Science.gov

Sample records for acid synthesis pathway

  1. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway

    PubMed Central

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  2. Engineered Production of Short Chain Fatty Acid in Escherichia coli Using Fatty Acid Synthesis Pathway.

    PubMed

    Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z; Yazdani, Syed Shams

    2016-01-01

    Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817

  3. Exogenous fatty acids affect CDP-choline pathway to increase phosphatidylcholine synthesis in granular pneumocytes

    SciTech Connect

    Chander, A.; Gullo, J.; Reicherter, J.; Fisher, A.

    1987-05-01

    Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased only by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.

  4. Intersection of RNA Processing and the Type II Fatty Acid Synthesis Pathway in Yeast Mitochondria▿

    PubMed Central

    Schonauer, Melissa S.; Kastaniotis, Alexander J.; Hiltunen, J. Kalervo; Dieckmann, Carol L.

    2008-01-01

    Distinct metabolic pathways can intersect in ways that allow hierarchical or reciprocal regulation. In a screen of respiration-deficient Saccharomyces cerevisiae gene deletion strains for defects in mitochondrial RNA processing, we found that lack of any enzyme in the mitochondrial fatty acid type II biosynthetic pathway (FAS II) led to inefficient 5′ processing of mitochondrial precursor tRNAs by RNase P. In particular, the precursor containing both RNase P RNA (RPM1) and tRNAPro accumulated dramatically. Subsequent Pet127-driven 5′ processing of RPM1 was blocked. The FAS II pathway defects resulted in the loss of lipoic acid attachment to subunits of three key mitochondrial enzymes, which suggests that the octanoic acid produced by the pathway is the sole precursor for lipoic acid synthesis and attachment. The protein component of yeast mitochondrial RNase P, Rpm2, is not modified by lipoic acid in the wild-type strain, and it is imported in FAS II mutant strains. Thus, a product of the FAS II pathway is required for RNase P RNA maturation, which positively affects RNase P activity. In addition, a product is required for lipoic acid production, which is needed for the activity of pyruvate dehydrogenase, which feeds acetyl-coenzyme A into the FAS II pathway. These two positive feedback cycles may provide switch-like control of mitochondrial gene expression in response to the metabolic state of the cell. PMID:18779316

  5. Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1991-01-01

    The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.

  6. Bacterial Fatty Acid Synthesis and its Relationships with Polyketide Synthetic Pathways

    PubMed Central

    Cronan, John E.; Thomas, Jacob

    2014-01-01

    This review presents the most thoroughly studied bacterial fatty acid synthetic pathway, that of Escherichia coli and then discusses the exceptions to the E. coli pathway present in other bacteria. The known interrelationships between the fatty acid and polyketide synthetic pathways are also assessed, mainly in the Streptomyces group of bacteria. Finally, we present a compendium of methods for analysis of bacterial fatty acid synthetic pathways. PMID:19362649

  7. Identification of genes and pathways involved in the synthesis of Mead acid (20:3n-9), an indicator of essential fatty acid deficiency.

    PubMed

    Ichi, Ikuyo; Kono, Nozomu; Arita, Yuka; Haga, Shizuka; Arisawa, Kotoko; Yamano, Misato; Nagase, Mana; Fujiwara, Yoko; Arai, Hiroyuki

    2014-01-01

    In mammals, 5,8,11-eicosatrienoic acid (Mead acid, 20:3n-9) is synthesized from oleic acid during a state of essential fatty acid deficiency (EFAD). Mead acid is thought to be produced by the same enzymes that synthesize arachidonic acid and eicosapentaenoic acid, but the genes and the pathways involved in the conversion of oleic acid to Mead acid have not been fully elucidated. The levels of polyunsaturated fatty acids in cultured cells are generally very low compared to those in mammalian tissues. In this study, we found that cultured cells, such as NIH3T3 and Hepa1-6 cells, have significant levels of Mead acid, indicating that cells in culture are in an EFAD state under normal culture conditions. We then examined the effect of siRNA-mediated knockdown of fatty acid desaturases and elongases on the level of Mead acid, and found that knockdown of Elovl5, Fads1, or Fads2 decreased the level of Mead acid. This and the measured levels of possible intermediate products for the synthesis of Mead acid such as 18:2n-9, 20:1n-9 and 20:2n-9 in the knocked down cells indicate two pathways for the synthesis of Mead acid: pathway 1) 18:1n-9→(Fads2)→18:2n-9→(Elovl5)→20:2n-9→(Fads1)→20:3n-9 and pathway 2) 18:1n-9→(Elovl5)→20:1n-9→(Fads2)→20:2n-9→(Fads1)→20:3n-9. PMID:24184513

  8. Maintenance of essential amino acid synthesis pathways in the Blattabacterium cuenoti symbiont of a wood-feeding cockroach

    PubMed Central

    Tokuda, Gaku; Elbourne, Liam D. H.; Kinjo, Yukihiro; Saitoh, Seikoh; Sabree, Zakee; Hojo, Masaru; Yamada, Akinori; Hayashi, Yoshinobu; Shigenobu, Shuji; Bandi, Claudio; Paulsen, Ian T.; Watanabe, Hirofumi; Lo, Nathan

    2013-01-01

    In addition to harbouring intestinal symbionts, some animal species also possess intracellular symbiotic microbes. The relative contributions of gut-resident and intracellular symbionts to host metabolism, and how they coevolve are not well understood. Cockroaches and the termite Mastotermes darwiniensis present a unique opportunity to examine the evolution of spatially separated symbionts, as they harbour gut symbionts and the intracellular symbiont Blattabacterium cuenoti. The genomes of B. cuenoti from M. darwiniensis and the social wood-feeding cockroach Cryptocercus punctulatus are each missing most of the pathways for the synthesis of essential amino acids found in the genomes of relatives from non-wood-feeding hosts. Hypotheses to explain this pathway degradation include: (i) feeding on microbes present in rotting wood by ancestral hosts; (ii) the evolution of high-fidelity transfer of gut microbes via social behaviour. To test these hypotheses, we sequenced the B. cuenoti genome of a third wood-feeding species, the phylogenetically distant and non-social Panesthia angustipennis. We show that host wood-feeding does not necessarily lead to degradation of essential amino acid synthesis pathways in B. cuenoti, and argue that ancestral high-fidelity transfer of gut microbes best explains their loss in strains from M. darwiniensis and C. punctulatus. PMID:23515978

  9. Maintenance of essential amino acid synthesis pathways in the Blattabacterium cuenoti symbiont of a wood-feeding cockroach.

    PubMed

    Tokuda, Gaku; Elbourne, Liam D H; Kinjo, Yukihiro; Saitoh, Seikoh; Sabree, Zakee; Hojo, Masaru; Yamada, Akinori; Hayashi, Yoshinobu; Shigenobu, Shuji; Bandi, Claudio; Paulsen, Ian T; Watanabe, Hirofumi; Lo, Nathan

    2013-06-23

    In addition to harbouring intestinal symbionts, some animal species also possess intracellular symbiotic microbes. The relative contributions of gut-resident and intracellular symbionts to host metabolism, and how they coevolve are not well understood. Cockroaches and the termite Mastotermes darwiniensis present a unique opportunity to examine the evolution of spatially separated symbionts, as they harbour gut symbionts and the intracellular symbiont Blattabacterium cuenoti. The genomes of B. cuenoti from M. darwiniensis and the social wood-feeding cockroach Cryptocercus punctulatus are each missing most of the pathways for the synthesis of essential amino acids found in the genomes of relatives from non-wood-feeding hosts. Hypotheses to explain this pathway degradation include: (i) feeding on microbes present in rotting wood by ancestral hosts; (ii) the evolution of high-fidelity transfer of gut microbes via social behaviour. To test these hypotheses, we sequenced the B. cuenoti genome of a third wood-feeding species, the phylogenetically distant and non-social Panesthia angustipennis. We show that host wood-feeding does not necessarily lead to degradation of essential amino acid synthesis pathways in B. cuenoti, and argue that ancestral high-fidelity transfer of gut microbes best explains their loss in strains from M. darwiniensis and C. punctulatus. PMID:23515978

  10. The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

    SciTech Connect

    Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

    2013-11-15

    Highlights: •The function of the mitochondria fatty acid synthesis pathway is partially unknown. •Overexpression of the pathway causes transcriptional activation through PPARs. •Knock down of the pathway attenuates that activation. •The last enzyme in the pathway regulates its own transcription. •Products of the mtFASII pathway are able to drive nuclear transcription. -- Abstract: Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR-based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease.

  11. Altering the Mitochondrial Fatty Acid Synthesis (mtFASII) Pathway Modulates Cellular Metabolic States and Bioactive Lipid Profiles as Revealed by Metabolomic Profiling

    PubMed Central

    Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.

    2016-01-01

    Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735

  12. Integrated engineering of β-oxidation reversal and ω-oxidation pathways for the synthesis of medium chain ω-functionalized carboxylic acids.

    PubMed

    Clomburg, James M; Blankschien, Matthew D; Vick, Jacob E; Chou, Alexander; Kim, Seohyoung; Gonzalez, Ramon

    2015-03-01

    An engineered reversal of the β-oxidation cycle was exploited to demonstrate its utility for the synthesis of medium chain (6-10-carbons) ω-hydroxyacids and dicarboxylic acids from glycerol as the only carbon source. A redesigned β-oxidation reversal facilitated the production of medium chain carboxylic acids, which were converted to ω-hydroxyacids and dicarboxylic acids by the action of an engineered ω-oxidation pathway. The selection of a key thiolase (bktB) and thioesterase (ydiI) in combination with previously established core β-oxidation reversal enzymes, as well as the development of chromosomal expression systems for the independent control of pathway enzymes, enabled the generation of C6-C10 carboxylic acids and provided a platform for vector based independent expression of ω-functionalization enzymes. Using this approach, the expression of the Pseudomonas putida alkane monooxygenase system, encoded by alkBGT, in combination with all β-oxidation reversal enzymes resulted in the production of 6-hydroxyhexanoic acid, 8-hydroxyoctanoic acid, and 10-hydroxydecanoic acid. Following identification and characterization of potential alcohol and aldehyde dehydrogenases, chnD and chnE from Acinetobacter sp. strain SE19 were expressed in conjunction with alkBGT to demonstrate the synthesis of the C6-C10 dicarboxylic acids, adipic acid, suberic acid, and sebacic acid. The potential of a β-oxidation cycle with ω-oxidation termination pathways was further demonstrated through the production of greater than 0.8 g/L C6-C10 ω-hydroxyacids or about 0.5 g/L dicarboxylic acids of the same chain lengths from glycerol (an unrelated carbon source) using minimal media. PMID:25638687

  13. Novel Insights into Seed Fatty Acid Synthesis and Modification Pathways from Genetic Diversity and Quantitative Trait Loci Analysis of the Brassica C Genome1[OA

    PubMed Central

    Barker, Guy C.; Larson, Tony R.; Graham, Ian A.; Lynn, James R.; King, Graham J.

    2007-01-01

    Natural genetic variation in fatty acid synthesis and modification pathways determine the composition of vegetable oils, which are major components of human diet and renewable products. Based on known pathways we combined diversity and genetic analysis of metabolites to infer the existence of enzymes encoded by distinct loci, and associated these with specific elongation steps or subpathways. A total of 107 lines representing different Brassica genepools revealed considerable variation for 18 seed fatty acid products. The effect of genetic variation within a single biochemical step on subsequent products was demonstrated using a correlation matrix of scatterplots, and by calculating relative step yields. Surprisingly, diploid Brassica oleracea segregating populations had a similar range of variation for individual fatty acids as across the whole genepool. This allowed identification of 22 quantitative trait loci (QTL) associated with activity in the plastid, early stages of synthesis, desaturation, and elongases. Four QTL were assigned to early stages of synthesis, seven to subpathway specific or general elongase activity, one to ketoacyl acyl-carrier protein synthetase, and two each to fatty acid desaturase and either desaturase or fatty acyl-carrier protein thioesterase. An additional 10 QTL had distinct effects but were not assigned specific functions. Where contrasting behavior in more than one subpathway was detected, we inferred QTL specificity for particular combinations of substrate and product. The assignment of enzyme function to QTL was consistent with the known position of some Brassicaeae candidate genes and collinear regions of the Arabidopsis (Arabidopsis thaliana) genome. PMID:17573542

  14. Ascorbate Synthesis Pathway

    PubMed Central

    Gabbay, Kenneth H.; Bohren, Kurt M.; Morello, Roy; Bertin, Terry; Liu, Jeff; Vogel, Peter

    2010-01-01

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of d-glucuronate to l-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide ∼85 and ∼15% of l-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice (∼85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis. PMID:20410296

  15. Introduction of a bacterial acetyl-CoA synthesis pathway improves lactic acid production in Saccharomyces cerevisiae.

    PubMed

    Song, Ji-Yoon; Park, Joon-Song; Kang, Chang Duk; Cho, Hwa-Young; Yang, Dongsik; Lee, Seunghyun; Cho, Kwang Myung

    2016-05-01

    Acid-tolerant Saccharomyces cerevisiae was engineered to produce lactic acid by expressing heterologous lactate dehydrogenase (LDH) genes, while attenuating several key pathway genes, including glycerol-3-phosphate dehydrogenase1 (GPD1) and cytochrome-c oxidoreductase2 (CYB2). In order to increase the yield of lactic acid further, the ethanol production pathway was attenuated by disrupting the pyruvate decarboxylase1 (PDC1) and alcohol dehydrogenase1 (ADH1) genes. Despite an increase in lactic acid yield, severe reduction of the growth rate and glucose consumption rate owing to the absence of ADH1 caused a considerable decrease in the overall productivity. In Δadh1 cells, the levels of acetyl-CoA, a key precursor for biologically applicable components, could be insufficient for normal cell growth. To increase the cellular supply of acetyl-CoA, we introduced bacterial acetylating acetaldehyde dehydrogenase (A-ALD) enzyme (EC 1.2.1.10) genes into the lactic acid-producing S. cerevisiae. Escherichia coli-derived A-ALD genes, mhpF and eutE, were expressed and effectively complemented the attenuated acetaldehyde dehydrogenase (ALD)/acetyl-CoA synthetase (ACS) pathway in the yeast. The engineered strain, possessing a heterologous acetyl-CoA synthetic pathway, showed an increased glucose consumption rate and higher productivity of lactic acid fermentation. The production of lactic acid was reached at 142g/L with production yield of 0.89g/g and productivity of 3.55gL(-1)h(-1) under fed-batch fermentation in bioreactor. This study demonstrates a novel approach that improves productivity of lactic acid by metabolic engineering of the acetyl-CoA biosynthetic pathway in yeast. PMID:26384570

  16. α-Lipoic Acids Promote the Protein Synthesis of C2C12 Myotubes by the TLR2/PI3K Signaling Pathway.

    PubMed

    Jing, Yuanyuan; Cai, Xingcai; Xu, Yaqiong; Zhu, Canjun; Wang, Lina; Wang, Songbo; Zhu, Xiaotong; Gao, Ping; Zhang, Yongliang; Jiang, Qingyan; Shu, Gang

    2016-03-01

    Skeletal muscle protein turnover is regulated by endocrine hormones, nutrients, and inflammation. α-Lipoic acid (ALA) plays an important role in energy homeostasis. Therefore, the aim of this study was to investigate the effects of ALA on protein synthesis in skeletal muscles and reveal the underlying mechanism. ALA (25 μM) significantly increased the protein synthesis and phosphorylation of Akt, mTOR, and S6 in C2C12 myotubes with attenuated phosphorylation of AMPK, Ikkα/β, and eIF2α. Intraperitoneal injection of 50 mg/kg ALA also produced the same results in mouse gastrocnemius. Both the PI3K (LY294002) and mTOR (rapamycin) inhibitors abolished the effects of ALA on protein synthesis in the C2C12 myotubes. However, AICAR (AMPK agonist) failed to block the activation of mTOR and S6 by ALA. ALA increased TLR2 and MyD88 mRNA expression in the C2C12 myotubes. TLR2 knockdown by siRNA almost eliminated the effects of ALA on protein synthesis and the Akt/mTOR pathway in the C2C12 myotubes. Immunoprecipitation data showed that ALA enhanced the p85 subunit of PI3K binding to MyD88. These findings indicate that ALA induces protein synthesis and the PI3K/Akt signaling pathway by TLR2. PMID:26855124

  17. Statins and the squalene synthase inhibitor zaragozic acid stimulate the non-amyloidogenic pathway of amyloid-beta protein precursor processing by suppression of cholesterol synthesis.

    PubMed

    Kojro, Elzbieta; Füger, Petra; Prinzen, Claudia; Kanarek, Anna Maria; Rat, Dorothea; Endres, Kristina; Fahrenholz, Falk; Postina, Rolf

    2010-01-01

    Cholesterol-lowering drugs such as statins influence the proteolytic processing of the amyloid-beta protein precursor (AbetaPP) and are reported to stimulate the activity of alpha-secretase, the major preventive secretase of Alzheimer's disease. Statins can increase the alpha-secretase activity by their cholesterol-lowering properties as well as by impairment of isoprenoids synthesis. In the present study, we elucidate the contribution of these pathways in alpha-secretase activation. We demonstrate that zaragozic acid, a potent inhibitor of squalene synthase which blocks cholesterol synthesis but allows synthesis of isoprenoids, also stimulates alpha-secretase activity. Treatment of human neuroblastoma cells with 50 microM zaragozic acid resulted in a approximately 3 fold increase of alpha-secretase activity and reduced cellular cholesterol by approximately 30%. These effects were comparable to results obtained from cells treated with a low lovastatin concentration (2 microM). Zaragozic acid-stimulated secretion of alpha-secretase-cleaved soluble AbetaPP was dose dependent and saturable. Lovastatin- or zaragozic acid-stimulated increase of alpha-secretase activity was completely abolished by a selective ADAM10 inhibitor. By targeting the alpha-secretase ADAM10 to lipid raft domains via a glycosylphosphatidylinositol anchor, we demonstrate that ADAM10 is unable to cleave AbetaPP in a cholesterol-rich environment. Our results indicate that inhibition of cholesterol biosynthesis by a low lovastatin concentration is sufficient for alpha-secretase activation. PMID:20413873

  18. Synthesis of amino acids

    DOEpatents

    Davis, J.W. Jr.

