PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
NASA Astrophysics Data System (ADS)
Ahmed, Mohammed H. Othman; Al-Amiery, Ahmed A.; Al-Majedy, Yasmin K.; Kadhum, Abdul Amir H.; Mohamad, Abu Bakar; Gaaz, Tayser Sumer
2018-03-01
The synthesis and characterization of a novel organic corrosion inhibitor (4-(3-mercapto-5,6,7,8-tetrahydro-[1,2,4]triazolo[4,3-b][1,2,4,5]tetrazin-6-yl)phenol), for mild steel in 1 M hydrochloric acid (HCl) has been successfully reported for the first time. The inhibitor evaluated as corrosion inhibitor for mild steel in 1 M of Hydrochloric acid solution using electrochemical impedance spectroscopy (EIS), and electrochemical frequency modulation (EFM) measurement techniques. Changes in the impedance parameters suggested an adsorption of the inhibitor onto the mild steel surface, leading to the formation of protective films. The results show that the inhibition efficiencies increased with increasing the concentrations of the inhibitors and decreased with increasing temperature. The maximum inhibition efficiency up to 67% at the maximum concentration 0.5 mM. This shows that those inhibitors are effective in helping to reduce and slowing down the corrosion process that occurs to mild steel with a hydrochloric acid solution by providing an organic inhibitor for the mild steel that can be weakened by increasing the temperature. The adsorption process of the synthesized organic inhibitor depends on its electronic characteristics in addition to steric effects and the nature of metal surface, temperature degree and the varying degrees of surface-site activity. The synthesized inhibitor molecules were absorbed by metal surface and follow Langmuir isotherms.
Aurintricarboxylic acid is a potent inhibitor of phosphofructokinase.
McCune, S A; Foe, L G; Kemp, R G; Jurin, R R
1989-01-01
Aurintricarboxylic acid (ATA) was found to be a very potent inhibitor of purified rabbit liver phosphofructokinase (PFK), giving 50% inhibition at 0.2 microM. The inhibition was in a manner consistent with interaction at the citrate-inhibitory site of the enzyme. The data suggest that inhibition of PFK by ATA was not due to denaturation of the enzyme or the irreversible binding of inhibitor, since the inhibition could be reversed by addition of allosteric activators of PFK, i.e. fructose 2,6-bisphosphate or AMP. Two other tricarboxylic acids, agaric acid and (-)-hydroxycitrate, were found to inhibit PFK. ATA at much higher concentrations (500 microM) was shown to inhibit fatty acid synthesis from endogenous glycogen in rat hepatocytes; however, protein synthesis was not altered. PMID:2525029
Parsons, Joshua B.; Frank, Matthew W.; Subramanian, Chitra; Saenkham, Panatda; Rock, Charles O.
2011-01-01
The rationale for the pursuit of bacterial type 2 fatty acid synthesis (FASII) as a target for antibacterial drug discovery in Gram-positive organisms is being debated vigorously based on their ability to incorporate extracellular fatty acids. The regulation of FASII by extracellular fatty acids was examined in Staphylococcus aureus and Streptococcus pneumoniae, representing two important groups of pathogens. Both bacteria use the same enzymatic tool kit for the conversion of extracellular fatty acids to acyl-acyl carrier protein, elongation, and incorporation into phospholipids. Exogenous fatty acids completely replace the endogenous fatty acids in S. pneumoniae but support only 50% of phospholipid synthesis in S. aureus. Fatty acids overcame FASII inhibition in S. pneumoniae but not in S. aureus. Extracellular fatty acids strongly suppress malonyl-CoA levels in S. pneumoniae but not in S. aureus, showing a feedback regulatory system in S. pneumoniae that is absent in S. aureus. Fatty acids overcame either a biochemical or a genetic block at acetyl-CoA carboxylase (ACC) in S. aureus, confirming that regulation at the ACC step is the key difference between these two species. Bacteria that possess a stringent biochemical feedback inhibition of ACC and malonyl-CoA formation triggered by environmental fatty acids are able to circumvent FASII inhibition. However, if exogenous fatty acids do not suppress malonyl-CoA formation, FASII inhibitors remain effective in the presence of fatty acid supplements. PMID:21876172
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Qian, Keduo; Kuo, Reen-Yun; Chen, Chin-Ho; Huang, Li; Morris-Natschke, Susan L; Lee, Kuo-Hsiung
2010-04-22
In our continuing study of triterpene derivatives as potent anti-HIV agents, different C-3 conformationally restricted betulinic acid (BA, 1) derivatives were designed and synthesized in order to explore the conformational space of the C-3 pharmacophore. 3-O-Monomethylsuccinyl-betulinic acid (MSB) analogues were also designed to better understand the contribution of the C-3' dimethyl group of bevirimat (2), the first-in-class HIV maturation inhibitor, which is currently in phase IIb clinical trials. In addition, another triterpene skeleton, moronic acid (MA, 3), was also employed to study the influence of the backbone and the C-3 modification toward the anti-HIV activity of this compound class. This study enabled us to better understand the structure-activity relationships (SAR) of triterpene-derived anti-HIV agents and led to the design and synthesis of compound 12 (EC(50): 0.0006 microM), which displayed slightly better activity than 2 as a HIV-1 maturation inhibitor.
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
NASA Astrophysics Data System (ADS)
Hariono, Maywan; Abdullah, Nurshariza; Damodaran, K. V.; Kamarulzaman, Ezatul E.; Mohamed, Nornisah; Hassan, Sharifah Syed; Shamsuddin, Shaharum; Wahab, Habibah A.
2016-12-01
We report the computational and experimental efforts in the design and synthesis of novel neuraminidase (NA) inhibitors from ferulic acid and vanillin. Two proposed ferulic acid analogues, MY7 and MY8 were predicted to inhibit H1N1 NA using molecular docking. From these two analogues, we designed, synthesised and evaluated the biological activities of a series of ferulic acid and vanillin derivatives. The enzymatic H1N1 NA inhibition assay showed MY21 (a vanillin derivative) has the lowest IC50 of 50 μM. In contrast, the virus inhibition assay showed MY15, a ferulic acid derivative has the best activity with the EC50 of ~0.95 μM. Modelling studies further suggest that these predicted activities might be due to the interactions with conserved and essential residues of NA with ΔGbind values comparable to those of oseltamivir and zanamivir, the two commercial NA inhibitors.
Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Metabolic approaches to enhance transdermal drug delivery. 1. Effect of lipid synthesis inhibitors.
Tsai, J C; Guy, R H; Thornfeldt, C R; Gao, W N; Feingold, K R; Elias, P M
1996-06-01
The intercellular domains of the stratum corneum, which contain a mixture of cholesterol, free fatty acids, and ceramides, mediate both the epidermal permeability barrier and the transdermal delivery of both lipophilic and hydrophilic molecules. Prior studies have shown that each of the three key lipid classes is required for normal barrier function. For example, selective inhibition of either cholesterol, fatty acid, or ceramide synthesis in the epidermis delays barrier recovery rates after barrier perturbation of hairless mouse skin in vivo. In this study, we investigated the potential of certain inhibitors of lipid synthesis to enhance the transdermal delivery of lidocaine or caffeine as a result of their capacity to perturb barrier homeostasis. After acetone disruption of the barrier, the extent of lidocaine delivery and the degree of altered barrier function paralleled each other. Moreover, the further alteration in barrier function produced by either the fatty acid synthesis inhibitor 5-(tetradecyloxy)-2-furancarboxylic acid (TOFA), the cholesterol synthesis inhibitor fluvastatin (FLU), or cholesterol sulfate (CS) resulted in a further increase in lidocaine absorption. Furthermore, coapplications of TOFA and CS together caused an additive increase in lidocaine uptake. Finally, a comparable increase in drug delivery occurred when the barrier was disrupted initially with DMSO instead of acetone; coapplications of TOFA and FLU together again delayed barrier recovery and increased drug delivery by about 8-fold vs delivery from a standard enhancing vehicle. Whereas these metabolic inhibitors also variably increased the octanol/water partitioning of the drugs studied (perhaps via complexion or pH alterations), physicochemical effects of the inhibitors alone did not alter drug uptake in intact skin; i.e., passive mechanisms alone cannot account for the net increase in drug delivery. Our results show that modulations of epidermal lipid biosynthesis, following
Frlan, Rok; Kovač, Andreja; Blanot, Didier; Gobec, Stanislav; Pečar, Slavko; Obreza, Aleš
2011-06-01
Mur ligases are essential enzymes involved in the cytoplasmic steps of peptidoglycan synthesis which remain attractive, yet unexploited targets. In order to develop new antibacterial agents, we have designed a series of new MurC and MurD inhibitors bearing amino acid sulfonohydrazide moiety. The L-Leu series of this class displayed the highest enzyme inhibition with IC50 in the concentration range between 100 and 500 µM, with L-Thr, L-Pro and L-Ala derivatives being inactive. The most promising compound of the series also expressed weak antibacterial activity against S. aureus with MIC = 128 µg/mL.
Improved synthesis of ADAM10 inhibitor GI254023X.
Hoettecke, Nicole; Ludwig, Andreas; Foro, Sabine; Schmidt, Boris
2010-01-01
The metalloproteinases ADAM10 and ADAM17 are involved in various diseases: neurodegeneration, cancer and inflammation. The inhibition of these proteases is a promising target in the treatment of inflammation and cancer. In this study, we present an improved synthesis of the ADAM10 reference inhibitor GI254023X with a higher overall yield, enhanced detection ability and increased acid stability, providing easier handling. This upscaled synthesis, free of diastereomeric intermediates, ensures single-batch identity, thus warranting its reproducibility in further biological investigations. 2010 S. Karger AG, Basel.
Synthesis of pyrimidin-2-one nucleosides as acid-stable inhibitors of cytidine deaminase.
Kim, C H; Marquez, V E; Mao, D T; Haines, D R; McCormack, J J
1986-08-01
One of the problems encountered in the use of tetrahydrouridine (THU, 2) and saturated 2-oxo-1,3-diazepine nucleosides as orally administered cytidine deaminase (CDA) inhibitors is their acid instability. Under acid conditions these compounds are rapidly converted into inactive ribopyranoside forms. A solution this problem was sought by functionalizing the acid-stable but less potent CDA inhibitor 1-beta-D-ribofuranosyl-2(1H)-pyrimidinone (1) with the hope of increasing its potency to the level achieved with THU. The selection of the hydroxymethyl substituent at C-4, which led to the synthesis of 4-(hydroxymethyl)-1-beta-D-ribofuranosyl-2(1H)-pyrimidinone (10), 3,4-dihydro-4-(hydroxymethyl)-1-beta-D-ribofuranosyl-2(1H)-pyrimidinone (7), and 3,4,5,6-tetrahydro-4-(dihydroxymethyl)-1-beta-D-ribofuranosyl-2(1H)-p yrimidinone (28) was based on the transition-state (TS) concept. The key intermediate precursor, 4-[(benzoyloxy)methyl]-1-(2,3,5-tri-O-benzoyl-beta-D-ribofuranosyl)-2(H) -pyrimidinone (24), was obtained via the classical Hilbert-Johnson reaction between 2-methoxy-4-[(benzoyloxy)methyl]pyrimidine (20) and 2,3,5-tri-O-benzoyl-1-D-ribofuranosyl bromide (21). Deprotection of 24 afforded compound 10, while its sodium borohydride reduction products afforded compounds 7 and 28 after removal of the blocking groups. Syntheses of 3,4-dihydro-1-beta-D-ribofuranosyl-2(1H)-pyrimidinone (9) and 3,6-dihydro-1-beta-D-ribofuranosyl-2(1H)-pyrimidinone (8), which lack the hydroxymethyl substituent, was accomplished in a similar fashion. The new compounds bearing the hydroxymethyl substituent were more acid stable than THU, and their CDA inhibitory potency, expressed in terms of Ki values, spanned from 10(-4) to 10(-7) M in a manner consistent with the TS theory. Compound 7, in particular, was superior to its parent 1 and equipotent to THU (Ki = 4 X 10(-7) M) when examined against mouse kidney CDA. The superior acid stability of this compound coupled to its potent inhibitory
Arabinosylthymine: inhibitor of splenic lymphocyte macromolecular synthesis in vitro.
Barnett, J M; McGowan, J J; Gentry, G A
1979-01-01
The effect of arabinosylthymine on lymphocyte transformation was investigated. Arabinosylthymine was demonstrated not to be cytotoxic for hamster spleen lymphocytes but was found to inhibit the increase in deoxyribonucleic acid and protein synthesis usually observed as a result of mitogen stimulation. These findings suggest that, in addition to being a potent anti-herpesvirus inhibitor, arabinosylthymine is also an immunosuppressive agent. PMID:500206
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Soraphen A, an inhibitor of acetyl CoA carboxylase activity, interferes with fatty acid elongation
Jump, Donald B.; Torres-Gonzalez, Moises; Olson, L. Karl
2010-01-01
Acetyl CoA carboxylase (ACC1 & ACC2) generates malonyl CoA, a substrate for de novo lipogenesis (DNL) and an inhibitor of mitochondrial fatty acid β-oxidation (FAO). Malonyl CoA is also a substrate for microsomal fatty acid elongation, an important pathway for saturated (SFA), mono- (MUFA) and polyunsaturated fatty acid (PUFA) synthesis. Despite the interest in ACC as a target for obesity and cancer therapy, little attention has been given to the role ACC plays in long chain fatty acid synthesis. This report examines the effect of pharmacological inhibition of ACC on DNL & palmitate (16:0) and linoleate (18:2,n-6) metabolism in HepG2 and LnCap cells. The ACC inhibitor, soraphen A, lowers cellular malonyl CoA, attenuates DNL and the formation of fatty acid elongation products derived from exogenous fatty acids, i.e., 16:0 & 18:2,n-6; IC50 ~ 5 nM. Elevated expression of fatty acid elongases (Elovl5, Elovl6) or desaturases (FADS1, FADS2) failed to override the soraphen A effect on SFA, MUFA or PUFA synthesis. Inhibition of fatty acid elongation leads to the accumulation of 16- and 18-carbon unsaturated fatty acids derived from 16:0 and 18:2,n-6, respectively. Pharmacological inhibition of ACC activity will not only attenuate DNL and induce FAO, but will also attenuate the synthesis of very long chain saturated, mono- and polyunsaturated fatty acids. PMID:21184748
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Structure-based Design and In-Parallel Synthesis of Inhibitors of AmpC b-lactamase
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tondi, D.; Powers, R.A.; Negri, M.C.
2010-03-08
Group I {beta}-lactamases are a major cause of antibiotic resistance to {beta}-lactams such as penicillins and cephalosporins. These enzymes are only modestly affected by classic {beta}-lactam-based inhibitors, such as clavulanic acid. Conversely, small arylboronic acids inhibit these enzymes at sub-micromolar concentrations. Structural studies suggest these inhibitors bind to a well-defined cleft in the group I {beta}-lactamase AmpC; this cleft binds the ubiquitous R1 side chain of {beta}-lactams. Intriguingly, much of this cleft is left unoccupied by the small arylboronic acids. To investigate if larger boronic acids might take advantage of this cleft, structure-guided in-parallel synthesis was used to explore newmore » inhibitors of AmpC. Twenty-eight derivatives of the lead compound, 3-aminophenylboronic acid, led to an inhibitor with 80-fold better binding (2; K{sub i} 83 nM). Molecular docking suggested orientations for this compound in the R1 cleft. Based on the docking results, 12 derivatives of 2 were synthesized, leading to inhibitors with K{sub i} values of 60 nM and with improved solubility. Several of these inhibitors reversed the resistance of nosocomial Gram-positive bacteria, though they showed little activity against Gram-negative bacteria. The X-ray crystal structure of compound 2 in complex with AmpC was subsequently determined to 2.1 {angstrom} resolution. The placement of the proximal two-thirds of the inhibitor in the experimental structure corresponds with the docked structure, but a bond rotation leads to a distinctly different placement of the distal part of the inhibitor. In the experimental structure, the inhibitor interacts with conserved residues in the R1 cleft whose role in recognition has not been previously explored. Combining structure-based design with in-parallel synthesis allowed for the rapid exploration of inhibitor functionality in the R1 cleft of AmpC. The resulting inhibitors differ considerably from {beta}-lactams but
How polyamine synthesis inhibitors and cinnamic acid affect tropane alkaloid production.
Marconi, Patricia L; Alvarez, María A; Pitta-Alvarez, Sandra I
2007-01-01
Hairy roots of Brugmansia candida produce the tropane alkaloids scopolamine and hyoscyamine. In an attempt to divert the carbon flux from competing pathways and thus enhance productivity, the polyamine biosynthesis inhibitors cyclohexylamine (CHA) and methylglyoxal-bis-guanylhydrazone (MGBG) and the phenylalanine-ammonia-lyase inhibitor cinnamic acid were used. CHA decreased the specific productivity of both alkaloids but increased significantly the release of scopolamine (approx 500%) when it was added in the mid-exponential phase. However, when CHA was added for only 48 h during the exponential phase, the specific productivity of both alkaloids increased (approx 200%), favoring scopolamine. Treatment with MGBG was detrimental to growth but promoted release into the medium of both alkaloids. However, when it was added for 48 h during the exponential phase, MGBG increased the specific productivity (approx 200%) and release (250- 1800%) of both alkaloids. Cinnamic acid alone also favored release but not specific productivity. When a combination of CHA or MGBG with cinnamic acid was used, the results obtained were approximately the same as with each polyamine biosynthesis inhibitor alone, although to a lesser extent. Regarding root morphology, CHA inhibited growth of primary roots and ramification. However, it had a positive effect on elongation of lateral roots.
Adipocyte fatty acid binding protein 4 (FABP4) inhibitors. A comprehensive systematic review.
Floresta, Giuseppe; Pistarà, Venerando; Amata, Emanuele; Dichiara, Maria; Marrazzo, Agostino; Prezzavento, Orazio; Rescifina, Antonio
2017-09-29
Small molecule inhibitors of adipocyte fatty acid binding protein 4 (FABP4) have attracted interest following the recent publications of beneficial pharmacological effects of these compounds. FABP4 is predominantly expressed in macrophages and adipose tissue where it regulates fatty acids (FAs) storage and lipolysis and is an important mediator of inflammation. In the past years, hundreds FABP4 inhibitors have been synthesized for effective atherosclerosis and diabetes treatments, including derivatives of niacin, quinoxaline, aryl-quinoline, bicyclic pyridine, urea, aromatic compounds and other novel heterocyclic compounds. This review provides an overview of the synthesized and discovered molecules as adipocyte fatty acid binding protein 4 inhibitors (FABP4is) since the synthesis of the putative FABP4i, BMS309403, highlighting the interactions of the different classes of inhibitors with the targets. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Synthesis of ST7612AA1, a Novel Oral HDAC Inhibitor, via Radical Thioacetic Acid Addition.
Battistuzzi, Gianfranco; Giannini, Giuseppe
2016-12-01
In the expanding field of anticancer drugs, HDAC inhibitors are playing an increasingly important role. To date, four/five HDAC inhibitors have been approved by FDA. All these compounds fit the widely accepted HDAC inhibitors pharmacophore model characterized by a cap group, a linker chain and a zinc binding group (ZBG), able to bind the Zn 2+ ion in a pocket of the HDAC active site. Romidepsin, a natural compound, is the only thiol derivative. We have selected a new class of synthetic HDAC inhibitors, the thio-ω(lactam-carboxamide) derivatives, with ST7612AA1 as drug candidate, pan-inhibitor active in the range of single- to two-digit nanomolar concentrations. Preliminary results of a synthetic optimization attempt towards a fast scale-up process are here proposed. In the four steps of synthesis, from unsaturated amino acid intermediate to the final product, we explored different synthetic conditions in order to have a transferable process for a scale-up synthetic laboratory. In the first step, isobutyl chloroformate was used and, after a simple work up with 1M HCl, 2 (96% yield) was obtained as a white solid, which was used directly in the next step. For thioacetic acid addition to the double bond of intermediate 2 , two different routes were possible, with addition reaction in the first (D') or last step (D). Reactions of 2 to give 5 or of 4 to give ST7612AA1 were both performed in dioxane. Reactions were fast and did not need the usually advised radical quenching with cyclohexene. The corresponding products were obtained in good yields (step D', 89%; step D, 81%) after a flash chromatography. , a thiol derivative prodrug of ST7464AA1 , is the first of a new generation of HDAC inhibitors, very potent, orally administered, and well tolerated. Here, we have identified a synthetic route, competitive, versatile and easily transferable to industrial processes.
Benzoylurea Chitin Synthesis Inhibitors.
Sun, Ranfeng; Liu, Chunjuan; Zhang, Hao; Wang, Qingmin
2015-08-12
Benzoylurea chitin synthesis inhibitors are widely used in integrated pest management (IPM) and insecticide resistance management (IRM) programs due to their low toxicity to mammals and predatory insects. In the past decades, a large number of benzoylurea derivatives have been synthesized, and 15 benzoylurea chitin synthesis inhibitors have been commercialized. This review focuses on the history of commercial benzolyphenylureas (BPUs), synthetic methods, structure-activity relationships (SAR), action mechanism research, environmental behaviors, and ecotoxicology. Furthermore, their disadvantages of high risk to aquatic invertebrates and crustaceans are pointed out. Finally, we propose that the para-substituents at anilide of benzoylphenylureas should be the functional groups, and bipartite model BPU analogues are discussed in an attempt to provide new insight for future development of BPUs.
DNA synthesis inhibitors for the treatment of gastrointestinal cancer.
Yasui, Hiroshi; Tsurita, Giichiro; Imai, Kohzoh
2014-11-01
Intensive laboratory, preclinical and clinical studies have identified and validated molecular targets in cancers, leading to a shift toward the development of novel, rationally designed and specific therapeutic agents. However, gastrointestinal cancers continue to have a poor prognosis, largely due to drug resistance. Here, we discuss the current understanding of DNA synthesis inhibitors and their mechanisms of action for the treatment of gastrointestinal malignancies. Conventional agents, including DNA synthesis inhibitors such as fluoropyrimidines and platinum analogs, remain the most effective therapeutics and are the standards against which new drugs are compared. Novel DNA synthesis inhibitors for the treatment of gastrointestinal malignancies include a combination of the antimetabolite TAS-102, which consists of trifluorothymidine with a thymidine phosphorylase inhibitor, and a novel micellar formulation of cisplatin NC-6004 that uses a nanotechnology-based drug delivery system. The challenges of translational cancer research using DNA synthesis inhibitors include the identification of drugs that are specific to tumor cells to reduce toxicity and increase antitumor efficacy, biomarkers to predict pharmacological responses to chemotherapeutic drugs, identification of ways to overcome drug resistance and development of novel combination therapies with DNA synthesis inhibitors and other cancer therapies, such as targeted molecular therapeutics. Here, we discuss the current understanding of DNA synthesis inhibitors and their mechanisms of action for the treatment of gastrointestinal malignancies.
A PHGDH inhibitor reveals coordination of serine synthesis and 1-carbon unit fate
Pacold, Michael E.; Brimacombe, Kyle R.; Chan, Sze Ham; Rohde, Jason M.; Lewis, Caroline A.; Swier, Lotteke J.Y.M.; Possemato, Richard; Chen, Walter W.; Sullivan, Lucas B.; Fiske, Brian P.; Cho, Sung Won; Freinkman, Elizaveta; Birsoy, Kıvanç; Abu-Remaileh, Monther; Shaul, Yoav D.; Liu, Chieh Min; Zhou, Minerva; Koh, Min Jung; Chung, Haeyoon; Davidson, Shawn M.; Luengo, Alba; Wang, Amy Q.; Xu, Xin; Yasgar, Adam; Liu, Li; Rai, Ganesha; Westover, Kenneth D.; Vander Heiden, Matthew G.; Shen, Min; Gray, Nathanael S.; Boxer, Matthew B.; Sabatini, David M.
2016-01-01
Serine is a both a proteinogenic amino acid and the source of one-carbon units essential for de novo purine and deoxythymidine synthesis. In the canonical glucose-derived serine synthesis pathway, Homo sapiens phosphoglycerate dehydrogenase (PHGDH) catalyzes the first, rate-limiting step. Genetic loss of PHGDH is toxic towards PHGDH-overexpressing breast cancer cell lines even in the presence of exogenous serine. Here, we use a quantitative high-throughput screen to identify small molecule PHGDH inhibitors. These compounds reduce the production of glucose-derived serine in cells and suppress the growth of PHGDH-dependent cancer cells in culture and in orthotopic xenograft tumors. Surprisingly, PHGDH inhibition reduced the incorporation into nucleotides of one-carbon units from glucose-derived and exogenous serine. We conclude that glycolytic serine synthesis coordinates the use of one-carbon units from endogenous and exogenous serine in nucleotide synthesis, and suggest that one-carbon unit wasting may contribute to the efficacy of PHGDH inhibitors in vitro and in vivo. PMID:27110680
Erkel, G; Anke, T; Velten, R; Steglich, W
1991-01-01
A novel enzyme inhibitor of RNA-directed DNA-polymerases of avian myeloblastosis and murine leukemia virus was isolated from fermentations of an tasmanian Podoscypha species. Its structure was elucidated by spectroscopic methods and oxidative degradation as (E)-4,5-dioxo-2-hexadecenoic acid (1). The enzyme inhibitor, which was named podoscyphic acid, did not inhibit DNA and RNA synthesis in permeabilized L 1210 cells nor did it affect RNA synthesis in isolated nuclei of L 1210 cells. 1 inhibits protein synthesis in whole L 1210 cells and rabbit reticulocyte lysate and shows very weak antimicrobial and cytotoxic properties. The testing of ethyl (E)-4,5-dioxo-2-hexadecenoate (2) and (E)-4-oxo-2-tetradecenoic acid (11) revealed the importance of the free gamma-oxoacrylic acid unit for the biological activities of 1.
A human fatty acid synthase inhibitor binds β-ketoacyl reductase in the keto-substrate site.
Hardwicke, Mary Ann; Rendina, Alan R; Williams, Shawn P; Moore, Michael L; Wang, Liping; Krueger, Julie A; Plant, Ramona N; Totoritis, Rachel D; Zhang, Guofeng; Briand, Jacques; Burkhart, William A; Brown, Kristin K; Parrish, Cynthia A
2014-09-01
Human fatty acid synthase (hFAS) is a complex, multifunctional enzyme that is solely responsible for the de novo synthesis of long chain fatty acids. hFAS is highly expressed in a number of cancers, with low expression observed in most normal tissues. Although normal tissues tend to obtain fatty acids from the diet, tumor tissues rely on de novo fatty acid synthesis, making hFAS an attractive metabolic target for the treatment of cancer. We describe here the identification of GSK2194069, a potent and specific inhibitor of the β-ketoacyl reductase (KR) activity of hFAS; the characterization of its enzymatic and cellular mechanism of action; and its inhibition of human tumor cell growth. We also present the design of a new protein construct suitable for crystallography, which resulted in what is to our knowledge the first co-crystal structure of the human KR domain and includes a bound inhibitor.
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Bagley, Mark C.; Baashen, Mohammed; Chuckowree, Irina; Dwyer, Jessica E.; Kipling, David; Davis, Terence
2015-01-01
Microwave-assisted Suzuki-Miyaura cross-coupling reactions have been employed towards the synthesis of three different MAPKAPK2 (MK2) inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a 3-pyridinylboronic acid, the coupling of an aryl bromide with an indolylboronic acid and the reaction of a 3-amino-4-bromopyrazole with 4-carbamoylphenylboronic acid. In all of these processes, the Suzuki-Miyaura reaction was fast and relatively efficient using a palladium catalyst under microwave irradiation. The process was incorporated into a rapid 3-step microwave-assisted method for the synthesis of a MK2 inhibitor involving 3-aminopyrazole formation, pyrazole C-4 bromination using N-bromosuccinimide (NBS), and Suzuki-Miyaura cross-coupling of the pyrazolyl bromide with 4-carbamoylphenylboronic acid to give the target 4-arylpyrazole in 35% overall yield, suitable for study in WS cells. PMID:26046488
Bagley, Mark C; Baashen, Mohammed; Chuckowree, Irina; Dwyer, Jessica E; Kipling, David; Davis, Terence
2015-06-03
Microwave-assisted Suzuki-Miyaura cross-coupling reactions have been employed towards the synthesis of three different MAPKAPK2 (MK2) inhibitors to study accelerated aging in Werner syndrome (WS) cells, including the cross-coupling of a 2-chloroquinoline with a 3-pyridinylboronic acid, the coupling of an aryl bromide with an indolylboronic acid and the reaction of a 3-amino-4-bromopyrazole with 4-carbamoylphenylboronic acid. In all of these processes, the Suzuki-Miyaura reaction was fast and relatively efficient using a palladium catalyst under microwave irradiation. The process was incorporated into a rapid 3-step microwave-assisted method for the synthesis of a MK2 inhibitor involving 3-aminopyrazole formation, pyrazole C-4 bromination using N-bromosuccinimide (NBS), and Suzuki-Miyaura cross-coupling of the pyrazolyl bromide with 4-carbamoylphenylboronic acid to give the target 4-arylpyrazole in 35% overall yield, suitable for study in WS cells.
Synthesis of Lysine Methyltransferase Inhibitors
NASA Astrophysics Data System (ADS)
Ye, Tao; Hui, Chunngai
2015-07-01
Lysine methyltransferase which catalyze methylation of histone and nonhistone proteins, play a crucial role in diverse biological processes and has emerged as a promising target for the development of various human diseases, including cancer, inflammation, and psychiatric disorders. However, inhibiting Lysine methyltransferases selectively has presented many challenges to medicinal chemists. During the past decade, lysine methyltransferase inhibitors covering many different structural classes have been designed and developed. In this review, we describe the development of selective, small-molecule inhibitors of lysine methyltransferases with an emphasis on their discovery and chemical synthesis. We highlight the current state of lysine methyltransferase inhibitors and discuss future directions and opportunities for lysine methyltransferase inhibitor discovery.
Structure-based optimization of Cephalothin-analogue boronic acids as β-lactamase inhibitors
Morandi, Stefania; Morandi, Federica; Caselli, Emilia; Shoichet, Brian K.; Prati, Fabio
2008-01-01
Boronic acids have proved to be promising selective inhibitors of β-lactamases, acting as transition state analogues. Starting from a previously described nanomolar inhibitor of AmpC β-lactamase, three new inhibitors were designed to gain interactions with highly conserved residues, such as Asn343, and to bind more tightly to the enzyme. Among these, one was obtained by stereoselective synthesis and succeeded in placing its anionic group into the carboxylate binding site of the enzyme, as revealed by X-ray crystallography of the complex inhibitor/AmpC. Nevertheless, it failed at improving affinity, when compared to the lead from which it was derived. The origins of this structural and energetic discrepancy are discussed. PMID:17997318
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
Thromboxane synthesis inhibitors and postprandial jejunal capillary exchange capacity.
Mangino, M J; Chou, C C
1988-05-01
The effects of thromboxane synthesis inhibitors (imidazole and U 63557A; Upjohn) and the cyclooxygenase inhibitor, mefenamic acid, on jejunal capillary filtration coefficients (Kfc) were determined in dogs before and during the presence of predigested food in the jejunal lumen. The jejunal Kfc increased significantly soon after the placement of a predigested test food containing all major constituents of diet. The Kfc remained elevated as long as the food was present in the lumen (15 min). Mefenamic acid (10 mg/kg iv) did not significantly alter resting jejunal Kfc or alter the food-induced increase in Kfc. Imidazole (5.0 mg/min ia) or U 63557A (5.0 mg/kg iv) per se significantly increased jejunal Kfc. Placement of digested food further increased the Kfc to levels significantly higher than those observed before administration of the two thromboxane synthase inhibitors. Production of thromboxane B2 by jejunal tissue was significantly reduced and 6-ketoprostaglandin F1 alpha (the stable hydrolysis product of prostacyclin) production was significantly increased after administration of U 63557A. Our study indicates that the relative production of endogenous thromboxanes and other prostanoids modulates jejunal capillary exchange capacity in the absence or presence of digested food in the jejunal lumen.
Chen, Yao; Zhu, Jie; Mo, Jun; Yang, Hongyu; Jiang, Xueyang; Lin, Hongzhi; Gu, Kai; Pei, Yuqiong; Wu, Liang; Tan, Renxiang; Hou, Jing; Chen, Jingyi; Lv, Yang; Bian, Yaoyao; Sun, Haopeng
2018-12-01
Small molecule cholinesterases inhibitor (ChEI) provides an effective therapeutic strategy to treat Alzheimer's disease (AD). Currently, the discovery of new ChEI with multi-target effect is still of great importance. Herein, we report the synthesis, structure-activity relationship study and biological evaluation of a series of tacrine-cinnamic acid hybrids as new ChEIs. All target compounds are evaluated for their in vitro cholinesterase inhibitory activities. The representatives which show potent activity on cholinesterase, are evaluated for the amyloid β-protein self-aggregation inhibition and in vivo assays. The optimal compound 19, 27, and 30 (human AChE IC 50 = 10.2 ± 1.2, 16.5 ± 1.7, and 15.3 ± 1.8 nM, respectively) show good performance in ameliorating the scopolamine-induced cognition impairment and preliminary safety in hepatotoxicity evaluation. These compounds deserve further evaluation for the development of new therapeutic agents against AD.
Vontzalidou, Argyro; Zoidis, Grigoris; Chaita, Eliza; Makropoulou, Maria; Aligiannis, Nektarios; Lambrinidis, George; Mikros, Emmanuel; Skaltsounis, Alexios-Leandros
2012-09-01
The synthesis, molecular modeling and biological evaluation of substituted deoxybenzoins and optimized dihydrostilbenes are reported. Preliminary structure-activity relationship data were elucidated and lead compounds suitable for further optimization were discovered. Dihydrostilbene 7 is a particularly potent inhibitor (IC(50)=8.44 μM, more potent than kojic acid). Copyright © 2012 Elsevier Ltd. All rights reserved.
Bhatia, M; Landolfi, C; Basta, F; Bovi, G; Ramnath, R Devi; de Joannon, A Capezzone; Guglielmotti, A
2008-10-01
Chemokines play a fundamental role in trafficking and activation of leukocytes in colonic inflammation. We investigated the ability of bindarit, an inhibitor of monocyte chemoattractant protein-1 (MCP-1/CCL2) synthesis, to inhibit chemokine production by human intestinal epithelial cells (HT-29) and its effect in trinitro-benzene sulfonic acid (TNBS)-induced colitis in mice. HT-29 cells were incubated with bindarit in the presence of TNF-alpha/IFN-gamma and 24 h later supernatants were collected for MCP-1, IL-8 and RANTES measurement. A 1 mg enema of TNBS was given to BALB/c mice, and bindarit (100 mg/kg) was orally administered twice daily starting from two days before colitis induction. Weight loss, histology, and MCP-1 level and myeloperoxidase (MPO) activity in colon extracts were assessed. In HT-29 cells, bindarit concentration-dependently and selectively inhibited MCP-1 secretion (as well as mRNA expression) primed by TNF-alpha/IFN-gamma. Moreover treatment with bindarit reduced clinical and histopathological severity of TNBS-induced colitis. These effects were associated with significant inhibition of MCP-1 and MPO in colon extracts. Bindarit exhibits a potent bioactivity in reducing leukocyte infiltration, down-regulating MCP-1 synthesis, and preventing the development of severe colitis in a mice model of TNBS-induced colitis. These observations suggest a potential use of MCP-1 synthesis blockers in intestinal inflammation in humans.
Shi, Jingmiao; Lei, Meng; Wu, Wenkui; Feng, Huayun; Wang, Jia; Chen, Shanshan; Zhu, Yongqiang; Hu, Shihe; Liu, Zhaogang; Jiang, Cheng
2016-04-15
A series of novel dipeptidyl boronic acid proteasome inhibitors constructed from αα- and αβ-amino acids were designed and synthesized. Their structures were elucidated by (1)H NMR, (13)C NMR, LC-MS and HRMS. These compounds were evaluated for their β5 subunit inhibitory activities of human proteasome. The results showed that dipeptidyl boronic acid inhibitors composed of αα-amino acids were as active as bortezomib. Interestingly, the activities of those derived from αβ-amino acids lost completely. Of all the inhibitors, compound 22 (IC50=4.82 nM) was the most potent for the inhibition of proteasome activity. Compound 22 was also the most active against three MM cell lines with IC50 values less than 5 nM in inhibiting cell growth assays. Molecular docking studies displayed that 22 fitted very well in the β5 subunit active pocket of proteasome. Copyright © 2016. Published by Elsevier Ltd.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Synthesis of Novel Compounds as New Potent Tyrosinase Inhibitors
Hamidian, Hooshang
2013-01-01
In the present paper, we report the synthesis and pharmacological evaluation of a new series of azo compounds with different groups (1-naphthol, 2-naphthol, and N,N-dimethylaniline) and trifluoromethoxy and fluoro substituents in the scaffold. All synthesized compounds (5a–5f) showed the most potent mushroom tyrosinase inhibition (IC50 values in the range of 4.39 ± 0.76–1.71 ± 0.49 µM), comparable to the kojic acid, as reference standard inhibitor. All the novel compounds were characterized by FT-IR, 1H NMR, 13C NMR, and elemental analysis. PMID:24260737
Ponzano, Stefano; Berteotti, Anna; Petracca, Rita; Vitale, Romina; Mengatto, Luisa; Bandiera, Tiziano; Cavalli, Andrea; Piomelli, Daniele; Bertozzi, Fabio; Bottegoni, Giovanni
2014-12-11
N-(2-Oxo-3-oxetanyl)carbamic acid esters have recently been reported to be noncompetitive inhibitors of the N-acylethanolamine acid amidase (NAAA) potentially useful for the treatment of pain and inflammation. In the present study, we further explored the structure-activity relationships of the carbamic acid ester side chain of 2-methyl-4-oxo-3-oxetanylcarbamic acid ester derivatives. Additional favorable features in the design of potent NAAA inhibitors have been found together with the identification of a single digit nanomolar inhibitor. In addition, we devised a 3D QSAR using the atomic property field method. The model turned out to be able to account for the structural variability and was prospectively validated by designing, synthesizing, and testing novel inhibitors. The fairly good agreement between predictions and experimental potency values points to this 3D QSAR model as the first example of quantitative structure-activity relationships in the field of NAAA inhibitors.
Miki, Takashi; Kori, Masakuni; Mabuchi, Hiroshi; Tozawa, Ryu-ichi; Nishimoto, Tomoyuki; Sugiyama, Yasuo; Teshima, Koichiro; Yukimasa, Hidefumi
2002-09-26
Modification of the carboxyl group at the 3-position and introduction of protective groups to the hydroxy group of the 4,1-benzoxazepine derivative 2 (metabolite of 1) were carried out, and the inhibitory activity for squalene synthase and cholesterol synthesis in the liver was investigated. Among these compounds, the glycine derivative 3a and beta-alanine derivative 3f exhibited the most potent inhibition of squalene synthase prepared from HepG2 cells (IC(50) = 15 nM). On the other hand, the piperidine-4-acetic acid derivative 4a, which was prepared by acetylation of 3j, was the most effective inhibitor of cholesterol synthesis in rat liver (ED(50) = 2.9 mg/kg, po). After oral administration, 4a was absorbed and rapidly hydrolyzed to deacylated 3j. Compound 3j was detected mainly in the liver, but the plasma level of 3j was found to be low. Compounds 3j and 4a were found to be competitive inhibitors with respect to farnesyl pyrophosphate. Further evaluation of 4a as a cholesterol-lowering and antiatherosclerotic agent is underway.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Weïwer, Michel; Chen, Chi-Chang; Kemp, Melissa M.; Linhardt, Robert J.
2013-01-01
α-Sialic acid azide 1 has been used as a substrate for the efficient preparation of 1,2,3-triazole derivatives of sialic acid using the copper-catalyzed azide-alkyne Huisgen cycloaddition (“click chemistry”). Our approach is to generate non-natural N-glycosides of sialic acid that are resistant to neuraminidase catalyzed hydrolysis as opposed to the natural O-glycosides. These N-glycosides would act as neuraminidase inhibitors to prevent the release of new virions. As a preliminary study, a small library of 1,2,3-triazole-linked sialic acid derivatives has been synthesized in 71-89% yield. A disaccharide mimic of sialic acid has also been prepared using the α-sialic acid azide 1 and a C-8 propargyl sialic acid acceptor in 68% yield. A model sialic acid coated dendrimer was also synthesized from a per-propargylated pentaerythritol acceptor. These novel sialic acid derivatives were then evaluated as potential neuraminidase inhibitors using a 96-well plate fluorescence assay; micromolar IC50 values were observed, comparable to the known sialidase inhibitor Neu5Ac2en. PMID:24223493
NASA Technical Reports Server (NTRS)
Feldman, L. J.; Sun, P. S.
1986-01-01
Maize seeds were germinated in the dark in the presence of the carotenoid synthesis inhibitor norflurazon and the levels of abscisic acid, xanthoxin and total carotenoids were measured in the root cap and in the adjacent 1.5 mm segment. In norflurazon-treated roots abscisic acid levels were markedly reduced, but an increase occurred in the levels of xanthoxin, a compound structurally and physiologically similar to abscisic acid. In the cultivar of maize (Zea mays L. cv. Merit) used for this work, brief illumination of the root is required for gravitropic curving. Following illumination both control and norflurazon-treated roots showed normal gravitropic curvature; however, the rate of curvature was delayed in norflurazon-treated roots. Our data from norflurazon-treated roots are consistent with a role for xanthoxin in maize root gravitropism. The increase in xanthoxin in the presence of an inhibitor of carotenoid synthesis suggests that xanthoxin and abscisic acid originate, at least in part, via different metabolic pathways.
Pabba, Chittari; Gregg, Brian T; Kitchen, Douglas B; Chen, Zhen Jia; Judkins, Angela
2011-01-01
A series of novel hydroxamic acid based histone deacetylases (HDAC) inhibitors with aryl ether and aryl sulfone residues at the terminus of a substituted, unsaturated 5-carbon spacer moiety have been synthesized for the first time and evaluated. Compounds with meta- and para-substitution on the aryl ring of ether hydroxamic acids 19c, 20c, 19e, 19f and 19g are potent HDAC inhibitors with activities at low nanomolar levels. Copyright © 2010 Elsevier Ltd. All rights reserved.
Cai, Haiyan; Liu, Qiufeng; Gao, Dingding; Wang, Ting; Chen, Tiantian; Yan, Guirui; Chen, Kaixian; Xu, Yechun; Wang, Heyao; Li, Yingxia; Zhu, Weiliang
2015-01-27
Fatty acid binding protein 4 (FABP4) is a potential drug target for diabetes and atherosclerosis. For discovering new chemical entities as FABP4 inhibitors, structure-based virtual screening (VS) was performed, bioassay demonstrated that 16 of 251 tested compounds are FABP4 inhibitors, among which compound m1 are more active than endogenous ligand linoleic acid (LA). Based on the structure of m1, new derivatives were designed and prepared, leading to the discovery of two more potent inhibitors, compounds 9 and 10. To further explore the binding mechanisms of these new inhibitors, we determined the X-ray structures of the complexes of FABP4-9 and FABP4-10, which revealed similar binding conformations of the two compounds. Residue Ser53 and Arg126 formed direct hydrogen bonding with the ligands. We also found that 10 could significantly reduce the levels of lipolysis on mouse 3T3-L1 adipocytes. Taken together, in silico, in vitro and crystallographic data provide useful hints for future development of novel inhibitors against FABP4. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao
2011-01-01
Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122
Chen, Yan; Sit, Sing-Yuen; Chen, Jie; Swidorski, Jacob J; Liu, Zheng; Sin, Ny; Venables, Brian L; Parker, Dawn D; Nowicka-Sans, Beata; Lin, Zeyu; Li, Zhufang; Terry, Brian J; Protack, Tricia; Rahematpura, Sandhya; Hanumegowda, Umesh; Jenkins, Susan; Krystal, Mark; Dicker, Ira D; Meanwell, Nicholas A; Regueiro-Ren, Alicia
2018-05-15
The design and synthesis of a series of C28 amine-based betulinic acid derivatives as HIV-1 maturation inhibitors is described. This series represents a continuation of efforts following on from previous studies of C-3 benzoic acid-substituted betulinic acid derivatives as HIV-1 maturation inhibitors (MIs) that were explored in the context of C-28 amide substituents. Compared to the C-28 amide series, the C-28 amine derivatives exhibited further improvements in HIV-1 inhibitory activity toward polymorphisms in the Gag polyprotein as well as improved activity in the presence of human serum. However, plasma exposure of basic amines following oral administration to rats was generally low, leading to a focus on moderating the basicity of the amine moiety distal from the triterpene core. The thiomorpholine dioxide (TMD) 20 emerged from this study as a compound with the optimal antiviral activity and an acceptable pharmacokinetic profile in the C-28 amine series. Compared to the C-28 amide 3, 20 offers a 2- to 4-fold improvement in potency towards the screening viruses, exhibits low shifts in the EC 50 values toward the V370A and ΔV370 viruses in the presence of human serum or human serum albumin, and demonstrates improved potency towards the polymorphic T371A and V362I virus variants. Copyright © 2018 Elsevier Ltd. All rights reserved.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Discovery of novel BTK inhibitors with carboxylic acids.
Gao, Xiaolei; Wang, James; Liu, Jian; Guiadeen, Deodial; Krikorian, Arto; Boga, Sobhana Babu; Alhassan, Abdul-Basit; Selyutin, Oleg; Yu, Wensheng; Yu, Younong; Anand, Rajan; Liu, Shilan; Yang, Chundao; Wu, Hao; Cai, Jiaqiang; Cooper, Alan; Zhu, Hugh; Maloney, Kevin; Gao, Ying-Duo; Fischmann, Thierry O; Presland, Jeremy; Mansueto, My; Xu, Zangwei; Leccese, Erica; Zhang-Hoover, Jie; Knemeyer, Ian; Garlisi, Charles G; Bays, Nathan; Stivers, Peter; Brandish, Philip E; Hicks, Alexandra; Kim, Ronald; Kozlowski, Joeseph A
2017-03-15
We report the design and synthesis of a series of novel Bruton's Tyrosine Kinase (BTK) inhibitors with a carboxylic acid moiety in the ribose pocket. This series of compounds has demonstrated much improved off-target selectivities including adenosine uptake (AdU) inhibition compared to the piperidine amide series. Optimization of the initial lead compound 4 based on BTK enzyme inhibition, and human peripheral blood mononuclear cell (hPBMC) and human whole blood (hWB) activity led to the discovery of compound 40, with potent BTK inhibition, reduced off target activities, as well as favorable pharmacokinetic profile in both rat and dog. Copyright © 2016 Elsevier Ltd. All rights reserved.
NASA Astrophysics Data System (ADS)
Adhikari, Arijit A.
was applied towards the synthesis of natural products and their analogs. The pyrroloindoline ring system is found in many alkaloids and cyclic peptides which mainly differ in the substitution at the C3a position. To provide rapid access to these natural products a diversity-oriented strategy was established via displacement of C3a-trichloroacetimidate pyrroloindoline. Carbon, oxygen, sulfur and nitrogen nucleophiles were all shown to undergo substitution reactions with these trichloroacetimidates in the presence of a Lewis acid catalyst. In order to demonstrate the utility of this new method it was applied towards the synthesis of arundinine and a formal synthesis of psychotriasine. Current investigations involve the application of this method towards the synthesis of a complex pyrroloindoline natural product kapakahine C and the progress made therein has been discussed. The reactivity of trichloroacetimidates was also investigated for the selective C3-alkylation of 2,3-disubstituted indoles to provide indolenines. Indolenines serve as useful intermediates in the synthesis of many complex alkaloids. Different benzylic and allylic trichloroacetimidates were shown to provide 3,3'-disubstituted indolenines with high yields in the presence of catalytic amounts of Lewis acids. Various substituted indoles were evaluated under these reaction conditions. This methodology was also applied towards the synthesis of the core tetracyclic ring system found in communesin natural products. In addition to the above work, synthesis of small molecule inhibitors of Src Homology 2 Domain-Containing Inositol Phosphatase (SHIP) has also been described. Aberrations in the phosphoinositide 3-kinase (PI3K) cellular signaling pathway can lead to diseased cellular states like cancer. Herein we have reported stereoselective synthesis of two quinoline based small molecule SHIP inhibitors. The lead compounds and their analogs were tested for their activities against SHIP by Malachite green assay
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ilies, Monica; Di Costanzo, Luigi; Dowling, Daniel P.
Arginase is a binuclear manganese metalloenzyme that hydrolyzes L-arginine to form L-ornithine and urea, and aberrant arginase activity is implicated in various diseases such as erectile dysfunction, asthma, atherosclerosis, and cerebral malaria. Accordingly, arginase inhibitors may be therapeutically useful. Continuing our efforts to expand the chemical space of arginase inhibitor design and inspired by the binding of 2-(difluoromethyl)-L-ornithine to human arginase I, we now report the first study of the binding of {alpha},{alpha}-disubstituted amino acids to arginase. Specifically, we report the design, synthesis, and assay of racemic 2-amino-6-borono-2-methylhexanoic acid and racemic 2-amino-6-borono-2-(difluoromethyl)hexanoic acid. X-ray crystal structures of human arginase Imore » and Plasmodium falciparum arginase complexed with these inhibitors reveal the exclusive binding of the L-stereoisomer; the additional {alpha}-substituent of each inhibitor is readily accommodated and makes new intermolecular interactions in the outer active site of each enzyme. Therefore, this work highlights a new region of the protein surface that can be targeted for additional affinity interactions, as well as the first comparative structural insights on inhibitor discrimination between a human and a parasitic arginase.« less
Clinical Relevance of Type II Fatty Acid Synthesis Bypass in Staphylococcus aureus
Guillemet, Mélanie; Soler, Charles; Morvan, Claire; Halpern, David; Pourcel, Christine; Vu Thien, Hoang; Lamberet, Gilles
2017-01-01
ABSTRACT The need for new antimicrobials to treat bacterial infections has led to the use of type II fatty acid synthesis (FASII) enzymes as front-line targets. However, recent studies suggest that FASII inhibitors may not work against the opportunist pathogen Staphylococcus aureus, as environmental fatty acids favor emergence of multi-anti-FASII resistance. As fatty acids are abundant in the host and one FASII inhibitor, triclosan, is widespread, we investigated whether fatty acid pools impact resistance in clinical and veterinary S. aureus isolates. Simple addition of fatty acids to the screening medium led to a 50% increase in triclosan resistance, as tested in 700 isolates. Moreover, nonculturable triclosan-resistant fatty acid auxotrophs, which escape detection under routine conditions, were uncovered in primary patient samples. FASII bypass in selected isolates correlated with polymorphisms in the acc and fabD loci. We conclude that fatty-acid-dependent strategies to escape FASII inhibition are common among S. aureus isolates and correlate with anti-FASII resistance and emergence of nonculturable variants. PMID:28193654
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Oslob, Johan D; Johnson, Russell J; Cai, Haiying; Feng, Shirley Q; Hu, Lily; Kosaka, Yuko; Lai, Julie; Sivaraja, Mohanram; Tep, Samnang; Yang, Hanbiao; Zaharia, Cristiana A; Evanchik, Marc J; McDowell, Robert S
2013-01-10
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo.
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Davis, Tony D; Mohandas, Poornima; Chiriac, Maria I; Bythrow, Glennon V; Quadri, Luis E N; Tan, Derek S
2016-11-01
Biosynthesis of bacterial natural-product virulence factors is emerging as a promising antibiotic target. Many such natural products are produced by nonribosomal peptide synthetases (NRPS) from amino acid precursors. To develop selective inhibitors of these pathways, we have previously described aminoacyl-AMS (sulfamoyladenosine) macrocycles that inhibit NRPS amino acid adenylation domains but not mechanistically-related aminoacyl-tRNA synthetases. To improve the cell permeability of these inhibitors, we explore herein replacement of the α-amino group with an α-hydroxy group. In both macrocycles and corresponding linear congeners, this leads to decreased biochemical inhibition of the cysteine adenylation domain of the Yersina pestis siderophore synthetase HMWP2, which we attribute to loss of an electrostatic interaction with a conserved active-site aspartate. However, inhibitory activity can be regained by installing a cognate β-thiol moiety in the linear series. This provides a path forward to develop selective, cell-penetrant inhibitors of the biosynthesis of virulence factors to probe their biological functions and potential as therapeutic targets. Copyright © 2016 Elsevier Ltd. All rights reserved.
