stress. We found that hGX sPLA 2 releases a mixture of unsaturated FAs, including ω-3 and ω-6 polyunsaturated FAs (PUFAs), from TNBC cells. Starvation-induced breakdown of LDs induced by low micromolar concentrations of unsaturated FAs, including PUFAs, was associated with protection from cell death. Interestingly, adipose triglyceride lipase (ATGL) contributed to LD breakdown during starvation, but it was not required for the pro-survival effects of hGX sPLA 2 and unsaturated FAs. High micromolar concentrations of PUFAs, but not OA, induced oxidative stress-dependent cell death in TNBC cells. Inhibition of triacylglycerol (TAG) synthesis suppressed LD biogenesis and potentiated PUFA-induced cell damage. On the contrary, stimulation of LD biogenesis by hGX sPLA 2 and suppression of LD breakdown by ATGL depletion reduced PUFA-induced oxidative stress and cell death. Finally, lipidomic analyses revealed that sequestration of PUFAs in LDs by sPLA 2 -induced TAG remodelling and retention of PUFAs in LDs by inhibition of ATGL-mediated TAG lipolysis protect from PUFA lipotoxicity. LDs are thus antioxidant and pro-survival organelles that guard TNBC cells against nutrient and lipotoxic stress and emerge as attractive targets for novel therapeutic interventions. Copyright © 2017 Elsevier B.V. All rights reserved.
Raqib, Rubhana; Ekberg, Caroline; Sharkar, Protim; Bardhan, Pradip K.; Zychlinsky, Arturo; Sansonetti, Philippe J.; Andersson, Jan
2002-01-01
Shigella dysenteriae type 1-induced apoptotic cell death in rectal tissues from patients infected with Shigella dysenteriae type 1 was studied by the terminal deoxynucleotidyltransferase-mediated dUTP-biotin nick end labeling (TUNEL) technique and annexin V staining. Expression of proteins and cytokines participating in the apoptotic process (caspase-1, caspase-3, Fas [CD95], Fas ligand [Fas-L], perforin, granzyme A, Bax, WAF-1, Bcl-2, interleukin-2 [IL-2], IL-18, and granulocyte-macrophage colony-stimulating factor) in tissue in the acute and convalescent stages of dysentery was quantified at the single-cell level by in situ immunostaining. Apoptotic cell death in the lamina propria was markedly up-regulated at the acute stage (P < 0.05), where an increased number of necrotic cells were also seen. Phenotypic analysis of apoptotic cells revealed that 43% of T cells (CD3), 10% of granulocytes (CD15), and 5% of macrophages (CD56) underwent apoptosis. Increased activity of caspase-1 persisted in the rectum up to 1 month after onset. More-extensive expression of Fas, Fas-L, perforin, caspase-3, and IL-18, but not IL-2, at the acute stage than at the convalescent stage was observed. Increased expression of caspase-3 and IL-18 in tissues with severe inflammation compared to expression in those with mild inflammation was evident, implying a possible role in the perpetuation of inflammation. Significantly reduced cell death during convalescence was associated with a significant up-regulation of Bcl-2, Bax, and WAF-1 expression in the rectum compared to that in the acute phase of infection. Thus, induction of apoptosis at the local site in the early phase of S. dysenteriae type 1 infection was associated with a significant up-regulation of Fas/Fas-L and perforin and granzyme A expression and a down-regulation of Bcl-2 and IL-2, which promote cell survival. PMID:12011015
Sekikawa, Akira; Shin, Chol; Masaki, Kamal H; Barinas-Mitchell, Emma J M; Hirooka, Nobutaka; Willcox, Bradley J; Choo, Jina; White, Jessica; Evans, Rhobert W; Fujiyoshi, Akira; Okamura, Tomonori; Miura, Katsuyuki; Muldoon, Matthew F; Ueshima, Hirotsugu; Kuller, Lewis H; Sutton-Tyrrell, Kim
2013-11-01
Few previous studies have reported the association of aortic stiffness with marine n-3 fatty acids (Fas) in the general population. The aim of this study was to determine the combined and independent associations of 2 major marine n-3 FAs, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), with aortic stiffness evaluated using carotid-femoral pulse wave velocity (cfPWV) in Korean, white, and Japanese American men. A population-based sample of 851 middle-aged men (299 Koreans, 266 whites, and 286 Japanese Americans) was examined for cfPWV during 2002-2006. Serum FAs, including EPA and DHA, were measured as a percentage of total FAs using gas chromatography. Multiple regression analysis was used to examine the association of EPA and DHA with cfPWV after adjusting for blood pressure and other confounders. Mean EPA and DHA levels were 1.9 (SD = 1.0) and 4.8 (SD = 1.4) for Koreans, 0.8 (SD = 0.6) and 2.4 (SD = 1.2) for whites, and 1.0 (SD = 1.0) and 3.2 (SD = 1.4) for Japanese Americans. Both EPA and DHA were significantly higher in Koreans than in the other 2 groups (P < 0.01). Multiple regression analyses in Koreans showed that cfPWV had a significant inverse association with total marine n-3 FAs and with EPA alone after adjusting for blood pressure and other potential confounders. In contrast, there was no significant association of cfPWV with DHA. Whites and Japanese Americans did not show any significant associations of cfPWV with total marine n-3 FAs, EPA, or DHA. High levels of EPA observed in Koreans have an inverse association with aortic stiffness. © American Journal of Hypertension, Ltd 2013. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
2013-01-01
BACKGROUND Few previous studies have reported the association of aortic stiffness with marine n-3 fatty acids (Fas) in the general population. The aim of this study was to determine the combined and independent associations of 2 major marine n-3 FAs, eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA), with aortic stiffness evaluated using carotid–femoral pulse wave velocity (cfPWV) in Korean, white, and Japanese American men. METHODS A population-based sample of 851 middle-aged men (299 Koreans, 266 whites, and 286 Japanese Americans) was examined for cfPWV during 2002–2006. Serum FAs, including EPA and DHA, were measured as a percentage of total FAs using gas chromatography. Multiple regression analysis was used to examine the association of EPA and DHA with cfPWV after adjusting for blood pressure and other confounders. RESULTS Mean EPA and DHA levels were 1.9 (SD = 1.0) and 4.8 (SD = 1.4) for Koreans, 0.8 (SD = 0.6) and 2.4 (SD = 1.2) for whites, and 1.0 (SD = 1.0) and 3.2 (SD = 1.4) for Japanese Americans. Both EPA and DHA were significantly higher in Koreans than in the other 2 groups (P < 0.01). Multiple regression analyses in Koreans showed that cfPWV had a significant inverse association with total marine n-3 FAs and with EPA alone after adjusting for blood pressure and other potential confounders. In contrast, there was no significant association of cfPWV with DHA. Whites and Japanese Americans did not show any significant associations of cfPWV with total marine n-3 FAs, EPA, or DHA. CONCLUSIONS High levels of EPA observed in Koreans have an inverse association with aortic stiffness. PMID:23820020
Single-Nucleotide Polymorphisms of FAS and FASL Genes and Risk of Idiopathic Aplastic Anemia.
Rehman, Sadia; Saba, Nusrat; Naz, Madiha; Ahmed, Parvez; Munir, Saeeda; Sajjad, Sumaira; Tabassum, Sobia; Naseem, Lubna
2018-04-03
FAS/FASL signaling system plays a vital role in the regulation of apoptosis, envisaged as a death process required for immune surveillance to prevent autoimmunity and tumorigenesis along with several other biological activities. Several single-nucleotide polymorphisms (SNPs) of FAS/FASL system can result in aberrant apoptosis, which can cause different cancers and autoimmune diseases. Aplastic anemia (AA) is an autoimmune dysfunction characterized by peripheral blood pancytopenia associated with hypoplasia of bone marrow. The aim of this study was to screen Pakistani AA patients and controls for two Fas SNPs rs2234767 and rs1800682 and two FASLG SNPs rs763110 and rs5030772. Genotyping of 392 DNA samples was done by Tetra-ARMS polymerase chain reaction. Genotypic frequencies of Fas rs1800682 and FASLG rs5030772 showed significance difference in their distribution in both controls and patients, while Fas rs2234767 and FASLG rs763110 SNPs had no such difference. Carriers of rs1800682 AG+GG had a very odd ratio of 4.63, with 95% confidence interval (CI) of 3.01-7.11, while individuals with FASLG rs5030772 AG+GG were more common in controls than patients with OR 0.53 and 95% CI of 0.34-0.83. Cumulative effects of these SNPs were analyzed, and they showed almost similar trends; however, Fas rs2234767 and FASLG rs763110 genotypes in combination with Fas rs1800682 and FASLG rs5030772 demonstrated significant association. This study provided information that endorsed the involvement of FAS/FASL system SNPs in the pathogenesis of AA; further studies should be designed to understand the exact role of SNPs that can help in early diagnosis and treatment.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Circulating levels of FAS/APO-1 in patients with the systemic inflammatory response syndrome.
Torre, Donato; Tambini, Roberto; Manfredi, Mariangela; Mangani, Valerio; Livi, Paola; Maldifassi, Viviana; Campi, Paolo; Speranza, Filippo
2003-04-01
Resolution of inflammation/infection involves removal of neutrophils and other inflammatory cells by the induction of apoptosis. Fas/Apo-1 is a widely occurring apoptotic signal receptor molecule expressed by almost any type of cell, which is also released in a soluble circulating form. In this study we investigated the role of circulating Fas/Apo-1 in patients with systemic inflammatory response syndrome (SIRS). We evaluated 57 critically ill patients, 34 with infectious SIRS (sepsis and septic shock), and 23 patients with noninfectious SIRS. Circulating Fas/Apo-1 was determined by a commercially available immunoassay. Our results clearly show that levels of Fas/Apo-1 were significantly elevated in patients with infectious and noninfectious SIRS (10.4 +/- 8.1 pg/mL, controls: 5.0 +/- 0.7 pg/mL; p < 0.0001). In addition, Fas/Apo-1 levels were not able in predicting in predicting poor outcome of patients with SIRS. In conclusion, these results show that increased levels of Fas/Apo-1 from patients with SIRS is a mechanism which contribute to inflammatory response through accumulation of neutrophils at sites of inflammation/infection.
Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.
2013-01-01
Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease. PMID:24161390
NASA Astrophysics Data System (ADS)
Tyagi, P.
2014-12-01
To better understand the long-range atmospheric transport of microbial aerosols from Southeast Asia to the western North Pacific, marine aerosols were collected at a remote Island, Chichi-Jima on a biweekly basis during 1990-1993. These samples were investigated for the atmospheric abundances of hydroxy fatty acids (OH FAs). β-OH FAs are the major structural components of endotoxins in the outer membrane of Gram-negative bacteria (GNB) whereas w-OH FAs are present in cell walls of higher plants. Thus, we tested the applicability of the β-OH FAs (C10-C18) and ω-OH FAs (C16-C26) to assess the Gram-negative bacteria (GNB) and contribution of terrestrial higher plants, respectively. The average concentrations of β- and ω-OH FAs show pronounced seasonal variability with spring maximum (~301 ng/m-3 and ~ 272 ng/m-3, respectively). The concentrations of total OH FAs increased in winter/spring and decreased in summer/autumn, except for 1992-93. This seasonal trend can be interpreted by the atmospheric transport of microbial soil dust and higher plant metabolites from the Asian continent during winter/spring, when westerly winds dominate over the western North Pacific. The even carbon predominance of β- and ω-OH FAs (80 and 74 % of total) in marine aerosols could be explained by their significant contribution from GNB and terrestrial higher plants. These results have implications towards assessing the bacterial transport in the continental outflows. This study also confirms that β-OH FAs can be used as bacterial tracers in ambient aerosol samples.Keywords: β- and ω-hydroxy fatty acids, terrestrial biomarkers, marine aerosols, GC-MS
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Caulfield, Adam J.; Walker, Margaret E.; Gielda, Lindsay M.; Lathem, Wyndham W.
2014-01-01
SUMMARY Pneumonic plague is a deadly respiratory disease caused by Yersinia pestis. The bacterial protease Pla contributes to disease progression and manipulation of host immunity, but the mechanisms by which this occurs are largely unknown. Here we show that Pla degrades the apoptotic signaling molecule Fas ligand (FasL) to prevent host cell apoptosis and inflammation. Wild-type Y. pestis, but not a Pla mutant (Δpla), degrades FasL, which results in decreased downstream caspase-3/7 activation and reduced apoptosis. Similarly, lungs of mice challenged with wild-type Y. pestis show reduced levels of FasL and activated caspase-3/7 compared to Δpla infection. Consistent with a role for FasL in regulating immune responses, Δpla infection results in aberrant pro-inflammatory cytokine levels. The loss of FasL or inhibition of caspase activity alters host inflammatory responses and enables enhanced Y. pestis outgrowth in the lungs. Thus, by degrading FasL, Y. pestis manipulates host cell death pathways to facilitate infection. PMID:24721571
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Ikomey, G; Assoumou, M-C Okomo; Atashili, J; Mesembe, M; Mukwele, B; Lyonga, E; Eyoh, A; Kafando, A; Ndumbe, P M
2016-09-01
Difficulties in systematically monitoring HIV viral load in resource-limited settings prompt the search for alternate approaches. The authors aimed at assessing the correlation between the plasma levels of soluble forms of Fas receptors (Fas) and Fas ligands (FasL) with standard indicators of HIV disease progression in children. Twenty-two HIV-1-positive children were enrolled in Yaounde. CD4 counts, CD4% counts, plasma levels of Fas, FasL, and HIV-1 RNA levels were assayed. The correlation coefficients (P values) between FasL levels and each of HIV-1 viral load, CD4 counts, and CD4% were, respectively, .56 (.01), -.29 (.18), and .30 (.18). On the other hand, the respective correlation coefficients (P values) with Fas levels were .12 (.60), -.30 (.18), and -.29 (.19). The significant correlation between levels of HIV-1 viral load and FasL suggests that the latter needs to be further studied as a potential biomarker to monitor HIV-1 disease progression in children in resource-limited setting. © The Author(s) 2013.
Yokota, Aya; Takeuchi, Emiko; Iizuka, Misao; Ikegami, Yuko; Takayama, Hajime; Shinohara, Nobukata
2005-01-01
Using a panel of transfectant B lymphoma cells expressing varying amounts of the mutant Fas together with the endogenous wild type Fas, semi-quantitative studies on the dominant negative effect of a murine mutant Fas molecule lacking death domain were carried out. In anti-Fas antibody-mediated induction of apoptosis, the mutant molecules exerted significant dominant-negative effect only when their expression level was comparable to or higher than that of wild type molecules, or when exposed to low amounts of the antibody. The inhibitory effect was accompanied by the failure in DISC formation in spite of Fas aggregation. When they were subjected to T cell-mediated Fas-based induction of apoptosis, however, the dominant negative effect was prominent such that the expression of even a small amount of the mutant molecules resulted in significant inhibition. Such a strong inhibitory effect explains the dominant phenotype of this type of mutant Fas molecules in ALPS heterozygous patients and also implies that the physiological effectors for Fas in vivo are cells, i.e., FasL-expressing activated T cells.
Martins, Fabiane Ferreira; Bargut, Thereza Cristina Lonzetti; Aguila, Marcia Barbosa; Mandarim-de-Lacerda, Carlos Alberto
2017-03-01
Brown adipose tissue (BAT) is specialized in heat production, but its metabolism in ob/ob mice is still a matter of debate. We aimed to verify ob/ob mice BAT using C57Bl/6 male mice (as the wild-type, WT) and leptin-deficient ob/ob mice (on the C57Bl/6 background strain), at three months of age (n=10/group). At euthanasia, animals had their interscapular BAT weighed, and prepared for analysis (Western blot, and RT-qPCR). In comparison with the WT group, the ob/ob group showed reduced thermogenic signaling markers (gene expression of beta 3-adrenergic receptor, beta3-AR; PPARgamma coactivator 1 alpha, PGC1alpha, and uncoupling protein 1, UCP1). The ob/ob group also showed impaired gene expression for lipid utilization (perilipin was increased, while other markers were diminished: carnitine palmitoyltransferase-1b, CPT-1b; cluster of differentiation 36, CD36; fatty acid binding protein 4, FABP4; fatty acid synthase, FAS, and sterol regulatory element-binding protein 1c, SREBP1c), and altered protein expression of insulin signaling (diminished pAKT, TC10, and GLUT-4). Lastly, the ob/ob group showed increased gene expression of markers of inflammation (interleukin 1 beta, IL-1beta; IL-6, tumor necrosis factor alpha, TNFalpha; and monocyte chemotactic protein-1, MCP-1). In conclusion, the ob/ob mice have decreased thermogenic markers associated with reduced gene expression related to fatty acid synthesis, mobilization, and oxidation. There were also alterations in insulin signaling and protein and gene expressions of inflammation. The findings suggest that the lack of substrate for thermogenesis and the local inflammation negatively regulated thermogenic signaling in the ob/ob mice. Copyright © 2016 Elsevier GmbH. All rights reserved.
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
Rigouin, Coraline; Gueroult, Marc; Croux, Christian; Dubois, Gwendoline; Borsenberger, Vinciane; Barbe, Sophie; Marty, Alain; Daboussi, Fayza; André, Isabelle; Bordes, Florence
2017-10-20
Yarrowia lipolytica is a promising organism for the production of lipids of biotechnological interest and particularly for biofuel. In this study, we engineered the key enzyme involved in lipid biosynthesis, the giant multifunctional fatty acid synthase (FAS), to shorten chain length of the synthesized fatty acids. Taking as starting point that the ketoacyl synthase (KS) domain of Yarrowia lipolytica FAS is directly involved in chain length specificity, we used molecular modeling to investigate molecular recognition of palmitic acid (C16 fatty acid) by the KS. This enabled to point out the key role of an isoleucine residue, I1220, from the fatty acid binding site, which could be targeted by mutagenesis. To address this challenge, TALEN (transcription activator-like effector nucleases)-based genome editing technology was applied for the first time to Yarrowia lipolytica and proved to be very efficient for inducing targeted genome modifications. Among the generated FAS mutants, those having a bulky aromatic amino acid residue in place of the native isoleucine at position 1220 led to a significant increase of myristic acid (C14) production compared to parental wild-type KS. Particularly, the best performing mutant, I1220W, accumulates C14 at a level of 11.6% total fatty acids. Overall, this work illustrates how a combination of molecular modeling and genome-editing technology can offer novel opportunities to rationally engineer complex systems for synthetic biology.