    1979-09-21

    A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  19. Synthesis of (+)-Coronafacic Acid

    PubMed Central

    Taber, Douglass F.; Sheth, Ritesh B.; Tian, Weiwei

    2009-01-01

    An enantioselective synthesis of (+)-coronafacic acid has been achieved. Rhodium catalyzed cyclization of an α-diazoester provided the intermediate cyclopentanone in high enantiomeric purity. Subsequent Fe-mediated cyclocarbonylation of a derived alkenyl cyclopropane gave a bicyclic enone, that then was hydrogenated and carried on to the natural product. PMID:19231870

  20. Alternative isoleucine synthesis pathway in cyanobacterial species.

    PubMed

    Wu, Bing; Zhang, Baichen; Feng, Xueyang; Rubens, Jacob R; Huang, Rick; Hicks, Leslie M; Pakrasi, Himadri B; Tang, Yinjie J

    2010-02-01

    Cyanothece sp. ATCC 51142 is an aerobic N(2)-fixing and hydrogen-producing cyanobacterium. Isotopomer analysis of its amino acids revealed an identical labelling profile for leucine and isoleucine when Cyanothece 51142 was grown mixotrophically using 2-(13)C-labelled glycerol as the main carbon source. This indicated that Cyanothece 51142 employs the atypical alternative citramalate pathway for isoleucine synthesis, with pyruvate and acetyl-CoA as precursors. Utilization of the citramalate pathway was confirmed by an enzyme assay and LC-MS/MS analysis. Furthermore, the genome sequence of Cyanothece 51142 shows that the gene encoding the key enzyme (threonine ammonia-lyase) in the normal isoleucine pathway is missing. Instead, the cce_0248 gene in Cyanothece 51142 exhibits 53 % identity to the gene encoding citramalate synthase (CimA, GSU1798) from Geobacter sulfurreducens. Reverse-transcription PCR indicated that the cce_0248 gene is expressed and its transcriptional level is lower in medium with isoleucine than in isoleucine-free medium. Additionally, a blast search for citramalate synthase and threonine ammonia-lyase implies that this alternative isoleucine synthesis pathway may be present in other cyanobacteria, such as Cyanothece and Synechococcus. This suggests that the pathway is more widespread than originally thought, as previous identifications of the citramalate pathway are limited to mostly anaerobic bacteria or archaea. Furthermore, this discovery opens the possibility that such autrotrophic micro-organisms may be engineered for robust butanol and propanol production from 2-ketobutyrate, which is an intermediate in the isoleucine biosynthesis pathway. PMID:19875435

  1. Analysis of Δ12-fatty acid desaturase function revealed that two distinct pathways are active for the synthesis of PUFAs in T. aureum ATCC 34304

    PubMed Central

    Matsuda, Takanori; Sakaguchi, Keishi; Hamaguchi, Rie; Kobayashi, Takumi; Abe, Eriko; Hama, Yoichiro; Hayashi, Masahiro; Honda, Daiske; Okita, Yuji; Sugimoto, Shinichi; Okino, Nozomu; Ito, Makoto

    2012-01-01

    Thraustochytrids are known to synthesize PUFAs such as docosahexaenoic acid (DHA). Accumulating evidence suggests the presence of two synthetic pathways of PUFAs in thraustochytrids: the polyketide synthase-like (PUFA synthase) and desaturase/elongase (standard) pathways. It remains unclear whether the latter pathway functions in thraustochytrids. In this study, we report that the standard pathway produces PUFA in Thraustochytrium aureum ATCC 34304. We isolated a gene encoding a putative Δ12-fatty acid desaturase (TauΔ12des) from T. aureum. Yeasts transformed with the tauΔ12des converted endogenous oleic acid (OA) into linoleic acid (LA). The disruption of the tauΔ12des in T. aureum by homologous recombination resulted in the accumulation of OA and a decrease in the levels of LA and its downstream PUFAs. However, the DHA content was increased slightly in tauΔ12des-disruption mutants, suggesting that DHA is primarily produced in T. aureum via the PUFA synthase pathway. The transformation of the tauΔ12des-disruption mutants with a tauΔ12des expression cassette restored the wild-type fatty acid profiles. These data clearly indicate that TauΔ12des functions as Δ12-fatty acid desaturase in the standard pathway of T. aureum and demonstrate that this thraustochytrid produces PUFAs via both the PUFA synthase and the standard pathways. PMID:22368282

  2. Analysis of Δ12-fatty acid desaturase function revealed that two distinct pathways are active for the synthesis of PUFAs in T. aureum ATCC 34304.

    PubMed

    Matsuda, Takanori; Sakaguchi, Keishi; Hamaguchi, Rie; Kobayashi, Takumi; Abe, Eriko; Hama, Yoichiro; Hayashi, Masahiro; Honda, Daiske; Okita, Yuji; Sugimoto, Shinichi; Okino, Nozomu; Ito, Makoto

    2012-06-01

    Thraustochytrids are known to synthesize PUFAs such as docosahexaenoic acid (DHA). Accumulating evidence suggests the presence of two synthetic pathways of PUFAs in thraustochytrids: the polyketide synthase-like (PUFA synthase) and desaturase/elongase (standard) pathways. It remains unclear whether the latter pathway functions in thraustochytrids. In this study, we report that the standard pathway produces PUFA in Thraustochytrium aureum ATCC 34304. We isolated a gene encoding a putative Δ12-fatty acid desaturase (TauΔ12des) from T. aureum. Yeasts transformed with the tauΔ12des converted endogenous oleic acid (OA) into linoleic acid (LA). The disruption of the tauΔ12des in T. aureum by homologous recombination resulted in the accumulation of OA and a decrease in the levels of LA and its downstream PUFAs. However, the DHA content was increased slightly in tauΔ12des-disruption mutants, suggesting that DHA is primarily produced in T. aureum via the PUFA synthase pathway. The transformation of the tauΔ12des-disruption mutants with a tauΔ12des expression cassette restored the wild-type fatty acid profiles. These data clearly indicate that TauΔ12des functions as Δ12-fatty acid desaturase in the standard pathway of T. aureum and demonstrate that this thraustochytrid produces PUFAs via both the PUFA synthase and the standard pathways. PMID:22368282

  3. Inhibition of de novo Palmitate Synthesis by Fatty Acid Synthase Induces Apoptosis in Tumor Cells by Remodeling Cell Membranes, Inhibiting Signaling Pathways, and Reprogramming Gene Expression

    PubMed Central

    Ventura, Richard; Mordec, Kasia; Waszczuk, Joanna; Wang, Zhaoti; Lai, Julie; Fridlib, Marina; Buckley, Douglas; Kemble, George; Heuer, Timothy S.

    2015-01-01

    Inhibition of de novo palmitate synthesis via fatty acid synthase (FASN) inhibition provides an unproven approach to cancer therapy with a strong biological rationale. FASN expression increases with tumor progression and associates with chemoresistance, tumor metastasis, and diminished patient survival in numerous tumor types. TVB-3166, an orally-available, reversible, potent, and selective FASN inhibitor induces apoptosis, inhibits anchorage-independent cell growth under lipid-rich conditions, and inhibits in-vivo xenograft tumor growth. Dose-dependent effects are observed between 20–200 nM TVB-3166, which agrees with the IC50 in biochemical FASN and cellular palmitate synthesis assays. Mechanistic studies show that FASN inhibition disrupts lipid raft architecture, inhibits biological pathways such as lipid biosynthesis, PI3K–AKT–mTOR and β-catenin signal transduction, and inhibits expression of oncogenic effectors such as c-Myc; effects that are tumor-cell specific. Our results demonstrate that FASN inhibition has anti-tumor activities in biologically diverse preclinical tumor models and provide mechanistic and pharmacologic evidence that FASN inhibition presents a promising therapeutic strategy for treating a variety of cancers, including those expressing mutant K-Ras, ErbB2, c-Met, and PTEN. The reported findings inform ongoing studies to link mechanisms of action with defined tumor types and advance the discovery of biomarkers supporting development of FASN inhibitors as cancer therapeutics. Research in context Fatty acid synthase (FASN) is a vital enzyme in tumor cell biology; the over-expression of FASN is associated with diminished patient prognosis and resistance to many cancer therapies. Our data demonstrate that selective and potent FASN inhibition with TVB-3166 leads to selective death of tumor cells, without significant effect on normal cells, and inhibits in vivo xenograft tumor growth at well-tolerated doses. Candidate biomarkers for

  4. Phosphatidic Acid Synthesis in Bacteria

    PubMed Central

    Yao, Jiangwei; Rock, Charles O.

    2012-01-01

    Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

  5. The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis

    NASA Technical Reports Server (NTRS)

    Morowitz, Harold; Peterson, Eta; Chang, Sherwood

    1995-01-01

    This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.

  6. Synthesis of tertiary arylamines: Lewis acid-catalyzed direct reductive N-alkylation of secondary amines with ketones through an alternative pathway.

    PubMed

    Nayal, Onkar S; Thakur, Maheshwar S; Bhatt, Vinod; Kumar, Manoranjan; Kumar, Neeraj; Singh, Bikram; Sharma, Upendra

    2016-08-11

    We report herein a highly efficient, tin(ii)/PMHS catalyzed reductive N-alkylation of arylamines with ketones affording tertiary arylamines. A very wide substrate scope was observed for the current catalytic method as all six permutations of ketones/aldehydes/heterocyclic carbonyls and primary/secondary/heterocyclic amines were well tolerated, enabling access to secondary, tertiary and heterocyclic amines. The method is also convenient for the synthesis of N-substituted isoindolinones and phthalazinones via a tandem amination-amidation sequence. Mechanistic investigations revealed a carbocationic pathway instead of an ordinary direct reductive amination pathway. PMID:27363507

  7. Genetic mapping of QTLs controlling fatty acids provided insights into the genetic control of fatty acid synthesis pathway in peanut (Arachis hypogaea L.)

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C1...

  8. Genetic Mapping of QTLs Controlling Fatty Acids Provided Insights into the Genetic Control of Fatty Acid Synthesis Pathway in Peanut (Arachis hypogaea L.)

    PubMed Central

    Wang, Hui; Qiao, Lixian; Feng, Suping; Tonnis, Brandon; Barkley, Noelle A.; Pinnow, David; Holbrook, Corley C.; Culbreath, Albert K.; Varshney, Rajeev K.; Guo, Baozhu

    2015-01-01

    Peanut, a high-oil crop with about 50% oil content, is either crushed for oil or used as edible products. Fatty acid composition determines the oil quality which has high relevance to consumer health, flavor, and shelf life of commercial products. In addition to the major fatty acids, oleic acid (C18:1) and linoleic acid (C18:2) accounting for about 80% of peanut oil, the six other fatty acids namely palmitic acid (C16:0), stearic acid (C18:0), arachidic acid (C20:0), gadoleic acid (C20:1), behenic acid (C22:0), and lignoceric acid (C24:0) are accounted for the rest 20%. To determine the genetic basis and to improve further understanding on effect of FAD2 genes on these fatty acids, two recombinant inbred line (RIL) populations namely S-population (high oleic line ‘SunOleic 97R’ × low oleic line ‘NC94022’) and T-population (normal oleic line ‘Tifrunner’ × low oleic line ‘GT-C20’) were developed. Genetic maps with 206 and 378 marker loci for the S- and the T-population, respectively were used for quantitative trait locus (QTL) analysis. As a result, a total of 164 main-effect (M-QTLs) and 27 epistatic (E-QTLs) QTLs associated with the minor fatty acids were identified with 0.16% to 40.56% phenotypic variation explained (PVE). Thirty four major QTLs (>10% of PVE) mapped on five linkage groups and 28 clusters containing more than three QTLs were also identified. These results suggest that the major QTLs with large additive effects would play an important role in controlling composition of these minor fatty acids in addition to the oleic and linoleic acids in peanut oil. The interrelationship among these fatty acids should be considered while breeding for improved peanut genotypes with good oil quality and desired fatty acid composition. PMID:25849082

  9. Electron Transfer Pathways in Cholesterol Synthesis.

    PubMed

    Porter, Todd D

    2015-10-01

    Cholesterol synthesis in the endoplasmic reticulum requires electron input at multiple steps and utilizes both NADH and NADPH as the electron source. Four enzymes catalyzing five steps in the pathway require electron input: squalene monooxygenase, lanosterol demethylase, sterol 4α-methyl oxidase, and sterol C5-desaturase. The electron-donor proteins for these enzymes include cytochrome P450 reductase and the cytochrome b5 pathway. Here I review the evidence for electron donor protein requirements with these enzymes, the evidence for additional electron donor pathways, and the effect of deletion of these redox enzymes on cholesterol and lipid metabolism. PMID:26344922

  10. Vitamins and aging: pathways to NAD+ synthesis.

    PubMed

    Denu, John M

    2007-05-01

    Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction. PMID:17482537

  11. Increase of betulinic acid production in Saccharomyces cerevisiae by balancing fatty acids and betulinic acid forming pathways.

    PubMed

    Li, Jing; Zhang, Yansheng

    2014-04-01

    Betulinic acid is a plant-based triterpenoid that has been recognized for its antitumor and anti-HIV activities. The level of betulinic acid in its natural hosts is extremely low. In the present study, we constructed betulinic acid biosynthetic pathway in Saccharomyces cerevisiae by metabolic engineering. Given the betulinic acid forming pathways sharing the common substrate acetyl-CoA with fatty acid synthesis, the metabolic fluxes between the two pathways were varied by changing gene expressions, and their effects on betulinic acid production were investigated. We constructed nine S. cerevisiae strains representing nine combinations of the flux distributions between betulinic acid and fatty acid pathways. Our results demonstrated that it was possible to improve the betulinic acid production in S. cerevisiae while keeping a desirable growth phenotype by optimally balancing the carbon fluxes of the two pathways. Through modulating the expressions of the key genes on betulinic acid and fatty acid pathways, the difference in betulinic acid yield varied largely in the range of 0.01-1.92 mg L(-1) OD(-1). The metabolic engineering approach used in this study could be extended for synthesizing other triterpenoids in S. cerevisiae. PMID:24389702

  12. Biochemical pathways in seed oil synthesis.

    PubMed

    Bates, Philip D; Stymne, Sten; Ohlrogge, John

    2013-06-01

    Oil produced in plant seeds is utilized as a major source of calories for human nutrition, as feedstocks for non-food uses such as soaps and polymers, and can serve as a high-energy biofuel. The biochemical pathways leading to oil (triacylglycerol) synthesis in seeds involve multiple subcellular organelles, requiring extensive lipid trafficking. Phosphatidylcholine plays a central role in these pathways as a substrate for acyl modifications and likely as a carrier for the trafficking of acyl groups between organelles and membrane subdomains. Although much has been clarified regarding the enzymes and pathways responsible for acyl-group flux, there are still major gaps in our understanding. These include the identity of several key enzymes, how flux between alternative pathways is controlled and the specialized cell biology leading to biogenesis of oil bodies that store up to 80% of carbon in seeds. PMID:23529069

  13. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?

    PubMed

    Cook, Sam D; Nichols, David S; Smith, Jason; Chourey, Prem S; McAdam, Erin L; Quittenden, Laura; Ross, John J

    2016-06-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  14. Abiotic synthesis of fatty acids

    NASA Technical Reports Server (NTRS)

    Leach, W. W.; Nooner, D. W.; Oro, J.

    1978-01-01

    The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

  15. Orthogonal Fatty Acid Biosynthetic Pathway Improves Fatty Acid Ethyl Ester Production in Saccharomyces cerevisiae.

    PubMed

    Eriksen, Dawn T; HamediRad, Mohammad; Yuan, Yongbo; Zhao, Huimin

    2015-07-17

    Fatty acid ethyl esters (FAEEs) are a form of biodiesel that can be microbially produced via a transesterification reaction of fatty acids with ethanol. The titer of microbially produced FAEEs can be greatly reduced by unbalanced metabolism and an insufficient supply of fatty acids, resulting in a commercially inviable process. Here, we report on a pathway engineering strategy in Saccharomyces cerevisiae for enhancing the titer of microbially produced FAEEs by providing the cells with an orthogonal route for fatty acid synthesis. The fatty acids generated from this heterologous pathway would supply the FAEE production, safeguarding endogenous fatty acids for cellular metabolism and growth. We investigated the heterologous expression of a Type-I fatty acid synthase (FAS) from Brevibacterium ammoniagenes coupled with WS/DGAT, the wax ester synthase/acyl-coenzyme that catalyzes the transesterification reaction with ethanol. Strains harboring the orthologous fatty acid synthesis yielded a 6.3-fold increase in FAEE titer compared to strains without the heterologous FAS. Variations in fatty acid chain length and degree of saturation can affect the quality of the biodiesel; therefore, we also investigated the diversity of the fatty acid production profile of FAS enzymes from other Actinomyces organisms. PMID:25594225

  16. Metabolic Engineering of a Novel Muconic Acid Biosynthesis Pathway via 4-Hydroxybenzoic Acid in Escherichia coli

    PubMed Central

    Sengupta, Sudeshna; Goonewardena, Lakshani; Juturu, Veeresh

    2015-01-01

    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroFFBR, aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  17. Metabolic engineering of a novel muconic acid biosynthesis pathway via 4-hydroxybenzoic acid in Escherichia coli.

    PubMed

    Sengupta, Sudeshna; Jonnalagadda, Sudhakar; Goonewardena, Lakshani; Juturu, Veeresh

    2015-12-01

    cis,cis-Muconic acid (MA) is a commercially important raw material used in pharmaceuticals, functional resins, and agrochemicals. MA is also a potential platform chemical for the production of adipic acid (AA), terephthalic acid, caprolactam, and 1,6-hexanediol. A strain of Escherichia coli K-12, BW25113, was genetically modified, and a novel nonnative metabolic pathway was introduced for the synthesis of MA from glucose. The proposed pathway converted chorismate from the aromatic amino acid pathway to MA via 4-hydroxybenzoic acid (PHB). Three nonnative genes, pobA, aroY, and catA, coding for 4-hydroxybenzoate hydrolyase, protocatechuate decarboxylase, and catechol 1,2-dioxygenase, respectively, were functionally expressed in E. coli to establish the MA biosynthetic pathway. E. coli native genes ubiC, aroF(FBR), aroE, and aroL were overexpressed and the genes ptsH, ptsI, crr, and pykF were deleted from the E. coli genome in order to increase the precursors of the proposed MA pathway. The final engineered E. coli strain produced nearly 170 mg/liter of MA from simple carbon sources in shake flask experiments. The proposed pathway was proved to be functionally active, and the strategy can be used for future metabolic engineering efforts for production of MA from renewable sugars. PMID:26362984

  18. Genetics Home Reference: congenital bile acid synthesis defect type 1

    MedlinePlus

    ... bile acid synthesis defect type 1 congenital bile acid synthesis defect type 1 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 1 is a disorder characterized ...