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-01-01
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N—H groups are tolerated on the barbituric acid, with no complications arising from N—H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. PMID:25959544
Dang, Zhao; Qian, Keduo; Ho, Phong; Zhu, Lei; Lee, Kuo-Hsiung; Huang, Li; Chen, Chin-Ho
2012-08-15
Betulinic acid derivatives modified at the C28 position are HIV-1entry inhibitors such as compound A43D; however, modified at the C3 position instead of C28 give HIV-1 maturation inhibitor such as bevirimat. Bevirimat exhibited promising pharmacokinetic profiles in clinical trials, but its effectiveness was compromised by the high baseline drug resistance of HIV-1 variants with polymorphism in the putative drug binding site. In an effort to determine whether the viruses with bevirimat resistant polymorphism also altered their sensitivities to the betulinic acid derivatives that inhibit HIV-1 entry, a series of new betulinic acid entry inhibitors were synthesized and tested for their activities against HIV-1 NL4-3 and NL4-3 variants resistant to bevirimat. The results show that the bevirimat resistant viruses were approximately 5- to10-fold more sensitive to three new glutamine ester derivatives (13, 15 and 38) and A43D in an HIV-1 multi-cycle replication assay. In contrast, the wild type NL4-3 and the bevirimat resistant variants were equally sensitive to the HIV-1 RT inhibitor AZT. In addition, these three new compounds markedly improved microsomal stability compared to A43D. Copyright © 2012 Elsevier Ltd. All rights reserved.
2012-01-01
Potent imidazopyridine-based inhibitors of fatty acid synthase (FASN) are described. The compounds are shown to have antiviral (HCV replicon) activities that track with their biochemical activities. The most potent analogue (compound 19) also inhibits rat FASN and inhibits de novo palmitate synthesis in vitro (cell-based) as well as in vivo. PMID:24900571
Increased sensitivity to protein synthesis inhibitors in cells lacking tmRNA.
de la Cruz, J; Vioque, A
2001-01-01
tmRNA (also known as SsrA or 10Sa RNA) is involved in a trans-translation reaction that contributes to the recycling of stalled ribosomes at the 3' end of an mRNA lacking a stop codon or at an internal mRNA cluster of rare codons. Inactivation of the ssrA gene in most bacteria results in viable cells bearing subtle phenotypes, such as temperature-sensitive growth. Herein, we report on the functional characterization of the ssrA gene in the cyanobacterium Synechocystis sp. strain PCC6803. Deletion of the ssrA gene in Synechocystis resulted in viable cells with a growth rate identical to wild-type cells. However, null ssrA cells (deltassrA) were not viable in the presence of the protein synthesis inhibitors chloramphenicol, lincomycin, spiramycin, tylosin, erythromycin, and spectinomycin at low doses that do not significantly affect the growth of wild-type cells. Sensitivity of deltassrA cells similar to wild-type cells was observed with kasugamycin, fusidic acid, thiostrepton, and puromycin. Antibiotics unrelated to protein synthesis, such as ampicillin or rifampicin, had no differential effect on the deltassrA strain. Furthermore, deletion of the ssrA gene is sufficient to impair global protein synthesis when chloramphenicol is added at sublethal concentrations for the wild-type strain. These results indicate that ribosomes stalled by some protein synthesis inhibitors can be recycled by tmRNA. In addition, this suggests that the first elongation cycle with tmRNA, which incorporates a noncoded alanine on the growing peptide chain, may have mechanistic differences with the normal elongation cycles that bypasses the block produced by these specific antibiotics. tmRNA inactivation could be an useful therapeutic target to increase the sensitivity of pathogenic bacteria against antibiotics. PMID:11780628
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors.
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios; Zhang, Jinwei; Stathopoulos, Constantinos
2017-09-29
Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.
Demarcus, M; Ganadu, M L; Mura, G M; Porcheddu, A; Quaranta, L; Reginato, G; Taddei, M
2001-02-09
Different dipeptide analogues containing an oxirane ring in the place of the peptidic bond were prepared starting from naturally occurring amino acids. N-Fmoc-amino aldehydes were transformed into the corresponding methoxyvinyl derivatives through a Wittig reaction, and the addition of PhSeCl gave a series of different alpha-phenylselenyl aldehydes. Mukajiama reaction with silylketene acetals gave an intermediate product that was finally transformed into the desired oxiranyl peptidomimetics. Following this strategy we were able to control three new contiguous stereocenters starting from the enantiomerically pure amino acid. The dipeptide analogues could be used in SPPS on a SASRIN resin as the final epoxides were relatively unstable under acidic conditions. Moreover the synthesis of the single dipeptide mimetics was carried out on solid phase to generate a small library of epoxy peptidomimetics. Some of the products prepared in this work resulted as time-dependent reversible inhibitors of cysteine protease.
Ahmaditaba, Mohammad Ali; Houshdar Tehrani, Mohammad Hassan; Zarghi, Afshin; Shahosseini, Sorayya; Daraei, Bahram
2018-01-01
A new series of peptide-like derivatives containing different aromatic amino acids and possessing pharmacophores of COX-2 inhibitors as SO2Me or N3 attached to the para position of an end phenyl ring was synthesized for evaluation as selective cyclooxygenase-2 (COX-2) inhibitors. The synthetic reactions were based on the solid phase peptide synthesis method using Wang resin. One of the analogues, i.e., compound 2d, as the representative of these series was recognized as the most effective and the highest selective COX-2 inhibitor with IC50 value of 0.08 μM and COX-2 selectivity index of 351.2, among the other synthesized compounds. Molecular docking study was operated to determine possible binding models of compound 2d to COX-2 enzyme. The study showed that the p-azido-phenyl fragment of 2d occupied inside the secondary COX-2 binding site (Arg513, and His90). The structure-activity relationships acquired disclosed that compound 2d with 4-(azido phenyl) group as pharmacophore and histidine as amino acid gives the essential geometry to provide inhibition of the COX-2 enzyme with high selectivity. Compound 2d can be a good candidate for the development of new hits of COX-2 inhibitors.
Shi, Wei-Kang; Deng, Rui-Cheng; Wang, Peng-Fei; Yue, Qin-Qin; Liu, Qi; Ding, Kun-Ling; Yang, Mei-Hui; Zhang, Hong-Yu; Gong, Si-Hua; Deng, Min; Liu, Wen-Run; Feng, Qiu-Ju; Xiao, Zhu-Ping; Zhu, Hai-Liang
2016-10-01
Helicobacter pylori urease is involved in several physiologic responses such as stomach and duodenal ulcers, adenocarcinomas and stomach lymphomas. Thus, inhibition of urease is taken for a good chance to treat H. pylori-caused infections, we have therefore focused our efforts on seeking novel urease inhibitors. Here, a series of arylpropionylhydroxamic acids were synthesized and evaluated for urease inhibition. Out of these compounds, 3-(2-benzyloxy-5-chlorophenyl)-3-hydroxypropionylhydroxamic acid (d24) was the most active inhibitor with IC50 of 0.15±0.05μM, showing a mixed inhibition with both competitive and uncompetitive aspects. Non-linear fitting of kinetic data gives kinetics parameters of 0.13 and 0.12μg·mL(-1) for Ki and Ki', respectively. The plasma protein binding assays suggested that d24 exhibited moderate binding to human and rabbit plasma proteins. Copyright © 2016 Elsevier Ltd. All rights reserved.
Grijalvo, Santiago; Bedia, Carmen; Triola, Gemma; Casas, Josefina; Llebaria, Amadeu; Teixidó, Jordi; Rabal, Obdulia; Levade, Thierry; Delgado, Antonio; Fabriàs, Gemma
2006-10-01
The synthesis of novel N-acylethanolamines and their use as inhibitors of the aCDase is reported here. The compounds are either 2-oxooctanamides or oleamides of sphingosine analogs featuring a 3-hydroxy-4,5-hexadecenyl tail replaced by ether or thioether moieties. It appears that, within the 2-oxooctanamide family, the C3-OH group of the sphingosine molecule is required for inhibition both in vitro and in cultured cells. Furthermore, although the (E)-4 double bond is not essential for inhibitory activity, the (E) configuration is required, since the analogue with a (Z)-4 unsaturation was not inhibitory. None of the oleamides inhibited the aCDase in vitro. Conversely, with the exception of N-oleoylethanolamine and its analogs with S-decyl and S-hexadecyl substituents, all the synthesized oleamides inhibited the aCDase in cultured cells, although with a relatively low potency. We conclude that novel aCDase inhibitors can evolve from N-acylation of sphingoid bases with electron deficient-acyl groups. In contrast, chemical modification of the N-oleoylsphingosine backbone does not seem to offer an appropriate strategy to obtain aCDase inhibitors.
Yao, Jiangwei; Rock, Charles O.
2015-01-01
Bacterial type II fatty acid synthesis (FASII) is a target for the development of novel therapeutics. Bacteria incorporate extracellular fatty acids into membrane lipids, raising the question of whether pathogens use host fatty acids to bypass FASII and defeat FASII therapeutics. Some pathogens suppress FASII when exogenous fatty acids are present to bypass FASII therapeutics. FASII inhibition cannot be bypassed in many bacteria because essential fatty acids cannot be obtained from the host. FASII antibiotics may not be effective against all bacteria, but a broad spectrum of Gram-negative and -positive pathogens can be effectively treated with FASII inhibitors. PMID:25648887
Synthesis and Evaluation of Novel RSK Inhibitors in a Living Human Breast Model
2015-09-01
the n- propyl carbamate analogue 9, and the sec-butyl carbamate analogue 10. The modified synthetic route could also be applied to the synthesis of...AWARD NUMBER: W81XWH-11-1-0068 TITLE: Synthesis and Evaluation of Novel RSK Inhibitors in a Living Human Breast Model PRINCIPAL INVESTIGATOR...DATES COVERED 01 Jul 2011 – 30 Jun 2015 4. TITLE AND SUBTITLE Synthesis and Evaluation of Novel RSK Inhibitors in a Living Human Breast Model 5a
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
SCD1 Inhibition Causes Cancer Cell Death by Depleting Mono-Unsaturated Fatty Acids
Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L.; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G. F.; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara
2012-01-01
Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway. PMID:22457791
SCD1 inhibition causes cancer cell death by depleting mono-unsaturated fatty acids.
Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G F; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara
2012-01-01
Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway.
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
NASA Astrophysics Data System (ADS)
Negmeldin, Ahmed Thabet
HDAC proteins have emerged as interesting targets for anti-cancer drugs due to their involvement in cancers, as well as several other diseases. Several HDAC inhibitors have been approved by the FDA as anti-cancer drugs, including SAHA (suberoylanilide hydroxamic acid, Vorinostat). Unfortunately, SAHA inhibits most HDAC isoforms, which limit its use as a pharmacological tool and may lead to side effects in the clinic. In this work we were interested in developing isoform selective HDAC inhibitors, which may decrease or eliminate the side effects associated with non-selective inhibitors treatment. In addition, isoform selective HDAC inhibitors can be used as biological tools to help understand the HDAC-related cancer biology. Our strategy was based on synthesis and screening of several derivatives of the non-selective FDA approved drug SAHA substituted at different positions of the linker region. Several SAHA analogs modified at the C4 and C5 positions of the linker were synthesized. The new C4- and C5-modified SAHA libraries, along with the previously synthesized C2-modified SAHA analogs were screened in vitro and in cellulo for HDAC isoform selectivity. Interestingly, several analogs exhibited dual HDAC6/HDAC8 selectivity. Enantioselective syntheses of the pure enantiomers of some of the interesting analogs were performed and the enantiomers were screened in vitro. Among the most interesting analogs, ( R)-C4-benzyl SAHA displayed 520- to 1300-fold selectivity for HDAC6 and HDAC8 over HDAC1, 2, and 3, with IC50 values of 48 and 27 nM with HDAC6 and 8, respectively. Docking studies were performed to provide structural rationale for the observed selectivity of the new analogs. In addition, rational design, synthesis, and screening of several other biaryl indolyl benzamide HDAC inhibitors is discussed, and some showed modest HDAC1 selectivity. The new biaryl indolyl benzamides can be useful to further develop HDAC1 selective inhibitors. The dual HDAC6/8 selective
DOE Office of Scientific and Technical Information (OSTI.GOV)
Not Available
The existence of an intricate interplay of nucleic acids and nucleotides in the chain of events leading from free amino acid to completed polypeptide chain has been determined. To this was added another participant to the nucleotides in protein synthesis - diadenosine-5', 5''', p'p/sup 4/-tetraphosphate (Ap4A). Ap/sub 4/A serves as an initiation primer for DNA synthesis in a eukaryotic system catalyzed by DNA polymerase ..cap alpha... Thus the initial step in protein synthesis is linked to the first step in DNA synthesis by a small molecular weight, unique dinucleotide signal. Advances in the methodology of nucleic acid sequencing have mademore » it possible to examine the relationship between specific short segments of DNA and RNA and their function in the metabolism of the living cell. The triester method of synthesizing deoxynucleotide polymers has made it feasible to synthesize and use specific oligomeric deoxynucleotide sequences as probes of genetic function and potential viral inhibitors. The synthesis of ribonucleotide polymers has been more difficult, due almost entirely to the presence of the 2' ribosyl hydroxyl group. The possibility is now emerging, however, of employing ribonucleotide polymers as specific RNA-virus inhibitors.« less
2015-01-01
Fatty acid synthase (FASN), the enzyme responsible for de novo synthesis of free fatty acids, is up-regulated in many cancers. FASN is essential for cancer cell survival and contributes to drug resistance and poor prognosis. However, it is not expressed in most nonlipogenic normal tissues. Thus, FASN is a desirable target for drug discovery. Although different FASN inhibitors have been identified, none has successfully moved into clinical use. In this study, using in silico screening of an FDA-approved drug database, we identified proton pump inhibitors (PPIs) as effective inhibitors of the thioesterase activity of human FASN. Further investigation showed that PPIs inhibited proliferation and induced apoptosis of cancer cells. Supplementation of palmitate, the end product of FASN catalysis, rescued cancer cells from PPI-induced cell death. These findings provide new evidence for the mechanism by which this FDA-approved class of compounds may be acting on cancer cells. PMID:25513712
Synthesis of the Pitstop family of clathrin inhibitors.
Robertson, Mark J; Deane, Fiona M; Stahlschmidt, Wiebke; von Kleist, Lisa; Haucke, Volker; Robinson, Phillip J; McCluskey, Adam
2014-07-01
This protocol describes the synthesis of two classes of clathrin inhibitors, Pitstop 1 and Pitstop 2, along with two inactive analogs that can be used as negative controls (Pitstop inactive controls, Pitnot-2 and Pitnot-2-100). Pitstop-induced inhibition of clathrin TD function acutely interferes with clathrin-mediated endocytosis (CME), synaptic vesicle recycling and cellular entry of HIV, whereas clathrin-independent internalization pathways and secretory traffic proceed unperturbed; these reagents can, therefore, be used to investigate clathrin function, and they have potential pharmacological applications. Pitstop 1 is synthesized in two steps: sulfonation of 1,8-naphthalic anhydride and subsequent reaction with 4-amino(methyl)aniline. Pitnot-1 results from the reaction of 4-amino(methyl)aniline with commercially available 4-sulfo-1,8-naphthalic anhydride potassium salt. Reaction of 1-naphthalene sulfonyl chloride with pseudothiohydantoin followed by condensation with 4-bromobenzaldehyde yields Pitstop 2. The synthesis of the inactive control commences with the condensation of 4-bromobenzaldehyde with the rhodanine core. Thioketone methylation and displacement with 1-napthylamine affords the target compound. Although Pitstop 1-series compounds are not cell permeable, they can be used in biochemical assays or be introduced into cells via microinjection. The Pitstop 2-series compounds are cell permeable. The synthesis of these compounds does not require specialist equipment and can be completed in 3-4 d. Microwave irradiation can be used to reduce the synthesis time. The synthesis of the Pitstop 2 family is easily adaptable to enable the synthesis of related compounds such as Pitstop 2-100 and Pitnot-2-100. The procedures are also simple, efficient and amenable to scale-up, enabling cost-effective in-house synthesis for users of these inhibitor classes.
Rapid synthesis of triazine inhibitors of inosine monophosphate dehydrogenase.
Pitts, William J; Guo, Junqing; Dhar, T G Murali; Shen, Zhongqi; Gu, Henry H; Watterson, Scott H; Bednarz, Mark S; Chen, Bang Chi; Barrish, Joel C; Bassolino, Donna; Cheney, Daniel; Fleener, Catherine A; Rouleau, Katherine A; Hollenbaugh, Diane L; Iwanowicz, Edwin J
2002-08-19
A series of novel triazine-based small molecule inhibitors (IV) of inosine monophosphate dehydrogenase was prepared. The synthesis and the structure-activity relationships (SAR) derived from in vitro studies are described.
Acid lipase inhibitor in chicken plasma identified as apolipoprotein A-I.
Fujii, M; Higuchi, T; Mukai, S; Yonekura, M; Yano, T; Kawaguchi, H; Nonaka, K; Fukunaga, T; Sugimoto, Y; Yamada, S
1996-10-01
We have reported a inhibitor of acid lipases in liver lysosomes and erythrocytes from chickens [M. Fujii et al., Int. J. Biochem., 22, 895-898 (1990)]. In this paper, the properties of the inhibitor were described in comparison with those of apo A-I of chicken. The purified inhibitor migrated with the same mobility on SDS-PAGE as apo A-I, and had a molecular weight of 27,000. The peptide map from the lipase inhibitor was similar to that of apo A-I. Antibodies to the acid lipase inhibitor also reacted with apo A-I. Apo A-I inhibited the acid lipase activities of liver lysosomes and erythrocytes from chickens as strongly as the lipase inhibitor. The N-terminal amino acid sequence of lipase inhibitor was identical to that of apo A-I as far as residue 20. The amino acid sequence of peptides obtained from the inhibitor by cleavage with CNBr corresponded to internal sequence of apo A-I, and so the CNBr-peptides were derived by cleavage after the methionine residues in apo A-I. The findings showed that the inhibitor of the acid lipases in liver lysosomes and erythrocytes from chickens was identical to apo A-I.
Xu, Feng; Corley, Edward; Zacuto, Michael; Conlon, David A; Pipik, Brenda; Humphrey, Guy; Murry, Jerry; Tschaen, David
2010-03-05
A practical asymmetric synthesis of a novel aminopiperidine-fused imidazopyridine dipeptidyl peptidase IV (DPP-4) inhibitor 1 has been developed. Application of a unique three-component cascade coupling with chiral nitro diester 7, which is easily accessed via a highly enantioselective Michael addition of dimethyl malonate to a nitrostyrene, allows for the assembly of the functionalized piperidinone skeleton in one pot. Through a base-catalyzed, dynamic crystallization-driven process, the cis-piperidionone 16a is epimerized to the desired trans isomer 16b, which is directly crystallized from the crude reaction stream in high yield and purity. Isomerization of the allylamide 16b in the presence of RhCl(3) is achieved without any epimerization of the acid/base labile stereogenic center adjacent to the nitro group on the piperidinone ring, while the undesired enamine intermediate is consumed to <0.5% by utilizing a trace amount of HCl generated from RhCl(3). The amino lactam 4, obtained through hydrogenation and hydrolysis, is isolated as its crystalline pTSA salt from the reaction solution directly, as such intramolecular transamidation has been dramatically suppressed via kinetic control. Finally, a Cu(I) catalyzed coupling-cyclization allows for the formation of the tricyclic structure of the potent DPP-4 inhibitor 1. The synthesis, which is suitable for large scale preparation, is accomplished in 23% overall yield.
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
The synthesis of ethacrynic acid thiazole derivatives as glutathione S-transferase pi inhibitors.
Li, Ting; Liu, Guyue; Li, Hongcai; Yang, Xinmei; Jing, Yongkui; Zhao, Guisen
2012-04-01
Glutathione S-transferase pi (GSTpi) is a phase II enzyme which protects cells from death and detoxifies chemotherapeutic agents in cancer cells. Ethacrynic acid (EA) is a weak GSTpi inhibitor. Structure modifications were done to improve the ability of EA to inhibit GSTpi activity. Eighteen EA thiazole derivatives were designed and synthesized. Compounds 9a, 9b and 9c with a replacement of carboxyl group of EA by a heterocyclic thiazole exhibited improvement over EA to inhibit GSTpi activity. Copyright © 2012 Elsevier Ltd. All rights reserved.
Moreno-Sanz, Guillermo; Duranti, Andrea; Melzig, Laurin; Fiorelli, Claudio; Ruda, Gian Filippo; Colombano, Giampiero; Mestichelli, Paola; Sanchini, Silvano; Tontini, Andrea; Mor, Marco; Bandiera, Tiziano; Scarpelli, Rita; Tarzia, Giorgio; Piomelli, Daniele
2014-01-01
The peripherally restricted fatty acid amide hydrolase (FAAH) inhibitor URB937 (3, cyclohexylcarbamic acid 3’-carbamoyl-6-hydroxybiphenyl-3-yl ester) is extruded from the brain and spinal cord by the Abcg2 efflux transporter. Despite its inability to enter the central nervous system (CNS), 3 exerts profound antinociceptive effects in mice and rats, which result from the inhibition of FAAH in peripheral tissues and the consequent enhancement of anandamide signaling at CB1 cannabinoid receptors localized on sensory nerve endings. In the present study, we examined the structure-activity relationships (SAR) for the biphenyl region of compound 3, focusing on the carbamoyl and hydroxyl groups in the distal and proximal phenyl rings. Our SAR studies generated a new series of peripherally restricted FAAH inhibitors and identified compound 35 (cyclohexylcarbamic acid 3’-carbamoyl-5-hydroxybiphenyl-3-yl ester) as the most potent brain-impermeant FAAH inhibitor disclosed to date. PMID:23822179
Di Santo, Roberto; Costi, Roberta; Roux, Alessandra; Artico, Marino; Lavecchia, Antonio; Marinelli, Luciana; Novellino, Ettore; Palmisano, Lucia; Andreotti, Mauro; Amici, Roberta; Galluzzo, Clementina Maria; Nencioni, Lucia; Palamara, Anna Teresa; Pommier, Yves; Marchand, Christophe
2008-01-01
The virally encoded integrase protein is an essential enzyme in the life cycle of the HIV-1 virus and represents an attractive and validated target in the development of therapeutics against HIV infection. Drugs that selectively inhibit this enzyme, when used in combination with inhibitors of reverse transcriptase and protease, are believed to be highly effective in suppressing the viral replication. Among the HIV-1 integrase inhibitors, the β-diketo acids (DKAs) represent a major lead for anti-HIV-1drug development. In this study, novel bifunctional quinolonyl diketo acid derivatives were designed, synthesized and tested for their inhibitory ability against HIV-1 integrase. The compounds are potent inhibitors of integrase activity. Particularly, derivative 8 is a potent IN inhibitor for both steps of the reaction (3′-processing and strand transfer) and exhibits both high antiviral activity against HIV-1 infected cells and low cytotoxicity. Molecular modeling studies provide a plausible mechanism of action, which is consistent with ligand SARs and enzyme photo-crosslinking experiments. PMID:16539381
Beilby, J P
1983-05-01
The incorporation of isotopically labelled precursors, [1-14C]leucine, [2-14C]uracil and [1-14C]acetate, by germinating spores of the vesicular-arbuscular mycorrhizal fungus Glomus caledonium was investigated after prior incubation with several metabolic inhibitors. Inhibition of isotope incorporation was greatest with ethidium bromide and cycloheximide and least with chloramphenicol and actinomycin D. The incorporation of [1-14C]leucine into protein was reduced by 92% within 60 min of incubation in either ethidium bromide at 5 micrograms/mL or cycloheximide at 100 micrograms/mL. For these studies time zero was coincident with dry quiescent spores being first wet. Lipid synthesis during germination of the spores was detected at 120 min by following the incorporation of [1-14C]acetate. At 51 h, incorporation was greater in the triacylglycerides and diacylglycerides than in the free sterols, phospholipids, or free fatty acid. Spores exposed to cycloheximide for 60 min after imbibition showed very little phospholipid synthesis and no free fatty acid synthesis. The synthesis of RNA after spore imbibition is also discussed.
Evaluating Fmoc-amino acids as selective inhibitors of butyrylcholinesterase
Gonzalez, Jeannette; Ramirez, Jennifer
2018-01-01
Cholinesterases are involved in neuronal signal transduction, and perturbation of function has been implicated in diseases, such as Alzheimer’s and Huntington’s disease. For the two major classes of cholinesterases, such as acetylcholinesterase (AChE) and butyrylcholinesterase (BChE), previous studies reported BChE activity is elevated in patients with Alzheimer’s disease, while AChE levels remain the same or decrease. Thus, the development of potent and specific inhibitors of BChE have received much attention as a potential therapeutic in the alleviation of neurodegenerative diseases. In this study, we evaluated amino acid analogs as selective inhibitors of BChE. Amino acid analogs bearing a 9-fluorenylmethyloxycarbonyl (Fmoc) group were tested, as the Fmoc group has structural resemblance to previously described inhibitors. We identified leucine, lysine, and tryptophan analogs bearing the Fmoc group as selective inhibitors of BChE. The Fmoc group contributed to inhibition, as analogs bearing a carboxybenzyl group showed ~tenfold higher values for the inhibition constant (KI value). Inclusion of a t-butoxycarbonyl on the side chain of Fmoc tryptophan led to an eightfold lower KI value compared to Fmoc tryptophan alone suggesting that modifications of the amino acid side chains may be designed to create inhibitors with higher affinity. Our results identify Fmoc-amino acids as a scaffold upon which to design BChE-specific inhibitors and provide the foundation for further experimental and computational studies to dissect the interactions that contribute to inhibitor binding. PMID:27522651
Evaluating Fmoc-amino acids as selective inhibitors of butyrylcholinesterase.
Gonzalez, Jeannette; Ramirez, Jennifer; Schwans, Jason P
2016-12-01
Cholinesterases are involved in neuronal signal transduction, and perturbation of function has been implicated in diseases, such as Alzheimer's and Huntington's disease. For the two major classes of cholinesterases, such as acetylcholinesterase (AChE) and butyrylcholinesterase (BChE), previous studies reported BChE activity is elevated in patients with Alzheimer's disease, while AChE levels remain the same or decrease. Thus, the development of potent and specific inhibitors of BChE have received much attention as a potential therapeutic in the alleviation of neurodegenerative diseases. In this study, we evaluated amino acid analogs as selective inhibitors of BChE. Amino acid analogs bearing a 9-fluorenylmethyloxycarbonyl (Fmoc) group were tested, as the Fmoc group has structural resemblance to previously described inhibitors. We identified leucine, lysine, and tryptophan analogs bearing the Fmoc group as selective inhibitors of BChE. The Fmoc group contributed to inhibition, as analogs bearing a carboxybenzyl group showed ~tenfold higher values for the inhibition constant (K I value). Inclusion of a t-butoxycarbonyl on the side chain of Fmoc tryptophan led to an eightfold lower K I value compared to Fmoc tryptophan alone suggesting that modifications of the amino acid side chains may be designed to create inhibitors with higher affinity. Our results identify Fmoc-amino acids as a scaffold upon which to design BChE-specific inhibitors and provide the foundation for further experimental and computational studies to dissect the interactions that contribute to inhibitor binding.
Frlan, Rok; Kovac, Andreja; Blanot, Didier; Gobec, Stanislav; Pecar, Slavko; Obreza, Ales
2008-01-11
A series of novel N-benzylidenesulfonohydrazide compounds were designed and synthesized as inhibitors of UDP-N-acetylmuramic acid: L-alanine ligase (MurC) and UDP-N-acetylmuramoyl-L-alanine: D-glutamate ligase (MurD) from E. coli, involved in the biosynthesis of bacterial cell-walls. Some compounds possessed inhibitory activity against both enzymes with IC(50) values as low as 30 microM. In addition, a new, one-pot synthesis of amidobenzaldehydes is reported.
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
Tabassum, Nadia; Lee, Ji-Hyung; Yim, Soon-Ho; Batkhuu, Galzad Javzan; Jung, Da-Woon; Williams, Darren R
2016-01-01
There is a continual need to develop novel and effective melanogenesis inhibitors for the prevention of hyperpigmentation disorders. The plant Artemisia capillaris Thunberg (Oriental Wormwood) was screened for antipigmentation activity using murine cultured cells (B16-F10 malignant melanocytes). Activity-based fractionation using HPLC and NMR analyses identified the compound 4,5-O-dicaffeoylquinic acid as an active component in this plant. 4,5-O-Dicaffeoylquinic acid significantly reduced melanin synthesis and tyrosinase activity in a dose-dependent manner in the melanocytes. In addition, 4,5-O-dicaffeoylquinic acid treatment reduced the expression of tyrosinase-related protein-1. Significantly, we could validate the antipigmentation activity of this compound in vivo, using a zebrafish model. Moreover, 4,5-O-dicaffeoylquinic acid did not show toxicity in this animal model. Our discovery of 4,5-O-dicaffeoylquinic acid as an inhibitor of pigmentation that is active in vivo shows that this compound can be developed as an active component for formulations to treat pigmentation disorders.
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Garbaccio, Robert M; Tasber, Edward S; Neilson, Lou Anne; Coleman, Paul J; Fraley, Mark E; Olson, Christy; Bergman, Jeff; Torrent, Maricel; Buser, Carolyn A; Rickert, Keith; Walsh, Eileen S; Hamilton, Kelly; Lobell, Robert B; Tao, Weikang; South, Vicki J; Diehl, Ronald E; Davide, Joseph P; Yan, Youwei; Kuo, Lawrence C; Li, Chunze; Prueksaritanont, Thomayant; Fernandez-Metzler, Carmen; Mahan, Elizabeth A; Slaughter, Donald E; Salata, Joseph J; Kohl, Nancy E; Huber, Hans E; Hartman, George D
2007-10-15
Observations from two structurally related series of KSP inhibitors led to the proposal and discovery of dihydropyrazolobenzoxazines that possess ideal properties for cancer drug development. The synthesis and characterization of this class of inhibitors along with relevant pharmacokinetic and in vivo data are presented. The synthesis is highlighted by a key [3+2] cycloaddition to form the pyrazolobenzoxazine core followed by diastereospecific installation of a quaternary center.
NASA Astrophysics Data System (ADS)
Pandey, Archana; Verma, Chandrabhan; Singh, B.; Ebenso, Eno E.
2018-03-01
The present study deals with the synthesis of two new compounds namely, benzamide - 2-chloro-4-nitrobenzoic acid (BENCNBA) and anthranilic acid-2-chloro-4-nitrobenzoic acid (AACNBA) using solid phase reactions. The phase diagram studies revealed that formation of the investigated compounds occurs in 1:1 molar ratio. The synthesized compounds were characterized using several spectral techniques such as FT-IR, 1H and 13C NMR, UV-Vis, powder X-ray diffraction (PXRD). Single crystal XRD (SCXRD) study showed that both BENCNBA and AACNBA compounds crystallize in triclinic crystal system with P-1 space group. Further, the presence of intermolecular hydrogen bonding between the constituent components was also supported by single crystal X-ray diffraction (SCXRD) method. Heat of mixing, entropy of fusion, roughness parameter, interfacial energy and excess thermodynamic functions have also been computed using the enthalpy of fusion values derived from differential scanning calorimeter (DSC) study. The inhibition effect of BENCNBA and AACNBA on the mild steel corrosion in hydrochloric acid solution was tested using electrochemical methods. Electrochemical impedance spectroscopy (EIS) study revealed that both BENCNBA and AACNBA behaved as interface corrosion inhibitors and showed maximum inhibition efficiencies of 95.71% and 96.42%, respectively at 400 ppm (1.23 × 10-3 M) concentration. Potentiodynamic polarization (PDP) measurements suggested that BENCNBA and AACNBA acted as mixed type corrosion inhibitors. EIS and PDP results showed that BENCNBA and AACNBA act as efficient corrosion inhibitors for mild steel and their inhibition efficiencies enhances on increasing their concentrations.
DOE Office of Scientific and Technical Information (OSTI.GOV)
R Daher; M Coincon; M Fonvielle
2011-12-31
We report the synthesis and biochemical evaluation of several selective inhibitors of class II (zinc dependent) fructose bis-phosphate aldolases (Fba). The products were designed as transition-state analogues of the catalyzed reaction, structurally related to the substrate fructose bis-phosphate (or sedoheptulose bis-phosphate) and based on an N-substituted hydroxamic acid, as a chelator of the zinc ion present in active site. The compounds synthesized were tested on class II Fbas from various pathogenic microorganisms and, by comparison, on a mammalian class I Fba. The best inhibitor shows Ki against class II Fbas from various pathogens in the nM range, with very highmore » selectivity (up to 105). Structural analyses of inhibitors in complex with aldolases rationalize and corroborate the enzymatic kinetics results. These inhibitors represent lead compounds for the preparation of new synthetic antibiotics, notably for tuberculosis prophylaxis.« less
Cathcart, George R; Gilmore, Brendan F; Greer, Brett; Harriott, Pat; Walker, Brian
2009-11-01
We report on the synthesis and biological evaluation of a focussed library of N-alpha mercaptoamide containing dipeptides as inhibitors of the zinc metallopeptidase Pseudomonas aeruginosa elastase (LasB, EC 3.4.24.26). The aim of the study was to derive an inhibitor profile for LasB with regard to mapping the S'1 binding site of the enzyme. Consequently, a focussed library of 160 members has been synthesised, using standard Fmoc-solid phase methods (on a Rink-amide resin), in which a subset of amino acids including examples of those with basic (Lys, Arg), aromatic (Phe, Trp), large aliphatic (Val, Leu) and acidic (Asp, Glu) side-chains populated the P'2 position of the inhibitor sequence and all 20 natural amino acids were incorporated, in turn, at the P'1 position. The study has revealed a preference for aromatic and/or large aliphatic amino acids at P'1 and a distinct bias against acidic residues at P'2. Ten inhibitor sequences were discovered that exhibited sub to low micromolar Ki values.
Synthesis and Application of Pyrrolidone-containing Shale Inhibitors
NASA Astrophysics Data System (ADS)
Liu, Yonggui; Hou, Jie; Zhang, Yang; Yan, Jing; Song, Tao; Xu, Yongjun
2018-03-01
New generation polyamine inhibitors are amino-terminated polyethers with excellent inhibiting capabilities; they play a key role in borehole stabilization and reservoir protection. However, polyamine inhibitors are limited by their poor thermal stability, which can be attributed to the presence of ether bonds in their molecular structures. We propose a three-step synthesis approach fora novel pyrrolidone-containing polyamine inhibitor (DYNP) by introducing N-vinyl-2-pyrrolidone (NVP) on divinyloxyethane. This polyamine inhibitor exhibits an optimized molecular structure and has enhanced heat resistance. Characterizations by infrared (IR) spectroscopy and evaluation tests demonstrate several advantages of DYNP inhibitors, including excellent inhibiting capability (superior to similar materials such as polyamines), improved heat resistance (reasonable stability at temperatures up to 240°C), and good compatibility with both fresh water and salt water drilling fluids. These can be attributed to the presence of considerable amounts of amino groups in the repeating unit of DYNP molecules. The DYNP inhibitor was applied in over 20 boreholes in tight oil blocks in Daqing Oilfield to relieve hydration of formations with high shale contents. For instance, drilling in the 2033.5m horizontal section of Dragon 2 borehole was smooth, with a borehole diameter expansion ratio below 10%.
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
McCune, S A; Durant, P J; Harris, R A
1984-02-01
Hepatocytes were isolated from 3 and 5 month old female genetically obese Zucker rats and their lean littermate controls. An age-dependent loss in sensitivity of fatty acid synthesis to inhibition by both glucagon and dibutyryl cyclic AMP was observed with hepatocytes from the obese rats. Hepatocytes from lean animals were much more sensitive to these agents, regardless of age. Low concentrations of glucagon and dibutyryl cyclic AMP actually produced some stimulation of fatty acid synthesis with hepatocytes prepared from the older obese rats. 5-Tetradecyloxy-2-furoic acid, a compound which inhibits fatty acid synthesis, was a very effective inhibitor of fatty acid synthesis by hepatocytes isolated from all rats used in the study. An inhibition of lactate plus pyruvate accumulation and a strong stimulation of glycogenolysis occurred in response to both glucagon and dibutyryl cyclic AMP with hepatocytes from both age groups of lean and obese rats. The results suggest that with aging of the obese female Zucker rat some step of hepatic fatty acid synthesis becomes progressively less sensitive to inhibition by glucagon and dibutyryl cyclic AMP. This may play an important role in maintenance of obesity in these animals.
Best, Daniel; Burns, David J; Lam, Hon Wai
2015-06-15
A commercially available rhodium(II) complex catalyzes the direct arylation of 5-diazobarbituric acids with arenes, allowing straightforward access to 5-aryl barbituric acids. Free N-H groups are tolerated on the barbituric acid, with no complications arising from N-H insertion processes. This method was applied to the concise synthesis of a potent matrix metalloproteinase (MMP) inhibitor. © 2015 The Authors. Published by Wiley-VCH Verlag GmbH & Co. KGaA. This is an open access article under the terms of the Creative Commons Attribution License, which permits use, distribution and reproduction in any medium, provided the original work is properly cited.
Complete amino acid sequence of bovine colostrum low-Mr cysteine proteinase inhibitor.
Hirado, M; Tsunasawa, S; Sakiyama, F; Niinobe, M; Fujii, S
1985-07-01
The complete amino acid sequence of bovine colostrum cysteine proteinase inhibitor was determined by sequencing native inhibitor and peptides obtained by cyanogen bromide degradation, Achromobacter lysylendopeptidase digestion and partial acid hydrolysis of reduced and S-carboxymethylated protein. Achromobacter peptidase digestion was successfully used to isolate two disulfide-containing peptides. The inhibitor consists of 112 amino acids with an Mr of 12787. Two disulfide bonds were established between Cys 66 and Cys 77 and between Cys 90 and Cys 110. A high degree of homology in the sequence was found between the colostrum inhibitor and human gamma-trace, human salivary acidic protein and chicken egg-white cystatin.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Minor, P.D.; Dimmock, N.J.
1977-05-15
Various known inhibitors of cellular DNA function were shown to inhibit cellular RNA synthesis and influenza (fowl plague) virus multiplication. The drugs were investigated for their effect upon the synthesis of influenza virus proteins. According to this effect they could be classified with previously studied compounds as follows: Group I (ethidium bromide, proflavine, and N-nitroquinoline-N-oxide) inhibited both viral and cellular protein synthesis; Group II (nogalomycin, daunomycin and ..cap alpha..-amanitin) inhibited viral but not cellular protein synthesis, and all viral proteins were inhibited coordinately; Group III (mithramycin, echinomycin, and actinomycin D) inhibited all viral but not cellular protein synthesis at highmore » concentrations, but at a lower critical concentration inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein preferentially; Group IV(uv irradiation and camptothecin) inhibited the synthesis of viral haemagglutinin, neuraminidase, and M protein, but not other viral proteins, even at high doses. The mode of action of these inhibitors is discussed in relation to the mechanism of the nuclear events upon which influenza virus multiplication is dependent.« less
Kim, Eun Ju; Jin, Xing-Ji; Kim, Yeon Kyung; Oh, In Kyung; Kim, Ji Eun; Park, Chi-Hyun; Chung, Jin Ho
2010-01-01
Although fatty acids are known to be important in various skin functions, their roles on photoaging in human skin are poorly understood. We investigated the alteration of lipid metabolism in the epidermis by photoaging and acute UV irradiation in human skin. UV irradiated young volunteers (21-33 years, n=6) and elderly volunteers (70-75 years, n=7) skin samples were obtained by punch biopsy. Then the epidermis was separated from dermis and lipid metabolism was investigated. We observed that the amounts of free fatty acids (FFA) and triglycerides (TG) in the epidermis of photoaged or acutely UV irradiated human skin were significantly decreased. The expressions of genes related to lipid synthesis, including acetyl-CoA carboxylase (ACC), fatty acid synthase (FAS), stearoyl-CoA desaturase (SCD), sterol regulatory element binding proteins (SREBPs), and peroxisome proliferator-activated receptors (PPARgamma) were also markedly decreased. To elucidate the significance of these changes of epidermal lipids in human skin, we investigated the effects of TG or various inhibitors for the enzymes involved in TG synthesis on the expression of matrix metalloproteinase-1 (MMP-1) in cultured human epidermal keratinocytes. We demonstrated that triolein (TG) reduced basal and UV-induced MMP-1 mRNA expression. In addition, each inhibitor for various lipid synthesis enzymes, such as TOFA (ACC inhibitor), cerulenin (FAS inhibitor) and trans-10, cis-12-CLA (SCD inhibitor), increased the MMP-1 expression significantly in a dose-dependent manner. We also demonstrated that triolein could inhibit cerulenin-induced MMP-1 expression. Furthermore, topical application of triolein (10%) significantly prevented UV-induced MMP-13, COX-2, and IL-1beta expression in hairless mice. Our results suggest that TG and FFA may play important roles in photoaging of human skin. Copyright 2009 Japanese Society for Investigative Dermatology. Published by Elsevier Ireland Ltd. All rights reserved.
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Engelhart, Curtis A.; Aldrich, Courtney C.
2013-01-01
MbtA catalyzes the first committed step of mycobactin biosynthesis in Mycobacterium tuberculosis (Mtb) and is responsible for the incorporation of salicylic acid into the mycobactin siderophores. 5′-O-[N-(Salicyl)sulfamoyl]adenosine (Sal-AMS) is an extremely potent nucleoside inhibitor of MbtA that possesses excellent activity against whole-cell Mtb, but suffers from poor bioavailability. In an effort to improve the bioavailability, we have designed four conformationally constrained analogues of Sal-AMS that remove two rotatable bonds and the ionized sulfamate group based on computational and structural studies. Herein we describe the synthesis, biochemical, and microbiological evaluation of chromone-, quinolone-, and benzoxazinone-3-sulfonamide derivatives of Sal-AMS. We developed new chemistry to assemble these three heterocycles from common β-ketosulfonamide intermediates. The synthesis of the chromone- and quinolone-3-sulfonamide intermediates features formylation of a β-ketosulfonamide employing dimethylformamide dimethyl acetal to afford an enaminone that can react intramolecularly with a phenol or intermolecularly with a primary amine via addition-elimination reaction(s). The benzoxazinone-3-sulfonamide was prepared by nitrosation of a β-ketosulfonamide followed by intramolecular nucleophilic aromatic substitution. Mitsunobu coupling of these bicyclic sulfonamides with a protected adenosine derivative followed by global deprotection provides a concise synthesis of the respective inhibitors. PMID:23805993
Dhar, T G Murali; Shen, Zhongqi; Fleener, Catherine A; Rouleau, Katherine A; Barrish, Joel C; Hollenbaugh, Diane L; Iwanowicz, Edwin J
2002-11-18
A modified approach to the synthesis of 3-(oxazolyl-5-yl) indoles is reported. This method was applied to the synthesis of series of novel indole based inhibitors of inosine monophosphate dehydrogenase (IMPDH). The synthesis and the structure-activity relationships (SARs), derived from in vitro studies, for this new series of inhibitors is given.
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Should anti-inhibitor coagulant complex and tranexamic acid be used concomitantly?
Valentino, L A; Holme, P A
2015-11-01
Inhibitor development in haemophilia patients is challenging especially when undergoing surgical procedures. The development of an inhibitor precludes using factor VIII (FVIII) therapy thereby requiring a bypassing agent (BPA) for surgical bleeding prophylaxis if the FVIII inhibitor titre >5 BU. Concomitant use of anti-inhibitor coagulant complex (AICC) and tranexamic acid has been reported in the literature as a beneficial treatment for this population. Anti-inhibitor coagulant complex is known to cause an increase in thrombin generation and tranexamic acid inhibits fibrinolysis. Hence, the combined used of AICC and tranexamic acid has been limited due to safety concerns over possibilities of increased risk of thrombotic events and disseminated intravascular coagulation. However, the rationale for concomitant therapy is to obtain a potential synergistic effect and to increase clot stability. We conducted a literature review of past studies and individual case reports of concomitant use of AICC and tranexamic acid, which was extensively used during dental procedures. Evidence also exists for concomitant use of the combined therapy in orthopaedic procedures, control of gastrointestinal bleeding, epistaxis and cerebral haemorrhages. Some patients who received the combined therapy had failed monotherapy with a single BPA prior to combined therapy. There were no reports of thrombotic complications related to the concomitant therapy and haemostasis was achieved in all cases. Anti-inhibitor coagulant complex and tranexamic acid therapy was found to be safe, well-tolerated and effective therapy in haemophilia patients with inhibitors. Additional randomized controlled studies should be performed to confirm these findings. © 2015 John Wiley & Sons Ltd.
Lee, Ho-Joo; Choi, Mun Hwan; Kim, Tae-Un; Yoon, Sung Chul
2001-01-01
A psychrotrophic bacterium, Pseudomonas fluorescens BM07, which is able to accumulate polyhydroxyalkanoic acid (PHA) containing large amounts of 3-hydroxy-cis-5-dodecenoate unit up to 35 mol% in the cell from unrelated substrates such as fructose, succinate, etc., was isolated from an activated sludge in a municipal wastewater treatment plant. When it was grown on heptanoic acid (C7) to hexadecanoic acid (C16) as the sole carbon source, the monomer compositional characteristics of the synthesized PHA were similar to those observed in other fluorescent pseudomonads belonging to rRNA homology group I. However, growth on stearic acid (C18) led to no PHA accumulation, but instead free stearic acid was stored in the cell. The existence of the linkage between fatty acid de novo synthesis and PHA synthesis was confirmed by using inhibitors such as acrylic acid and two other compounds, 2-bromooctanoic acid and 4-pentenoic acid, which are known to inhibit β-oxidation enzymes in animal cells. Acrylic acid completely inhibited PHA synthesis at a concentration of 4 mM in 40 mM octanoate-grown cells, but no inhibition of PHA synthesis occurred in 70 mM fructose-grown cells in the presence of 1 to 5 mM acrylic acid. 2-Bromooctanoic acid and 4-pentenoic acid were found to much inhibit PHA synthesis much more strongly in fructose-grown cells than in octanoate-grown cells over concentrations ranging from 1 to 5 mM. However, 2-bromooctanoic acid and 4-pentenoic acid did not inhibit cell growth at all in the fructose media. Especially, with the cells grown on fructose, 2-bromooctanoic acid exhibited a steep rise in the percent PHA synthesis inhibition over a small range of concentrations below 100 μM, a finding indicative of a very specific inhibition, whereas 4-pentenoic acid showed a broad, featureless concentration dependence, suggesting a rather nonspecific inhibition. The apparent inhibition constant Ki (the concentration for 50% inhibition of PHA synthesis) for 2
Amino acid sequence of a trypsin inhibitor from a Spirometra (Spirometra erinaceieuropaei).
Sanda, A; Uchida, A; Itagaki, T; Kobayashi, H; Inokuchi, N; Koyama, T; Iwama, M; Ohgi, K; Irie, M
2001-12-01
A trypsin inhibitor that is highly homologous with bovine pancreatic trypsin inhibitor (BPTI) was co-purified along with RNase from Spirometra (Spirometra erinaceieuropaei). The amino acid sequence of this inhibitor (SETI) and the nucleotide sequence of the cDNA encoding this protein were determined by protein chemistry and gene technology. SETI contains 68 amino acid residues and has a molecular mass of 7,798 Da. SETI has 31 amino acid residues that are identical with BPTI's sequence, including 6 half-cystine and 5 aromatic amino acid residues. The active site Lys residue in BPTI is replaced by an Arg residue in SETI. SETI is an effective inhibitor of trypsin and moderately inhibits a-chymotrypsin, but less inhibits elastase or subtilisin. SETI was expressed by E. coli containing a PelB vector carrying the SETI encoding cDNA; an expression yield of 0.68 mg/l was obtained. The phylogenetic relationship of SETI and the other BPTI-like trypsin inhibitors was analyzed using most likelihood inference methods.
Varasi, Mario; Thaler, Florian; Abate, Agnese; Bigogno, Chiara; Boggio, Roberto; Carenzi, Giacomo; Cataudella, Tiziana; Dal Zuffo, Roberto; Fulco, Maria Carmela; Rozio, Marco Giulio; Mai, Antonello; Dondio, Giulio; Minucci, Saverio; Mercurio, Ciro
2011-04-28
New spiro[chromane-2,4'-piperidine] and spiro[benzofuran-2,4'-piperidine] hydroxamic acid derivatives as HDAC inhibitors have been identified by combining privileged structures with a hydroxamic acid moiety as zinc binding group. The compounds were evaluated for their ability to inhibit nuclear extract HDACs and for their in vitro antiproliferative activity on different tumor cell lines. This work resulted in the discovery of spirocycle 30d that shows good oral bioavailability and tumor growth inhibition in an HCT-116 murine xenograft model.
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
González-Olvera, Rodrigo; Espinoza-Vázquez, Araceli; Negrón-Silva, Guillermo E; Palomar-Pardavé, Manuel E; Romero-Romo, Mario A; Santillan, Rosa
2013-12-06
A series of new mono-1,2,3-triazole derivatives of pyrimidine nucleobases were synthesized by one-pot copper(I)-catalyzed 1,3-dipolar cycloaddition reactions between N-1-propargyluracil and thymine, sodium azide and several benzyl halides. The desired heterocyclic compounds were obtained in good yields and characterized by NMR, IR, and high resolution mass spectrometry. These compounds were investigated as corrosion inhibitors for steel in 1 M HCl solution, using electrochemical impedance spectroscopy (EIS) technique. The results indicate that these heterocyclic compounds are promising acidic corrosion inhibitors for steel.
Monosaccharides as Scaffolds for the Synthesis of Novel Compounds
NASA Astrophysics Data System (ADS)
Murphy, Paul V.; Velasco-Torrijos, Trinidad
This chapter focuses on monosaccharides and scaffolds their derivatives as scaffolds for the synthesis of primarily bioactive compounds. Such carbohydrate derivatives have been designed to modulate mainly protein-protein and peptide-protein interactions although modulators of carbohydrate-protein and carbohydrate-nucleic acid interactions have also been of interest. The multiple hydroxyl groups that are present on saccharides have made pyranose, furanose and iminosugars ideal templates or scaffolds to which recognition or pharmacophoric groups can be grafted to generate novel compounds for medicinal chemistry. The synthesis of compounds for evaluations require strategies for regioselective reactions of saccharide hydroxyl groups and use of orthogonally stable protecting groups. Syntheses have been carried out on the solid phase and in solution. Also the use of uronic acids, amino sugars and sugar amino acids has facilitated the synthesis of peptidomimetics and prospecting libraries as they enable, through presence of amino or carboxylic acid groups, chemoselective approaches to be employed in solution and on solid phase. Sugar amino acids are readily incorporated, as peptide isosteres, to generate sugar-peptide hybrids or for the synthesis of novel carbopeptoids . The synthesis of new cyclic compounds, derived in part from saccharides, and their application as scaffolds is an emerging area and recent examples include spirocyclic compounds, benzodiazepine-saccharide hybrids and macrolide-saccharide hybrids. Potent bioactive saccharide derivatives have been identified that include enzyme inhibitors , somatostatin receptor ligands, integrin ligands, anti-viral compounds, shiga toxin inhibitors and cell growth inhibitors. Some saccharide derivatives have demonstrated improved cellular permeability when compared with peptides and are in clinical trials.
Zheng, Chang-Ji; Sohn, Mi-Jin; Chi, Seung-Wook; Kim, Won-Gon
2010-05-01
Bacterial enoyl-ACP reductase (FabI) has been demonstrated to be a novel antibacterial target. In the course of our screening for FabI inhibitors we isolated two methyl-branched fatty acids from Streptomyces sp. A251. They were identified as 14-methyl-9(Z)-pentadecenoic acid and 15-methyl-9(Z)-hexadecenoic acid by MS and NMR spectral data. These compounds inhibited Staphylococcus aureus FabI with IC50 of 16.0 and 16.3mu M, respectively, while didn't affect FabK, an enoyl-ACP reductase of Streptococcus pneumonia, at 100muM. Consistent with their selective inhibition for FabI, they blocked intracellular fatty acid synthesis as well as the growth of S. aureus, while didn't inhibit the growth of S. pneumonia. Additionally, these compounds showed reduced antibacterial activity against fabI-overexpressing S. aureus compared to the wild-type strain. These results demonstrate that the methyl-branched fatty acids showed antibacterial activity by inhibiting FabI in vivo.
Ginger extract as green corrosion inhibitor of mild steel in hydrochloric acid solution
NASA Astrophysics Data System (ADS)
Fidrusli, A.; Suryanto; Mahmood, M.