Enantioselectivity of anteiso-fatty acids in hitherto uninspected sample matrices.
Eibler, Dorothee; Seyfried, Carolin; Vetter, Walter
2017-09-01
Anteiso-fatty acids (aFAs) are chiral molecules due to a methyl substituent on the antepenultimate carbon of the otherwise straight acyl chain. 12-Methyltetradecanoic acid (a15:0) and 14-methylhexadecanoic acid (a17:0) are the predominant aFAs in nature but their individual contributions e.g. to food lipids are usually low. Enantioselective data has been collected in fish, bovine milk/cheese, and Brussels sprouts. In this study, we determined the enantioselectivity of a15:0 and a17:0 in shea butter, moose and camel milk, two soil samples and mold (collected from contaminated cheese). For this purpose, sample lipids were extracted and containing fatty acids were converted into methyl esters. Methyl esters of aFAs were selectively enriched by hydrogenation, urea complexation and/or RP-HPLC-fractionation. Enantioselective gas chromatography with mass spectrometry operated in the selected ion monitoring mode using a chiral stationary phase consisting of 66% tert.-butyldimethylsilylated β-cyclodextrin in OV-1701. While a15:0 and a17:0 in moose milk were (S)-enantiopure, all other determined samples contained up to 10% (R)-aFAs. The highest proportions of (R)-enantiomers were detected in the soil samples (ee=80%). Copyright © 2017 Elsevier B.V. All rights reserved.
Enzymatic synthesis of structured lipids.
Iwasaki, Yugo; Yamane, Tsuneo
2004-01-01
Structured lipids (SLs) are defined as lipids that are modified chemically or enzymatically in order to change their structure. This review deals with structured triacylglycerols (STGs) and structured phospholipids (SPLs). The most typical STGs are MLM-type STGs, having medium chain fatty acids (FAs) at the 1- and 3-positions and a long chain fatty acid at the 2- position. MLM-type STGs are synthesized by: 1) 1,3-position-specific lipase-catalyzed acyl exchange of TG with FA or with FA ethylester (FAEt); 2) 1,3-position-specific lipase-catalyzed acylation of glycerol with FA, giving symmetric 1,3-diacyl-sn-glycerol, followed by chemical acylation at the sn-2 position, and; 3) 1,3-position-specific lipase-catalyzed deacylation of TG, giving 2-monoacylglycerol, followed by reacylation at the 1- and 3-positions with FA or with (FAEt). Enzymatic preparation of SPLs requires: 1) acyl group modification, and 2) head group modification of phospholipids. Acyl group modification is performed using lipases or phospholipase A2-mediated transesterification or ester synthesis to introduce arbitrary fatty acid to phospholipids. Head group modification is carried out by phospholipase D-catalyzed transphosphatidylation. A wide range of compounds can be introduced into the polar head of phospholipids, making it possible to prepare various SPLs.
Effective Teaching for FAS & FAE Children.
ERIC Educational Resources Information Center
Root, Pam
This paper discusses the importance of teaching social skills to children with Fetal Alcohol Syndrome (FAS) or Fetal Alcohol Effect (FAE) and the interrelationship between social skills and academic improvement. Goals and techniques for teaching social skills are identified, including: (1) improving the skill of compliance by setting reasonable…
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Lin, Jiajing; Zeng, Dingyuan; He, Hongying; Tan, Guangping; Lan, Ying; Jiang, Fuyan; Sheng, Shuting
2017-10-01
Low tissue specificity and efficiency of exogenous gene expression are the two major obstacles in tumor‑targeted gene therapy. The Fas cell surface death receptor (Fas)/Fas ligand pathway is one of the primary pathways responsible for the regulation of cell apoptosis. The aim of the present study was to explore whether the regulation of tumor specific promoters and a two‑step transcriptional amplification system (TSTA) assured efficient, targeted expression of their downstream Fas gene in human ovarian cancer cells, and to assess the killing effect of γδT cells on these cells with high Fas expression. Three shuttle plasmids containing different control elements of the human telomerase reverse transcriptase (hTERT) promoter and/or TSTA were constructed and packaged into adenovirus 5 (Ad5) vectors for the expression of exogenous Fas gene. The human ovarian cancer cell line SKOV3 and a control human embryonic lung fibroblast cell line were transfected with Ad5‑hTERT‑Fas or Ad5‑hTERT‑TSTA‑Fas. Fas mRNA and protein expression were examined by reverse transcription‑quantitative polymerase chain reaction and western blot analysis. γδT lymphocytes were isolated, cultured and mixed at different ratios with SKOV3 cells with Fas expression in order to assess the killing effect of γδT cells. hTERT promoter induced the specific expression of FAS gene in SKOV3 cells, and the TSTA strategy increased FAS expression by 14.2‑fold. The killing effect of γδT cells increased with the expression level of Fas and the effector‑target cell ratio. The killing rate for SKOV3 cells with high FAS expression was 72.5% at an effector‑target cell ratio of 40:1. The regulators of hTERT promoter and TSTA assure the efficient and targeted expression of their downstream Fas gene in SKOV3 cells. The killing effect of γδT cells for ovarian cancer cells with relatively high Fas expression was improved.
Gilbert, Stéphane; Loranger, Anne; Omary, M. Bishr
2016-01-01
ABSTRACT Keratins are epithelial cell intermediate filament (IF) proteins that are expressed as pairs in a cell-differentiation-regulated manner. Hepatocytes express the keratin 8 and 18 pair (denoted K8/K18) of IFs, and a loss of K8 or K18, as in K8-null mice, leads to degradation of the keratin partner. We have previously reported that a K8/K18 loss in hepatocytes leads to altered cell surface lipid raft distribution and more efficient Fas receptor (FasR, also known as TNFRSF6)-mediated apoptosis. We demonstrate here that the absence of K8 or transgenic expression of the K8 G62C mutant in mouse hepatocytes reduces lipid raft size. Mechanistically, we find that the lipid raft size is dependent on acid sphingomyelinase (ASMase, also known as SMPD1) enzyme activity, which is reduced in absence of K8/K18. Notably, the reduction of ASMase activity appears to be caused by a less efficient redistribution of surface membrane PKCδ toward lysosomes. Moreover, we delineate the lipid raft volume range that is required for an optimal FasR-mediated apoptosis. Hence, K8/K18-dependent PKCδ- and ASMase-mediated modulation of lipid raft size can explain the more prominent FasR-mediated signaling resulting from K8/K18 loss. The fine-tuning of ASMase-mediated regulation of lipid rafts might provide a therapeutic target for death-receptor-related liver diseases. PMID:27422101
Smyth, Mark J.; Krasovskis, Erika; Johnstone, Ricky W.
1998-01-01
Mouse cytotoxic T lymphocytes (CTL) reactive with a H-2Db-presented 9-mer peptide of the human papillomavirus type 16 protein E749-57 (RAHYNIVTF) were generated from the spleen cells of wild-type C57BL/6 (B6) or B6 perforin-deficient (B6.P0) mice. CD8+ B6 CTL displayed peptide-specific perforin- and Fas-mediated lysis of E7-transfected mouse RMA lymphoma cells (RMA-E7), while CD8+ CTL from B6.P0 mice lysed RMA-E7 cells via Fas ligand (FasL) exclusively. Rapid and efficient lysis of syngeneic bystander B6 blasts or RMA cells by either B6 or B6.P0 Ag-activated CTL was mediated by a FasL-Fas mechanism. Fas-resistant bystanders were not lysed, nor were allogeneic Fas-sensitive C3H/HeJ (H-2k) or BALB/c (H-2d) bystander blasts. Interestingly, however, phorbol myristate acetate-ionomycin preactivation of B6.P0 effectors enabled lysis of allogeneic H-2k and H-2d bystanders even in the absence of antigenic stimulation. Lysis of syngeneic bystander cells was always FasL-Fas dependent and required effector-bystander contact and, in particular, an interaction between CTL LFA-1 and bystander ICAM-1. Thus, in the context of major histocompatibility complex class I molecule-peptide ligation of the T-cell receptors of CD8+ CTL, neighboring bystander cells that are syngeneic and Fas sensitive and express the adhesion molecule ICAM-1 are potential targets of CTL attack. PMID:9621057
Serum concentrations of fatty acids and colorectal adenoma risk: a case-control study in Japan.
Ghadimi, Reza; Kuriki, Kiyonori; Tsuge, Shinji; Takeda, Emiru; Imaeda, Nahomi; Suzuki, Sadao; Sawai, Asuka; Takekuma, Kiyoshi; Hosono, Akihiro; Tokudome, Yuko; Goto, Chiho; Esfandiary, Imaneh; Nomura, Hisashi; Tokudome, Shinkan
2008-01-01
Epidemiologic studies of n-3 fatty acids (FAs) and risk of colorectal cancer have generated inconsistent results, and relations with precursor colorectal adenomas (CRA) have not been evaluated in detail. We here focused on possible associations of serum FAs with CRA in the Japanese population. We conducted a case-control study of 203 asymptomatic CRA cases (148 men, 55 women) and 179 healthy controls (67 men, 112 women) during 1997-2003 in Nagoya, Japan. Baseline information was obtained using a lifestyle questionnaire and serum FA levels were measured by gas chromatography. A non-significant inverse association with CRA was observed for eicosapentaenoic acid (EPA) among women. Moreover, the concentrations of docosahexaenoeic acid (DHA), a major component of n-3 highly-unsaturated FAs (HUFAs), were significantly lower in cases in both sexes. In addition, serum concentrations of total FAs, saturated FAs (SFAs) and mono-unsaturated FAs (MUFAs) had strong positive links with CRA risk. In contrast, arachidonic acid (AA) and DHA were inversely related, with 66% and 59% risk reduction, respectively. Ratios of SFAs/n-3 PUFAs and SFAs/n-3 HUFAs exhibited significant positive relations with CRA risk but there was no clear link with n-6 PUFAs/n-3 PUFAs. Our findings suggest a promoting influence of SFAs and MUFAs along with a protective effect of DHA on CRA risk. However, further research is needed to investigate the observed discrepancy with the generally accepted roles of the AA cascade in carcinogenesis.
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
English, William R; Ireland-Zecchini, Heather; Baker, Andrew H; Littlewood, Trevor D; Bennett, Martin R; Murphy, Gillian
2018-01-01
Over expression of Tissue Inhibitor of Metalloproteinases-3 (TIMP-3) in vascular smooth muscle cells (VSMCs) induces apoptosis and reduces neointima formation occurring after saphenous vein interposition grafting or coronary stenting. In studies to address the mechanism of TIMP-3-driven apoptosis in human VSMCs we find that TIMP-3 increased activation of caspase-8 and apoptosis was inhibited by expression of Cytokine response modifier A (CrmA) and dominant negative FAS-Associated protein with Death Domain (FADD). TIMP-3 induced apoptosis did not cause mitochondrial depolarisation, increase activation of caspase-9 and was not inhibited by over-expression of B-cell Lymphoma 2 (Bcl2), indicating a mitochondrial independent/type-I death receptor pathway. TIMP-3 increased levels of the First Apoptosis Signal receptor (FAS) and depletion of FAS with shRNA showed TIMP-3-induced apoptosis was FAS dependent. TIMP-3 induced formation of the Death-Inducing Signalling Complex (DISC), as detected by immunoprecipitation and by immunofluorescence. Cellular-FADD-like IL-1 converting enzyme-Like Inhibitory Protein (c-FLIP) localised with FAS at the cell periphery in the absence of TIMP-3 and this localisation was lost on TIMP-3 expression with c-FLIP adopting a perinuclear localisation. Although TIMP-3 inhibited FAS shedding, this did not increase total surface levels of FAS but instead increased FAS levels within localised regions at the cell surface. A Disintegrin And Metalloproteinase 17 (ADAM17) is inhibited by TIMP-3 and depletion of ADAM17 with shRNA significantly decreased FAS shedding. However ADAM17 depletion did not induce apoptosis or replicate the effects of TIMP-3 by increasing localised clustering of cell surface FAS. ADAM17-depleted cells could activate caspase-3 when expressing levels of TIMP-3 that were otherwise sub-apoptotic, suggesting a partial role for ADAM17 mediated ectodomain shedding in TIMP-3 mediated apoptosis. We conclude that TIMP-3 induced apoptosis
Ireland-Zecchini, Heather; Baker, Andrew H.; Littlewood, Trevor D.; Bennett, Martin R.; Murphy, Gillian
2018-01-01
Over expression of Tissue Inhibitor of Metalloproteinases-3 (TIMP-3) in vascular smooth muscle cells (VSMCs) induces apoptosis and reduces neointima formation occurring after saphenous vein interposition grafting or coronary stenting. In studies to address the mechanism of TIMP-3-driven apoptosis in human VSMCs we find that TIMP-3 increased activation of caspase-8 and apoptosis was inhibited by expression of Cytokine response modifier A (CrmA) and dominant negative FAS-Associated protein with Death Domain (FADD). TIMP-3 induced apoptosis did not cause mitochondrial depolarisation, increase activation of caspase-9 and was not inhibited by over-expression of B-cell Lymphoma 2 (Bcl2), indicating a mitochondrial independent/type-I death receptor pathway. TIMP-3 increased levels of the First Apoptosis Signal receptor (FAS) and depletion of FAS with shRNA showed TIMP-3-induced apoptosis was FAS dependent. TIMP-3 induced formation of the Death-Inducing Signalling Complex (DISC), as detected by immunoprecipitation and by immunofluorescence. Cellular-FADD-like IL-1 converting enzyme-Like Inhibitory Protein (c-FLIP) localised with FAS at the cell periphery in the absence of TIMP-3 and this localisation was lost on TIMP-3 expression with c-FLIP adopting a perinuclear localisation. Although TIMP-3 inhibited FAS shedding, this did not increase total surface levels of FAS but instead increased FAS levels within localised regions at the cell surface. A Disintegrin And Metalloproteinase 17 (ADAM17) is inhibited by TIMP-3 and depletion of ADAM17 with shRNA significantly decreased FAS shedding. However ADAM17 depletion did not induce apoptosis or replicate the effects of TIMP-3 by increasing localised clustering of cell surface FAS. ADAM17-depleted cells could activate caspase-3 when expressing levels of TIMP-3 that were otherwise sub-apoptotic, suggesting a partial role for ADAM17 mediated ectodomain shedding in TIMP-3 mediated apoptosis. We conclude that TIMP-3 induced apoptosis
Libera, Laura; Boari, Nicola; Mortini, Pietro; Bellipanni, Gianfranco; Giordano, Antonio; Cotelli, Franco; Riva, Paola
2014-01-01
Chordoma is a rare malignant tumor that recapitulates the notochord phenotype and is thought to derive from notochord remnants not correctly regressed during development. Apoptosis is necessary for the proper notochord development in vertebrates, and the apoptotic pathway mediated by Fas and Fasl has been demonstrated to be involved in notochord cells regression. This study was conducted to investigate the expression of FAS/FASL pathway in a cohort of skull base chordomas and to analyze the role of fas/fasl homologs in zebrafish notochord formation. FAS/FASL expression was found to be dysregulated in chordoma leading to inactivation of the downstream Caspases in the samples analyzed. Both fas and fasl were specifically expressed in zebrafish notochord sorted cells. fas and fasl loss-of-function mainly resulted in larvae with notochord multi-cell-layer jumps organization, larger vacuolated notochord cells, defects in the peri-notochordal sheath structure and in vertebral mineralization. Interestingly, we observed the persistent expression of ntla and col2a1a, the zebrafish homologs of the human T gene and COL2A1 respectively, which are specifically up-regulated in chordoma. These results demonstrate for the first time the dysregulation of FAS/FASL in chordoma and their role in notochord formation in the zebrafish model, suggesting their possible implication in chordoma onset. PMID:25071022
Ferrari, Luca; Pistocchi, Anna; Libera, Laura; Boari, Nicola; Mortini, Pietro; Bellipanni, Gianfranco; Giordano, Antonio; Cotelli, Franco; Riva, Paola
2014-07-30
Chordoma is a rare malignant tumor that recapitulates the notochord phenotype and is thought to derive from notochord remnants not correctly regressed during development. Apoptosis is necessary for the proper notochord development in vertebrates, and the apoptotic pathway mediated by Fas and Fasl has been demonstrated to be involved in notochord cells regression. This study was conducted to investigate the expression of FAS/FASL pathway in a cohort of skull base chordomas and to analyze the role of fas/fasl homologs in zebrafish notochord formation. FAS/FASL expression was found to be dysregulated in chordoma leading to inactivation of the downstream Caspases in the samples analyzed. Both fas and fasl were specifically expressed in zebrafish notochord sorted cells. fas and fasl loss-of-function mainly resulted in larvae with notochord multi-cell-layer jumps organization, larger vacuolated notochord cells, defects in the peri-notochordal sheath structure and in vertebral mineralization. Interestingly, we observed the persistent expression of ntla and col2a1a, the zebrafish homologs of the human T gene and COL2A1 respectively, which are specifically up-regulated in chordoma. These results demonstrate for the first time the dysregulation of FAS/FASL in chordoma and their role in notochord formation in the zebrafish model, suggesting their possible implication in chordoma onset.
Mechanisms of fatty acid synthesis in marine fungus-like protists.
Xie, Yunxuan; Wang, Guangyi
2015-10-01
Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed.
Gilbert, Stéphane; Loranger, Anne; Omary, M Bishr; Marceau, Normand
2016-09-01
Keratins are epithelial cell intermediate filament (IF) proteins that are expressed as pairs in a cell-differentiation-regulated manner. Hepatocytes express the keratin 8 and 18 pair (denoted K8/K18) of IFs, and a loss of K8 or K18, as in K8-null mice, leads to degradation of the keratin partner. We have previously reported that a K8/K18 loss in hepatocytes leads to altered cell surface lipid raft distribution and more efficient Fas receptor (FasR, also known as TNFRSF6)-mediated apoptosis. We demonstrate here that the absence of K8 or transgenic expression of the K8 G62C mutant in mouse hepatocytes reduces lipid raft size. Mechanistically, we find that the lipid raft size is dependent on acid sphingomyelinase (ASMase, also known as SMPD1) enzyme activity, which is reduced in absence of K8/K18. Notably, the reduction of ASMase activity appears to be caused by a less efficient redistribution of surface membrane PKCδ toward lysosomes. Moreover, we delineate the lipid raft volume range that is required for an optimal FasR-mediated apoptosis. Hence, K8/K18-dependent PKCδ- and ASMase-mediated modulation of lipid raft size can explain the more prominent FasR-mediated signaling resulting from K8/K18 loss. The fine-tuning of ASMase-mediated regulation of lipid rafts might provide a therapeutic target for death-receptor-related liver diseases. © 2016. Published by The Company of Biologists Ltd.