  19. Genetics Home Reference: congenital bile acid synthesis defect type 2

    MedlinePlus

    ... bile acid synthesis defect type 2 congenital bile acid synthesis defect type 2 Enable Javascript to view ... PDF Open All Close All Description Congenital bile acid synthesis defect type 2 is a disorder characterized ...

  20. Hydroxamic Acids in Asymmetric Synthesis

    PubMed Central

    Li, Zhi; Yamamoto, Hisashi

    2012-01-01

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst’s center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Due to their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless Asymmetric Epoxidation, which uses titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless Asymmetric Epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  1. Hydroxamic acids in asymmetric synthesis.

    PubMed

    Li, Zhi; Yamamoto, Hisashi

    2013-02-19

    Metal-catalyzed stereoselective reactions are a central theme in organic chemistry research. In these reactions, the stereoselection is achieved predominantly by introducing chiral ligands at the metal catalyst's center. For decades, researchers have sought better chiral ligands for asymmetric catalysis and have made great progress. Nevertheless, to achieve optimal stereoselectivity and to catalyze new reactions, new chiral ligands are needed. Because of their high metal affinity, hydroxamic acids play major roles across a broad spectrum of fields from biochemistry to metal extraction. Dr. K. Barry Sharpless first revealed their potential as chiral ligands for asymmetric synthesis in 1977: He published the chiral vanadium-hydroxamic-acid-catalyzed, enantioselective epoxidation of allylic alcohols before his discovery of Sharpless asymmetric epoxidation, which uses the titanium-tartrate complex as the chiral reagent. However, researchers have reported few highly enantioselective reactions using metal-hydroxamic acid as catalysts since then. This Account summarizes our research on metal-catalyzed asymmetric epoxidation using hydroxamic acids as chiral ligands. We designed and synthesized a series of new hydroxamic acids, most notably the C2-symmetric bis-hydroxamic acid (BHA) family. V-BHA-catalyzed epoxidation of allylic and homoallylic alcohols achieved higher activity and stereoselectivity than Sharpless asymmetric epoxidation in many cases. Changing the metal species led to a series of unprecedented asymmetric epoxidation reactions, such as (i) single olefins and sulfides with Mo-BHA, (ii) homoallylic and bishomoallylic alcohols with Zr- and Hf-BHA, and (iii) N-alkenyl sulfonamides and N-sulfonyl imines with Hf-BHA. These reactions produce uniquely functionalized chiral epoxides with good yields and enantioselectivities. PMID:23157425

  2. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages

    PubMed Central

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A.; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  3. Signaling Pathways Related to Protein Synthesis and Amino Acid Concentration in Pig Skeletal Muscles Depend on the Dietary Protein Level, Genotype and Developmental Stages.

    PubMed

    Liu, Yingying; Li, Fengna; Kong, Xiangfeng; Tan, Bie; Li, Yinghui; Duan, Yehui; Blachier, François; Hu, Chien-An A; Yin, Yulong

    2015-01-01

    Muscle growth is regulated by the homeostatic balance of the biosynthesis and degradation of muscle proteins. To elucidate the molecular interactions among diet, pig genotype, and physiological stage, we examined the effect of dietary protein concentration, pig genotype, and physiological stages on amino acid (AA) pools, protein deposition, and related signaling pathways in different types of skeletal muscles. The study used 48 Landrace pigs and 48 pure-bred Bama mini-pigs assigned to each of 2 dietary treatments: lower/GB (Chinese conventional diet)- or higher/NRC (National Research Council)-protein diet. Diets were fed from 5 weeks of age to respective market weights of each genotype. Samples of biceps femoris muscle (BFM, type I) and longissimus dorsi muscle (LDM, type II) were collected at nursery, growing, and finishing phases according to the physiological stage of each genotype, to determine the AA concentrations, mRNA levels for growth-related genes in muscles, and protein abundances of mechanistic target of rapamycin (mTOR) signaling pathway. Our data showed that the concentrations of most AAs in LDM and BFM of pigs increased (P<0.05) gradually with increasing age. Bama mini-pigs had generally higher (P<0.05) muscle concentrations of flavor-related AA, including Met, Phe, Tyr, Pro, and Ser, compared with Landrace pigs. The mRNA levels for myogenic determining factor, myogenin, myocyte-specific enhancer binding factor 2 A, and myostatin of Bama mini-pigs were higher (P<0.05) than those of Landrace pigs, while total and phosphorylated protein levels for protein kinase B, mTOR, and p70 ribosomal protein S6 kinases (p70S6K), and ratios of p-mTOR/mTOR, p-AKT/AKT, and p-p70S6K/p70S6K were lower (P<0.05). There was a significant pig genotype-dependent effect of dietary protein on the levels for mTOR and p70S6K. When compared with the higher protein-NRC diet, the lower protein-GB diet increased (P<0.05) the levels for mTOR and p70S6K in Bama mini-pigs, but

  4. Salicylic Acid Inhibits Synthesis of Proteinase Inhibitors in Tomato Leaves Induced by Systemin and Jasmonic Acid.

    PubMed Central

    Doares, S. H.; Narvaez-Vasquez, J.; Conconi, A.; Ryan, C. A.

    1995-01-01

    Salicylic acid (SA) and acetylsalicylic acid (ASA), previously shown to inhibit proteinase inhibitor synthesis induced by wounding, oligouronides (H.M. Doherty, R.R. Selvendran, D.J. Bowles [1988] Physiol Mol Plant Pathol 33: 377-384), and linolenic acid (H. Pena-Cortes, T. Albrecht, S. Prat, E.W. Weiler, L. Willmitzer [1993] Planta 191: 123-128), are shown here to be potent inhibitors of systemin-induced and jasmonic acid (JA)-induced synthesis of proteinase inhibitor mRNAs and proteins. The inhibition by SA and ASA of proteinase inhibitor synthesis induced by systemin and JA, as well as by wounding and oligosaccharide elicitors, provides further evidence that both oligosaccharide and polypeptide inducer molecules utilize the octadecanoid pathway to signal the activation of proteinase inhibitor genes. Tomato (Lycopersicon esculentum) leaves were pulse labeled with [35S]methionine, followed by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, and the inhibitory effects of SA are shown to be specific for the synthesis of a small number of JA-inducible proteins that includes the proteinase inhibitors. Previous results have shown that SA inhibits the conversion of 13S-hydroperoxy linolenic acid to 12-oxo-phytodienoic acid, thereby inhibiting the signaling pathway by blocking synthesis of JA. Here we report that the inhibition of synthesis of proteinase inhibitor proteins and mRNAs by SA in both light and darkness also occurs at a step in the signal transduction pathway, after JA synthesis but preceding transcription of the inhibitor genes. PMID:12228577

  5. Cyclic phosphatidic acid and lysophosphatidic acid induce hyaluronic acid synthesis via CREB transcription factor regulation in human skin fibroblasts.

    PubMed

    Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko

    2014-09-01

    Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. PMID:24845645

  6. Abscisic Acid Synthesis and Response

    PubMed Central

    Finkelstein, Ruth

    2013-01-01

    Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463

  7. Fatty acid synthesis is inhibited by inefficient utilization of unusual fatty acids for glycerolipid assembly

    PubMed Central

    Bates, Philip D.; Johnson, Sean R.; Cao, Xia; Li, Jia; Nam, Jeong-Won; Jaworski, Jan G.; Ohlrogge, John B.; Browse, John

    2014-01-01

    Degradation of unusual fatty acids through β-oxidation within transgenic plants has long been hypothesized as a major factor limiting the production of industrially useful unusual fatty acids in seed oils. Arabidopsis seeds expressing the castor fatty acid hydroxylase accumulate hydroxylated fatty acids up to 17% of total fatty acids in seed triacylglycerols; however, total seed oil is also reduced up to 50%. Investigations into the cause of the reduced oil phenotype through in vivo [14C]acetate and [3H]2O metabolic labeling of developing seeds surprisingly revealed that the rate of de novo fatty acid synthesis within the transgenic seeds was approximately half that of control seeds. RNAseq analysis indicated no changes in expression of fatty acid synthesis genes in hydroxylase-expressing plants. However, differential [14C]acetate and [14C]malonate metabolic labeling of hydroxylase-expressing seeds indicated the in vivo acetyl–CoA carboxylase activity was reduced to approximately half that of control seeds. Therefore, the reduction of oil content in the transgenic seeds is consistent with reduced de novo fatty acid synthesis in the plastid rather than fatty acid degradation. Intriguingly, the coexpression of triacylglycerol synthesis isozymes from castor along with the fatty acid hydroxylase alleviated the reduced acetyl–CoA carboxylase activity, restored the rate of fatty acid synthesis, and the accumulation of seed oil was substantially recovered. Together these results suggest a previously unidentified mechanism that detects inefficient utilization of unusual fatty acids within the endoplasmic reticulum and activates an endogenous pathway for posttranslational reduction of fatty acid synthesis within the plastid. PMID:24398521

  8. Development of a model describing regulation of casein synthesis by the mammalian target of rapamycin (mTOR) signaling pathway in response to insulin, amino acids, and acetate.

    PubMed

    Castro, J J; Arriola Apelo, S I; Appuhamy, J A D R N; Hanigan, M D

    2016-08-01

    To improve dietary protein use efficiency in lactating cows, mammary protein synthesis responses to AA, energy substrates, and hormones must be better understood. These entities exert their effects through stimulation of mRNA translation via control of initiation and elongation rates at the cellular level. A central protein kinase of this phenomenon is the mammalian target of rapamycin (mTOR), which transfers the nutritional and hormonal stimuli onto a series of proteins downstream through a cascade of phosphorylation reactions that ultimately affect protein synthesis. The objective of this work was to further develop an existing mechanistic model of mTOR phosphorylation responses to insulin and total essential AA to include the effects of specific essential AA and acetate mediated by signaling proteins including protein kinase B (Akt), adenosine monophosphate activated protein kinase (AMPK), and mTOR and to add a representation of milk protein synthesis. Data from 6 experiments in MAC-T cells and mammary tissue slices previously conducted in our laboratory were assembled and used to parameterize the dynamic system of differential equations representing Akt, AMPK, and mTOR in their phosphorylated and dephosphorylated states and the resulting regulation of milk protein synthesis. The model predicted phosphorylated Akt, mTOR, AMPK, and casein synthesis rates with root mean square prediction errors of 16.8, 28.4, 33.0, and 54.9%, respectively. All other dependent variables were free of mean and slope bias, indicating an adequate representation of the data. Whereas mTOR was not very sensitive to changes in insulin or acetate levels, it was highly sensitive to leucine and isoleucine, and this signal appeared to be effectively transduced to casein synthesis. Although prior work had observed a relationship with additional essential AA, and data supporting those conclusions were present in the data set, we were unable to derive significant relationships with any essential

  9. Synthesis of new polysialic acid derivatives.

    PubMed

    Su, Yi; Kasper, Cornelia; Kirschning, Andreas; Dräger, Gerald; Berski, Silke

    2010-09-01

    In this paper we report the first synthesis of novel polysialic acid derivatives which is initiated by treatment of polysialic acid with EDC-HCl to yield the inter-residual delta-lactone. Subsequent reaction with amines or hydrazine gives the corresponding polysialic acid amides and hydrazide. Alkylation of the tetrabutylammonium salt of polysialic acid yields polysialic acid esters. In contrast a variety of N-derivatives of polysialic acid can be prepared starting from deacetylated polysialic acid. The N-derivatives prepared in this communication can be used for the Cu-catalyzed as well as Cu-free "click" chemistry. PMID:20602419

  10. PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.

    PubMed

    Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G

    2016-04-01

    Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans. PMID:26850107

  11. Amino Acid Synthesis in a Supercritical Carbon Dioxide - Water System

    PubMed Central

    Fujioka, Kouki; Futamura, Yasuhiro; Shiohara, Tomoo; Hoshino, Akiyoshi; Kanaya, Fumihide; Manome, Yoshinobu; Yamamoto, Kenji

    2009-01-01

    Mars is a CO2-abundant planet, whereas early Earth is thought to be also CO2-abundant. In addition, water was also discovered on Mars in 2008. From the facts and theory, we assumed that soda fountains were present on both planets, and this affected amino acid synthesis. Here, using a supercritical CO2/liquid H2O (10:1) system which mimicked crust soda fountains, we demonstrate production of amino acids from hydroxylamine (nitrogen source) and keto acids (oxylic acid sources). In this research, several amino acids were detected with an amino acid analyzer. Moreover, alanine polymers were detected with LC-MS. Our research lights up a new pathway in the study of life’s origin. PMID:19582225

  12. Flaviviruses Are Sensitive to Inhibition of Thymidine Synthesis Pathways

    PubMed Central

    Fischer, Matthew A.; Smith, Jessica L.; Shum, David; Stein, David A.; Parkins, Christopher; Bhinder, Bhavneet; Radu, Constantin; Hirsch, Alec J.; Djaballah, Hakim; Nelson, Jay A.

    2013-01-01

    Dengue virus has emerged as a global health threat to over one-third of humankind. As a positive-strand RNA virus, dengue virus relies on the host cell metabolism for its translation, replication, and egress. Therefore, a better understanding of the host cell metabolic pathways required for dengue virus infection offers the opportunity to develop new approaches for therapeutic intervention. In a recently described screen of known drugs and bioactive molecules, we observed that methotrexate and floxuridine inhibited dengue virus infections at low micromolar concentrations. Here, we demonstrate that all serotypes of dengue virus, as well as West Nile virus, are highly sensitive to both methotrexate and floxuridine, whereas other RNA viruses (Sindbis virus and vesicular stomatitis virus) are not. Interestingly, flavivirus replication was restored by folinic acid, a thymidine precursor, in the presence of methotrexate and by thymidine in the presence of floxuridine, suggesting an unexpected role for thymidine in flavivirus replication. Since thymidine is not incorporated into RNA genomes, it is likely that increased thymidine production is indirectly involved in flavivirus replication. A possible mechanism is suggested by the finding that p53 inhibition restored dengue virus replication in the presence of floxuridine, consistent with thymidine-less stress triggering p53-mediated antiflavivirus effects in infected cells. Our data reveal thymidine synthesis pathways as new and unexpected therapeutic targets for antiflaviviral drug development. PMID:23824813

  13. Total synthesis of (+)-zaragozic acid C.

    PubMed

    Armstrong, A; Barsanti, P A; Jones, L H; Ahmed, G

    2000-10-20

    A total synthesis of (+)-zaragozic acid C is described. Key features of the synthesis are the use of a double Sharpless asymmetric dihydroxylation reaction of diene 6 to control stereochemistry at four contiguous stereocenters from C3 to C6; the introduction of the C1-side chain by reaction between the anion derived from the dithiane monosulfoxide 27 and the core aldehyde 12; a high yielding, acid-mediated simultaneous acetonide deprotection-dithiane removal-ketalization procedure leading exclusively to the 2, 8-dioxabicyclo[3.2.1]octane core 34; and a novel triple oxidation procedure allowing installation of the tricarboxylic acid. PMID:11031024

  14. Effect of aluminum (III) on the conversion of dopachrome in the melanin synthesis pathway

    NASA Astrophysics Data System (ADS)

    Di, Junwei; Bi, Shuping

    2003-06-01

    The effect of aluminum ions on the kinetics and mode of the conversion of dopachrome (DC) in acidic environment has been studied using UV-Vis spectrophotometric and cyclic voltammetric methods. The DC conversion step is an important reaction in melanogenesis. Aluminum ions catalyze greatly the decarboxylative transformation of DC to give 5,6-dihydroxyindole (DHI) rather than 5,6-dihydroxyindole-2-carboxylic acid (DHICA) at pH 5.5, which enhance the ratio of formation DHI/DHICA in melanin synthesis pathway. The kinetics of DC conversion catalyzed by aluminum ions is dependent on the concentration of DC and aluminum ions. These results provide evidence that aluminum ions could play a role in the synthesis of melanin pathway in acidic condition through catalyzing the DC decarboxylative transformation to yield DHI and influence the melanin structure and properties.

  15. Auxin Biosynthesis: Are the Indole-3-Acetic Acid and Phenylacetic Acid Biosynthesis Pathways Mirror Images?1[OPEN

    PubMed Central

    Nichols, David S.; Smith, Jason; Chourey, Prem S.; McAdam, Erin L.; Quittenden, Laura

    2016-01-01

    The biosynthesis of the main auxin in plants (indole-3-acetic acid [IAA]) has been elucidated recently and is thought to involve the sequential conversion of Trp to indole-3-pyruvic acid to IAA. However, the pathway leading to a less well studied auxin, phenylacetic acid (PAA), remains unclear. Here, we present evidence from metabolism experiments that PAA is synthesized from the amino acid Phe, via phenylpyruvate. In pea (Pisum sativum), the reverse reaction, phenylpyruvate to Phe, is also demonstrated. However, despite similarities between the pathways leading to IAA and PAA, evidence from mutants in pea and maize (Zea mays) indicate that IAA biosynthetic enzymes are not the main enzymes for PAA biosynthesis. Instead, we identified a putative aromatic aminotransferase (PsArAT) from pea that may function in the PAA synthesis pathway. PMID:27208245

  16. Nitrated fatty acids: Synthesis and measurement

    PubMed Central

    Woodcock, Steven R.; Bonacci, Gustavo; Gelhaus, Stacy L.; Schopfer, Francisco J.