2018-01-01
Ginger extract as corrosion inhibitor from natural resources was studied to prevent corrosion of mild steel in acid media. Ginger rhizome was extracted to produce green corrosion inhibitor (G-1) while ginger powder bought at supermarket was also extract to form green corrosion inhibitor (G-2). Effectiveness of inhibitor in preventing corrosion process of mild steel was studied in 1.0 M of hydrochloric acid. The experiment of weight loss method and polarization technique were conducted to measure corrosion rate and inhibition efficiency of mild steel in solution containing 1.0 M of hydrochloric acid with various concentration of inhibitor at room temperature. The results showed that, the rate of corrosion dropped from 8.09 mmpy in solution containing no inhibitor to 0.72 mmpy in solution containing 150g/l inhibitor while inhibition efficiency up to 91% was obtained. The polarization curve in polarization experiments shows that the inhibition efficiency is 86% with high concentration of inhibitor. The adsorption of ginger extract on the surface of mild steel was observed by using optical microscope and the characterization analysis was done by using pH measurement method. When high concentration of green inhibitor in the acid solution is used, the pH at the surface of steel is increasing.
Therapeutic potential of monoacylglycerol lipase inhibitors.
Mulvihill, Melinda M; Nomura, Daniel K
2013-03-19
Marijuana and aspirin have been used for millennia to treat a wide range of maladies including pain and inflammation. Both cannabinoids, like marijuana, that exert anti-inflammatory action through stimulating cannabinoid receptors, and cyclooxygenase (COX) inhibitors, like aspirin, that suppress pro-inflammatory eicosanoid production have shown beneficial outcomes in mouse models of neurodegenerative diseases and cancer. Both cannabinoids and COX inhibitors, however, have untoward effects that discourage their chronic usage, including cognitive deficits and gastrointestinal toxicity, respectively. Recent studies have uncovered that the serine hydrolase monoacylglycerol lipase (MAGL) links the endocannabinoid and eicosanoid systems together through hydrolysis of the endocannabinoid 2-arachidonoylglycerol (2-AG) to provide the major arachidonic acid (AA) precursor pools for pro-inflammatory eicosanoid synthesis in specific tissues. Studies in recent years have shown that MAGL inhibitors elicit anti-nociceptive, anxiolytic, and anti-emetic responses and attenuate precipitated withdrawal symptoms in addiction paradigms through enhancing endocannabinoid signaling. MAGL inhibitors have also been shown to exert anti-inflammatory action in the brain and protect against neurodegeneration through lowering eicosanoid production. In cancer, MAGL inhibitors have been shown to have anti-cancer properties not only through modulating the endocannabinoid-eicosanoid network, but also by controlling fatty acid release for the synthesis of protumorigenic signaling lipids. Thus, MAGL serves as a critical node in simultaneously coordinating multiple lipid signaling pathways in both physiological and disease contexts. This review will discuss the diverse (patho)physiological roles of MAGL and the therapeutic potential of MAGL inhibitors in treating a vast array of complex human diseases. Copyright © 2012 Elsevier Inc. All rights reserved.
Iftikhar, Fatima; Ali, Yousaf; Ahmad Kiani, Farooq; Fahad Hassan, Syed; Fatima, Tabeer; Khan, Ajmal; Niaz, Basit; Hassan, Abbas; Latif Ansari, Farzana; Rashid, Umer
2017-10-01
In our previous report, we have identified 3,4-dihydropyrimidine scaffold as promising class of urease inhibitor in a structure based virtual screen (SBVS) experiment. In present study, we attempted to optimize the scaffold by varying C-5 substituent. The elongation of the C-5 chain was achieved by the reaction of C-5 ester with hydrazine leading to C-5 carbohydrazides which were further used as building blocks for the synthesis of fifteen new compounds having diverse moieties. A significantly higher in vitro urease inhibitory activity with IC 50 values in submicromolar range was observed for semithiocarbazide derivatives (4a-c, 0.58-0.79µM) and isatin Schiff base derivative 5a (0.23µM). Docking analysis suggests that the synthesized compounds were anchored well in the catalytic site and extending to the entrance of binding pocket and thus restrict the mobility of the flap by interacting with its key amino acid residues. The overall results of urease inhibition have shown that these compounds can be further optimized and developed as lead urease inhibitors. Copyright © 2017 Elsevier Inc. All rights reserved.
Cosgrove, J W; Brown, I R
1984-05-01
An initiating cell-free protein synthesis system derived from brain was utilized to demonstrate that the intravenous injection of D-lysergic acid diethylamide (LSD) to rabbits resulted in a lesion at the initiation stage of brain protein synthesis. Three inhibitors of initiation, edeine, poly(I), and aurintricarboxylic acid were used to demonstrate a reduction in initiation-dependent amino acid incorporation in the brain cell-free system. One hour after LSD injection, there was also a measurable decrease in the formation of 40S and 80S initiation complexes in vitro, using either [35S]methionine or [35S]Met-tRNAf. Analysis of the methionine pool size after LSD administration indicated there was no change in methionine levels. Analysis of the formation of initiation complexes in the brain cell-free protein synthesis system prepared 6 h after LSD administration indicated that there was a return to control levels at this time. The effects of LSD on steps in the initiation process are thus reversible.
Inhibition of fatty acid synthesis decreases very low density lipoprotein secretion in the hamster.
Arbeeny, C M; Meyers, D S; Bergquist, K E; Gregg, R E
1992-06-01
The hamster was developed as a model to study very low density lipoprotein (VLDL) metabolism, since, as is the case in humans, the hamster liver was found to synthesize apoB-100 and not apoB-48. The effect of inhibiting fatty acid synthesis on the hepatic secretion of VLDL triglyceride (TG) and apolipoprotein (apo) B-100 in this model was then investigated. In an in vivo study, hamsters were fed a chow diet containing 0.15% TOFA (5-tetradecyloxy-2-furancarboxylic acid), an inhibitor of acetyl-CoA carboxylase. After 6 days of treatment, plasma triglyceride and cholesterol levels were decreased by 30.2% and 11.6%, respectively. When the secretion of VLDL-TG by the liver was measured in vivo after injection of Triton WR 1339, TOFA treatment was found to decrease VLDL-TG secretion by 40%. In subsequent in vitro studies utilizing cultured primary hamster hepatocytes, incubation with 20 microM TOFA for 4 h resulted in 98% and 76% inhibition in fatty acid and triglyceride synthesis, respectively; VLDL-TG secretion was decreased by 90%. When hepatocytes were pulsed with [3H]leucine, incubation with TOFA resulted in a 50% decrease in the incorporation of radiolabel into secreted VLDL apoB-100. The results of this study indicate that inhibition of intracellular triglyceride synthesis decreases the secretion of VLDL-TG and apoB-100, and does not result in the secretion of a dense, triglyceride-depleted lipoprotein.
Design and Synthesis of New Peptidomimetics as Potential Inhibitors of MurE.
Zivec, Matej; Turk, Samo; Blanot, Didier; Gobec, Stanislav
2011-03-01
With the continuing emergence and spread of multidrug-resistant bacteria, there is an urgent need for the development of new antimicrobial agents. One possible source of new antibacterial targets is the biosynthesis of the bacterial cell-wall peptidoglycan. The assembly of the peptide stem is carried out by four essential enzymes, known as the Mur ligases (MurC, D, E and F). We have designed and synthesised a focused library of compounds as potential inhibitors of UDP-N-acetylmuramoyl-L-alanyl-D-glutamate:L-lysine ligase (MurE) from Staphylococcus aureus. This was achieved using two approaches: (i) synthesis of transition-state analogues based on the methyleneamino core; and (ii) synthesis of MurE reaction product analogues. Two methyleneamino-based compounds are identified as initial hits for inhibitors of MurE.
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
New peptide deformylase inhibitors design, synthesis and pharmacokinetic assessment.
Lv, Fengping; Chen, Chen; Tang, Yang; Wei, Jianhai; Zhu, Tong; Hu, Wenhao
2016-08-01
The docking approach for the screening of designed small molecule ligands, led to the identification of a critical arginine residue in peptide deformylase for spiro cyclopropyl PDF inhibitor's extra hydrophobic binding, providing us a useful tool for searching more efficient PDF inhibitors to fight for horrifying antibiotics resistance. Further synthetic modification was undertaken to optimize the potency of amide compounds. To lower metabolic susceptibility and in turn reduce unwanted metabolic toxicity that was observed clinically, while retaining desired antibacterial activity, the use of azoles as amide bioisosteres had also been investigated. After the completion of chemical synthesis, all the compounds were evaluated through in vitro antibacterial activity assay, some of which were further subject to in vivo rat pharmacokinetic assessment. Those findings in this letter showed that spiro cyclopropyl proline N-formyl hydroxylamines, and especially the bioisosteric azoles, can represent a promising class of PDF inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Zhu, Jie; Yang, Hongyu; Chen, Yao; Lin, Hongzhi; Li, Qi; Mo, Jun; Bian, Yaoyao; Pei, Yuqiong; Sun, Haopeng
2018-12-01
The cholinergic hypothesis has long been a "polar star" in drug discovery for Alzheimer's disease (AD), resulting in many small molecules and biological drug candidates. Most of the drugs marketed for AD are cholinergic. Herein, we report our efforts in the discovery of cholinesterases inhibitors (ChEIs) as multi-target-directed ligands. A series of tacrine-ferulic acid hybrids have been designed and synthesised. All these compounds showed potent acetyl-(AChE) and butyryl cholinesterase(BuChE) inhibition. Among them, the optimal compound 10g, was the most potent inhibitor against AChE (electrophorus electricus (eeAChE) half maximal inhibitory concentration (IC 50 ) = 37.02 nM), it was also a strong inhibitor against BuChE (equine serum (eqBuChE) IC 50 = 101.40 nM). Besides, it inhibited amyloid β-protein self-aggregation by 65.49% at 25 μM. In subsequent in vivo scopolamine-induced AD models, compound 10g obviously ameliorated the cognition impairment and showed preliminary safety in hepatotoxicity evaluation. These data suggest compound 10g as a promising multifunctional agent in the drug discovery process against AD.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Dysregulation of fatty acid synthesis and glycolysis in non-Hodgkin lymphoma
Bhatt, Aadra P.; Jacobs, Sarah R.; Freemerman, Alex J.; Makowski, Liza; Rathmell, Jeffrey C.; Dittmer, Dirk P.; Damania, Blossom
2012-01-01
The metabolic differences between B-NHL and primary human B cells are poorly understood. Among human B-cell non-Hodgkin lymphomas (B-NHL), primary effusion lymphoma (PEL) is a unique subset that is linked to infection with Kaposi's sarcoma-associated herpesvirus (KSHV). We report that the metabolic profiles of primary B cells are significantly different from that of PEL. Compared with primary B cells, both aerobic glycolysis and fatty acid synthesis (FAS) are up-regulated in PEL and other types of nonviral B-NHL. We found that aerobic glycolysis and FAS occur in a PI3K-dependent manner and appear to be interdependent. PEL overexpress the fatty acid synthesizing enzyme, FASN, and both PEL and other B-NHL were much more sensitive to the FAS inhibitor, C75, than primary B cells. Our findings suggest that FASN may be a unique candidate for molecular targeted therapy against PEL and other B-NHL. PMID:22752304
Cheng, Chien-shan; Wang, Zhiyu; Chen, Jianping
2014-01-01
Molecular targeted therapy has been developed for cancer chemoprevention and treatment. Cancer cells process a fundamental change in its bioenergetic metabolism from normal cells on an altered lipid metabolism, also known as the de novo fatty acid synthesis, for sustaining their high proliferation rates. Fatty acid synthesis is now associated with clinically aggressive tumor behavior and tumor cell growth and has become a novel target pathway for chemotherapy development. Although the underlying mechanisms of the altered de novo fatty acid synthesis still remains unclear, recent progress has shown that by targeting Fatty acid synthase (FASN), a key enzyme that catalyzes the synthesis of endogenous long chain fatty acid could be a critical target for drug discovery. However, relatively few FASN inhibitors have been discovered. With the long history of clinical practices and numerous histological case study reports, traditional Chinese medicine enjoys an important role in seeking bioactive anticancer natural compounds. Herein, we will give an overall picture of the current progress of molecular targeted therapy in cancer fatty acid synthesis, describe the advances in the research on natural products-derived FASN inhibitors and their potential for enhancing our understanding of fatty acids in tumor biology, and may provide new therapeutic moieties for breast cancer patient care. PMID:24778702
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Latli, Bachir; Hrapchak, Matt; Chevliakov, Maxim; Li, Guisheng; Campbell, Scot; Busacca, Carl A; Senanayake, Chris H
2015-05-30
Deleobuvir, (2E)-3-(2-{1-[2-(5-bromopyrimidin-2-yl)-3-cyclopentyl-1-methyl-1H-indole-6-carboxamido]cyclobutyl}-1-methyl-1H-benzimidazol-6-yl)prop-2-enoic acid (1), is a non-nucleoside, potent, and selective inhibitor of hepatitis C virus NS5B polymerase. Herein, we describe the detailed synthesis of this compound labeled with carbon-13 and carbon-14. The synthesis of its three major metabolites, namely, the reduced double bond metabolite (2) and the acyl glucuronide derivatives of (1) and (2), is also reported. Aniline-(13) C6 was the starting material to prepare butyl (E)-3-(3-methylamino-4-nitrophenyl-(13) C6 )acrylate [(13) C6 ]-(11) in six steps. This intermediate was then used to obtain [(13) C6 ]-(1) and [(13) C6 ]-(2) in five and four more steps, respectively. For the radioactive synthesis, potassium cyanide-(14) C was used to prepare 1-cylobutylaminoacid [(14) C]-(23) via Buchrer-Bergs reaction. The carbonyl chloride of this acid was then used to access both [(14) C]-(1) and [(14) C]-(2) in four steps. The acyl glucuronide derivatives [(13) C6 ]-(3), [(13) C6 ]-(4) and [(14) C]-(3) were synthesized in three steps from the acids [(13) C6 ]-(1), [(13) C6 ]-(2) and [(14) C]-(1) using known procedures. Copyright © 2015 John Wiley & Sons, Ltd.
Inhibition of hepatic lipogenesis by 2-tetradecylglycidic acid.
McCune, S A; Nomura, T; Harris, R A
1979-10-01
2-Tetradecylglycidic acid (TDGA), a hypoglycemic agent, has been found to be a very effective inhibitor of de novo fatty acid synthesis by isolated hepatocytes. A comparison was made between the effectiveness of TDGA and 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, on the metabolic processes of isolated hepatocytes. These compounds are structurally related and both inhibit fatty acid synthesis; however, they have opposite effects from each other on the oxidation and esterification of fatty acids. TDGA inhibits whereas TOFA stimulates fatty acid oxidation. TDGA stimulates whereas TOFA inhibits fatty acid esterification.
Cell proliferation and progesterone synthesis depend on lipid metabolism in bovine granulosa cells.
Elis, Sebastien; Desmarchais, Alice; Maillard, Virginie; Uzbekova, Svetlana; Monget, Philippe; Dupont, Joëlle
2015-03-15
In dairy cows, lipids are essential to support energy supplies for all biological functions, especially during early lactation. Lipid metabolism is crucial for sustaining proper reproductive function. Alteration of lipid metabolism impacts follicular development and affects oocyte developmental competence. Indeed, nonesterified fatty acids are able to decrease granulosa cell (GC) proliferation and affect estradiol synthesis, thus potentially affecting follicular growth and viability. The objective of this study was to assess the impact of lipid metabolism on bovine GCs, through the use of the lipid metabolism inhibitors etomoxir, an inhibitor of fatty acid (FA) oxidation through inhibition of carnitine palmitoyl transferase 1 (CPT1), and C75, an inhibitor of FA synthesis through inhibition of fatty acid synthase. We showed that etomoxir and C75 significantly inhibited DNA synthesis in vitro; C75 also significantly decreased progesterone synthesis. Both inhibitors significantly reduced AMPK (5' adenosine monophosphate-activated protein kinase) and acetyl-CoA carboxylase phosphorylation. Etomoxir also affected the AKT (protein kinase B) signaling pathway. Combined, these data suggest that both FA oxidation and synthesis are important for the bovine GCs to express a proliferative and steroidogenic phenotype and, thus, for sustaining follicular growth. Despite these findings, it is important to note that the changes caused by the inhibitors of FA metabolism on GCs in vitro are globally mild, suggesting that lipid metabolism is not as critical in GCs as was observed in the oocyte-cumulus complex. Further studies are needed to investigate the detailed mechanisms by which lipid metabolism interacts with GC functions. Copyright © 2015 Elsevier Inc. All rights reserved.
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Paganelli, Fernanda L; van de Kamer, Tim; Brouwer, Ellen C; Leavis, Helen L; Woodford, Neil; Bonten, Marc J M; Willems, Rob J L; Hendrickx, Antoni P A
2017-03-01
Enterococcus faecium is a multidrug-resistant (MDR) nosocomial pathogen causing significant morbidity in debilitated patients. New antimicrobials are needed to treat antibiotic-resistant E. faecium infections in hospitalised patients. E. faecium incorporates lipoteichoic acid (LTA) (1,3-polyglycerol-phosphate linked to glycolipid) in its cell wall. The small-molecule inhibitor 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] specifically blocks the activity of Staphylococcus aureus LtaS synthase, which polymerises 1,3-glycerolphosphate into LTA polymers. Here we characterised the effects of the small-molecule inhibitor 1771 on the growth of E. faecium isolates, alone (28 strains) or in combination with the antibiotics vancomycin, daptomycin, ampicillin, gentamicin or linezolid (15 strains), and on biofilm formation (16 strains). Inhibition of LTA synthesis at the surface of the cell by compound 1771 in combination with current antibiotic therapy abrogates enterococcal growth in vitro but does not affect mature E. faecium biofilms. Targeting LTA synthesis may provide new possibilities to treat MDR E. faecium infections. Copyright © 2017 Elsevier B.V. and International Society of Chemotherapy. All rights reserved.
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Bhatti, Huma Aslam; Khatoon, Memoona; Al-Rashida, Mariya; Bano, Huma; Iqbal, Nafees; Zaib-Un-Nisa; Yousuf, Sammer; Khan, Khalid Mohammed; Hameed, Abdul; Iqbal, Jamshed
2017-04-01
Owing to the biological importance of cyclic sulfonamides (sultams), herein we report a new, facile and cost-effective method for the synthesis of sultams that makes use of a reaction between dansyl amide and easily accessible benzaldehydes under mildly acidic conditions. All compounds were obtained in good yields (69-96%). Consequently a series of cyclic sulfonamides (7a-7n) was synthesized and characterized using FTIR, MS and NMR spectroscopy, crystal structure of compound 7b has also been determined. All compounds were evaluated for their potential to inhibit alkaline phosphatase (bTNAP and bIAP). All compounds were found to be excellent inhibitors of bTNAP with IC 50 values in lower micro-molar range (0.11-6.63μM). Most of the compounds were selective inhibitors of bTNAP over bIAP. Only six compounds were found to be active against bIAP (IC 50 values in the range 0.38-3.48μM). Molecular docking studies were carried out to identify and rationalize the structural elements necessary for efficient AP inhibition. Copyright © 2017 Elsevier Inc. All rights reserved.
Cetyltrimethyl Ammonium Bromide as Corrosion Inhibitor for Zinc Used in Hydrochloric Acid
NASA Astrophysics Data System (ADS)
Sun, C. X.; Du, J. J.; Ma, Z. W.; Huang, C. S.; Wu, J. Y.
2018-05-01
A compound inhibitor composed of cetyltrimethyl ammonium bromide (CTAB) and bromohexadecyl pyridine was tested as corrosion inhibitor for zinc in hydrochloric acid. The results of static coupon test show that the compound inhibitor can effectively protect zinc from corrosion and the best concentration ratio is CTAB 50 mg/L and bromohexadecyl pyridine 200 mg/L. The polarization results show that the compound inhibitor will cause a negative shift of E0 of zinc in hydrochloric acid. The EIS (electrchemical impedance spectra) results show that the inhibitor leads to a bigger radius and has one time constant. SEM results show that the CTAB and bromohexadecyl pyridine form a uniform and compact membrane on the surface of zinc that can protect zinc from corroding effectively.
Zawadzke, Laura E; Norcia, Michael; Desbonnet, Charlene R; Wang, Hong; Freeman-Cook, Kevin; Dougherty, Thomas J
2008-02-01
The pathway for synthesis of the peptidoglycan precursor UDP-N-acetylmuramyl pentapeptide is essential in Gram-positive and Gram-negative bacteria. This pathway has been exploited in the recent past to identify potential new antibiotics as inhibitors of one or more of the Mur enzymes. In the present study, a high-throughput screen was employed to identify potential inhibitors of the Escherichia coli MurC (UDP-N-acetylmuramic acid:L-alanine ligase), the first of four paralogous amino acid-adding enzymes. Inhibition of ATP consumed during the MurC reaction, using an adaptation of a kinase assay format, identified a number of potential inhibitory chemotypes. After nonspecific inhibition testing and chemical attractiveness were assessed, C-1 emerged as a compound for further characterization. The inhibition of MurC by this compound was confirmed in both a kinetic-coupled enzyme assay and a direct nuclear magnetic resonance product detection assay. C-1 was found to be a low micromolar inhibitor of the E. coli MurC reaction, with preferential inhibition by one of two enantiomeric forms. Experiments indicated that it was a competitive inhibitor of ATP binding to the MurC enzyme. Further work with MurC enzymes from several bacterial sources revealed that while the compound was equally effective at inhibiting MurC from genera (Proteus mirabilis and Klebsiella pneumoniae) closely related to E. coli, MurC enzymes from more distant Gram-negative species such as Haemophilus influenzae, Acinetobacter baylyi, and Pseudomonas aeruginosa were not inhibited.
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Dhar, T G Murali; Shen, Zhongqi; Gu, Henry H; Chen, Ping; Norris, Derek; Watterson, Scott H; Ballentine, Shelley K; Fleener, Catherine A; Rouleau, Katherine A; Barrish, Joel C; Townsend, Robert; Hollenbaugh, Diane L; Iwanowicz, Edwin J
2003-10-20
A series of novel small molecule inhibitors of inosine monophosphate dehydrogenase (IMPDH), based upon a 3-cyanoindole core, were explored. IMPDH catalyzes the rate determining step in guanine nucleotide biosynthesis and is a target for anticancer, immunosuppressive and antiviral therapy. The synthesis and the structure-activity relationships (SAR), derived from in vitro studies, for this new series of inhibitors is given.
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Wyatt, Emma E; Galloway, Warren R J D; Thomas, Gemma L; Welch, Martin; Loiseleur, Olivier; Plowright, Alleyn T; Spring, David R
2008-10-28
The screening of a diversity-oriented synthesis library followed by structure-activity relationship investigations have led to the discovery of an anti-MRSA agent which operates as an inhibitor of Staphylococcus aureus dihydrofolate reductase.
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Baston, Eckhard; Salem, Ola I A; Hartmann, Rolf W
2003-03-01
In search of novel nonsteroidal mimics of steroidal inhibitors of 5 alpha reductase, 4-(2-phenylethyl)cyclohex-1-ene carboxylic acids 1-5 were synthesized with different substituents in para position of the phenyl ring (1: N, N-diisopropylcarbamoyl, 2: phenyl, 3: phenoxy, 4: benzoyl, and 5: benzyl). The principal synthetic approach for the desired compounds consisted of a Wittig olefination between 1, 4-dioxaspiro [4.5]-decane-8-carbaldehyde (4g and the appropriate phosphonium salts. The compounds were tested for inhibition of human 5 alpha reductase isozymes 1 and 2 using DU 145 cells and preparations from prostatic tissue, respectively. They turned out to be good inhibitors of the prostatic isozyme 2 with compound 1 being the most potent one (IC(50) = 760 nM). Isozyme 1 was only slightly inhibited. It is concluded that the novel structures are appropriate for being further optimized, aiming at the development of a novel drug for the treatment of benign prostatic hyperplasia.
Design, Synthesis, and Properties of a Potent Inhibitor of Pseudomonas aeruginosa Deacetylase LpxC.
Piizzi, Grazia; Parker, David T; Peng, Yunshan; Dobler, Markus; Patnaik, Anup; Wattanasin, Som; Liu, Eugene; Lenoir, Francois; Nunez, Jill; Kerrigan, John; McKenney, David; Osborne, Colin; Yu, Donghui; Lanieri, Leanne; Bojkovic, Jade; Dzink-Fox, JoAnn; Lilly, Maria-Dawn; Sprague, Elizabeth R; Lu, Yipin; Wang, Hongming; Ranjitkar, Srijan; Xie, Lili; Wang, Bing; Glick, Meir; Hamann, Lawrence G; Tommasi, Ruben; Yang, Xia; Dean, Charles R
2017-06-22
Over the past several decades, the frequency of antibacterial resistance in hospitals, including multidrug resistance (MDR) and its association with serious infectious diseases, has increased at alarming rates. Pseudomonas aeruginosa is a leading cause of nosocomial infections, and resistance to virtually all approved antibacterial agents is emerging in this pathogen. To address the need for new agents to treat MDR P. aeruginosa, we focused on inhibiting the first committed step in the biosynthesis of lipid A, the deacetylation of uridyldiphospho-3-O-(R-hydroxydecanoyl)-N-acetylglucosamine by the enzyme LpxC. We approached this through the design, synthesis, and biological evaluation of novel hydroxamic acid LpxC inhibitors, exemplified by 1, where cytotoxicity against mammalian cell lines was reduced, solubility and plasma-protein binding were improved while retaining potent anti-pseudomonal activity in vitro and in vivo.
Lu, Tianbao; Schubert, Carsten; Cummings, Maxwell D; Bignan, Gilles; Connolly, Peter J; Smans, Karine; Ludovici, Donald; Parker, Michael H; Meyer, Christophe; Rocaboy, Christian; Alexander, Richard; Grasberger, Bruce; De Breucker, Sabine; Esser, Norbert; Fraiponts, Erwin; Gilissen, Ron; Janssens, Boudewijn; Peeters, Danielle; Van Nuffel, Luc; Vermeulen, Peter; Bischoff, James; Meerpoel, Lieven
2018-05-08
We designed and synthesized a new series of fatty acid synthase (FASN) inhibitors with potential utility for the treatment of cancer. Extensive SAR studies led to highly active FASN inhibitors with good cellular activity and oral bioavailability, exemplified by compound 34. Compound 34 is a potent inhibitor of human FASN (IC 50 = 28 nM) that effectively inhibits proliferation of A2780 ovarian cells (IC 50 = 13 nM) in lipid-reduced serum (LRS). This cellular activity can be rescued by addition of palmitate, consistent with an on-target effect. Compound 34 is also active in many other cell types, including PC3M (IC 50 = 25 nM) and LnCaP-Vancouver prostate cells (IC 50 = 66 nM), and is highly bioavailable (F 61%) with good exposure after oral administration. In a pharmacodynamics study in H460 lung xenograft-bearing mice, oral treatment with compound 34 results in elevated tumor levels of malonyl-CoA and decreased tumor levels of palmitate, fully consistent with the desired target engagement. Copyright © 2018 Elsevier Ltd. All rights reserved.
Shinji, Chihiro; Maeda, Satoko; Imai, Keisuke; Yoshida, Minoru; Hashimoto, Yuichi; Miyachi, Hiroyuki
2006-11-15
A series of hydroxamic acid derivatives bearing a cyclic amide/imide group as a linker and/or cap structure, prepared during our structural development studies based on thalidomide, showed class-selective potent histone deacetylase (HDAC)-inhibitory activity. Structure-activity relationship studies indicated that the steric character of the substituent introduced at the cyclic amide/imide nitrogen atom, the presence of the amide/imide carbonyl group, the hydroxamic acid structure, the shape of the linking group, and the distance between the zinc-binding hydroxamic acid group and the cap structure are all important for HDAC-inhibitory activity and class selectivity. A representative compound (30w) showed potent p21 promoter activity, comparable with that of trichostatin A (TSA), and its cytostatic activity against cells of the human prostate cell line LNCaP was more potent than that of the well-known HDAC inhibitor, suberoylanilide hydroxamic acid (SAHA).
Alkyl piperidine and piperazine hydroxamic acids as HDAC inhibitors.
Rossi, Cristina; Porcelloni, Marina; D'Andrea, Piero; Fincham, Christopher I; Ettorre, Alessandro; Mauro, Sandro; Squarcia, Antonella; Bigioni, Mario; Parlani, Massimo; Nardelli, Federica; Binaschi, Monica; Maggi, Carlo A; Fattori, Daniela
2011-04-15
We report here the strategy used in our research group to find a new class of histone deacetylase (HDAC) inhibitors. A series of N-substituted 4-alkylpiperazine and 4-alkylpiperidine hydroxamic acids, corresponding to the basic structure of HDAC inhibitors (zinc binding moiety-linker-capping group) has been designed, prepared, and tested for HDAC inhibition. Linker length and aromatic capping group connection were systematically varied to find the optimal geometric parameters. A new series of submicromolar inhibitors was thus identified, which showed antiproliferative activity on HCT-116 colon carcinoma cells. Copyright © 2011 Elsevier Ltd. All rights reserved.
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Fox, Simon R.; Rawsthorne, Stephen; Hills, Matthew J.
2001-01-01
The uptake in vitro of glucose (Glc)-6-phosphate (Glc-6-P) into plastids from the roots of 10- to 14-d-old pea (Pisum sativum L. cv Puget) plants was inhibited by oleoyl-coenzyme A (CoA) concentrations in the low micromolar range (1–2 μm). The IC50 (the concentration of inhibitor that reduces enzyme activity by 50%) for the inhibition of Glc-6-P uptake was approximately 750 nm; inhibition was reversed by recombinant rapeseed (Brassica napus) acyl-CoA binding protein. In the presence of ATP (3 mm) and CoASH (coenzyme A; 0.3 mm), Glc-6-P uptake was inhibited by 60%, due to long-chain acyl-CoA synthesis, presumably from endogenous sources of fatty acids present in the preparations. Addition of oleoyl-CoA (1 μm) decreased carbon flux from Glc-6-P into the synthesis of starch and through the oxidative pentose phosphate (OPP) pathway by up to 73% and 40%, respectively. The incorporation of carbon from Glc-6-P into fatty acids was not detected under any conditions. Oleoyl-CoA inhibited the incorporation of acetate into fatty acids by 67%, a decrease similar to that when ATP was excluded from incubations. The oleoyl-CoA-dependent inhibition of fatty acid synthesis was attributable to a direct inhibition of the adenine nucleotide translocator by oleoyl-CoA, which indirectly reduced fatty acid synthesis by ATP deprivation. The Glc-6-P-dependent stimulation of acetate incorporation into fatty acids was reversed by the addition of oleoyl-CoA. PMID:11457976
Samal, Ramanuj P; Khedkar, Vijay M; Pissurlenkar, Raghuvir R S; Bwalya, Angela Gono; Tasdemir, Deniz; Joshi, Ramesh A; Rajamohanan, P R; Puranik, Vedavati G; Coutinho, Evans C
2013-06-01
Recent studies have revealed that plasmodial enoyl-ACP reductase (pfENR, FabI), one of the crucial enzymes in the plasmodial type II fatty acid synthesis II (FAS II) pathway, is a promising target for liver stage malaria infections. Hence, pfENR inhibitors have the potential to be used as causal malarial prophylactic agents. In this study, we report the design, synthesis, structural characterization and evaluation of a new class of pfENR inhibitors. The search for inhibitors began with a virtual screen of the iResearch database by molecular docking. Hits obtained from the virtual screen were ranked according to their Glide score. One hit was selected as a lead and modified to improve its binding to pfENR; from this, a series of phenylamino acetic acid benzylidene hydrazides were designed and synthesized. These molecules were thoroughly characterized by IR, (1) H, (13) C, (15) N, 2D-NMR (COSY, NOESY, (1) H-(13) C, (1) H-(15) N HSQC and HMBC), and X-ray diffraction. NMR studies revealed the existence of conformational/configurational isomers around the amide and imine functionalities. The major species in DMSO solution is the E, E form, which is in dynamic equilibrium with the Z, E isomer. In the solid state, the molecule has a completely extended conformation and forms helical structures that are stabilized by strong hydrogen bond interactions, forming a helical structure stabilized by N-H…O interactions, a feature unique to this class of compounds. Furthermore, detailed investigation of the NMR spectra indicated the presence of a minor impurity in most compounds. The structure of this impurity was deduced as an imidazoline-4-one derivative based on (1) H-(13) C and (1) H-(15) H HMBC spectra and was confirmed from the NOESY spectra. The molecules were screened for in vitro activity against recombinant pfENR enzyme by a spectrophotometric assay. Four molecules, viz. 17, 7, 10, and 12 were found to be active at 7, 8, 10, and 12 μm concentration, respectively
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
2012-01-01
A series of 36 thiosemicarbazone analogues containing the thiochromanone molecular scaffold functionalized primarily at the C-6 position were prepared by chemical synthesis and evaluated as inhibitors of cathepsins L and B. The most promising inhibitors from this group are selective for cathepsin L and demonstrate IC50 values in the low nanomolar range. In nearly all cases, the thiochromanone sulfide analogues show superior inhibition of cathepsin L as compared to their corresponding thiochromanone sulfone derivatives. Without exception, the compounds evaluated were inactive (IC50 > 10000 nM) against cathepsin B. The most potent inhibitor (IC50 = 46 nM) of cathepsin L proved to be the 6,7-difluoro analogue 4. This small library of compounds significantly expands the structure–activity relationship known for small molecule, nonpeptidic inhibitors of cathepsin L. PMID:24900494
Performance Characteristics of Borate Fatty Acid Formulations as Mold Inhibitors
Robert D. Coleman; Vina Yang; Carol A. Clausen
2013-01-01
The combination of boric acid (BA) or disodium octaborate tetrahydrate (DOT) and a fatty acid (FA) such as heptanoic, octanoic, and nonanoic acids (C7âC9) is an effective treatment solution for protecting wood structures against mold. BA or DOT alone have substantial potency against insects and decay fungi, but have negligible or no mold inhibitor activity. However,...
Evitt, Andrew S; Cox, Russell J
2011-05-01
Inhibitors of the enzyme aspartate semialdehyde dehydrogenase, a key biological target for the generation of a new class of antibiotic compounds, have been developed. To investigate improvements to binding within an inhibitor series, the lowering of the entropic barrier to binding through conformational restriction was investigated. A library of linear and cyclic substrate analogues was generated and computational docking used to aid in structure selection. The cyclic phosphonate inhibitor 18 was thus identified as complimentary to the enzyme active-site. Synthesis and in vitro inhibition assay revealed a K(i) of 3.8 mM against natural substrate, where the linear analogue of 18, compound 15, had previously shown no inhibitory activity. Two further inhibitors, phosphate analogue diastereoisomers 17a and 17b, were synthesised and also found to have low millimolar K(i) values. As a result of the computational docking investigations, a novel substrate binding interaction was discovered: hydrogen bonding between the substrate (phosphate hydroxy-group as the hydrogen bond donor) and the NADPH cofactor (2'-oxygen as the hydrogen bond acceptor).
Discovery and gram-scale synthesis of BMS-593214, a potent, selective FVIIa inhibitor
DOE Office of Scientific and Technical Information (OSTI.GOV)
Priestley, E. Scott; De Lucca, Indawati; Zhou, Jinglan
A 6-amidinotetrahydroquinoline screening hit was driven to a structurally novel, potent, and selective FVIIa inhibitor through a combination of library synthesis and rational design. An efficient gram-scale synthesis of the active enantiomer BMS-593214 was developed, which required significant optimization of the key Povarov annulation. Importantly, BMS-593214 showed antithrombotic efficacy in a rabbit arterial thrombosis model. A crystal structure of BMS-593214 bound to FVIIa highlights key contacts with Asp 189, Lys 192, and the S2 pocket.
Kaminski, Rafal M.; Rogawski, Michael A.
2011-01-01
Steroid 11β-hydroxylase (CYP11B1; EC 1.14.15.4) is a mitochondrial enzyme located in the zona fasciculata of the adrenal cortex and also in the brain that mediates the conversion of 11-deoxycortisol to cortisol and 11-deoxycorticosterone (DOC) to corticosterone. Inhibitors of CYP11B1, such as metyrapone and etomidate, reduce glucocorticoid synthesis and raise levels of DOC providing greater availability for metabolic conversion to the GABAA receptor modulating neurosteroid allotetrahydrodeoxycorticosterone (THDOC). Because THDOC is a potent anticonvulsant, it is plausible that CYP11B1 inhibitors could protect against seizures. Here we demonstrate that metyrapone affords dose-dependent protection against 6-Hz seizures 30 min after injection (ED50, 191 mg/kg), but is markedly more potent at 6 h (ED50, 30 mg/kg). Similarly, etomidate is also protective at 30 min and 6 h (ED50 values, 4.5 and 1.7 mg/kg). Finasteride, an inhibitor of neurosteroid synthesis, attenuated the anticonvulsant effects of both CYP11B1 inhibitors at 6 h, but not 30 min following their injection. Plasma THDOC levels measured by liquid chromatography-mass spectrometry were markedly increased 6 h after injection of both CYP11B1 inhibitors and this increase was attenuated by finasteride pretreatment. We conclude that inhibition of CYP11B1 causes delayed seizure protection due to slow build-up of neurosteroids. Early seizure protection is independent of neurosteroids. PMID:21458468
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Bagley, Mark C; Dwyer, Jessica E; Molina, Maria D Beltran; Rand, Alexander W; Rand, Hayley L; Tomkinson, Nicholas C O
2015-06-28
Microwave irradiation of 2-halobenzonitriles and methyl thioglycolate in the presence of triethylamine in DMSO at 130 °C provides rapid access to 3-aminobenzo[b]thiophenes in 58-96% yield. This transformation has been applied in the synthesis of the thieno[2,3-b]pyridine core motif of LIMK1 inhibitors, the benzo[4,5]thieno[3,2-e][1,4]diazepin-5(2H)-one scaffold of MK2 inhibitors and a benzo[4,5]thieno[3,2-d]pyrimidin-4-one inhibitor of the PIM kinases.
Beaulieu, Pierre L; Gillard, James; Bailey, Murray D; Boucher, Colette; Duceppe, Jean-Simon; Simoneau, Bruno; Wang, Xiao-Jun; Zhang, Li; Grozinger, Karl; Houpis, Ioannis; Farina, Vittorio; Heimroth, Heidi; Krueger, Thomas; Schnaubelt, Jürgen
2005-07-22
(1R,2S)-1-Amino-2-vinylcyclopropanecarboxylic acid (vinyl-ACCA) is a key building block in the synthesis of potent inhibitors of the hepatitis C virus NS3 protease such as BILN 2061, which was recently shown to dramatically reduce viral load after administration to patients infected with HCV genotype 1. We have developed a scalable process that delivers derivatives of this unusual amino acid in >99% ee. The strategy was based on the dialkylation of a glycine Schiff base using trans-1,4-dibromo-2-butene as an electrophile to produce racemic vinyl-ACCA, which was subsequently resolved using a readily available, inexpensive esterase enzyme (Alcalase 2.4L). Factors that affect diastereoselection in the initial dialkylation steps were examined and the conditions optimized to deliver the desired diastereomer selectively. Product inhibition, which was encountered during the enzymatic resolution step, initially resulted in prolonged cycle times. Enrichment of racemic vinyl-ACCA through a chemical resolution via diastereomeric salt formation or the use of forcing conditions in the enzymatic reaction both led to improvements in throughput and the development of a viable process. The chemistry described herein was scaled up to produce multikilogram quantities of this building block.
Synthesis and pharmacological evaluation of the stereoisomers of 3-carba cyclic-phosphatidic acid.
Gupte, Renuka; Siddam, Anjaih; Lu, Yan; Li, Wei; Fujiwara, Yuko; Panupinthu, Nattapon; Pham, Truc-Chi; Baker, Daniel L; Parrill, Abby L; Gotoh, Mari; Murakami-Murofushi, Kimiko; Kobayashi, Susumu; Mills, Gordon B; Tigyi, Gabor; Miller, Duane D
2010-12-15
Cyclic phosphatidic acid (CPA) is a naturally occurring analog of lysophosphatidic acid (LPA) in which the sn-2 hydroxy group forms a five-membered ring with the sn-3 phosphate. Here, we describe the synthesis of R-3-CCPA and S-3-CCPA along with their pharmacological properties as inhibitors of lysophospholipase D/autotaxin, agonists of the LPA(5) GPCR, and blockers of lung metastasis of B16-F10 melanoma cells in a C57BL/6 mouse model. S-3CCPA was significantly more efficacious in the activation of LPA(5) compared to the R-stereoisomer. In contrast, no stereoselective differences were found between the two isomers toward the inhibition of autotaxin or lung metastasis of B16-F10 melanoma cells in vivo. These results extend the potential utility of these compounds as potential lead compounds warranting evaluation as cancer therapeutics. Copyright © 2010 Elsevier Ltd. All rights reserved.
Direct modulation of T-box riboswitch-controlled transcription by protein synthesis inhibitors
Stamatopoulou, Vassiliki; Apostolidi, Maria; Li, Shuang; Lamprinou, Katerina; Papakyriakou, Athanasios
2017-01-01
Abstract Recently, it was discovered that exposure to mainstream antibiotics activate numerous bacterial riboregulators that control antibiotic resistance genes including metabolite-binding riboswitches and other transcription attenuators. However, the effects of commonly used antibiotics, many of which exhibit RNA-binding properties, on the widespread T-box riboswitches, remain unknown. In Staphylococcus aureus, a species-specific glyS T-box controls the supply of glycine for both ribosomal translation and cell wall synthesis, making it a promising target for next-generation antimicrobials. Here, we report that specific protein synthesis inhibitors could either significantly increase T-box-mediated transcription antitermination, while other compounds could suppress it, both in vitro and in vivo. In-line probing of the full-length T-box combined with molecular modelling and docking analyses suggest that the antibiotics that promote transcription antitermination stabilize the T-box:tRNA complex through binding specific positions on stem I and the Staphylococcal-specific stem Sa. By contrast, the antibiotics that attenuate T-box transcription bind to other positions on stem I and do not interact with stem Sa. Taken together, our results reveal that the transcription of essential genes controlled by T-box riboswitches can be directly modulated by commonly used protein synthesis inhibitors. These findings accentuate the regulatory complexities of bacterial response to antimicrobials that involve multiple riboregulators. PMID:28973457
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Karlström, Åsa; Boyd, Kelli L.; English, B. Keith; McCullers, Jonathan A.
2008-01-01
Pneumonia as a secondary infection after influenza is a major cause of excess morbidity and mortality despite the availability and use of antibiotics active against Streptococcus pneumoniae. We hypothesized that use of a bacteriostatic protein synthesis inhibitor would improve outcomes by reducing the inflammatory response. BALB/c mice infected with influenza virus and super-infected with Streptococcus pneumoniae were treated with either the cell wall active antibiotic ampicillin or protein synthesis inhibitors clindamycin or azithromycin. Ampicillin therapy performed significantly worse (56% survival) in the model compared to clindamycin therapy either alone (82%) or in combination with ampicillin (80%) and to azithromycin (92%). Improved survival appeared to be mediated by decreased inflammation manifested as lower levels of inflammatory cells and pro-inflammatory cytokines in the lungs, and less severe histopathology. These data suggest that beta-lactam therapy may not be optimal as first line treatment of community acquired pneumonia when it follows influenza. PMID:19113989
Scoparic acid A, a beta-glucuronidase inhibitor from Scoparia dulcis.
Hayashi, T; Kawasaki, M; Okamura, K; Tamada, Y; Morita, N; Tezuka, Y; Kikuchi, T; Miwa, Y; Taga, T
1992-12-01
The 70% EtOH extract of Scoparia dulcis showed inhibitory activity against beta-glucuronidase from bovine liver. Bioassay-directed fractionation of the active extract led to the isolation of three labdane-type diterpene acids, scoparic acid A [1] [6-benzoyl-12-hydroxy-labda-8(17), 13-dien-18-oic acid], scoparic acid B [2] [6-benzoyl-14,15-dinor-13-oxo-8(17)-labden-18-oic acid], and scoparic acid C [3] [6-benzoyl-15-nor-14-oxo-8(17)-labden-18-oic acid], the structures of which were established by spectral means, including X-ray analysis. Scoparic acid A was found to be a potent beta-glucuronidase inhibitor.
Acetyl-CoA carboxylase-alpha inhibitor TOFA induces human cancer cell apoptosis.
Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-Fang; Cao, Deliang
2009-07-31
Acetyl-CoA carboxylase-alpha (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC(50) at approximately 5.0, 5.0, and 4.5 microg/ml, respectively. TOFA at 1.0-20.0 microg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 microM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis.
Acetyl-CoA Carboxylase-α Inhibitor TOFA Induces Human Cancer Cell Apoptosis
Wang, Chun; Xu, Canxin; Sun, Mingwei; Luo, Dixian; Liao, Duan-fang; Cao, Deliang
2009-01-01
Acetyl-CoA carboxylase-α (ACCA) is a rate-limiting enzyme in long chain fatty acid synthesis, playing a critical role in cellular energy storage and lipid synthesis. ACCA is upregulated in multiple types of human cancers and small interfering RNA-mediated ACCA silencing in human breast and prostate cancer cells results in oxidative stress and apoptosis. This study reports for the first time that TOFA (5-tetradecyloxy-2-furoic acid), an allosteric inhibitor of ACCA, is cytotoxic to lung cancer cells NCI-H460 and colon carcinoma cells HCT-8 and HCT-15, with an IC50 at approximately 5.0, 5.0, and 4.5 μg/ml, respectively. TOFA at 1.0–20.0 μg/ml effectively blocked fatty acid synthesis and induced cell death in a dose-dependent manner. The cell death was characterized with PARP cleavage, DNA fragmentation, and annexin-V staining, all of which are the features of the apoptosis. Supplementing simultaneously the cells with palmitic acids (100 μM), the end-products of the fatty acid synthesis pathway, prevented the apoptosis induced by TOFA. Taken together, these data suggest that TOFA is a potent cytotoxic agent to lung and colon cancer cells, inducing apoptosis through disturbing their fatty acid synthesis. PMID:19450551
Design and synthesis of chalcone derivatives as potential non-purine xanthine oxidase inhibitors.
Bui, Trung Huu; Nguyen, Nhan Trung; Dang, Phu Hoang; Nguyen, Hai Xuan; Nguyen, Mai Thanh Thi
2016-01-01
Based on some previous research, the chalcone derivatives exhibited potent xanthine oxidase inhibitory activity, e.g. sappanchalcone ( 7 ), with IC 50 value of 3.9 μM, was isolated from Caesalpinia sappan . Therefore, objectives of this research are design and synthesis of 7 and other chalcone derivatives by Claisen-Schmidt condensation and then evaluate their XO inhibitory activity. Fifteen chalcone derivatives were synthesized by Claisen-Schmidt condensation, and were evaluated for XO inhibitory activity. Nine out of 15 synthetic chalcones showed inhibitory activity ( 3 ; 5 - 8 ; 10 - 13 ). Sappanchalcone derivatives ( 11 ) (IC 50 , 2.5 μM) and a novel chalcone ( 13 ) (IC 50 , 2.4 μM) displayed strong xanthine oxidase inhibitory activity that is comparable to allopurinol (IC 50 , 2.5 μM). The structure-activity relationship of these chalcone derivatives was also presented. It is the first research on synthesis sappanchalcone ( 7 ) by Claisen-Schmidt condensation. The overall yield of this procedure was 6.6 %, higher than that of reported procedure (4 %). Design, synthesis, and evaluation of chalcone derivatives were carried out. This result suggests that the chalcone derivative can be used as potential non-purine XO inhibitors.Graphical abstractThe chalcone derivatives as potential non-purine xanthine oxidase inhibitors.
Synthesis and Characterization of Novel Acyl-Glycine Inhibitors of GlyT2.
Mostyn, Shannon N; Carland, Jane E; Shimmon, Susan; Ryan, Renae M; Rawling, Tristan; Vandenberg, Robert J
2017-09-20
It has been demonstrated previously that the endogenous compound N-arachidonyl-glycine inhibits the glycine transporter GlyT2, stimulates glycinergic neurotransmission, and provides analgesia in animal models of neuropathic and inflammatory pain. However, it is a relatively weak inhibitor with an IC 50 of 9 μM and is subject to oxidation via cyclooxygenase, limiting its therapeutic value. In this paper we describe the synthesis and testing of a novel series of monounsaturated C18 and C16 acyl-glycine molecules as inhibitors of the glycine transporter GlyT2. We demonstrate that they are up to 28 fold more potent that N-arachidonyl-glycine with no activity at the closely related GlyT1 transporter at concentrations up to 30 μM. This novel class of compounds show considerable promise as a first generation of GlyT2 transport inhibitors.
Fyvie, W. Sean; Brindisi, Margherita; Steffey, Melinda; Agniswamy, Johnson; Wang, Yuan-Fang; Aoki, Manabu; Amano, Masayuki; Weber, Irene T.; Mitsuya, Hiroaki
2018-01-01
The structure-based design, synthesis, and biological evaluation of a series of nonpeptidic HIV-1 protease inhibitors with rationally designed P2′ ligands are described. The inhibitors are designed to enhance backbone binding interactions, particularly at the S2′ subsite. Synthesis of inhibitors was carried out efficiently. The stereochemistry of alcohol functionalities of the P2′ ligands was set by asymmetric reduction of the corresponding ketone using (R,R)- or (S,S)-Noyori catalysts. A number of inhibitors displayed very potent enzyme inhibitory and antiviral activity. Inhibitors 3g and 3h showed enzyme Ki values of 27.9 and 49.7 pM and antiviral activity of 6.2 and 3.9 nM, respectively. These inhibitors also remained quite potent against darunavir-resistant HIV-1 variants. An X-ray structure of inhibitor 3g in complex with HIV-1 protease revealed key interactions in the S2′ subsite. PMID:29110408
Gheibi, Nematollah; Taherkhani, Negar; Ahmadi, Abolfazl; Haghbeen, Kamahldin; Ilghari, Dariush
2015-02-01
Involvement of tyrosinase in the synthesis of melanin and cell signaling pathway has made it an attractive target in the search for therapeutic inhibitors for treatment of different skin hyperpigmentation disorders and melanoma cancers. In the present study, we conducted a comprehensive kinetic analysis to understand the mechanisms of inhibition imposed by 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid on the monophenolase and diphenolase activities of the mushroom tyrosinase, and then MTT assay was exploited to evaluate their toxicity on the melanoma cells. Kinetic analysis revealed that nicotinic acid and picolinic acid competitively restricted the monophenolase activity with inhibition constants (Ki) of 1.21 mM and 1.97 mM and the diphenolase activity with Kis of 2.4 mM and 2.93 mM, respectively. 2-aminobenzoic acid and 4-aminobenzoic acid inhibited the monophenolase activity in a non-competitive fashion with Kis of 5.15 µM and 3.8 µM and the diphenolase activity with Kis of 4.72 µM and 20 µM, respectively. Our cell-based data revealed that only the pyridine derivatives imposed cytotoxicity in melanoma cells. Importantly, the concentrations of the inhibitors leading to 50% decrease in the cell density (IC50) were comparable to those causing 50% drop in the enzyme activity, implying that the observed cytotoxicity is highly likely due to the tyrosinase inhibition. Moreover, our cell-based data exhibited that the pyridine derivatives acted as anti-proliferative agents, perhaps inducing cytotoxicity in the melanoma cells through inhibition of the tyrosinase activities.
Arias, D G; Herrera, F E; Garay, A S; Rodrigues, D; Forastieri, P S; Luna, L E; Bürgi, M D L M; Prieto, C; Iglesias, A A; Cravero, R M; Guerrero, S A
2017-01-05
The rational design and synthesis of a series of 5-nitro-2-furoic acid analogues are presented. The trypanocidal activity against epimastigote forms of Trypanosoma cruzi and the toxic effects on human HeLa cells were tested. Between all synthetic compounds, three of thirteen had an IC 50 value in the range of Nfx, but compound 13 exhibited an improved effect with an IC 50 of 1.0 ± 0.1 μM and a selective index of 70 in its toxicity against HeLa cells. We analyzed the activity of compounds 8, 12 and 13 to interfere in the central redox metabolic pathway in trypanosomatids, which is dependent of reduced trypanothione as the major pivotal thiol. The three compounds behaved as better inhibitors of trypanothione reductase than Nfx (Ki values of 118 μM, 61 μM and 68 μM for 8, 12 and 13, respectively, compared with 245 μM for Nfx), all following an uncompetitive enzyme inhibition pattern. Docking analysis predicted a binding of inhibitors to the enzyme-substrate complex with binding energy calculated in-silico that supports such molecular interaction. Copyright © 2016 Elsevier Masson SAS. All rights reserved.