Chakrabandhu, Krittalak; Huault, Sébastien; Durivault, Jérôme; Lang, Kévin; Ta Ngoc, Ly; Bole, Angelique; Doma, Eszter; Dérijard, Benoit; Gérard, Jean-Pierre; Pierres, Michel; Hueber, Anne-Odile
2016-01-01
Demonstrations of both pro-apoptotic and pro-survival abilities of Fas (TNFRSF6/CD95/APO-1) have led to a shift from the exclusive “Fas apoptosis” to “Fas multisignals” paradigm and the acceptance that Fas-related therapies face a major challenge, as it remains unclear what determines the mode of Fas signaling. Through protein evolution analysis, which reveals unconventional substitutions of Fas tyrosine during divergent evolution, evolution-guided tyrosine-phosphorylated Fas proxy, and site-specific phosphorylation detection, we show that the Fas signaling outcome is determined by the tyrosine phosphorylation status of its death domain. The phosphorylation dominantly turns off the Fas-mediated apoptotic signal, while turning on the pro-survival signal. We show that while phosphorylations at Y232 and Y291 share some common functions, their contributions to Fas signaling differ at several levels. The findings that Fas tyrosine phosphorylation is regulated by Src family kinases (SFKs) and the phosphatase SHP-1 and that Y291 phosphorylation primes clathrin-dependent Fas endocytosis, which contributes to Fas pro-survival signaling, reveals for the first time the mechanistic link between SFK/SHP-1-dependent Fas tyrosine phosphorylation, internalization route, and signaling choice. We also demonstrate that levels of phosphorylated Y232 and Y291 differ among human cancer types and differentially respond to anticancer therapy, suggesting context-dependent involvement of Fas phosphorylation in cancer. This report provides a new insight into the control of TNF receptor multisignaling by receptor phosphorylation and its implication in cancer biology, which brings us a step closer to overcoming the challenge in handling Fas signaling in treatments of cancer as well as other pathologies such as autoimmune and degenerative diseases. PMID:26942442
Karray, Saoussen; Kress, Chantal; Cuvellier, Sylvain; Hue-Beauvais, Catherine; Damotte, Diane; Babinet, Charles; Lévi-Strauss, Matthieu
2004-02-15
To investigate the in vivo function of Fas ligand (FasL), we produced a mouse strain with a FasL gene flanked by loxP sequences. Mice with homozygous floxed FasL gene showed no obvious abnormalities. However, germline deletion of the FasL gene, obtained after mating with mice expressing ubiquitous Cre recombinase, resulted in an unexpectedly severe phenotype. FasL(-/-) mice exhibited an extreme splenomegaly and lymphadenopathy associated with lymphocytic infiltration into multiple organs and autoimmune disease. This severe phenotype led to the premature death at 4 mo of age of >50% of the homozygous mice. It stands in sharp contrast with the milder disease observed in gld (generalized lymphoproliferative disease) mice, indicating that the FasL allele of these mice encodes a protein still able to bind, albeit at a very low level, the Fas receptor.
Svandova, E Budisova; Vesela, B; Lesot, H; Poliard, A; Matalova, E
2017-04-01
Elimination of the interdigital web is considered to be the classical model for assessing apoptosis. So far, most of the molecules described in the process have been connected to the intrinsic (mitochondrial) pathway. The extrinsic (receptor mediated) apoptotic pathway has been rather neglected, although it is important in development, immunomodulation and cancer therapy. This work aimed to investigate factors of the extrinsic apoptotic machinery during interdigital regression with a focus on three crucial initiators: Fas, Fas ligand and caspase-8. Immunofluorescent analysis of mouse forelimb histological sections revealed abundant expression of these molecules prior to digit separation. Subsequent PCR Array analyses indicated the expression of several markers engaged in the extrinsic pathway. Between embryonic days 11 and 13, statistically significant increases in the expression of Fas and caspase-8 were observed, along with other molecules involved in the extrinsic apoptotic pathway such as Dapk1, Traf3, Tnsf12, Tnfrsf1A and Ripk1. These results demonstrate for the first time the presence of extrinsic apoptotic components in mouse limb development and indicate novel candidates in the molecular network accompanying the regression of interdigital tissue during digitalisation.
Lee, Ji-Hyun; Kim, Su-Jin; Lee, Sul; Rhee, Jin-Kyu; Lee, Soo Young; Na, Yun-Cheol
2017-09-01
A sensitive and selective capillary electrophoresis-mass spectrometry (CE-MS) method for determination of saturated fatty acids (FAs) was developed by using dicationic ion-pairing reagents forming singly charged complexes with anionic FAs. For negative ESI detection, 21 anionic FAs at pH 10 were separated using ammonium formate buffer containing 40% acetonitrile modifier in normal polarity mode in CE by optimizing various parameters. This method showed good separation efficiency, but the sensitivity of the method to short-chain fatty acids was quite low, causing acetic and propionic acids to be undetectable even at 100 mgL -1 in negative ESI-MS detection. Out of the four dicationic ion-pairing reagents tested, N,N'-dibutyl 1,1'-pentylenedipyrrolidium infused through a sheath-liquid ion source during CE separation was the best reagent regarding improved sensitivity and favorably complexed with anionic FAs for detection in positive ion ESI-MS. The monovalent complex showed improved ionization efficiency, providing the limits of detection (LODs) for 15 FAs ranging from 0.13 to 2.88 μg/mL and good linearity (R 2 > 0.99) up to 150 μg/mL. Compared to the negative detection results, the effect was remarkable for the detection of short- and medium-chain fatty acids. The optimized CE-paired ion electrospray (PIESI)-MS method was utilized for the determination of FAs in cheese and coffee with simple pretreatment. This method may be extended for sensitive analysis of unsaturated fatty acids. Copyright © 2017 Elsevier B.V. All rights reserved.
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Ocean acidification increases fatty acids levels of larval fish.
Díaz-Gil, Carlos; Catalán, Ignacio A; Palmer, Miquel; Faulk, Cynthia K; Fuiman, Lee A
2015-07-01
Rising levels of anthropogenic carbon dioxide in the atmosphere are acidifying the oceans and producing diverse and important effects on marine ecosystems, including the production of fatty acids (FAs) by primary producers and their transfer through food webs. FAs, particularly essential FAs, are necessary for normal structure and function in animals and influence composition and trophic structure of marine food webs. To test the effect of ocean acidification (OA) on the FA composition of fish, we conducted a replicated experiment in which larvae of the marine fish red drum (Sciaenops ocellatus) were reared under a climate change scenario of elevated CO2 levels (2100 µatm) and under current control levels (400 µatm). We found significantly higher whole-body levels of FAs, including nine of the 11 essential FAs, and altered relative proportions of FAs in the larvae reared under higher levels of CO2. Consequences of this effect of OA could include alterations in performance and survival of fish larvae and transfer of FAs through food webs. © 2015 The Author(s) Published by the Royal Society. All rights reserved.
Fan, Jilian; Yan, Chengshi; Xu, Changcheng
2013-12-01
Phospholipid:diacylglycerol acyltransferase (PDAT) and diacylglycerol:acyl CoA acyltransferase play overlapping roles in triacylglycerol (TAG) assembly in Arabidopsis, and are essential for seed and pollen development, but the functional importance of PDAT in vegetative tissues remains largely unknown. Taking advantage of the Arabidopsis tgd1-1 mutant that accumulates oil in vegetative tissues, we demonstrate here that PDAT1 is crucial for TAG biosynthesis in growing tissues. We show that disruption of PDAT1 in the tgd1-1 mutant background causes serious growth retardation, gametophytic defects and premature cell death in developing leaves. Lipid analysis data indicated that knockout of PDAT1 results in increases in the levels of free fatty acids (FFAs) and diacylglycerol. In vivo ¹⁴C-acetate labeling experiments showed that, compared with wild-type, tgd1-1 exhibits a 3.8-fold higher rate of fatty acid synthesis (FAS), which is unaffected by disruption or over-expression of PDAT1, indicating a lack of feedback regulation of FAS in tgd1-1. We also show that detached leaves of both pdat1-2 and tgd1-1 pdat1-2 display increased sensitivity to FFA but not to diacylglycerol. Taken together, our results reveal a critical role for PDAT1 in mediating TAG synthesis and thereby protecting against FFA-induced cell death in fast-growing tissues of plants. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Costa, Sara; Afonso, Cláudia; Cardoso, Carlos; Batista, Irineu; Chaveiro, Nádia; Nunes, Maria Leonor; Bandarra, Narcisa Maria
2015-10-15
The effect of culinary treatments on the fatty acid profile, mercury (Hg), and methylmercury (MeHg) levels of salmon was studied. The bioaccessibility of fatty acids, Hg, and MeHg in raw and grilled salmon was determined. The most intense thermal treatment (grilling) did not alter the relative fatty acid (FA) profile. There were bioaccessibility differences between FAs. To the authors' knowledge, for the first time, higher bioaccessibility of the long-chain FAs than the short- and medium-chain FAs was measured. Chemical interaction phenomena seemed to play a role. On the other hand, higher levels of unsaturation decreased bioaccessibility. Two main alternative hypotheses were put forward, either lower polarity led to higher incorporation of FAs with longer hydrophobic aliphatic chain and lower number of double bonds in the emulsion present in the bioaccessible fraction or enzymatic selectivity preferentially hydrolyzed some FAs on the basis of their structure or position in the triacylglycerol molecule. Copyright © 2015 Elsevier Ltd. All rights reserved.
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Sunlight triggers cutaneous lupus through a CSF-1-dependent mechanism in MRL-Fas(lpr) mice.
Menke, Julia; Hsu, Mei-Yu; Byrne, Katelyn T; Lucas, Julie A; Rabacal, Whitney A; Croker, Byron P; Zong, Xiao-Hua; Stanley, E Richard; Kelley, Vicki R
2008-11-15
Sunlight (UVB) triggers cutaneous lupus erythematosus (CLE) and systemic lupus through an unknown mechanism. We tested the hypothesis that UVB triggers CLE through a CSF-1-dependent, macrophage (Mø)-mediated mechanism in MRL-Fas(lpr) mice. By constructing mutant MRL-Fas(lpr) strains expressing varying levels of CSF-1 (high, intermediate, none), and use of an ex vivo gene transfer to deliver CSF-1 intradermally, we determined that CSF-1 induces CLE in lupus-susceptible MRL-Fas(lpr) mice, but not in lupus-resistant BALB/c mice. UVB incites an increase in Møs, apoptosis in the skin, and CLE in MRL-Fas(lpr), but not in CSF-1-deficient MRL-Fas(lpr) mice. Furthermore, UVB did not induce CLE in BALB/c mice. Probing further, UVB stimulates CSF-1 expression by keratinocytes leading to recruitment and activation of Møs that, in turn, release mediators, which induce apoptosis in keratinocytes. Thus, sunlight triggers a CSF-1-dependent, Mø-mediated destructive inflammation in the skin leading to CLE in lupus-susceptible MRL-Fas(lpr) but not lupus-resistant BALB/c mice. Taken together, CSF-1 is envisioned as the match and lupus susceptibility as the tinder leading to CLE.
Serological levels of apoptotic bodies, sFAS and TNF in lupus erythematosus.
Alecu, M; Coman, G; Alecu, S
In our study we have investigated the presence of apoptotic bodies, soluble FAS receptor and TNF (tumor necrosis factor) in three clinical forms of lupus erythematosus. Determinations were performed in attack period of: systemic lupus erythematosus (SLE) for 20 patients, 20 patients with subacute cutaneous lupus erythematosus (SCLE), 20 patients with chronic discoid lupus erythematosus (DLE). Determinations were performed by ELISA (for apoptotic bodies, kit Boehringer, normal values 400-800 mU), (for sFAS, kit R&D Systems, normal values 4500-17000 pg/ml) (for TNF, ELISA kit R&D Systems, normal values 0.4-3.6 pg/ml). Results in SLE: apoptotic bodies were increased in 16 cases (980-1030); sFAS in 18 cases (17000-24000 pg/ml) TNF was increased in all 20 cases (40-140 pg/ml). In SCLE with multiple cutaneous lesions and without internal organs disturbance the apoptotic bodies were increased in 10 cases (960-1030 pg/ml), sFAS in 9 cases (17000-22000 pg/ml), and TNF alpha in 9 cases. In DLE, apoptotic bodies were increased in 2 patients (980-1010 pg/ml), sFAS in 3 patients (17000-20000 pg/ml) and TNF in 2 patients (20-40 pg/mil). Investigated values were slightly correlated with immune parameters (anti dsDNA antibodies), but they were correlated with the presence of renal disturbances or extension of cutaneous lesions. We consider that the presence of increased apoptotic bodies as a result of peripheral mononuclear cells apoptosis appear as a nauto-limiting mechanism in a pathological immune response. The increase of sFAS in lupus patients serum might be interpreted as an alteration of apoptosis respectively a deficit in apoptosis which has as a first consequence the persistence of B and T lymphocytes, activated, in the pathogen immune response.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Fatty acid synthase inhibitors from plants: isolation, structure elucidation, and SAR studies.
Li, Xing-Cong; Joshi, Alpana S; ElSohly, Hala N; Khan, Shabana I; Jacob, Melissa R; Zhang, Zhizheng; Khan, Ikhlas A; Ferreira, Daneel; Walker, Larry A; Broedel, Sheldon E; Raulli, Robert E; Cihlar, Ronald L
2002-12-01
Fatty acid synthase (FAS) has been identified as a potential antifungal target. FAS prepared from Saccharomyces cerevisiae was employed for bioactivity-guided fractionation of Chlorophora tinctoria,Paspalum conjugatum, Symphonia globulifera, Buchenavia parviflora, and Miconia pilgeriana. Thirteen compounds (1-13), including three new natural products (1, 4, 12), were isolated and their structures identified by spectroscopic interpretation. They represented five chemotypes, namely, isoflavones, flavones, biflavonoids, hydrolyzable tannin-related derivatives, and triterpenoids. 3'-Formylgenistein (1) and ellagic acid 4-O-alpha-l-rhamnopyranoside (9) were the most potent compounds against FAS, with IC(50) values of 2.3 and 7.5 microg/mL, respectively. Furthermore, 43 (14-56) analogues of the five chemotypes from our natural product repository and commercial sources were tested for their FAS inhibitory activity. Structure-activity relationships for some chemotypes were investigated. All these compounds were further evaluated for antifungal activity against Candida albicans and Cryptococcus neoformans. Although there were several antifungal compounds in the set, correlation between the FAS inhibitory activity and antifungal activity could not be defined.
A novel splice variant of the Fas gene in patients with cutaneous T-cell lymphoma.
van Doorn, Remco; Dijkman, Remco; Vermeer, Maarten H; Starink, Theo M; Willemze, Rein; Tensen, Cornelis P
2002-10-01
Defective apoptosis signaling has been implicated in the pathogenesis of primary cutaneous T-cell lymphomas (CTCLs), a group of malignancies derived from skin-homing T cells. An important mediator of apoptosis in T cells is the Fas receptor. We identified a novel splice variant of the Fas gene that displays retention of intron 5 and encodes a dysfunctional Fas protein in 13 of 22 patients (59%) in both early and advanced CTCL. Impairment of Fas-induced apoptosis resulting from aberrant splicing potentially contributes to the development and progression of CTCL by allowing continued clonal expansion of activated T cells and by reducing susceptibility to antitumor immune responses.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Zhang, Lin; Xiao, Jianfeng; Xu, Jianrong; Fu, Tianran; Cao, Zhiwei; Zhu, Liang; Chen, Hong-Zhuan; Shen, Xu; Jiang, Hualiang; Zhang, Liang
2016-12-01
Fatty acid biosynthesis (FAS) is a vital process in cells. Fatty acids are essential for cell assembly and cellular metabolism. Abnormal FAS directly correlates with cell growth delay and human diseases, such as metabolic syndromes and various cancers. The FAS system utilizes an acyl carrier protein (ACP) as a transporter to stabilize and shuttle the growing fatty acid chain throughout enzymatic modules for stepwise catalysis. Studying the interactions between enzymatic modules and ACP is, therefore, critical for understanding the biological function of the FAS system. However, the information remains unclear due to the high flexibility of ACP and its weak interaction with enzymatic modules. We present here a 2.55 Å crystal structure of type II FAS dehydratase FabZ in complex with holo-ACP, which exhibits a highly symmetrical FabZ hexamer-ACP 3 stoichiometry with each ACP binding to a FabZ dimer subunit. Further structural analysis, together with biophysical and computational results, reveals a novel dynamic seesaw-like ACP binding and catalysis mechanism for the dehydratase module in the FAS system, which is regulated by a critical gatekeeper residue (Tyr100 in FabZ) that manipulates the movements of the β-sheet layer. These findings improve the general understanding of the dehydration process in the FAS system and will potentially facilitate drug and therapeutic design for diseases associated with abnormalities in FAS.
Mou, Haiwei; Moore, Jill; Malonia, Sunil K; Li, Yingxiang; Ozata, Deniz M; Hough, Soren; Song, Chun-Qing; Smith, Jordan L; Fischer, Andrew; Weng, Zhiping; Green, Michael R; Xue, Wen
2017-04-04
Genetic lesions that activate KRAS account for ∼30% of the 1.6 million annual cases of lung cancer. Despite clinical need, KRAS is still undruggable using traditional small-molecule drugs/inhibitors. When oncogenic Kras is suppressed by RNA interference, tumors initially regress but eventually recur and proliferate despite suppression of Kras Here, we show that tumor cells can survive knockout of oncogenic Kras , indicating the existence of Kras -independent survival pathways. Thus, even if clinical KRAS inhibitors were available, resistance would remain an obstacle to treatment. Kras -independent cancer cells exhibit decreased colony formation in vitro but retain the ability to form tumors in mice. Comparing the transcriptomes of oncogenic Kras cells and Kras knockout cells, we identified 603 genes that were specifically up-regulated in Kras knockout cells, including the Fas gene, which encodes a cell surface death receptor involved in physiological regulation of apoptosis. Antibodies recognizing Fas receptor efficiently induced apoptosis of Kras knockout cells but not oncogenic Kras -expressing cells. Increased Fas expression in Kras knockout cells was attributed to decreased association of repressive epigenetic marks at the Fas promoter. Concordant with this observation, treating oncogenic Kras cells with histone deacetylase inhibitor and Fas-activating antibody efficiently induced apoptosis, thus bypassing the need to inhibit Kras. Our results suggest that activation of Fas could be exploited as an Achilles' heel in tumors initiated by oncogenic Kras.