    2012-01-01

    Nitrated fatty acids are the product of nitrogen dioxide reaction with unsaturated fatty acids. The discovery of peroxynitrite and peroxidase-induced nitration of biomolecules led to the initial reports of endogenous nitrated fatty acids. These species increase during ischemia reperfusion, but concentrations are often at or near the limits of detection. Here, we describe multiple methods for nitrated fatty acid synthesis, sample extraction from complex biological matrices, and a rigorous method of qualitative and quantitative detection of nitrated fatty acids by LC-MS. In addition, optimized instrument conditions and caveats regarding data interpretation are discussed. PMID:23200809

  17. The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

    PubMed Central

    Bates, Philip D.; Browse, John

    2012-01-01

    The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

  18. Genetic dissection of polyunsaturated fatty acid synthesis in Caenorhabditis elegans

    PubMed Central

    Watts, Jennifer L.; Browse, John

    2002-01-01

    Polyunsaturated fatty acids (PUFAs) are important membrane components and precursors of signaling molecules. To investigate the roles of these fatty acids in growth, development, and neurological function in an animal system, we isolated Caenorhabditis elegans mutants deficient in PUFA synthesis by direct analysis of fatty acid composition. C. elegans possesses all the desaturase and elongase activities to synthesize arachidonic acid and eicosapentaenoic acid from saturated fatty acid precursors. In our screen we identified mutants with defects in each fatty acid desaturation and elongation step of the PUFA biosynthetic pathway. The fatty acid compositions of the mutants reveal the substrate preferences of the desaturase and elongase enzymes and clearly demarcate the steps of this pathway. The mutants show that C. elegans does not require n3 or Δ5-unsaturated PUFAs for normal development under laboratory conditions. However, mutants with more severe PUFA deficiencies display growth and neurological defects. The mutants provide tools for investigating the roles of PUFAs in membrane biology and cell function in this animal model. PMID:11972048

  19. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  20. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

  1. Expression of Vibrio harveyi Acyl-ACP Synthetase Allows Efficient Entry of Exogenous Fatty Acids into the Escherichia coli Fatty Acid and Lipid A Synthetic Pathways

    PubMed Central

    Jiang, Yanfang; Morgan-Kiss, Rachael M.; Campbell, John W.; Chan, Chi Ho; Cronan, John E.

    2010-01-01

    Although the Escherichia coli fatty acid synthesis (FAS) pathway is the best studied type II fatty acid synthesis system, a major experimental limitation has been the inability to feed intermediates into the pathway in vivo because exogenously-supplied free fatty acids are not efficiently converted to the acyl-acyl carrier protein (ACP) thioesters required by the pathway. We report that expression of Vibrio harveyi acyl-ACP synthetase (AasS), a soluble cytosolic enzyme that ligates free fatty acids to ACP to form acyl-ACPs, allows exogenous fatty acids to enter the E. coli fatty acid synthesis pathway. The free fatty acids are incorporated intact and can be elongated or directly incorporated into complex lipids by acyltransferases specific for acyl-ACPs. Moreover, expression of AasS strains and supplementation with the appropriate fatty acid restored growth to E. coli mutant strains that lack essential fatty acid synthesis enzymes. Thus, this strategy provides a new tool for circumventing the loss of enzymes essential for FAS function. PMID:20028080

  2. Synthesis and Characterization of Fatty Acid Conjugates of Niacin and Salicylic Acid.

    PubMed

    Vu, Chi B; Bemis, Jean E; Benson, Ericka; Bista, Pradeep; Carney, David; Fahrner, Richard; Lee, Diana; Liu, Feng; Lonkar, Pallavi; Milne, Jill C; Nichols, Andrew J; Picarella, Dominic; Shoelson, Adam; Smith, Jesse; Ting, Amal; Wensley, Allison; Yeager, Maisy; Zimmer, Michael; Jirousek, Michael R

    2016-02-11

    This report describes the synthesis and preliminary biological characterization of novel fatty acid niacin conjugates and fatty acid salicylate conjugates. These molecular entities were created by covalently linking two bioactive molecules, either niacin or salicylic acid, to an omega-3 fatty acid. This methodology allows the simultaneous intracellular delivery of two bioactives in order to elicit a pharmacological response that could not be replicated by administering the bioactives individually or in combination. The fatty acid niacin conjugate 5 has been shown to be an inhibitor of the sterol regulatory element binding protein (SREBP), a key regulator of cholesterol metabolism proteins such as PCSK9, HMG-CoA reductase, ATP citrate lyase, and NPC1L1. On the other hand, the fatty acid salicylate conjugate 11 has been shown to have a unique anti-inflammatory profile based on its ability to modulate the NF-κB pathway through the intracellular release of the two bioactives. PMID:26784936

  3. Pinolenic Acid Downregulates Lipid Anabolic Pathway in HepG2 Cells.

    PubMed

    Lee, Ah Ron; Han, Sung Nim

    2016-07-01

    Pine nut oil (PNO) was reported to reduce lipid accumulation in the liver. However, the specific effect of pinolenic acid (18:3, all-cis-Δ5,9,12), a unique component of PNO, on lipid metabolism has not been studied. We hypothesized that pinolenic acid downregulates the lipid anabolic pathway in HepG2 cells. HepG2 cells were incubated in serum-free medium supplemented with 50 μM bovine serum albumin (BSA), palmitic acid, oleic acid, γ-linolenic acid, pinolenic acid, eicosapentaenoic acid (EPA), or α-linolenic acid for 24 h. Lipid accumulation was determined by Oil Red O (ORO) staining. The mRNA levels of genes related to fatty acid biosynthesis (SREBP1c, FAS, SCD1, and ACC1), fatty acid oxidation (ACC2, PPARα, CPT1A, and ACADL), cholesterol synthesis (SREBP2 and HMGCR), and lipoprotein uptake (LDLr) and of genes that may be involved in the downregulation of the lipogenic pathway (ACSL3, ACSL4, and ACSL5) were determined by qPCR. LDLR protein levels were measured by Western blot analysis. The mRNA levels of SREBP1c, FAS, and SCD1 were significantly downregulated by pinolenic acid treatment compared to BSA control (53, 54, and 38 % lower, respectively). In addition, the mRNA levels of HMGCR, ACSL3, and LDLr were significantly lower (30, 30, and 43 % lower, respectively), and ACSL4 tended to be lower in the pinolenic acid group (20 % lower, P = 0.082) relative to the control group. In conclusion, pinolenic acid downregulated the lipid anabolic pathway in HepG2 cells by reducing expression of genes related to lipid synthesis, lipoprotein uptake, and the regulation of the lipogenic pathway. PMID:27084371

  4. Polyamines in the Synthesis of Bacteriophage Deoxyribonucleic Acid. I. Lack of Dependence of Polyamine Synthesis on Bacteriophage Deoxyribonucleic Acid Synthesis

    PubMed Central

    Dion, Arnold S.; Cohen, Seymour S.

    1972-01-01

    To determine whether polyamine synthesis is dependent on deoxyribonucleic acid (DNA) synthesis, polyamine levels were estimated after infection of bacterial cells with ultraviolet-irradiated T4 or T4 am N 122, a DNA-negative mutant. Although phage DNA accumulation was restricted to various degrees in comparison to cells infected with T4D, nearly commensurate levels of putrescine and spermidine synthesis were observed after infection, regardless of the rate of phage DNA synthesis. We conclude from these data that polyamine synthesis after infection is independent of phage DNA synthesis. PMID:4552549

  5. Enantioselective Total Synthesis of Secalonic Acid E.

    PubMed

    Ganapathy, Dhandapani; Reiner, Johannes R; Löffler, Lorenz E; Ma, Ling; Gnanaprakasam, Boopathy; Niepötter, Benedikt; Koehne, Ingo; Tietze, Lutz F

    2015-11-16

    The first enantioselective synthesis of a secalonic acid containing a dimeric tetrahydroxanthenone skeleton is described, using a Wacker-type cyclization of a methoxyphenolic compound to form a chiral chroman with a quaternary carbon stereogenic center with >99% ee. Further steps are a Sharpless dihydroxylation and a Dieckmann condensation to give a tetrahydroxanthenone. A late-stage one-pot palladium-catalyzed Suzuki-dimerization reaction leads to the 2,2'-biphenol linkage to complete the enantioselective total synthesis of secalonic acid E in 18 steps with 8% overall yield. PMID:26447631

  6. [Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

    PubMed

    Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

    2016-03-01

    Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis. PMID:27349116

  7. Piperazic acid derivatives inhibit Gli1 in Hedgehog signaling pathway.

    PubMed

    Khatra, Harleen; Kundu, Jayanta; Khan, Pragya Paramita; Duttagupta, Indranil; Pattanayak, Sankha; Sinha, Surajit

    2016-09-15

    Piperazic acid, a non-proteinogenic amino acid, found in complex secondary metabolites and peptide natural substances, has shown down regulation of Gli1 expression in Hedgehog signaling pathway in cell based assays. Further structure activity relationship study indicated that amide derivatives of piperazic acid are more potent than piperazic acid itself, with little to no toxicity. However, other cellular components involved in the pathway were not affected. To the best of our knowledge, this is the first report on the inhibitory property of piperazic acid in this pathway. Hence, this molecule could serve as a useful tool for studying Hedgehog signaling. PMID:27528433

  8. Prolonged stimulation of muscle protein synthesis by leucine in neonates is dependent on amino acid availability

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rise in amino acids and insulin after a meal independently stimulate protein synthesis in skeletal muscle of neonates by activating the intracellular signalling pathways that regulate mRNA translation. Leucine, in particular, is important in mediating the response to amino acids. Previously, w...

  9. Biotin and Lipoic Acid: Synthesis, Attachment and Regulation

    PubMed Central

    Cronan, John E.

    2014-01-01

    Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses

  10. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2014-05-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise, and the BioH esterase is responsible for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl acyl carrier protein of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyltransferase followed by sulfur insertion at carbons C-6 and C-8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and, thus, there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA, a dual-function protein

  11. Biotin and Lipoic Acid: Synthesis, Attachment, and Regulation.

    PubMed

    Cronan, John E

    2008-09-01

    Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as "swinging arms" that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid was discovered 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway, in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like "arm" of biotin, were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase, followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized, and thus there is no transcriptional control of the synthetic genes. In contrast, transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system exerted through BirA, a dual-function protein that both represses

  12. Synthesis of (+) and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  13. Synthesis of (+)- and (-)-phaselic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    (2S)-Phaselic acid (2S-O-caffeoylmalate) is a common plant metabolite belonging to the o-diphenol subclass of phenolic secondary metabolites. Our interest in this metabolite stems from previous studies showing that the presence of (2S)-phaselic acid in red clover is crucial to the preservation of ut...

  14. Synthesis of pyromellitic acid esters

    NASA Technical Reports Server (NTRS)

    Fedorova, V. A.; Donchak, V. A.; Martynyuk-Lototskaya, A. N.

    1985-01-01

    The ester acids necessary for studyng the thermochemical properties of pyromellitic acid (PMK)-based peroxides were investigated. Obtaining a tetramethyl ester of a PMK was described. The mechanism of an esterification reaction is discussed, as is the complete esterification of PMK with primary alcohol.

  15. Evolutionary algorithm for metabolic pathways synthesis.

    PubMed

    Gerard, Matias F; Stegmayer, Georgina; Milone, Diego H

    2016-06-01

    Metabolic pathway building is an active field of research, necessary to understand and manipulate the metabolism of organisms. There are different approaches, mainly based on classical search methods, to find linear sequences of reactions linking two compounds. However, an important limitation of these methods is the exponential increase of search trees when a large number of compounds and reactions is considered. Besides, such models do not take into account all substrates for each reaction during the search, leading to solutions that lack biological feasibility in many cases. This work proposes a new evolutionary algorithm that allows searching not only linear, but also branched metabolic pathways, formed by feasible reactions that relate multiple compounds simultaneously. Tests performed using several sets of reactions show that this algorithm is able to find feasible linear and branched metabolic pathways. PMID:27080162

  16. Synthesis of higher monocarboxylic acids

    SciTech Connect

    Taikov, B.F.; Novakovskii, E.M.; Zhelkovskaya, V.P.; Shadrova, V.N.; Shcherbik, P.K.

    1981-01-01

    Brown-coal and peat waxes contain higher monocarboxylic acids, alcohols and esters of them as their main components. In view of this, considerable interest is presented by the preparation of individual compounds among those mentioned above, which is particularly important in the study of the composition and development of the optimum variants of the chemical processing of the waxes. In laboratory practice, to obtain higher monocarboxylic acids use is generally made of electrosynthesis according to Kolbe which permits unbranched higher aliphatic acids with given lengths of the hydrocarbon chain to be obtained. The aim of the present work was to synthesize higher monocarboxylic acids: arachidic, behenic, lignoceric, pentacosanoic, erotic, heptacosanoic, montanic, nonacosanoic, melissic, dotriacontanoic and tetratriacontanoic, which are present in waxes. Characteristics of synthesized acids are tabulated. 20 refs.

  17. Synthesis of nucleic acid methylphosphonothioates.

    PubMed Central

    Roelen, H C; de Vroom, E; van der Marel, G A; van Boom, J H

    1988-01-01

    The reagent obtained in situ by treating methylphosphonothioic dichloride with 1-hydroxy-6-trifluoromethylbenzotriazole could be used for the introduction of methylphosphonothioate linkages. The individual diastereomers of the protected dimer d-Tp(S,Me)A were applied in the synthesis of the chiral pure (R or S) hexamers d-[CpCpTp(S,Me)ApGpG]. The reagent showed also to be very effective for the preparation of the 3',5'-cyclic methylphosphonothioate of uridine. PMID:3412896

  18. Cross Talk between Nucleotide Synthesis Pathways with Cellular Immunity in Constraining Hepatitis E Virus Replication.

    PubMed

    Wang, Yijin; Wang, Wenshi; Xu, Lei; Zhou, Xinying; Shokrollahi, Ehsan; Felczak, Krzysztof; van der Laan, Luc J W; Pankiewicz, Krzysztof W; Sprengers, Dave; Raat, Nicolaas J H; Metselaar, Herold J; Peppelenbosch, Maikel P; Pan, Qiuwei

    2016-05-01

    in HEV infection and its potential for antiviral drug development. We show that targeting the later but not the early steps of the purine synthesis pathway exerts strong anti-HEV activity. In particular, IMP dehydrogenase (IMPDH) is the most important anti-HEV target of this cascade. Importantly, the clinically used IMPDH inhibitors, including mycophenolic acid and ribavirin, have potent anti-HEV activity. Furthermore, targeting the pyrimidine synthesis pathway also exerts potent antiviral activity against HEV. Interestingly, antiviral effects of nucleotide synthesis pathway inhibitors appear to depend on the medication-induced transcription of antiviral interferon-stimulated genes. Thus, this study reveals an unconventional novel mechanism as to how nucleotide synthesis pathway inhibitors can counteract HEV replication. PMID:26926637

  19. A new regulatory mechanism for bacterial lipoic acid synthesis

    PubMed Central

    Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

    2015-01-01

    Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

  20. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

    SciTech Connect

    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; Wang, Clay C.

    2014-09-29

    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  1. Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

    SciTech Connect

    Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; Wang, Clay C.

    2014-09-29

    Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

  2. Amino acid synthesis in Europa's subsurface environment

    NASA Astrophysics Data System (ADS)

    Abbas, Sam H.; Schulze-Makuch, Dirk

    2008-10-01

    It has been suggested that Europa's subsurface environment may provide a haven for prebiotic evolution and the development of exotic biotic systems. The detection of hydrogen peroxide, sulfuric acid, water, hydrates and related species on the surface, coupled with observed mobility of icebergs, suggests the presence of a substantial subsurface liquid reservoir that actively exchanges materials with the surface environment. The atmospheric, surface and subsurface environments are described with their known chemistry. Three synthetic schemes using hydrogen peroxide, sulfuric acid and hydrocyanic acid leading to the production of larger biologically important molecules such as amino acids are described. Metabolic pathways based on properties of the subsurface ocean environment are detailed. Tidal heating, osmotic gradients, chemical cycling, as well as hydrothermal vents, provide energy and materials that may support a course of prebiotic evolution leading to the development or sustenance of simple biotic systems. Putative organisms may employ metabolic pathways based on chemical oxidation reduction cycles occurring in the putative subsurface ocean environment.

  3. Synthesis of Alkyl Methylphosphonic Acid Esters

    SciTech Connect

    Mong, Gary M.; Harvey, Scott D.; Campbell, James A.

    2005-08-01

    This manuscript describes a simple synthesis and purification of cyclohexyl methylphosphonic and isopropyl methylphosphonic acids that provides high purity (>95% purity) product in gram quantities. Based on needs for improved analytical methods for indirect detection of nerve agent use, there is an increasing demand for these nerve agent hydrolysis products. These products are not commercially available. Synthesis is based on reaction of equimolar amounts of alcohol with methylphosphonic dichloride in toluene followed by the addition of excess water (two mole equivalents). The product was then extracted from the resulting aqueous layer into chloroform. The extraction scheme proved highly effective in removing unreacted starting materials and reaction by-products.

  4. Synthesis of alpha-amino acids

    DOEpatents

    Davis, Jr., Jefferson W.

    1983-01-01

    A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

  5. Synthesis of carbon-13-labeled tetradecanoic acids.

    PubMed

    Sparrow, J T; Patel, K M; Morrisett, J D

    1983-07-01

    The synthesis of tetradecanoic acid enriched with 13C at carbons 1, 3, or 6 is described. The label at the carbonyl carbon was introduced by treating 1-bromotridecane with K13CN (90% enriched) to form the 13C-labeled nitrile, which upon hydrolysis yielded the desired acid. The [3-13C]tetradecanoic acid was synthesized by alkylation of diethyl sodio-malonate with [1-13C]1-bromododecane; the acid was obtained upon saponification and decarboxylation. The label at the 6 position was introduced by coupling the appropriately labeled alkylcadmium chloride with the half acid chloride methyl ester of the appropriate dioic acid, giving the corresponding oxo fatty acid ester. Formation of the tosylhydrazone of the oxo-ester followed by reduction with sodium cyanoborohydride gave the labeled methyl tetradecanoate which, upon hydrolysis, yielded the desired tetradecanoic acid. All tetradecanoic acids were identical to unlabeled analogs as evaluated by gas-liquid chromatography and infrared or NMR spectroscopy. These labeled fatty acids were used subsequently to prepare the correspondingly labeled diacyl phosphatidylcholines. PMID:6631228

  6. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

    SciTech Connect

    Lake, April D.; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D.; Lu, Zhenqiang; Lehman-McKeeman, Lois D.; Cherrington, Nathan J.