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
PROFLAVINE INHIBITION OF VACCINIA VIRUS SYNTHESIS.
BUBEL, H C; WOLFF, D A
1965-04-01
Bubel, H. Curt (University of Cincinnati College of Medicine, Cincinnati, Ohio), and David A. Wolff. Proflavine inhibition of vaccinia virus synthesis. J. Bacteriol. 89:977-983. 1965.-The synthesis of vaccinia virus, hemagglutinin, and blocking antigen, as well as the development of cytopathic effects, were inhibited by low concentrations of proflavine. This inhibitor did not exert a selective effect on any particular portion of the virus synthetic cycle. Proflavine added to infected KB cells during the eclipse period or later stages of virus maturation rapidly arrested further production of infectious virus and virus-related products. Suppression of virus synthesis was completely reversible, indicating that permanent damage to the virus synthetic mechanism did not result from a transient exposure to proflavine. Photosensitization of maturating vaccinia virus by subinhibiting concentrations of proflavine suggested an interaction of the inhibitor with viral nucleic acid.
The effect of ethionine on ribonucleic acid synthesis in rat liver.
Swann, P F
1975-01-01
1. By 1h after administration of ethionine to the female rat the appearance of newly synthesized 18SrRNA in the cytoplasm is completely inhibited. This is not caused by inhibition of RNA synthesis, for the synthesis of the large ribosomal precursor RNA (45S) and of tRNA continues. Cleavage of 45S RNA to 32S RNA also occurs, but there was no evidence for the accumulation of mature or immature rRNA in the nucleus. 2. The effect of ethionine on the maturation of rRNA was not mimicked by an inhibitor of protein synthesis (cycloheximide) or an inhibitor of polyamine synthesis [methylglyoxal bis(guanylhydrazone)]. 3. Unlike the ethionine-induced inhibition of protein synthesis, this effect was not prevented by concurrent administration of inosine. A similar effect could be induced in HeLa cells by incubation for 1h in a medium lacking methionine. The ATP concentration in these cells was normal. From these two observations it was concluded that the effect of etionine on rRNA maturation is not caused by an ethionine-induced lack of ATP. It is suggested that ethionine, by lowering the hepatic concentration of S-adenosylmethionine, prevents methylation of the ribosomal precursor. The methylation is essential for the correct maturation of the molecule; without methylation complete degradation occurs. PMID:1212195
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Small molecule inhibitors of human adipocyte fatty acid binding protein (FABP4).
Zhang, Mingming; Zhu, Weiliang; Li, Yingxia
2014-06-01
Fatty acid binding protein 4 (FABP4) is expressed in adipocytes and macrophages, and modulates inflammatory and metabolic response. Studies in FABP4-deficient mice have shown that this lipid carrier has a significant role within the field of metabolic syndrome, inflammation and atherosclerosis; thus, its inhibition may open up new opportunities to develop novel therapeutic agents. A number of potent small molecule inhibitors of FABP4 have been identified and found to have the potential to prevent and treat metabolic diseases such as type-2 diabetes and atherosclerosis. Due to the ubiquity of endogenous fatty acids and the high intracellular concentration of FABP4, the inhibitors need to have significantly greater intrinsic potency than endogenous fatty acids. Furthermore, heart-type FABP (FABP3), which is expressed in both heart and skeletal muscle, is involved in active fatty acid metabolism where it transports fatty acids from the cell membrane to mitochondria for oxidation. However, FABP3 shares high overall sequence identity and similar 3D structure with FABP4, but has a potential problem with selectivity. In this review, we would like to analyze the main inhibitors that have appeared in the literature in the last decade, focusing on chemical structures, biological properties, selectivity and structure-activity relationships.
Synthesis and evaluation of thiophenyl derivatives as inhibitors of alkaline phosphatase.
Chang, Lei; Duy, Do Le; Mébarek, Saida; Popowycz, Florence; Pellet-Rostaing, Stéphane; Lemaire, Marc; Buchet, René
2011-04-15
Pathological calcifications induced by deposition of basic phosphate crystals or hydroxyapatite (HA) on soft tissues are a large family of diseases comprising of ankylosing spondylitis (AS), end-stage osteoarthritis (OA) and vascular calcification. High activity of tissue non-specific alkaline phosphatase (TNAP) is a hallmark of pathological calcifications induced by HA deposition. The use of TNAP inhibitor is a possible therapeutic option to address calcific diseases produced by HA deposition on soft tissues. We report the synthesis of a series of thiopheno-imidazo[2,1-b]thiazole derivatives which were evaluated as potential inhibitors of TNAP displaying a large range of IC(50) at pH 10.4 (from 42±13 μM to more than 800 μM). Copyright © 2011. Published by Elsevier Ltd.
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Hackbarth, Corinne J.; Chen, Dawn Z.; Lewis, Jason G.; Clark, Kirk; Mangold, James B.; Cramer, Jeffrey A.; Margolis, Peter S.; Wang, Wen; Koehn, Jim; Wu, Charlotte; Lopez, S.; Withers III, George; Gu, Helen; Dunn, Elina; Kulathila, R.; Pan, Shi-Hao; Porter, Wilma L.; Jacobs, Jeff; Trias, Joaquim; Patel, Dinesh V.; Weidmann, Beat; White, Richard J.; Yuan, Zhengyu
2002-01-01
Peptide deformylase (PDF) is a prokaryotic metalloenzyme that is essential for bacterial growth and is a new target for the development of antibacterial agents. All previously reported PDF inhibitors with sufficient antibacterial activity share the structural feature of a 2-substituted alkanoyl at the P1′ site. Using a combination of iterative parallel synthesis and traditional medicinal chemistry, we have identified a new class of PDF inhibitors with N-alkyl urea at the P1′ site. Compounds with MICs of ≤4 μg/ml against gram-positive and gram-negative pathogens, including Staphylococcus aureus, Streptococcus pneumoniae, and Haemophilus influenzae, have been identified. The concentrations needed to inhibit 50% of enzyme activity (IC50s) for Escherichia coli Ni-PDF were ≤0.1 μM, demonstrating the specificity of the inhibitors. In addition, these compounds were very selective for PDF, with IC50s of consistently >200 μM for matrilysin and other mammalian metalloproteases. Structure-activity relationship analysis identified preferred substitutions resulting in improved potency and decreased cytotoxity. One of the compounds (VRC4307) was cocrystallized with PDF, and the enzyme-inhibitor structure was determined at a resolution of 1.7 Å. This structural information indicated that the urea compounds adopt a binding position similar to that previously determined for succinate hydroxamates. Two compounds, VRC4232 and VRC4307, displayed in vivo efficacy in a mouse protection assay, with 50% protective doses of 30.8 and 17.9 mg/kg of body weight, respectively. These N-alkyl urea hydroxamic acids provide a starting point for identifying new PDF inhibitors that can serve as antimicrobial agents. PMID:12183225
Small molecule inhibitor of lipoteichoic acid synthesis is an antibiotic for Gram-positive bacteria
Richter, Stefan G.; Elli, Derek; Kim, Hwan Keun; Hendrickx, Antoni P. A.; Sorg, Joseph A.; Schneewind, Olaf; Missiakas, Dominique
2013-01-01
The current epidemic of infections caused by antibiotic-resistant Gram-positive bacteria requires the discovery of new drug targets and the development of new therapeutics. Lipoteichoic acid (LTA), a cell wall polymer of Gram-positive bacteria, consists of 1,3-polyglycerol-phosphate linked to glycolipid. LTA synthase (LtaS) polymerizes polyglycerol-phosphate from phosphatidylglycerol, a reaction that is essential for the growth of Gram-positive bacteria. We screened small molecule libraries for compounds inhibiting growth of Staphylococcus aureus but not of Gram-negative bacteria. Compound 1771 [2-oxo-2-(5-phenyl-1,3,4-oxadiazol-2-ylamino)ethyl 2-naphtho[2,1-b]furan-1-ylacetate] blocked phosphatidylglycerol binding to LtaS and inhibited LTA synthesis in S. aureus and in Escherichia coli expressing ltaS. Compound 1771 inhibited the growth of antibiotic-resistant Gram-positive bacteria and prolonged the survival of mice with lethal S. aureus challenge, validating LtaS as a target for the development of antibiotics. PMID:23401520
Dow, Robert L; Andrews, Melissa; Aspnes, Gary E; Balan, Gayatri; Michael Gibbs, E; Guzman-Perez, Angel; Karki, Kapil; Laperle, Jennifer L; Li, Jian-Cheng; Litchfield, John; Munchhof, Michael J; Perreault, Christian; Patel, Leena
2011-10-15
A novel series of potent DGAT-1 inhibitors was developed originating from the lactam-based clinical candidate PF-04620110. Incorporation of a dioxino[2,3-d]pyrimidine-based core afforded good alignment of pharmacophore features and resulted in improved passive permeability. Development of an efficient, homochiral synthesis of these targets facilitated confirmation of predictions regarding the stereochemical-dependence of DGAT-1 inhibition for this series. Compound 10 was shown to be a potent inhibitor of human DGAT-1 (10 nM) and to suppress triglyceride synthesis at oral doses of <3mg/kg. Copyright © 2011 Elsevier Ltd. All rights reserved.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Synthesis of HIV-Maturation Inhibitor BMS-955176 from Betulin by an Enabling Oxidation Strategy.
Ortiz, Adrian; Soumeillant, Maxime; Savage, Scott A; Strotman, Neil A; Haley, Matthew; Benkovics, Tamas; Nye, Jeffrey; Xu, Zhongmin; Tan, Yichen; Ayers, Sloan; Gao, Qi; Kiau, Susanne
2017-05-05
A concise and scalable second generation synthesis of HIV maturation inhibitor BMS-955176 is described. The synthesis is framed by an oxidation strategy highlighted by a Cu I mediated aerobic oxidation of betulin, a highly selective PIFA mediated dehydrogenation of an oxime, and a subsequent Lossen rearrangement which occurs through a unique reaction mechanism for the installation of the C17 amino functionality. The synthetic route proceeds in 7 steps with 47% overall yield and begins from the abundant and inexpensive natural product betulin.
Chiral-catalyst-based convergent synthesis of HIV protease inhibitor GRL-06579A.
Mihara, Hisashi; Sohtome, Yoshihiro; Matsunaga, Shigeki; Shibasaki, Masakatsu
2008-02-01
Catalytic asymmetric synthesis of GRL-06579A (1), an HIV-1 protease inhibitor effective against multi-protease-inhibitor-resistant viruses, is described. A convergent strategy that utilizes heterobimetallic multifunctional catalysts developed in our group is a key feature of the synthesis. The chirality of the bicyclic tetrahydrofuran unit of 1 was introduced through Al-Li-bis(binaphthoxide) (ALB) catalyst-controlled Michael addition of dimethyl malonate to racemic 4-O-protected cyclopentenone. ALB afforded not only the trans adduct with up to 96% ee from a matched substrate through kinetic resolution, but also the cis adduct with 99% ee through a catalyst-controlled Michael addition to a mismatched substrate. The Michael addition to produce the unusual cis adduct is described in detail. The framework of the bicyclic tetrahydrofuran was constructed by an intramolecular oxy-Michael reaction. The amino alcohol unit was constructed by an La-Li3-tris(binaphthoxide) (LLB)-catalyzed diastereoselective nitroaldol reaction of N-Boc aldehyde (Boc = tert-butoxycarbonyl) derived from L-phenylalanine. LLB promoted the nitroaldol reaction without racemization of the chiral aldehyde to give the nitroaldol adduct in 85% yield and with 93:7 diastereoselectivity and over 99% ee.
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Dickinson, Jared M; Fry, Christopher S; Drummond, Micah J; Gundermann, David M; Walker, Dillon K; Glynn, Erin L; Timmerman, Kyle L; Dhanani, Shaheen; Volpi, Elena; Rasmussen, Blake B
2011-05-01
The relationship between mammalian target of rapamycin complex 1 (mTORC1) signaling and muscle protein synthesis during instances of amino acid surplus in humans is based solely on correlational data. Therefore, the goal of this study was to use a mechanistic approach specifically designed to determine whether increased mTORC1 activation is requisite for the stimulation of muscle protein synthesis following L-essential amino acid (EAA) ingestion in humans. Examination of muscle protein synthesis and signaling were performed on vastus lateralis muscle biopsies obtained from 8 young (25 ± 2 y) individuals who were studied prior to and following ingestion of 10 g of EAA during 2 separate trials in a randomized, counterbalanced design. The trials were identical except during 1 trial, participants were administered a single oral dose of a potent mTORC1 inhibitor (rapamycin) prior to EAA ingestion. In response to EAA ingestion, an ~60% increase in muscle protein synthesis was observed during the control trial, concomitant with increased phosphorylation of mTOR (Ser(2448)), ribosomal S6 kinase 1 (Thr(389)), and eukaryotic initiation factor 4E binding protein 1 (Thr(37/46)). In contrast, prior administration of rapamycin completely blocked the increase in muscle protein synthesis and blocked or attenuated activation of mTORC1-signaling proteins. The inhibition of muscle protein synthesis and signaling was not due to differences in either extracellular or intracellular amino acid availability, because these variables were similar between trials. These data support a fundamental role for mTORC1 activation as a key regulator of human muscle protein synthesis in response to increased EAA availability. This information will be useful in the development of evidence-based nutritional therapies targeting mTORC1 to counteract muscle wasting associated with numerous clinical conditions.
Costigan, M G; Gilchrist, T L; Lindup, W E
1996-06-01
The furan dicarboxylic acid, 3-carboxy-4-methyl-5-propyl-2-furanpropanoic acid (5-propyl FPA) accumulates in the plasma of patients with chronic renal failure and is a major contributor to the drug binding defect of uraemic plasma. This acid has also been implicated in several other aspects of the uraemic syndrome: anaemia, irregularities of thyroid function, neurological symptoms and inhibition of active tubular secretion. The acid is not commercially available and its synthesis, starting with Meldrum's acid and methyl succinyl chloride, is described. The pKa values were measured by titration and values of 3.2 and 3.6 respectively were assigned to the carboxylic acid groups attached directly to the ring at position 3 and at position 2 (on the side-chain). The partition coefficient (log P) between hydrochloric acid and octanol was 1.2 and the distribution coefficient (log D; octanol-phosphate buffer pH 7.4) was -0.59. The pKa values and the degree of hydrophobic character of 5-propyl FPA are consistent with those of other protein-bound acids which undergo active tubular secretion by the kidney and this substance may serve as an endogenous marker for the effects of drugs and disease on this process.
Proflavine Inhibition of Vaccinia Virus Synthesis
Bubel, H. Curt; Wolff, David A.
1965-01-01
Bubel, H. Curt (University of Cincinnati College of Medicine, Cincinnati, Ohio), and David A. Wolff. Proflavine inhibition of vaccinia virus synthesis. J. Bacteriol. 89:977–983. 1965.—The synthesis of vaccinia virus, hemagglutinin, and blocking antigen, as well as the development of cytopathic effects, were inhibited by low concentrations of proflavine. This inhibitor did not exert a selective effect on any particular portion of the virus synthetic cycle. Proflavine added to infected KB cells during the eclipse period or later stages of virus maturation rapidly arrested further production of infectious virus and virus-related products. Suppression of virus synthesis was completely reversible, indicating that permanent damage to the virus synthetic mechanism did not result from a transient exposure to proflavine. Photosensitization of maturating vaccinia virus by subinhibiting concentrations of proflavine suggested an interaction of the inhibitor with viral nucleic acid. PMID:14276124
Baston, Eckhard; Salem, Ola I A; Hartmann, Rolf W
2002-10-01
Novel 3,4-dihydro-naphthalene-2-carboxylic acids were synthesized and evaluated for 5alpha reductase inhibitory activity. This enzyme exists in two isoforms and is a pharmacological target for the treatment of benign prostatic hyperplasia, male pattern baldness and acne. In the present study non-steroidal compounds capable of mimicking the transition state of the steroidal substrates were prepared. The synthetic strategy for the preparation of compounds 1-6 consisted of triflation followed by subsequent Heck-type carboxylation or methoxy carbonylation for 6-phenyl-3,4-dihydronaphthalen-2(1H)-one 1c. A Negishi-type coupling reaction between 6-(trifluoro-methanesulfonyloxy)-3,4-dihydro-naphthalene-2-carboxylic acid methyl ester 7b and various aryl bromides led, after further transformations, to 6-substituted 3,4-dihydro-naphthalene-2-carboxylic acids 7-15. In a similar way the corresponding naphthalene-2-carboxylic acids 16 and 17 were obtained. The DU 145 cell line and prostate homogenates served as enzyme sources for the human type 1 and type 2 isozymes, whereas ventral prostate was employed to evaluate rat isozyme inhibitory potency. The most active inhibitors identified in this study were 6-[4-(N,N-dicyclohexylaminocarbonyl)phenyl]-3,4-dihydro-naphthalene-2-carboxylic acid (3) (IC50 = 0.09 microM, rat type 1), 6-[3-(N,N-dicyclohexylaminocarbonyl)phenyl]-3,4-dihydro-naphthalene-2-carboxylic acid (13) (IC50 = 0.75 microM, human type 2; IC50 = 0.81 microM, human type 1) and 6-[4-(N,N-diisopropylamino-carbonyl)phenyl]naphthalene-2-carboxylic acid (16) (IC50 = 0.2 microM, human type 2). The latter compound was shown to deactivate the enzyme in an uncompetitive manner (Ki = 90 nM; Km, Testosterone = 0.8-1.0 microM) similar to the steroidal inhibitor Epristeride. Select inhibitors (13 and 16) were tested in vivo using testosterone propionate-treated, juvenile, orchiectomized SD-rats. None of the compounds was active at a dose of 25 mg/kg. This result might in part be
Murakami, Taro; Matsuo, Masayuki; Shimizu, Ayako; Shimomura, Yoshiharu
2005-02-01
Branched-chain alpha-keto acid dehydrogenase kinase (BDK) phosphorylates and inactivates the branched-chain alpha-keto acid dehydrogenase complex (BCKDC), which is the rate-limiting enzyme in the branched-chain amino acid catabolism. BDK has been believed to be bound to the BCKDC. However, recent our studies demonstrated that protein-protein interaction between BDK and BCKDC is one of the factors to regulate BDK activity. Furthermore, only the bound form of BDK appears to have its activity. In the present study, we examined effects of BDK inhibitors on the amount of BDK bound to the BCKDC using rat liver extracts. The bound form of BDK in the extracts of liver from low protein diet-fed rats was measured by an immunoprecipitation pull down assay with or without BDK inhibitors. Among the BDK inhibitors. alpha-ketoisocaproate, alpha-chloroisocaproate, and a-ketoisovalerate released the BDK from the complex. Furthermore, the releasing effect of these inhibitors on the BDK appeared to depend on their inhibition constants. On the other hand, clofibric acid and thiamine pyrophosphate had no effect on the protein-protein interaction between two enzymes. These results suggest that the dissociation of the BDK from the BCKDC is one of the mechanisms responsible for the action of some inhibitors to BDK.
Gheibi, Nematollah; Taherkhani, Negar; Ahmadi, Abolfazl; Haghbeen, Kamahldin; Ilghari, Dariush
2015-01-01
Objective(s): Involvement of tyrosinase in the synthesis of melanin and cell signaling pathway has made it an attractive target in the search for therapeutic inhibitors for treatment of different skin hyperpigmentation disorders and melanoma cancers. Materials and Methods: In the present study, we conducted a comprehensive kinetic analysis to understand the mechanisms of inhibition imposed by 2-amino benzoic acid, 4-amino benzoic acid, nicotinic acid, and picolinic acid on the monophenolase and diphenolase activities of the mushroom tyrosinase, and then MTT assay was exploited to evaluate their toxicity on the melanoma cells. Results: Kinetic analysis revealed that nicotinic acid and picolinic acid competitively restricted the monophenolase activity with inhibition constants (Ki) of 1.21 mM and 1.97 mM and the diphenolase activity with Kis of 2.4 mM and 2.93 mM, respectively. 2-aminobenzoic acid and 4-aminobenzoic acid inhibited the monophenolase activity in a non-competitive fashion with Kis of 5.15 µM and 3.8 µM and the diphenolase activity with Kis of 4.72 µM and 20 µM, respectively. Conclusion: Our cell-based data revealed that only the pyridine derivatives imposed cytotoxicity in melanoma cells. Importantly, the concentrations of the inhibitors leading to 50% decrease in the cell density (IC50) were comparable to those causing 50% drop in the enzyme activity, implying that the observed cytotoxicity is highly likely due to the tyrosinase inhibition. Moreover, our cell-based data exhibited that the pyridine derivatives acted as anti-proliferative agents, perhaps inducing cytotoxicity in the melanoma cells through inhibition of the tyrosinase activities. PMID:25810885
Ling, Yong; Wang, Xuemin; Wang, Chenniu; Xu, Chenjun; Zhang, Wei; Zhang, Yihua; Zhang, Yanan
2015-06-01
A novel series of hybrids was designed and synthesized by combining key elements from farnesylthiosalicylic acid (FTS) and hydroxamic acid. Several 3,7,11-trimethyldodeca-2,6,10-trien-1-yl) thio)benzamide derivatives, particularly those with branched and linear aliphatic linkers between the hydroxamic zinc binding group (ZBG) and the benzamide core, not only displayed significant antitumor activities against six human cancer cells but also exhibited histone deacetylase (HDAC) inhibitory effects in vitro. Among them, N-(4-(hydroxyamino)-4-oxobutyl)-2-(((2E,6E)-3,7,11-trimethyldodeca-2,6, 10-trien-1-yl)thio)benzamide (8 d) was the most potent, with IC50 values of 4.9-7.6 μM; these activities are eight- to sixteen-fold more potent than FTS and comparable to that of suberoylanilide hydroxamic acid (SAHA). Derivative 8 d induced cell cycle arrest in the G0/G1 phase, inhibited the acetylation of histone H3 and α-tubulin, and blocked Ras-related signaling pathways in a dose-dependent manner. The improved tumor growth inhibition and cell-cycle arrest in vitro might result from the dual inhibition. These findings suggest dual inhibitors of Ras-related signaling pathway and HDAC hold promise as therapeutic agents for the treatment of cancer. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Najumudeen, Arafath K; Posada, Itziar M D; Lectez, Benoit; Zhou, Yong; Landor, Sebastian K-J; Fallarero, Adyary; Vuorela, Pia; Hancock, John; Abankwa, Daniel
2015-12-15
Ras isoforms H-, N-, and K-ras are each mutated in specific cancer types at varying frequencies and have different activities in cell fate control. On the plasma membrane, Ras proteins are laterally segregated into isoform-specific nanoscale signaling hubs, termed nanoclusters. As Ras nanoclusters are required for Ras signaling, chemical modulators of nanoclusters represent ideal candidates for the specific modulation of Ras activity in cancer drug development. We therefore conducted a chemical screen with commercial and in-house natural product libraries using a cell-based H-ras-nanoclustering FRET assay. Next to established Ras inhibitors, such as a statin and farnesyl-transferase inhibitor, we surprisingly identified five protein synthesis inhibitors as positive regulators. Using commonly employed cycloheximide as a representative compound, we show that protein synthesis inhibition increased nanoclustering and effector recruitment specifically of active H-ras but not of K-ras. Consistent with these data, cycloheximide treatment activated both Erk and Akt kinases and specifically promoted H-rasG12V-induced, but not K-rasG12V-induced, PC12 cell differentiation. Intriguingly, cycloheximide increased the number of mammospheres, which are enriched for cancer stem cells. Depletion of H-ras in combination with cycloheximide significantly reduced mammosphere formation, suggesting an exquisite synthetic lethality. The potential of cycloheximide to promote tumor cell growth was also reflected in its ability to increase breast cancer cell tumors grown in ovo. These results illustrate the possibility of identifying Ras-isoform-specific modulators using nanocluster-directed screening. They also suggest an unexpected feedback from protein synthesis inhibition to Ras signaling, which might present a vulnerability in certain tumor cell types.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Sharp, Phillip P; Garnier, Jean-Marc; Hatfaludi, Tamas; Xu, Zhen; Segal, David; Jarman, Kate E; Jousset, Hélène; Garnham, Alexandra; Feutrill, John T; Cuzzupe, Anthony; Hall, Peter; Taylor, Scott; Walkley, Carl R; Tyler, Dean; Dawson, Mark A; Czabotar, Peter; Wilks, Andrew F; Glaser, Stefan; Huang, David C S; Burns, Christopher J
2017-12-14
A number of diazepines are known to inhibit bromo- and extra-terminal domain (BET) proteins. Their BET inhibitory activity derives from the fusion of an acetyl-lysine mimetic heterocycle onto the diazepine framework. Herein we describe a straightforward, modular synthesis of novel 1,2,3-triazolobenzodiazepines and show that the 1,2,3-triazole acts as an effective acetyl-lysine mimetic heterocycle. Structure-based optimization of this series of compounds led to the development of potent BET bromodomain inhibitors with excellent activity against leukemic cells, concomitant with a reduction in c- MYC expression. These novel benzodiazepines therefore represent a promising class of therapeutic BET inhibitors.
Structure-Based Design and Synthesis of Potent and Selective Matrix Metalloproteinase 13 Inhibitors.
Choi, Jun Yong; Fuerst, Rita; Knapinska, Anna M; Taylor, Alexander B; Smith, Lyndsay; Cao, Xiaohang; Hart, P John; Fields, Gregg B; Roush, William R
2017-07-13
We describe the use of comparative structural analysis and structure-guided molecular design to develop potent and selective inhibitors (10d and (S)-17b) of matrix metalloproteinase 13 (MMP-13). We applied a three-step process, starting with a comparative analysis of the X-ray crystallographic structure of compound 5 in complex with MMP-13 with published structures of known MMP-13·inhibitor complexes followed by molecular design and synthesis of potent but nonselective zinc-chelating MMP inhibitors (e.g., 10a and 10b). After demonstrating that the pharmacophores of the chelating inhibitors (S)-10a, (R)-10a, and 10b were binding within the MMP-13 active site, the Zn 2+ chelating unit was replaced with nonchelating polar residues that bridged over the Zn 2+ binding site and reached into a solvent accessible area. After two rounds of structural optimization, these design approaches led to small molecule MMP-13 inhibitors 10d and (S)-17b, which bind within the substrate-binding site of MMP-13 and surround the catalytically active Zn 2+ ion without chelating to the metal. These compounds exhibit at least 500-fold selectivity versus other MMPs.
Fierro-Monti, Ivo; Racle, Julien; Hernandez, Celine; Waridel, Patrice; Hatzimanikatis, Vassily; Quadroni, Manfredo
2013-01-01
Standard proteomics methods allow the relative quantitation of levels of thousands of proteins in two or more samples. While such methods are invaluable for defining the variations in protein concentrations which follow the perturbation of a biological system, they do not offer information on the mechanisms underlying such changes. Expanding on previous work [1], we developed a pulse-chase (pc) variant of SILAC (stable isotope labeling by amino acids in cell culture). pcSILAC can quantitate in one experiment and for two conditions the relative levels of proteins newly synthesized in a given time as well as the relative levels of remaining preexisting proteins. We validated the method studying the drug-mediated inhibition of the Hsp90 molecular chaperone, which is known to lead to increased synthesis of stress response proteins as well as the increased decay of Hsp90 “clients”. We showed that pcSILAC can give information on changes in global cellular proteostasis induced by treatment with the inhibitor, which are normally not captured by standard relative quantitation techniques. Furthermore, we have developed a mathematical model and computational framework that uses pcSILAC data to determine degradation constants kd and synthesis rates Vs for proteins in both control and drug-treated cells. The results show that Hsp90 inhibition induced a generalized slowdown of protein synthesis and an increase in protein decay. Treatment with the inhibitor also resulted in widespread protein-specific changes in relative synthesis rates, together with variations in protein decay rates. The latter were more restricted to individual proteins or protein families than the variations in synthesis. Our results establish pcSILAC as a viable workflow for the mechanistic dissection of changes in the proteome which follow perturbations. Data are available via ProteomeXchange with identifier PXD000538. PMID:24312217
Valproic acid defines a novel class of HDAC inhibitors inducing differentiation of transformed cells
Göttlicher, Martin; Minucci, Saverio; Zhu, Ping; Krämer, Oliver H.; Schimpf, Annemarie; Giavara, Sabrina; Sleeman, Jonathan P.; Lo Coco, Francesco; Nervi, Clara; Pelicci, Pier Giuseppe; Heinzel, Thorsten
2001-01-01
Histone deacetylases (HDACs) play important roles in transcriptional regulation and pathogenesis of cancer. Thus, HDAC inhibitors are candidate drugs for differentiation therapy of cancer. Here, we show that the well-tolerated antiepileptic drug valproic acid is a powerful HDAC inhibitor. Valproic acid relieves HDAC-dependent transcriptional repression and causes hyperacetylation of histones in cultured cells and in vivo. Valproic acid inhibits HDAC activity in vitro, most probably by binding to the catalytic center of HDACs. Most importantly, valproic acid induces differentiation of carcinoma cells, transformed hematopoietic progenitor cells and leukemic blasts from acute myeloid leukemia patients. More over, tumor growth and metastasis formation are significantly reduced in animal experiments. Therefore, valproic acid might serve as an effective drug for cancer therapy. PMID:11742974
Meyer, Andrew C; Neugebauer, Nichole M; Zheng, Guangrong; Crooks, Peter A; Dwoskin, Linda P; Bardo, Michael T
2013-10-01
Vesicular monoamine transporter-2 (VMAT2) inhibitors reduce methamphetamine (METH) reward in rats. The current study determined the effects of VMAT2 inhibitors lobeline (LOB; 1 or 3 mg/kg) and N-(1,2R-dihydroxylpropyl)-2,6-cis-di(4-methoxyphenethyl)piperidine hydrochloride (GZ-793A; 15 or 30 mg/kg) on METH-induced (0.5 mg/kg, SC) changes in extracellular dopamine (DA) and its metabolite dihydroxyphenylacetic acid (DOPAC) in the reward-relevant nucleus accumbens (NAc) shell using in vivo microdialysis. The effect of GZ-793A (15 mg/kg) on DA synthesis in tissue also was investigated in NAc, striatum, medial prefrontal cortex and orbitofrontal cortex. In NAc shell, METH produced a time-dependent increase in extracellular DA and decrease in DOPAC. Neither LOB nor GZ-793A alone altered extracellular DA; however, both drugs increased extracellular DOPAC. In combination with METH, LOB did not alter the effects of METH on DA; however, GZ-793A, which has greater selectivity than LOB for inhibiting VMAT2, reduced the duration of the METH-induced increase in extracellular DA. Both LOB and GZ-793A enhanced the duration of the METH-induced decrease in extracellular DOPAC. METH also increased tissue DA synthesis in NAc and striatum, whereas GZ-793A decreased synthesis; no effect of METH or GZ-793A on DA synthesis was found in medial prefrontal cortex or orbitofrontal cortex. These results suggest that selective inhibition of VMAT2 produces a time-dependent decrease in DA release in NAc shell as a result of alterations in tyrosine hydroxylase activity, which may play a role in the ability of GZ-793A to decrease METH reward. © 2013 International Society for Neurochemistry.
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
Yamane, Satoshi; Nomura, Ryouya; Yanagihara, Madoka; Nakamura, Hiroyuki; Fujino, Hiromichi; Matsumoto, Kenjiro; Horie, Syunji; Murayama, Toshihiko
2015-10-05
Previous studies including ours demonstrated that L-cysteine treatments decreased motility in gastrointestinal tissues including the ileum via hydrogen sulfide (H2S), which is formed from sulfur-containing amino acids such as L-cysteine and L-homocysteine. However, the amino acid transport systems involved in L-cysteine/L-homocysteine-induced responses have not yet been elucidated in detail; therefore, we investigated these systems pharmacologically by measuring electrical stimulation (ES)-induced contractions with amino acids in mouse ileum preparations. The treatments with L-cysteine and D,L-homocysteine inhibited ES-induced contractions in ileum preparations from fasted mice, and these responses were decreased by the treatment with 2-aminobicyclo[2.2.1]heptane-2-carboxylate (BCH), an inhibitor of systems L and B°(,+). The results obtained using ileum preparations and a model cell line (PC12 cells) with various amino acids and BCH showed that not only L-cysteine, but also aminooxyacetic acid and D,L-propargylglycine, which act as H2S synthesis inhibitors, appeared to be taken up by these preparations/cells in L and B°(,+) system-dependent manners. The L-cysteine and D,L-homocysteine responses were delayed and abolished, respectively, in ileum preparations from fed mice. Our results suggested that the regulation of ileum motility by L-cysteine and D,L-homocysteine was dependent on BCH-sensitive systems, and varied depending on feeding in mice. Therefore, the effects of aminooxyacetic acid and D,L-propargylglycine on transport systems need to be considered in pharmacological analyses. Copyright © 2015 Elsevier B.V. All rights reserved.
Design, Synthesis, and Evaluation of Novel Tyrosine-Based DNA Gyrase B Inhibitors.
Cotman, Andrej E; Trampuž, Marko; Brvar, Matjaž; Kikelj, Danijel; Ilaš, Janez; Peterlin-Mašič, Lucija; Montalvão, Sofia; Tammela, Päivi; Frlan, Rok
2017-08-01
The discovery and synthesis of new tyrosine-based inhibitors of DNA gyrase B (GyrB), which target its ATPase subunit, is reported. Twenty-four compounds were synthesized and evaluated for activity against DNA gyrase and DNA topoisomerase IV. The antibacterial properties of selected GyrB inhibitors were demonstrated by their activity against Staphylococcus aureus and Enterococcus faecalis in the low micromolar range. The most promising compounds, 8a and 13e, inhibited Escherichia coli and S. aureus GyrB with IC 50 values of 40 and 30 µM. The same compound also inhibited the growth of S. aureus and E. faecalis with minimal inhibitory concentrations (MIC 90 ) of 14 and 28 µg/mL, respectively. © 2017 Deutsche Pharmazeutische Gesellschaft.
Electrochemical studies of novel corrosion inhibitor for mild steel in 1 M hydrochloric acid
NASA Astrophysics Data System (ADS)
Al-Amiery, Ahmed A.; Ahmed, Mohammed H. Othman; Abdullah, Thamer Adnan; Gaaz, Tayser Sumer; Kadhum, Abdul Amir H.
2018-06-01
The electrochemical performance of a novel organic corrosion inhibitor 6-(4-hydroxyphenyl)-3-mercapto-7,8-dihydro-[1,2,4]triazolo[4,3-b][1,2,4,5]tetrazine [HT3], for mild steel in 1 M hydrochloric acid is evaluated by potentiodynamic curves. The experimental results show that the investigated inhibitor [HT3], which can effectively retard the corrosion process that occurs to mild steel with a hydrochloric acid solution by providing a protective coating for the mild steel that, can be weakened by increasing the temperature. Furthermore, the inhibition efficiency of [HT3] increased with increasing the concentrations of the inhibitors and decreased with increasing temperature.
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael
2017-05-15
Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our
Sanchez, Erica L.; Pulliam, Thomas H.; Dimaio, Terri A.; Thalhofer, Angel B.; Delgado, Tracie
2017-01-01
ABSTRACT Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
De, Surya K.; Chen, Vida; Stebbins, John L.; Chen, Li-Hsing; Cellitti, Jason F.; Machleidt, Thomas; Barile, Elisa; Riel-Mehan, Megan; Dahl, Russell; Yang, Li; Emdadi, Aras; Murphy, Ria; Pellecchia, Maurizio
2009-01-01
A series of thiadiazole derivatives has been designed as potential allosteric, substrate competitive inhibitors of the protein kinase JNK. We report on the synthesis, characterization and evaluation of a series of compounds that resulted in the identification of potent and selective JNK inhibitors targeting its JIP-1 docking site. PMID:20045647
Grappin, P; Bouinot, D; Sotta, B; Miginiac, E; Jullien, M
2000-01-01
The physiological characteristics of seed dormancy in Nicotiana plumbaginifolia Viv. are described. The level of seed dormancy is defined by the delay in seed germination (i.e the time required prior to germination) under favourable environmental conditions. A wild-type line shows a clear primary dormancy, which is suppressed by afterripening, whereas an abscisic acid (ABA)-deficient mutant shows a non-dormant phenotype. We have investigated the role of ABA and gibberellic acid (GA(3)) in the control of dormancy maintenance or breakage during imbibition in suitable conditions. It was found that fluridone, a carotenoid biosynthesis inhibitor, is almost as efficient as GA(3) in breaking dormancy. Dry dormant seeds contained more ABA than dry afterripened seeds and, during early imbibition, there was an accumulation of ABA in dormant seeds, but not in afterripened seeds. In addition, fluridone and exogenous GA(3) inhibited the accumulation of ABA in imbibed dormant seeds. This reveals an important role for ABA synthesis in dormancy maintenance in imbibed seeds.
De Savi, Chris; Pape, Andrew; Cumming, John G; Ting, Attilla; Smith, Peter D; Burrows, Jeremy N; Mills, Mark; Davies, Chris; Lamont, Scott; Milne, David; Cook, Calum; Moore, Peter; Sawyer, Yvonne; Gerhardt, Stefan
2011-03-01
Two series of N-hydroxyformamide inhibitors of ADAM-TS4 were identified from screening compounds previously synthesised as inhibitors of matrix metalloproteinase-13 (collagenase-3). Understanding of the binding mode of this class of compound using ADAM-TS1 as a structural surrogate has led to the discovery of potent and very selective inhibitors with favourable DMPK properties. Synthesis, structure-activity relationships, and strategies to improve selectivity and lower in vivo metabolic clearance are described. Copyright © 2011 Elsevier Ltd. All rights reserved.
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
The existence of imidazoline corrosion inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Martin, J.A.; Valone, F.W.
1985-05-01
Spectroscopic methods, i.e., Fourier transform infrared (FT-IR), carbon-13 nuclear magnetic reasonance (/sup 13/C NMR), and ultraviolet (UV) spectroscopy, were used to investigate the actual chemical composition of oilfield corrosion inhibitors. Inhibitor formulations consisting of an amide or imidazoline reacted with a dimer-trimer acid, along with an ethoxylated surfactant and an aromatic solvent, were used for these studies. /sup 13/C NMR and FT-IR spectra of these inhibitors, as well as spectra of pure imidazolines, showed that the imidazoline functional group was fairly rapidly hydrolyzed to the amide form. For instance, in FT-IR studies, the imine functional group decreased in intensity asmore » a function of time. Coincident with this was an increase in the intensities of the vibrational resonances attributed to the amide functionality. The relative molar ratio of imidazoline to amide in a corrosion inhibitor could be calculated via UV spectroscopy. Within a 20 day interval after inhibitor synthesis, this ratio decreased by a factor greater than 20. These results, as well as a discussion of their economic impact on oilfield corrosion inhibitor formulation, are presented in this paper.« less
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Tran, Mai L; McCarthy, Thomas W; Sun, Hao; Wu, Shu-Zon; Norris, Joanna H; Bezanilla, Magdalena; Vidali, Luis; Anderson, Charles T; Roberts, Alison W
2018-01-15
Results from live cell imaging of fluorescently tagged Cellulose Synthase (CESA) proteins in Cellulose Synthesis Complexes (CSCs) have enhanced our understanding of cellulose biosynthesis, including the mechanisms of action of cellulose synthesis inhibitors. However, this method has been applied only in Arabidopsis thaliana and Brachypodium distachyon thus far. Results from freeze fracture electron microscopy of protonemal filaments of the moss Funaria hygrometrica indicate that a cellulose synthesis inhibitor, 2,6-dichlorobenzonitrile (DCB), fragments CSCs and clears them from the plasma membrane. This differs from Arabidopsis, in which DCB causes CSC accumulation in the plasma membrane and a different cellulose synthesis inhibitor, isoxaben, clears CSCs from the plasma membrane. In this study, live cell imaging of the moss Physcomitrella patens indicated that DCB and isoxaben have little effect on protonemal growth rates, and that only DCB causes tip rupture. Live cell imaging of mEGFP-PpCESA5 and mEGFP-PpCESA8 showed that DCB and isoxaben substantially reduced CSC movement, but had no measureable effect on CSC density in the plasma membrane. These results suggest that DCB and isoxaben have similar effects on CSC movement in P. patens and Arabidopsis, but have different effects on CSC intracellular trafficking, cell growth and cell integrity in these divergent plant lineages.
Hille, Ulrike E; Hu, Qingzhong; Vock, Carsten; Negri, Matthias; Bartels, Marc; Müller-Vieira, Ursula; Lauterbach, Thomas; Hartmann, Rolf W
2009-07-01
Recently, the steroidal CYP17 inhibitor Abiraterone entered phase II clinical trial for the treatment of androgen-dependent prostate cancer. As 17alpha-hydroxylase-17,20-lyase (CYP17) catalyzes the last step in androgen biosynthesis, inhibition of this target should affect not only testicular but also adrenal androgen formation. Therefore CYP17 inhibitors should be advantageous over existing therapies, for example with GnRH analogues. However, steroidal drugs are known for side effects which are due to affinities for steroid receptors. Therefore we decided to synthesize non-steroidal compounds mimicking the natural CYP17 substrates pregnenolone and progesterone. The synthesis and biological evaluation of a series of 15 novel and highly active non-steroidal CYP17 inhibitors are reported. The compounds were prepared via Suzuki-cross-coupling, Grignard reaction and CDI-assisted S(N)t-reaction with imidazole and their inhibitory activity was examined with recombinant human CYP17 expressed in Escherichia coli. Promising compounds were further tested for their selectivity against the hepatic enzyme CYP3A4 and the glucocorticoid-forming enzyme CYP11B1. All compounds turned out to be potent CYP17 inhibitors. The most active compounds 7 and 8 were much more active than Ketoconazole showing activity comparable to Abiraterone (IC(50) values of 90 and 52nM vs. 72nM). Most compounds also showed higher selectivities than Ketoconazole, but turned out to be less selective than Abiraterone. Docking studies using our CYP17 protein model were performed with selected compounds to study the interactions between the inhibitors and the amino acid residues of the active site.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
The synthesis of a tritium, carbon-14, and stable isotope-labeled cathepsin C inhibitors.
Allen, Paul; Bragg, Ryan A; Caffrey, Moya; Ericsson, Cecilia; Hickey, Michael J; Kingston, Lee P; Elmore, Charles S
2017-02-01
As part of a medicinal chemistry program aimed at developing a highly potent and selective cathepsin C inhibitor, tritium, carbon-14, and stable isotope-labeled materials were required. The synthesis of tritium-labeled methanesulfonate 5 was achieved via catalytic tritiolysis of a chloro precursor, albeit at a low radiochemical purity of 67%. Tritium-labeled AZD5248 was prepared via a 3-stage synthesis, utilizing amide-directed hydrogen isotope exchange. Carbon-14 and stable isotope-labeled AZD5248 were successfully prepared through modifications of the medicinal chemistry synthetic route, enabling the use of available labeled intermediates. Copyright © 2016 John Wiley & Sons, Ltd.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Matsuda, Morihiro; Korn, Bobby S.; Hammer, Robert E.; Moon, Young-Ah; Komuro, Ryutaro; Horton, Jay D.; Goldstein, Joseph L.; Brown, Michael S.; Shimomura, Iichiro
2001-01-01
In liver, the synthesis of cholesterol and fatty acids increases in response to cholesterol deprivation and insulin elevation, respectively. This regulatory mechanism underlies the adaptation to cholesterol synthesis inhibitors (statins) and high calorie diets (insulin). In nonhepatic cells, lipid synthesis is controlled by sterol regulatory element-binding proteins (SREBPs), membrane-bound transcription factors whose active domains are released proteolytically to enter the nucleus and activate genes involved in the synthesis and uptake of cholesterol and fatty acids. SCAP (SREBP cleavage-activating protein) is a sterol-regulated escort protein that transports SREBPs from their site of synthesis in the endoplasmic reticulum to their site of cleavage in the Golgi. Here, we produced a conditional deficiency of SCAP in mouse liver by genomic recombination mediated by inducible Cre recombinase. SCAP-deficient mice showed an 80% reduction in basal rates of cholesterol and fatty acid synthesis in liver, owing to decreases in mRNAs encoding multiple biosynthetic enzymes. Moreover, these mRNAs failed to increase normally in response to cholesterol deprivation produced by a cholesterol synthesis inhibitor and to insulin elevation produced by a fasting–refeeding protocol. These data provide in vivo evidence that SCAP and the SREBPs are required for hepatic lipid synthesis under basal and adaptive conditions. PMID:11358865
Enantioselective Synthesis and Profiling of Two Novel Diazabicyclooctanone β-Lactamase Inhibitors
2014-01-01
The enantioselective synthesis of two novel cyclopropane-fused diazabicyclooctanones is reported here. Starting from butadiene monoxide, the key enone intermediate 7 was prepared in six steps. Subsequent stereoselective introduction of the cyclopropane group and further transformation led to compounds 1a and 1b as their corresponding sodium salt. The great disparity regarding their hydrolytic stability was rationalized by the steric interaction between the cyclopropyl methylene and urea carbonyl. These two novel β-lactamase inhibitors were active against class A, C, and D enzymes. PMID:25313328
Corrosion control of carbon steel using inhibitor of banana peel extract in acid diluted solutions
NASA Astrophysics Data System (ADS)
Komalasari; Utami, S. P.; Fermi, M. I.; Aziz, Y.; Irianti, R. S.
2018-04-01
Issues of corrosion happened in pipes, it was used as fluid transportation in the chemical industry. Corrosion cannot be preventing, however it could be controlled or blocked. Inhibitor addition is one of the method to control the corrosion inside the pipe. Corrosion inhibitors consisted of inorganic and organic compound inhibitors. Organic inhibitor is composed from synthetic and natural material. This study focused to evaluate the inhibition’s efficiency from banana peel to carbon steel in different concentration of inhibitor and immersing time in acid solution variation. The research employed inhibitor concentration of 0 gram/liter, 2 gram/liter, 4 gram/liter and 6 gram/liter, immersed time of carbon steel for 2, 4, 6, 8 and 10 hours. It was immersed in chloride acid solution of 0.5 M and 1.5 M. Carbon Steel AISI 4041 was used as specimen steel. Results were analyzed using corrosion rate evaluation for each specimens and inhibitor efficiencies determination. It was found that the specimen without inhibitor yielded fast corrosion rate in long immersing time and high concentration of HCl. However, the specimens with inhibitor gave lowest corrosion rate which was 78.59% for 6 gram/litre and 10 hours in 0.5 M HCl.
Abdelwahab, Nuha Z; Crossman, Arthur T; Sullivan, Lauren; Ferguson, Michael A J; Urbaniak, Michael D
2012-03-01
Disruption of glycosylphosphatidylinositol biosynthesis is genetically and chemically validated as a drug target against the protozoan parasite Trypanosoma brucei, the causative agent of African sleeping sickness. The N-acetylglucosamine-phosphatidylinositol de-N-acetylase (deNAc) is a zinc metalloenzyme responsible for the second step of glycosylphosphatidylinositol biosynthesis. We recently reported the synthesis of eight deoxy-2-C-branched monosaccharides containing carboxylic acid, hydroxamic acid, or N-hydroxyurea substituents at the C2 position that may act as zinc-binding groups. Here, we describe the synthesis of a glucocyclitol-phospholipid incorporating a hydroxamic acid moiety and report the biochemical evaluation of the monosaccharides and the glucocyclitol-phospholipid as inhibitors of the trypanosome deNAc in the cell-free system and against recombinant enzyme. Monosaccharides with carboxylic acid or hydroxamic acid substituents were found to be the inhibitors of the trypanosome deNAc with IC(50) values 0.1-1.5mM and the glucocyclitol-phospholipid was found to be a dual inhibitor of the deNAc and the α1-4-mannose transferase with an apparent IC(50)= 19±0.5μm. © 2011 John Wiley & Sons A/S.
Bukhari, S N A; Butt, A M; Amjad, M W B; Ahmad, W; Shah, V H; Trivedi, A R
2013-11-01
Hypertension is a widespread and frequently progressive ailment that imparts a foremost threat for cardiovascular and renal disorders. Mammoth efforts are needed for the synthesis of innovative antihypertensive agents to combat this lethal disease. Chalcones have shown antihypertensive activity through inhibition of Angiotensin Converting Enzyme (ACE). Hence, a series of chalcone analogues is synthesized and used as precursor for the synthesis of novel series of pyrimidines. Precursor chalcones were prepared by reacting aldehydes and ketones in presence of sodium hydroxide followed by synthesis of corresponding pyrimidines by reaction with urea in presence of potassium hydroxide. Both groups were then evaluated for their effects on ACE. The results depicted that pyrimidines were more active than chalcones with methoxy (C5 and P5) substitution showing best results to inhibit ACE. Given that chalcone analogues and pyrimidines show a potential as the angiotensin converting enzyme inhibitors.
Pillarisetti, Sivaram; Alexander, Christopher W; Khanna, Ish
2009-12-01
Fatty acid amide hydrolase (FAAH) is responsible for the hydrolysis of several important endogenous fatty acid amides (FAAs), including anandamide, oleoylethanolamide and palmitoylethanolamide. Because specific FAAs interact with cannabinoid and vanilloid receptors, they are often referred to as 'endocannabinoids' or 'endovanilloids'. Initial interest in this area, therefore, has focused on developing FAAH inhibitors to augment the actions of FAAs and reduce pain. However, recent literature has shown that these FAAs - through interactions with unique receptors (extracellular and intracellular) - can induce a diverse array of effects that include appetite suppression, modulation of lipid and glucose metabolism, vasodilation, cardiac function and inflammation. This review gives an overview of FAAs and diverse FAAH inhibitors and their potential therapeutic utility in pain and non-pain indications.
Design and Synthesis of 4-Heteroaryl 1,2,3,4-Tetrahydroisoquinolines as Triple Reuptake Inhibitors
2014-01-01
A series of 4-bicyclic heteroaryl 1,2,3,4-tetrahydroisoquinoline inhibitors of the serotonin transporter (SERT), norepinephrine transporter (NET), and dopamine transporter (DAT) was discovered. The synthesis and structure–activity relationship (SAR) of these triple reuptake inhibitors (TRIs) will be discussed. Compound 10i (AMR-2), a very potent inhibitor of SERT, NET, and DAT, showed efficacy in the rat forced-swim and mouse tail suspension models with minimum effective doses of 0.3 and 1 mg/kg (po), respectively. At efficacious doses in these assays, 10i exhibited substantial occupancy levels at the three transporters in both rat and mouse brain. The study of the metabolism of 10i revealed the formation of a significant active metabolite, compound 13. PMID:25050161
Design and synthesis of 4-heteroaryl 1,2,3,4-tetrahydroisoquinolines as triple reuptake inhibitors.
Liu, Shuang; Zha, Congxiang; Nacro, Kassoum; Hu, Min; Cui, Wenge; Yang, Yuh-Lin; Bhatt, Ulhas; Sambandam, Aruna; Isherwood, Matthew; Yet, Larry; Herr, Michael T; Ebeltoft, Sarah; Hassler, Carla; Fleming, Linda; Pechulis, Anthony D; Payen-Fornicola, Anne; Holman, Nicholas; Milanowski, Dennis; Cotterill, Ian; Mozhaev, Vadim; Khmelnitsky, Yuri; Guzzo, Peter R; Sargent, Bruce J; Molino, Bruce F; Olson, Richard; King, Dalton; Lelas, Snjezana; Li, Yu-Wen; Johnson, Kim; Molski, Thaddeus; Orie, Anitra; Ng, Alicia; Haskell, Roy; Clarke, Wendy; Bertekap, Robert; O'Connell, Jonathan; Lodge, Nicholas; Sinz, Michael; Adams, Stephen; Zaczek, Robert; Macor, John E
2014-07-10
A series of 4-bicyclic heteroaryl 1,2,3,4-tetrahydroisoquinoline inhibitors of the serotonin transporter (SERT), norepinephrine transporter (NET), and dopamine transporter (DAT) was discovered. The synthesis and structure-activity relationship (SAR) of these triple reuptake inhibitors (TRIs) will be discussed. Compound 10i (AMR-2), a very potent inhibitor of SERT, NET, and DAT, showed efficacy in the rat forced-swim and mouse tail suspension models with minimum effective doses of 0.3 and 1 mg/kg (po), respectively. At efficacious doses in these assays, 10i exhibited substantial occupancy levels at the three transporters in both rat and mouse brain. The study of the metabolism of 10i revealed the formation of a significant active metabolite, compound 13.
Effect of inhibitors of prostaglandin synthesis on gonadotropin release in the rat.