Sudarshana Reddy, B; Pavankumar, P; Sridhar, L; Saha, Soumen; Narahari Sastry, G; Prabhakar, S
2018-04-24
The intercellular and intracellular transport of charged species (Na + /K + ) entail interaction of the ions with neutral organic molecules and formation of adduct ions. The rate of transport of the ions across the cell membrane(s) may depend on the stability of the adduct ions, which in turn rely on structural aspects of the organic molecules that interact with the ions. Positive ion ESI mass spectra were recorded for the solutions containing fatty acids (FAs) and monovalent cations (X=Li + , Na + , K + , Rb + and Cs + ). Product ion spectra of the [FA+X] + ions were recorded at different collision energies. Theoretical studies were exploited under both gas phase and solvent phase to investigate the structural effects of the fatty acids during cationization. Stability of [FA+X] + adduct ions were further estimated by means of AIM topological analyses and interaction energy (IE) values. Positive ion ESI-MS analyses of the solution of FAs and X + ions showed preferential binding of the K + ions to FAs. The K + ion binding increased with the increase in number of double bonds of FAs, while decreased with increase in the number of carbons of FAs. Dissociation curves of [FA+X] + ions indicated the relative stability order of the [FA+X] + ions and it was in line with the observed trends in ESI-MS. The solvent phase computational studies divulged the mode of binding and the binding efficiencies of different FAs with monovalent cations. Among the studied monovalent cations, the cationization of FAs follow the order K + >Na + >Li + >Rb + >Cs + . The docosahexaenoic acid showed high efficiency in binding with K + ion. The K + ion binding efficiency of FAs depends on the number of double bonds in unsaturated FAs and the carbon chain length in saturated FAs. The cationization trends of FAs obtained from the ESI-MS, ESI-MS/MS analyses were in good agreement with solvent phase computational studies. This article is protected by copyright. All rights reserved.
Corsolini, Simonetta; Borghesi, Nicoletta
2017-05-01
Lipids are important energy source and structural component for cellular membranes and tissues, involved in the osmoregulation and immune response, and are very important in the bioaccumulation of lipophilic chemicals too. Among lipids, fatty acids (FAs) give information on diet of organisms, since FA of consumer lipids can be related to those of diet; plants and animals vary in their FA signature because of differences in the synthesis of lipids. In this study, lipid content and FA composition in tissues of Antarctic organisms from the Ross Sea (Odontaster validus, Sterechinus neumayeri, Chionodraco hamatus, Trematomus bernacchii, Pygoscelis adèliae) were assessed. Differences in lipid characterisation were found between both species and tissues. The lipid content was highest in C. hamatus liver (3.51%), and lowest in T. bernacchii muscle (0.16%). The polyunsaturated fatty acids (PUFAs) prevailed in the C. hamatus muscle, and among FAs, the docosahexaenoic acid (DHA; C22:6n3) was the most abundant (20.93%). The C22:6n3 accumulated more in fish and penguin tissues than in invertebrate species. The high contribution of unsaturated fatty acids (>74%) in fish tissues wats related to the low environmental temperature. The fatty acid profile and the essential fatty acids occurrence were also discussed in the light of physiological adaptations and feeding habits of organisms; the relationships with contaminant bioaccumulation were also assessed. To the best of our knowledge, this is the first report of fatty acid composition and fingerprint in a Ross Sea trophic web and their correlation with contaminant concentration. Copyright © 2017 Elsevier Ltd. All rights reserved.
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
NF-κB Regulates Caspase-4 Expression and Sensitizes Neuroblastoma Cells to Fas-Induced Apoptosis
Yang, Hai-Jie; Wang, Mian; Wang, Lei; Cheng, Bin-Feng; Lin, Xiao-Yu; Feng, Zhi-Wei
2015-01-01
Found in neurons and neuroblastoma cells, Fas-induced apoptosis and accompanied activation of NF-κB signaling were thought to be associated with neurodegenerative diseases. However, the detailed functions of NF-κB activation in Fas killing and the effect of NF-κB activation on its downstream events remain unclear. Here, we demonstrated that agonistic Fas antibody induces cell death in a dose-dependent way and NF-κB signaling is activated as well, in neuroblastoma cells SH-EP1. Unexpectedly, NF-κB activation was shown to be pro-apoptotic, as suggested by the reduction of Fas-induced cell death with either a dominant negative form of IκBα (DN-IκBα) or an IκB kinase-specific inhibitor. To our interest, when analyzing downstream events of NF-κB signaling, we found that DN-IκBα only suppressed the expression of caspase-4, but not other caspases. Vice versa, enhancement of NF-κB activity by p65 (RelA) overexpression increased the expression of caspase-4 at both mRNA and protein levels. More directly, results from dual luciferase reporter assay demonstrated the regulation of caspase-4 promoter activity by NF-κB. When caspase-4 activity was blocked by its dominant negative (DN) form, Fas-induced cell death was substantially reduced. Consistently, the cleavage of PARP and caspase-3 induced by Fas was also reduced. In contrast, the cleavage of caspase-8 remained unaffected in caspase-4 DN cells, although caspase-8 inhibitor could rescue Fas-induced cell death. Collectively, these data suggest that caspase-4 activity is required for Fas-induced cell apoptosis and caspase-4 may act upstream of PARP and caspase-3 and downstream of caspase-8. Overall, we demonstrate that NF-κB can mediate Fas-induced apoptosis through caspase-4 protease, indicating that caspase-4 is a new mediator of NF-κB pro-apoptotic pathway in neuroblastoma cells. PMID:25695505
Ma, Hong-Xia; You, Zhao-Ling; Wang, Xiao-Yun
2008-11-01
To explore the effect of total flavones from cuscuta chinensis (TFCC) on expression of Fas, PCNA and HB-EGF in SD rats model with bromocriptine-induced abortion. The model rats of bromocriptine during 6-8 d of pregnancy induced early abortion was established, adopting respectively herbs in high and low dosage and progesterone affect model rat and after 12 d, Immunohistochemical was applied to determine Fas, HB-EGF and PCNA in deciduas and placenta. Expression of PCNA on trophoblast and deciduas, HB-EGF on trophoblast, PR on deciduas in the model used Semen cuscutae flavonoid, proesterone and normal pregnacy, were significantlly higher than those of the pure model. Expression of Fas on trophoblast and deciduas in above four groups, were significantlly lower than those of the pure model. There were no expression of HB-EGF on deciduas. TFCC regulates the proliferation and apoptosis of the deciduas and cytotrophoblasts and prevents spontaneous abortions.
González-Thuillier, Irene; Venegas-Calerón, Mónica; Garcés, Rafael; von Wettstein-Knowles, Penny; Martínez-Force, Enrique
2015-01-01
Enoyl-[acyl carrier protein]-reductases from sunflower. A major factor contributing to the amount of fatty acids in plant oils are the first steps of their synthesis. The intraplastidic fatty acid biosynthetic pathway in plants is catalysed by type II fatty acid synthase (FAS). The last step in each elongation cycle is carried out by the enoyl-[ACP]-reductase, which reduces the dehydrated product of β-hydroxyacyl-[ACP] dehydrase using NADPH or NADH. To determine the mechanisms involved in the biosynthesis of fatty acids in sunflower (Helianthus annuus) seeds, two enoyl-[ACP]-reductase genes have been identified and cloned from developing seeds with 75 % identity: HaENR1 (GenBank HM021137) and HaENR2 (HM021138). The two genes belong to the ENRA and ENRB families in dicotyledons, respectively. The genetic duplication most likely originated after the separation of di- and monocotyledons. RT-qPCR revealed distinct tissue-specific expression patterns. Highest expression of HaENR1 was in roots, stems and developing cotyledons whereas that of H a ENR2 was in leaves and early stages of seed development. Genomic DNA gel blot analyses suggest that both are single-copy genes. In vivo activity of the ENR enzymes was tested by complementation experiments with the JP1111 fabI(ts) E. coli strain. Both enzymes were functional demonstrating that they interacted with the bacterial FAS components. That different fatty acid profiles resulted infers that the two Helianthus proteins have different structures, substrate specificities and/or reaction rates. The latter possibility was confirmed by in vitro analysis with affinity-purified heterologous-expressed enzymes that reduced the crotonyl-CoA substrate using NADH with different V max.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ma, Noelle; Department of Obstetrics and Gynecology, The University of Western Ontario; The Lawson Health Research Institute, The University of Western Ontario
While nicotine replacement therapy is assumed to be a safer alternative to smoking during pregnancy, the long-term consequences for the offspring remain elusive. Animal studies now suggest that maternal nicotine exposure during perinatal life leads to a wide range of adverse outcomes for the offspring including increased adiposity. The focus of this study was to investigate if nicotine exposure during pregnancy and lactation leads to alterations in hepatic triglyceride synthesis. Female Wistar rats were randomly assigned to receive daily subcutaneous injections of saline (vehicle) or nicotine bitartrate (1 mg/kg/day) for two weeks prior to mating until weaning. At postnatal daymore » 180 (PND 180), nicotine exposed offspring exhibited significantly elevated levels of circulating and hepatic triglycerides in the male offspring. This was concomitant with increased expression of fatty acid synthase (FAS), the critical hepatic enzyme in de novo triglyceride synthesis. Given that FAS is regulated by the nuclear receptor Liver X receptor (LXRα), we measured LXRα expression in both control and nicotine-exposed offspring. Nicotine exposure during pregnancy and lactation led to an increase in hepatic LXRα protein expression and enriched binding to the putative LXRE element on the FAS promoter in PND 180 male offspring. This was also associated with significantly enhanced acetylation of histone H3 [K9,14] surrounding the FAS promoter, a hallmark of chromatin activation. Collectively, these findings suggest that nicotine exposure during pregnancy and lactation leads to an increase in circulating and hepatic triglycerides long-term via changes in the transcriptional and epigenetic regulation of the hepatic lipogenic pathway. - Highlights: • Our data reveals the links nicotine exposure in utero and long-term hypertriglyceridemia. • It is due to nicotine-induced augmented expression of hepatic FAS and LXRα activity. • Moreover, this involves nicotine-induced enhanced
Krishnan, Anitha; Fei, Fei; Jones, Alexander; Busto, Patricia; Marshak-Rothstein, Ann; Ksander, Bruce R.; Gregory-Ksander, Meredith
2016-01-01
Glaucoma is a multifactorial disease resulting in the death of retinal ganglion cells (RGCs) and irreversible blindness. Glaucoma-associated RGC cell death depends on the pro-apoptotic and proinflammatory activity of membrane-bound FasL (mFasL). In contrast to mFasL, the natural soluble FasL cleavage product (sFasL) inhibits mFasL-mediated apoptosis and inflammation and is therefore a mFasL antagonist. DBA/2J (D2) mice spontaneously develop glaucoma and predictably RGC destruction is exacerbated by expression of a mutated membrane-only FasL (mFasL) gene that lacks the extracellular cleavage site. Remarkably, one time intraocular adeno-associated virus-mediated gene delivery of sFasL (AAV2.sFasL) provides complete and sustained neuroprotection in both the chronic D2 and acute microbead-induced models of glaucoma, even in the presence of elevated intraocular pressure (IOP). This protection correlated with inhibition of glial activation, reduced production of TNFα, and decreased apoptosis of RGCs and loss of axons. These data indicate that cleavage of FasL under homeostatic conditions, and the ensuing release of sFasL, normally limits the neurodestructive activity of FasL. The data further support the notion that sFasL, and not mFasL, contributes to the immune privileged status of the eye. PMID:27849168
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
Pin1-FADD interactions regulate Fas-mediated apoptosis in activated eosinophils#
Oh, Jiyoung; Malter, James S.
2013-01-01
Abnormally long-lived eosinophils (Eos) are the major inflammatory component of allergic responses in the lungs of active asthmatics. Eos recruited to the airways after allergen exposure produce and respond to IL-5 and GM-CSF, enhancing their survival. Pro-survival signaling activates Pin1, a cis-trans peptidyl isomerase (PPIase) that binds to Bax and prevents it activation. How long-lived Eos, despite the continued presence of GM-CSF or IL-5, eventually undergo apoptosis to end allergic inflammation remains unclear. Here we show that Pin1 location, activity and protein interactions are jointly influenced by Fas and pro-survival cytokine IL-5. Fas signaling strongly induced the phosphorylation of FADD at Ser194 and Pin1 at Ser16 as well as their nuclear accumulation. Phospho-mimic Ser194Glu FADD mutants accelerated Eos apoptosis compared to WT or Ser194Ala mutants. Downstream of FADD phosphorylation, Caspase 8, 9 and 3 cleavage as well as Eos apoptosis induced by Fas were reduced by constitutively active Pin1 and enhanced by Pin1 inhibition. Pin1 was activated by IL-5 while simultaneous IL-5 and anti-Fas treatment modestly reduced PPIase activity but induced Pin1 to associate with FADD after its phosphorylation at Ser194. Mechanistically, Pin1 mediated isomerization facilitated the subsequent dephosphorylation of Ser194 FADD and maintenance of cytoplasmic location. In vivo activated bronchoalvelolar (BAL) Eos obtained after allergen challenge showed elevated survival and Pin1 activity that could be reversed by anti-Fas. Therefore, our data suggest that Pin1 is a critical link between FADD mediated cell death and IL-5 mediated pro-survival signaling. PMID:23606538
Tsukinoki, Tomoko; Sugiyama, Hitoshi; Sunami, Reiko; Kobayashi, Mizuho; Onoda, Tetsuya; Maeshima, Yohei; Yamasaki, Yasushi; Makino, Hirofumi
2004-09-01
Fas ligand (FasL) is a well-known death factor; however, the role of FasL in the regulation of human glomerulonephritis remains unclear. We investigated the renal expression and localization of FasL in various forms of human glomerulonephritis by immunohistochemistry, utilizing confocal laser scanning microscopy. We further evaluated cytokine-induced FasL expression via nuclear factor (NF)kappaB in cultured human mesangial cells (HMC). The level of soluble FasL was measured by a specific enzyme-linked immunosorbent assay (ELISA). The frequency of glomerular FasL-positive cases was higher in lupus nephritis (37.9%) as compared with other forms of glomerulonephritis (8.7%). The glomerular FasL score in proliferative lupus nephritis was significantly higher than that in nonproliferative forms. Patients with a high apoptosis score, severe microhematuria, proteinuria, or decreased renal function had a high FasL score. Double immunolabelling demonstrated that the most prevalent phenotypes of FasL-positive cells were mesangial cells. In cultured HMC, interleukin (IL)1beta, lipopolysaccharide (LPS), or gamma interferon (IFN) upregulated membrane-bound FasL. IL1beta significantly, and LPS or gammaIFN weakly activated NFkappaB, but none of these agents activated NFkappaB/Rel-related nuclear factor of activated T cells (NFATc) or IFN regulatory factor-1. IL1beta-mediated NFkappaB was completely inhibited in the presence of lactacystin, a potent inhibitor of NFkappaB. Lactacystin-mediated inhibition of NFkappaB reduced FasL protein levels. Matrix metalloproteinase (MMP)-7, but not other MMPs (1, 2, 3, 8, or 9), significantly sensitized HMC to release soluble FasL after IL1beta stimulation. The results suggest that: (1) upregulation of mesangial FasL may contribute to the glomerular inflammation in proliferative lupus nephritis in vivo; (2) proinflammatory cytokines, in particular IL1beta, produced in nephritis can upregulate FasL via the transcription factor NFkappaB in HMC
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Wang, Xiao Yang; Crowston, Jonathan G; White, Andrew J R; Zoellner, Hans; Healey, Paul R
2014-08-01
The aim of the study was to investigate, using a native mitomycin-C-resistant human Tenon's fibroblast cell line, the possibility that interferon-alpha and gamma could be used with Fas agonists as an alternative anti-fibrotic strategy to mitomycin-C in trabeculectomy. A clinically resistant and in vitro verified mitomycin-C-resistant human Tenon's fibroblast cell line was pretreated with interferon-alpha and interferon-gamma for 48 h before stimulation with an agonistic Fas antibody (CH11) for 2 days to induce cell death. Cell death assays were undertaken. Changes in apoptosis-related proteins were determined by flow cytometry and Western blot. Pretreatment with interferon-alpha or interferon-gamma for 48 h increased Fas, Fas-associated protein with death domain and caspase-8 expression. Protein expression was further increased by combined exposure to interferon-alpha and gamma. Pretreatment with cytokines had no effect on Fas-L and Bcl-2. Interferon-alpha alone did not change the rate of induced cell death. A combination of interferon-alpha and gamma synergistically increased the sensitivity of mitomycin-C-resistant human Tenon's fibroblast cell line to induced cell death. An antagonistic anti-Fas antibody (ZB4) completely blocked induced cell death. Broad caspase inhibitors specific for caspases-8 and -3 reduced induced deaths in interferon pretreated mitomycin-C-resistant human Tenon's fibroblast cell line in a dose-dependent manner. Interferon-alpha and interferon-gamma render mitomycin-C-resistant human Tenon's fibroblast cell line sensitive to Fas-mediated apoptosis. The mechanism involves increased death-inducing signalling complex formation by upregulation of Fas, Fas-associated protein with death domain and caspase-8 expression. © 2013 Royal Australian and New Zealand College of Ophthalmologists.