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile acids

  7. Synthesis of alpha-amino acids

    DOEpatents

    Davis, J.W. Jr.

    1983-01-25

    A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

  8. Exploring De Novo metabolic pathways from pyruvate to propionic acid.

    PubMed

    Stine, Andrew; Zhang, Miaomin; Ro, Soo; Clendennen, Stephanie; Shelton, Michael C; Tyo, Keith E J; Broadbelt, Linda J

    2016-03-01

    Industrial biotechnology provides an efficient, sustainable solution for chemical production. However, designing biochemical pathways based solely on known reactions does not exploit its full potential. Enzymes are known to accept non-native substrates, which may allow novel, advantageous reactions. We have previously developed a computational program named Biological Network Integrated Computational Explorer (BNICE) to predict promiscuous enzyme activities and design synthetic pathways, using generalized reaction rules curated from biochemical reaction databases. Here, we use BNICE to design pathways synthesizing propionic acid from pyruvate. The currently known natural pathways produce undesirable by-products lactic acid and succinic acid, reducing their economic viability. BNICE predicted seven pathways containing four reaction steps or less, five of which avoid these by-products. Among the 16 biochemical reactions comprising these pathways, 44% were validated by literature references. More than 28% of these known reactions were not in the BNICE training dataset, showing that BNICE was able to predict novel enzyme substrates. Most of the pathways included the intermediate acrylic acid. As acrylic acid bioproduction has been well advanced, we focused on the critical step of reducing acrylic acid to propionic acid. We experimentally validated that Oye2p from Saccharomyces cerevisiae can catalyze this reaction at a slow turnover rate (10(-3) s(-1) ), which was unknown to occur with this enzyme, and is an important finding for further propionic acid metabolic engineering. These results validate BNICE as a pathway-searching tool that can predict previously unknown promiscuous enzyme activities and show that computational methods can elucidate novel biochemical pathways for industrial applications. © 2016 American Institute of Chemical Engineers Biotechnol. Prog., 32:303-311, 2016. PMID:26821575

  9. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis

    PubMed Central

    Arendt, Kristin L.; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M.; Tang, Yitai; Cho, Ahryon; Graef, Isabella A.; Chen, Lu

    2015-01-01

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca2+ levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca2+-levels to RA synthesis remains unknown. Here we identify the Ca2+-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca2+-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  10. Calcineurin mediates homeostatic synaptic plasticity by regulating retinoic acid synthesis.

    PubMed

    Arendt, Kristin L; Zhang, Zhenjie; Ganesan, Subhashree; Hintze, Maik; Shin, Maggie M; Tang, Yitai; Cho, Ahryon; Graef, Isabella A; Chen, Lu

    2015-10-20

    Homeostatic synaptic plasticity is a form of non-Hebbian plasticity that maintains stability of the network and fidelity for information processing in response to prolonged perturbation of network and synaptic activity. Prolonged blockade of synaptic activity decreases resting Ca(2+) levels in neurons, thereby inducing retinoic acid (RA) synthesis and RA-dependent homeostatic synaptic plasticity; however, the signal transduction pathway that links reduced Ca(2+)-levels to RA synthesis remains unknown. Here we identify the Ca(2+)-dependent protein phosphatase calcineurin (CaN) as a key regulator for RA synthesis and homeostatic synaptic plasticity. Prolonged inhibition of CaN activity promotes RA synthesis in neurons, and leads to increased excitatory and decreased inhibitory synaptic transmission. These effects of CaN inhibitors on synaptic transmission are blocked by pharmacological inhibitors of RA synthesis or acute genetic deletion of the RA receptor RARα. Thus, CaN, acting upstream of RA, plays a critical role in gating RA signaling pathway in response to synaptic activity. Moreover, activity blockade-induced homeostatic synaptic plasticity is absent in CaN knockout neurons, demonstrating the essential role of CaN in RA-dependent homeostatic synaptic plasticity. Interestingly, in GluA1 S831A and S845A knockin mice, CaN inhibitor- and RA-induced regulation of synaptic transmission is intact, suggesting that phosphorylation of GluA1 C-terminal serine residues S831 and S845 is not required for CaN inhibitor- or RA-induced homeostatic synaptic plasticity. Thus, our study uncovers an unforeseen role of CaN in postsynaptic signaling, and defines CaN as the Ca(2+)-sensing signaling molecule that mediates RA-dependent homeostatic synaptic plasticity. PMID:26443861

  11. Cytochrome P450 epoxygenase pathway of polyunsaturated fatty acid metabolism

    PubMed Central

    Spector, Arthur A.; Kim, Hee-Yong

    2014-01-01

    Polyunsaturated fatty acids (PUFA) are oxidized by cytochrome P450 epoxygenases to PUFA epoxides which function as potent lipid mediators. The major metabolic pathways of PUFA epoxides are incorporation into phospholipids and hydrolysis to the corresponding PUFA diols by soluble epoxide hydrolase. Inhibitors of soluble epoxide hydrolase stabilize PUFA epoxides and potentiate their functional effects. The epoxyeicosatrienoic acids (EETs) synthesized from arachidonic acid produce vasodilation, stimulate angiogenesis, have anti-inflammatory actions, and protect the heart against ischemia-reperfusion injury. EETs produce these functional effects by activating receptor-mediated signaling pathways and ion channels. The epoxyeicosatetraenoic acids synthesized from eicosapentaenoic acid and epoxydocosapentaenoic acids synthesized from docosahexaenoic acid are potent inhibitors of cardiac arrhythmias. Epoxydocosapentaenoic acids also inhibit angiogenesis, decrease inflammatory and neuropathic pain, and reduce tumor metastasis. These findings indicate that a number of the beneficial functions of PUFA may be due to their conversion to PUFA epoxides. PMID:25093613

  12. Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

    NASA Astrophysics Data System (ADS)

    Fu, Qi; Socki, Richard A.; Niles, Paul B.

    2015-04-01

    Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

  13. Expression of fatty acid synthesis genes and fatty acid accumulation in haematococcus pluvialis under different stressors

    PubMed Central

    2012-01-01

    Background Biofuel has been the focus of intensive global research over the past few years. The development of 4th generation biofuel production (algae-to-biofuels) based on metabolic engineering of algae is still in its infancy, one of the main barriers is our lacking of understanding of microalgal growth, metabolism and biofuel production. Although fatty acid (FA) biosynthesis pathway genes have been all cloned and biosynthesis pathway was built up in some higher plants, the molecular mechanism for its regulation in microalgae is far away from elucidation. Results We cloned main key genes for FA biosynthesis in Haematococcus pluvialis, a green microalga as a potential biodiesel feedstock, and investigated the correlations between their expression alternation and FA composition and content detected by GC-MS under different stress treatments, such as nitrogen depletion, salinity, high or low temperature. Our results showed that high temperature, high salinity, and nitrogen depletion treatments played significant roles in promoting microalgal FA synthesis, while FA qualities were not changed much. Correlation analysis showed that acyl carrier protein (ACP), 3-ketoacyl-ACP-synthase (KAS), and acyl-ACP thioesterase (FATA) gene expression had significant correlations with monounsaturated FA (MUFA) synthesis and polyunsaturated FA (PUFA) synthesis. Conclusions We proposed that ACP, KAS, and FATA in H. pluvialis may play an important role in FA synthesis and may be rate limiting genes, which probably could be modified for the further study of metabolic engineering to improve microalgal biofuel quality and production. PMID:22448811

  14. Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

  15. Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

    PubMed Central

    Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

    2014-01-01

    Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

  16. trans-Caffeic acid stearyl ester from Paeonia suffruticosa inhibits melanin synthesis by cAMP-mediating down-regulation of α-melanocyte-stimulating hormone-stimulated melanogenesis signaling pathway in B16 cells.

    PubMed

    Liang, Chia-Hua; Chou, Tzung-Han; Tseng, Ya-Ping; Ding, Hsiou-Yu

    2012-01-01

    trans-Caffeic acid stearyl ester (TCASE) from the root cortex of Paeonia suffruticosa ANDREWS is a traditional medicinal herb that has several beneficial properties. However, the inhibitory effect of TCASE on melanogenesis has not been explored. In the cell viability assay, TCASE did not show a cytotoxic effect at a dose of 65 µM for 48 h in B16, HaCaT and Hs68 cells. TCASE considerably inhibits melanin synthesis, and reduces intracellular cyclic adenosine monophosphate (cAMP) levels, tyrosinase activity and L-3-(3,4-dihydroxyphenyl)-alanine (DOPA) oxidase activity in a concentration-dependent manner in the presence of α-melanocyte-stimulating hormone (α-MSH) in B16 cells, and the inhibition efficiency of TCASE exceeds that of ascorbic acid and arbutin. TCASE reduces melanocortin-1 receptor (MC1R), microphthalmia transcription factor (MITF), tyrosinase, tyrosinase-related protein-2 (TRP-2) and TRP-1 mRNA and protein levels in B16 cells. Based on the findings, TCASE is posited to inhibit melanogenesis signaling while suppressing cAMP levels and, subsequently, MC1R, MITF, tyrosinase, TRP-2 and TRP-1 down-regulation, resulting in the suppression of tyrosinase activity, DOPA oxidase activity and melanin synthesis. PMID:23207771

  17. Modified branched-chain amino acid pathways give rise to acyl acids of sucrose esters exuded from tobacco leaf trichomes.

    PubMed

    Kandra, G; Severson, R; Wagner, G J

    1990-03-10

    A major diversion of carbon from branched-chain amino acid biosynthesis/catabolism to form acyl moieties of sucrose esters (6-O-acetyl-2,3,4-tri-O-acyl-alpha-D-glucopyranosyl-beta-D- fructofuranosides) was observed to be associated with specialized trichome head cells which secrete large amounts of sucrose esters. Surface chemistry and acetyl and acyl substituent groups of tobacco (T.I. 1068) sucrose esters were identified and quantified by gas chromatography/mass spectrometry. Sucrose esters were prominent surface constituents and 3-methylvaleric acid, 2- and 3-methylbutyric acid, and methylpropionic acid accounted for 60%, 25% and 9%, respectively, of total C3--C7 acyl substituents. Radiolabeled Thr, Ile, Val, Leu, pyruvate and Asp, metabolites of branched-chain amino acid pathways, were compared with radioactively labeled acetate and sucrose as donors of carbon to sucrose, acetyl and acyl components of sucrose esters using epidermal peels with undisturbed trichomes. Preparations of biosynthetically competent trichome heads (site of sucrose ester formation) were also examined. Results indicate that 3-methylvaleryl and 2-methylbutyryl groups are derived from the Thr pathway of branched-chain amino acid metabolism, 3-methylbutyryl and methylpropionyl groups are formed via the pyruvate pathway, and that acetyl groups are principally formed directly via acetyl-CoA. Arguments are presented which rule out participation of fatty acid synthase in the formation of prominent acyl acids. Results suggest that the shunting of carbon away from the biosynthesis of Val, Leu and Ile may be due to a low level of amino acid utilization in protein synthesis in specialized glandular head cells of trichomes. This would result in the availability of corresponding oxo acids for CoA activation and esterification to form sucrose esters. Preliminary evidence was found for the involvement of cycling reactions in oxo-acid-chain lengthening and for utilization of pyruvate-derived 2

  18. New approaches to target the mycolic acid biosynthesis pathway for the development of tuberculosis therapeutics.

    PubMed

    North, E Jeffrey; Jackson, Mary; Lee, Richard E

    2014-01-01

    Mycolic acids are the major lipid components of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose- containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  19. New Approaches to Target the Mycolic Acid Biosynthesis Pathway for the Development of Tuberculosis Therapeutics

    PubMed Central

    North, E. Jeffrey; Jackson, Mary; Lee, Richard E.

    2015-01-01

    Mycolic acids are the major lipid component of the unique mycobacterial cell wall responsible for the protection of the tuberculosis bacilli from many outside threats. Mycolic acids are synthesized in the cytoplasm and transported to the outer membrane as trehalose-containing glycolipids before being esterified to the arabinogalactan portion of the cell wall and outer membrane glycolipids. The large size of these unique fatty acids is a result of a huge metabolic investment that has been evolutionarily conserved, indicating the importance of these lipids to the mycobacterial cellular survival. There are many key enzymes involved in the mycolic acid biosynthetic pathway, including fatty acid synthesis (KasA, KasB, MabA, InhA, HadABC), mycolic acid modifying enzymes (SAM-dependent methyltransferases, aNAT), fatty acid activating and condensing enzymes (FadD32, Acc, Pks13), transporters (MmpL3) and tranferases (Antigen 85A-C) all of which are excellent potential drug targets. Not surprisingly, in recent years many new compounds have been reported to inhibit specific portions of this pathway, discovered through both phenotypic screening and target enzyme screening. In this review, we analyze the new and emerging inhibitors of this pathway discovered in the post-genomic era of tuberculosis drug discovery, several of which show great promise as selective tuberculosis therapeutics. PMID:24245756

  20. NANS-mediated synthesis of sialic acid is required for brain and skeletal development.

    PubMed

    van Karnebeek, Clara D M; Bonafé, Luisa; Wen, Xiao-Yan; Tarailo-Graovac, Maja; Balzano, Sara; Royer-Bertrand, Beryl; Ashikov, Angel; Garavelli, Livia; Mammi, Isabella; Turolla, Licia; Breen, Catherine; Donnai, Dian; Cormier, Valerie; Heron, Delphine; Nishimura, Gen; Uchikawa, Shinichi; Campos-Xavier, Belinda; Rossi, Antonio; Hennet, Thierry; Brand-Arzamendi, Koroboshka; Rozmus, Jacob; Harshman, Keith; Stevenson, Brian J; Girardi, Enrico; Superti-Furga, Giulio; Dewan, Tammie; Collingridge, Alissa; Halparin, Jessie; Ross, Colin J; Van Allen, Margot I; Rossi, Andrea; Engelke, Udo F; Kluijtmans, Leo A J; van der Heeft, Ed; Renkema, Herma; de Brouwer, Arjan; Huijben, Karin; Zijlstra, Fokje; Heisse, Thorben; Boltje, Thomas; Wasserman, Wyeth W; Rivolta, Carlo; Unger, Sheila; Lefeber, Dirk J; Wevers, Ron A; Superti-Furga, Andrea

    2016-07-01

    We identified biallelic mutations in NANS, the gene encoding the synthase for N-acetylneuraminic acid (NeuNAc; sialic acid), in nine individuals with infantile-onset severe developmental delay and skeletal dysplasia. Patient body fluids showed an elevation in N-acetyl-D-mannosamine levels, and patient-derived fibroblasts had reduced NANS activity and were unable to incorporate sialic acid precursors into sialylated glycoproteins. Knockdown of nansa in zebrafish embryos resulted in abnormal skeletal development, and exogenously added sialic acid partially rescued the skeletal phenotype. Thus, NANS-mediated synthesis of sialic acid is required for early brain development and skeletal growth. Normal sialylation of plasma proteins was observed in spite of NANS deficiency. Exploration of endogenous synthesis, nutritional absorption, and rescue pathways for sialic acid in different tissues and developmental phases is warranted to design therapeutic strategies to counteract NANS deficiency and to shed light on sialic acid metabolism and its implications for human nutrition. PMID:27213289

  1. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

    PubMed Central

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

    2015-01-01

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  2. Pathways of retinoid synthesis in mouse macrophages and bone marrow cells.

    PubMed

    Niu, Haixia; Hadwiger, Gayla; Fujiwara, Hideji; Welch, John S

    2016-06-01

    In vivo pathways of natural retinoid metabolism and elimination have not been well characterized in primary myeloid cells, even though retinoids and retinoid receptors have been strongly implicated in regulating myeloid maturation. With the use of a upstream activation sequence-GFP reporter transgene and retrovirally expressed Gal4-retinoic acid receptor α in primary mouse bone marrow cells, we identified 2 distinct enzymatic pathways used by mouse myeloid cells ex vivo to synthesize retinoic acid receptor α ligands from free vitamin A metabolites (retinyl acetate, retinol, and retinal). Bulk Kit(+) bone marrow progenitor cells use diethylaminobenzaldehyde-sensitive enzymes, whereas bone marrow-derived macrophages use diethylaminobenzaldehyde-insensitive enzymes to synthesize natural retinoic acid receptor α-activating retinoids (all-trans retinoic acid). Bone marrow-derived macrophages do not express the diethylaminobenzaldehyde-sensitive enzymes Aldh1a1, Aldh1a2, or Aldh1a3 but instead, express Aldh3b1, which we found is capable of diethylaminobenzaldehyde-insensitive synthesis of all trans-retinoic acid. However, under steady-state and stimulated conditions in vivo, diverse bone marrow cells and peritoneal macrophages showed no evidence of intracellular retinoic acid receptor α-activating retinoids, despite expression of these enzymes and a vitamin A-sufficient diet, suggesting that the enzymatic conversion of retinal is not the rate-limiting step in the synthesis of intracellular retinoic acid receptor α-activating retinoids in myeloid bone marrow cells and that retinoic acid receptor α remains in an unliganded configuration during adult hematopoiesis. PMID:26768478

  3. Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis.