Ojeda, S R; Harms, P G; McCann, S M
1975-10-01
To study the effect of blockade of prostaglandin (PG) synthesis on gonadotropin release in the rat, inhibitors of PG synthesis were injected by various routes in various experimental conditions. The injection of 5-, 8-, 11-, 14-eicosatetraynoic acid (TYA) into the third ventricle (3rd V) significantly decreased plasma LH of ovariectomized (OVX) rats 1, 2, and 4 h following its injection; however, TYA failed to alter plasma LH in OVX rats when administered as a single sc injection and also failed to prevent the post-castration rise in plasma LH when administered sc once daily for 4 days to short-term OVX rats. None of these treatments altered plasma FSH concentrations. Indomethacin (Id) injected into the 3rd V or implanted into the medial basal hypothalamus (MBH) of OVX rats depressed plasma LH 1--6 h later. This effect was no longer observed 24--72 h following its implantation in the MBH. When different doses of Id were administered as single sc injections to OVX rats, plasma LH titers were depressed 24--32 h later, whereas plasma FSH remained either unaltered or was slightly increased. Similarly, the post-castration rise of plasma LH but not that of FSH in male rats was suppressed by a single sc injection of Id given 6 h before orchidectomy. Id administered acutely iv failed to modify the pulsatile release of LH in OVX rats, but it effectively inhibited this release when injected sc 20--30 h before the initiation of blood collection. Moreover, Id blocked the progesterone-induced LH and FSH release in OVX estrogen-primed rats when given sc 24 h before progesterone, but not when it was injected either sc or iv shortly (2 h) before or shortly after (1--3 h) progesterone treatment. Rats treated with Id showed a decrease in BW 24--32 h afters its sc injection. However, the effects of Id on LH release could not be explained by lack of food intake since fasted controls showed LH titers similar to fed rats. Id did not significantly inhibit the LH release in response to
Vasileiou, Zoe; Barlos, Kostas K; Gatos, Dimitrios; Adermann, Knut; Deraison, Celine; Barlos, Kleomenis
2010-01-01
Proteinase inhibitors are of high pharmaceutical interest and are drug candidates for a variety of indications. Specific kallikrein inhibitors are important for their antitumor activity and their potential application to the treatment of skin diseases. In this study we describe the synthesis of domain 6 of the kallikrein inhibitor Lympho-Epithilial Kazal-Type Inhibitor (LEKTI) by the fragment condensation method and site-directed cystine bridge formation. To obtain the linear LEKTI precursor, the condensation was best performed in solution, coupling the protected fragment 1-22 to 23-68. This method yielded LEKTI domain 6 of high purity and equipotent to the recombinantly produced peptide. (c) 2010 Wiley Periodicals, Inc.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Ashraf, Zaman; Rafiq, Muhammad; Seo, Sung-Yum; Babar, Mustafeez Mujtaba; Zaidi, Najam-us-Sahar Sadaf
2015-09-01
The purpose of the present study was to discover the extent of contribution to antityrosinase activity by adding hydroxy substituted benzoic acid, cinnamic acid and piperazine residues to vanillin. The study showed the transformation of vanillin into esters as shown in (4a-4d), (6a-6b), and (8a-8b). In addition, the relationship between structures of these esters and their mushroom tyrosinase inhibitory activity was explored. The kinetics of inhibition on mushroom tyrosinase by these esters was also investigated. It was found that hydroxyl substituted benzoic acid derivatives were weak inhibitors; however hydroxy or chloro substituted cinnamic acid and piperazine substituted derivatives were able to induce significant tyrosinase inhibition. The mushroom tyrosinase (PDBID 2ZWE) was docked with synthesized vanillin derivatives and their calculated binding energies were compared with experimental IC50 values which provided positive correlation. The most potent derivative 2-(4-formyl-2-methoxyphenoxy)-2-oxoethyl (2E)-3-(4-hydroxyphenyl)prop-2-enoate (6a) possesses hydroxy substituted cinnamic acid scaffold having IC50 value 16.13 μM with binding energy of -7.2 kcal/mol. The tyrosinase inhibitory activity of (6a) is comparable with standard kojic acid. Kinetic analysis indicated that compound 6a was mixed-type tyrosinase inhibitor with inhibition constant values Ki (13 μM) and Ki' (53 μM) and formed reversible enzyme inhibitor complex. The active vanillin analog (6a) was devoid of toxic effects as shown in cytotoxic studies. Copyright © 2015 Elsevier Ltd. All rights reserved.
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Structural basis for 18-β-glycyrrhetinic acid as a novel non-GSH analog glyoxalase I inhibitor.
Zhang, Hong; Huang, Qiang; Zhai, Jing; Zhao, Yi-ning; Zhang, Li-ping; Chen, Yun-yun; Zhang, Ren-wei; Li, Qing; Hu, Xiao-peng
2015-09-01
Glyoxalase I (GLOI), a glutathione (GSH)-dependent enzyme, is overexpressed in tumor cells and related to multi-drug resistance in chemotherapy, making GLOI inhibitors as potential anti-tumor agents. But the most studied GSH analogs exhibit poor pharmacokinetic properties. The aim of this study was to discover novel non-GSH analog GLOI inhibitors and analyze their binding mechanisms. Mouse GLOI (mGLOI) was expressed in BL21 (DE3) pLysS after induction with isopropyl-β-D-1-thiogalactopyranoside and purified using AKTA FPLC system. An in vitro mGLOI enzyme assay was used to screen a small pool of compounds containing carboxyl groups. Crystal structure of the mGLOI-inhibitor complex was determined at 2.3 Å resolution. Molecular docking study was performed using Discovery Studio 2.5 software package. A natural compound 18-β-glycyrrhetinic acid (GA) and its derivative carbenoxolone were identified as potent competitive non-GSH analog mGLOI inhibitors with Ki values of 0.29 μmol/L and 0.93 μmol/L, respectively. Four pentacyclic triterpenes (ursolic acid, oleanolic acid, betulic acid and tripterine) showed weak activities (mGLOI inhibition ratio <25% at 10 μmol/L) and other three (maslinic acid, corosolic acid and madecassic acid) were inactive. The crystal structure of the mGLOI-GA complex showed that the carboxyl group of GA mimicked the γ-glutamyl residue of GSH by hydrogen bonding to the glutamyl sites (residues Arg38B, Asn104B and Arg123A) in the GSH binding site of mGLOI. The extensive van der Waals interactions between GA and the surrounding residues also contributed greatly to the binding of GA and mGLOI. This work demonstrates a carboxyl group to be an important functional feature of non-GSH analog GLOI inhibitors.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Pecic, Stevan; Pakhomova, Svetlana; Newcomer, Marcia E.
2013-09-27
A series of potent amide non-urea inhibitors of soluble epoxide hydrolase (sEH) is disclosed. The inhibition of soluble epoxide hydrolase leads to elevated levels of epoxyeicosatrienoic acids (EETs), and thus inhibitors of sEH represent one of a novel approach to the development of vasodilatory and anti-inflammatory drugs. Structure–activities studies guided optimization of a lead compound, identified through high-throughput screening, gave rise to sub-nanomolar inhibitors of human sEH with stability in human liver microsomal assay suitable for preclinical development.
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Dhar, T G Murali; Guo, Junqing; Shen, Zhongqi; Pitts, William J; Gu, Henry H; Chen, Bang-Chi; Zhao, Rulin; Bednarz, Mark S; Iwanowicz, Edwin J
2002-06-13
[structure: see text] A modified approach to the synthesis of 2-(N-aryl)-1,3-oxazoles, employing an optimized iminophosphorane/heterocumulene-mediated methodology, and its application to the synthesis of BMS-337197, a potent inhibitor of IMPDH, are described.
Antimicrobial and Efflux Inhibitor Activity of Usnic Acid Against Mycobacterium abscessus.
Ramis, Ivy B; Vianna, Júlia S; Reis, Ana Júlia; von Groll, Andrea; Ramos, Daniela F; Viveiros, Miguel; da Silva, Pedro E Almeida
2018-06-18
New drugs are needed to treat infections with antimicrobial-resistant Mycobacterium abscessus ; therefore, we evaluated usnic acid as an antimicrobial agent and efflux inhibitor (EI) against M. abscessus . Usnic acid showed antimicrobial activity, and synergistically, the EI verapamil increased this activity. In addition, when we evaluated the interaction of antimicrobials with usnic acid, the increase of their activity was observed. Finally, usnic acid showed an efflux inhibitory effect between the classical EIs verapamil and carbonyl cyanide m-chlorophenylhydrazine. In conclusion, usnic acid showed both antimicrobial and EI activity, indicating that this natural compound may be a promising scaffold for new drugs against this difficult-to-treat microorganism. Georg Thieme Verlag KG Stuttgart · New York.
Synthesis of Benzo[a]carbazoles and an Indolo[2,3-a]carbazole from 3-Aryltetramic Acids.
Truax, Nathanyal J; Banales Mejia, Fernando; Kwansare, Deborah O; Lafferty, Megan M; Kean, Maeve H; Pelkey, Erin T
2016-08-05
A simple and flexible approach to 3-pyrrolin-2-one fused carbazoles is disclosed. The key step involves the BF3-mediated electrophilic substitution of indoles with N-alkyl-substituted 3-aryltetramic acids, which provides access to indole-substituted 3-pyrrolin-2-ones. Scholl-type oxidative cyclizations of these materials led to the formation of the corresponding 3-pyrrolin-2-one-fused benzo[a]carbazoles and indolo[2,3-a]carbazoles. This work represents the first synthesis of the benzo[a]pyrrolo[3,4-c]carbazol-3(8H)-one ring system, while the indolo[2,3-a]pyrrolo[3,4-c]carbazol-5-one ring system is found in a number of biologically active compounds including the protein kinase C (PKC) inhibitor, staurosporine.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Lamb, Rebecca; Harrison, Hannah; Smith, Duncan L.; Townsend, Paul A.; Jackson, Thomas; Ozsvari, Bela; Martinez-Outschoorn, Ubaldo E.; Pestell, Richard G.; Howell, Anthony; Lisanti, Michael P.; Sotgia, Federica
2015-01-01
We have used an unbiased proteomic profiling strategy to identify new potential therapeutic targets in tumor-initiating cells (TICs), a.k.a., cancer stem cells (CSCs). Towards this end, the proteomes of mammospheres from two breast cancer cell lines were directly compared to attached monolayer cells. This allowed us to identify proteins that were highly over-expressed in CSCs and/or progenitor cells. We focused on ribosomal proteins and protein folding chaperones, since they were markedly over-expressed in mammospheres. Overall, we identified >80 molecules specifically associated with protein synthesis that were commonly upregulated in mammospheres. Most of these proteins were also transcriptionally upregulated in human breast cancer cells in vivo, providing evidence for their potential clinical relevance. As such, increased mRNA translation could provide a novel mechanism for enhancing the proliferative clonal expansion of TICs. The proteomic findings were functionally validated using known inhibitors of protein synthesis, via three independent approaches. For example, puromycin (which mimics the structure of tRNAs and competitively inhibits protein synthesis) preferentially targeted CSCs in both mammospheres and monolayer cultures, and was ~10-fold more potent for eradicating TICs, than “bulk” cancer cells. In addition, rapamycin, which inhibits mTOR and hence protein synthesis, was very effective at reducing mammosphere formation, at nanomolar concentrations. Finally, mammosphere formation was also markedly inhibited by methionine restriction, which mimics the positive effects of caloric restriction in cultured cells. Remarkably, mammosphere formation was >18-fold more sensitive to methionine restriction and replacement, as directly compared to monolayer cell proliferation. Methionine is absolutely required for protein synthesis, since every protein sequence starts with a methionine residue. Thus, the proliferation and survival of CSCs is very sensitive to
Minutoli, Letteria; Marini, Herbert; Rinaldi, Mariagrazia; Bitto, Alessandra; Irrera, Natasha; Pizzino, Gabriele; Pallio, Giovanni; Calò, Margherita; Adamo, Elena Bianca; Trichilo, Vincenzo; Interdonato, Monica; Galfo, Federica; Squadrito, Francesco; Altavilla, Domenica
2015-06-01
Systemic administration of kainic acid causes inflammation and apoptosis in the brain, resulting in neuronal loss. Dual cyclooxygenase/5-lipoxygenase (COX/5-LOX) inhibitors could represent a possible neuroprotective approach in preventing glutamate excitotoxicity. Consequently, we investigated the effects of a dual inhibitor of COX/5-LOX following intraperitoneal administration of kainic acid (KA, 10 mg/kg) in rats. Animals were randomized to receive either the dual inhibitor of COX/5-LOX (flavocoxid, 20 mg/kg i.p.) or its vehicle (1 ml/kg i.p.) 30 min after KA administration. Sham brain injury rats were used as controls. We evaluated protein expression of phosphorylated extracellular signal-regulated kinase (p-ERK1/2) and tumor necrosis factor alpha (TNF-α) as well as levels of malondialdehyde (MDA), prostaglandin E2 (PGE2) and leukotriene B4 (LTB4) in the hippocampus. Animals were also observed for monitoring behavioral changes according to Racine Scale. Finally, histological analysis and brain edema evaluation were carried out. Treatment with the dual inhibitor of COX/5-LOX decreased protein expression of p-ERK1/2 and TNF-α in hippocampus, markedly reduced MDA, LTB4 and PGE2 hippocampal levels, and also ameliorated brain edema. Histological analysis showed a reduction in cell damage in rats treated with the dual inhibitor of COX/5-LOX, particularly in hippocampal subregion CA3c. Moreover, flavocoxid significantly improved behavioral signs following kainic acid administration. Our results suggest that dual inhibition of COX/5-LOX by flavocoxid has neuroprotective effects during kainic acid-induced excitotoxicity.
Fontaine, Fanny; Héquet, Arnaud; Voisin-Chiret, Anne-Sophie; Bouillon, Alexandre; Lesnard, Aurélien; Cresteil, Thierry; Jolivalt, Claude; Rault, Sylvain
2015-05-05
In response to the extensive use of antibiotics, bacteria have evolved numerous mechanisms of defense against antimicrobial agents. Among them, extrusion of the antimicrobial agents outside the bacterial cell through efflux pumps is a major cause of concern. At first limited to one or few structurally-related antibiotics, bacterial resistance have then progressed towards cross-resistance between different classes of antibiotics, leading to multidrug-resistant microorganisms. Emergence of these pathogens requires development of novel therapeutic strategies and inhibition of efflux pumps appears to be a promising strategy that could restore the potency of existing antibiotics. NorA is the most studied chromosomal efflux pump of Staphylococcus aureus; it is known to be implied in resistance of Methicillin-resistant S. aureus (MRSA) strains against a wide range of unrelated substrates, including hydrophilic fluoroquinolones. Starting from 6-benzyloxypyridine-3-boronic acid I that we previously identified as a potential inhibitor of the NorA efflux pump against the NorA-overexpressing S. aureus 1199B strain (SA1199B), we describe here the synthesis and biological evaluation of a series of 6-(aryl)alkoxypyridine-3-boronic acids. 6-(3-Phenylpropoxy)pyridine-3-boronic acid 3i and 6-(4-phenylbutoxy)pyridine-3-boronic acid 3j were found to potentiate ciprofloxacin activity by a 4-fold increase compared to the parent compound I. In addition, it has been shown that both compounds promote Ethidium Bromide (EtBr) accumulation in SA1199B, thus corroborating their potential mode of action as NorA inhibitors. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Regulation of retinoic acid synthetic enzymes by WT1 and HDAC inhibitors in 293 cells.
Li, Yifan; Wang, Lei; Ai, Weipeng; He, Nianhui; Zhang, Lin; Du, Jihui; Wang, Yong; Mao, Xingjian; Ren, Junqi; Xu, Dan; Zhou, Bei; Li, Rong; Mai, Liwen
2017-09-01
All-trans retinoic acid (atRA), which is mainly generated endogenously via two steps of oxidation from vitamin A (retinol), plays an indispensible role in the development of the kidney and many other organs. Enzymes that catalyze the oxidation of retinol to generate atRA, including aldehyde dehydrogenase 1 family (ALDH1)A1, ALDH1A2 and ALDH1A3, exhibit complex expression patterns at different stages of renal development. However, molecular triggers that control these differential expression levels are poorly understood. In this study, we provide in vitro evidence to demonstrate that Wilms' tumor 1 (WT1) negatively regulates the expression of the atRA synthetic enzymes, ALDH1A1, ALDH1A2 and ALDH1A3, in the 293 cell line, leading to significant blockage of atRA production. Furthermore, we demonstrate that the suppression of ALDH1A1 by WT1 can be markedly attenuated by histone deacetylase inhibitors (HDACis). Taken together, we provide evidence to indicate that WT1 and HDACs are strong regulators of endogenous retinoic acid synthetic enzymes in 293 cells, indicating that they may be involved in the regulation of atRA synthesis.
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
Patterson, Stephen; Alphey, Magnus S; Jones, Deuan C; Shanks, Emma J; Street, Ian P; Frearson, Julie A; Wyatt, Paul G; Gilbert, Ian H; Fairlamb, Alan H
2011-10-13
Trypanothione reductase (TryR) is a genetically validated drug target in the parasite Trypanosoma brucei , the causative agent of human African trypanosomiasis. Here we report the discovery, synthesis, and development of a novel series of TryR inhibitors based on a 3,4-dihydroquinazoline scaffold. In addition, a high resolution crystal structure of TryR, alone and in complex with substrates and inhibitors from this series, is presented. This represents the first report of a high resolution complex between a noncovalent ligand and this enzyme. Structural studies revealed that upon ligand binding the enzyme undergoes a conformational change to create a new subpocket which is occupied by an aryl group on the ligand. Therefore, the inhibitor, in effect, creates its own small binding pocket within the otherwise large, solvent exposed active site. The TryR-ligand structure was subsequently used to guide the synthesis of inhibitors, including analogues that challenged the induced subpocket. This resulted in the development of inhibitors with improved potency against both TryR and T. brucei parasites in a whole cell assay.
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Konno, Hiroyuki; Wakabayashi, Masaki; Takanuma, Daiki; Saito, Yota; Akaji, Kenichi
2016-03-15
Synthesis of serine derivatives having the essential functional groups for the inhibitor of SARS 3CL protease and evaluation of their inhibitory activities using SARS 3CL R188I mutant protease are described. The lead compounds, functionalized serine derivatives, were designed based on the tetrapeptide aldehyde and Bai's cinnamoly inhibitor, and additionally performed with simulation on GOLD softwear. Structure activity relationship studies of the candidate compounds were given reasonable inhibitors ent-3 and ent-7k against SARS 3CL R188I mutant protease. These inhibitors showed protease selectivity and no cytotoxicity. Copyright © 2016 Elsevier Ltd. All rights reserved.
Chen, Nanhua; LaCrue, Alexis N.; Teuscher, Franka; Waters, Norman C.; Gatton, Michelle L.; Kyle, Dennis E.
2014-01-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. PMID:24913167
Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin
2014-08-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Zhang, Ting-Jian; Li, Song-Ye; Yuan, Wei-Yan; Zhang, Yi; Meng, Fan-Hao
2018-04-01
A series of N-(9,10-anthraquinone-2-carbonyl)amino acid derivatives (1a-j) was designed and synthesized as novel xanthine oxidase inhibitors. Among them, the L/D-phenylalanine derivatives (1d and 1i) and the L/D-tryptophan derivatives (1e and 1j) were effective with micromolar level potency. In particular, the L-phenylalanine derivative 1d (IC 50 = 3.0 μm) and the D-phenylalanine derivative 1i (IC 50 = 2.9 μm) presented the highest potency and were both more potent than the positive control allopurinol (IC 50 = 8.1 μm). Preliminary SAR analysis pointed that an aromatic amino acid fragment, for example, phenylalanine or tryptophan, was essential for the inhibition; the D-amino acid derivative presented equal or greater potency compared to its L-enantiomer; and the 9,10-anthraquinone moiety was welcome for the inhibition. Molecular simulations provided rational binding models for compounds 1d and 1i in the xanthine oxidase active pocket. As a result, compounds 1d and 1i could be promising lead compounds for further investigation. © 2017 John Wiley & Sons A/S.
Effects of Sodium Glucose Cotransporter-2 Inhibitors on Serum Uric Acid in Type 2 Diabetes Mellitus.
Ahmadieh, Hala; Azar, Sami
2017-09-01
Hyperuricemia has been linked to metabolic syndrome, cardiovascular disease, and chronic kidney disease. Hyperuricemia and type 2 diabetes mellitus were inter-related, type 2 diabetes mellitus was more at risk of having a higher serum uric acid level, and also individuals with higher serum uric acid had higher risk of developing type 2 diabetes in the future. Insulin resistance seems to play an important role in the causal relationship between metabolic syndrome, type 2 diabetes, and hyperuricemia. Oral diabetic drugs that would have additional beneficial effects on reducing serum uric acid levels are of importance. Selective SGLT2 inhibitors were extensively studied in type 2 diabetes mellitus and were found to have improvement of glycemic control, in addition to their proven metabolic effects on weight and blood pressure. Additional beneficial effect of SGLT2 inhibitors on serum uric acid level reduction is investigated. Recently, data have been accumulating showing that they have additional beneficial effects on serum uric acid reduction. As for the postulated mechanism, serum uric acid decreased in SGLT2 inhibitor users as a result of the increase in the urinary excretion rate of uric acid, due to the inhibition of uric acid reabsorption mediated by the effect of the drug on the GLUT9 isoform 2, located at the collecting duct of the renal tubule.
Blass, Benjamin E; Iyer, Pravin; Abou-Gharbia, Magid; Childers, Wayne E; Gordon, John C; Ramanjulu, Mercy; Morton, George; Arumugam, Premkumar; Boruwa, Joshodeep; Ellingboe, John; Mitra, Sayan; Reddy Nimmareddy, Rajashekar; Paliwal, Shalini; Rajasekhar, Jamallamudi; Shivakumar, Savithiri; Srivastava, Pratima; Tangirala, Raghuram S; Venkataramanaiah, Konda; Bobbala, Ramreddy; Yanamandra, Mahesh; Krishnakanth Reddy, L
2018-07-15
The synthesis of steroid hormones is critical to human physiology and improper regulation of either the synthesis of these key molecules or activation of the associated receptors can lead to disease states. This has led to intense interest in developing compounds capable of modulating the synthesis of steroid hormones. Compounds capable of inhibiting Cyp19 (Aromatase), a key enzyme in the synthesis of estrogens, have been successfully employed as breast cancer therapies, while inhibitors of Cyp17 (17α-hydroxylase-17,20-lyase), a key enzyme in the synthesis of glucocorticoids, mineralocorticoids and steroidal sex hormones, are a key component of prostate cancer therapy. Inhibition of CYP17 has also been suggested as a possible target for the treatment of Cushing Syndrome and Metabolic Syndrome. We have identified two novel series of stilbene based CYP17 inhibitors and demonstrated that exemplary compounds in these series have pharmacokinetic properties consistent with orally delivered drugs. These findings suggest that compounds in these classes may be useful for the treatment of diseases and conditions associated with improper regulation of glucocorticoids synthesis and glucocorticoids receptor activation. Copyright © 2018. Published by Elsevier Ltd.
NASA Technical Reports Server (NTRS)
Mulkey, T. J.; Evans, M. L.
1982-01-01
In gravitropically stimulated roots of maize (Zea mays L., hybrid WF9 x 38MS), there is more acid efflux on the rapidly growing upper side than on the slowly growing lower side. In light of the Cholodny/Went hypothesis of gravitropism which states that gravitropic curvature results from lateral redistribution of auxin, the effects of auxin transport inhibitors on the development of acid efflux asymmetry and curvature in gravistimulated roots were examined. All the transport inhibitors tested prevented both gravitropism and the development of asymmetric acid efflux in gravistimulated roots. The results indicate that auxin redistribution may cause the asymmetry of acid efflux, a finding consistent with the Cholodny/Went hypothesis of gravitropism. As further evidence that auxin-induced acid efflux asymmetry may mediate gravitropic curvature, sodium orthovanadate, an inhibitor of auxin-induced H+ efflux was found to prevent both gravitropism and the development of asymmetric acid efflux in gravistimulated roots.
Koda, Sho; Okumura, Naoki; Kitano, Junji; Koizumi, Noriko; Tabata, Yasuhiko
2017-01-01
The purpose of this study was to investigate the feasibility of poly lactic/glycolic acid (PLGA) as a drug delivery carrier of Rho kinase (ROCK) inhibitor for the treatment of corneal endothelial disease. ROCK inhibitor Y-27632 and PLGA were dissolved in water with or without gelatin (W1), and a double emulsion [(W1/O)/W2] was formed with dichloromethane (O) and polyvinyl alcohol (W2). Drug release curve was obtained by evaluating the released Y-27632 by using high performance liquid chromatography. PLGA was injected into the anterior chamber or subconjunctiva in rabbit eyes, and ocular complication was evaluated by slitlamp microscope and histological analysis. Y-27632 incorporated PLGA microspheres with different molecular weights, and different composition ratios of lactic acid and glycolic acid were fabricated. A high molecular weight and low content of glycolic acid produced a slower and longer release. The Y-27632 released from PLGA microspheres significantly promoted the cell proliferation of cultured corneal endothelial cells. The injection of PLGA did not induce any evident eye complication. ROCK inhibitor-incorporated PLGA microspheres were fabricated, and the microspheres achieved the sustained release of ROCK inhibitor over 7-10 days in vitro. Our data should encourage researchers to use PLGA microspheres for treating corneal endothelial diseases.
Reichel, Christoph A.; Lerchenberger, Max; Uhl, Bernd; Rehberg, Markus; Berberich, Nina; Zahler, Stefan; Wymann, Matthias P.; Krombach, Fritz
2011-01-01
Clinical trials revealed beneficial effects of the broad-spectrum serine protease inhibitor aprotinin on the prevention of ischemia-reperfusion (I/R) injury. The underlying mechanisms remained largely unclear. Using in vivo microscopy on the cremaster muscle of male C57BL/6 mice, aprotinin as well as inhibitors of the serine protease plasmin including tranexamic acid and ε-aminocaproic acid were found to significantly diminish I/R-elicited intravascular firm adherence and (subsequent) transmigration of neutrophils. Remodeling of collagen IV within the postischemic perivenular basement membrane was almost completely abrogated in animals treated with plasmin inhibitors or aprotinin. In separate experiments, incubation with plasmin did not directly activate neutrophils. Extravascular, but not intravascular administration of plasmin caused a dose-dependent increase in numbers of firmly adherent and transmigrated neutrophils. Blockade of mast cell activation as well as inhibition of leukotriene synthesis or antagonism of the platelet-activating-factor receptor significantly reduced plasmin-dependent neutrophil responses. In conclusion, our data suggest that extravasated plasmin(ogen) mediates neutrophil recruitment in vivo via activation of perivascular mast cells and secondary generation of lipid mediators. Aprotinin as well as the plasmin inhibitors tranexamic acid and ε-aminocaproic acid interfere with this inflammatory cascade and effectively prevent postischemic neutrophil responses as well as remodeling events within the vessel wall. PMID:21364954
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
Synergism of antifungal activity between mitochondrial respiration inhibitors and kojic acid
USDA-ARS?s Scientific Manuscript database
Co-application of certain types of compounds with conventional antimicrobial drugs results in the enhancement of efficacy of drugs through a mechanism termed chemosensitization. We show that kojic acid (KA), a natural product, is a potent chemosensitizer to complex III inhibitors of mitochondrial re...
Mielecki, Marcin; Lesyng, Bogdan
2016-01-01
Cinnamic acid belongs to phenolic-acid class of polyphenols, one of the most abundant plant secondary metabolites. These substances are widely studied because of plethora of their biological activities. In particular, their inhibition of protein kinases contributes to the pleiotropic effects in the cell. Protein kinases are essential in controlling cell signaling networks. Selective targeting of oncogenic protein kinases increases clinical anticancer efficacy. Cinnamic acid and related compounds have inspired researchers in the design of numerous synthetic and semisynthetic inhibitors of oncogenic protein kinases for the past three decades. Interest in cinnamoyl-scaffold-containing compounds revived in recent years, which was stimulated by modern drug design and discovery methodologies such as in vitro and in silico HTS. This review presents cinnamic acid derivatives and analogs for which direct inhibition of protein kinases was identified. We also summarize significance of the above protein kinase families - validated or promising targets for anticancer therapies. The inhibition mode may vary from ATP-competitive, through bisubstrate-competitive and mixedcompetitive, to non-competitive one. Kinase selectivity is often correlated with subtle chemical modifications, and may also be steered by an additional non-cinnamoyl fragment of the inhibitor. Specific cinnamic acid congeners may synergize their effects in the cell by a wider range of activities, like suppression of additional enzymes, e.g. deubiquitinases, influencing the same signaling pathways (e.g. JAK2/STAT). Cinnamic acid, due to its biological and physicochemical properties, provides nature-inspired ideas leading to novel inhibitors of oncogenic protein kinases and related enzymes, capable to target a variety of cancer cells.
NASA Technical Reports Server (NTRS)
Zhang, Nenggang; Hasenstein, Karl H.
2002-01-01
We studied the mode of action of 4,4,4-trifluoro-3- (indole-3-) butyric acid (TFIBA), a recently described root growth stimulator, on primary root growth of Lactuca sativa L. seedlings. TFIBA (100 micromoles) promoted elongation of primary roots by 40% in 72 h but inhibited hypocotyl growth by 35%. TFIBA induced root growth was independent of pH. TFIBA did not affect ethylene production, but reduced the inhibitory effect of ethylene on root elongation. TFIBA promoted root growth even in the presence of the ethylene biosynthesis inhibitor L-alpha-(2-aminoethoxyvinyl)glycine. TFIBA and the ethylene-binding inhibitor silver thiosulphate (STS) had a similar effect on root elongation. The results indicate that TFIBA-stimulated root elongation was neither pH-dependent nor related to inhibition of ethylene synthesis, but was possibly related to ethylene action.
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Nobusawa, Takashi; Okushima, Yoko; Nagata, Noriko; Kojima, Mikiko; Sakakibara, Hitoshi; Umeda, Masaaki
2013-01-01
Plant organ growth is controlled by inter-cell-layer communication, which thus determines the overall size of the organism. The epidermal layer interfaces with the environment and participates in both driving and restricting growth via inter-cell-layer communication. However, it remains unknown whether the epidermis can send signals to internal tissue to limit cell proliferation in determinate growth. Very-long-chain fatty acids (VLCFAs) are synthesized in the epidermis and used in the formation of cuticular wax. Here we found that VLCFA synthesis in the epidermis is essential for proper development of Arabidopsis thaliana. Wild-type plants treated with a VLCFA synthesis inhibitor and pasticcino mutants with defects in VLCFA synthesis exhibited overproliferation of cells in the vasculature or in the rib zone of shoot apices. The decrease of VLCFA content increased the expression of IPT3, a key determinant of cytokinin biosynthesis in the vasculature, and, indeed, elevated cytokinin levels. These phenotypes were suppressed in ipt3;5;7 triple mutants, and also by vasculature-specific expression of cytokinin oxidase, which degrades active forms of cytokinin. Our results imply that VLCFA synthesis in the epidermis is required to suppress cytokinin biosynthesis in the vasculature, thus fine-tuning cell division activity in internal tissue, and therefore that shoot growth is controlled by the interaction between the surface (epidermis) and the axis (vasculature) of the plant body. PMID:23585732
Design and synthesis of novel 2-(indol-5-yl)thiazole derivatives as xanthine oxidase inhibitors.
Song, Jeong Uk; Choi, Sung Pil; Kim, Tae Hun; Jung, Cheol-Kyu; Lee, Joo-Youn; Jung, Sang-Hun; Kim, Geun Tae
2015-03-15
Xanthine oxidase (XO) inhibitors have been widely used for the treatment of gout. Indole rings are frequently used as active scaffold in designing inhibitors for enzymes. Herein, we describe the structure-activity relationship for novel xanthine oxidase inhibitors based on indole scaffold. A series of novel tri-substituted 2-(indol-5-yl)thiazole derivatives were synthesized, and their in vitro inhibitory activities against xanthine oxidase and in vivo efficacy lowering uric acid level in blood were measured. Among them, 2-(3-cyano-2-isopropylindol-5-yl)-4-methylthiazole-5-carboxylic acid exhibits the most potent XO inhibitory activity (IC50 value: 3.5nM) and the excellent plasma uric acid lowering activity. Study of structure activity relationship indicated that hydrophobic moiety (e.g., isopropyl) at 1-position and electron withdrawing group (e.g., CN) at 3-position of indole ring and small hydrophobic group (CH3) at 4-position of the thiazole ring enhanced the XO inhibitory activity. Hydrophobic substitution such as isopropyl at 1-position of the indole moiety without any substitution at 2-position has an essential role for enhancing bioavailability and therefore for high in vivo efficacy. Copyright © 2015 Elsevier Ltd. All rights reserved.
Skorin, C; Necochea, C; Johow, V; Soto, U; Grau, A M; Bremer, J; Leighton, F
1992-01-01
Fatty acid oxidation was studied in the presence of inhibitors of carnitine palmitoyltransferase I (CPT I), in normal and in peroxisome-proliferated rat hepatocytes. The oxidation decreased in mitochondria, as expected, but in peroxisomes it increased. These two effects were seen, in variable proportions, with (+)-decanoylcarnitine, 2-tetradecylglycidic acid (TDGA) and etomoxir. The decrease in mitochondrial oxidation (ketogenesis) affected saturated fatty acids with 12 or more carbon atoms, whereas the increase in peroxisomal oxidation (H2O2 production) affected saturated fatty acids with 8 or more carbon atoms. The peroxisomal increase was sensitive to chlorpromazine, a peroxisomal inhibitor. To study possible mechanisms, palmitoyl-, octanoyl- and acetyl-carnitine acyltransferase activities were measured, in homogenates and in subcellular fractions from control and TDGA-treated cells. The palmitoylcarnitine acyltransferase was inhibited, as expected, but the octanoyltransferase activity also decreased. The CoA derivative of TDGA was synthesized and tentatively identified as being responsible for inhibition of the octanoylcarnitine acyltransferase. These results show that inhibitors of the mitochondrial CPT I may also inhibit the peroxisomal octanoyl transferase; they also support the hypothesis that the octanoyltransferase has the capacity to control or regulate peroxisomal fatty acid oxidation. PMID:1736904
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Interleukin-1 inhibits the synthesis of collagen by fibroblasts.
Bhatnagar, R; Penfornis, H; Mauviel, A; Loyau, G; Saklatvala, J; Pujol, J P
1986-10-01
Human dermal fibroblasts, exposed to human or porcine Interleukin-1, responded by an inhibition of collagen synthesis in a dose dependent manner. Incubation with Il-1 for more than 8 h was required to see an appreciable effect. The phenomenon was not dependent on the presence of serum in the culture medium. Since a stimulation of prostaglandin E2 secretion was also observed in presence of Il-1, we investigated the eventual role of arachidonic acid metabolites in the phenomenon. Inhibitors interfering with arachidonate metabolism, namely indomethacin, acetyl salicylic acid, BW 755 C and NDGA had no influence on the inhibition of collagen synthesis caused by Il-1. These data suggest that both cyclooxygenase and lipoxygenase derived metabolites of arachidonic acid are unlikely to play a role in the mechanism.
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Fonseca, Jorge M; Rushing, James W; Rajapakse, Nihal C; Thomas, Ronald L; Riley, Melissa B
2005-05-01
The effect of harvest time, shading prior to harvest and water stress on parthenolide (PRT) concentration in feverfew and its possible connection with the abscisic acid (ABA) pathway were investigated. In plants harvested at different times of the day, acetumar the PRT levels were highest during late afternoon while ABA levels were greatest during morning hours. Shading plants during the afternoon prior to harvest caused a two-fold increase in ABA and no significant difference in PRT levels. ABA was higher in water-stressed plants while PRTcontent increased in plants following recovery from a water stress event. ABA inhibitors, norflurazon, sodium tungstate, naproxen and sodium bisulfite, were used to determine the connection between the biosynthesis of PRTand ABA. Norflurazon and naproxen reduced PRT concentration in cut flowers and in 2-month old plants. Sodium bisulfite and sodium tungstate reduced PRT only in cut flowers. Application of 2,4-D, a promoter of ABA synthesis, to potted plants resulted in a 2.5 fold increase in PRT levels. The inhibition of PRT formation in response to ABA inhibitors and the increase in PRT concentration observed with 2,4-D application indicated that PRT is derived from carotenoid synthesis similarly to ABA and not directly from farnesyl pyrosphosphate (FPP) as suggested for other sesquiterpene Lactones. However, PRT and ABA levels are affected dissimilarly by environmental conditions. The overall results of the study indicated that simple agricultural practices, such as harvesting during afternoon and subjecting plants to a single water stress event, can increase PRT concentration in the final feverfew product with no additional costs of production prior to harvest.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Curcumin Derivatives as Green Corrosion Inhibitors for α-Brass in Nitric Acid Solution
NASA Astrophysics Data System (ADS)
Fouda, A. S.; Elattar, K. M.
2012-11-01
1,7- Bis-(4-hydroxy-3-methoxy-phenyl)-hepta-1,6-diene-4-arylazo-3,5-dione I-V have been investigated as corrosion inhibitors for α-brass in 2 M nitric acid solution using weight-loss and galvanostatic polarization techniques. The efficiency of the inhibitors increases with the increase in the inhibitor concentration but decreases with a rise in temperature. The conjoint effect of the curcumin derivatives and KSCN has also been studied. The apparent activation energy ( E a*) and other thermodynamic parameters for the corrosion process have also been calculated. The galvanostatic polarization data indicated that the inhibitors were of mixed-type, but the cathode is more polarized than the anode. The slopes of the cathodic and anodic Tafel lines ( b c and b a) are maintained approximately equal for various inhibitor concentrations. However, the value of the Tafel slopes increases together as inhibitor concentration increases. The adsorption of these compounds on α-brass surface has been found to obey the Frumkin's adsorption isotherm. The mechanism of inhibition was discussed in the light of the chemical structure of the undertaken inhibitors.
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Multifunctional Cinnamic Acid Derivatives.
Peperidou, Aikaterini; Pontiki, Eleni; Hadjipavlou-Litina, Dimitra; Voulgari, Efstathia; Avgoustakis, Konstantinos
2017-07-25
Our research to discover potential new multitarget agents led to the synthesis of 10 novel derivatives of cinnamic acids and propranolol, atenolol, 1-adamantanol, naphth-1-ol, and (benzylamino) ethan-1-ol. The synthesized molecules were evaluated as trypsin, lipoxygenase and lipid peroxidation inhibitors and for their cytotoxicity. Compound 2b derived from phenoxyphenyl cinnamic acid and propranolol showed the highest lipoxygenase (LOX) inhibition (IC 50 = 6 μΜ) and antiproteolytic activity (IC 50 = 0.425 μΜ). The conjugate 1a of simple cinnamic acid with propranolol showed the higher antiproteolytic activity (IC 50 = 0.315 μΜ) and good LOX inhibitory activity (IC 50 = 66 μΜ). Compounds 3a and 3b , derived from methoxylated caffeic acid present a promising combination of in vitro inhibitory and antioxidative activities. The S isomer of 2b also presented an interesting multitarget biological profile in vitro . Molecular docking studies point to the fact that the theoretical results for LOX-inhibitor binding are identical to those from preliminary in vitro study.
Trivaric acid, a new inhibitor of PTP1b with potent beneficial effect on diabetes.
Sun, Wenlong; Zhang, Bowei; Zheng, Haizhou; Zhuang, Chunlin; Li, Xia; Lu, Xinhua; Quan, Chunshan; Dong, Yuesheng; Zheng, Zhihui; Xiu, Zhilong
2017-01-15
To screen a potential PTP1b inhibitor from the microbial origin-based compound library and to investigate the potential anti-diabetic effects of the inhibitor in vivo and determine its primary anti-diabetic mechanism in vitro and in silico. PTP1b inhibitory activity was measured using recombination protein as the enzyme and p-NPP as the substrate. The binding of the inhibitor to PTP1b was analysed by docking in silico and confirmed by ITC experiments. The intracellular signalling pathway was detected by Western blot analysis in HepG2 cells. The anti-diabetic effects were evaluated using a diabetic mice model in vivo. Among 545 microbial origin-based pure compounds tested, trivaric acid, a tridepside, was selected as a PTP1B inhibitor exhibiting strong inhibitory activity with an IC 50 of 173nM. Docking and ITC studies showed that trivaric acid was able to spontaneously bind to PTP1b and may inhibit PTP1b by blocking the catalytic domain of the phosphatase. Trivaric acid also enhanced the ability of insulin to stimulate the IR/IRS/Akt/GLUT2 pathway and increase the glucose consumption in HepG2 cells. In diabetic mice, trivaric acid that had been encapsulated into Eudrgit L100-5.5 showed significant anti-diabetic effects, improving insulin resistance, leptin resistance and lipid profile and weight control at doses of 5mg/kg and 50mg/kg. Trivaric acid is a potential lead compound in the search for anti-diabetic agents targeting PTP1b. Copyright © 2016 Elsevier Inc. All rights reserved.
Devendra, Leena P; Pandey, Ashok
2017-11-01
Acid pretreatment is the most common method employed in the lignocellulosic biorefinery leading to the separation of pentose and hexose sugar. The liquor obtained after pretreatment (acid pretreatment liquor or APL) needs to be detoxified prior to fermentation. The aim of this study was to design functional groups on a polymer matrix which are selective in their interaction to inhibitors with little or no specificity to sugars. Molecular modeling was used as a tool to design a suitable adsorbent for selective adsorption of inhibitors from a complex mixture of APL. Phenyl glycine-p-sulfonic acid loaded on chloromethylated polystyrene polymer was designed as an adsorbent for selective interaction with inhibitors. Experimental verification of the selectivity was successfully achieved. The current study provides insights on the adsorptive separation processes at the molecular level by design of specific adsorbent which can be tailor made for the better selectivity of the desired component.
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Ning, Chengqing; Bi, Yanjing; He, Yujun; Huang, WenYuan; Liu, Lifei; Li, Yi; Zhang, Sihan; Liu, Xiaoyu; Yu, Niefang
2013-12-01
A novel class of di-substituted cinnamic hydroxamic acid derivatives containing urea or thiourea unit was designed, synthesized and evaluated as HDAC inhibitors. All tested compounds demonstrated significant HDAC inhibitory activities and anti-proliferative effects against diverse human tumor cell lines. Among them, 7l exhibited most potent pan-HDAC inhibitory activity, with an IC50 value of 130 nM. It also showed strong cellular inhibition against diverse cell lines including HCT-116, MCF-7, MDB-MB-435 and NCI-460, with GI50 values of 0.35, 0.22, 0.51 and 0.48 μM, respectively. Copyright © 2013 Elsevier Ltd. All rights reserved.
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Kardash, N.V.; Egorov, V.V.; Forman, A.Y.
1986-11-01
The purpose of the present study is to ascertain the effectiveness of familiar additives and oil-soluble inhibitors under conditions of acid corrosion in comparison with their rapid action and waterreplacement efficiency, and the capacity to inhibit an electrolyte that forms in the oils, to protect against electrochemical corrosion, especially from pitting, and to reduce the mechanical-corrosion forms of wear. Characteristics of several oil-soluble corrosion inhibitors and the effectiveness of the oil-soluble inhibitors are shown. The additives M, ALOP, and MONIKA are most effective under fretting-corrosion conditions. It is shown that only the combined additives and compositions that provide for metalmore » protection in both acid and neutral media are sufficiently effective in preventing corrosion cracking, fatigue, corrosion fatigue and corrosion fretting.« less
Pyrogenicity of polyadenylic.polyuridylic acid in rabbits.
Won, S J; Lin, M T
1991-05-01
Polyadenylic.polyuridylic acid injected intravenously into rabbits produced a rapid-onset, monophasic fever. Pyrogenic tolerance occurred in rabbits following daily injections of polyadenylic.polyuridylic acid. However, direct injection of the agent into the preoptic anterior hypothalamic region of rabbit's brain produced a markedly different fever. After an intrahypothalamic injection of polyadenylic.polyuridylic acid, fever was delayed in onset and persisted for a longer period. At room temperature, the fever was due to both increased metabolism and cutaneous vasoconstriction. In a colder atmosphere the fever was due solely to increased metabolism, whereas in the heat the fever was due to reduction in cutaneous blood flow and respiratory evaporative heat loss. In addition, the fever induced by intravenous polyadenylic.polyuridylic acid injection was reversed by a cyclooxygenase inhibitor, but not by a protein synthesis inhibitor. Polyadenylic.polyuridylic acid was shown to stimulate PGE2 production from rabbit's hypothalamus in vitro. The results reveal that this agent is a prostaglandin-dependent pyrogen.
Henmi, Yuji; Oe, Natsuko; Kono, Nozomu; Taguchi, Tomohiko; Takei, Kohji; Tanabe, Kenji
2016-03-01
EHD3 is localized on the tubular structures of early endosomes, and it regulates their trafficking pathway. However, the regulatory mechanism of EHD3-containing tubular structures remains poorly understood. An in vitro liposome co-sedimentation assay revealed that EHD3 interacted with phosphatidic acid through its helical domain and this interaction induced liposomal tubulations. Additionally, inhibiting phosphatidic acid synthesis with diacylglycerol kinase inhibitor or lysophosphatidic acid acyltransferase inhibitor significantly reduced the number of EHD3-containing tubules and impaired their trafficking from early endosomes. These results suggest that EHD3 and phosphatidic acid cooperatively regulate membrane deformation and trafficking from early endosomes. Copyright © 2016 Elsevier Inc. All rights reserved.
Novel human D-amino acid oxidase inhibitors stabilize an active-site lid-open conformation
Terry-Lorenzo, Ryan T.; Chun, Lawrence E.; Brown, Scott P.; Heffernan, Michele L. R.; Fang, Q. Kevin; Orsini, Michael A.; Pollegioni, Loredano; Hardy, Larry W.; Spear, Kerry L.; Large, Thomas H.
2014-01-01
The NMDAR (N-methyl-D-aspartate receptor) is a central regulator of synaptic plasticity and learning and memory. hDAAO (human D-amino acid oxidase) indirectly reduces NMDAR activity by degrading the NMDAR co-agonist D-serine. Since NMDAR hypofunction is thought to be a foundational defect in schizophrenia, hDAAO inhibitors have potential as treatments for schizophrenia and other nervous system disorders. Here, we sought to identify novel chemicals that inhibit hDAAO activity. We used computational tools to design a focused, purchasable library of compounds. After screening this library for hDAAO inhibition, we identified the structurally novel compound, ‘compound 2’ [3-(7-hydroxy-2-oxo-4-phenyl-2H-chromen-6-yl)propanoic acid], which displayed low nM hDAAO inhibitory potency (Ki=7 nM). Although the library was expected to enrich for compounds that were competitive for both D-serine and FAD, compound 2 actually was FAD uncompetitive, much like canonical hDAAO inhibitors such as benzoic acid. Compound 2 and an analog were independently co-crystalized with hDAAO. These compounds stabilized a novel conformation of hDAAO in which the active-site lid was in an open position. These results confirm previous hypotheses regarding active-site lid flexibility of mammalian D-amino acid oxidases and could assist in the design of the next generation of hDAAO inhibitors. PMID:25001371
Seufert, Florian; Kuhn, Maximilian; Hein, Michael; Weiwad, Matthias; Vivoli, Mirella; Norville, Isobel H; Sarkar-Tyson, Mitali; Marshall, Laura E; Schweimer, Kristian; Bruhn, Heike; Rösch, Paul; Harmer, Nicholas J; Sotriffer, Christoph A; Holzgrabe, Ulrike
2016-11-01
The bacteria Burkholderia pseudomallei and Legionella pneumophila cause severe diseases like melioidosis and Legionnaire's disease with high mortality rates despite antibiotic treatment. Due to increasing antibiotic resistances against these and other Gram-negative bacteria, alternative therapeutical strategies are in urgent demand. As a virulence factor, the macrophage infectivity potentiator (Mip) protein constitutes an attractive target. The Mip proteins of B. pseudomallei and L. pneumophila exhibit peptidyl-prolyl cis/trans isomerase (PPIase) activity and belong to the PPIase superfamily. In previous studies, the pipecolic acid moiety proved to be a valuable scaffold for inhibiting this PPIase activity. Thus, a library of pipecolic acid derivatives was established guided by structural information and computational analyses of the binding site and possible binding modes. Stability and toxicity considerations were taken into account in iterative extensions of the library. Synthesis and evaluation of the compounds in PPIase assays resulted in highly active inhibitors. The activities can be interpreted in terms of a common binding mode obtained by docking calculations. Copyright © 2016 Elsevier Ltd. All rights reserved.
Yang, Bin; Lamb, Michelle L; Zhang, Tao; Hennessy, Edward J; Grewal, Gurmit; Sha, Li; Zambrowski, Mark; Block, Michael H; Dowling, James E; Su, Nancy; Wu, Jiaquan; Deegan, Tracy; Mikule, Keith; Wang, Wenxian; Kaspera, Rüdiger; Chuaqui, Claudio; Chen, Huawei
2014-12-11
KIFC1 (HSET), a member of the kinesin-14 family of motor proteins, plays an essential role in centrosomal bundling in cancer cells, but its function is not required for normal diploid cell division. To explore the potential of KIFC1 as a therapeutic target for human cancers, a series of potent KIFC1 inhibitors featuring a phenylalanine scaffold was developed from hits identified through high-throughput screening (HTS). Optimization of the initial hits combined both design-synthesis-test cycles and an integrated high-throughput synthesis and biochemical screening method. An important aspect of this integrated method was the utilization of DMSO stock solutions of compounds registered in the corporate compound collection as synthetic reactants. Using this method, over 1500 compounds selected for structural diversity were quickly assembled in assay-ready 384-well plates and were directly tested after the necessary dilutions. Our efforts led to the discovery of a potent KIFC1 inhibitor, AZ82, which demonstrated the desired centrosome declustering mode of action in cell studies.
Study on tea leaves extract as green corrosion inhibitor of mild steel in hydrochloric acid solution
NASA Astrophysics Data System (ADS)
Hamdan, A. B.; Suryanto; Haider, F. I.
2018-01-01
Corrosion inhibitor from extraction of plant has been considered as the most preferable and most chosen technique to prevent corrosion of metal in acidic medium because of the environmental friendly factor. In this study, black tea leaves extraction was tested as corrosion inhibitor for mild steel in 0.1M of hydrochloric acid (HCl) with the absence and presence of corrosion inhibitor. The efficiency and effectiveness of black tea as corrosion inhibitor was tested by using corrosion weight loss measurement experiment was carried out with varies parameters which with different concentration of black tea extract solution. The extraction of black tea solution was done by using aqueous solvent method. The FT-IR result shows that black tea extract containing compounds such as catechin, caffeine and tannins that act as anti-corrosive reagents and responsible to enhance the effectiveness of black tea extract as corrosion inhibitor by forming the hydrophobic thin film through absorption process. As a result of weight loss measurement, it shows that loss in weight of mild steel reduces as the concentration of inhibitor increases. The surface analysis was done on the mild steel samples by using SEM.
Yao, Jiangwei; Bruhn, David F.; Frank, Matthew W.; Lee, Richard E.; Rock, Charles O.