Chung, Christine C; Ohwaki, Kenji; Schneeweis, Jonathan E; Stec, Erica; Varnerin, Jeffrey P; Goudreau, Paul N; Chang, Amy; Cassaday, Jason; Yang, Lihu; Yamakawa, Takeru; Kornienko, Oleg; Hodder, Peter; Inglese, James; Ferrer, Marc; Strulovici, Berta; Kusunoki, Jun; Tota, Michael R; Takagi, Toshimitsu
2008-06-01
Here we report the development and miniaturization of a cell-free enzyme assay for ultra-high-throughput screening (uHTS) for inhibitors of two potential drug targets for obesity and cancer: fatty acid synthase (FAS) and acetyl-coenzyme A (CoA) carboxylase (ACC) 2. This assay detects CoA, a product of the FAS-catalyzed condensation of malonyl-CoA and acetyl-CoA. The free thiol of CoA can react with 7-diethylamino-3-(4'-maleimidylphenyl)-4-methylcoumarin (CPM), a profluorescent coumarin maleimide derivative that becomes fluorescent upon reaction with thiols. FAS produces long-chain fatty acid and CoA from the condensation of malonyl-CoA and acetyl-CoA. In our FAS assay, CoA released in the FAS reaction forms a fluorescence adduct with CPM that emits at 530 nm when excited at 405 nm. Using this detection method for CoA, we measured the activity of sequential enzymes in the fatty acid synthesis pathway to develop an ACC2/FAS-coupled assay where ACC2 produces malonyl-CoA from acetyl-CoA. We miniaturized the FAS and ACC2/FAS assays to 3,456- and 1,536-well plate format, respectively, and completed uHTSs for small molecule inhibitors of this enzyme system. This report shows the results of assay development, miniaturization, and inhibitor screening for these potential drug targets.
Nicklas, Theresa A; O'Neil, Carol E
2015-05-01
The diets of most US children and adults are poor, as reflected by low diet quality scores, when compared with the recommendations of the Dietary Guidelines for Americans (DGAs). Contributing to these low scores is that most Americans overconsume solid fats, which may contain saturated fatty acids and added sugars; although alcohol consumption was generally modest, it provided few nutrients. Thus, the 2005 DGAs generated a new recommendation: to reduce intakes of solid fats, alcohol, and added sugars (SoFAAS). What precipitated the emergence of the new SoFAAS terminology was the concept of discretionary calories (a "calorie" is defined as the amount of energy needed to increase the temperature of 1 kg of water by 1°C), which were defined as calories consumed after an individual had met his or her recommended nutrient intakes while consuming fewer calories than the daily recommendation. A limitation with this concept was that additional amounts of nutrient-dense foods consumed beyond the recommended amount were also considered discretionary calories. The rationale for this was that if nutrient-dense foods were consumed beyond recommended amounts, after total energy intake was met then this constituted excess energy intake. In the 2010 DGAs, the terminology was changed to solid fats and added sugars (SoFAS); thus, alcohol was excluded because it made a minor contribution to overall intake and did not apply to children. The SoFAS terminology also negated nutrient-dense foods that were consumed in amounts above the recommendations for the specific food groups in the food patterns. The ambiguous SoFAS terminology was later changed to "empty calories" to reflect only those calories from solid fats and added sugars (and alcohol if consumed beyond moderate amounts). The purpose of this review is to provide an historical perspective on how the dietary recommendations went from SoFAAS to SoFAS and how discretionary calories went to empty calories between the 2005 and 2010
Natural (Mineral, Vegetable, Coconut, Essential) Oils and Contact Dermatitis.
Verallo-Rowell, Vermén M; Katalbas, Stephanie S; Pangasinan, Julia P
2016-07-01
Natural oils include mineral oil with emollient, occlusive, and humectant properties and the plant-derived essential, coconut, and other vegetable oils, composed of triglycerides that microbiota lipases hydrolyze into glycerin, a potent humectant, and fatty acids (FAs) with varying physico-chemical properties. Unsaturated FAs have high linoleic acid used for synthesis of ceramide-I linoleate, a barrier lipid, but more pro-inflammatory omega-6:-3 ratios above 10:1, and their double bonds form less occlusive palisades. VCO FAs have a low linoleic acid content but shorter and saturated FAs that form a more compact palisade, more anti-inflammatory omega-6:-3 ratio of 2:1, close to 7:1 of olive oil, which disrupts the skin barrier, otherwise useful as a penetration enhancer. Updates on the stratum corneum illustrate how this review on the contrasting actions of NOs provide information on which to avoid and which to select for barrier repair and to lower inflammation in contact dermatitis genesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Wieckowski, Eva; Atarashi, Yoshinari; Stanson, Joanna; Sato, Taka-Aki; Whiteside, Theresa L
2007-01-01
Molecular mechanisms responsible for tumor resistance to apoptosis often involve the Fas/FasL pathway. While squamous cell carcinomas of the head and neck (SCCHN) express both Fas and FasL, their resistance to self-induced apoptosis or apoptosis mediated by Fas agonistic antibody (CH-11Ab) was independent of the level of Fas surface expression or the presence of soluble Fas in supernatants of primary or metastatic SCCHN cell lines. By in vitro immunoselection, using PCI-15A cell line treated with successive cycles of CH-11 Ab, Fas-resistant sublines with the parental genotype were selected. Such sublines failed to cleave caspase-8 upon Fas engagement and were resistant to CH-11 Ab, although they remained sensitive to VP-16 or staurosporin. In the presence of cycloheximide, the selected SCCHN sublines become susceptible to CH-11 Ab, and showed cleavage of caspase-8, suggesting that apoptosis resistance was mediated by an inhibitory protein(s) acting upstream of caspase-8. Overexpression of Fas-associated phosphatase 1 (FAP-1), but not cellular FLICE-inhibitory protein (cFLIP) in SCCHN sublines was documented by Western blots and RT-PCR analyses. The FAP-1+ selected sublines also downregulated cell surface Fas. A high phosphorylation level of IkappaB kappa, NFkappaB activation and upregulation of Bcl-2 expression were observed in the FAP-1+ sublines. Treatment with the phosphatase inhibitor, orthovanadate, or silencing of FAP-1 with siRNA abolished their resistance to apoptosis, suggesting that FAP-1 phosphatase activity could be responsible for NF-kappaB activation and resistance of SCCHN cells to Fas-mediated apoptosis. 2006 Wiley-Liss, Inc.
Tasharrofi, Nooshin; Kouhkan, Fatemeh; Soleimani, Masoud; Soheili, Zahra-Sheila; Kabiri, Mahboubeh; Mahmoudi Saber, Mohaddeseh; Dorkoosh, Farid Abedin
2017-12-01
Oxidative conditions of the eye could contribute to retinal cells loss through activating the Fas-L/Fas pathway. This phenomenon is one of the leading causes of some ocular diseases like age-related macular degeneration (AMD). By targeting proteins at their mRNA level, microRNAs (miRNAs) can regulate gene expression and cell function. The aim of the present study is to investigate Fas targeting by miR-374a and find whether it can inhibit Fas-mediated apoptosis in primary human retinal pigment epithelial (RPE) cells under oxidative stress. So, the primary human RPE cells were transfected with pre-miR-374a pLEX construct using polymeric carrier and were exposed to H 2 O 2 (200 μM) as an oxidant agent for induction of Fas expression. Fas expression at mRNA and protein level was evaluated by quantitative real-time PCR and Western blot analysis, respectively. These results revealed that miR-374a could prevent Fas upregulation under oxidative conditions. Moreover, Luciferase activity assay confirmed that Fas could be a direct target of miR-374a. The cell viability studies demonstrated that caspase-3 activity was negligible in miR-374a treated cells compared to the controls. Our data suggest miR-374a is a negative regulator of Fas death receptor which is able to enhance the cell survival and protect RPE cells against oxidative conditions. J. Cell. Biochem. 118: 4854-4861, 2017. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Fatty acids of erythrocyte membrane in acute pancreatitis patients.
Kuliaviene, Irma; Gulbinas, Antanas; Cremers, Johannes; Pundzius, Juozas; Kupcinskas, Limas; Dambrauskas, Zilvinas; Jansen, Eugene
2013-09-14
To evaluate changes in the fatty acid composition of erythrocyte membrane phospholipids during severe and mild acute pancreatitis (AP) of alcoholic and nonalcoholic etiology. All consecutive patients with a diagnosis of AP and onset of the disease within the last 72 h admitted to the Hospital of Lithuanian University of Health Sciences between June and December 2007 were included. According to the Acute Physiology and Chronic Health Evaluation (APACHE II) scale, the patients were subdivided into the mild (APACHE II score < 7, n = 22) and severe (APACHE II score ≥ 7, n = 17) AP groups. Healthy individuals (n = 26) were enrolled as controls. Blood samples were collected from patients on admission to the hospital. Fatty acids (FAs) were extracted from erythrocyte phospholipids and expressed as percentages of the total FAs present in the chromatogram. The concentrations of superoxide dismutase and glutathione peroxidase were measured in erythrocytes. We found an increase in the percentages of saturated and monounsaturated FAs, a decrease in the percentages of total polyunsaturated FAs (PUFAs) and n-3 PUFAs in erythrocyte membrane phospholipids of AP patients compared with healthy controls. Palmitic (C16:0), palmitoleic (C16:1n7cis), arachidonic (C20:4n6), docosahexaenoic (DHA, C22:6n3), and docosapentaenoic (DPA, C22:5n3) acids were the major contributing factors. A decrease in the peroxidation and unsaturation indexes in AP patients as well as the severe and mild AP groups as compared with controls was observed. The concentrations of antioxidant enzymes in the mild AP group were lower than in the control group. In severe AP of nonalcoholic etiology, the percentages of arachidic (C20:0) and arachidonic (C20:4n6) acids were decreased as compared with the control group. The patients with mild AP of nonalcoholic etiology had the increased percentages of total saturated FAs and gama linoleic acid (C18:3n6) and the decreased percentages of elaidic (C18:1n9t
Fatty acids of erythrocyte membrane in acute pancreatitis patients
Kuliaviene, Irma; Gulbinas, Antanas; Cremers, Johannes; Pundzius, Juozas; Kupcinskas, Limas; Dambrauskas, Zilvinas; Jansen, Eugene
2013-01-01
AIM: To evaluate changes in the fatty acid composition of erythrocyte membrane phospholipids during severe and mild acute pancreatitis (AP) of alcoholic and nonalcoholic etiology. METHODS: All consecutive patients with a diagnosis of AP and onset of the disease within the last 72 h admitted to the Hospital of Lithuanian University of Health Sciences between June and December 2007 were included. According to the Acute Physiology and Chronic Health Evaluation (APACHE II) scale, the patients were subdivided into the mild (APACHE II score < 7, n = 22) and severe (APACHE II score ≥ 7, n = 17) AP groups. Healthy individuals (n = 26) were enrolled as controls. Blood samples were collected from patients on admission to the hospital. Fatty acids (FAs) were extracted from erythrocyte phospholipids and expressed as percentages of the total FAs present in the chromatogram. The concentrations of superoxide dismutase and glutathione peroxidase were measured in erythrocytes. RESULTS: We found an increase in the percentages of saturated and monounsaturated FAs, a decrease in the percentages of total polyunsaturated FAs (PUFAs) and n-3 PUFAs in erythrocyte membrane phospholipids of AP patients compared with healthy controls. Palmitic (C16:0), palmitoleic (C16:1n7cis), arachidonic (C20:4n6), docosahexaenoic (DHA, C22:6n3), and docosapentaenoic (DPA, C22:5n3) acids were the major contributing factors. A decrease in the peroxidation and unsaturation indexes in AP patients as well as the severe and mild AP groups as compared with controls was observed. The concentrations of antioxidant enzymes in the mild AP group were lower than in the control group. In severe AP of nonalcoholic etiology, the percentages of arachidic (C20:0) and arachidonic (C20:4n6) acids were decreased as compared with the control group. The patients with mild AP of nonalcoholic etiology had the increased percentages of total saturated FAs and gama linoleic acid (C18:3n6) and the decreased percentages of elaidic
Expression of fas protein on CD4+T cells irradiated by low level He-Ne
NASA Astrophysics Data System (ADS)
Nie, Fan; Zhu, Jing; Zhang, Hui-Guo
2005-07-01
Objective: To investigate the influence on the Expression of Fas protein on CD4+ T cells irradiated by low level He-Ne laser in the cases of psoriasis. Methods:the expression of CD4+ T Fas protein was determined in the casee of psoriasis(n=5) pre and post-low level laser irradiation(30 min、60min and 120min)by flow cytometry as compared withthe control(n=5). Results:In the cases of psoriasis,the expression of CD4+T FAS protein 21.4+/-3.1% was increased significantly than that of control group 16.8+/-2.1% pre-irradiation, p<0.05in the control,there is no difference between pre and post- irradiation,p>0.05in the cases , the expression of CD4+T Fas protein wae positively corelated to the irradiation times, when the energy density arrived to 22.92J/cm2(60 minutes)and 45.84J/cm2(120minutes), the expression of CD4+ T Fas protein was increased significantly as compared with pre-irradiation,p<0.05.Conclusion: The expression of CD4+T Fas protein may be increased by low level He-Ne laser irradiation ,the uncontrolled status of apoptosis could be corrected.
Salimon, Jumat; Omar, Talal A.; Salih, Nadia
2014-01-01
Two different procedures for the methylation of fatty acids (FAs) and trans fatty acids (TFAs) in food fats were compared using gas chromatography (GC-FID). The base-catalyzed followed by an acid-catalyzed method (KOCH3/HCl) and the base-catalyzed followed by (trimethylsilyl)diazomethane (TMS–DM) method were used to prepare FA methyl esters (FAMEs) from lipids extracted from food products. In general, both methods were suitable for the determination of cis/trans FAs. The correlation coefficients (r) between the methods were relatively small (ranging from 0.86 to 0.99) and had a high level of agreement for the most abundant FAs. The significant differences (P = 0.05) can be observed for unsaturated FAs (UFAs), specifically for TFAs. The results from the KOCH3/HCl method showed the lowest recovery values (%R) and higher variation (from 84% to 112%), especially for UFAs. The TMS-DM method had higher R values, less variation (from 90% to 106%), and more balance between variation and %RSD values in intraday and interday measurements (less than 4% and 6%, resp.) than the KOCH3/HCl method, except for C12:0, C14:0, and C18:0. Nevertheless, the KOCH3/HCl method required shorter time and was less expensive than the TMS-DM method which is more convenient for an accurate and thorough analysis of rich cis/trans UFA samples. PMID:24719581
Salimon, Jumat; Omar, Talal A; Salih, Nadia
2014-01-01
Two different procedures for the methylation of fatty acids (FAs) and trans fatty acids (TFAs) in food fats were compared using gas chromatography (GC-FID). The base-catalyzed followed by an acid-catalyzed method (KOCH3/HCl) and the base-catalyzed followed by (trimethylsilyl)diazomethane (TMS-DM) method were used to prepare FA methyl esters (FAMEs) from lipids extracted from food products. In general, both methods were suitable for the determination of cis/trans FAs. The correlation coefficients (r) between the methods were relatively small (ranging from 0.86 to 0.99) and had a high level of agreement for the most abundant FAs. The significant differences (P = 0.05) can be observed for unsaturated FAs (UFAs), specifically for TFAs. The results from the KOCH3/HCl method showed the lowest recovery values (%R) and higher variation (from 84% to 112%), especially for UFAs. The TMS-DM method had higher R values, less variation (from 90% to 106%), and more balance between variation and %RSD values in intraday and interday measurements (less than 4% and 6%, resp.) than the KOCH3/HCl method, except for C12:0, C14:0, and C18:0. Nevertheless, the KOCH3/HCl method required shorter time and was less expensive than the TMS-DM method which is more convenient for an accurate and thorough analysis of rich cis/trans UFA samples.
Acyl-CoA-Binding Protein ACBP1 Modulates Sterol Synthesis during Embryogenesis.
Lung, Shiu-Cheung; Liao, Pan; Yeung, Edward C; Hsiao, An-Shan; Xue, Yan; Chye, Mee-Len
2017-07-01
Fatty acids (FAs) and sterols are primary metabolites that exert interrelated functions as structural and signaling lipids. Despite their common syntheses from acetyl-coenzyme A, homeostatic cross talk remains enigmatic. Six Arabidopsis ( Arabidopsis thaliana ) acyl-coenzyme A-binding proteins (ACBPs) are involved in FA metabolism. ACBP1 interacts with PHOSPHOLIPASE Dα1 and regulates phospholipid composition. Here, its specific role in the negative modulation of sterol synthesis during embryogenesis is reported. ACBP1, likely in a liganded state, interacts with STEROL C4-METHYL OXIDASE1-1 (SMO1-1), a rate-limiting enzyme in the sterol pathway. Proembryo abortion in the double mutant indicated that the ACBP1-SMO1-1 interaction is synthetic lethal, corroborating with their strong promoter activities in developing ovules. Gas chromatography-mass spectrometry revealed quantitative and compositional changes in FAs and sterols upon overexpression or mutation of ACBP1 and/or SMO1-1 Aberrant levels of these metabolites may account for the downstream defect in lipid signaling. GLABRA2 ( GL2 ), encoding a phospholipid/sterol-binding homeodomain transcription factor, was up-regulated in developing seeds of acbp1 , smo1-1 , and ACBP1 +/- smo1-1 in comparison with the wild type. Consistent with the corresponding transcriptional alteration of GL2 targets, high-oil, low-mucilage phenotypes of gl2 were phenocopied in ACBP1 +/- smo1-1 Thus, ACBP1 appears to modulate the metabolism of two important lipid classes (FAs and sterols) influencing cellular signaling. © 2017 American Society of Plant Biologists. All Rights Reserved.