    PubMed

    Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

    2015-07-01

    Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

  4. Akt phosphorylation and regulation of transketolase is a nodal point for amino acid control of purine synthesis.

    PubMed

    Saha, Arindam; Connelly, Stephen; Jiang, Jingjing; Zhuang, Shunhui; Amador, Deron T; Phan, Tony; Pilz, Renate B; Boss, Gerry R

    2014-07-17

    The phosphatidylinositol 3-kinase (PI3K)/Akt pathway integrates environmental clues to regulate cell growth and survival. We showed previously that depriving cells of a single essential amino acid rapidly and reversibly arrests purine synthesis. Here we demonstrate that amino acids via mammalian target of rapamycin 2 and IκB kinase regulate Akt activity and Akt association and phosphorylation of transketolase (TKT), a key enzyme of the nonoxidative pentose phosphate pathway (PPP). Akt phosphorylates TKT on Thr382, markedly enhancing enzyme activity and increasing carbon flow through the nonoxidative PPP, thereby increasing purine synthesis. Mice fed a lysine-deficient diet for 2 days show decreased Akt activity, TKT activity, and purine synthesis in multiple organs. These results provide a mechanism whereby Akt coordinates amino acid availability with glucose utilization, purine synthesis, and RNA and DNA synthesis. PMID:24981175

  5. A mutation affecting the synthesis of 4-chloroindole-3-acetic acid.

    PubMed

    Ross, John J; Tivendale, Nathan D; Davidson, Sandra E; Reid, James B; Davies, Noel W; Quittenden, Laura J; Smith, Jason A

    2012-12-01

    Traditionally, schemes depicting auxin biosynthesis in plants have been notoriously complex. They have involved up to four possible pathways by which the amino acid tryptophan might be converted to the main active auxin, indole-3-acetic acid (IAA), while another pathway was suggested to bypass tryptophan altogether. It was also postulated that different plants use different pathways, further adding to the complexity. In 2011, however, it was suggested that one of the four tryptophan-dependent pathways, via indole-3-pyruvic acid (IPyA), is the main pathway in Arabidopsis thaliana, although concurrent operation of one or more other pathways has not been excluded. We recently showed that, for seeds of Pisum sativum (pea), it is possible to go one step further. Our new evidence indicates that the IPyA pathway is the only tryptophan-dependent IAA synthesis pathway operating in pea seeds. We also demonstrated that the main auxin in developing pea seeds, 4-chloroindole-3-acetic acid (4-Cl-IAA), which accumulates to levels far exceeding those of IAA, is synthesized via a chlorinated version of the IPyA pathway. PMID:23073010

  6. Loss of nuclear receptor SHP impairs but does not eliminate negative feedback regulation of bile acid synthesis.

    PubMed

    Kerr, Thomas A; Saeki, Shigeru; Schneider, Manfred; Schaefer, Karen; Berdy, Sara; Redder, Thadd; Shan, Bei; Russell, David W; Schwarz, Margrit

    2002-06-01

    The in vivo role of the nuclear receptor SHP in feedback regulation of bile acid synthesis was examined. Loss of SHP in mice caused abnormal accumulation and increased synthesis of bile acids due to derepression of rate-limiting CYP7A1 and CYP8B1 hydroxylase enzymes in the biosynthetic pathway. Dietary bile acids induced liver damage and restored feedback regulation. A synthetic agonist of the nuclear receptor FXR was not hepatotoxic and had no regulatory effects. Reduction of the bile acid pool with cholestyramine enhanced CYP7A1 and CYP8B1 expression. We conclude that input from three negative regulatory pathways controls bile acid synthesis. One is mediated by SHP, and two are SHP independent and invoked by liver damage and changes in bile acid pool size. PMID:12062084

  7. Chemical Synthesis of a Hyaluronic Acid Decasaccharide

    PubMed Central

    Lu, Xiaowei; Kamat, Medha N.; Huang, Lijun; Huang, Xuefei

    2009-01-01

    The chemical synthesis of a hyaluronic acid decasaccharide using the pre-activation based chemoselective glycosylation strategy is described. Assembly of large oligosaccharides is generally challenging due to the increased difficulties in both glycosylation and deprotection. Indeed, the same building blocks previously employed for hyaluronic acid hexasaccharide syntheses failed to yield the desired decasaccharide. After extensive experimentation, the decasaccharide backbone was successfully constructed with an overall yield of 37% from disaccharide building blocks. The trichloroacetyl group was used as the nitrogen protective group for the glucosamine units and the addition of TMSOTf was found to be crucial to suppress the formation of trichloromethyl oxazoline side-product and enable high glycosylation yield. For deprotections, the combination of a mild basic condition and the monitoring methodology using 1H-NMR allowed the removal of all base-labile protective groups, which facilitated the generation of the fully deprotected HA decasaccharide. PMID:19764799

  8. Hyaluronic acid lipoate: synthesis and physicochemical properties.

    PubMed

    Picotti, Fabrizio; Fabbian, Matteo; Gianni, Rita; Sechi, Alessandra; Stucchi, Luca; Bosco, Marco

    2013-03-01

    The synthesis and physicochemical characterisation of mixed lipoic and formic esters of hyaluronan (Lipohyal) are presented in this paper. The synthesis was conducted by activating lipoic acid with 1,1'-carbonyldiimidazole to obtain lipoyl imidazolide, which reacted with hyaluronan (HA) in formamide under basic conditions. This procedure allows researchers to modulate easily the degree of substitution over a range of 0.05-1.8. Radical scavenger properties were analysed by UV-vis spectroscopy, where improved performance was demonstrated for Lipohyal with respect to the HA row material and lipoic acid. The chemical modification also causes HA to show an improved resistance to hyaluronidase digestion. These findings show that Lipohyal is a highly interesting derivative for applications in the tricological and dermo-cosmetic field and as an anti-aging ingredient. Moreover, Lipohyal can be easily crosslinked by UV irradiation, resulting in an innovative hydrogel with distinctive viscoelastic properties that is suitable as both a dermal-filler and as an intra-articular medical device. PMID:23465930

  9. Synthesis of novel acid electrolytes for phosphoric acid fuel cells

    NASA Astrophysics Data System (ADS)

    Adcock, James L.

    1988-11-01

    A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

  10. Variations in metabolic pathways create challenges for automated metabolic reconstructions: Examples from the tetrahydrofolate synthesis pathway

    PubMed Central

    de Crécy-Lagard, Valérie

    2014-01-01

    The availability of thousands of sequenced genomes has revealed the diversity of biochemical solutions to similar chemical problems. Even for molecules at the heart of metabolism, such as cofactors, the pathway enzymes first discovered in model organisms like Escherichia coli or Saccharomyces cerevisiae are often not universally conserved. Tetrahydrofolate (THF) (or its close relative tetrahydromethanopterin) is a universal and essential C1-carrier that most microbes and plants synthesize de novo. The THF biosynthesis pathway and enzymes are, however, not universal and alternate solutions are found for most steps, making this pathway a challenge to annotate automatically in many genomes. Comparing THF pathway reconstructions and functional annotations of a chosen set of folate synthesis genes in specific prokaryotes revealed the strengths and weaknesses of different microbial annotation platforms. This analysis revealed that most current platforms fail in metabolic reconstruction of variant pathways. However, all the pieces are in place to quickly correct these deficiencies if the different databases were built on each other's strengths. PMID:25210598

  11. Potency of individual bile acids to regulate bile acid synthesis and transport genes in primary human hepatocyte cultures.

    PubMed

    Liu, Jie; Lu, Hong; Lu, Yuan-Fu; Lei, Xiaohong; Cui, Julia Yue; Ellis, Ewa; Strom, Stephen C; Klaassen, Curtis D

    2014-10-01

    Bile acids (BAs) are known to regulate their own homeostasis, but the potency of individual bile acids is not known. This study examined the effects of cholic acid (CA), chenodeoxycholic acid (CDCA), deoxycholic acid (DCA), lithocholic acid (LCA) and ursodeoxycholic acid (UDCA) on expression of BA synthesis and transport genes in human primary hepatocyte cultures. Hepatocytes were treated with the individual BAs at 10, 30, and 100μM for 48 h, and RNA was extracted for real-time PCR analysis. For the classic pathway of BA synthesis, BAs except for UDCA markedly suppressed CYP7A1 (70-95%), the rate-limiting enzyme of bile acid synthesis, but only moderately (35%) down-regulated CYP8B1 at a high concentration of 100μM. BAs had minimal effects on mRNA of two enzymes of the alternative pathway of BA synthesis, namely CYP27A1 and CYP7B1. BAs increased the two major target genes of the farnesoid X receptor (FXR), namely the small heterodimer partner (SHP) by fourfold, and markedly induced fibroblast growth factor 19 (FGF19) over 100-fold. The BA uptake transporter Na(+)-taurocholate co-transporting polypeptide was unaffected, whereas the efflux transporter bile salt export pump was increased 15-fold and OSTα/β were increased 10-100-fold by BAs. The expression of the organic anion transporting polypeptide 1B3 (OATP1B3; sixfold), ATP-binding cassette (ABC) transporter G5 (ABCG5; sixfold), multidrug associated protein-2 (MRP2; twofold), and MRP3 (threefold) were also increased, albeit to lesser degrees. In general, CDCA was the most potent and effective BA in regulating these genes important for BA homeostasis, whereas DCA and CA were intermediate, LCA the least, and UDCA ineffective. PMID:25055961

  12. Ambient pressure synthesis of MIL-100(Fe) MOF from homogeneous solution using a redox pathway.

    PubMed

    Jeremias, Felix; Henninger, Stefan K; Janiak, Christoph

    2016-05-17

    Micro- to mesoporous iron(iii) trimesate MIL-100(Fe) is a MOF of high interest for numerous applications. With regard to large-scale synthesis, e.g., by continuous flow or the in situ deposition of coatings, a replacement for the conventional, hydrothermal low-yield fluoride-containing synthesis is desirable. In this contribution, we present a method to synthesize crystalline fluoride-free MIL-100(Fe) from iron(iii) nitrate and trimesic acid in zeotropic DMSO/water solution at normal ambient pressure involving a DMSO-nitrate redox pathway. Yields of 72%, surface areas of SBET = 1791 m(2) g(-1) and pore volumes of Vpore = 0.82 cm(3) g(-1) were achieved. PMID:27143562

  13. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha.

    PubMed

    Eklund, D Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L

    2015-06-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  14. Rapid synthesis of the 7-deoxy zaragozic acid core.

    PubMed

    Calter, Michael A; Zhu, Cheng; Lachicotte, Rene J

    2002-01-24

    [reaction: see text] We have developed an efficient synthesis of the 7-deoxy zaragozic acid core. The synthesis begins with a Feist-Bénary reaction that assembles all three carbons of the polycarboxylic acid portion of the core. This reaction is followed by highly diastereoselective aldol and dihydroxylation reactions that set the remaining stereocenters of the core. The synthesis finishes with lactol oxidation and lactone alcoholysis/ketal formation reactions to construct the bicyclic ring system of the core. PMID:11796052

  15. First total synthesis of prasinic acid and its anticancer activity.

    PubMed

    Chakor, Narayan; Patil, Ganesh; Writer, Diana; Periyasamy, Giridharan; Sharma, Rajiv; Roychowdhury, Abhijit; Mishra, Prabhu Dutt

    2012-11-01

    The first total synthesis of prasinic acid is being reported along with its biological evaluation. The ten step synthesis involved readily available and cheap starting materials and can easily be transposed to large scale manufacturing. The crucial steps of the synthesis included the formation of two different aromatic units (7 and 9) and their coupling reaction. The synthetic prasinic acid exhibited moderate antitumor activity (IC(50) 4.3-9.1 μM) in different lines of cancer cells. PMID:23031589

  16. Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.

    PubMed

    Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun

    2014-05-01

    cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites. PMID:24583236

  17. The general amino acid control pathway regulates mTOR and autophagy during serum/glutamine starvation

    PubMed Central

    Chen, Rui; Zou, Yilong; Mao, Dongxue; Sun, Daxiao; Gao, Guanguang; Shi, Jingwen; Liu, Xiaoqing; Zhu, Chen; Yang, Mingyu; Ye, Wanlu; Hao, Qianqian

    2014-01-01

    Organisms have evolved elaborate mechanisms to adjust intracellular nutrient levels in response to fluctuating availability of exogenous nutrients. During starvation, cells can enhance amino acid uptake and synthesis through the general amino acid control (GAAC) pathway, whereas nonessential cellular contents are recycled by autophagy. How these two pathways are coordinated in response to starvation is currently unknown. Here we show that the GAAC pathway couples exogenous amino acid availability with autophagy. Starvation caused deactivation of mTOR, which then activated autophagy. In parallel, serum/glutamine starvation activated the GAAC pathway, which up-regulated amino acid transporters, leading to increased amino acid uptake. This elevated the intracellular amino acid level, which in turn reactivated mTOR and suppressed autophagy. Knockdown of activating transcription factor 4, the major transcription factor in the GAAC pathway, or of SLC7A5, a leucine transporter, caused impaired mTOR reactivation and much higher levels of autophagy. Thus, the GAAC pathway modulates autophagy by regulating amino acid uptake and mTOR reactivation during serum/glutamine starvation. PMID:25049270

  18. Characterization of polyamine synthesis pathway in Bacillus subtilis 168.

    PubMed

    Sekowska, A; Bertin, P; Danchin, A

    1998-08-01

    The ubiquitous polyamines fulfil a variety of functions in all three kingdoms of life. However, little is known about the biosynthesis of these compounds in Gram-positive bacteria. We show that, in Bacillus subtilis, there is a single pathway to polyamines, starting from arginine, with agmatine as an intermediate. We first identified the structural gene of arginine decarboxylase, speA (formerly cad), and then described the speE speB operon, directing synthesis of spermidine synthase and agmatinase. This operon is transcribed into two messenger RNAs, a major one for the speE gene and a minor one for both speEand speB. The promoter of the operon was identified upstream from the speE gene by primer extension analysis. Transcription of this operon indicated that the level of agmatinase synthesis is very low, thus allowing a stringent control on the synthesis of putrescine and, therefore, of all polyamines. This is consistent with the level of polyamines measured in the cell. PMID:9723923

  19. Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

    ERIC Educational Resources Information Center

    Forster, Denis; DeKleva, Thomas W.

    1986-01-01

    Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

  20. Induction of Arabidopsis tryptophan pathway enzymes and camalexin by amino acid starvation, oxidative stress, and an abiotic elicitor.

    PubMed Central

    Zhao, J; Williams, C C; Last, R L

    1998-01-01

    The tryptophan (Trp) biosynthetic pathway leads to the production of many secondary metabolites with diverse functions, and its regulation is predicted to respond to the needs for both protein synthesis and secondary metabolism. We have tested the response of the Trp pathway enzymes and three other amino acid biosynthetic enzymes to starvation for aromatic amino acids, branched-chain amino acids, or methionine. The Trp pathway enzymes and cytosolic glutamine synthetase were induced under all of the amino acid starvation test conditions, whereas methionine synthase and acetolactate synthase were not. The mRNAs for two stress-inducible enzymes unrelated to amino acid biosynthesis and accumulation of the indolic phytoalexin camalexin were also induced by amino acid starvation. These results suggest that regulation of the Trp pathway enzymes under amino acid deprivation conditions is largely a stress response to allow for increased biosynthesis of secondary metabolites. Consistent with this hypothesis, treatments with the oxidative stress-inducing herbicide acifluorfen and the abiotic elicitor alpha-amino butyric acid induced responses similar to those induced by the amino acid starvation treatments. The role of salicylic acid in herbicide-mediated Trp and camalexin induction was investigated. PMID:9501110

  1. Role of the fatty acid breakdown pathway in the leaf

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Components of the lipid breakdown pathway including beta-oxidation enzymes and fatty acid transport mechanisms are essential for mobilizing storage lipid in germinating seeds of many plants. Comparatively little is known about their role during the rest of the plant’s life-time, however. We are cur...

  2. PATHWAY FOR THE DISSIMILATION OF ITACONIC AND MESACONIC ACIDS.

    PubMed

    Brightman, V; Martin, W R

    1961-09-01

    Brightman, Vernon (The University of Chicago, Chicago), and William R. Martin. Pathway for the dissimilation of itaconic and mesaconic acids. J. Bacteriol. 82:376-382. 1961.-Studies on the oxidation of itaconic and mesaconic acids by a Pseudomonas sp., adapted to utilize either of these acids as a sole carbon source, have provided evidence for a pathway converting both itaconate and mesaconate to succinate. A metabolic interconversion of itaconate, mesaconate, and citramalate has also been demonstrated by whole cell and cell-free enzyme studies. Succinate derived from methylene-labeled itaconate was found to be labeled in the inside carbon atoms, a fact which indicates that the branched chain compound was converted into a straight chain molecule by a shift of the methylene carbon (C-5) from the side chain of itaconate to a position between C-2 and C-3 in an, as yet, unknown straight chain intermediate prior to its conversion to succinate. PMID:16561921

  3. Identification of an itaconic acid degrading pathway in itaconic acid producing Aspergillus terreus.

    PubMed

    Chen, Mei; Huang, Xuenian; Zhong, Chengwei; Li, Jianjun; Lu, Xuefeng

    2016-09-01

    Itaconic acid, one of the most promising and flexible bio-based chemicals, is mainly produced by Aspergillus terreus. Previous studies to improve itaconic acid production in A. terreus through metabolic engineering were mainly focused on its biosynthesis pathway, while the itaconic acid-degrading pathway has largely been ignored. In this study, we used transcriptomic, proteomic, bioinformatic, and in vitro enzymatic analyses to identify three key enzymes, itaconyl-CoA transferase (IctA), itaconyl-CoA hydratase (IchA), and citramalyl-CoA lyase (CclA), that are involved in the catabolic pathway of itaconic acid in A. terreus. In the itaconic acid catabolic pathway in A. terreus, itaconic acid is first converted by IctA into itaconyl-CoA with succinyl-CoA as the CoA donor, and then itaconyl-CoA is hydrated into citramalyl-CoA by IchA. Finally, citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by CclA. Moreover, IctA can also catalyze the reaction between citramalyl-CoA and succinate to generate succinyl-CoA and citramalate. These results, for the first time, identify the three key enzymes, IctA, IchA, and CclA, involved in the itaconic acid degrading pathway in itaconic acid producing A. terreus. The results will facilitate the improvement of itaconic acid production by metabolically engineering the catabolic pathway of itaconic acid in A. terreus. PMID:27102125

  4. Flux Balance Analysis of Mycolic Acid Pathway: Targets for Anti-Tubercular Drugs

    PubMed Central

    Raman, Karthik; Rajagopalan, Preethi; Chandra, Nagasuma

    2005-01-01

    Mycobacterium tuberculosis is the focus of several investigations for design of newer drugs, as tuberculosis remains a major epidemic despite the availability of several drugs and a vaccine. Mycobacteria owe many of their unique qualities to mycolic acids, which are known to be important for their growth, survival, and pathogenicity. Mycolic acid biosynthesis has therefore been the focus of a number of biochemical and genetic studies. It also turns out to be the pathway inhibited by front-line anti-tubercular drugs such as isoniazid and ethionamide. Recent years have seen the emergence of systems-based methodologies that can be used to study microbial metabolism. Here, we seek to apply insights from flux balance analyses of the mycolic acid pathway (MAP) for the identification of anti-tubercular drug targets. We present a comprehensive model of mycolic acid synthesis in the pathogen M. tuberculosis involving 197 metabolites participating in 219 reactions catalysed by 28 proteins. Flux balance analysis (FBA) has been performed on the MAP model, which has provided insights into the metabolic capabilities of the pathway. In silico systematic gene deletions and inhibition of InhA by isoniazid, studied here, provide clues about proteins essential for the pathway and hence lead to a rational identification of possible drug targets. Feasibility studies using sequence analysis of the M. tuberculosis H37Rv and human proteomes indicate that, apart from the known InhA, potential targets for anti-tubercular drug design are AccD3, Fas, FabH, Pks13, DesA1/2, and DesA3. Proteins identified as essential by FBA correlate well with those previously identified experimentally through transposon site hybridisation mutagenesis. This study demonstrates the application of FBA for rational identification of potential anti-tubercular drug targets, which can indeed be a general strategy in drug design. The targets, chosen based on the critical points in the pathway, form a ready shortlist

  5. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

    PubMed Central

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-01-01

    The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  6. TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

    PubMed

    Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

    2016-01-01

    The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

  7. Ascorbic acid intake and oxalate synthesis.

    PubMed

    Knight, John; Madduma-Liyanage, Kumudu; Mobley, James A; Assimos, Dean G; Holmes, Ross P

    2016-08-01

    In humans, approximately 60 mg of ascorbic acid (AA) breaks down in the body each day and has to be replaced by a dietary intake of 70 mg in women and 90 mg in men to maintain optimal health and AA homeostasis. The breakdown of AA is non-enzymatic and results in oxalate formation. The exact amount of oxalate formed has been difficult to ascertain primarily due to the limited availability of healthy human tissue for such research and the difficulty in measuring AA and its breakdown products. The breakdown of 60 mg of AA to oxalate could potentially result in the formation of up to 30 mg oxalate per day. This exceeds our estimates of the endogenous production of 10-25 mg oxalate per day, indicating that degradative pathways that do not form oxalate exist. In this review, we examine what is known about the pathways of AA metabolism and how oxalate forms. We further identify how gaps in our knowledge may be filled to more precisely determine the contribution of AA breakdown to oxalate production in humans. The use of stable isotopes of AA to directly assess the conversion of vitamin to oxalate should help fill this void. PMID:27002809

  8. Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

    SciTech Connect

    Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.; Culley, David E.; Deng, Shuang; Collett, James R.; Umemura, Myco; Koike, Hideaki; Baker, Scott E.; Machida, Masa

    2013-01-01

    Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes we successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.