2016-01-01
Neisseria is a Gram-negative pathogen with phospholipids composed of straight chain saturated and monounsaturated fatty acids, the ability to incorporate exogenous fatty acids, and lipopolysaccharides that are not essential. The FabI inhibitor, AFN-1252, was deployed as a chemical biology tool to determine whether Neisseria can bypass the inhibition of fatty acid synthesis by incorporating exogenous fatty acids. Neisseria encodes a functional FabI that was potently inhibited by AFN-1252. AFN-1252 caused a dose-dependent inhibition of fatty acid synthesis in growing Neisseria, a delayed inhibition of growth phenotype, and minimal inhibition of DNA, RNA, and protein synthesis, showing that its mode of action is through inhibiting fatty acid synthesis. Isotopic fatty acid labeling experiments showed that Neisseria encodes the ability to incorporate exogenous fatty acids into its phospholipids by an acyl-acyl carrier protein-dependent pathway. However, AFN-1252 remained an effective antibacterial when Neisseria were supplemented with exogenous fatty acids. These results demonstrate that extracellular fatty acids are activated by an acyl-acyl carrier protein synthetase (AasN) and validate type II fatty acid synthesis (FabI) as a therapeutic target against Neisseria. PMID:26567338
Gueguen, Geneviéve; Granci, Virginie; Rogalle, Pierre; Briand-Mésange, Fabienne; Wilson, Michéle; Klaébé, Alain; Tercé, François; Chap, Hugues; Salles, Jean-Pierre; Simon, Marie-Françoise; Gaits, Frédérique
2002-12-01
A previous study demonstrated that cross-desensitization experiments performed with the lysophosphatidic acid (LPA) analogues (R)- and (S)-N-palmitoyl-norleucinol 1-phosphate (PNPAs) inhibited LPA-induced platelet aggregation without any stereospecificity. Here we report opposite biological effects of the two enantiomers on mitogenesis of IMR-90 fibroblasts in relation to their respective metabolism. (R)PNPA was proliferative, while (S)PNPA induced apoptosis by specifically inhibiting phosphatidylcholine biosynthesis at the last step of the CDP-choline pathway controlled by cholinephosphotransferase. This effect was not direct but required dephosphorylation of PNPAs by ecto-lipid phosphate phosphatase before cellular uptake of the generated N-palmitoyl-norleucinols (PNOHs). Inhibition of cholinephosphotransferase by the derivative (S)PNOH was confirmed by an in vitro assay. (S)PNPA proapoptotic effects led us to clarify the mechanism linking cholinephosphotransferase inhibition to apoptosis. Three proapoptotic responses were observed: the activation of caspase-3, the production of ceramides from newly synthesized pools (as demonstrated by the inhibitor Fumonisin B1) and finally the activation of stress-activated protein kinase, p38 and c-Jun N-terminal kinases 1/2, as a result of ceramide increase. Thus our data demonstrate that synthetic analogues of LPA might display stereospecific effects leading to apoptosis independently of classical LPA-activated pathways.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Sagar, Sneha R; Agarwal, Jessica K; Pandya, Dhaivat H; Dash, Ranjeet Prasad; Nivsarkar, Manish; Vasu, Kamala K
2015-10-15
We report the design, synthesis, biological activity and docking studies of series of novel pyrazolo[3,4-d]pyrimidinones as DPP-IV inhibitors in diabetes. Molecules were synthesized and evaluated for their DPP-IV inhibition activity. Compounds 5e, 5k, 5o and 6a were found to be potent inhibitors of DPP-IV enzyme. Amongst all the synthesized compounds, 6-methyl-5-(4-methylpyridin-2-yl)-1-phenyl-1H-pyrazolo[3,4-d]pyrimidin-4(5H)-one (5k) was found to be the most active based on in vitro DPP-IV studies and also exhibited promising in vivo blood glucose lowering activity in male Wistar rats. Copyright © 2015. Published by Elsevier Ltd.
Ashraf, Zaman; Rafiq, Muhammad; Nadeem, Humaira; Hassan, Mubashir; Afzal, Samina; Waseem, Muhammad; Afzal, Khurram; Latip, Jalifah
2017-01-01
The present work describesthe development of highly potent mushroom tyrosinase inhibitor better than the standard kojic acid. Carvacrol derivatives 4a-f and 6a-d having substituted benzoic acid and cinnamic acidresidues were synthesized with the aim to possess potent tyrosinase inhibitory activity.The structures of the synthesized compounds were ascertained by their spectroscopic data (FTIR, 1HNMR, 13CNMR and Mass Spectroscopy).Mushroom tyrosinase inhibitory activity of synthesized compounds was determined and it was found that one of the derivative 6c possess higher activity (IC50 0.0167μM) than standard kojic acid (IC50 16.69μM). The derivatives 4c and 6b also showed good tyrosinase inhibitory activity with (IC50 16.69μM) and (IC50 16.69μM) respectively.Lineweaver-Burk and Dixon plots were used for the determination of kinetic mechanism of the compounds 4c and 6b and 6c. The kinetic analysis revealed that compounds 4c and 6b showed mixed-type inhibition while 6c is a non-competitive inhibitor having Ki values19 μM, 10 μM, and 0.05 μMrespectively. The enzyme inhibitory kinetics further showed thatcompounds 6b and 6c formed irreversible enzyme inhibitor complex while 4c bind reversibly with mushroom tyrosinase.The docking studies showed that compound 6c have maximum binding affinity against mushroom tyrosinase (PDBID: 2Y9X) with binding energy value (-7.90 kcal/mol) as compared to others.The 2-hydroxy group in compound 6c interacts with amino acid HIS85 which is present in active binding site. The wet lab results are in good agreement with the dry lab findings.Based upon our investigation we may propose that the compound 6c is promising candidate for the development of safe cosmetic agent.
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Effects of fatty acid amide hydrolase (FAAH) inhibitors on working memory in rats.
Panlilio, Leigh V; Thorndike, Eric B; Nikas, Spyros P; Alapafuja, Shakiru O; Bandiera, Tiziano; Cravatt, Benjamin F; Makriyannis, Alexandros; Piomelli, Daniele; Goldberg, Steven R; Justinova, Zuzana
2016-05-01
Manipulations of the endocannabinoid system could potentially produce therapeutic effects with minimal risk of adverse cannabis-like side effects. Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of the cannabinoid-receptor agonist, anandamide, and show promise for treating a wide range of disorders. However, their effects on learning and memory have not been fully characterized. We determined the effects of five structurally different FAAH inhibitors in an animal model of working memory known to be sensitive to impairment by delta-9 tetrahydrocannabinol (THC). A delayed nonmatching-to-position procedure was used in rats. Illuminated nosepoke holes were used to provide sample cues (left versus right) and record responses (correct versus incorrect) after delays ranging from 0 to 28 s. Various test drugs were given acutely up to two times per week before daily sessions. One FAAH inhibitor, AM3506 (3 mg/kg), decreased accuracy in the memory task. Four other FAAH inhibitors (URB597, URB694, PF-04457845, and ARN14633) and a monoacylglycerol lipase inhibitor (JZL184, which blocks the degradation of the endocannabinoid 2-arachidonoylglycerol) had no effect. Testing of AM3506 in combination with antagonists for receptors known to be affected by anandamide and other fatty acid amides indicated that the impairment induced by AM3506 was mediated by cannabinoid CB1 receptors, and not by alpha-type peroxisome proliferator-activated receptors (PPAR-alpha) or vanilloid transient receptor potential cation channels (TRPV1). FAAH inhibitors differ with respect to their potential for memory impairment, abuse liability, and probably other cannabis-like effects, and they should be evaluated individually for specific therapeutic and adverse effects.
Effects of fatty acid amide hydrolase (FAAH) inhibitors on working memory in rats
Panlilio, Leigh V.; Thorndike, Eric B.; Nikas, Spyros P.; Alapafuja, Shakiru O.; Bandiera, Tiziano; Cravatt, Benjamin F.; Makriyannis, Alexandros; Piomelli, Daniele; Goldberg, Steven R.; Justinova, Zuzana
2015-01-01
Rationale Manipulations of the endocannabinoid system could potentially produce therapeutic effects with minimal risk of adverse cannabis-like side effects. Inhibitors of fatty acid amide hydrolase (FAAH) increase endogenous levels of the cannabinoid-receptor agonist, anandamide, and show promise for treating a wide range of disorders. However, their effects on learning and memory have not been fully characterized. Objectives We determined the effects of five structurally different FAAH inhibitors in an animal model of working memory known to be sensitive to impairment by delta-9 tetrahydrocannabinol (THC). Methods A delayed nonmatching-to-position procedure was used in rats. Illuminated nosepoke holes were used to provide sample cues (left versus right) and record responses (correct versus incorrect) after delays ranging from 0-28 seconds. Various test drugs were given acutely up to two times per week before daily sessions. Results One FAAH inhibitor, AM3506 (3 mg/kg), decreased accuracy in the memory task. Four other FAAH inhibitors (URB597, URB694, PF-04457845, and ARN14633) and a monoacylglycerol lipase inhibitor (JZL184, which blocks the degradation of the endocannabinoid 2-arachidonoylglycerol) had no effect. Testing of AM3506 in combination with antagonists for receptors known to be affected by anandamide and other fatty-acid amides indicated that the impairment induced by AM3506 was mediated by cannabinoid CB1 receptors, and not by alpha-type peroxisome proliferator-activated receptors (PPAR-alpha) or vanilloid transient receptor potential cation channels (TRPV1). Conclusions FAAH inhibitors differ with respect to their potential for memory impairment, abuse liability, and probably other cannabis-like effects, and they should be evaluated individually for specific therapeutic and adverse effects. PMID:26558620
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
González-Olvera, Rodrigo; Román-Rodríguez, Viridiana; Negrón-Silva, Guillermo E; Espinoza-Vázquez, Araceli; Rodríguez-Gómez, Francisco Javier; Santillan, Rosa
2016-02-22
An efficient one-pot synthesis of 1,2,3-triazole derivatives of dihydropyrimidinones has been developed using two multicomponent reactions. The aldehyde-1,2,3-triazoles were obtained in good yields from in situ-generated organic azides and O-propargylbenzaldehyde. The target heterocycles were synthesized through the Biginelli reaction in which the aldehyde-1,2,3-triazoles reacted with ethyl acetoacetate and urea in the presence of Ce(OTf)₃ as the catalyst. The corrosion inhibition of steel grade API 5 L X52 in 1 M HCl by the synthesized compounds was investigated using the electrochemical impedance spectroscopy technique. The measurements revealed that these heterocycles are promising candidates to inhibit acidic corrosion of steel.
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Structure-based mechanism of lipoteichoic acid synthesis by Staphylococcus aureus LtaS
Lu, Duo; Wörmann, Mirka E.; Zhang, Xiaodong; Schneewind, Olaf; Gründling, Angelika; Freemont, Paul S.
2009-01-01
Staphylococcus aureus synthesizes polyglycerol-phosphate lipoteichoic acid (LTA) from phosphatidylglycerol. LtaS, a predicted membrane protein with 5 N-terminal transmembrane helices followed by a large extracellular part (eLtaS), is required for staphylococcal growth and LTA synthesis. Here, we report the first crystal structure of the eLtaS domain at 1.2-Å resolution and show that it assumes a sulfatase-like fold with an α/β core and a C-terminal part composed of 4 anti-parallel β-strands and a long α-helix. Overlaying eLtaS with sulfatase structures identified active site residues, which were confirmed by alanine substitution mutagenesis and in vivo enzyme function assays. The cocrystal structure with glycerol-phosphate and the coordination of a Mn2+ cation allowed us to propose a reaction mechanism, whereby the active site threonine of LtaS functions as nucleophile for phosphatidylglycerol hydrolysis and formation of a covalent threonine–glycerolphosphate intermediate. These results will aid in the development of LtaS-specific inhibitors for S. aureus and many other Gram-positive pathogens. PMID:19168632
Synthesis, antimalarial properties, and SAR studies of alkoxyurea-based HDAC inhibitors.
Hansen, Finn K; Skinner-Adams, Tina S; Duffy, Sandra; Marek, Linda; Sumanadasa, Subathdrage D M; Kuna, Krystina; Held, Jana; Avery, Vicky M; Andrews, Katherine T; Kurz, Thomas
2014-03-01
Histone deacetylase (HDAC) inhibitors are an emerging class of potential antimalarial drugs. We investigated the antiplasmodial properties of 16 alkoxyurea-based HDAC inhibitors containing various cap and zinc binding groups (ZBGs). Ten compounds displayed sub-micromolar activity against the 3D7 line of Plasmodium falciparum. Structure-activity relationship studies revealed that a hydroxamic acid ZBG is crucial for antiplasmodial activity, and that the introduction of bulky alkyl substituents to cap groups increases potency against asexual blood-stage parasites. We also demonstrate that selected compounds cause hyperacetylation of P. falciparum histone H4, indicating inhibition of one or more PfHDACs. To assess the selectivity of alkoxyurea-based HDAC inhibitors for parasite over normal mammalian cells, the cytotoxicity of representative compounds was evaluated against neonatal foreskin fibroblast (NFF) cells. The most active compound, 6-((3-(4-(tert-butyl)phenyl)ureido)oxy)-N-hydroxyhexanamide (1 e, Pf3D7 IC50 : 0.16 μM) was 31-fold more toxic against the asexual blood stages than towards normal mammalian cells. Moreover, a subset of four structurally diverse HDAC inhibitors revealed moderate activity against late-stage (IV-V) gametocytes. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Recent developments in trans-sialidase inhibitors of Trypanosoma cruzi.
Kashif, Muhammad; Moreno-Herrera, Antonio; Lara-Ramirez, Edgar E; Ramírez-Moreno, Esther; Bocanegra-García, Virgilio; Ashfaq, Muhammad; Rivera, Gildardo
2017-07-01
Chagas is a lethal chronic disease that currently affects 8-10 million people worldwide, primarily in South and Central America. Trypanosoma cruzi trans-sialidase is an enzyme that is of vital importance for the survival of the parasite due to its key role in the transfer of sialic acid from the host to the parasite surface and it also helps the parasite combat the host's immune system. This enzyme has no equivalent human enzyme; thus, it has become an interesting target for the development of inhibitors that combat the parasite. In this review, we summarize three classes of inhibitors (acceptor, donor and unrelated) with their inhibition values and their mode of action against this enzyme. Based on molecular docking, molecular dynamics and structure-activity relationship studies, it has been discovered that the molecules with -NH 2 , -OH and -COOH groups on an aromatic ring could be used as a scaffold for the development of new and potent trans-sialidase inhibitors due to their key interaction with active enzyme sites. In particular, carboxylic acid derivatives have importance over the sugar moiety due to their ease of synthesis and unique structure-activity relationship.
Tsai, Ting-Yueh; Yeh, Teng-Kuang; Chen, Xin; Hsu, Tsu; Jao, Yu-Chen; Huang, Chih-Hsiang; Song, Jen-Shin; Huang, Yu-Chen; Chien, Chia-Hui; Chiu, Jing-Huai; Yen, Shih-Chieh; Tang, Hung-Kuan; Chao, Yu-Sheng; Jiaang, Weir-Torn
2010-09-23
Fibroblast activation protein (FAP) belongs to the prolyl peptidase family. FAP inhibition is expected to become a new antitumor target. Most known FAP inhibitors often resemble the dipeptide cleavage products, with a boroproline at the P1 site; however, these inhibitors also inhibit DPP-IV, DPP-II, DPP8, and DPP9. Potent and selective FAP inhibitor is needed in evaluating that FAP as a therapeutic target. Therefore, it is important to develop selective FAP inhibitors for the use of target validation. To achieve this, optimization of the nonselective DPP-IV inhibitor 8 led to the discovery of a new class of substituted 4-carboxymethylpyroglutamic acid diamides as FAP inhibitors. SAR studies resulted in a number of FAP inhibitors having IC(50) of <100 nM with excellent selectivity over DPP-IV, DPP-II, DPP8, and DPP9 (IC(50) > 100 μM). Compounds 18a, 18b, and 19 are the only known potent and selective FAP inhibitors, which prompts us to further study the physiological role of FAP.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Rashid, Davood; Panda, B P; Vohora, Divya
2015-11-01
Neurosteroids, such as testosterone and their metabolites, are known to modulate neuronal excitability. The enzymes regulating the metabolism of these neurosteroids, thus, may be targeted as a noval strategy for the development of new antiepileptic drugs. The present work targeted two such enzymes i,e aromatase and 5α-reductase in order to explore the potential of letrozole (an aromatase inhibitor) on pentylenetetrazole (PTZ)-induced kindling in mice and the ability of finasteride (a 5α-reductase inhibitor) to modulate any such effects. PTZ (30 mg/kg, i.p.), when administered once every two days (for a total of 24 doses) induced kindling in Swiss albino mice. Letrozole (1 mg/kg, p.o.), administered prior to PTZ, significantly reduced the % incidence of kindling, delayed mean onset time of seizures and reduced seizure severity score. Letrozole reduced the levels of plasma 17β-estradiol after induction of kindling. The concurrent administration of finasteride and letrozole produced effects similar to letrozole on PTZ-kindling and on estradiol levels. This implies that the ability of letrozole to redirect the synthesis of dihydrotestosterone (DHT) and 5α-androstanediol from testosterone doesn't appear to play a significant role in the protective effects of letrozole against PTZ kindling. Letrozole, however, increased the levels of 5α-DHT in mice plasma. The aromatase inhibitors, thus, may be exploited for inhibiting the synthesis of proconvulsant (17β-estradiol) and/or redirecting the synthesis of anticonvulsant (DHT and 5α-androstanediol) neurosteroids. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ieda, Naoya; Yamada, Sota; Kawaguchi, Mitsuyasu; Miyata, Naoki; Nakagawa, Hidehiko
2016-06-15
Histone deacetylases (HDACs) are involved in epigenetic control of the expression of various genes by catalyzing deacetylation of ε-acetylated lysine residues. Here, we report the design, synthesis and evaluation of the (7-diethylaminocoumarin-4-yl)methyl ester of suberoylanilide hydroxamic acid (AC-SAHA) as a caged HDAC inhibitor, which releases the known pan-HDAC inhibitor SAHA upon cleavage of the photolabile (7-diethylaminocoumarin-4-yl)methyl protecting group in response to photoirradiation. A key advantage of AC-SAHA is that the caged derivative itself shows essentially no HDAC-inhibitory activity. Upon photoirradiation, AC-SAHA decomposes to SAHA and a 7-diethylaminocoumarin derivative, together with some minor products. We confirmed that AC-SAHA inhibits HDAC in response to photoirradiation in vitro by means of chemiluminescence assay. AC-SAHA also showed photoinduced inhibition of proliferation of human colon cancer cell line HCT116, as determined by MTT assay. Thus, AC-SAHA should be a useful tool for spatiotemporally controlled inhibition of HDAC activity, as well as a candidate chemotherapeutic reagent for human colon cancer. Copyright © 2016 The Authors. Published by Elsevier Ltd.. All rights reserved.
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
Beauchêne, C; Martins-Héricher, J; Denis, D; Martin, L; Maillard, H
2018-05-04
Episodes of acquired bradykinin-mediated angioedema due to angiotensin-converting enzyme (ACE) inhibitors may result in fatal outcomes. There is no consensus regarding emergency pharmacological management of these episodes. Treatment options include icatibant and C1INH concentrate. Tranexamic acid is administered for moderate episodes. Its efficacy in the treatment of ACE inhibitor-induced episodes of angioedema is not established. The aim of this retrospective study is to assess the benefits of emergency tranexamic acid administration in the management of ACE inhibitor-induced episodes of angioedema. Retrospective analysis of the medical files of patients who consulted between 2010 and 2016 in two French tertiary care hospitals for a bradykinic angioedema attributed to an ACE treatment. All of them had received tranexamic acid as a first line treatment. Thirty three patients who had experienced severe episode of angioedema were included. Twenty seven patients showed significant improvement when treated with tranexamic acid alone. The six remaining patients were treated with icatibant (5/33) or C1INH concentrate (1/33), due to partial improvement after tranexamic acid therapy. None of the patients were intubated, no fatalities were recorded and no side effects were reported. Tranexamic acid is an easily accessible and affordable therapy that may provide effective treatment for ACE inhibitor-induced episodes of angioedema. It may help while waiting for a more specific treatment (icatibant and C1INH concentrate) that is at times unavailable in emergency departments. Copyright © 2018 Société Nationale Française de Médecine Interne (SNFMI). Published by Elsevier SAS. All rights reserved.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Zhang, Jie; Sasaki, Tatsunori; Li, Wei; Nagata, Kazuya; Higai, Koji; Feng, Feng; Wang, Jian; Cheng, Maosheng; Koike, Kazuo
2018-04-15
Considerable attention has been paid to protein tyrosine phosphatase 1B (PTP1B) inhibitors as a potential therapy for diabetes, obesity, and cancer. Ten caffeoylquinic acid derivatives (1-10) from leaves of Artemisia princeps Pamp. (Asteraceae) were identified as natural PTP1B inhibitors. Among them, chlorogenic acid (3) showed the most potent inhibitory activity (IC 50 11.1 μM). Compound 3 was demonstrated to be a noncompetitive inhibitor by a kinetic analysis. Molecular docking simulation suggested that compound 3 bound to the allosteric site of PTP1B. Furthermore, compound 3 showed remarkable selectivity against four homologous PTPs. According to these findings, compound 3 might be potentially valuable for further drug development. Copyright © 2018 Elsevier Ltd. All rights reserved.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
DOE Office of Scientific and Technical Information (OSTI.GOV)
Saini, Nipun; Black, Paul N.; Montefusco, David
The inhibition of the fatty acid uptake into non-adipose tissues provides an attractive target for prevention of lipotoxicity leading to obesity-associated non-alcoholic fatty liver disease and type 2 diabetes. Fatty acid transport proteins (FATPs) are bifunctional proteins involved in the uptake and activation of fatty acids by esterification with coenzyme A. Here we characterize Grassofermata/CB5, previously identified as a fatty acid uptake inhibitor directed against HsFATP2. The compound was effective in inhibiting the uptake of fatty acids in the low micro-molar range (IC{sub 50} 8–11 μM) and prevented palmitate-mediated lipid accumulation and cell death in cell lines that are models formore » intestines, liver, muscle and pancreas. In adipocytes, uptake inhibition was less effective (IC{sub 50} 58 μM). Inhibition was specific for long chain fatty acids and was ineffective toward medium chain fatty acids, which are transported by diffusion. Kinetic analysis of Grassofermata-dependent FA transport inhibition verified a non-competitive mechanism. By comparison with Grassofermata, several atypical antipsychotic drugs previously implicated as inhibitors of FA uptake were ineffectual. In mice Grassofermata decreased absorption of {sup 13}C-oleate demonstrating its potential as a therapeutic agent. - Highlights: • Grassofermata is a small compound inhibitor of FATP2. • Uptake inhibition is specific for long chain fatty acids. • Uptake kinetics shows low specificity for adipocytes compared to other cell types. • Inhibition is by a non-competitive mechanism. • Atypical antipsychotics do not inhibit FA uptake by comparison with Grassofermata.« less
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Acetobixan, an Inhibitor of Cellulose Synthesis Identified by Microbial Bioprospecting
Xia, Ye; Lei, Lei; Brabham, Chad; Stork, Jozsef; Strickland, James; Ladak, Adam; Gu, Ying; Wallace, Ian; DeBolt, Seth
2014-01-01
In plants, cellulose biosynthesis is an essential process for anisotropic growth and therefore is an ideal target for inhibition. Based on the documented utility of small-molecule inhibitors to dissect complex cellular processes we identified a cellulose biosynthesis inhibitor (CBI), named acetobixan, by bio-prospecting among compounds secreted by endophytic microorganisms. Acetobixan was identified using a drug-gene interaction screen to sift through hundreds of endophytic microbial secretions for one that caused synergistic reduction in root expansion of the leaky AtcesA6prc1-1 mutant. We then mined this microbial secretion for compounds that were differentially abundant compared with Bacilli that failed to mimic CBI action to isolate a lead pharmacophore. Analogs of this lead compound were screened for CBI activity, and the most potent analog was named acetobixan. In living Arabidopsis cells visualized by confocal microscopy, acetobixan treatment caused CESA particles localized at the plasma membrane (PM) to rapidly re-localize to cytoplasmic vesicles. Acetobixan inhibited 14C-Glc uptake into crystalline cellulose. Moreover, cortical microtubule dynamics were not disrupted by acetobixan, suggesting specific activity towards cellulose synthesis. Previous CBI resistant mutants such as ixr1-2, ixr2-1 or aegeus were not cross resistant to acetobixan indicating that acetobixan targets a different aspect of cellulose biosynthesis. PMID:24748166
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Redova, Martina; Chlapek, Petr; Loja, Tomas; Zitterbart, Karel; Hermanova, Marketa; Sterba, Jaroslav; Veselska, Renata
2010-02-01
We investigated the possible modulation by LOX/ COX inhibitors of all-trans retinoic acid (ATRA)-induced cell differentiation in two established neuroblastoma cell lines, SH-SY5Y and SK-N-BE(2). Caffeic acid, as an inhibitor of 5-lipoxygenase, and celecoxib, as an inhibitor of cyclooxygenase-2, were chosen for this study. The effects of the combined treatment with ATRA and LOX/COX inhibitors on neuroblastoma cells were studied using cell morphology assessment, detection of differentiation markers by immunoblotting, measurement of proliferation activity, and cell cycle analysis and apoptosis detection by flow cytometry. The results clearly demonstrated the potential of caffeic acid to enhance ATRA-induced cell differentiation, especially in the SK-N-BE(2) cell line, whereas application of celecoxib alone or with ATRA led predominantly to cytotoxic effects in both cell lines. Moreover, the higher sensitivity of the SK-N-BE(2) cell line to combined treatment with ATRA and LOX/COX inhibitors suggests that cancer stem cells are a main target for this therapeutic approach. Nevertheless, further detailed study of the phenomenon of enhanced cell differentiation by expression profiling is needed.
Unique response of lung acetyl-CoA carboxylase to inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Patterson, C.E.; Davis, K.S.; Rhoades, R.A.
1986-05-01
Fatty acid synthesis (FAS) in lung is not inhibited by c-AMP analogs or aminophylline although these agents inhibit FAS in other lipogenic tissues. To further characterize FAS in lung, the authors examined the response of cultured fetal lung explants to known inhibitors of FAS in liver: t-butyl benzoic acid (tBB-which binds CoA and inhibits acetyl-CoA carboxylase) and palmitate (an allosteric effector of acetyl-CoA carboxylase). Explants derived from d18 fetuses (term=22d) were cultured 2d in F12k media containing 10mM lactate, 2mM glucose, and 10mM Hepes. At 48h, FAS was determined by incubation with /sup 3/H/sub 2/O (control = 3892 +/- 755more » nmoles C2 units/g/h) and surfactant lipid production estimated by incorporation of /sup 14/C-choline into DSPC (control = 35.8 +/- 9.0 nmoles/g/h). Addition of tBB (50uM) did not significantly alter FAS or choline incorporation. Addition of palmitate (0.15mM) in either ethanol (1% final conc.) or albumin (3% final conc.) did not result in diminished FAS. Palmitate did increase DSPC labeling 20%, indicating that in these cultures the rate of surfactant synthesis is partially dependent upon palmitate availability. These data show that lung is unique in its unresponsiveness to various inhibitors of FAS which act at the level acetyl-CoA carboxylase and suggest that FAS is maintained in order to insure a de novo palmitate supply for surfactant lipid synthesis.« less
Comparative pathogenesis of haloacetic acid and protein kinase inhibitor embryotoxicity in mouse whole embryo culture.
Ward KW, Rogers EH, Hunter ES 3rd.
Curriculum in Toxicology, University of North Carolina at Chapel Hill, 27599-7270, USA.
Haloacetic acids ...
A Two-Step Synthesis of Virstatin, a Virulence Inhibitor of "Vibrio cholerae"
ERIC Educational Resources Information Center
McDonald, Chriss E.
2009-01-01
Virstatin, an "N"-butanoic acid substituted naphthalimide, inhibits the ability of "Vibrio cholerae" to cause disease. A three-week experiment involving synthesis, purification, and spectral characterization of this compound is described. This experiment is appropriate for organic chemistry. It has been performed with three lab sections of about…
Delekta, Phillip C; Shook, John C; Lydic, Todd A; Mulks, Martha H; Hammer, Neal D
2018-03-26
Methicillin-resistant Staphylococcus aureus (MRSA) is a threat to global health. Consequently, much effort has focused on the development of new antimicrobials that target novel aspects of S. aureus physiology. Fatty acids are required to maintain cell viability, and bacteria synthesize fatty acids using the type II fatty acid synthesis pathway (FASII). FASII is significantly different from human fatty acid synthesis, underscoring the therapeutic potential of inhibiting this pathway. However, many Gram-positive pathogens incorporate exogenous fatty acids, bypassing FASII inhibition and leaving the clinical potential of FASII inhibitors uncertain. Importantly, the source(s) of fatty acids available to pathogens within the host environment remains unclear. Fatty acids are transported throughout the body by lipoprotein particles in the form of triglycerides and esterified cholesterol. Thus, lipoproteins, such as low-density lipoprotein (LDL) represent a potentially rich source of exogenous fatty acids for S. aureus during infection. We sought to test the ability of LDLs to serve as a fatty acid source for S. aureus and show that cells cultured in the presence of human LDLs demonstrate increased tolerance to the FASII inhibitor, triclosan. Using mass spectrometry, we observed that host-derived fatty acids present in the LDLs are incorporated into the staphylococcal membrane and that tolerance to triclosan is facilitated by the fatty acid kinase A, FakA, and Geh, a triacylglycerol lipase. Finally, we demonstrate that human LDLs support the growth of S. aureus fatty acid auxotrophs. Together, these results suggest that human lipoprotein particles are a viable source of exogenous fatty acids for S. aureus during infection. IMPORTANCE Inhibition of bacterial fatty acid synthesis is a promising approach to combating infections caused by S. aureus and other human pathogens. However, S. aureus incorporates exogenous fatty acids into its phospholipid bilayer. Therefore, the
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Zhou, Weibo; Han, Wan Fang; Landree, Leslie E; Thupari, Jagan N; Pinn, Michael L; Bililign, Tsion; Kim, Eun Kyoung; Vadlamudi, Aravinda; Medghalchi, Susan M; El Meskini, Rajaa; Ronnett, Gabriele V; Townsend, Craig A; Kuhajda, Francis P
2007-04-01
Fatty acid synthase (FAS), the enzyme responsible for the de novo synthesis of fatty acids, is highly expressed in ovarian cancers and most common human carcinomas. Inhibition of FAS and activation of AMP-activated protein kinase (AMPK) have been shown to be cytotoxic to human cancer cells in vitro and in vivo. In this report, we explore the cytotoxic mechanism of action of FAS inhibition and show that C93, a synthetic FAS inhibitor, increases the AMP/ATP ratio, activating AMPK in SKOV3 human ovarian cancer cells, which leads to cytotoxicity. As a physiologic consequence of AMPK activation, acetyl-CoA carboxylase (ACC), the rate-limiting enzyme of fatty acid synthesis, was phosphorylated and inhibited whereas glucose oxidation was increased. Despite these attempts to conserve energy, the AMP/ATP ratio increased with worsening cellular redox status. Pretreatment of SKOV3 cells with compound C, an AMPK inhibitor, substantially rescued the cells from C93 cytotoxicity, indicating its dependence on AMPK activation. 5-(Tetradecyloxy)-2-furoic acid, an ACC inhibitor, did not activate AMPK despite inhibiting fatty acid synthesis pathway activity and was not significantly cytotoxic to SKOV3 cells. This indicates that substrate accumulation from FAS inhibition triggering AMPK activation, not end-product depletion of fatty acids, is likely responsible for AMPK activation. C93 also exhibited significant antitumor activity and apoptosis against SKOV3 xenografts in athymic mice without significant weight loss or cytotoxicity to proliferating cellular compartments such as bone marrow, gastrointestinal tract, or skin. Thus, pharmacologic FAS inhibition selectively activates AMPK in ovarian cancer cells, inducing cytotoxicity while sparing most normal human tissues from the pleiotropic effects of AMPK activation.
Grolla, Ambra A; Podestà, Valeria; Chini, Maria Giovanna; Di Micco, Simone; Vallario, Antonella; Genazzani, Armando A; Canonico, Pier Luigi; Bifulco, Giuseppe; Tron, Gian Cesare; Sorba, Giovanni; Pirali, Tracey
2009-05-14
HDAC inhibitors show great promise for the treatment of cancer. As part of a broader effort to explore the SAR of HDAC inhibitors, synthesis, biological evaluation, and molecular docking of novel Ugi products containing a zinc-chelating moiety are presented. One compound shows improved inhibitory potencies compared to SAHA, demonstrating that hindered lipophilic residues grafted on the peptide scaffold of the alpha-aminoacylamides can be favorable in the interaction with the enzyme.
Kawamura, O; Shimoyama, Y; Hosaka, H; Kuribayashi, S; Maeda, M; Nagoshi, A; Zai, H; Kusano, M
2011-05-01
Gastro-esophageal reflux disease (GERD)-related chronic cough (CC) may have multifactorial causes. To clarify the characteristics of esophagopharyngeal reflux (EPR) events in CC patients whose cough was apparently influenced by gastro-esophageal reflux (GER), we studied patients with CC clearly responding to full-dose proton pump inhibitor (PPI) therapy (CC patients). Ten CC patients, 10 GERD patients, and 10 healthy controls underwent 24-h ambulatory pharyngo-esophageal impedance and pH monitoring. Weakly acidic reflux was defined as a decrease of pH by >1 unit with a nadir pH >4. In six CC patients, monitoring was repeated after 8 weeks of PPI therapy. The number of each EPR event and the symptom association probability (SAP) were calculated. Symptoms were evaluated by a validated GERD symptom questionnaire. Weakly acidic gas EPR and swallowing-induced acidic/weakly acidic EPR only occurred in CC patients, and the numbers of such events was significantly higher in the CC group than in the other two groups (P < 0.05, respectively). Symptom association probability analysis revealed a positive association between GER and cough in three CC patients. Proton pump inhibitor therapy abolished swallowing-induced acidic/weakly acidic EPR, reduced weakly acidic gas EPR, and improved symptoms (all P < 0.05). Most patients with CC responding to PPI therapy had weakly acidic gas EPR and swallowing-induced acidic/weakly acidic EPR. A direct effect of acidic mist or liquid refluxing into the pharynx may contribute to chronic cough, while cough may also arise indirectly from reflux via a vago-vagal reflex in some patients. © 2011 Blackwell Publishing Ltd.
Concurrent protein synthesis is required for in vivo chitin synthesis in postmolt blue crabs
DOE Office of Scientific and Technical Information (OSTI.GOV)
Horst, M.N.
1990-12-01
Chitin synthesis in crustaceans involves the deposition of a protein-polysaccharide complex at the apical surface of epithelial cells which secrete the cuticle or exoskeleton. The present study involves an examination of in vivo incorporation of radiolabeled amino acids and amino sugars into the cuticle of postmolt blue crabs, Callinectes sapidus. Rates of incorporation of both 3H leucine and 3H threonine were linear with respect to time of incubation. Incorporation of 3H threonine into the endocuticle was inhibited greater than 90% in the presence of the protein synthesis inhibitor, puromycin. Linear incorporation of 14C glucosamine into the cuticle was also demonstrated;more » a significant improvement of radiolabeling was achieved by using 14C-N-acetylglucosamine as the labeled precursor. Incorporation of 3H-N-acetylglucosamine into the cuticle of postmolt blue crabs was inhibited 89% by puromycin, indicating that concurrent protein synthesis is required for the deposition of chitin in the blue crab. Autoradiographic analysis of control vs. puromycin-treated crabs indicates that puromycin totally blocks labeling of the new endocuticle with 3H glucosamine. These results are consistent with the notion that crustacean chitin is synthesized as a protein-polysaccharide complex. Analysis of the postmolt and intermolt blue crab cuticle indicates that the exoskeleton contains about 60% protein and 40% chitin. The predominant amino acids are arginine, glutamic acid, alanine, aspartic acid, and threonine.« less
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Greiner, C; Hörnig, C; Rossi, A; Pergola, C; Zettl, H; Schubert-Zsilavecz, M; Steinhilber, D; Sautebin, L; Werz, O
2011-01-01
BACKGROUND AND PURPOSE 5-Lipoxygenase (5-LO) is the key enzyme in the biosynthesis of pro-inflammatory leukotrienes (LTs) representing a potential target for pharmacological intervention with inflammation and allergic disorders. Although many LT synthesis inhibitors are effective in simple in vitro test systems, they frequently fail in vivo due to lack of efficacy. Here, we attempted to assess the pharmacological potential of the previously identified 5-LO inhibitor 2-(4-(biphenyl-4-ylamino)-6-chloropyrimidin-2-ylthio)octanoic acid (HZ52). EXPERIMENTAL APPROACH We evaluated the efficacy of HZ52 in vivo using carrageenan-induced pleurisy in rats and platelet-activating factor (PAF)-induced lethal shock in mice. We also characterized 5-LO inhibition by HZ52 at the cellular and molecular level in comparison with other types of 5-LO inhibitor, that is, BWA4C, ZM230487 and hyperforin. KEY RESULTS HZ52, 1.5 mg·kg−1 i.p., prevented carrageenan-induced pleurisy accompanied by reduced LTB4 levels and protected mice (10 mg·kg−1, i.p.) against PAF-induced shock. Detailed analysis in cell-based and cell-free assays revealed that inhibition of 5-LO by HZ52 (i) does not depend on radical scavenging properties and is reversible; (ii) is not impaired by an increased peroxide tone or by elevated substrate concentrations; and (iii) is little affected by the cell stimulus or by phospholipids, glycerides, membranes or Ca2+. CONCLUSIONS AND IMPLICATIONS HZ52 is a promising new type of 5-LO inhibitor with efficacy in vivo and with a favourable pharmacological profile. It possesses a unique 5-LO inhibitory mechanism different from classical 5-LO inhibitors and seemingly lacks the typical disadvantages of former classes of LT synthesis blockers. PMID:21506958
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
Schoch, Guillaume A.; Nikov, Georgi N.; Alworth, William L.; Werck-Reichhart, Danièle
2002-01-01
The cinnamate (CA) 4-hydroxylase (C4H) is a cytochrome P450 that catalyzes the second step of the main phenylpropanoid pathway, leading to the synthesis of lignin, pigments, and many defense molecules. Salicylic acid (SA) is an essential trigger of plant disease resistance. Some plant species can synthesize SA from CA by a mechanism not yet understood. A set of specific inhibitors of the C4H, including competitive, tight-binding, mechanism-based irreversible, and quasi-irreversible inhibitors have been developed with the main objective to redirect cinnamic acid to the synthesis of SA. Competitive inhibitors such as 2-hydroxy-1-naphthoic acid and the heme-coordinating compound 3-(4-pyridyl)-acrylic acid allowed strong inhibition of C4H activity in a tobacco (Nicotiana tabacum cv Bright Yellow [BY]) cell suspension culture. This inhibition was however rapidly relieved either because of substrate accumulation or because of inhibitor metabolism. Substrate analogs bearing a methylenedioxo function such as piperonylic acid (PIP) or a terminal acetylene such as 4-propynyloxybenzoic acid (4PB), 3-propynyloxybenzoic acid, and 4-propynyloxymethylbenzoic acid are potent mechanism-based inactivators of the C4H. PIP and 4PB, the best inactivators in vitro, were also efficient inhibitors of the enzyme in BY cells. Inhibition was not reversed 46 h after cell treatment. Cotreatment of BY cells with the fungal elicitor β-megaspermin and PIP or 4PB led to a dramatic increase in SA accumulation. PIP and 4PB do not trigger SA accumulation in nonelicited cells in which the SA biosynthetic pathway is not activated. Mechanism-based C4H inactivators, thus, are promising tools for the elucidation of the CA-derived SA biosynthetic pathway and for the potentiation of plant defense. PMID:12376665
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
HALOACETIC ACIDS AND KINASE INHIBITORS PERTURB MOUSE NEURAL CREST CELLS IN VITRO
HUNTER, E.S.1, J. SMITH2, J. ANDREWS1. 1 Reproductive Toxicology Division, NHEERL, US EPA, Research Triangle Park and 2 Department of Cell and Developmental Biology, UNC-CH, Chapel Hill, North Carolina. Haloacetic acids and kinase inhibitors perturb mouse neural crest cells in vi...
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Studies on the Role of RNA Synthesis in Auxin Induction of Cell Enlargement 1
Nooden, Larry D.
1968-01-01
Selective inhibitors were used to study the connection between nucleic acid synthesis and indoleacetic acid (IAA) induction of cell enlargement. Actinomycin D (act D) and azaguanine (azaG) almost completely inhibit IAA-induced growth in aged artichoke tuber disks when they are added simultaneously with IAA. In contrast, when they are added 24 hours after the hormone, these inhibitors have little or no effect on the induced growth which continues for 48 hours or more with little or no inhibition. Inhibitors of protein synthesis still stop growth when applied 24 hours after the IAA, thus protein synthesis and presumably supporting metabolism are still essential. In corn coleoptile sections auxin-induced growth did not show any pronounced tendency to become less sensitive to act D as the IAA treatment progressed. Act D did not completely inhibit the response to IAA unless the sections were pretreated with act D for 6 hours. In contrast to act D, cordycepin produced almost complete inhibition of IAA-induced growth when added with the IAA. Although IAA has a very large and very rapid stimulatory effect (within 10 min) on incorporation of 32P-orthophosphate into RNA in disks, it did not cause a detectable change in the base composition of the RNA synthesized. Furthermore, the promotive effect could be accounted for through increased uptake of the 32P. That much of the RNA synthesis in these tissues is not necessary for auxin action is indicated by the results with fluorouracil (FU). FU strongly inhibits RNA synthesis, probably acting preferentially on ribosomal RNA synthesis, without inhibiting auxin-induced growth in the disks or coleoptile sections. FU also strongly inhibited respiration in auxin-treated disks indicating that the large promotion of respiration by auxin likewise may not be entirely necessary for growth. At least in the artichoke disks, RNA synthesis is required for auxin induction of cell enlargement and not for cell enlargement itself. The possible
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
Saeed, Aamer; Mahesar, Parvez Ali; Zaib, Sumera; Khan, Muhammad Siraj; Matin, Abdul; Shahid, Mohammad; Iqbal, Jamshed
2014-05-06
The present study reports the synthesis of cinnamide derivatives and their biological activity as inhibitors of both cholinesterases and anticancer agents. Controlled inhibition of brain acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) may slow neurodegeneration in Alzheimer's diseases (AD). The anticholinesterase activity of phenylcinnamide derivatives was determined against Electric Eel acetylcholinesterase (EeAChE) and horse serum butyrylcholinesterase (hBChE) and some of the compounds appeared as moderately potent inhibitors of EeAChE and hBChE. The compound 3-(2-(Benzyloxy)phenyl)-N-(3,4,5-trimethoxyphenyl)acrylamide (3i) showed maximum activity against EeAChE with an IC50 0.29 ± 0.21 μM whereas 3-(2-chloro-6-nitrophenyl)-N-(3,4,5-trimethoxyphenyl)acrylamide (3k) was proved to be the most potent inhibitor of hBChE having IC50 1.18 ± 1.31 μM. To better understand the enzyme-inhibitor interaction of the most active compounds toward cholinesterases, molecular modelling studies were carried out on high-resolution crystallographic structures. The anticancer effects of synthesized compounds were also evaluated against cancer cell line (lung carcinoma). The compounds may be useful leads for the design of a new class of anticancer drugs for the treatment of cancer and cholinesterase inhibitors for Alzheimer's disease (AD). Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Huang, Tengfang; Jander, Georg
2017-10-01
Whereas proline accumulates through de novo biosynthesis in plants subjected to osmotic stress, leucine, isoleucine, and valine accumulation in drought-stressed Arabidopsis thaliana is caused by abscisic acid-regulated protein degradation. In response to several kinds of abiotic stress, plants greatly increase their accumulation of free amino acids. Although stress-induced proline increases have been studied the most extensively, the fold-increase of other amino acids, in particular branched-chain amino acids (BCAAs; leucine, isoleucine, and valine), is often higher than that of proline. In Arabidopsis thaliana (Arabidopsis), BCAAs accumulate in response to drought, salt, mannitol, polyethylene glycol, herbicide treatment, and nitrogen starvation. Plants that are deficient in abscisic acid signaling accumulate lower amounts of BCAAs, but not proline and most other amino acids. Previous bioinformatic studies had suggested that amino acid synthesis, rather than protein degradation, is responsible for the observed BCAA increase in osmotically stressed Arabidopsis. However, whereas treatment with the protease inhibitor MG132 decreased drought-induced BCAA accumulation, inhibition of BCAA biosynthesis with the acetolactate synthase inhibitors chlorsulfuron and imazapyr did not. Additionally, overexpression of BRANCHED-CHAIN AMINO ACID TRANSFERASE2 (BCAT2), which is upregulated in response to osmotic stress and functions in BCAA degradation, decreased drought-induced BCAA accumulation. Together, these results demonstrate that BCAA accumulation in osmotically stressed Arabidopsis is primarily the result of protein degradation. After relief of the osmotic stress, BCAA homeostasis is restored over time by amino acid degradation involving BCAT2. Thus, drought-induced BCAA accumulation is different from that of proline, which is accumulated due to de novo synthesis in an abscisic acid-independent manner and remains elevated for a more prolonged period of time after removal of
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
Amino derivatives of glycyrrhetinic acid as potential inhibitors of cholinesterases.
Schwarz, Stefan; Lucas, Susana Dias; Sommerwerk, Sven; Csuk, René
2014-07-01
The development of remedies against the Alzheimer's disease (AD) is one of the biggest challenges in medicinal chemistry nowadays. Although not completely understood, there are several strategies fighting this disease or at least bringing some relief. During the progress of AD, the level of acetylcholine (ACh) decreases; hence, a therapy using inhibitors should be of some benefit to the patients. Drugs presently used for the treatment of AD inhibit the two ACh controlling enzymes, acetylcholinesterase as well as butyrylcholinesterase; hence, the design of selective inhibitors is called for. Glycyrrhetinic acid seems to be an interesting starting point for the development of selective inhibitors. Although its glycon, glycyrrhetinic acid is known for being an AChE activator, several derivatives, altered in position C-3 and C-30, exhibited remarkable inhibition constants in micro-molar range. Furthermore, five representative compounds were subjected to three more enzyme assays (on carbonic anhydrase II, papain and the lipase from Candida antarctica) to gain information about the selectivity of the compounds in comparison to other enzymes. In addition, photometric sulforhodamine B assays using murine embryonic fibroblasts (NiH 3T3) were performed to study the cytotoxicity of these compounds. Two derivatives, bearing either a 1,3-diaminopropyl or a 1H-benzotriazolyl residue, showed a BChE selective inhibition in the single-digit micro-molar range without being cytotoxic up to 30μM. In silico molecular docking studies on the active sites of AChE and BChE were performed to gain a molecular insight into the mode of action of these compounds and to explain the pronounced selectivity for BChE. Copyright © 2014 Elsevier Ltd. All rights reserved.
Al-Amiery, Ahmed A; Binti Kassim, Fatin A; Kadhum, Abdul Amir H; Mohamad, Abu Bakar
2016-01-22
The acid corrosion inhibition process of mild steel in 1 M HCl by azelaic acid dihydrazide has been investigated using electrochemical impedance spectroscopy (EIS), potentiodynamic polarization, open circuit potential (OCP) and electrochemical frequency modulation (EFM). Azelaic acid dihydrazide was synthesized, and its chemical structure was elucidated and confirmed using spectroscopic techniques (infrared, nuclear magnetic resonance and mass spectroscopy). Potentiodynamic polarization studies indicate that azelaic acid dihydrazide is a mixed-type inhibitor. The inhibition efficiency increases with increased inhibitor concentration and reaches its maximum of 93% at 5 × 10(-3) M. The adsorption of the inhibitor on a mild steel surface obeys Langmuir's adsorption isotherm. The effect of te perature on corrosion behavior in the presence of 5 × 10(-3) M inhibitor was studied in the temperature range of 30-60 °C. The results indicated that inhibition efficiencies were enhanced with an increase in concentration of inhibitor and decreased with a rise in temperature. To inspect the surface morphology of inhibitor film on the mild steel surface, scanning electron microscopy (SEM) was used before and after immersion in 1.0 M HCl.
X-ray crystal structure of plasmin with tranexamic acid-derived active site inhibitors.
Law, Ruby H P; Wu, Guojie; Leung, Eleanor W W; Hidaka, Koushi; Quek, Adam J; Caradoc-Davies, Tom T; Jeevarajah, Devadharshini; Conroy, Paul J; Kirby, Nigel M; Norton, Raymond S; Tsuda, Yuko; Whisstock, James C
2017-05-09
The zymogen protease plasminogen and its active form plasmin perform key roles in blood clot dissolution, tissue remodeling, cell migration, and bacterial pathogenesis. Dysregulation of the plasminogen/plasmin system results in life-threatening hemorrhagic disorders or thrombotic vascular occlusion. Accordingly, inhibitors of this system are clinically important. Currently, tranexamic acid (TXA), a molecule that prevents plasminogen activation through blocking recruitment to target substrates, is the most widely used inhibitor for the plasminogen/plasmin system in therapeutics. However, TXA lacks efficacy on the active form of plasmin. Thus, there is a need to develop specific inhibitors that target the protease active site. Here we report the crystal structures of plasmin in complex with the novel YO ( trans -4-aminomethylcyclohexanecarbonyl-l-tyrosine- n -octylamide) class of small molecule inhibitors. We found that these inhibitors form key interactions with the S1 and S3' subsites of the catalytic cleft. Here, the TXA moiety of the YO compounds inserts into the primary (S1) specificity pocket, suggesting that TXA itself may function as a weak plasmin inhibitor, a hypothesis supported by subsequent biochemical and biophysical analyses. Mutational studies reveal that F587 of the S' subsite plays a key role in mediating the inhibitor interaction. Taken together, these data provide a foundation for the future development of small molecule inhibitors to specifically regulate plasmin function in a range of diseases and disorders.
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
Channar, Pervaiz Ali; Saeed, Aamer; Larik, Fayaz Ali; Rafiq, Muhammad; Ashraf, Zaman; Jabeen, Farukh; Fattah, Tanzeela Abdul
2017-11-01
The present article describes the synthesis and enzyme inhibitory kinetics of methyl[2-(arylmethylene-hydrazono)-4-oxo-thiazolidin-5-ylidene]acetates 5a-j as mushroom tyrosinase inhibitors. The title compounds were synthesized via cyclocondensation of thiosemicarbazones 3a-j with dimethyl but-2-ynedioate (DMAD) 4 in good yields under solvent-free conditions. The synthesized compounds were evaluated for their potential to inhibit the activity of mushroom tyrosinase. It was unveiled that compounds 5i showed excellent enzyme inhibitory activity with IC 50 3.17µM while IC 50 of standard kojic acid is 15.91µM. The presence of heterocyclic pyridine ring in compound 5i play important role in enzyme inhibitory activity as rest of the functional groups are common in all synthesized compounds. The enzyme inhibitory kinetics of the most potent derivative 5i determined by Lineweaver-Burk plots and Dixon plots showed that it is non-competitive inhibitor with Ki value 1.5µM. It was further investigated that the wet lab results are in good agreement with the computational results. The molecular docking of the synthesized compounds was performed against tyrosinase protein (PDBID 2Y9X) to delineate ligand-protein interactions at molecular level. The docking results showed that the major interacting residues are His244, His85, His263, Val 283, His 296, Asn260, Val248, His260, His261 and Phe264 which are located in active binding site of the protein. The molecular modeling demonstrates that the oxygen atom of the compound 5i coordinated with the key residues in the active site of mushroom tyrosinase contribute significantly against inhibitory ability and diminishing the human melanin synthesis. These results evident that compound 5i is a lead structure in developing most potent mushroom tyrosinase inhibitors. Copyright © 2017 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
Peters, Godefridus J
2018-05-03
The pyrimidine de novo nucleotide synthesis consists of 6 sequential steps. Various inhibitors against these enzymes have been developed and evaluated in the clinic for their potential anticancer activity: acivicin inhibits carbamoyl-phosphate-synthase-II, N-(phosphonacetyl)-L- aspartate (PALA) inhibits aspartate-transcarbamylase, Brequinar sodium and dichloroallyl-lawsone (DCL) inhibit dihydroorotate-dehydrogenase, and pyrazofurin (PF) inhibits orotate-phosphoribosyltransferase. We compared their growth inhibition against 3 cell lines from head-and-neck-cancer (HEP-2, UMSCC-14B and UMSCC-14C) and related the sensitivity to their effects on nucleotide pools. In all cell lines Brequinar and PF were the most active compounds with IC50 (50% growth inhibition) values between 0.06-0.37 µM, Acivicin was as potent (IC50s 0.26-1 µM), but DCL was 20-31-fold less active. PALA was most inactive (24-128 µM). At equitoxic concentrations, all pure antipyrimidine de novo inhibitors depleted UTP and CTP after 24 hr exposure, which was most pronounced for Brequinar (between 6-10% of UTP left, and 12-36% CTP), followed by DCL and PF, which were almost similar (6-16% UTP and 12-27% CTP), while PALA was the least active compound (10-70% UTP and 13-68% CTP). Acivicin is a multi-target inhibitor of more glutamine requiring enzymes (including GMP synthetase) and no decrease of UTP was found, but a pronounced decrease in GTP (31-72% left). In conclusion, these 5 inhibitors of the pyrimidine de novo nucleotide synthesis varied considerably in their efficacy and effect on pyrimidine nucleotide pools. Inhibitors of DHO-DH were most effective suggesting a primary role of this enzyme in controlling pyrimidine nucleotide pools.