Genetic disruption of oncogenic Kras sensitizes lung cancer cells to Fas receptor-mediated apoptosis
Mou, Haiwei; Moore, Jill; Malonia, Sunil K.; Li, Yingxiang; Ozata, Deniz M.; Hough, Soren; Song, Chun-Qing; Smith, Jordan L.; Fischer, Andrew; Weng, Zhiping; Xue, Wen
2017-01-01
Genetic lesions that activate KRAS account for ∼30% of the 1.6 million annual cases of lung cancer. Despite clinical need, KRAS is still undruggable using traditional small-molecule drugs/inhibitors. When oncogenic Kras is suppressed by RNA interference, tumors initially regress but eventually recur and proliferate despite suppression of Kras. Here, we show that tumor cells can survive knockout of oncogenic Kras, indicating the existence of Kras-independent survival pathways. Thus, even if clinical KRAS inhibitors were available, resistance would remain an obstacle to treatment. Kras-independent cancer cells exhibit decreased colony formation in vitro but retain the ability to form tumors in mice. Comparing the transcriptomes of oncogenic Kras cells and Kras knockout cells, we identified 603 genes that were specifically up-regulated in Kras knockout cells, including the Fas gene, which encodes a cell surface death receptor involved in physiological regulation of apoptosis. Antibodies recognizing Fas receptor efficiently induced apoptosis of Kras knockout cells but not oncogenic Kras-expressing cells. Increased Fas expression in Kras knockout cells was attributed to decreased association of repressive epigenetic marks at the Fas promoter. Concordant with this observation, treating oncogenic Kras cells with histone deacetylase inhibitor and Fas-activating antibody efficiently induced apoptosis, thus bypassing the need to inhibit Kras. Our results suggest that activation of Fas could be exploited as an Achilles’ heel in tumors initiated by oncogenic Kras. PMID:28320962
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Lee, Hye-Jeong; Kim, Ji Young; Park, Ji Eun; Yoon, Yong-Dal; Tsang, Benjamin K; Kim, Jong-Min
2016-12-01
Fas ligand (FasL) and its receptor Fas have been implicated in granulosa cell apoptosis during follicular atresia. Although interferon-gamma (IFN-γ) is believed to be involved in the regulation Fas expression in differentiated granulosa or granulosa-luteal cells, the expression of this cytokine and its role in the regulation of the granulosa cell Fas/FasL system and apoptosis during follicular maturation have not been thoroughly investigated. In the present study, we have examined the presence of IFN-γ in ovarian follicles at different stage of development by immunohistochemistry and related their relative intensities with follicular expression of Fas and FasL, and with differences in granulosa cell sensitivity to Fas activation by exogenous agonistic Anti-Fas monoclonal antibody (Fas mAb). Although IFN-γ immunostaining was detectable in oocyte and granulosa cells in antral follicles, most intense immunoreactivity for the cytokine was observed in these cells of preantral follicles. Intense immunoreactivity for IFN-γ was most evident in granulosa cells of atretic early antral follicles where increased Fas and FasL expression and apoptosis were also observed. Whereas low concentrations of IFN-γ (10-100 U/mL) significantly increased Fas expression in undifferentiated granulosa cells (from preantral or very early antral follicles) in vitro , very higher concentrations (≥ 1,000 U/mL) were required to up-regulate of Fas in differentiated cells isolated from eCG-primed (antral) follicles. Addition of agonistic Fas mAb to cultures of granulosa cells at the two stages of differentiation and pretreated with IFN-γ (100 U/mL) elicited morphological and biochemical apoptotic features which were more prominent in cells not previously exposed to the gonadotropin in vivo . These findings suggested that IFN-γ is an important physiologic intra-ovarian regulator of follicular atresia and plays a pivotal role in regulation of expression of Fas receptor and subsequent
Lee, Hye-Jeong; Kim, Ji Young; Park, Ji Eun; Yoon, Yong-Dal; Tsang, Benjamin K.; Kim, Jong-Min
2016-01-01
ABSTRACT Fas ligand (FasL) and its receptor Fas have been implicated in granulosa cell apoptosis during follicular atresia. Although interferon-gamma (IFN-γ) is believed to be involved in the regulation Fas expression in differentiated granulosa or granulosa-luteal cells, the expression of this cytokine and its role in the regulation of the granulosa cell Fas/FasL system and apoptosis during follicular maturation have not been thoroughly investigated. In the present study, we have examined the presence of IFN-γ in ovarian follicles at different stage of development by immunohistochemistry and related their relative intensities with follicular expression of Fas and FasL, and with differences in granulosa cell sensitivity to Fas activation by exogenous agonistic Anti-Fas monoclonal antibody (Fas mAb). Although IFN-γ immunostaining was detectable in oocyte and granulosa cells in antral follicles, most intense immunoreactivity for the cytokine was observed in these cells of preantral follicles. Intense immunoreactivity for IFN-γ was most evident in granulosa cells of atretic early antral follicles where increased Fas and FasL expression and apoptosis were also observed. Whereas low concentrations of IFN-γ (10-100 U/mL) significantly increased Fas expression in undifferentiated granulosa cells (from preantral or very early antral follicles) in vitro, very higher concentrations (≥ 1,000 U/mL) were required to up-regulate of Fas in differentiated cells isolated from eCG-primed (antral) follicles. Addition of agonistic Fas mAb to cultures of granulosa cells at the two stages of differentiation and pretreated with IFN-γ (100 U/mL) elicited morphological and biochemical apoptotic features which were more prominent in cells not previously exposed to the gonadotropin in vivo. These findings suggested that IFN-γ is an important physiologic intra-ovarian regulator of follicular atresia and plays a pivotal role in regulation of expression of Fas receptor and subsequent
Muraki, Michiro; Hirota, Kiyonori
2017-07-03
Fas ligand plays a key role in the human immune system as a major cell death inducing protein. The extracellular domain of human Fas ligand (hFasLECD) triggers apoptosis of malignant cells, and therefore is expected to have substantial potentials in medical biotechnology. However, the current application of this protein to clinical medicine is hampered by a shortage of the benefits relative to the drawbacks including the side-effects in systemic administration. Effective procedures for the engineering of the protein by attaching useful additional functions are required to overcome the problem. A procedure for the site-specific chemical conjugation of hFasLECD with a fluorochrome and functional proteins was devised using an inverse-electron-demand Diels-Alder reaction between trans-cyclooctene group and methyltetrazine group. The conjugations in the present study were attained by using much less molar excess amounts of the compounds to be attached as compared with the conventional chemical modification reactions using maleimide derivatives in the previous study. The isolated conjugates of hFasLECD with sulfo-Cy3, avidin and rabbit IgG Fab' domain presented the functional and the structural integrities of the attached molecules without impairing the specific binding activity toward human Fas receptor extracellular domain. The present study provided a new fundamental strategy for the production of the engineered hFasLECDs with additional beneficial functions, which will lead to the developments of the improved diagnostic systems and the effective treatment methods of serious diseases by using this protein as a component of novel molecular tools.
Fas- and Mitochondria-Mediated Signaling Pathway Involved in Osteoblast Apoptosis Induced by AlCl3.
Xu, Feibo; Ren, Limin; Song, Miao; Shao, Bing; Han, Yanfei; Cao, Zheng; Li, Yanfei
2018-07-01
Aluminum (Al) is known to induce apoptosis of osteoblasts (OBs). However, the mechanism is not yet established. To investigate the apoptotic mechanism of OBs induced by aluminum trichloride (AlCl 3 ), the primary OBs from the craniums of fetal Wistar rats were exposed to 0 mg/mL (control group, CG), 0.06 mg/mL (low-dose group, LG), 0.12 mg/mL (mid-dose group, MG), and 0.24 mg/mL (high-dose group, HG) AlCl 3 for 24 h, respectively. We observed that AlCl 3 induced OB apoptosis with the appearance of apoptotic morphology and increase of apoptosis rate. Additionally, AlCl 3 treatment activated mitochondrial-mediated signaling pathway, accompanied by mitochondrial membrane potential (ΔΨm) depolarization, release of cytochrome c from the mitochondria to the cytoplasm, as well as survival signal-related factor caspase-9 and caspase-3 activation. AlCl 3 exposure also activated Fas/Fas ligand signaling pathway, presented as Fas, Fas ligand, and Fas-associated death domain expression enhancement and caspase-8 activation, as well as the hydrolysis of Bid to truncated Bid, suggesting that the Fas-mediated signaling pathway might aggravate mitochondria-mediated OB apoptosis through hydrolyzing Bid. Furthermore, AlCl 3 exposure inhibited Bcl-2 protein expression and increased the expressions of Bax, Bak, and Bim in varying degrees. These results indicated that AlCl 3 exposure induced OB apoptosis through activating Fas- and mitochondria-mediated signaling pathway and disrupted B-cell lymphoma-2 family proteins.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Kojima, H; Eshima, K; Takayama, H; Sitkovsky, M V
1997-09-15
Exquisite specificity toward Ag-bearing cells (cognate targets) is one of the most important properties of CD8+ CTL-mediated cytotoxicity. Using highly Ag-specific CD8+ CTL lines and clones, which spare noncognate, Ag-free targets, we found that in the presence of Ag-bearing targets the CTL acquire the ability to lyse noncognate target cells (bystanders). It is shown that the unexpectedly rapid and efficient lysis of bystanders by Ag-activated CTL is mediated by a Fas ligand (FasL)/Fas-based mechanism and does not depend on perforin. The CTL lysed Fas-expressing bystanders, but spared the Fas-negative or anti-Fas mAb-resistant bystander cells. Accordingly, the FasL-deficient gld/gld CTL did not kill bystanders, while perforin-deficient CTL did. Unlike anti-Fas mAb-induced cell death, the lysis of bystanders was not only FasL/Fas dependent but also required adhesion molecule LFA-1 on the surface of the activated CTL. Lysis of bystanders is viewed as acceptable "collateral" damage, but the persistent presence of activated CTL could result in immunopathologies involving functional Fas-expressing tissues.
NASA Astrophysics Data System (ADS)
Nishimura, Mitsugu; Baker, Earl W.
1987-06-01
Five recent sediment samples from a variety of North American continental shelves were analyzed for fatty acids (FAs) in the solvent-extractable (SOLEX) lipids as well as four types of non-solvent extractable (NONEX) lipids. The NONEX lipids were operationally defined by the succession of extraction procedure required to recover them. The complete procedure included (i) very mild acid treatment, (ii) HF digestion and (iii) saponification of the sediment residue following exhaustive solvent extraction. The distribution pattern and various compositional parameters of SOLEX FAs in the five sediments were divided into three different groups, indicating the difference of biological sources and also diagenetic factors and processes among the three groups of samples. Nevertheless, the compositions of the corresponding NONEX FAs after acid treatment were surprisingly very similar. This was also true for the remaining NONEX FA groups in the five sediment samples. The findings implied that most of the NONEX FAs reported here are derived directly from living organisms. It is also concluded that a large part of NONEX FAs are much more resistant to biodegradation than we have thought, so that they can form the large percentage of total lipids with increasing depth of water and sediments.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Inhibition of Fatty Acid Synthase in Prostate Cancer by Orlistat, a Novel Therapeutic
2007-11-01
up large amount of proteins and lipids through their daily diet . Therefore, the levels of FAS in most tissues are low. In human tissue, FAS is...in the type and level of fats in diet and inhibition of de novo lipogenesis may hold a great promise in the prevention and treatment of cancers. Lipids...synthesis, and multiple signaling pathways. Some lipids are obtained exclusively from diet , whereas others can also be synthesized de novo. A large
Genetic variability of milk fatty acids.
Arnould, V M-R; Soyeurt, H
2009-01-01
The milk fatty acid (FA) profile is far from the optimal fat composition in regards to human health. The natural sources of variation, such as feeding or genetics, could be used to increase the concentrations of unsaturated fatty acids. The impact of feeding is well described. However, genetic effects on the milk FA composition begin to be extensively studied. This paper summarizes the available information about the genetic variability of FAs. The greatest breed differences in FA composition are observed between Holstein and Jersey milk. Milk fat of the latter breed contains higher concentrations of saturated FAs, especially short-chain FAs. The variation of the delta-9 desaturase activity estimated from specific FA ratios could explain partly these breed differences. The choice of a specific breed seems to be a possibility to improve the nutritional quality of milk fat. Generally, the proportions of FAs in milk are more heritable than the proportions of these same FAs in fat. Heritability estimates range from 0.00 to 0.54. The presence of some single nucleotide polymorphisms could explain partly the observed individual genetic variability. The polymorphisms detected on SCD1 and DGAT1 genes influence the milk FA composition. The SCD1 V allele increases the unsaturation of C16 and C18. The DGAT1 A allele is related to the unsaturation of C18. So, a combination of the molecular and quantitative approaches should be used to develop tools helping farmers in the selection of their animals to improve the nutritional quality of the produced milk fat.
Theoretical Analysis of Fas Ligand-Induced Apoptosis with an Ordinary Differential Equation Model.
Shi, Zhimin; Li, Yan; Liu, Zhihai; Mi, Jun; Wang, Renxiao
2012-12-01
Upon the treatment of Fas ligand, different types of cells exhibit different apoptotic mechanisms, which are determined by a complex network of biological pathways. In order to derive a quantitative interpretation of the cell sensitivity and apoptosis pathways, we have developed an ordinary differential equation model. Our model is intended to include all of the known major components in apoptosis pathways mediated by Fas receptor. It is composed of 29 equations using a total of 49 rate constants and 13 protein concentrations. All parameters used in our model were derived through nonlinear fitting to experimentally measured concentrations of four selected proteins in Jurkat T-cells, including caspase-3, caspase-8, caspase-9, and Bid. Our model is able to correctly interpret the role of kinetic parameters and protein concentrations in cell sensitivity to FasL. It reveals the possible reasons for the transition between type-I and type-II pathways and also provides some interesting predictions, such as the more decisive role of Fas over Bax in apoptosis pathway and a possible feedback mechanism between type-I and type-II pathways. But our model failed in predicting FasL-induced apoptotic mechanism of NCI-60 cells from their gene-expression levels. Limitations in our model are also discussed. Copyright © 2012 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Modiano, Jaime F; Bellgrau, Donald; Cutter, Gary R; Lana, Susan E; Ehrhart, Nicole P; Ehrhart, EJ; Wilke, Vicki L; Charles, J Brad; Munson, Sibyl; Scott, Milcah C; Pozniak, John; Carlson, Cathy S; Schaack, Jerome; Duke, Richard C
2012-01-01
Fas ligand (FasL) gene therapy for cancer has shown promise in rodents; however, its efficacy in higher mammals remains unknown. Here, we used intratumoral FasL gene therapy delivered in an adenovirus vector (Ad-FasL) as neoadjuvant to standard of care in 56 dogs with osteosarcoma. Tumors from treated dogs had greater inflammation, necrosis, apoptosis, and fibrosis at day 10 (amputation) compared to pretreatment biopsies or to tumors from dogs that did not receive Ad-FasL. Survival improvement was apparent in dogs with inflammation or lymphocyte-infiltration scores >1 (in a 3-point scale), as well as in dogs that had apoptosis scores in the top 50th percentile (determined by cleaved caspase-3). Survival was no different than that expected from standard of care alone in dogs with inflammation scores ≤1 or apoptosis scores in the bottom 50th percentile. Reduced Fas expression by tumor cells was associated with prognostically advantageous inflammation, and this was seen only in dogs that received Ad-FasL. Together, the data suggest that Ad-FasL gene therapy improves survival in a subset of large animals with naturally occurring tumors, and that at least in some tumor types like osteosarcoma, it is most effective when tumor cells fail to express Fas. PMID:22850679
Functional Polymorphisms of FAS and FASL Gene and Risk of Breast Cancer – Pilot Study of 134 Cases
Fazaeli, Aliakbar; Eskandari-Nasab, Ebrahim; Arbabi, Farshid; Mashhadi, Mohammad Ali; Taheri, Mohsen; Chaabane, Wiem; Jain, Mayur V.; Łos, Marek J.
2013-01-01
Fas/Fas ligand (FasL) system is one of the key apoptotic signaling entities in the extrinsic apoptotic pathway. De-regulation of this pathway, i.e. by mutations may prevent the immune system from the removal of newly-formed tumor cells, and thus lead to tumor formation. The present study investigated the association between −1377 G/A (rs2234767) and −670 A/G (rs1800682) polymorphisms in Fas as well as single nucleotide polymorphisms INV2nt −124 A/G (rs5030772) and −844 C/T (rs763110) in FasL in a sample of Iranian patients with breast cancer. This case-control study was done on 134 breast cancer patients and 152 normal women. Genomic DNA was extracted from whole blood samples. The polymorphisms were determined by using tetra-ARMS-PCR method. There was no significant difference in the genotype distribution of FAS rs2234767 polymorphism between cases and controls. FAS rs1800682, FASL rs5030772, and FASL rs763110 genotypes showed significant associations with an increasing risk of breast cancer (odds ratio OR = 3.18, P = 0.019; OR = 5.08, P = 0.012; OR = 2.40, P = 0.024, respectively). In conclusion, FAS rs2234767 was not associated with breast cancer risk. Though, FAS rs1800682, FASL rs5030772, and FASL rs763110 polymorphisms were associated with the risk of breast cancer in the examined population. PMID:23326385
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Functional polymorphisms in cell death pathway genes FAS and FASL contribute to risk of lung cancer.
Zhang, X; Miao, X; Sun, T; Tan, W; Qu, S; Xiong, P; Zhou, Y; Lin, D
2005-06-01
The FAS and FASL system plays a key role in regulating apoptotic cell death and corruption of this signalling pathway has been shown to participate in immune escape and tumorigenesis. There is reduced expression of FAS but elevated expression of FASL in many types of human cancers including lung cancer. We recently reported an association between functional polymorphisms in FAS (-1377G-->A) and FASL (-844T-->C) and risk of oesophageal cancer. To examine the contribution of these polymorphisms to risk of developing lung cancer. Genotypes of 1000 lung cancer patients and 1270 controls were analysed by PCR based restriction fragment length polymorphism. Associations with risk of lung cancer were estimated by logistic regression. Compared with non-carriers, there was a 1.6 fold excess risk of developing lung cancer for carriers of the FAS -1377AA genotype (odds ratio (OR) 1.59, 95% confidence interval (CI) 1.21 to 2.10; p = 0.001), and 1.8 fold excess risk (OR 1.79, 95% CI 1.26 to 2.52; p = 0.001) for carriers of FASL -844CC. Gene-gene interaction of FAS and FASL polymorphisms increased risk of lung cancer in a multiplicative manner (OR for the carriers of both FAS -1377AA and FASL -844CC genotypes 4.18, 95% CI 2.83 to 6.18). Gene-environment interaction of FAS or FASL polymorphism and smoking associated with increased risk of lung cancer was also found. These results are consistent with our initial findings in oesophageal cancer and further support the hypothesis that the FAS and FASL triggered apoptosis pathway plays an important role in human carcinogenesis.