  9. Energetics of amino acid synthesis in hydrothermal ecosystems

    NASA Technical Reports Server (NTRS)

    Amend, J. P.; Shock, E. L.

    1998-01-01

    Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

  10. Oleic acid-enhanced transdermal delivery pathways of fluorescent nanoparticles

    NASA Astrophysics Data System (ADS)

    Lo, Wen; Ghazaryan, Ara; Tso, Chien-Hsin; Hu, Po-Sheng; Chen, Wei-Liang; Kuo, Tsung-Rong; Lin, Sung-Jan; Chen, Shean-Jen; Chen, Chia-Chun; Dong, Chen-Yuan

    2012-05-01

    Transdermal delivery of nanocarriers provides an alternative pathway to transport therapeutic agents, alleviating pain, improving compliance of patients, and increasing overall effectiveness of delivery. In this work, enhancement of transdermal delivery of fluorescent nanoparticles and sulforhodamine B with assistance of oleic acid was visualized utilizing multiphoton microscopy (MPM) and analyzed quantitatively using multi-photon excitation-induced fluorescent signals. Results of MPM imaging and MPM intensity-based spatial depth-dependent analysis showed that oleic acid is effective in facilitating transdermal delivery of nanoparticles.

  11. Enhanced production of fatty alcohols by engineering the TAGs synthesis pathway in Saccharomyces cerevisiae.

    PubMed

    Tang, Xiaoling; Chen, Wei Ning

    2015-02-01

    The production of fatty acid-derived chemicals has received a great deal of attention in recent years. In yeast cells, the main storage forms of fatty acids are TAGs. However, the conversion of TAGs into fatty acid derivatives suffers from a practical standpoint. Herein, a more direct strategy was applied to accumulate cellular fatty acyl-CoAs in Saccharomyces cerevisiae, which are the activated forms of fatty acids and used as important precursors for various converting enzymes. The dga1 gene was deleted to block the fatty acyl-CoAs dependent pathway of TAGs synthesis and a significant decrease in lipid content was observed. The FAR gene was cloned and overexpressed in the wild type strain and gene disrupted strain, to convert the fatty acyl-CoAs to the corresponding fatty acid derivatives. The metabolic engineered pathway resulted in enhanced production of fatty alcohols. Compared with the wild type strain with overexpressed FAR gene, the yield of fatty alcohols in the Δdga1 strain with FAR was dramatically increased: the intracellular fatty alcohols increased from 26 mg/L to 45 mg/L, while the extracellular fatty alcohols increased from 2.2 mg/L to 4.3 mg/L. By optimizing the culture medium with increased carbon concentration and limited nitrogen concentration, the fatty alcohols yield in the Δdga1 strain with FAR was further increased to 84 mg/L in cells and 14 mg/L secreted in broth. The results in this study demonstrated the feasibility of using the designed strategy to solve the bottleneck in utilizing TAGs for fatty acid derivatives production. PMID:25116045

  12. De novo fatty acid synthesis controls the fate between regulatory T and T helper 17 cells.

    PubMed

    Berod, Luciana; Friedrich, Christin; Nandan, Amrita; Freitag, Jenny; Hagemann, Stefanie; Harmrolfs, Kirsten; Sandouk, Aline; Hesse, Christina; Castro, Carla N; Bähre, Heike; Tschirner, Sarah K; Gorinski, Nataliya; Gohmert, Melanie; Mayer, Christian T; Huehn, Jochen; Ponimaskin, Evgeni; Abraham, Wolf-Rainer; Müller, Rolf; Lochner, Matthias; Sparwasser, Tim

    2014-11-01

    Interleukin-17 (IL-17)-secreting T cells of the T helper 17 (TH17) lineage play a pathogenic role in multiple inflammatory and autoimmune conditions and thus represent a highly attractive target for therapeutic intervention. We report that inhibition of acetyl-CoA carboxylase 1 (ACC1) restrains the formation of human and mouse TH17 cells and promotes the development of anti-inflammatory Foxp3(+) regulatory T (Treg) cells. We show that TH17 cells, but not Treg cells, depend on ACC1-mediated de novo fatty acid synthesis and the underlying glycolytic-lipogenic metabolic pathway for their development. Although TH17 cells use this pathway to produce phospholipids for cellular membranes, Treg cells readily take up exogenous fatty acids for this purpose. Notably, pharmacologic inhibition or T cell-specific deletion of ACC1 not only blocks de novo fatty acid synthesis but also interferes with the metabolic flux of glucose-derived carbon via glycolysis and the tricarboxylic acid cycle. In vivo, treatment with the ACC-specific inhibitor soraphen A or T cell-specific deletion of ACC1 in mice attenuates TH17 cell-mediated autoimmune disease. Our results indicate fundamental differences between TH17 cells and Treg cells regarding their dependency on ACC1-mediated de novo fatty acid synthesis, which might be exploited as a new strategy for metabolic immune modulation of TH17 cell-mediated inflammatory diseases. PMID:25282359

  13. Retinol metabolism in LLC-PK1 Cells. Characterization of retinoic acid synthesis by an established mammalian cell line.

    PubMed

    Napoli, J L

    1986-10-15

    Specific assays, based on gas chromatography-mass spectrometry and high-performance liquid chromatography, were used to quantify the conversion of retinol and retinal into retinoic acid by the pig kidney cell line LLC-PK1. Retinoic acid synthesis was linear for 2-4 h as well as with graded amounts of either substrate to at least 50 microM. Retinoic acid concentrations increased through 6-8 h, but decreased thereafter because of substrate depletion (t1/2 of retinol = 13 h) and product metabolism (1/2 = 2.3 h). Retinoic acid metabolism was accelerated by treating cells with 100 nM retinoic acid for 10 h (t1/2 = 1.7 h) and was inhibited by the antimycotic imidazole ketoconazole. Feedback inhibition was not indicated since retinoic acid up to 100 nM did not inhibit its own synthesis. Retinol dehydrogenation was rate-limiting. The reduction and dehydrogenation of retinal were 4-8-fold and 30-60-fold faster, respectively. Greater than 95% of retinol was converted into metabolites other than retinoic acid, whereas the major metabolite of retinal was retinoic acid. The synthetic retinoid 13-cis-N-ethylretinamide inhibited retinoic acid synthesis, but 4-hydroxylphenylretinamide did not. 4'-(9-Acridinylamino)methanesulfon-m-anisidide, an inhibitor of aldehyde oxidase, and ethanol did not inhibit retinoic acid synthesis. 4-Methylpyrazole was a weak inhibitor: disulfiram was a potent inhibitor. These data indicate that retinol dehydrogenase is a sulfhydryl group-dependent enzyme, distinct from ethanol dehydrogenase. Homogenates of LLC-PK1 cells converted retinol into retinoic acid and retinyl palmitate and hydrolyzed retinyl palmitate. This report suggests that substrate availability, relative to enzyme activity/amount, is a primary determinant of the rate of retinoic acid synthesis, identifies inhibitors of retinoic acid synthesis, and places retinoic acid synthesis into perspective with several other known pathways of retinoid metabolism. PMID:3759984

  14. Total synthesis and complete stereostructure of gambieric acid A.

    PubMed

    Fuwa, Haruhiko; Ishigai, Kazuya; Hashizume, Keisuke; Sasaki, Makoto

    2012-07-25

    Total synthesis of gambieric acid A, a potent antifungal polycyclic ether metabolite, has been accomplished for the first time, which firmly established the complete stereostructure of this natural product. PMID:22779404

  15. Synthesis of fatty acids in the perused mouse liver.

    PubMed

    Salmon, D M; Bowen, N L; Hems, D A

    1974-09-01

    1. Fatty acid synthesis de novo was measured in the perfused liver of fed mice. 2. The total rate, measured by the incorporation into fatty acid of (3)H from (3)H(2)O (1-7mumol of fatty acid/h per g of fresh liver), resembled the rate found in the liver of intact mice. 3. Perfusions with l-[U-(14)C]lactic acid and [U-(14)C]glucose showed that circulating glucose at concentrations less than about 17mm was not a major carbon source for newly synthesized fatty acid, whereas lactate (10mm) markedly stimulated fatty acid synthesis, and contributed extensive carbon to lipogenesis. 4. The identification of 50% of the carbon converted into newly synthesized fatty acid lends further credibility to the use of (3)H(2)O to measure hepatic fatty acid synthesis. 5. The total rate of fatty acid synthesis, and the contribution of glucose carbon to lipogenesis, were directly proportional to the initial hepatic glycogen concentration. 6. The proportion of total newly synthesized lipid that was released into the perfusion medium was 12-16%. 7. The major products of lipogenesis were saturated fatty acids in triglyceride and phospholipid. 8. The rate of cholesterol synthesis, also measured with (3)H(2)O, expressed as acetyl residues consumed, was about one-fourth of the basal rate of fatty acid synthesis. 9. These results are discussed in terms of the carbon sources of hepatic newly synthesized fatty acids, and the effect of glucose, glycogen and lactate in stimulating lipogenesis, independently of their role as precursors. PMID:4464843

  16. Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

    PubMed Central

    Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

    2009-01-01

    In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

  17. A symmetry-based formal synthesis of zaragozic acid A.

    PubMed

    Freeman-Cook, K D; Halcomb, R L

    2000-09-22

    A symmetry-based strategy for the synthesis of the zaragozic acids is reported. Two enantioselective dihydroxylations were used to establish the absolute configuration of a C(2) symmetric intermediate. Noteworthy transformations include a group-selective lactonization, which accomplished an end-differentiation of a pseudo-C(2) symmetric intermediate. Late stage protecting group adjustments and oxidations accomplished a formal synthesis of zaragozic acid A. PMID:10987953

  18. Photoorganocatalytic One-Pot Synthesis of Hydroxamic Acids from Aldehydes.

    PubMed

    Papadopoulos, Giorgos N; Kokotos, Christoforos G

    2016-05-10

    An efficient one-pot synthesis of hydroxamic acids from aldehydes and hydroxylamine is described. A fast, visible-light-mediated metal-free hydroacylation of dialkyl azodicarboxylates was used to develop the subsequent addition of hydroxylamine hydrochloride. A range of aliphatic and aromatic aldehydes were employed in this reaction to give hydroxamic acids in high to excellent yields. Application of the current methodology was demonstrated in the synthesis of the anticancer medicine vorinostat. PMID:27038037

  19. Dissecting Abscisic Acid Signaling Pathways Involved in Cuticle Formation.

    PubMed

    Cui, Fuqiang; Brosché, Mikael; Lehtonen, Mikko T; Amiryousefi, Ali; Xu, Enjun; Punkkinen, Matleena; Valkonen, Jari P T; Fujii, Hiroaki; Overmyer, Kirk

    2016-06-01

    The cuticle is the outer physical barrier of aerial plant surfaces and an important interaction point between plants and the environment. Many environmental stresses affect cuticle formation, yet the regulatory pathways involved remain undefined. We used a genetics and gene expression analysis in Arabidopsis thaliana to define an abscisic acid (ABA) signaling loop that positively regulates cuticle formation via the core ABA signaling pathway, including the PYR/PYL receptors, PP2C phosphatase, and SNF1-Related Protein Kinase (SnRK) 2.2/SnRK2.3/SnRK2.6. Downstream of the SnRK2 kinases, cuticle formation was not regulated by the ABA-responsive element-binding transcription factors but rather by DEWAX, MYB16, MYB94, and MYB96. Additionally, low air humidity increased cuticle formation independent of the core ABA pathway and cell death/reactive oxygen species signaling attenuated expression of cuticle-biosynthesis genes. In Physcomitrella patens, exogenous ABA suppressed expression of cuticle-related genes, whose Arabidopsis orthologs were ABA-induced. Hence, the mechanisms regulating cuticle formation are conserved but sophisticated in land plants. Signaling specifically related to cuticle deficiency was identified to play a major role in the adaptation of ABA signaling pathway mutants to increased humidity and in modulating their immunity to Botrytis cinerea in Arabidopsis. These results define a cuticle-specific downstream branch in the ABA signaling pathway that regulates responses to the external environment. PMID:27060495

  20. Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1998-01-01

    Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

  1. Synthesis of the Enzymes of the Mandelate Pathway by Pseudomonas putida I. Synthesis of Enzymes by the Wild Type

    PubMed Central

    Hegeman, G. D.

    1966-01-01

    Hegeman, G. D. (University of California, Berkeley). Synthesis of the enzymes of the mandelate pathway by Pseudomonas putida. I. Synthesis of enzymes by the wild type. J. Bacteriol. 91:1140–1154. 1966.—The control of synthesis of the five enzymes responsible for the conversion of d(−)-mandelate to benzoate by Pseudomonas putida was investigated. The first three compounds occurring in the pathway, d(−)-mandelate, l(+)-mandelate, and benzoylformate, are equipotent inducers of all five enzymes. A nonmetabolizable inducer, phenoxyacetate, also induces synthesis of these enzymes; but, unlike the metabolizable inducer-substrates, it does not elicit synthesis of enzymes that mediate steps in the pathway beyond benzoate. Under conditions of semigratuity, dl-mandelate elicits immediate synthesis at a steady rate of the first two enzymes of the pathway, but two enzymes which act below the level of benzoate are synthesized only after a considerable lag. Succinate and asparagine do not significantly repress the synthesis of the enzymes responsible for mandelate oxidation. PMID:5929747

  2. Lysophosphatidic acid synthesis and phospholipid metabolism in rat mast cells

    SciTech Connect

    Fagan, D.L.

    1986-01-01

    The role of lysophosphatidic acid in mast cell response to antigen was investigated using an isolated rat serosal mast cell model. The cells were incubated with monoclonal murine immunoglobulin E to the dinitrophenyl hapten and prelabeled with /sup 32/P-orthophosphate or /sup 3/H-fatty acids. Lysophosphatidic acid was isolated form cell extracts by 2-dimensional thin-layer chromatography, and the incorporated radioactivity was assessed by liquid scintillation counting. Lysophosphatidic acid labeling with /sup 32/P was increased 2-4 fold within 5 minutes after the addition of antigen or three other mast cell agonists. Functional group analyses unequivocally showed that the labeled compound was lysophosphatidic acid. Lysophosphatidic acid synthesis was dependent on the activity of diacylglycerol lipase, suggesting formation from monoacylglycerol. In addition, the studies of lysophosphatidic acid synthesis suggest that the addition of antigen to mast cells may initiate more than one route of phospholipid degradation and resynthesis. Whatever the origin of lysophosphatidic acid, the results of this study demonstrated that lysophosphatidic acid synthesis is stimulated by a variety of mast cell agonists. Dose-response, kinetic, and pharmacologic studies showed close concordance between histamine release and lysophosphatidic acid labeling responses. These observations provide strong evidence that lysophosphatidic acid plays an important role in mast cell activation.

  3. The prokaryotic pathway of lipid synthesis in oat leaf plastids

    SciTech Connect

    Gillanders, B.; Mackender, R. )

    1990-05-01

    Evidence for the operation of the prokaryotic pathway of acyl lipid synthesis is an 18:3 plant was sought by incubating plastids from 6 sequential segments from oat seedling leaves as described previously except that {sup 14}C-G3P was used. Proplastids were the most biosynthetically active plastids (x2-3) and DAG and PA were the most heavily labelled acyl lipids (>75% of label). Analysis of MGDG and DGDG molecular species (MS) following pre-incubation with {sup 14}C-G3P (40 mins) and subsequently with UDP{sup 3}H-gal (30 mins), showed that only MS 16:0/18:0 and MS 16:0/18:1 were significantly labelled with {sup 14}C whereas all 5 MS were labelled with {sup 3}H-gal. However most of the {sup 3}H label was in the same MS as the {sup 14}C except when 18:2/18:2 DAG or PC was added with the {sup 3}H-gal, in which case considerably additional {sup 3}H-gal (up to 100%) appeared in the 18:2/18:2 MS of both these lipids.