Structure-Based Design of Novel HIV-1 Protease Inhibitors to Combat Drug Resistance
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghosh,A.; Sridhar, P.; Leshchenko, S.
2006-01-01
Structure-based design and synthesis of novel HIV protease inhibitors are described. The inhibitors are designed specifically to interact with the backbone of HIV protease active site to combat drug resistance. Inhibitor 3 has exhibited exceedingly potent enzyme inhibitory and antiviral potency. Furthermore, this inhibitor maintains impressive potency against a wide spectrum of HIV including a variety of multi-PI-resistant clinical strains. The inhibitors incorporated a stereochemically defined 5-hexahydrocyclopenta[b]furanyl urethane as the P2-ligand into the (R)-(hydroxyethylamino)sulfonamide isostere. Optically active (3aS,5R,6aR)-5-hydroxy-hexahydrocyclopenta[b]furan was prepared by an enzymatic asymmetrization of meso-diacetate with acetyl cholinesterase, radical cyclization, and Lewis acid-catalyzed anomeric reduction as the key steps.more » A protein-ligand X-ray crystal structure of inhibitor 3-bound HIV-1 protease (1.35 Angstroms resolution) revealed extensive interactions in the HIV protease active site including strong hydrogen bonding interactions with the backbone. This design strategy may lead to novel inhibitors that can combat drug resistance.« less
Ogawa, Shintaro; Kunugi, Hiroshi
2015-01-01
Cannabis and analogs of Δ<sup>9</sup>-tetrahydrocannabinol have been used for therapeutic purposes, but their therapeutic use remains limited because of various adverse effects. Endogenous cannabinoids have been discovered, and dysregulation of endocannabinoid signaling is implicated in the pathophysiology of major depressive disorder (MDD). Recently, endocannabinoid hydrolytic enzymes such as fatty acid amide hydrolase (FAAH) and monoacylglycerol lipase (MAGL) have become new therapeutic targets in the treatment of MDD. Several FAAH or MAGL inhibitors are reported to have no cannabimimetic side effects and, therefore, are new potential therapeutic options for patients with MDD who are resistant to first-line antidepressants (selective serotonin and serotonin-norepinephrine reuptake inhibitors). In this review, we focus on the possible relationships between MDD and the endocannabinoid system as well as the inhibitors' therapeutic potential. MAGL inhibitors may reduce inflammatory responses through activation of cannabinoid receptor type 2. In the hypothalamic-pituitary-adrenal axis, repeated FAAH inhibitor administration may be beneficial for reducing circulating glucocorticoid levels. Both FAAH and MAGL inhibitors may contribute to dopaminergic system regulation. Recently, several new inhibitors have been developed with strong potency and selectivity. FAAH inhibitor, MAGL inhibitor, or dual blocker use would be promising new treatments for MDD. Further pre-clinical studies and clinical trials using these inhibitors are warranted.
Efficient Synthesis and Discovery of Schiff Bases as Potent Cholinesterase Inhibitors.
Razik, Basma M Abd; Osman, Hasnah; Ezzat, Mohammed O; Basiri, Alireza; Salhin, Abdussalam; Kia, Yalda; Murugaiyah, Vikneswaran
2016-01-01
The search for new cholinesterase inhibitors is still a promising approach for management of Alzheimer`s disease. Schiff bases are considered as important class of organic compounds, which have wide range of applications including as enzyme inhibitors. In the present study, a new green ionic liquid mediated strategy was developed for convenient synthesis of two series of Schiff bases 3(a-j) and 5(a-j) as potential cholinesterase inhibitors using aromatic aldehydes and primary amines in [bmim]Br. The synthesized compounds were evaluated for their acetylcholinesterase (AChE) and butyrylcholinesterase (BChE) inhibitory potential by modified Ellman's method. The molecular interactions between the most active compound and the enzyme were analyzed by molecular docking. Among them, 3j displayed higher inhibitory activities than reference drug, galanthamine, with IC50 values of 2.05 and 5.77 µM, for AChE and BChE, respectively. Interestingly, all the compounds except 3b displayed higher BChE inhibitions than galanthamine with IC50 values ranging from 5.77 to 18.52 µM. Molecular docking of compound 3j inside the TcAChE and hBChE completely coincided with the inhibitory activities observed. The compound forms strong hydrogen bonding at the peripheral anionic site of AChE whereas on BChE, it had hydrophobic and mild polar interactions. An efficient and eco-friendly synthetic methodology has been developed to synthesize Schiff bases in a very short reaction time and excellent yields in ionic solvent, whereby the compounds from series 3 showed promising cholinesterase inhibitory activity.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ghosh, Arun K.; Sean Fyvie, W.; Brindisi, Margherita
Design, synthesis, and evaluation of a new class of HIV-1 protease inhibitors containing diverse flexible macrocyclic P1'-P2' tethers are reported. Inhibitor 5a with a pyrrolidinone-derived macrocycle exhibited favorable enzyme inhibitory and antiviral activity (Ki = 13.2 nM, IC50 = 22 nM). Further incorporation of heteroatoms in the macrocyclic skeleton provided macrocyclic inhibitors 5m and 5o. These compounds showed excellent HIV-1 protease inhibitory (Ki = 62 pM and 14 pM, respectively) and antiviral activity (IC50 = 5.3 nM and 2.0 nM, respectively). Inhibitor 5o also remained highly potent against a DRV-resistant HIV-1 variant.
Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Sharma, Sandeep; Verslues, Paul E
2016-10-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1 pro :LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1 pro :LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1 pro :LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1 pro :LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4 These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. © 2016 American Society of Plant Biologists. All Rights Reserved.
Maheshwari, Neelesh; Karthikeyan, Chandrabose; Bhadada, Shraddha V; Sahi, Chandan; Verma, Amit K; Hari Narayana Moorthy, N S; Trivedi, Piyush
2018-06-08
Described herein is the synthesis and biological evaluation of a series of non-carboxylic inhibitors of Protein Tyrosine Phosphatase 1B designed using bioisosteric replacement strategy. Six N-(3-(1H-tetrazol-5-yl)phenyl)acetamide derivatives designed employing the aforementioned strategy were synthesized and screened for PTP1B inhibitory activity. Among the synthesized compounds, compound NM-03 exhibited the most potent inhibitory activity with IC 50 value of 4.48 µM. Docking studies with NM-03 revealed the key interactions with desired amino acids in the binding site of PTP1B. Furthermore, compound NM-03 also elicited good in vivo activity. Taken together, the results of this study establish N-(3-(1H-tetrazole-5-yl)phenyl)-2-(benzo[d]oxazol-2-ylthio)acetamide (NM-03) as a valuable lead molecule with great potential for PTP1B inhibitor development targeting diabetes. Copyright © 2018 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
Ogino, Masaki; Nakada, Yoshihisa; Negoro, Nobuyuki; Itokawa, Shigekazu; Nishimura, Satoshi; Sanada, Tsukasa; Satomi, Tomoko; Kita, Shunbun; Kubo, Kazuki; Marui, Shogo
2011-01-01
As a part of our research for novel potent and orally available acyl-CoA: cholesterol acyltransferase (ACAT) inhibitors that can be used as anti-atherosclerotic agents, we recently reported the discovery of the (4-phenylcoumarine)acetanilide derivative 1. However, compound 1 showed adrenal toxicity in animal models. In order to search for safer ACAT inhibitors that do not have adrenal toxicity, we examined the inhibitory activity of ACAT in human macrophage and adrenal cells. The introduction of a carboxylic acid moiety on the pendant phenyl ring and the adjustment of the lipophilicity led to the discovery of (2E)-3-[7-chloro-3-[2-[[4-fluoro-2-(trifluoromethyl)phenyl]amino]-2-oxoethyl]-6-methyl-2-oxo-2H-chromen-4-yl]phenyl]acrylic acid (21e), which showed potent ACAT inhibitory activity in macrophages and a selectivity of around 30-fold over adrenal cells. In addition, compound 21e showed high adrenal safety in guinea pigs.
Wani, Naiem Ahmad; Singh, Samsher; Farooq, Saleem; Shankar, Sudha; Koul, Surrinder; Khan, Inshad Ali; Rai, Rajkishor
2016-09-01
A total of eighteen piperic acid (PA) and 4-ethylpiperic acid (EPA) amides (C1-C18) with α-, β- and γ-amino acids were synthesized, characterized and evaluated for their efflux pump inhibitory activity against ciprofloxacin resistant Staphylococcus aureus. The amides were screened against NorA overexpressing S. aureus SA-1199B and wild type S. aureus SA-1199 using ethidium bromide as NorA efflux pump substrate. EPI C6 was found to be most potent and reduced the MIC of ciprofloxacin by 16 fold followed by C18 which showed 4 fold reduction of MIC. Ethidium bromide efflux inhibition and accumulation assay proved these compounds as NorA inhibitors. Copyright © 2016 Elsevier Ltd. All rights reserved.
Fujita, Kazuhiko; Otsuka, Takanobu; Yamamoto, Naohiro; Kainuma, Shingo; Ohguchi, Reou; Kawabata, Tetsu; Sakai, Go; Kuroyanagi, Gen; Matsushima-Nishiwaki, Rie; Kozawa, Osamu; Tokuda, Haruhiko
2017-07-01
Chlorogenic acid (CGA) is a primary phenolic component of coffee and (-)-epigallocatechin gallate (EGCG) is a primary flavonoid component of green tea, both of which have been documented to possess beneficial health properties. A previous study by the present authors demonstrated that p38 mitogen-activated protein kinase (MAPK) may be associated with osteoprotegerin synthesis stimulated by bone morphogenetic protein-4 (BMP-4) in osteoblast-like MC3T3-E1 cells. In the present study, the effects of CGA and EGCG on BMP-4-stimulated osteoprotegerin synthesis in MC3T3-E1 cells were investigated. It was observed that CGA had no effect on osteoprotegerin release stimulated by BMP-4, whereas EGCG significantly enhanced BMP-4-stimulated osteoprotegerin release (P=0.003). Levels of osteoprotegerin mRNA expression induced by BMP-4 were also significantly increased by EGCG (P=0.03). By contrast, EGCG had no significant effect on phosphorylation of Smad1 or p38 MAPK induced by BMP-4. In addition, EGCG had little effect on BMP-induced phosphorylation of p70 S6 kinase; however rapamycin, as an inhibitor of p70 S6 kinase, significantly suppressed osteoprotegerin release (P=0.007). These data suggest that EGCG but not CGA may upregulate the synthesis of osteoprotegerin induced by BMP-4 in osteoblasts.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Aitken, H; Poyser, N L
2001-01-01
The outputs of PGF(2 alpha), PGE2 and 6-keto-PGF(1 alpha)were similar from the day 22 guinea-pig placenta and sub-placenta in culture, except for PGE2 output from the sub-placenta which was lower. Between days 22 and 29 of pregnancy, the outputs of PGF(2 alpha), PGE2 and 6-keto-PGF(1 alpha)during the initial 2 h culture period increased 6.9-, 1.1- and 3.2-fold, respectively, from the placenta, and 2.1-, 1.4- and 2.2-fold, respectively, from the sub-placenta. Therefore, there was a relatively specific increase in PGF(2 alpha)production by the guinea-pig placenta between days 22 and 29 of pregnancy. The output of PGFM from the cultured placenta also increased between days 22 and 29, indicating that the increase in PGF(2 alpha)output was due to increased synthesis rather than to decreased metabolism. By comparing the amounts of prostaglandins produced by tissue homogenates during a 1 h incubation period, it appears that there is approximately a 2-fold increase in the amount of prostaglandin H synthase (PGHS) present in the guinea-pig placenta between days 22 and 29. NS-398 (a specific inhibitor of PGHS-2) and indomethacin (an inhibitor of both PGHS-1 and PGHS-2) both inhibited prostaglandin production by homogenates of day 22 and day 29 placenta. Indomethacin was more effective than NS-398, except for their actions on PGF(2 alpha)production by the day 29 placenta where indomethacin and NS-398 were equiactive. Indomethacin and NS-398 were both very effective at inhibiting the outputs of PGF(2 alpha), PGE2 and 6-keto-PGF(1 alpha)from the day 22 and day 29 placenta and sub-placenta in culture, indicating that prostaglandin production by the guinea-pig placenta and sub-placenta in culture is largely dependent upon the activity of PGHS-2. The high production of PGF(2 alpha)by the day 29 placenta is not dependent on the continual synthesis of fresh protein(s), as inhibitors of protein synthesis did not reduce PGF(2 alpha)output from the day 29 guinea-pig placenta in culture
de Oliveira Lopes, Raquel; Romeiro, Nelilma Correia; de Lima, Cleverton Kleiton F; Louback da Silva, Leandro; de Miranda, Ana Luisa Palhares; Nascimento, Paulo Gustavo B D; Cunha, Fernando Q; Barreiro, Eliezer J; Lima, Lídia Moreira
2012-08-01
p38 mitogen-activated protein kinase (p38 MAPK) is an important signal transducing enzyme involved in many cellular regulations, including signaling pathways, pain and inflammation. Several p38 MAPK inhibitors have been developed as drug candidates to treatment of autoimmune disorders, such as rheumatoid arthritis. In this paper we reported the docking, synthesis and pharmacological activity of novel urea-derivatives (4a-e) designed as p38 MAPK inhibitors. These derivatives presented good theoretical affinity to the target p38 MAPK, standing out compound 4e (LASSBio-998), which showed a better score value compared to the prototype GK-00687. This compound was able to reduce in vitro TNF-α production and was orally active in a hypernociceptive murine model sensible to p38 MAPK inhibitors. Otherwise, compound 4e presented a dose-dependent analgesic effect in a model of antigen (mBSA)-induced arthritis and anti-inflammatory profile in carrageenan induced paw edema, indicating its potential as a new antiarthritis prototype. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Antibacterial properties of soap containing some fatty acid esters.
Pandey, N K; Natraj, C V; Kalle, G P; Nambudiry, M E
1985-02-01
Synopsis Chemical microbial inhibitors compatible with formulations of soaps and deodorant perfumes are more effective if they are substantive to the skin. However, highly effective inhibitors are toxic and their substantivity on skin may accentuate the toxicity. Natural compounds such as short to medium chain fatty acids and their derivatives, which are known to be germicidal, offer a viable alternative to chemical inhibitors. We report here the synthesis of sodium 2-lauroyloxy propionate and an in vivo method to test its substantivity on skin following its incorporation in soaps. Among several compounds tested, sodium 2-lauroyloxy propionate was found to be highly substantive in soap formulation.
Lee, Kyeong; Lee, Jee-Hyun; Boovanahalli, Shanthaveerappa K; Choi, Yongseok; Choo, Soo-Jin; Yoo, Ick-dong; Kim, Dong Hee; Yun, Mi Young; Lee, Gye Won; Song, Gyu-Yong
2010-12-01
We report the synthesis of a novel series of highly potent melanin inhibitors which were obtained through structural modification of an anticancer compound S-(+)-decursinol. The in vitro inhibitory potencies of the newly synthesized compounds were evaluated against α-MSH induced melanin production in B16 murine melanoma cells. Among the compounds evaluated, compounds 2, 3, 6b, 7a, 7b, 8a and 8b emerged as highly potent inhibitors of melanin production. Besides, these compounds demonstrated significantly low cytotoxicity. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Mechanism of antiinflammatory actions of curcumine and boswellic acids.
Ammon, H P; Safayhi, H; Mack, T; Sabieraj, J
1993-03-01
Curcumine from Curcuma longa and the gum resin of Boswellia serrata, which were demonstrated to act as anti-inflammatories in in vivo animal models, were studied in a set of in vitro experiments in order to elucidate the mechanism of their beneficial effects. Curcumine inhibited the 5-lipoxygenase activity in rat peritoneal neutrophils as well as the 12-lipoxygenase and the cyclooxygenase activities in human platelets. In a cell free peroxidation system curcumine exerted strong antioxidative activity. Thus, its effects on the dioxygenases are probably due to its reducing capacity. Boswellic acids were isolated from the gum resin of Boswellia serrata and identified as the active principles. Boswellic acids inhibited the leukotriene synthesis via 5-lipoxygenase, but did not affect the 12-lipoxygenase and the cyclooxygenase activities. Additionally, boswellic acids did not impair the peroxidation of arachidonic acid by iron and ascorbate. The data suggest that boswellic acids are specific, non-redox inhibitors of leukotriene synthesis either interacting directly with 5-lipoxygenase or blocking its translocation.
Short peptides containing L-lysine and epsilon-aminocaproic acid as potential plasmin inhibitors.
Purwin, M; Bruzgo, I; Markowska, A; Midura-Nowaczek, K
2009-11-01
Eight short peptides containing L-lysine and epsilon-aminocaproic acid were obtained and their effect on the amidolytic activities of plasmin, thrombin and trypsin was examined. Tripeptide amide Boc-EACA-L-Lys-EACA-NH2 was the most effective and specific plasmin inhibitor.
NASA Astrophysics Data System (ADS)
Sgrignani, Jacopo; De Luca, Filomena; Torosyan, Hayarpi; Docquier, Jean-Denis; Duan, Da; Novati, Beatrice; Prati, Fabio; Colombo, Giorgio; Grazioso, Giovanni
2016-10-01
β-Lactamases are bacterial enzymes conferring resistance to β-lactam antibiotics in clinically-relevant pathogens, and represent relevant drug targets. Recently, the identification of new boronic acids (i.e. RPX7009) paved the way to the clinical application of these molecules as potential drugs. Here, we screened in silico a library of 1400 boronic acids as potential AmpC β-lactamase inhibitors. Six of the most promising candidates were evaluated in biochemical assays leading to the identification of potent inhibitors of clinically-relevant β-lactamases like AmpC, KPC-2 and CTX-M-15. One of the selected compounds showed nanomolar K i value with the clinically-relevant KPC-2 carbapenemase, while another one exhibited broad spectrum inhibition, being also active on Enterobacter AmpC and the OXA-48 class D carbapenemase.
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
Breda, Ardala; Machado, Pablo; Rosado, Leonardo Astolfi; Souto, André Arigony; Santos, Diógenes Santiago; Basso, Luiz Augusto
2012-08-01
Tuberculosis (TB) is an ancient human chronic infectious disease caused mainly by Mycobacterium tuberculosis. The emergence of strains resistant to first and second line anti-TB drugs, associated with the increasing number of TB cases among HIV positive subjects, and the large number of individuals infected with latent bacilli have urged the development of new strategies to treat TB. Enzymes of nucleotide metabolism pathways provide promising molecular targets for the development of drugs, aiming at both active and latent TB. The orotate phosphoribosyltransferase (OPRT) enzyme catalyzes the synthesis of orotidine 5'-monophosphate from 5'-phospho-α-d-ribose 1'-diphosphate and orotic acid, in the de novo pyrimidine synthesis pathway. Based on the kinetic mechanism and molecular properties, here we describe the design, selection and synthesis of substrate analogs with inhibitory activity of M. tuberculosis OPRT (MtOPRT) enzyme. Steady-state kinetic measurements were employed to determine the mode of inhibition of commercially available and chemically derived compounds. The 6-Hydroxy-2-oxo-1,2-dihydropyridine-4-carboxylic acid (6) chemical compound and its derivative, 3-Benzylidene-2,6-dioxo-1,2,3,6-tetrahydropyridine-4-carboxylic acid (13), showed enzyme inhibition constants in the submicromolar range. Isothermal titration calorimetry data indicated that binding of both compounds to MtOPRT have negative enthalpy and favorable Gibbs free energy probably due to their high complementarity to the enzyme's binding pocket. Improvement of compound 13 hydrophobic character by addition of an aromatic ring substituent resulted in entropic optimization, reflected on a thermodynamic discrimination profile characteristic of high affinity ligands. These inhibitors represent lead compounds for further development of MtOPRT inhibitors with increased potency, which may be tested as anti-TB agents. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ogura, Hirotsugu; Tsukumo, Yoshinori; Department of Bioengineering, Tokyo Institute of Technology, 4259 Nagatsuta-cho, Midori-ku, Yokohama 226-8501
2008-04-01
The transcription factor nuclear factor {kappa}B (NF-{kappa}B) plays a major role in the inducible resistance to death receptor-mediated apoptosis. It has been established that the protein synthesis inhibitor cycloheximide (CHX) sensitizes many types of cells to tumor necrosis factor (TNF)-{alpha}-induced apoptosis, mainly due to its ability to block de novo synthesis of cellular FLICE-inhibitory protein (c-FLIP). Nevertheless, we have surprisingly found that CHX, as well as its structural analogue acetoxycycloheximide (Ac-CHX), prevents TNF-{alpha}-mediated activation of NF-{kappa}B and caspase-8 in human lung carcinoma A549 cells. Both CHX and Ac-CHX reduced the expression of cell surface TNF receptor 1 (TNF-R1) in amore » dose-dependent manner, while Ac-CHX was approximately 100-fold more effective than CHX. Consistent with this observation, Ac-CHX induced the proteolytic cleavage of TNF-R1 and its release into the culture medium. CHX and Ac-CHX profoundly decreased constitutive and inducible expression of c-FLIP, whereas these compounds potentiated TNF-{alpha}-induced caspase-8 activation only when metalloprotease inhibitors were present. Thus, our results indicate that ectodomain shedding of TNF-R1 induced by protein synthesis inhibitors regulates TNF-{alpha}-mediated activation of NF-{kappa}B and caspase-8.« less
Proton pump inhibitors reduce the size and acidity of the acid pocket in the stomach.
Rohof, Wout O; Bennink, Roelof J; Boeckxstaens, Guy E
2014-07-01
The gastric acid pocket is believed to be the reservoir from which acid reflux events originate. Little is known about how changes in position, size, and acidity of the acid pocket contribute to the therapeutic effect of proton pump inhibitors (PPIs) in patients with gastroesophageal reflux disease (GERD). Thirty-six patients with GERD (18 not taking PPIs, 18 taking PPIs; 19 men; age, 55 ± 2.1 y) were analyzed by concurrent high-resolution manometry and pH-impedance monitoring after a standardized meal. The acid pocket was visualized using scintigraphy after intravenous administration of (99m)technetium-pertechnetate. The size of the acid pocket was measured and its position was determined, relative to the diaphragm, using radionuclide markers on a high-resolution manometry catheter. At the end of the study, the acid pocket was aspirated, and its pH level was measured. The number of reflux episodes was comparable between patients on and off PPIs, but the number of acid reflux episodes was reduced significantly in patients on PPIs. In patients on PPIs, the acid pocket was smaller and more frequently located below the diaphragm. The mean pH of the acid pocket was significantly lower in patients not taking PPIs (n = 6) than in those who were (n = 16) (0.9; range, 0.7-1.2 vs 4.0; range, 1.6-5.9; P < .001). The pH of acid pockets correlated significantly with the lowest pH values measured for refluxate (r = 0.72; P < .01). Based on analyses of acid pockets in patients with GERD, the acid pocket appears to be a reservoir from which reflux occurs when patients are receiving PPIs. PPIs might affect the size, acidity, or position of the acid pocket, which contributes to the efficacy in patients with GERD. Copyright © 2014 AGA Institute. Published by Elsevier Inc. All rights reserved.
Noureldin, Nada A; Kothayer, Hend; Lashine, El-Sayed M; Baraka, Mohamed M; Huang, Yanrong; Li, Bing; Ji, Qinggang
2018-05-25
A series of (2-(1-methyl-2,4-dioxo-1,2-dihydroquinazolin-3(4H)-yl) acetamido) acids) (6 a-m), (7) has been designed to inhibit the action of fungus chitin synthase enzyme (CHS). The synthesis of the designed compounds was carried out in four steps starting from the reaction between 1-methylquinazoline-2,4(1H,3H)-dione and ethyl chloroacetate to yield the ethyl acetate derivative. This ester was hydrolyzed to the corresponding carboxylic acid derivative that was then utilized to couple several amino acids getting the final designed compounds. The synthesized compounds were tested for their inhibition against CHS. Compound 7 showed the highest potency among others with minimum inhibitory concentration (IC 50 ) of 0.166 mmol/L, while polyoxin B (the positive control) had IC 50 of 0.17 mmol/L. The synthesized compounds were also evaluated for their in vitro antifungal activity using Aspergillus fumigates, Aspergillus flavus, Crytococcus neoformans and Candida albicans. Unfortunately, the 14 synthesized compounds showed lower in vitro activity compared to the used active controls. However, compound 6m and fluconazole have synergistic effect on Aspergillus flavus; Compounds 7 and fluconazole have synergistic effects on Aspergillus fumigates. Copyright © 2018 Elsevier Masson SAS. All rights reserved.
Reciprocal effects of 5-(tetradecyloxy)-2-furoic acid on fatty acid oxidation.
Otto, D A; Chatzidakis, C; Kasziba, E; Cook, G A
1985-10-01
Under certain incubation conditions 5-(tetradecyloxy)-2-furoic acid (TOFA) stimulated the oxidation of palmitate by hepatocytes, as observed by others. A decrease in malonyl-CoA concentration accompanied the stimulation of oxidation. Under other conditions, however, TOFA inhibited fatty acid oxidation. The observed effects of TOFA depended on the TOFA and fatty acid concentrations, the cell concentration, the time of TOFA addition relative to the addition of fatty acid, and the nutritional state of the animal (fed or starved). The data indicate that only under limited incubation conditions may TOFA be used as an inhibitor of fatty acid synthesis without inhibition of fatty acid oxidation. When rat liver mitochondria were preincubated with TOFA, ketogenesis from palmitate was slightly inhibited (up to 20%) at TOFA concentrations that were less than that of CoA, but the inhibition became almost complete (up to 90%) when TOFA was greater than or equal to the CoA concentration. TOFA had only slight or no inhibitory effects on the oxidation of palmitoyl-CoA, palmitoyl(-)carnitine, or butyrate. Since TOFA can be converted to TOFyl-CoA, the data suggest that the inhibition of fatty acid oxidation from palmitate results from the decreased availability of CoA for extramitochondrial activation of fatty acids. These data, along with previous data of others, indicate that inhibition of fatty acid oxidation by CoA sequestration is a common mechanism of a group of carboxylic acid inhibitors. A general caution is appropriate with regard to the interpretation of results when using TOFA in studies of fatty acid oxidation.
Ilies, Marc A.; Scozzafava, Andrea
2000-01-01
Zinc, magnesium, aluminum and copper complexes of several potent, clinically used carbonic anhydrase (CA) sulfonamide inhibitors, such as acetazolamide, methazolamide, ethoxzolamide and benzolamide were tested for their possible applications as antacids, in experimental animals. Gastric acid secretion parameters 3 days after treatment with these CA inhibitors (2 × 500 mg, twice a day), in dogs with chronic gastric fistulas, led to the observation that the gastric acid parameters BAO (the basal acid output), and MAO (the maximal acid output after stimulation with histamine) were drastically reduced, as compared to the same parameters in animals that did not receive these enzyme inhibitors. These are promising results for the possible use of metal complexes of heterocyclic sulfonamides as treatment alternatives (alone or in combination with other drugs) for gastric acid secretion imbalances. PMID:18475926
Hajbi, Youssef; Neagoie, Cléopatra; Biannic, Bérenger; Chilloux, Aurélie; Vedrenne, Emeline; Baldeyrou, Brigitte; Bailly, Christian; Mérour, Jean-Yves; Rosca, Sorin; Routier, Sylvain; Lansiaux, Amélie
2010-11-01
New 1,5-dihydro-4-(substituted phenyl)-3H-furo[3,4-b]carbazol-3-ones were synthesised via a key step Diels-Alder reaction under microwave irradiation. 3-Formylindole was successfully used in a 6-step synthesis to obtain those complex heterocycles. The Diels-Alder reaction generating the carbazole ring was optimised under thermal conditions or microwave irradiation. After cleavage of functional groups, DNA binding, topoisomerase inhibition and cytotoxic properties of the new-formed furocarbazoles were investigated. These carbazoles do not present a strong interaction with the DNA, and do not modify the relaxation of the DNA in the presence of topoisomerase I or II except for one promising compound. This compound is a potent topoisomerase II inhibitor, and its cellular activity is not moderated compared to etoposide. The synthesis of these molecules allowed the generalisation of the method using indole and 5-OBn indole and several benzaldehydes. The synthesis of these molecules produced chemical structures endowed with promising cytotoxic and topoisomerase II inhibition activities. Copyright © 2010 Elsevier Masson SAS. All rights reserved.
Microwave-assisted synthesis of novel purine nucleosides as selective cholinesterase inhibitors.
Schwarz, S; Csuk, R; Rauter, A P
2014-04-21
Alzheimer's disease (AD), the most common form of senile dementia, is characterized by high butyrylcholinesterase (BChE) levels in the brain in later AD stages, for which no treatment is available. Pursuing our studies on selective BChE inhibitors, that may contribute to understand the role of this enzyme in disease progression, we present now microwave-assisted synthesis and anticholinesterase activity of a new nucleoside series embodying 6-chloropurine or 2-acetamido-6-chloropurine linked to D-glucosyl, D-galactosyl and D-mannosyl residues. It was designed to assess the contribution of sugar stereochemistry, purine structure and linkage to the sugar for cholinesterase inhibition efficiency and selectivity. Compounds were subjected to Ellman's assay and their inhibition constants determined. The α-anomers were the most active compounds, while selectivity for BChE or acetylcholinesterase (AChE) inhibition could be tuned by the purine base, by the glycosyl moiety and by N(7)-ligation. Some of the nucleosides were far more potent than the drug galantamine, and the most promising competitive and selective BChE inhibitor, the N(7)-linked 2-acetamido-α-D-mannosylpurine, showed a Ki of 50 nM and a selectivity factor of 340 fold for BChE over AChE.
Design, Synthesis, and Evaluation of New Tripeptides as COX-2 Inhibitors.
Vernieri, Ermelinda; Gomez-Monterrey, Isabel; Milite, Ciro; Grieco, Paolo; Musella, Simona; Bertamino, Alessia; Scognamiglio, Ilaria; Alcaro, Stefano; Artese, Anna; Ortuso, Francesco; Novellino, Ettore; Sala, Marina; Campiglia, Pietro
2013-01-01
Cyclooxygenase (COX) is a key enzyme in the biosynthetic pathway leading to the formation of prostaglandins, which are mediators of inflammation. It exists mainly in two isoforms COX-1 and COX-2. The conventional nonsteroidal anti-inflammatory drugs (NSAIDs) have gastrointestinal side effects because they inhibit both isoforms. Recent data demonstrate that the overexpression of these enzymes, and in particular of cyclooxygenases-2, promotes multiple events involved in tumorigenesis; in addition, numerous studies show that the inhibition of cyclooxygenases-2 can delay or prevent certain forms of cancer. Agents that inhibit COX-2 while sparing COX-1 represent a new attractive therapeutic development and offer a new perspective for a further use of COX-2 inhibitors. The present study extends the evaluation of the COX activity to all 20(3) possible natural tripeptide sequences following a rational approach consisting in molecular modeling, synthesis, and biological tests. Based on data obtained from virtual screening, only those peptides with better profile of affinity have been selected and classified into two groups called S and E. Our results suggest that these novel compounds may have potential as structural templates for the design and subsequent development of the new selective COX-2 inhibitors drugs.
NASA Astrophysics Data System (ADS)
Al-Amiery, Ahmed A.; Binti Kassim, Fatin A.; Kadhum, Abdul Amir H.; Mohamad, Abu Bakar
2016-01-01
The acid corrosion inhibition process of mild steel in 1 M HCl by azelaic acid dihydrazide has been investigated using electrochemical impedance spectroscopy (EIS), potentiodynamic polarization, open circuit potential (OCP) and electrochemical frequency modulation (EFM). Azelaic acid dihydrazide was synthesized, and its chemical structure was elucidated and confirmed using spectroscopic techniques (infrared, nuclear magnetic resonance and mass spectroscopy). Potentiodynamic polarization studies indicate that azelaic acid dihydrazide is a mixed-type inhibitor. The inhibition efficiency increases with increased inhibitor concentration and reaches its maximum of 93% at 5 × 10-3 M. The adsorption of the inhibitor on a mild steel surface obeys Langmuir’s adsorption isotherm. The effect of temperature on corrosion behavior in the presence of 5 × 10-3 M inhibitor was studied in the temperature range of 30-60 °C. The results indicated that inhibition efficiencies were enhanced with an increase in concentration of inhibitor and decreased with a rise in temperature. To inspect the surface morphology of inhibitor film on the mild steel surface, scanning electron microscopy (SEM) was used before and after immersion in 1.0 M HCl.
Al-Amiery, Ahmed A.; Binti Kassim, Fatin A.; Kadhum, Abdul Amir H.; Mohamad, Abu Bakar
2016-01-01
The acid corrosion inhibition process of mild steel in 1 M HCl by azelaic acid dihydrazide has been investigated using electrochemical impedance spectroscopy (EIS), potentiodynamic polarization, open circuit potential (OCP) and electrochemical frequency modulation (EFM). Azelaic acid dihydrazide was synthesized, and its chemical structure was elucidated and confirmed using spectroscopic techniques (infrared, nuclear magnetic resonance and mass spectroscopy). Potentiodynamic polarization studies indicate that azelaic acid dihydrazide is a mixed-type inhibitor. The inhibition efficiency increases with increased inhibitor concentration and reaches its maximum of 93% at 5 × 10−3 M. The adsorption of the inhibitor on a mild steel surface obeys Langmuir’s adsorption isotherm. The effect of temperature on corrosion behavior in the presence of 5 × 10−3 M inhibitor was studied in the temperature range of 30–60 °C. The results indicated that inhibition efficiencies were enhanced with an increase in concentration of inhibitor and decreased with a rise in temperature. To inspect the surface morphology of inhibitor film on the mild steel surface, scanning electron microscopy (SEM) was used before and after immersion in 1.0 M HCl. PMID:26795066
NASA Astrophysics Data System (ADS)
Luo, Caidian
1998-12-01
Common methods employed in the ethanol production from biomass consist of chemical or enzymatic degradation of biomass into sugars and then fermentation of sugars into ethanol or other chemicals. However, some degradation products severely inhibit the fermentation processes and substantially reduce the efficiency of ethanol production. How to remove inhibitors from the reaction product mixture and increase the production efficiency are critical in the commercialization of any processes of energy from biomass. The present study has investigated anion exchange and liquid-liquid extraction as potential methods for inhibitor removal. An analytical method has been developed to identify the fermentation inhibitors in a hydrolyzate. The majority of inhibitors present in hybrid poplar hydrolyzate have positively been identified. Ion exchange with weak basic Dowex-MWA-1 resin has been proved to be an effective mean to remove fermentation inhibitors from hybrid poplar hydrolyzate and significantly increase the fermentation productivity. Extraction with n-butanol might be a preferred way to remove inhibitors from wood hydrolyzates and improve the fermentability of sugars in the hydrolyzates. n-Butanol also removes some glucose, mannose and xylose from the hydrolyzate. Inhibitor identification reveals that lignin and sugar degradation compounds including both aromatic and aliphatic aldehydes and carboxylic acids formed in hydrolysis, plus fatty acids and other components from wood extractives are major fermentation inhibitors in Sacchromyces cerevisiae fermentation. There are 35 components identified as fermentation inhibitors. Among them, 4-hydroxy benzoic acid, 3,4-dihydroxy benzoic acid, syringic acid, syringaldehyde, and ferulic acid are among the most abundant aromatic inhibitors in hybrid poplar hydrolyzate. The conversion of aldehyde groups into carboxylic acid groups in the nitric acid catalyzed hydrolysis reduces the toxicity of the hydrolyzate. A wide spectrum of
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Sentein, P; Ates, Y
1978-01-01
The effects of spindle inhibitors and of protein synthesis inhibitors on segmentation mitoses allow us to classify them into six groups : 1. Colchicine type : destruction of the whole achromatic apparatus and centrospheres without storing of dense bodies; 2. Quinoline type : same effect on the achromatic apparatus, but blocked centrospheres with accumulation of dense bodies; 3. Chloralhydrate type : Incomplete destruction of achromatic apparatus, spindle residue which maintains the chromosomes in a star shape, inactive centrospheres sequestered by the reticulum, but without accumulation of dense bodies; 4. Phenylurethane type : Incomplete and reversible action, which leads to easy production of pluripolar mitoses; 5. Carboxylic acid type : dissociation of the spindle, sometimes with blocking of the centrosphere, together with profound chromosome changes without primitive breaks; the intensity and quality of their action is related to the number of carbon atoms in the acid considered; 6. Protein synthesis inhibitor type : (cycloheximide, pederin) characterized by a stop of the nuclear cycle at telo-prophase when the action is sufficient, chromosome abnormalities, sometimes, reduced to strings of beads, and freeing of asters; at weaker concentrations mitosis is possible, but the congression of chromosomes at the equator is abnormal because of functional disturbance of the kinetochores. The nature and grading of these effects, their association (or non - association) to chromosome damage, the soundness of the spindle when only the chromosomes are affected (nitrogen mustard) make this one of the tests which gives the most specific data about the action of antimitotic substances.
Discovery and Structure Enabled Synthesis of 2,6-Diaminopyrimidin-4-one IRAK4 Inhibitors
DOE Office of Scientific and Technical Information (OSTI.GOV)
Seganish, W. Michael; Fischmann, Thierry O.; Sherborne, Brad
2015-08-13
We report the identification and synthesis of a series of aminopyrimidin-4-one IRAK4 inhibitors. Through high throughput screening, an aminopyrimidine hit was identified and modified via structure enabled design to generate a new, potent, and kinase selective pyrimidin-4-one chemotype. This chemotype is exemplified by compound 16, which has potent IRAK4 inhibition activity (IC50 = 27 nM) and excellent kinase selectivity (>100-fold against 99% of 111 tested kinases), and compound 31, which displays potent IRAK4 activity (IC50 = 93 nM) and good rat bioavailability (F = 42%).
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction.
Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W; Waddell, M Brett; Guy, R Kiplin; Luthman, Kristina; Grøtli, Morten
2015-01-01
The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein-protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay.
Design, Synthesis and Evaluation of 2,5-Diketopiperazines as Inhibitors of the MDM2-p53 Interaction
Pettersson, Mariell; Quant, Maria; Min, Jaeki; Iconaru, Luigi; Kriwacki, Richard W.; Waddell, M. Brett; Guy, R. Kiplin; Luthman, Kristina; Grøtli, Morten
2015-01-01
The transcription factor p53 is the main tumour suppressor in cells and many cancer types have p53 mutations resulting in a loss of its function. In tumours that retain wild-type p53 function, p53 activity is down-regulated by MDM2 (human murine double minute 2) via a direct protein—protein interaction. We have designed and synthesised two series of 2,5-diketopiperazines as inhibitors of the MDM2-p53 interaction. The first set was designed to directly mimic the α-helical region of the p53 peptide, containing key residues in the i, i+4 and i+7 positions of a natural α-helix. Conformational analysis indicated that 1,3,6-trisubstituted 2,5-diketopiperazines were able to place substituents in the same spatial orientation as an α-helix template. The key step of the synthesis involved the cyclisation of substituted dipeptides. The other set of tetrasubstituted 2,5-diketopiperazines were designed based on structure-based docking studies and the Ugi multicomponent reaction was used for the synthesis. This latter set comprised the most potent inhibitors which displayed micromolar IC50-values in a biochemical fluorescence polarisation assay. PMID:26427060
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Acute inhibition of neurosteroid estrogen synthesis suppresses status epilepticus in an animal model
Sato, Satoru M; Woolley, Catherine S
2016-01-01
Status epilepticus (SE) is a common neurological emergency for which new treatments are needed. In vitro studies suggest a novel approach to controlling seizures in SE: acute inhibition of estrogen synthesis in the brain. Here, we show in rats that systemic administration of an aromatase (estrogen synthase) inhibitor after seizure onset strongly suppresses both electrographic and behavioral seizures induced by kainic acid (KA). We found that KA-induced SE stimulates synthesis of estradiol (E2) in the hippocampus, a brain region commonly involved in seizures and where E2 is known to acutely promote neural activity. Hippocampal E2 levels were higher in rats experiencing more severe seizures. Consistent with a seizure-promoting effect of hippocampal estrogen synthesis, intra-hippocampal aromatase inhibition also suppressed seizures. These results reveal neurosteroid estrogen synthesis as a previously unknown factor in the escalation of seizures and suggest that acute administration of aromatase inhibitors may be an effective treatment for SE. DOI: http://dx.doi.org/10.7554/eLife.12917.001 PMID:27083045
Synthesis and antitumour activity of 4-aminoquinazoline derivatives
NASA Astrophysics Data System (ADS)
Lipunova, G. N.; Nosova, E. V.; Charushin, V. N.; Chupakhin, O. N.
2016-07-01
Pieces of data on the synthesis and antitumour activity of 4-aminoquinazolines are summarized and analyzed. Key methods for the synthesis of these compounds are considered, primarily cyclocondensation of carboxylic acid derivatives, as well as the oxidation of quinazolines and the cyclization of disubstituted thioureas. Improvements of synthetic schemes for erlotinib, gefitinib and lapatinib, which are the best-known pharmaceuticals based on compounds of the title class, are also considered. Synthetic strategies and biological activities for new 4-aminoquinazoline derivatives that are EGFR-tyrosine kinase inhibitors, multiactive compounds, and labelled compounds for use as positron emission tomography (PET) imaging agents are discussed. The bibliography includes 263 references.
Du, Q S; Ma, Y; Xie, N Z; Huang, R B
2014-01-01
In the design of peptide inhibitors the huge possible variety of the peptide sequences is of high concern. In collaboration with the fast accumulation of the peptide experimental data and database, a statistical method is suggested for peptide inhibitor design. In the two-level peptide prediction network (2L-QSAR) one level is the physicochemical properties of amino acids and the other level is the peptide sequence position. The activity contributions of amino acids are the functions of physicochemical properties and the sequence positions. In the prediction equation two weight coefficient sets {ak} and {bl} are assigned to the physicochemical properties and to the sequence positions, respectively. After the two coefficient sets are optimized based on the experimental data of known peptide inhibitors using the iterative double least square (IDLS) procedure, the coefficients are used to evaluate the bioactivities of new designed peptide inhibitors. The two-level prediction network can be applied to the peptide inhibitor design that may aim for different target proteins, or different positions of a protein. A notable advantage of the two-level statistical algorithm is that there is no need for host protein structural information. It may also provide useful insight into the amino acid properties and the roles of sequence positions.
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
ERIC Educational Resources Information Center
Touaibia, Mohamed; Guay, Michel
2011-01-01
Natural products play a critical role in modern organic synthesis and learning synthetic techniques is an important component of the organic laboratory experience. In addition to traditional one-step organic synthesis laboratories, a multistep natural product synthesis is an interesting experiment to challenge students. The proposed three-step…
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Zhang, Yan; Liu, Xing-Hai; Zhan, Yi-Zhou; Zhang, Li-Yuan; Li, Zheng-Ming; Li, Yong-Hong; Zhang, Xiao; Wang, Bao-Lei
2016-10-01
A series of novel 5-substituted-1,3,4-oxadiazole Mannich bases and bis-Mannich bases have been conveniently synthesized in good yields. Their structures were characterized by IR, (1)H NMR, (13)C NMR and elemental analysis. The preliminary bioassay results indicated that some of the compounds showed promising in vitro fungicidal activities towards several test plant fungi; some of them exhibited significant herbicidal activities against Brassica campestris and excellent in vitro inhibitory activities against rice ketol-acid reductoisomerase (KARI). Among 14 novel compounds, 8c, 8d and 8m showed potent KARI inhibitory activities with Ki value of (0.96±0.42), (3.86±0.49) and (3.10±0.71) μmol/L, respectively, and were comparable with IpOHA. These compounds could be novel KARI inhibitors for further investigation. The density functional theory (DFT) calculations and molecular docking were carried out to study the structure-activity relationship (SAR) of the active inhibitors in this Letter. Copyright © 2016 Elsevier Ltd. All rights reserved.
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Fujita, Kazuhiko; Otsuka, Takanobu; Yamamoto, Naohiro; Kainuma, Shingo; Ohguchi, Reou; Kawabata, Tetsu; Sakai, Go; Kuroyanagi, Gen; Matsushima-Nishiwaki, Rie; Kozawa, Osamu; Tokuda, Haruhiko
2017-01-01
Chlorogenic acid (CGA) is a primary phenolic component of coffee and (−)-epigallocatechin gallate (EGCG) is a primary flavonoid component of green tea, both of which have been documented to possess beneficial health properties. A previous study by the present authors demonstrated that p38 mitogen-activated protein kinase (MAPK) may be associated with osteoprotegerin synthesis stimulated by bone morphogenetic protein-4 (BMP-4) in osteoblast-like MC3T3-E1 cells. In the present study, the effects of CGA and EGCG on BMP-4-stimulated osteoprotegerin synthesis in MC3T3-E1 cells were investigated. It was observed that CGA had no effect on osteoprotegerin release stimulated by BMP-4, whereas EGCG significantly enhanced BMP-4-stimulated osteoprotegerin release (P=0.003). Levels of osteoprotegerin mRNA expression induced by BMP-4 were also significantly increased by EGCG (P=0.03). By contrast, EGCG had no significant effect on phosphorylation of Smad1 or p38 MAPK induced by BMP-4. In addition, EGCG had little effect on BMP-induced phosphorylation of p70 S6 kinase; however rapamycin, as an inhibitor of p70 S6 kinase, significantly suppressed osteoprotegerin release (P=0.007). These data suggest that EGCG but not CGA may upregulate the synthesis of osteoprotegerin induced by BMP-4 in osteoblasts. PMID:28672948
Docking analysis of gallic acid derivatives as HIV-1 protease inhibitors.
Singh, Anjali; Pal, Tapan Kumar
2015-01-01
HIV-1 Protease (HIV-1 PR) enzymes are essential for accurate assembly and maturation of infectious HIV retroviruses. The significant role of HIV-1 protease in viral replication has made it a potential drug target. In the recent past, phytochemical Gallic Acid (GA) derivatives have been screened for protease inhibitor activity. The present work aims to design and evaluate potential GA-based HIV-1 PR phytoinhibitors by docking approach. The ligands were prepared by ChemDraw and docking was performed in HEX software. In this present study, one of the GA analogues (GA4) emerged as a potent drug candidate for HIV-1 PR inhibition, and docking results showed it to be comparable with anti-HIV drugs, darunavir and amprenavir. The GA4 derivative provided a lead for designing more effective HIV-1 PR inhibitors.
Identification of Broad-Based HIV-1 Protease Inhibitors From Combinatorial Libraries
Chang, Max W.; Giffin, Michael J.; Muller, Rolf; Savage, Jeremiah; Lin, Ying C.; Hong, Sukwon; Jin, Wei; Whitby, Landon R.; Elder, John H.; Boger, Dale L.; Torbett, Bruce E.
2011-01-01
Clinically approved inhibitors of HIV-1 protease function via a competitive mechanism. A particular vulnerability of competitive inhibitors is their sensitivity to increases in substrate concentration, as may occur during virion assembly, budding and processing into a mature, infectious viral particle. Advances in chemical synthesis have led to the development of new chemical libraries with high diversity using rapid in-solution syntheses. These libraries have been previously shown to be effective at disrupting protein-protein and protein-nucleic acid interfaces. We have screened 44,000 compounds from such a library to identify inhibitors of HIV-1 protease. One compound was identified that inhibits wild type protease, as well as a drug-resistant protease with 6 mutations. Moreover, analysis of this compound suggests an allosteric, non-competitive mechanism of inhibition and may represent a starting point for an additional strategy for anti-retroviral therapy. PMID:20507280
Phenylalanine and Phenylglycine Analogues as Arginine Mimetics in Dengue Protease Inhibitors.
Weigel, Lena F; Nitsche, Christoph; Graf, Dominik; Bartenschlager, Ralf; Klein, Christian D
2015-10-08
Dengue virus is an increasingly global pathogen. One of the promising targets for antiviral drug discovery against dengue and related flaviviruses such as West Nile virus is the viral serine protease NS2B-NS3. We here report the synthesis and in vitro characterization of potent peptidic inhibitors of dengue virus protease that incorporate phenylalanine and phenylglycine derivatives as arginine-mimicking groups with modulated basicity. The most promising compounds were (4-amidino)-L-phenylalanine-containing inhibitors, which reached nanomolar affinities against dengue virus protease. The type and position of the substituents on the phenylglycine and phenylalanine side chains has a significant effect on the inhibitory activity against dengue virus protease and selectivity against other proteases. In addition, the non-natural, basic amino acids described here may have relevance for the development of other peptidic and peptidomimetic drugs such as inhibitors of the blood clotting cascade.
Dow, Robert L; Andrews, Melissa P; Li, Jian-Cheng; Michael Gibbs, E; Guzman-Perez, Angel; Laperle, Jennifer L; Li, Qifang; Mather, Dawn; Munchhof, Michael J; Niosi, Mark; Patel, Leena; Perreault, Christian; Tapley, Susan; Zavadoski, William J
2013-09-01
DGAT-1 is an enzyme that catalyzes the final step in triglyceride synthesis. mRNA knockout experiments in rodent models suggest that inhibitors of this enzyme could be of value in the treatment of obesity and type II diabetes. The carboxylic acid-based DGAT-1 inhibitor 1 was advanced to clinical trials for the treatment of type 2 diabetes, despite of the low passive permeability of 1. Because of questions relating to the potential attenuation of distribution and efficacy of a poorly permeable agent, efforts were initiated to identify compounds with improved permeability. Replacement of the acid moiety in 1 with an oxadiazole led to the discovery of 52, which possesses substantially improved passive permeability. The resulting pharmacodynamic profile of this neutral DGAT-1 inhibitor was found to be similar to 1 at comparable plasma exposures. Copyright © 2013 Elsevier Ltd. All rights reserved.
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
NASA Astrophysics Data System (ADS)
Hu, Xiuqin; Wang, Disha; Tong, Yi; Tong, Linjiang; Wang, Xia; Zhu, Lili; Xie, Hua; Li, Shiliang; Yang, You; Xu, Yufang
2017-11-01
The synthesis of a series of ribose-modified anilinopyrimidine derivatives was efficiently achieved by utilizing DBU or tBuOLi-promoted coupling of ribosyl alcohols with 2,4,5-trichloropyrimidine as key step. Preliminary biological evaluation of this type of compounds as new EGFR tyrosine kinase inhibitors for combating EGFR L858R/T790M mutant associated with drug resistance in the treatment of non-small cell lung cancer revealed that 3-N-acryloyl-5-O-anilinopyrimidine ribose derivative 1a possessed potent and specific inhibitory activity against EGFR L858R/T790M over WT EGFR. Based upon molecular docking studies of the binding mode between compound 1a and EGFR, the distance between the Michael receptor and the pyrimidine scaffold is considered as an important factor for the inhibitory potency and future design of selective EGFR tyrosine kinase inhibitors against EGFR L858R/T790M mutants.
Synthesis and biological evaluation of di-aryl urea derivatives as c-Kit inhibitors.
Ravez, Séverine; Arsenlis, Stéphane; Barczyk, Amélie; Dupont, Anthony; Frédérick, Raphaël; Hesse, Stéphanie; Kirsch, Gilbert; Depreux, Patrick; Goossens, Laurence
2015-11-15
Inhibition of receptor tyrosine kinases (RTKs) continued to be a successful approach for the treatment of many types of human cancers and many potent small molecules kinase inhibitors have been discovered the last decade. In the present study, we describe the synthesis of thienopyrimidine derivatives and their pharmacological evaluation against nine kinases (EGFR, PDGFR-ß, c-Kit, c-Met, Src, Raf, VEGFR-1, -2 and -3). Most of the synthesized compounds showed from moderate to potent activities against c-Kit with IC50 values in the nanomolar range. Among them, 4-anilino(urea)thienopyrimidine analogs showed selectivity and potent c-Kit inhibition with IC50 values less than 6 nM. Docking simulation was performed for the most promising compound 9 into the c-Kit active site to determine the potential binding mode. This study reveal that the 4-anilino(urea)thienopyrimidine is an interesting scaffold to design novel potent and selective c-Kit inhibitors which may make promising candidates for cancers where c-Kit receptors are overexpressed. Copyright © 2015 Elsevier Ltd. All rights reserved.
Li, Hailan; Yun, Hye-Young; Baek, Kwang Jin; Kwon, Nyoun Soo; Park, Kyoung-Chan; Kim, Dong-Seok
2014-03-01
The purpose of this study was to investigate effects of myriocin, an inhibitor of serine palmitoyltransferase, on melanogenesis. It was found that myriocin increased melanin synthesis in a concentration-dependent manner. Moreover, myriocin up-regulated microphthalmia-associated transcription factor (MITF) and tyrosinase expression via phosphorylation of CREB, but it did not directly activate tyrosinase, a rate-limiting melanogenic enzyme. Furthermore, we demonstrated increased melanin synthesis with myriocin on a pigmented skin equivalent model established using Cervi cornus Colla (deer antler glue). One and 5 microM of myriocin darkened the color of the skin equivalent. These results suggest that myriocin may have potential effects for the treatment of hypopigmentary skin diseases like vitiligo or for sunless tanning.