Akt-mediated anti-apoptotic effects of substance P in Anti-Fas-induced apoptosis of human tenocytes
Backman, Ludvig J; Danielson, Patrik
2013-01-01
Substance P (SP) and its receptor, the neurokinin-1 receptor (NK-1 R), are expressed by human tenocytes, and they are both up-regulated in cases of tendinosis, a condition associated with excessive apoptosis. It is known that SP can phosphorylate/activate the protein kinase Akt, which has anti-apoptotic effects. This mechanism has not been studied for tenocytes. The aims of this study were to investigate if Anti-Fas treatment is a good apoptosis model for human tenocytes in vitro, if SP protects from Anti-Fas-induced apoptosis, and by which mechanisms SP mediates an anti-apoptotic response. Anti-Fas treatment resulted in a time- and dose-dependent release of lactate dehydrogenase (LDH), i.e. induction of cell death, and SP dose-dependently reduced the Anti-Fas-induced cell death through a NK-1 R specific pathway. The same trend was seen for the TUNEL assay, i.e. SP reduced Anti-Fas-induced apoptosis via NK-1 R. In addition, it was shown that SP reduces Anti-Fas-induced decrease in cell viability as shown with crystal violet assay. Protein analysis using Western blot confirmed that Anti-Fas induces cleavage/activation of caspase-3 and cleavage of PARP; both of which were inhibited by SP via NK-1 R. Finally, SP treatment resulted in phosphorylation/activation of Akt as shown with Western blot, and it was confirmed that the anti-apoptotic effect of SP was, at least partly, induced through the Akt-dependent pathway. In conclusion, we show that SP reduces Anti-Fas-induced apoptosis in human tenocytes and that this anti-apoptotic effect of SP is mediated through NK-1 R and Akt-specific pathways. PMID:23577779
Cystic fibrosis epithelial cells are primed for apoptosis as a result of increased Fas (CD95).
Chen, Qiwei; Pandi, Sudha Priya Soundara; Kerrigan, Lauren; McElvaney, Noel G; Greene, Catherine M; Elborn, J Stuart; Taggart, Clifford C; Weldon, Sinéad
2018-02-24
Previous work suggests that apoptosis is dysfunctional in cystic fibrosis (CF) airways with conflicting results. We evaluated the relationship between dysfunctional cystic fibrosis transmembrane conductance regulator (CFTR) and apoptosis in CF airway epithelial cells. Apoptosis and associated caspase activity were analysed in non-CF and CF tracheal and bronchial epithelial cell lines. Basal levels of apoptosis and activity of caspase-3 and caspase-8 were significantly increased in CF epithelial cells compared to controls, suggesting involvement of extrinsic apoptosis signalling, which is mediated by the activation of death receptors, such as Fas (CD95). Increased levels of Fas were observed in CF epithelial cells and bronchial brushings from CF patients compared to non-CF controls. Neutralisation of Fas significantly inhibited caspase-3 activity in CF epithelial cells compared to untreated cells. In addition, activation of Fas significantly increased caspase-3 activity and apoptosis in CF epithelial cells compared to control cells. Overall, these results suggest that CF airway epithelial cells are more sensitive to apoptosis via increased levels of Fas and subsequent activation of the Fas death receptor pathway, which may be associated with dysfunctional CFTR. Copyright © 2018 European Cystic Fibrosis Society. All rights reserved.
Liu, Wei; Jing, Zhen-Tang; Wu, Shu-Xiang; He, Yun; Lin, Yan-Ting; Chen, Wan-Nan; Lin, Xin-Jian; Lin, Xu
2018-05-01
Acute liver failure is a serious clinical problem of which the underlying pathogenesis remains unclear and for which effective therapies are lacking. The Fas receptor/ligand system, which is negatively regulated by AKT, is known to play a prominent role in hepatocytic cell death. We hypothesized that AKT activation may represent a strategy to alleviate Fas-induced fulminant liver failure. We report here that a novel AKT activator, SC79, protects hepatocytes from apoptosis induced by agonistic anti-Fas antibody CH11 (for humans) or Jo2 (for mice) and significantly prolongs the survival of mice given a lethal dose of Jo2. Under Fas-signaling stimulation, SC79 inhibited Fas aggregation, prevented the recruitment of the adaptor molecule Fas-associated death domain (FADD) and procaspase-8 [or FADD-like IL-1β-converting enzyme (FLICE)] into the death-inducing signaling complex (DISC), but SC79 enhanced the recruitment of the long and short isoforms of cellular FLICE-inhibitory protein at the DISC. All of the SC79-induced hepatoprotective and DISC-interruptive effects were confirmed to have been reversed by the Akt inhibitor LY294002. These results strongly indicate that SC79 protects hepatocytes from Fas-induced fatal hepatic apoptosis. The potent alleviation of Fas-mediated hepatotoxicity by the relatively safe drug SC79 highlights the potential of our findings for immediate hepatoprotective translation. Copyright © 2018 American Society for Investigative Pathology. Published by Elsevier Inc. All rights reserved.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Dagorn, Flore; Couzinet-Mossion, Aurélie; Kendel, Melha; Beninger, Peter G.; Rabesaotra, Vony; Barnathan, Gilles; Wielgosz-Collin, Gaëtane
2016-01-01
Economic exploitation is one means to offset the cost of controlling invasive species, such as the introduced Pacific oyster (Crassostrea gigas Thunberg) on the French Atlantic coast. Total lipid and phospholipid (PL) fatty acids (FAs) and sterols were examined in an invasive population of C. gigas in Bourgneuf Bay, France, over four successive seasons, with a view to identify possible sources of exploitable substances. The total lipid level (% dry weight) varied from 7.1% (winter) to 8.6% (spring). Of this, PLs accounted for 28.1% (spring) to 50.4% (winter). Phosphatidylcholine was the dominant PL throughout the year (up to 74% of total PLs in winter). Plasmalogens were identified throughout the year as a series of eleven dimethylacetals (DMAs) with chain lengths between C16 and C20 (up to 14.5% of PL FAs + DMAs in winter). Thirty-seven FAs were identified in the PL FAs. Eicosapentaenoic acid (20:5n-3 EPA/7.53% to 14.5%) and docosahexaenoic acid (22:6n-3 DHA/5.51% to 9.5%) were the dominant polyunsaturated FAs in all seasons. Two non-methylene-interrupted dienoic (NMID) FAs were identified in all seasons: 7,13-docosadienoic and 7,15-docosadienoic acids, the latter being present at relatively high levels (up to 9.6% in winter). Twenty free sterols were identified, including cholesterol at 29.9% of the sterol mixture and about 33% of phytosterols. C. gigas tissues thus contained exploitable lipids for health benefits or as a potential source of high-quality commercial lecithin. PMID:27231919
7 CFR 1484.21 - How does FAS determine which Cooperator program applications are approved?
Code of Federal Regulations, 2013 CFR
2013-01-01
... FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Application and Fund Allocation § 1484.21 How does FAS... that effectively supports the strategic decision-making initiatives of the Government Performance and... creation, expansion, or maintenance of foreign markets, FAS seeks to identify those projects that would...
7 CFR 1484.21 - How does FAS determine which Cooperator program applications are approved?
Code of Federal Regulations, 2012 CFR
2012-01-01
... FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Application and Fund Allocation § 1484.21 How does FAS... that effectively supports the strategic decision-making initiatives of the Government Performance and... creation, expansion, or maintenance of foreign markets, FAS seeks to identify those projects that would...
7 CFR 1484.21 - How does FAS determine which Cooperator program applications are approved?
Code of Federal Regulations, 2014 CFR
2014-01-01
... FOREIGN MARKETS FOR AGRICULTURAL COMMODITIES Application and Fund Allocation § 1484.21 How does FAS... that effectively supports the strategic decision-making initiatives of the Government Performance and... creation, expansion, or maintenance of foreign markets, FAS seeks to identify those projects that would...
41 CFR 102-38.360 - What must an executive agency do to implement the eFAS program?
Code of Federal Regulations, 2011 CFR
2011-01-01
... agency do to implement the eFAS program? 102-38.360 Section 102-38.360 Public Contracts and Property... must an executive agency do to implement the eFAS program? (a) An executive agency must review the... value added services) of the eFAS SCs. Agencies should give full consideration to sales solutions...
41 CFR 102-38.360 - What must an executive agency do to implement the eFAS program?
Code of Federal Regulations, 2010 CFR
2010-07-01
... agency do to implement the eFAS program? 102-38.360 Section 102-38.360 Public Contracts and Property... must an executive agency do to implement the eFAS program? (a) An executive agency must review the... value added services) of the eFAS SCs. Agencies should give full consideration to sales solutions...
41 CFR 102-38.360 - What must an executive agency do to implement the eFAS program?
Code of Federal Regulations, 2014 CFR
2014-01-01
... agency do to implement the eFAS program? 102-38.360 Section 102-38.360 Public Contracts and Property... must an executive agency do to implement the eFAS program? (a) An executive agency must review the... value added services) of the eFAS SCs. Agencies should give full consideration to sales solutions...
41 CFR 102-38.360 - What must an executive agency do to implement the eFAS program?
Code of Federal Regulations, 2013 CFR
2013-07-01
... agency do to implement the eFAS program? 102-38.360 Section 102-38.360 Public Contracts and Property... must an executive agency do to implement the eFAS program? (a) An executive agency must review the... value added services) of the eFAS SCs. Agencies should give full consideration to sales solutions...
41 CFR 102-38.360 - What must an executive agency do to implement the eFAS program?
Code of Federal Regulations, 2012 CFR
2012-01-01
... agency do to implement the eFAS program? 102-38.360 Section 102-38.360 Public Contracts and Property... must an executive agency do to implement the eFAS program? (a) An executive agency must review the... value added services) of the eFAS SCs. Agencies should give full consideration to sales solutions...
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
THE EPIDEMIOLOGY OF FETAL ALCOHOL SYNDROME AND PARTIAL FAS IN A SOUTH AFRICAN COMMUNITY
May, Philip A.; Gossage, J. Phillip; Marais, Anna-Susan; Adnams, Colleen M.; Hoyme, H. Eugene; Jones, Kenneth L.; Robinson, Luther K.; Khaole, Nathaniel C.O.; Snell, Cudore; Kalberg, Wendy O.; Hendricks, Loretta; Brooke, Lesley; Stellavato, Chandra; Viljoen, Denis L.
2007-01-01
OBJECTIVES The prevalence and characteristics of fetal alcohol syndrome (FAS) and partial fetal alcohol syndrome (PFAS) were determined in a third primary school cohort in a community in South Africa (S.A.). METHODS An active case ascertainment, two-tier screening methodology, and the revised Institute of Medicine diagnostic criteria were employed among 818 first grade pupils. Characteristics of children with FAS and PFAS are contrasted with a randomly-selected control group. Data were collected and analyzed for children in the study regarding: 1.) physical growth and development, including dysmorphology, 2.) intelligence and behavioral characteristics, and 3.) their mother’s social, behavioral, and physical characteristics. RESULTS The rate of FAS and PFAS in this area continues as the highest reported in any overall community and is much higher than rates elsewhere. In this cohort it is 68.0 to 89.2 per 1,000. Severe episodic drinking on weekends among mothers of children with FAS and PFAS accounts for 96% of all alcohol consumed. Various measures of maternal drinking are significantly correlated with negative outcomes of children in the areas of non-verbal intelligence (-0.26), verbal intelligence (-0.28), problem behavior (0.31), and overall dysmorphology score (0.59). Significantly more FAS and PFAS exists among children of rural residents (OR = 3.79). CONCLUSIONS A high rate of FAS and PFAS was again documented in this community, and it has increased. Given population similarities, we suspect that other communities in the Western Cape Province of South Africa also have high rates. Programs for prevention are needed. PMID:17127017
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Nicklas, Theresa A; O’Neil, Carol E
2015-01-01
The diets of most US children and adults are poor, as reflected by low diet quality scores, when compared with the recommendations of the Dietary Guidelines for Americans (DGAs). Contributing to these low scores is that most Americans overconsume solid fats, which may contain saturated fatty acids and added sugars; although alcohol consumption was generally modest, it provided few nutrients. Thus, the 2005 DGAs generated a new recommendation: to reduce intakes of solid fats, alcohol, and added sugars (SoFAAS). What precipitated the emergence of the new SoFAAS terminology was the concept of discretionary calories (a “calorie” is defined as the amount of energy needed to increase the temperature of 1 kg of water by 1°C), which were defined as calories consumed after an individual had met his or her recommended nutrient intakes while consuming fewer calories than the daily recommendation. A limitation with this concept was that additional amounts of nutrient-dense foods consumed beyond the recommended amount were also considered discretionary calories. The rationale for this was that if nutrient-dense foods were consumed beyond recommended amounts, after total energy intake was met then this constituted excess energy intake. In the 2010 DGAs, the terminology was changed to solid fats and added sugars (SoFAS); thus, alcohol was excluded because it made a minor contribution to overall intake and did not apply to children. The SoFAS terminology also negated nutrient-dense foods that were consumed in amounts above the recommendations for the specific food groups in the food patterns. The ambiguous SoFAS terminology was later changed to “empty calories” to reflect only those calories from solid fats and added sugars (and alcohol if consumed beyond moderate amounts). The purpose of this review is to provide an historical perspective on how the dietary recommendations went from SoFAAS to SoFAS and how discretionary calories went to empty calories between the 2005
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
Fat in the heart: The enzymatic machinery regulating cardiac triacylglycerol metabolism.
Heier, Christoph; Haemmerle, Guenter
2016-10-01
The heart predominantly utilizes fatty acids (FAs) as energy substrate. FAs that enter cardiomyocytes can be activated and directly oxidized within mitochondria (and peroxisomes) or they can be esterified and intracellularly deposited as triacylglycerol (TAG) often simply referred to as fat. An increase in cardiac TAG can be a signature of the diseased heart and may implicate a minor role of TAG synthesis and breakdown in normal cardiac energy metabolism. Often overlooked, the heart has an extremely high TAG turnover and the transient deposition of FAs within the cardiac TAG pool critically determines the availability of FAs as energy substrate and signaling molecules. We herein review the recent literature regarding the enzymes and co-regulators involved in cardiomyocyte TAG synthesis and catabolism and discuss the interconnection of these metabolic pathways in the normal and diseased heart. This article is part of a Special Issue entitled: Heart Lipid Metabolism edited by G.D. Lopaschuk. Copyright © 2016 Elsevier B.V. All rights reserved.
Mohammadpour-Gharehbagh, Abbas; Salimi, Saeedeh; Keshavarzi, Farshid; Zakerian, Sepideh; Sajadian, Mojtaba; Mokhtari, Mojgan
2016-01-01
Background: Uterine leiomyoma (UL) is a benign tumor of uterine smooth muscle that affects women in reproductive ages. FAS has an important role in initial stages of apoptosis. Previous studies have shown an association between the FAS gene and tumorigenesis. In the present study, we evaluated the relationship between FAS A-670G (rs 1800682) and UL risk Methods: The FAS gene polymorphism of 155 women with UL and 157 healthy controls was analyzed by the polymerase chain reaction restriction fragment length polymorphism method Results: The AA, AG, and GG genotype frequencies of the FAS A-670G polymorphism were respectively 37.4, 42.6, and 20% in women with UL, and 46, 42.6, and 11.5% in healthy controls. The risk of UL in women was 1.5-fold greater in GG-genotype women than in AA-genotype women. The G allele frequencies were 41% in women with UL and 33% in healthy controls and statistically different (P = 0.03) Conclusion: The FAS polymorphism was associated with the risk of UL in a sample of Iranian women. PMID:28070535
[Experimental study on fas expression of spermatogenic cell in male rats induced by fluorine].
Xu, Rui; Shang, Weichao; Liu, Jianmin; Cheng, Xuemin; Ba, Yue; Huang, Hui; Cui, Liuxin
2010-05-01
To research the effect of fluorine on the expression of Fas protein, then study the mechanism of male reproductive toxicity induced by fluoride on molecular level. Thirty Wistar male rats were divided into control group, low-dose group and high-dose group. The NaF dosage for every group were 0,2 and 4g/L. The content of NaF in testis was measured by using fluorine selective electrode. Changes of testosterone and Fas protein were observed using the methods of radioimmunoassay, in situ hybridization. In addition, we observed the quality of spermatozoa. The testis fluoride content of two fluorine treatment groups were higher than that of control group (P < 0.05), and had a dose-dependent effect. The level of testosterone, the number and the livability of the spermatozoon in fluorotic groups were lower than those of control rats (P < 0.05), and the above indexes decreased with the incrase of dosage. The expression of Fas in spermatogenic cells and the sperm aberration of each fluorotic group were higher than control group (P < 0.05), both of them increased with the increase of dosage. Fluorin could reduce the level of serum testosterone, then activated the Fas/FasL system, which caused damage to the reprodutive system.
Chung, Ill-Min; Kim, Jae-Kwang; Yang, Jin-Hee; Lee, Ji-Hee; Park, Sung-Kyu; Son, Na-Young; Kim, Seung-Hyun
2017-12-01
This study examined the effects of soil type and fertilizer regimes on variations in fatty acids (FAs) and vitamin E (Vit-E) in 6-year-old ginseng roots. We observed significant variation in both FA and Vit-E contents owing to the type and quantity of organic fertilizer used in each soil type during cultivation. Unsaturated FAs were approximately 2.7-fold higher in ginseng than in saturated FAs. Linoleic, palmitic, and oleic acids were the most abundant FAs detected in ginseng roots. Additionally, α-tocopherol was the major Vit-E detected. In particular, the increased application of rice straw compost or food waste fertilizer elevated the quantity of nutritionally desirable FAs and bioactive Vit-E in ginseng root. Partial least square-discriminant analysis (PLS-DA) score plots showed that soil type might be the main cause of differences in FA and Vit-E levels in ginseng. Specifically, the PLS-DA model indicated that palmitic acid is a suitable FA marker in determining whether ginseng plants were grown in a paddy-converted field or an upland field. Moreover, linoleic acid levels were highly correlated with α-linolenic acid (r=0.8374; p<0.0001) according to Pearson's correlations and hierarchical clustering analysis. Hence, these preliminary results should prove useful for the reliable production of ginseng containing high phytonutrient quantities according to cultivation conditions. Copyright © 2017 Elsevier Ltd. All rights reserved.
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Lee, Chen-Ting; Zhou, Yingchun; Roy-Choudhury, Kingshuk; Siamakpour-Reihani, Sharareh; Young, Kenneth; Hoang, Peter; Kirkpatrick, John P; Chi, Jen-Tsan A; Dewhirst, Mark W; Horton, Janet K
2017-08-01
Breast cancer is the most common malignancy diagnosed among women and represents a heterogeneous group of subtypes. Radiation therapy is a critical component of treatment for breast cancer patients. However, little is known about radiation response among these intrinsic subtypes. In previous studies, we identified a significant induction of FAS after irradiation in biologically favorable breast cancer patients and breast cancer cell lines. Here, we expanded our study and investigated radiation response in a mouse model of breast cancer. MCF7 (luminal), HCC1954 (HER2 + ) or SUM159 (basal) cells were implanted orthotopically into the dorsal mammary fat pad of nude mice. These mice were then treated with different doses of radiation to assess tumor growth control. We further investigated the therapeutic effect of FAS modulation by silencing FAS in radiation-responsive tumors and injecting FAS agonist antibody into radiation-resistant tumors. Exposure to radiation inhibited MCF7, and to a lesser extent HCC1954 tumor growth in a dose-dependent manner. In contrast, SUM159 tumors were resistant to radiation. The estimated TCD 50 values were 19.3 Gy for MCF7 and 44.9 Gy for SUM159. Radiation induced FAS expression in MCF7 tumors, but not SUM159 tumors. We found that silencing of FAS did not negatively impact radiation response in MCF7 tumors, possibly due to compensation by other apoptotic pathways. On the other hand, FAS activating antibody in combination with radiation treatment delayed SUM159 and HCC1954 tumor growth. However, it did not reach statistical significance compared to radiation treatment alone. Our results suggest that there is intrinsic variation in radiation response among breast cancer subtypes. FAS activation concurrent with radiation slows tumor growth in the radiation-resistant subtypes, but the effect was not significant. Alternative subtype-specific modulators of radiation response are under investigation.
Akt-mediated anti-apoptotic effects of substance P in Anti-Fas-induced apoptosis of human tenocytes.
Backman, Ludvig J; Danielson, Patrik
2013-06-01
Substance P (SP) and its receptor, the neurokinin-1 receptor (NK-1 R), are expressed by human tenocytes, and they are both up-regulated in cases of tendinosis, a condition associated with excessive apoptosis. It is known that SP can phosphorylate/activate the protein kinase Akt, which has anti-apoptotic effects. This mechanism has not been studied for tenocytes. The aims of this study were to investigate if Anti-Fas treatment is a good apoptosis model for human tenocytes in vitro, if SP protects from Anti-Fas-induced apoptosis, and by which mechanisms SP mediates an anti-apoptotic response. Anti-Fas treatment resulted in a time- and dose-dependent release of lactate dehydrogenase (LDH), i.e. induction of cell death, and SP dose-dependently reduced the Anti-Fas-induced cell death through a NK-1 R specific pathway. The same trend was seen for the TUNEL assay, i.e. SP reduced Anti-Fas-induced apoptosis via NK-1 R. In addition, it was shown that SP reduces Anti-Fas-induced decrease in cell viability as shown with crystal violet assay. Protein analysis using Western blot confirmed that Anti-Fas induces cleavage/activation of caspase-3 and cleavage of PARP; both of which were inhibited by SP via NK-1 R. Finally, SP treatment resulted in phosphorylation/activation of Akt as shown with Western blot, and it was confirmed that the anti-apoptotic effect of SP was, at least partly, induced through the Akt-dependent pathway. In conclusion, we show that SP reduces Anti-Fas-induced apoptosis in human tenocytes and that this anti-apoptotic effect of SP is mediated through NK-1 R and Akt-specific pathways. © 2013 The Authors Journal of Cellular and Molecular Medicine Published by Foundation for Cellular and Molecular Medicine/Blackwell Publishing Ltd.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Enzymatic preparation of structured oils containing short-chain fatty acids.
Kanda, Ayato; Namiki, Fusako; Hara, Setsuko
2010-01-01
Structured oils prepared by enzymatic transacylation with triacylglycerols (TAGs) and various fatty acids (FAs) were characterized. Transacylation with trilaurin and saturated FAs (C4:0-C16:0) was performed using Lipozyme RM-IM under standard reaction conditions. The structured oils thus produced had transacylation ratios of 25-37%, as medium-chain FAs > long-chain FAs > short-chain FAs. This result confirmed that short-chain FAs have little reactivity in enzymatic transacylation. All prepared oils shared the same composition of TAG molecular species, as demonstrated by HPLC analysis, and contained a mixture of mono-substituted, di-substituted, and non-substituted TAGs. The reaction conditions for transacylation with TAGs and short-chain FAs were optimized to improve transacylation ratios. The introduction ratios of C4:0, C5:0, and C6:0 into trilaurin were increased to 52.4, 42.5, and 34.1%, respectively, by extending the reaction time. Transacylation between TAGs and short-chain FAs was further examined by using Lipase PL. C4:0 was introduced at 51.1%, the same ratio as for Lipozyme RM-IM. When C5:0 and C6:0 were used as the FA substrate, the transacylation ratios obtained were 47.7 and 43.4%, respectively, higher than those for Lipase RM-IM. Lipase PL is therefore useful for introducing short-chain FAs into TAGs.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Switch from type II to I Fas/CD95 death signaling on in vitro culturing of primary hepatocytes.
Walter, Dorothée; Schmich, Kathrin; Vogel, Sandra; Pick, Robert; Kaufmann, Thomas; Hochmuth, Florian Christoph; Haber, Angelika; Neubert, Karin; McNelly, Sabine; von Weizsäcker, Fritz; Merfort, Irmgard; Maurer, Ulrich; Strasser, Andreas; Borner, Christoph
2008-12-01
Fas/CD95-induced apoptosis of hepatocytes in vivo proceeds through the so-called type II pathway, requiring the proapoptotic BH3-only Bcl-2 family member Bid for mitochondrial death signaling. Consequently, Bid-deficient mice are protected from anti-Fas antibody injection induced fatal hepatitis. We report the unexpected finding that freshly isolated mouse hepatocytes, cultured on collagen or Matrigel, become independent of Bid for Fas-induced apoptosis, thereby switching death signaling from type II to type I. In such in vitro cultures, Fas ligand (FasL) activates caspase-3 without Bid cleavage, Bax/Bak activation or cytochrome c release, and neither Bid ablation nor Bcl-2 overexpression is protective. The type II to type I switch depends on extracellular matrix adhesion, as primary hepatocytes in suspension die in a Bid-dependent manner. Moreover, the switch is specific for FasL-induced apoptosis as collagen-plated Bid-deficient hepatocytes are protected from tumor necrosis factor alpha/actinomycin D (TNFalpha/ActD)-induced apoptosis. Our data suggest a selective crosstalk between extracellular matrix and Fas-mediated signaling that favors mitochondria-independent type I apoptosis induction.
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
Alonso-Hearn, Marta; Abendaño, Naiara; Ruvira, Maria A.; Aznar, Rosa; Landin, Mariana; Juste, Ramon A.
2017-01-01
Johne's disease is a chronic granulomatous enteritis of ruminants caused by the intracellular bacterium Mycobacterium avium subsp. paratuberculosis (Map). We previously demonstrated that Map isolates from sheep persisted within host macrophages in lower CFUs than cattle isolates after 7 days of infection. In the current study, we hypothesize that these phenotypic differences between Map isolates may be driven be the fatty acids (FAs) present on the phosphadidyl-1-myo-inositol mannosides of the Map cell wall that mediate recognition by the mannose receptors of host macrophages. FAs modifications may influence Map's envelope fluidity ultimately affecting pathogenicity. To test this hypothesis, we investigated the responses of two Map isolates from cattle (K10 isolate) and sheep (2349/06-1) to the bovine and ovine macrophage environment by measuring the FAs content of extracellular and intracellular bacteria. For this purpose, macrophages cell lines of bovine (BOMAC) and ovine (MOCL-4) origin were infected with the two isolates of Map for 4 days at 37°C. The relative FAs composition of the two isolates recovered from infected BOMAC and MOCL-4 cells was determined by gas chromatography and compared with that of extracellular bacteria and that of bacteria grown in Middlebrook 7H9 medium. Using this approach, we demonstrated that the FAs composition of extracellular and 7H9-grown bacteria was highly conserved within each Map isolate, and statistically different from that of intracellular bacteria. Analysis of FAs composition from extracellular bacteria enabled the distinction of the two Map strains based on the presence of the tuberculostearic acid (18:0 10Me) exclusively in the K10 strain of Map. In addition, significant differences in the content of Palmitic acid and cis-7 Palmitoleic acid between both isolates harvested from the extracellular environment were observed. Once the infection established itself in BOMAC and MOCL-4 cells, the FAs profiles of both Map
Abdel-Maksoud, Sahar M; Hassanein, Sally I; Gohar, Neveen A; Attia, Saad M M; Gad, Mohamed Z
2017-10-01
The aim of this study was investigating the effect of omega-3 fatty acids (ω-3 FAs) on brain-derived neurotrophic factor (BDNF) gene expression, using in vivo and in vitro models, to unravel the potential mechanisms of polyunsaturated fatty acids use in obesity. Twenty-nine Sprague-Dawley rats were divided into three groups; lean controls fed normal chow diet for 14 weeks, obese controls fed 60% of their diet as saturated fats for 14 weeks, and ω-3 FAs-treated rats fed 60% saturated fat diet for 14 weeks with concomitant oral administration of 400 mg/kg/day ω-3 FAs, mainly docosahexaenoic acid and EPA, from week 12 to week 14. For the in vitro experiment, hypothalamic cells from six obese rats were cultured in the presence of different concentrations of ω-3 FAs to determine its direct effect on BDNF expression. In vivo results showed that obesity has negative effect on BDNF gene expression in rat hypothalamus that was reversed by administration of ω-3 FAs. Obese rats showed hypercholesterolemia, hypertriglyceridemia, normoinsulinemia, hyperglycemia and hyperleptinemia. Treatment with ω-3 FAs showed significant decrease in serum total cholesterol and TAG. Also serum glucose level and HOMA index were decreased significantly. In vitro results demonstrated the increase in BDNF expression by ω-3 FAs in a dose-dependent manner. Obesity causes down-regulation of BDNF gene expression that can be reversed by ω-3 FAs treatment, making them an interesting treatment approach for obesity and metabolic disease.
Fatty acid synthase as a tumor marker: its extracellular expression in human breast cancer.
Wang, Young Y; Kuhajda, Francis P; Li, Jinong; Finch, Teia T; Cheng, Paul; Koh, Clare; Li, Tianwei; Sokoll, Lori J; Chan, Daniel W
2004-07-01
Overexpression of fatty acid synthase (FAS EC 2.3.1.85) is associated with certain cancers and therefore is a putative tumor marker. The presence of FAS in patients with breast, prostate, colon, ovarian, and other cancers has been reported. The mechanism of FAS overexpression in malignancies remains unknown. Here, we show that FAS is released into the extracellular space in cancer cells. The extracellular FAS are present in various immunoreactive forms, and show different expression patterns in various cancer cells. In serum of breast cancer patients, the FAS is a small molecule similar to the form in breast cancer cell lysate but not conditioned medium of cultured cells. The extracellular expression of FAS in breast cancer cells is time dependent and may be hormone independent. These results indicate that the FAS are an ordered cellular response of a living cell and actively exclude excess intracellular FAS molecules from the cell. This phenomenon is up-regulated in breast and may be in other cancer cells as well. Significant elevation of FAS was detected in serum of breast cancer patients compared to healthy subjects. In comparison with CA27.29, no correlation between these two tumor markers was found. Thus, the extracellular FAS may serve as a potential diagnostic and prognostic marker.
Freund Levi, Y; Vedin, I; Cederholm, T; Basun, H; Faxén Irving, G; Eriksdotter, M; Hjorth, E; Schultzberg, M; Vessby, B; Wahlund, L-O; Salem, N; Palmblad, J
2014-04-01
Little is known about the transfer of essential fatty acids (FAs) across the human blood-brain barrier (BBB) in adulthood. In this study, we investigated whether oral supplementation with omega-3 (n-3) FAs would change the FA profile of the cerebrospinal fluid (CSF). A total of 33 patients (18 receiving the n-3 FA supplement and 15 receiving placebo) were included in the study. These patients were participants in the double-blind, placebo-controlled randomized OmegAD study in which 204 patients with mild Alzheimer's disease (AD) received 2.3 g n-3 FA [high in docosahexaenoic acid (DHA)] or placebo daily for 6 months. CSF FA levels were related to changes in plasma FA and to CSF biomarkers of AD and inflammation. At 6 months, the n-3 FA supplement group displayed significant increases in CSF (and plasma) eicosapentaenoic acid (EPA), DHA and total n-3 FA levels (P < 0.01), whereas no changes were observed in the placebo group. Changes in CSF and plasma levels of EPA and n-3 docosapentaenoic acid were strongly correlated, in contrast to those of DHA. Changes in DHA levels in CSF were inversely correlated with CSF levels of total and phosphorylated tau, and directly correlated with soluble interleukin-1 receptor type II. Thus, the more DHA increased in CSF, the greater the change in CSF AD/inflammatory biomarkers. Oral supplementation with n-3 FAs conferred changes in the n-3 FA profile in CSF, suggesting transfer of these FAs across the BBB in adults. © 2013 The Association for the Publication of the Journal of Internal Medicine.
Nabhani, Schafiq; Ginzel, Sebastian; Miskin, Hagit; Revel-Vilk, Shoshana; Harlev, Dan; Fleckenstein, Bernhard; Hönscheid, Andrea; Oommen, Prasad T; Kuhlen, Michaela; Thiele, Ralf; Laws, Hans-Jürgen; Borkhardt, Arndt; Stepensky, Polina; Fischer, Ute
2015-09-01
Autoimmune lymphoproliferative syndrome is frequently caused by mutations in genes involved in the Fas death receptor pathway, but for 20-30% of patients the genetic defect is unknown. We observed that treatment of healthy T cells with interleukin-12 induces upregulation of Fas ligand and Fas ligand-dependent apoptosis. Consistently, interleukin-12 could not induce apoptosis in Fas ligand-deficient T cells from patients with autoimmune lymphoproliferative syndrome. We hypothesized that defects in the interleukin-12 signaling pathway may cause a similar phenotype as that caused by mutations of the Fas ligand gene. To test this, we analyzed 20 patients with autoimmune lymphoproliferative syndrome of unknown cause by whole-exome sequencing. We identified a homozygous nonsense mutation (c.698G>A, p.R212*) in the interleukin-12/interleukin-23 receptor-component IL12RB1 in one of these patients. The mutation led to IL12RB1 protein truncation and loss of cell surface expression. Interleukin-12 and -23 signaling was completely abrogated as demonstrated by deficient STAT4 phosphorylation and interferon γ production. Interleukin-12-mediated expression of membrane-bound and soluble Fas ligand was lacking and basal expression was much lower than in healthy controls. The patient presented with the classical symptoms of autoimmune lymphoproliferative syndrome: chronic non-malignant, non-infectious lymphadenopathy, splenomegaly, hepatomegaly, elevated numbers of double-negative T cells, autoimmune cytopenias, and increased levels of vitamin B12 and interleukin-10. Sanger sequencing and whole-exome sequencing excluded the presence of germline or somatic mutations in genes known to be associated with the autoimmune lymphoproliferative syndrome. Our data suggest that deficient regulation of Fas ligand expression by regulators such as the interleukin-12 signaling pathway may be an alternative cause of autoimmune lymphoproliferative syndrome-like disease. Copyright© Ferrata Storti
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
Conformational Flexibility of Metazoan Fatty Acid Synthase Enables Catalysis
Brignole, Edward J.; Smith, Stuart; Asturias, Francisco J.
2008-01-01
The metazoan cytosolic fatty acid synthase (FAS) contains all of the enzymes required for de novo fatty acid biosynthesis covalently linked around two reaction chambers. While the 3D architecture of FAS has been mostly defined, it is unclear how reaction intermediates can transfer between distant catalytic domains. Using single-particle electron microscopy we have identified a near continuum of conformations consistent with remarkable flexibility of FAS. The distribution of conformations was influenced by the presence of substrates and altered by different catalytic mutations suggesting a direct correlation between conformation and specific enzymatic activities. 3D reconstructions were interpreted by docking high-resolution structures of individual domains and illustrate that the substrate loading and condensation domains dramatically swing and swivel to access substrates within either reaction chamber. Concomitant rearrangement of the β-carbon processing domains synchronizes acyl-chain reduction in one chamber with acyl-chain elongation in the other. PMID:19151726
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Polyunsaturated fatty acids in various macroalgal species from North Atlantic and tropical seas.
van Ginneken, Vincent J T; Helsper, Johannes P F G; de Visser, Willem; van Keulen, Herman; Brandenburg, Willem A
2011-06-22
In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was detected.
Polyunsaturated fatty acids in various macroalgal species from north Atlantic and tropical seas
2011-01-01
Background In this study the efficacy of using marine macroalgae as a source for polyunsaturated fatty acids, which are associated with the prevention of inflammation, cardiovascular diseases and mental disorders, was investigated. Methods The fatty acid (FA) composition in lipids from seven sea weed species from the North Sea (Ulva lactuca, Chondrus crispus, Laminaria hyperborea, Fucus serratus, Undaria pinnatifida, Palmaria palmata, Ascophyllum nodosum) and two from tropical seas (Caulerpa taxifolia, Sargassum natans) was determined using GCMS. Four independent replicates were taken from each seaweed species. Results Omega-3 (n-3) and omega-6 (n-6) polyunsaturated fatty acids (PUFAs), were in the concentration range of 2-14 mg/g dry matter (DM), while total lipid content ranged from 7-45 mg/g DM. The n-9 FAs of the selected seaweeds accounted for 3%-56% of total FAs, n-6 FAs for 3%-32% and n-3 FAs for 8%-63%. Red and brown seaweeds contain arachidonic (C20:4, n-6) and/or eicosapentaenoic acids (EPA, C20:5, n-3), the latter being an important "fish" FA, as major PUFAs while in green seaweeds these values are low and mainly C16 FAs were found. A unique observation is the presence of another typical "fish" fatty acid, docosahexaenoic acid (DHA, C22:6, n-3) at ≈ 1 mg/g DM in S. natans. The n-6: n-3 ratio is in the range of 0.05-2.75 and in most cases below 1.0. Environmental effects on lipid-bound FA composition in seaweed species are discussed. Conclusion Marine macroalgae form a good, durable and virtually inexhaustible source for polyunsaturated fatty acids with an (n-6) FA: (n-3) FA ratio of about 1.0. This ratio is recommended by the World Health Organization to be less than 10 in order to prevent inflammatory, cardiovascular and nervous system disorders. Some marine macroalgal species, like P. palmata, contain high proportions of the "fish fatty acid" eicosapentaenoic acid (EPA, C20:5, n-3), while in S. natans also docosahexaenoic acid (DHA, C22:6, n-3) was
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817