Rota, Paola; Allevi, Pietro; Agnolin, Irene S; Mattina, Roberto; Papini, Nadia; Anastasia, Mario
2012-04-14
A simple protocol for the synthesis of N-perfluoroacylated and N-acylated glycals of neuraminic acid, with a secondary cyclic amine (morpholine or piperidine) at the 4α position, has been set-up, starting from peracetylated N-acetylneuraminic acid methyl ester that undergoes, sequentially to its direct N-transacylation followed by a C-4 amination, a β-elimination, and a selective hydrolysis of the ester functions, without affecting the sensitive perfluorinated amide. This journal is © The Royal Society of Chemistry 2012
Perdih, Andrej; Hrast, Martina; Barreteau, Hélène; Gobec, Stanislav; Wolber, Gerhard; Solmajer, Tom
2014-08-01
Enzymes catalyzing the biosynthesis of bacterial peptidoglycan represent traditionally a collection of highly selective targets for novel antibacterial drug design. Four members of the bacterial Mur ligase family-MurC, MurD, MurE and MurF-are involved in the intracellular steps of peptidoglycan biosynthesis, catalyzing the synthesis of the peptide moiety of the Park's nucleotide. In our previous virtual screening campaign, a chemical class of benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole derivatives exhibiting dual MurD/MurE inhibition properties was discovered. In the present study we further investigated this class of compounds by performing inhibition assays on all four Mur ligases (MurC-MurF). Furthermore, molecular dynamics (MD) simulation studies of one of the initially discovered compound 1 were performed to explore its geometry as well as its energetic behavior based on the Linear Interaction Energy (LIE) method. Further in silico virtual screening (VS) experiments based on the parent active compound 1 were conducted to optimize the discovered series. Selected hits were assayed against all Escherichia coli MurC-MurF enzymes in biochemical inhibition assays and molecules 10-14 containing benzene-1,3-dicarboxylic acid 2,5-dimethylpyrrole coupled with five member-ring rhodanine moiety were found to be multiple inhibitors of the whole MurC-MurF cascade of bacterial enzymes in the micromolar range. Steady-state kinetics studies suggested this class to act as competitive inhibitors of the MurD enzyme towards d-Glu. These compounds represent novel valuable starting point in the development of novel antibacterial agents. Copyright © 2014 Elsevier Ltd. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Becker, Jan C.; Grosser, Nina; Waltke, Christian
2006-07-07
Proton pump inhibitors (PPIs) have been demonstrated to prevent gastric mucosal injury by mechanisms independent of acid inhibition. Here we demonstrate that both omeprazole and lansoprazole protect human gastric epithelial and endothelial cells against oxidative stress. This effect was abrogated in the presence of the heme oxygenase-1 (HO-1) inhibitor ZnBG. Exposure to either PPI resulted in a strong induction of HO-1 expression on mRNA and protein level, and led to an increased activity of this enzyme. Expression of cyclooxygenase isoforms 1 and 2 remained unaffected, and COX-inhibitors did not antagonize HO-1 induction by PPIs. Our results suggest that the antioxidantmore » defense protein HO-1 is a target of PPIs in both endothelial and gastric epithelial cells. HO-1 induction might account for the gastroprotective effects of PPIs independently of acid inhibition, especially in NSAID gastropathy. Moreover, our findings provide additional perspectives for a possible but yet unexplored use of PPIs in vasoprotection.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Nguyen, Trung Xuan; Morrell, Andrew; Conda-Sheridan, Martin; Marchand, Christophe; Agama, Keli; Bermingam, Alun; Stephen, Andrew G.; Chergui, Adel; Naumova, Alena; Fisher, Robert; O’Keefe, Barry R.; Pommier, Yves; Cushman, Mark
2012-01-01
Substances with dual tyrosyl-DNA phosphodiesterase I - topoisomerase I inhibitory activity in one low molecular weight compound would constitute a unique class of anticancer agents that could potentially have significant advantages over drugs that work against the individual enzymes. The present study demonstrates the successful synthesis and evaluation of the first dual Top1-Tdp1 inhibitors, which are based on the indenoisoquinoline chemotype. One bis(indenoisoquinoline) had significant activity against human Tdp1 (IC50 = 1.52 ± 0.05 μM), and it was also equipotent to camptothecin as a Top1 inhibitor. Significant insights into enzyme-drug interactions were gained via structure-activity relationship studies of the series. The present results also document the failure of the previously reported sulfonyl ester pharmacophore to confer Tdp1 inhibition in this indenoisoquinoline class of inhibitors, even though it was demonstrated to work well for the steroid NSC 88915 (7). The current study will facilitate future efforts to optimize dual Top1-Tdp1 inhibitors. PMID:22536944
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bou, G.; Santillana, E; Sheri, A
Class D {beta}-lactamases represent a growing and diverse class of penicillin-inactivating enzymes that are usually resistant to commercial {beta}-lactamase inhibitors. As many such enzymes are found in multi-drug resistant (MDR) Acinetobacter baumannii and Pseudomonas aeruginosa, novel {beta}-lactamase inhibitors are urgently needed. Five unique 6-alkylidene-2{prime}-substituted penicillanic acid sulfones (1-5) were synthesized and tested against OXA-24, a clinically important {beta}-lactamase that inactivates carbapenems and is found in A. baumannii. Based upon the roles Tyr112 and Met223 play in the OXA-24 {beta}-lactamase, we also engineered two variants (Tyr112Ala and Tyr112Ala,Met223Ala) to test the hypothesis that the hydrophobic tunnel formed by these residues influencesmore » inhibitor recognition. IC{sub 50} values against OXA-24 and two OXA-24 {beta}-lactamase variants ranged from 10 {+-} 1 (4 vs WT) to 338 {+-} 20 nM (5 vs Tyr112Ala, Met223Ala). Compound 4 possessed the lowest K{sub i} (500 {+-} 80 nM vs WT), and 1 possessed the highest inactivation efficiency (k{sub inact}/K{sub i} = 0.21 {+-} 0.02 {micro}M{sup -1}s{sup -1}). Electrospray ionization mass spectrometry revealed a single covalent adduct, suggesting the formation of an acyl-enzyme intermediate. X-ray structures of OXA-24 complexed to four inhibitors (2.0-2.6 {angstrom}) reveal the formation of stable bicyclic aromatic intermediates with their carbonyl oxygen in the oxyanion hole. These data provide the first structural evidence that 6-alkylidene-2{prime}-substituted penicillin sulfones are effective mechanism-based inactivators of class D {beta}-lactamases. Their unique chemistry makes them developmental candidates. Mechanisms for class D hydrolysis and inhibition are discussed, and a pathway for the evolution of the BlaR1 sensor of Staphylococcus aureus to the class D {beta}-lactamases is proposed.« less
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Mipomersen, an antisense apolipoprotein B synthesis inhibitor.
Bell, Damon A; Hooper, Amanda J; Burnett, John R
2011-02-01
mipomersen is a second-generation antisense oligonucleotide (ASO) targeted to human apolipoprotein (apo) B-100, a large protein synthesized by the liver that plays a fundamental role in human lipoprotein metabolism. Mipomersen predominantly distributes to the liver and decreases the production of apoB-100, the primary structural protein of the atherogenic lipoproteins including low density lipoprotein (LDL), thereby reducing plasma LDL-cholesterol and apoB-100 concentrations. the mode of action, preclinical development and clinical trials of mipomersen, an antisense apoB synthesis inhibitor. The paper provides an understanding of the pharmacokinetic and pharmacodynamic characteristics of mipomersen and insight into its clinical efficacy and safety. In clinical trials, mipomersen produced dose-dependent and prolonged reductions in LDL-cholesterol and other apoB-containing lipoproteins, including lipoprotein (a) [Lp(a)] in healthy volunteers and in patients with mild to moderate hypercholesterolemia. Mipomersen has been shown to decrease apoB, LDL-cholesterol and Lp(a) in patients with heterozygous and homozygous familial hypercholesterolemia on maximally tolerated lipid-lowering therapy. mipomersen shows promise as an adjunctive agent by reducing apoB-containing lipoproteins in patients at high risk of atherosclerotic cardiovascular disease who are not at target or are intolerant of statins. Although the short-term efficacy and safety of mipomersen has been established, concern exists regarding the long-term potential for hepatic steatosis with this ASO.
Lan, Jin-Shuai; Hou, Jian-Wei; Liu, Yun; Ding, Yue; Zhang, Yong; Li, Ling; Zhang, Tong
2017-12-01
A novel family of cinnamic acid derivatives has been developed to be multifunctional cholinesterase inhibitors against AD by fusing N-benzyl pyridinium moiety and different substituted cinnamic acids. In vitro studies showed that most compounds were endowed with a noteworthy ability to inhibit cholinesterase, self-induced Aβ (1-42) aggregation, and to chelate metal ions. Especially, compound 5l showed potent cholinesterase inhibitory activity (IC 50 , 12.1 nM for eeAChE, 8.6 nM for hAChE, 2.6 μM for eqBuChE and 4.4 μM for hBuChE) and the highest selectivity toward AChE over BuChE. It also showed good inhibition of Aβ (1-42) aggregation (64.7% at 20 μM) and good neuroprotection on PC12 cells against amyloid-induced cell toxicity. Finally, compound 5l could penetrate the BBB, as forecasted by the PAMPA-BBB assay and proved in OF1 mice by ex vivo experiments. Overall, compound 5l seems to be a promising lead compound for the treatment of Alzheimer's diseases.
Nair, Reji N; Mishra, Jitendra K; Li, Fangzheng; Tortosa, Mariola; Yang, Chunying; Doherty, Joanne R; Cameron, Michael; Cleveland, John L; Roush, William R; Bannister, Thomas D
2016-05-01
Glutamine and tyrosine-based amino acid conjugates of monocarboxylate transporter types 1 and 2 inhibitors (MCT1/2) were designed, synthesized and evaluated for their potency in blocking the proliferation of a human B lymphoma cell line that expresses the transporters Asct2, LAT1 and MCT1. Appropriate placement of an amino acid transporter recognition element was shown to augment anti-tumour efficacy vs. Raji cells. Amino acid conjugation also improves the pharmacodynamic properties of experimental MCT1/2 inhibitors.
Sung, Hea Jung; Moon, Sung Jin; Kim, Jin Su; Lim, Chul Hyun; Park, Jae Myung; Lee, In Seok; Kim, Sang Woo; Choi, Myung-Gye
2012-01-01
Background/Aims Available data about reflux patterns and symptom determinants in the gastroesophageal reflux disease (GERD) subtypes off proton pump inhibitor (PPI) therapy are lacking. We aimed to evaluate reflux patterns and determinants of symptom perception in patients with GERD off PPI therapy by impedance-pH monitoring. Methods We retrospectively reviewed the impedance-pH data in patients diagnosed as GERD based on results of impedance-pH monitoring, endoscopy and/or typical symptoms. The characteristics of acid and weakly acidic reflux were evaluated. Symptomatic and asymptomatic reflux were compared according to GERD subtypes and individual symptoms. Results Forty-two patients (22 males, mean age 46 years) were diagnosed as GERD (17 erosive reflux disease, 9 pH(+) non-erosive reflux disease [NERD], 9 hypersensitive esophagus and 7 symptomatic NERD). A total of 1,725 reflux episodes were detected (855 acid [50%], 857 weakly acidic [50%] and 13 weakly alkaline reflux [< 1%]). Acid reflux was more frequently symptomatic and bolus clearance was longer compared with weakly acidic reflux. In terms of globus, weakly acidic reflux was more symptomatic. Symptomatic reflux was more frequently acid and mixed reflux; these associations were more pronounced in erosive reflux disease and symptomatic NERD. The perception of regurgitation was related to acid reflux, while that of globus was more related to weakly acidic reflux. Conclusions In patients not taking PPI, acid reflux was more frequently symptomatic and had longer bolus clearance. Symptomatic reflux was more frequently acid and mixed type; however, weakly acidic reflux was associated more with globus. These data suggest a role for impedance-pH data in the evaluation of globus. PMID:22837877
Sung, Hea Jung; Cho, Yu Kyung; Moon, Sung Jin; Kim, Jin Su; Lim, Chul Hyun; Park, Jae Myung; Lee, In Seok; Kim, Sang Woo; Choi, Myung-Gye
2012-07-01
Available data about reflux patterns and symptom determinants in the gastroesophageal reflux disease (GERD) subtypes off proton pump inhibitor (PPI) therapy are lacking. We aimed to evaluate reflux patterns and determinants of symptom perception in patients with GERD off PPI therapy by impedance-pH monitoring. We retrospectively reviewed the impedance-pH data in patients diagnosed as GERD based on results of impedance-pH monitoring, endoscopy and/or typical symptoms. The characteristics of acid and weakly acidic reflux were evaluated. Symptomatic and asymptomatic reflux were compared according to GERD subtypes and individual symptoms. Forty-two patients (22 males, mean age 46 years) were diagnosed as GERD (17 erosive reflux disease, 9 pH(+) non-erosive reflux disease [NERD], 9 hypersensitive esophagus and 7 symptomatic NERD). A total of 1,725 reflux episodes were detected (855 acid [50%], 857 weakly acidic [50%] and 13 weakly alkaline reflux [< 1%]). Acid reflux was more frequently symptomatic and bolus clearance was longer compared with weakly acidic reflux. In terms of globus, weakly acidic reflux was more symptomatic. Symptomatic reflux was more frequently acid and mixed reflux; these associations were more pronounced in erosive reflux disease and symptomatic NERD. The perception of regurgitation was related to acid reflux, while that of globus was more related to weakly acidic reflux. In patients not taking PPI, acid reflux was more frequently symptomatic and had longer bolus clearance. Symptomatic reflux was more frequently acid and mixed type; however, weakly acidic reflux was associated more with globus. These data suggest a role for impedance-pH data in the evaluation of globus.
Smetana, K; Zápotocký, M
2010-01-01
The present study was undertaken to provide more information on nucleolar changes induced by a histone deacetylase inhibitor such as valproic acid in leukaemic myeloblasts at the single-cell level. For this study, RNA in nucleoli was visualized by a simple but sensitive cytochemical procedure in unfixed cytospins of short-term bone marrow cultures from patients suffering from acute myeloid leukaemia. Valproic acid in leukaemic myeloblasts markedly reduced the nucleolar size and also produced significant transformation of "active" to "resting" and "inactive" nucleoli that reflected the alteration of the nucleolar transcription in sensitive myeloblasts. On this occasion it should be added that valproic acid significantly increased the incidence of altered myeloblasts that changed to apoptotic cells or apoptotic bodies and cell ghosts. In contrast to the above-mentioned decreased nucleolar size, the nucleolar RNA concentration, expressed by computerassisted RNA image densitometry in valproic acidtreated myeloblasts, was not significantly changed. The results of the present study clearly indicated that the nucleolar size and transformation of "active" to "sleeping" or "inactive" nucleoli are convenient markers of the sensitivity and alteration of leukaemic myeloblasts produced by a histone deacetylase inhibitor, valproic acid, at the single-cell level.
Dgachi, Youssef; Bautista-Aguilera, Oscar M; Benchekroun, Mohamed; Martin, Hélène; Bonet, Alexandre; Knez, Damijan; Godyń, Justyna; Malawska, Barbara; Gobec, Stanislav; Chioua, Mourad; Janockova, Jana; Soukup, Ondrej; Chabchoub, Fakher; Marco-Contelles, José; Ismaili, Lhassane
2016-05-14
We report herein the straightforward two-step synthesis and biological assessment of novel racemic benzochromenopyrimidinones as non-hepatotoxic, acetylcholinesterase inhibitors with antioxidative properties. Among them, compound 3Bb displayed a mixed-type inhibition of human acetylcholinesterase (IC50 = 1.28 ± 0.03 μM), good antioxidant activity, and also proved to be non-hepatotoxic on human HepG2 cell line.
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Wang, Xin; Li, Bing-Zhi; Ding, Ming-Zhu; Zhang, Wei-Wen; Yuan, Ying-Jin
2013-03-01
During hydrolysis of lignocellulosic biomass, a broad range of inhibitors are generated, which interfere with yeast growth and bioethanol production. In order to improve the strain tolerance to multiple inhibitors--acetic acid, furfural, and phenol (three representative lignocellulose-derived inhibitors) and uncover the underlying tolerant mechanism, an adaptation experiment was performed in which the industrial Saccharomyces cerevisiae was cultivated repeatedly in a medium containing multiple inhibitors. The adaptation occurred quickly, accompanied with distinct increase in growth rate, glucose utilization rate, furfural metabolism rate, and ethanol yield, only after the first transfer. A similar rapid adaptation was also observed for the lab strains of BY4742 and BY4743. The metabolomic analysis was employed to investigate the responses of the industrial S. cereviaise to three inhibitors during the adaptation. The results showed that higher levels of 2-furoic acid, 2, 3-butanediol, intermediates in glycolytic pathway, and amino acids derived from glycolysis, were discovered in the adapted strains, suggesting that enhanced metabolic activity in these pathways may relate to resistance against inhibitors. Additionally, through single-gene knockouts, several genes related to alanine metabolism, GABA shunt, and glycerol metabolism were verified to be crucial for the resistance to multiple inhibitors. This study provides new insights into the tolerance mechanism against multiple inhibitors, and guides for the improvement of tolerant ethanologenic yeast strains for lignocellulose-bioethanol fermentation.
Ghosh, Arun K.; Parham, Garth L.; Martyr, Cuthbert D.; Nyalapatla, Prasanth R.; Osswald, Heather L.; Agniswamy, Johnson; Wang, Yuan-Fang; Amano, Masayuki; Weber, Irene T.; Mitsuya, Hiroaki
2013-01-01
The design, synthesis, and biological evaluation of a series of HIV-1 protease inhibitors incorporating stereochemically defined fused tricyclic P2-ligands are described. Various substituent effects were investigated in order to maximize the ligand-binding site interactions in the protease active site. Inhibitors 16a and 16f showed excellent enzyme inhibitory and antiviral activity while incorporation of sulfone functionality resulted in a decrease in potency. Both inhibitors 16a and 16f have maintained activity against a panel of multidrug resistant HIV-1 variants. A high-resolution X-ray crystal structure of 16a-bound HIV-1 protease revealed important molecular insights into the ligand-binding site interactions which may account for the inhibitor’s potent antiviral activity and excellent resistance profiles. PMID:23947685
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Thupari, J N; Pinn, M L; Kuhajda, F P
2001-07-13
Inhibition of fatty acid synthase (FAS) induces apoptosis in human breast cancer cells in vitro and in vivo without toxicity to proliferating normal cells. We have previously shown that FAS inhibition causes a rapid increase in malonyl-CoA levels identifying malonyl-CoA as a potential trigger of apoptosis. In this study we further investigated the role of malonyl-CoA during FAS inhibition. We have found that: [i] inhibition of FAS with cerulenin causes carnitine palmitoyltransferase-1 (CPT-1) inhibition and fatty acid oxidation inhibition in MCF-7 human breast cancer cells likely mediated by elevation of malonyl-CoA; [ii] cerulenin cytotoxicity is due to the nonphysiological state of increased malonyl-CoA, decreased fatty acid oxidation, and decreased fatty acid synthesis; and [iii] the cytotoxic effect of cerulenin can be mimicked by simultaneous inhibition of CPT-1, with etomoxir, and fatty acid synthesis with TOFA, an acetyl-CoA carboxylase (ACC) inhibitor. This study identifies CPT-1 and ACC as two new potential targets for cancer chemotherapy. Copyright 2001 Academic Press.
McKenzie, Marian J; Chen, Ronan K Y; Harris, John C; Ashworth, Matthew J; Brummell, David A
2013-01-01
Cold-induced sweetening (CIS) is a serious post-harvest problem for potato tubers, which need to be stored cold to prevent sprouting and pathogenesis in order to maintain supply throughout the year. During storage at cold temperatures (below 10 °C), many cultivars accumulate free reducing sugars derived from a breakdown of starch to sucrose that is ultimately cleaved by acid invertase to produce glucose and fructose. When affected tubers are processed by frying or roasting, these reducing sugars react with free asparagine by the Maillard reaction, resulting in unacceptably dark-coloured and bitter-tasting product and generating the probable carcinogen acrylamide as a by-product. We have previously identified a vacuolar invertase inhibitor (INH2) whose expression correlates both with low acid invertase activity and with resistance to CIS. Here we show that, during cold storage, overexpression of the INH2 vacuolar invertase inhibitor gene in CIS-susceptible potato tubers reduced acid invertase activity, the accumulation of reducing sugars and the generation of acrylamide in subsequent fry tests. Conversely, suppression of vacuolar invertase inhibitor expression in a CIS-resistant line increased susceptibility to CIS. The results show that post-translational regulation of acid invertase by the vacuolar invertase inhibitor is an important component of resistance to CIS. © 2012 Blackwell Publishing Ltd.
Amakali, Klaudia T; Legoabe, Lesetja J; Petzer, Anél; Petzer, Jacobus P
2018-05-14
The present study investigates the human monoamine oxidase (MAO) inhibition properties of a series of twelve 2-heteroarylidene-1-tetralone derivatives. Also included are related cyclohexylmethylidene, cyclopentylmethylidene and benzylidene substituted 1-tetralones. These compounds are related to the 2-benzylidene-1-indanone class of compounds which has previously been shown to inhibit the MAOs, with specificity for the MAO-B isoform. The target compounds were synthesised by the Claisen-Schmidt condensation between 7-methoxy-1-tetralone or 1-tetralone, and various aldehydes, under acid (hydrochloric acid) or base (potassium hydroxide) catalysis. The results of the MAO inhibition studies showed that the 2-heteroarylidene-1-tetralone and related derivatives are in most instances more selective inhibitors of the MAO-B isoform compared to MAO-A. (2E)-2-Benzylidene-7-methoxy-3,4-dihydronaphthalen-1(2 H)-one (IC 50 =0.707 μM) was found to be the most potent MAO-B inhibitor, while the most potent MAO-A inhibitor was (2E)-2-[(2-chloropyridin-3-yl)methylidene]-7-methoxy-3,4-dihydronaphthalen-1(2 H)-one (IC 50 =1.37 μM). The effect of the heteroaromatic substituent on MAO-B inhibition activity, in decreasing order was found to be: cyclohexyl, phenyl>thiophene>pyridine, furane, pyrrole, cyclopentyl. This study concludes that, although some 2-heteroarylidene-1-tetralone derivatives are good potency MAO inhibitors, in general their inhibition potencies, particularly for MAO-B, are lower than structurally related chalcones and 1-indanone derivatives that were previously studied. © Georg Thieme Verlag KG Stuttgart · New York.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Fouda, A S; Gouda, M M; El-Rahman, S I
2000-05-01
The effect of benzaldehyde, 2-hydroxybenzoyl hydrazone derivatives on the corrosion of aluminium in hydrochloric acid has been investigated using thermometric and polarization techniques. The inhibitive efficiency ranking of these compounds from both techniques was found to be: 2>3>1>4. The inhibitors acted as mixed-type inhibitors but the cathode is more polarized. The relative inhibitive efficiency of these compounds has been explained on the basis of structure of the inhibitors and their mode of interaction at the surface. Results show that these additives are adsorbed on an aluminium surface according to the Langmuir isotherm. Polarization measurements indicated that the rate of corrosion of aluminium rapidly increases with temperature over the range 30-55 degrees C both in the absence and in the presence of inhibitors. Some thermodynamic data of the adsorption process are calculated and discussed.
Han, Ya; Gao, Yaning; He, Tian; Wang, Daidong; Guo, Ning; Zhang, Xiaotian; Chen, Shizhong; Wang, Hong
2018-04-15
Following the FDA approval of three monoclonal antibodies of PD-1/PD-L1, this pathway has become a promising target for cancer treatment. Currently small-molecule inhibitors have not been extensively investigated, and appropriate screening methods for such inhibitors are urgently required. In this study, surface plasmon resonance (SPR) technology was used to evaluate the affinity and competitive inhibition of nine caffeoylquinic acid compounds (CQAs) against PD-1/PD-L1. As a result, four small molecules including 1-CQA, 3-CQA, 4-CQA and 5-CQA were determined as PD-1/PD-L1 inhibitors. This study provided an efficient method for screening small-molecule inhibitors targeting PD-1/PD-L1 pathway. Copyright © 2018. Published by Elsevier Inc.
Design and synthesis of novel and highly-active pan-histone deacetylase (pan-HDAC) inhibitors.
Tashima, Toshihiko; Murata, Hiroaki; Kodama, Hidehiko
2014-07-15
Histone deacetylase (HDAC) inhibitions are known to elicit anticancer effects. We designed and synthesized several HDAC inhibitors. Among these compounds, compound 40 exhibited a more than 10-fold stronger inhibitory activity compared with that of suberoylanilide hydroxamic acid (SAHA) against each human HDAC isozyme in vitro (IC50 values of 40: HDAC1, 0.0038μM; HDAC2, 0.0082μM; HDAC3, 0.015μM; HDAC8, 0.0060μM; HDAC4, 0.058μM; HDAC9, 0.0052μM; HDAC6, 0.058μM). The dose of the administered HDAC inhibitors that contain hydroxamic acid as the zinc-binding group may be reduced by 40. Because the carbostyril subunit is a time-tested structural component of drugs and biologically active compounds, 40 most likely exhibits good absorption, distribution, metabolism, excretion, and toxicity (ADMET). Thus, compound 40 is expected to be a promising therapeutic agent or chemical tool for the investigation of life process. Copyright © 2014 Elsevier Ltd. All rights reserved.
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
NASA Astrophysics Data System (ADS)
Frei, Reto
I. The use of small molecule probes to explore biological phenomena has become a valuable tool in chemical biology. As a result, methods that permit the rapid synthesis and biological evaluation of such compounds are highly sought-after. The small molecule macroarray represents one such approach for the synthesis and identification of novel bioactive agents. Macroarrays are readily constructed via the SPOT-synthesis technique on planar cellulose membranes, yielding spatially addressed libraries of ˜10-1000 unique compounds. We sought to expand the arsenal of chemical reactions compatible with this solid-phase platform, and developed highly efficient SPOT-synthesis protocols for the Mizoroki-Heck, Suzuki-Miyaura, and copper-catalyzed azide-alkyne cycloaddition reaction. We demonstrated that these metal-mediated reactions can be implemented, either individually or sequentially, for the efficient construction of small molecules in high purity on rapid time scales. Utilizing these powerful C-C and C-N bond forming coupling reactions, we constructed a series of macroarrays based on novel stilbene, phenyl-naphthalene, and triazole scaliblds. Subsequent biological testing of the stilbene and phenyl-naphthalene libraries revealed several potent antagonists and agonists, respectively, of the quorum sensing (QS) receptor LuxR in Vibrio fischeri. II. Bacteria living within biofilms are notorious for their resistance to known antibiotic agents, and constitute a major human health threat. Methods to attenuate biofilm growth would have a significant impact on the management of bacterial infections. Despite intense research efforts, small molecules capable of either inhibiting or dispersing biolilms remain scarce. We utilized natural products with purported anti-biofilm or QS inhibitory activity as sources of structural insight to guide the synthesis of novel biofilm modulators with improved activities. These studies revealed 2-aminobenzimidazole derivatives as highly potent
Effect of Timing of Proton Pump Inhibitor Administration on Acid Suppression.
Furuta, Kenji; Adachi, Kyoichi; Aimi, Masahito; Shimura, Shino; Mikami, Hironobu; Nishimura, Nobuhiro; Ishimura, Norihisa; Ishihara, Shunji; Naora, Kohji; Kinoshita, Yoshikazu
2016-01-01
Esomeprazole has been reported to show a strong acid suppression following preprandial as compared to postprandial administration, though no known study has compared the acid suppressing effects of other proton pump inhibitors between those administrations. The aim of this study was to compare intragastric pH levels following pre- and postprandial administrations of rabeprazole and esomeprazole. In 15 Helicobacter pylori-negative healthy volunteers, we measured intragastric pH after 7 days of pre- and postprandial administrations of rabeprazole (10 mg) or esomeprazole (20 mg) using a 5-way crossover design. Preprandial administration of esomeprazole showed stronger acid suppression than postprandial administration. The values for percent time at pH >4.0 over a 24-hour period increased from 45.3% with postprandial administration of esomeprazole to 54.4% with preprandial administration, while the percent time at pH >4.0 during daytime was increased to a greater extent from 51.4 to 66.5% with preprandial administration (p = 0.05). On the other hand, the acid suppressing effect of rabeprazole was not influenced by the timing of administration. The acid suppressing effect of esomeprazole is influenced by administration timing. In contrast, the acid suppressing effect of rabeprazole is not augmented by preprandial administration. © 2015 S. Karger AG, Basel.
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
Salgueiro, Daniela A L; Sousa, Cristina E A; Fortes, A Gil; Alves, M José
2012-12-01
This comprehensive review deals with the synthesis of 1-azafagomine, analogs, and derivatives having the Diels-Alder cycloaddition as the key step. Most of the compounds referred are racemic or have been resolved by lipase transesterification. There are two asymmetric cycloadditions leading to 1-azafagomine or to an analog. In one case both enantiomers of 1-azafagomine were prepared together with a pair of derivatives. The study comprises glycosidase inhibition studies of the target compounds to a set of glycosidic enzymes, and evidenced molecular features that enhance or diminish their activity as glycosidase inhibitors.
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
Development of Inhibitors of Salicylic Acid Signaling.
Jiang, Kai; Kurimoto, Tetsuya; Seo, Eun-kyung; Miyazaki, Sho; Nakajima, Masatoshi; Nakamura, Hidemitsu; Asami, Tadao
2015-08-19
Salicylic acid (SA) plays important roles in the induction of systemic acquired resistance (SAR) in plants. Determining the mechanism of SAR will extend our understanding of plant defenses against pathogens. We recently reported that PAMD is an inhibitor of SA signaling, which suppresses the expression of the pathogenesis-related PR genes and is expected to facilitate the understanding of SA signaling. However, PAMD strongly inhibits plant growth. To minimize the side effects of PAMD, we synthesized a number of PAMD derivatives, and identified compound 4 that strongly suppresses the expression of the PR genes with fewer adverse effects on plant growth than PAMD. We further showed that the adverse effects on plant growth were partially caused the stabilization of DELLA, which is also related to the pathogen responses. These results indicate that compound 4 would facilitate our understanding of SA signaling and its cross talk with other plant hormones.
Dipicolinic Acid Derivatives as Inhibitors of New Delhi Metallo-β-lactamase-1.
Chen, Allie Y; Thomas, Pei W; Stewart, Alesha C; Bergstrom, Alexander; Cheng, Zishuo; Miller, Callie; Bethel, Christopher R; Marshall, Steven H; Credille, Cy V; Riley, Christopher L; Page, Richard C; Bonomo, Robert A; Crowder, Michael W; Tierney, David L; Fast, Walter; Cohen, Seth M
2017-09-14
The efficacy of β-lactam antibiotics is threatened by the emergence and global spread of metallo-β-lactamase (MBL) mediated resistance, specifically New Delhi metallo-β-lactamase-1 (NDM-1). By utilization of fragment-based drug discovery (FBDD), a new class of inhibitors for NDM-1 and two related β-lactamases, IMP-1 and VIM-2, was identified. On the basis of 2,6-dipicolinic acid (DPA), several libraries were synthesized for structure-activity relationship (SAR) analysis. Inhibitor 36 (IC 50 = 80 nM) was identified to be highly selective for MBLs when compared to other Zn(II) metalloenzymes. While DPA displayed a propensity to chelate metal ions from NDM-1, 36 formed a stable NDM-1:Zn(II):inhibitor ternary complex, as demonstrated by 1 H NMR, electron paramagnetic resonance (EPR) spectroscopy, equilibrium dialysis, intrinsic tryptophan fluorescence emission, and UV-vis spectroscopy. When coadministered with 36 (at concentrations nontoxic to mammalian cells), the minimum inhibitory concentrations (MICs) of imipenem against clinical isolates of Eschericia coli and Klebsiella pneumoniae harboring NDM-1 were reduced to susceptible levels.
Gupta, Neeraj Kumar; Joshi, P G; Srivastava, Vandana; Quraishi, M A
2018-01-01
The present investigation aims at investigation of low cost nontoxic carbohydrate biopolymer chitosan as corrosion inhibitor alone and in combination with KI for mild steel in 1M sulfamic acid medium using gravimetric, electrochemical and surface analysis techniques. It is found that chitosan alone exhibits inhibition efficiency of 73.8% at 200ppm concentration. However, in combination with KI (5ppm), it gave more than 90% inhibition efficiency. The significant increase in the inhibition performance of chitosan has been explained by the synergistic mechanism. The results of Potentiodynamic polarization study shows that chitosan and its blend with KI decreases both anodic and cathodic reactions occurring at mild steel surface in 1M sulfamic acid medium by blocking active sites of the metal and acts as mixed type inhibitor. EIS study reveals that the polarization resistance increases with increase in the concentration of inhibitors which increases charge transfer resistance across the metal/solution interface. The adsorption of chitosan followed the Langmuir adsorption isotherm. The formation of inhibitor film on metal surface was supported by scanning electron microscopy (SEM) and atomic force microscopy (AFM) surface studies. Copyright © 2017 Elsevier B.V. All rights reserved.
Miura, Shin-Ichiro; Suematsu, Yasunori; Matsuo, Yoshino; Tomita, Sayo; Nakayama, Asuka; Goto, Masaki; Arimura, Tadaaki; Kuwano, Takashi; Yahiro, Eiji; Saku, Keijiro
2016-11-01
A recent clinical study indicated that an angiotensin II (Ang II) type 1 (AT 1 ) receptor-neprilysin inhibitor (ARNi) designated LCZ696 (sacubitril/valsartan, as combined sodium complex) was superior to enalapril at reducing the risks of death and hospitalization due to heart failure. Therefore, we investigated the possible mechanisms of the beneficial effect of LCZ696, in which the inhibition of neprilysin enhances atrial natriuretic peptide (NP) or brain NP (ANP or BNP)-evoked signals that can block Ang II/AT 1 receptor-induced aldosterone (Ald) synthesis in human adrenocortical cells. The binding affinity of valsartan+LBQ657 (active moiety of sacubitril) to the AT 1 receptor was greater than that of valsartan alone in an AT 1 receptor-expressing human embryonic kidney cell-based assay. There was no difference in the dissociation from the AT 1 receptor between valsartan+LBQ657 and valsartan alone. In Ang II-sensitized human adrenocortical cells, ANP or BNP alone, but not LBQ657 or valsartan alone, significantly decreased Ald synthesis. The level of suppression of Ald synthesis by ANP or BNP with LBQ657 was greater than that by ANP or BNP without LBQ657. The suppression of ANP was blocked by inhibitors of regulator of G-protein signaling proteins and cyclic GMP-dependent protein kinase. The inhibition of neprilysin did not change the mRNA levels of the AT 1 receptor, ANP receptor A, regulator of G-protein signaling protein, renin or 3β-hydroxysteroid dehydrogenases. In conclusion, the inhibition of neprilysin by LBQ657 enhances the NP-evoked signals that can block Ang II/AT 1 receptor-induced Ald synthesis in human adrenocortical cells.
ATP Synthesis in the Extremely Halophilic Bacteria
NASA Technical Reports Server (NTRS)
Hochstein, Lawrence I.; Morrison, David (Technical Monitor)
1994-01-01
The proton-translocating ATPases are multimeric enzymes that carry out a multitude of essential functions. Their origin and evolution represent a seminal event in the early evolution of life. Amino acid sequences of the two largest subunits from archaeal ATPases (A-ATPases), vacuolar ATPases (V-ATPases), and FOF1-ATP syntheses (FATPases) suggest these ATPases evolved from an ancestral vacuolar-like ATP syntheses. A necessary consequence of this notion is that the A-ATPases are ATP syntheses. With the possible exception of the A-ATPase from Halobacterium salinarium. no A-ATPase has been demonstrated to synthesize ATP. The evidence for this case is dubious since ATP synthesis occurs only when conditions are distinctively unphysiological. We demonstrated that ATP synthesis in H.saccharovorum is inconsistent with the operation of an A-type ATPase. In order to determine if this phenomenon was unique to H. saccharovorum, ATP synthesis was examined in various extremely halophilic bacteria with the goal of ascertaining if it resembled what occurred in a. saccharovorum, or was consistent with the operation of an A-type ATPase. A-, V-, and F-type ATPases respond singularly to certain inhibitors. Therefore, the effect of these inhibitors on ATP synthesis in several extreme halophiles was determined. Inhibitors that either blocked or collapsed proton-gradients inhibited the steady state synthesis of ATP thus verifying that synthesis took place at the expense of a proton gradient. Azide, an inhibitor of F-ATPases inhibited ATP synthesis. Since the arginine-dependent synthesis of ATP, which occurs by way of substrate-level phosphorylation, was unaffected by azide, it was unlikely that azide acted as an "uncoupler." N -ethylmaleimide and nitrate, which inhibit V- and A-ATPases, either did not inhibit ATP synthesis or resulted in higher steady-state levels of ATP. These results suggest there are two types of proton-motive ATPases in the extreme halophiles (and presumably in other
DOE Office of Scientific and Technical Information (OSTI.GOV)
Mileni, Mauro; Garfunkle, Joie; Ezzili, Cyrine
2010-11-03
Three cocrystal X-ray structures of the {alpha}-ketoheterocycle inhibitors 3-5 bound to a humanized variant of fatty acid amide hydrolase (FAAH) are disclosed and comparatively discussed alongside those of 1 (OL-135) and its isomer 2. These five X-ray structures systematically probe each of the three active site regions key to substrate or inhibitor binding: (1) the conformationally mobile acyl chain-binding pocket and membrane access channel responsible for fatty acid amide substrate and inhibitor acyl chain binding, (2) the atypical active site catalytic residues and surrounding oxyanion hole that covalently binds the core of the {alpha}-ketoheterocycle inhibitors captured as deprotonated hemiketals mimickingmore » the tetrahedral intermediate of the enzyme-catalyzed reaction, and (3) the cytosolic port and its uniquely important imbedded ordered water molecules and a newly identified anion binding site. The detailed analysis of their key active site interactions and their implications on the interpretation of the available structure-activity relationships are discussed providing important insights for future design.« less
Rota, Paola; Cirillo, Federica; Piccoli, Marco; Gregorio, Antonio; Tettamanti, Guido; Allevi, Pietro; Anastasia, Luigi
2015-10-05
Previous studies demonstrated that reducing the GM3 content in myoblasts increased the cell resistance to hypoxic stress, suggesting that a pharmacological inhibition of the GM3 synthesis could be instrumental for the development of new treatments for ischemic diseases. Herein, the synthesis of several dephosphonated CMP-Neu5Ac congeners and their anti-GM3-synthase activity is reported. Biological activity testes revealed that some inhibitors almost completely blocked the GM3-synthase activity in vitro and reduced the GM3 content in living embryonic kidney 293A cells, eventually activating the epidermal growth factor receptor (EGFR) signaling cascade. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.
2016-01-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Kachhadia, Virendra; Rajagopal, Sridharan; Ponpandian, Thanasekaran; Vignesh, Radhakrishnan; Anandhan, Karnambaram; Prabhu, Daivasigamani; Rajendran, Praveen; Nidhyanandan, Saranya; Roy, Anshu Mittal; Ahamed, Fakrudeen Ali; Surendran, Narayanan; Rajagopal, Sriram; Narayanan, Shridhar; Gopalan, Balasubramanian
2016-01-27
Herein we report the synthesis and activity of a novel class of HDAC inhibitors based on 2, 3-diphenyl acrylic acid derivatives. The compounds in this series have shown to be potent HDAC inhibitors possessing significant antiproliferative activity. Further compounds in this series were subjected to metabolic stability in human liver microsomes (HLM), mouse liver microsomes (MLM), and exhibits promising stability in both. These efforts culminated with the identification of a developmental candidate (5a), which displayed desirable PK/PD relationships, significant efficacy in the xenograft models and attractive ADME profiles. Copyright © 2015 Elsevier Masson SAS. All rights reserved.
Farrow, Blake; Wong, Michelle; Malette, Jacquie; Lai, Bert; Deyle, Kaycie M; Das, Samir; Nag, Arundhati; Agnew, Heather D; Heath, James R
2015-06-08
Botulinum neurotoxin (BoNT) serotype A is the most lethal known toxin and has an occluded structure, which prevents direct inhibition of its active site before it enters the cytosol. Target-guided synthesis by in situ click chemistry is combined with synthetic epitope targeting to exploit the tertiary structure of the BoNT protein as a landscape for assembling a competitive inhibitor. A substrate-mimicking peptide macrocycle is used as a direct inhibitor of BoNT. An epitope-targeting in situ click screen is utilized to identify a second peptide macrocycle ligand that binds to an epitope that, in the folded BoNT structure, is active-site-adjacent. A second in situ click screen identifies a molecular bridge between the two macrocycles. The resulting divalent inhibitor exhibits an in vitro inhibition constant of 165 pM against the BoNT/A catalytic chain. The inhibitor is carried into cells by the intact holotoxin, and demonstrates protection and rescue of BoNT intoxication in a human neuron model. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Yan, Chunli; Xiu, Zhilong; Li, Xiaohui; Li, Shenmin; Hao, Ce; Teng, Hu
2008-10-01
Histone deacetylases (HDACs) play an important role in gene transcription, and inhibitors of HDACs can induce cell differentiation and suppress cell proliferation in tumor cells. Histone deacetylase1 (HDAC1) binds suberanilohydroxamic acid (SAHA) and 7-phenyl-2, 4, 6-hepta-trienoyl hydroxamic acid (CG-1521) with moderately low affinity (DeltaG = -8.6 and -7.8 kcal mol(-1)). The structurally related (E)-2-(3-(3-(hydroxyamino)-3-oxoprop-1-enyl)phenyl)-N(1),N(3)-diphenylmalonamide (SK-683), a Trichostatin A (TSA)-like HDAC1 inhibitor, and TSA are bound to the HDAC1 with -12.3 and -10.3 kcal mol(-1) of DeltaG, higher binding free energies than SAHA and CG-1521. Histone deacetylase-like protein (HDLP), an HDAC homologue, shows a 35.2% sequence identity of HDLP and human HDAC1. Molecular dynamics simulation and the molecular mechanics/generalized-Born surface area (MM-GBSA) free energy calculations were applied to investigate the factors responsible for the relatively activity of these four inhibitors to HDLP. In addition, computational alanine scanning of the binding site residues was carried out to determine the contribution components from van der Waals, electrostatic interaction, nonpolar and polar energy of solvation as well as the effects of backbones and side-chains with the MM-GBSA method. MM-GBSA methods reproduced the experimental relative affinities of the four inhibitors in good agreement (R(2) = 0.996) between experimental and computed binding energies. The MM-GBSA calculations showed that, the number of hydrogen bonds formed between the HDLP and inhibitors, which varied in the system studied, and electrostatic interactions determined the magnitude of the free energies for HDLP-inhibitor interactions. The MM-GBSA calculations revealed that the binding of HDLP to these four hydroxamic acid inhibitors is mainly driven by van der Waals/nonpolar interactions. This study can be a guide for the optimization of HDAC inhibitors and future design of new therapeutic
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
Chuang, Jen-Chieh; Lopez, Adam M; Turley, Stephen D
2017-07-01
Esterified cholesterol (EC) and triglycerides, contained within lipoproteins taken up by cells, are hydrolysed by lysosomal acid lipase (LAL) in the late endosomal/lysosomal (E/L) compartment. The resulting unesterified cholesterol (UC) is transported via Niemann-Pick type C2 and C1 into the cytosolic compartment where it enters a putative pool of metabolically active cholesterol that is utilized in accordance with cellular needs. Loss-of-function mutations in LIPA, the gene encoding LAL, result in dramatic increases in tissue concentrations of EC, a hallmark feature of Wolman disease and cholesteryl ester storage disease (CESD). The lysosomal sequestration of EC causes cells to respond to a perceived deficit of sterol by increasing their rate of cholesterol synthesis, particularly in the liver. A similar compensatory response occurs with treatments that disrupt the enterohepatic movement of cholesterol or bile acids. Here we measured rates of cholesterol synthesis in vivo in the liver and small intestine of a mouse model for CESD given the cholesterol absorption inhibitor ezetimibe from weaning until early adulthood. Consistent with previous findings, this treatment significantly reduced the amount of EC sequestered in the liver (from 132.43±7.35 to 70.07±6.04mg/organ) and small intestine (from 2.78±0.21 to 1.34±0.09mg/organ) in the LAL-deficient mice even though their rates of hepatic and intestinal cholesterol synthesis were either comparable to, or exceeded those in matching untreated Lal -/- mice. These data reveal the role of intestinal cholesterol absorption in driving the expansion of tissue EC content and disease progression in LAL deficiency. Copyright © 2017 Elsevier Inc. All rights reserved.
Wodtke, Robert; Hauser, Christoph; Ruiz-Gómez, Gloria; Jäckel, Elisabeth; Bauer, David; Lohse, Martin; Wong, Alan; Pufe, Johanna; Ludwig, Friedrich-Alexander; Fischer, Steffen; Hauser, Sandra; Greif, Dieter; Pisabarro, M Teresa; Pietzsch, Jens; Pietsch, Markus; Löser, Reik
2018-05-24
Transglutaminase 2 (TGase 2)-catalyzed transamidation represents an important post-translational mechanism for protein modification with implications in physiological and pathophysiological conditions, including fibrotic and neoplastic processes. Consequently, this enzyme is considered a promising target for the diagnosis of and therapy for these diseases. In this study, we report on the synthesis and kinetic characterization of N ε -acryloyllysine piperazides as irreversible inhibitors of TGase 2. Systematic structural modifications on 54 new compounds were performed with a major focus on fluorine-bearing substituents due to the potential of such compounds to serve as radiotracer candidates for positron emission tomography. The determined inhibitory activities ranged from 100 to 10 000 M -1 s -1 , which resulted in comprehensive structure-activity relationships. Structure-activity correlations using various substituent parameters accompanied by covalent docking studies provide an advanced understanding of the molecular recognition for this inhibitor class within the active site of TGase 2. Selectivity profiling of selected compounds for other transglutaminases demonstrated an excellent selectivity toward transglutaminase 2. Furthermore, an initial pharmacokinetic profiling of selected inhibitors was performed, including the assessment of potential membrane permeability and liver microsomal stability.
Effect of alpha lipoic acid on leukotriene A4 hydrolase.
Torres, María José; Fierro, Angélica; Pessoa-Mahana, C David; Romero-Parra, Javier; Cabrera, Gonzalo; Faúndez, Mario
2017-03-15
Leukotriene A 4 hydrolase is a soluble enzyme with epoxide hydrolase and aminopeptidase activities catalysing the conversion of leukotriene A 4 to leukotriene B 4 and the hydrolysis of the peptide proline-glycine-proline. Imbalances in leukotriene B 4 synthesis are related to several pathologic conditions. Currently there are no available drugs capable to modulate the synthesis of leukotriene B 4 or to block its receptors. Here we show the inhibitory profile of alpha lipoic acid on the activity of leukotriene A 4 Hydrolase. Alpha lipoic acid inhibited both activities of the enzyme at concentrations lower than 10μM. The 5-lipoxygenase inhibitor zileuton, or the 5-lipoxygenase activating protein inhibitor MK-886, were unable to inhibit the activity of the enzyme. Acute promyelocytic leukaemia HL-60 cells were differentiated to leukotriene A 4 hydrolase expressing neutrophil-like cells. Alpha lipoic acid inhibited the aminopeptidase activity of the cytosolic fraction from neutrophil-like cells but had no effect on the cytosolic fraction from undifferentiated cells. Docking and molecular dynamic approximations revealed that alpha lipoic acid participates in electrostatic interactions with K-565 and R-563, which are key residues for the carboxylate group recognition of endogenous substrates by the enzyme. Alpha lipoic acid is a compound widely used in clinical practice, most of its therapeutic effects are associated with its antioxidants properties, however, antioxidant effect alone is unable to explain all clinical effects observed with alpha lipoic acid. Our results invite to evaluate the significance of the inhibitory effect of alpha lipoic acid on the catalytic activity of leukotriene A 4 hydrolase using in vivo models. Copyright © 2017 Elsevier B.V. All rights reserved.
Baas-Espinola, Fray M; Castro-Concha, Lizbeth A; Vázquez-Flota, Felipe A; Miranda-Ham, María L
2016-06-21
Capsaicinoids (CAP) are nitrogenous metabolites formed from valine (Val) and phenylalanine (Phe) in the placentas of hot Capsicum genotypes. Placentas of Habanero peppers can incorporate inorganic nitrogen into amino acids and have the ability to secure the availability of the required amino acids for CAP biosynthesis. In order to determine the participation of the placental tissue as a supplier of these amino acids, the effects of blocking the synthesis of Val and Phe by using specific enzyme inhibitors were analyzed. Isolated placentas maintained in vitro were used to rule out external sources' participation. Blocking Phe synthesis, through the inhibition of arogenate dehydratase, significantly decreased CAP accumulation suggesting that at least part of Phe required in this process has to be produced in situ. Chlorsulfuron inhibition of acetolactate synthase, involved in Val synthesis, decreased not only Val accumulation but also that of CAP, pointing out that the requirement for this amino acid can also be fulfilled by this tissue. The presented data demonstrates that CAP accumulation in in vitro maintained placentas can be accomplished through the in situ availability of Val and Phe and suggests that the synthesis of the fatty acid chain moiety may be a limiting factor in the biosynthesis of these alkaloids.
Fouda, Abd El-Aziz S; Al-Sarawy, Ahmed A; Radwan, Mohamed S
2006-01-01
The effect of furfural benzoylhydrazone and its derivatives (I-VII) as corrosion inhibitors for C-steel in 1M phosphoric acid solution has been studied by weight-loss and galvanostatic polarization techniques. A significant decrease in the corrosion rate of C-steel was observed in the presence of the investigated inhibitors. This study revealed that, the inhibition efficiency increases with increasing the inhibitor concentration, and the addition of iodide ions enhances it to a considerable extent. The effect of temperature on the inhibition efficiency of these compounds was studied using weight-loss method. Activation energy (E(a)*) and other thermodynamic parameters for the corrosion process were calculated and discussed. The galvanostatic polarization data indicated that, the inhibitors were of mixed-type, but the cathode is more polarized than the anode. The adsorption of these compounds on C-steel surface has been found to obey Frumkin's adsorption isotherm. The mechanism of inhibition was discussed in the light of the chemical structure of the undertaken inhibitors.
Moroni, Flavio; Carpenedo, Raffaella; Cozzi, Andrea; Meli, Elena; Chiarugi, Alberto; Pellegrini-Giampietro, Domenico E
2003-01-01
Kynurenine 3-mono-oxygenase (KMO) inhibitors facilitate kynurenic acid (KYNA) neosynthesis and reduce the formation of 3OH-kynurenine (3-HK) and quinolinic acid (QUIN). They also attenuate post-ischemic brain damage and decrease glutamate (Glu) content in brain extracellular spaces. To investigate KMO mechanism(s) of neuroprotection, we performed experiments in gerbils subjected to bilateral carotid occlusion and in organotypic rat hippocampal slice cultures exposed to oxygen and glucose deprivation (OGD). In gerbils, direct application of KYNA (100 nM, through reverse microdialysis in the hippocampus) completely prevented the increase in Glu output induced by transient (5 min) occlusion of the carotids. In rat hippocampal slices exposed for 30 min to OGD, KMO inhibitors (m-nitrobenzoyl)-alanine (mNBA, 30-100 microM) or 3,4-dimethoxy-[-N-4-(nitrophenyl)thiazol-2yl]-benzenesulfonamide (Ro 61-8048, 1-10 microM) reduced post-ischemic neuronal death and increased KYNA concentrations in the incubation medium. KYNA may antagonize glycineb or alpha7 nicotinic acetylcholine receptors but the concentrations in the incubation medium never reached values that could efficiently antagonize receptor function. On the contrary, 3-HK (1-10 microM) added to slices exposed to OGD in the presence of KMO inhibitors completely prevented the neuroprotective effects of the inhibitors. Our findings suggest that KMO inhibitors reduce OGD-induced pyramidal cell death by decreasing 3-HK (and possibly QUIN) synthesis.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hempel, K.
1962-01-01
New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)