  4. Aldehyde Dehydrogenase 1a1 Mediates a GABA Synthesis Pathway in Midbrain Dopaminergic Neurons

    PubMed Central

    Kim, Jae-Ick; Ganesan, Subhashree; Luo, Sarah X.; Wu, Yu-Wei; Park, Esther; Huang, Eric J.; Chen, Lu; Ding, Jun B.

    2016-01-01

    Midbrain dopamine neurons are an essential component of the basal ganglia circuitry, playing key roles in the control of fine movement and reward. Recently, it has been demonstrated that γ-aminobutyric acid (GABA), the chief inhibitory neurotransmitter, is co-released by dopamine neurons. Here we show that GABA corelease in dopamine neurons does not utilize the conventional GABA synthesizing enzymes, glutamate decarboxylases GAD65 and GAD67. Our experiments reveal an evolutionarily conserved GABA synthesis pathway mediated by aldehyde dehydrogenase 1a1 (ALDH1a1). Moreover, GABA co-release is modulated by ethanol at binge drinking blood alcohol concentrations and diminished ALDH1a1 leads to enhanced alcohol consumption and preference. These findings provide insights into the functional role of GABA co-release in midbrain dopamine neurons, which may be essential for reward-based behavior and addiction. PMID:26430123

  5. Synthesis and characterization of anaerobic degradation biomarkers of n-alkanes via hydroxylation/carboxylation pathways.

    PubMed

    Zhou, Jing; Bian, Xin-Yu; Zhou, Lei; Mbadinga, Serge Maurice; Yang, Shi-Zhong; Liu, Jin-Feng; Gu, Ji-Dong; Mu, Bo-Zhong

    2016-01-01

    Metabolite profiling is a powerful method in research on anaerobic biodegradation of hydrocarbons. Hydroxylation and carboxylation are proposed pathways in anaerobic degradation but very little direct evidence is available about metabolites and signature biomarkers. 2-Acetylalkanoic acid is a potential signature metabolite because of its unique and specific structure among possible intermediates. A procedure for the synthesis of four homologues with various carbon chain lengths was proposed and the characteristics of 2-acetyl- alkanoic acid esters were investigated using four derivatization processes, namely methyl, ethyl, n-butyl and trimethylsilyl esterification. Four intermediate fragments observed were at m/z 73 + 14n, 87 + 14n, 102 + 14n (n = 1, 2 and 4 for methyl, ethyl and n-butyl ester, respectively) and [M - 42]+ for three of the derivatization methods. For silylation, characteristic ions were observed at m/z 73, 117, [M - 42](+) and [M - 55](+). These are basic and significant data for the future identification of potential intermediates of the hydroxylation and carboxylation pathways in hydrocarbon degradation. PMID:26863073

  6. Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease.

    PubMed

    Lake, April D; Novak, Petr; Shipkova, Petia; Aranibar, Nelly; Robertson, Donald; Reily, Michael D; Lu, Zhenqiang; Lehman-McKeeman, Lois D; Cherrington, Nathan J

    2013-04-15

    Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the 'classical' (neutral) and 'alternative' (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BA profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. PMID:23391614

  7. Life in hot acid: pathway analyses in extremely thermoacidophilic archaea.

    PubMed

    Auernik, Kathryne S; Cooper, Charlotte R; Kelly, Robert M

    2008-10-01

    The extremely thermoacidophilic archaea are a particularly intriguing group of microorganisms that must simultaneously cope with biologically extreme pHs (< or = 4) and temperatures (Topt > or = 60 degrees C) in their natural environments. Their expanding biotechnological significance relates to their role in biomining of base and precious metals and their unique mechanisms of survival in hot acid, at both the cellular and biomolecular levels. Recent developments, such as advances in understanding of heavy metal tolerance mechanisms, implementation of a genetic system, and discovery of a new carbon fixation pathway, have been facilitated by the availability of genome sequence data and molecular genetic systems. As a result, new insights into the metabolic pathways and physiological features that define extreme thermoacidophily have been obtained, in some cases suggesting prospects for biotechnological opportunities. PMID:18760359

  8. Oleochemical synthesis of an acid cleavable hydrophobe for surfactant use

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The synthesis of a series of branched hydroxy stearates from commercially available methyl oleate and common organic acids is reported. A variety of different acids, with 3 to 8 carbon atoms, and also varying in their branching and functionality, were used. The kinetics of the ring opening reactio...

  9. Hepatic alpha-oxidation of phytanic acid. A revised pathway.

    PubMed

    Van Veldhoven, P P; Mannaerts, G P; Casteels, M; Croes, K

    1999-01-01

    Synthetic 3-methyl-branched chain fatty acids were used to decipher the breakdown of phytanic acid. Based on results obtained in intact or permeabilized rat hepatocytes, rat liver homogenates or subcellular fractions, a revised alpha-oxidation pathway is proposed which appears to be functioning in man as well. In a first step, the 3-methyl-branched chain fatty acid is activated by an acyl-CoA synthetase. This reaction requires CoA, ATP and Mg2+. Subsequently, the acyl-CoA ester is hydroxylated at position 2 by a peroxisomal dioxygenase. This step is dependent on alpha-oxoglutarate, ascorbate (or glutathione), Fe2+ and O2. The 2-hydroxy-3-methylacyl-CoA intermediate is cleaved by a peroxisomal lyase to formyl-CoA and a 2-methyl-branched fatty aldehyde. Formyl-CoA is (partly enzymically) hydrolyzed to formate, which is then converted, most likely in the cytosol, to CO2. In the presence of NAD+, the aldehyde is dehydrogenated to a 2-methyl-branched fatty acid, presumably by a peroxisomal aldehyde dehydrogenase. This acid can--after activation--be degraded via a D-specific peroxisomal beta-oxidation system. PMID:10709654

  10. Nucleic acid arrays and methods of synthesis

    DOEpatents

    Sabanayagam, Chandran R.; Sano, Takeshi; Misasi, John; Hatch, Anson; Cantor, Charles

    2001-01-01

    The present invention generally relates to high density nucleic acid arrays and methods of synthesizing nucleic acid sequences on a solid surface. Specifically, the present invention contemplates the use of stabilized nucleic acid primer sequences immobilized on solid surfaces, and circular nucleic acid sequence templates combined with the use of isothermal rolling circle amplification to thereby increase nucleic acid sequence concentrations in a sample or on an array of nucleic acid sequences.

  11. Increased fatty acid synthesis inhibits nitrogen starvation-induced autophagy in lipid droplet-deficient yeast.

    PubMed

    Régnacq, Matthieu; Voisin, Pierre; Sere, Yves Y; Wan, Bin; Soeroso, Venty M S; Bernard, Marianne; Camougrand, Nadine; Bernard, François-Xavier; Barrault, Christine; Bergès, Thierry

    2016-08-12

    Macroautophagy is a degradative pathway whereby cells encapsulate and degrade cytoplasmic material within endogenously-built membranes. Previous studies have suggested that autophagosome membranes originate from lipid droplets. However, it was recently shown that rapamycin could induce autophagy in cells lacking these organelles. Here we show that lipid droplet-deprived cells are unable to perform autophagy in response to nitrogen-starvation because of an accelerated lipid synthesis that is not observed with rapamycin. Using cerulenin, a potent inhibitor of fatty acid synthase, and exogenous addition of palmitic acid we could restore nitrogen-starvation induced autophagy in the absence of lipid droplets. PMID:27270031

  12. Quantitative importance of the 25-hydroxylation pathway for bile acid biosynthesis in the rat

    SciTech Connect

    Duane, W.C.; Bjoerkhem, I.H.; Hamilton, J.N.; Mueller, S.M.

    1988-05-01

    During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. In the present study, we have quantitated the relative importance of these two pathways in vivo by measuring production of (14C) acetone from (14C)-26-cholesterol. Four days after intraperitoneal injection of 20 to 40 muCi (14C)-26-cholesterol and 1 day after beginning a constant intravenous infusion of unlabeled acetone at 25 mumoles per kg per min, 6 male and 2 female Sprague-Dawley rats underwent breath collections. Expired acetone was trapped and purified as the 2,4-dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied times the acetone infusion rate to calculate production of (14C)acetone. (14C) Acetone production averaged 1.7% of total release of 14C from (14C)-26-cholesterol, estimated by 14CO2 output. The method was validated by showing that (14C) acetone production from (14C)isopropanol averaged 111% of the (14C)isopropanol infusion rate. We conclude that, in the normal rat, the 25-hydroxylation pathway accounts for less than 2% of bile acid synthesis.

  13. Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

    PubMed Central

    Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

    2011-01-01

    The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

  14. Concise total synthesis of (±)-actinophyllic acid

    PubMed Central

    Granger, Brett A.; Jewett, Ivan T.; Butler, Jeffrey D.; Martin, Stephen F.

    2014-01-01

    A concise total synthesis of the complex indole alkaloid (±)-actinophyllic acid was accomplished by a sequence of reactions requiring only 10 steps from readily-available, known starting materials. The approach featured a Lewis acid-catalyzed cascade of reactions involving stabilized carbocations that delivered the tetracyclic core of the natural product in a single chemical operation. Optimal conversion of this key intermediate into (±)-actinophyllic acid required judicious selection of a protecting group strategy. PMID:24882888

  15. Solid Phase Synthesis of C-Terminal Boronic Acid Peptides.

    PubMed

    Behnam, Mira A M; Sundermann, Tom R; Klein, Christian D

    2016-05-01

    Peptides and peptidomimetics with a C-terminal boronic acid group have prolific applications in numerous fields of research, but their synthetic accessibility remains problematic. A convenient, high yield synthesis of peptide-boronic acids on a solid support is described here, using commercially available 1-glycerol polystyrene resin. The method is compatible with Fmoc chemistry and offers a versatile approach to aryl and alkyl aminoboronic acids without additional purification steps. PMID:27104613

  16. Regulation of Primary Metabolic Pathways in Oyster Mushroom Mycelia Induced by Blue Light Stimulation: Accumulation of Shikimic Acid

    PubMed Central

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-01-01

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  17. Regulation of primary metabolic pathways in oyster mushroom mycelia induced by blue light stimulation: accumulation of shikimic acid.

    PubMed

    Kojima, Masanobu; Kimura, Ninako; Miura, Ryuhei

    2015-01-01

    Shikimic acid is a key intermediate in the aromatic amino acid pathway as well as an important starting material for the synthesis of Tamiflu, a potent and selective inhibitor of the neuraminidase enzyme of influenza viruses A and B. Here we report that in oyster mushroom (Pleurotus ostreatus) mycelia cultivated in the dark, stimulation with blue light-emitting diodes induces the accumulation of shikimic acid. An integrated analysis of primary metabolites, gene expression and protein expression suggests that the accumulation of shikimic acid caused by blue light stimulation is due to an increase in 3-deoxy-D-arabinoheptulosonate 7-phosphate synthase (DAHPS, EC2.5.1.54), the rate-determining enzyme in the shikimic acid pathway, as well as phosphofructokinase (PFK, EC2.7.1.11) and glucose-6-phosphate dehydrogenase (G6PD, EC1.1.1.49), the rate-determining enzymes in the glycolysis and pentose phosphate pathways, respectively. This stimulation results in increased levels of phosphoenolpyruvic acid (PEP) and erythrose-4-phosphate (E4P), the starting materials of shikimic acid biosynthesis. PMID:25721093

  18. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid.

    PubMed

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Chen, Jian

    2016-01-01

    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes-glycerol dehydrogenase and malate dehydrogenase-were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L(-1) to 33.21 ± 1.92 g·L(-1) and 30.50 ± 1.63 g·L(-1), whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD(+) ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L(-1) in a fed-batch culture. PMID:26814976

  19. Pathway engineering of Propionibacterium jensenii for improved production of propionic acid

    PubMed Central

    Liu, Long; Guan, Ningzi; Zhu, Gexin; Li, Jianghua; Shin, Hyun-dong; Du, Guocheng; Chen, Jian

    2016-01-01

    Propionic acid (PA) is an important chemical building block widely used in the food, pharmaceutical, and chemical industries. In our previous study, a shuttle vector was developed as a useful tool for engineering Propionibacterium jensenii, and two key enzymes—glycerol dehydrogenase and malate dehydrogenase—were overexpressed to improve PA titer. Here, we aimed to improve PA production further via the pathway engineering of P. jensenii. First, the phosphoenolpyruvate carboxylase gene (ppc) from Klebsiella pneumoniae was overexpressed to access the one-step synthesis of oxaloacetate directly from phosphoenolpyruvate without pyruvate as intermediate. Next, genes encoding lactate dehydrogenase (ldh) and pyruvate oxidase (poxB) were deleted to block the synthesis of the by-products lactic acid and acetic acid, respectively. Overexpression of ppc and deleting ldh improved PA titer from 26.95 ± 1.21 g·L−1 to 33.21 ± 1.92 g·L−1 and 30.50 ± 1.63 g·L−1, whereas poxB deletion decreased it. The influence of this pathway engineering on gene transcription, enzyme expression, NADH/NAD+ ratio, and metabolite concentration was also investigated. Finally, PA production in P. jensenii with ppc overexpression as well as ldh deletion was investigated, which resulted in further increases in PA titer to 34.93 ± 2.99 g·L−1 in a fed-batch culture. PMID:26814976

  20. Effects of bile acid administration on bile acid synthesis and its circadian rhythm in man

    SciTech Connect

    Pooler, P.A.; Duane, W.C.

    1988-09-01

    In man bile acid synthesis has a distinct circadian rhythm but the relationship of this rhythm to feedback inhibition by bile acid is unknown. We measured bile acid synthesis as release of 14CO2 from (26-14C)cholesterol every 2 hr in three normal volunteers during five separate 24-hr periods. Data were fitted by computer to a cosine curve to estimate amplitude and acrophase of the circadian rhythm. In an additional six volunteers, we measured synthesis every 2 hr from 8:00 a.m. to 4:00 p.m. only. During the control period, amplitude (expressed as percentage of mean synthesis) averaged 52% and acrophase averaged 6:49 a.m. During administration of ursodeoxycholic acid (15 mg per kg per day), synthesis averaged 126% of baseline (p less than 0.1), amplitude averaged 43% and acrophase averaged 6:20 a.m. During administration of chenodeoxycholic acid (15 mg per kg per day), synthesis averaged 43% of baseline (p less than 0.001), amplitude averaged 53% and acrophase averaged 9:04 a.m. Addition of prednisone to this regimen of chenodeoxycholic acid to eliminate release of 14CO2 from corticosteroid hormone synthesis resulted in a mean amplitude of 62% and a mean acrophase of 6:50 a.m., values very similar to those in the baseline period. Administration of prednisone alone also did not significantly alter the baseline amplitude (40%) or acrophase (6:28 a.m.). We conclude that neither chenodeoxycholic acid nor ursodeoxycholic acid significantly alters the circadian rhythm of bile acid synthesis in man.

  1. Substrate specificity of the sialic acid biosynthetic pathway

    SciTech Connect

    Jacobs, Christina L.; Goon, Scarlett; Yarema, Kevin J.; Hinderlich, Stephan; Hang, Howard C.; Chai, Diana H.; Bertozzi, Carolyn R.

    2001-07-18

    Unnatural analogs of sialic acid can be delivered to mammalian cell surfaces through the metabolic transformation of unnatural N-acetylmannosamine (ManNAc) derivatives. In previous studies, mannosamine analogs bearing simple N-acyl groups up to five carbon atoms in length were recognized as substrates by the biosynthetic machinery and transformed into cell-surface sialoglycoconjugates [Keppler, O. T., et al. (2001) Glycobiology 11, 11R-18R]. Such structural alterations to cell surface glycans can be used to probe carbohydrate-dependent phenomena. This report describes our investigation into the extent of tolerance of the pathway toward additional structural alterations of the N-acyl substituent of ManNAc. A panel of analogs with ketone-containing N-acyl groups that varied in the lengthor steric bulk was chemically synthesized and tested for metabolic conversion to cell-surface glycans. We found that extension of the N-acyl chain to six, seven, or eight carbon atoms dramatically reduced utilization by the biosynthetic machinery. Likewise, branching from the linear chain reduced metabolic conversion. Quantitation of metabolic intermediates suggested that cellular metabolism is limited by the phosphorylation of the N-acylmannosamines by ManNAc 6-kinase in the first step of the pathway. This was confirmed by enzymatic assay of the partially purified enzyme with unnatural substrates. Identification of ManNAc 6-kinase as a bottleneck for unnatural sialic acid biosynthesis provides a target for expanding the metabolic promiscuity of mammalian cells.

  2. Proteolytic Pathways Induced by Herbicides That Inhibit Amino Acid Biosynthesis

    PubMed Central

    Zulet, Amaia; Gil-Monreal, Miriam; Villamor, Joji Grace; Zabalza, Ana; van der Hoorn, Renier A. L.; Royuela, Mercedes

    2013-01-01

    Background The herbicides glyphosate (Gly) and imazamox (Imx) inhibit the biosynthesis of aromatic and branched-chain amino acids, respectively. Although these herbicides inhibit different pathways, they have been reported to show several common physiological effects in their modes of action, such as increasing free amino acid contents and decreasing soluble protein contents. To investigate proteolytic activities upon treatment with Gly and Imx, pea plants grown in hydroponic culture were treated with Imx or Gly, and the proteolytic profile of the roots was evaluated through fluorogenic kinetic assays and activity-based protein profiling. Results Several common changes in proteolytic activity were detected following Gly and Imx treatment. Both herbicides induced the ubiquitin-26 S proteasome system and papain-like cysteine proteases. In contrast, the activities of vacuolar processing enzymes, cysteine proteases and metacaspase 9 were reduced following treatment with both herbicides. Moreover, the activities of several putative serine protease were similarly increased or decreased following treatment with both herbicides. In contrast, an increase in YVADase activity was observed under Imx treatment versus a decrease under Gly treatment. Conclusion These results suggest that several proteolytic pathways are responsible for protein degradation upon herbicide treatment, although the specific role of each proteolytic activity remains to be determined. PMID:24040092

  3. Pathways for abiotic organic synthesis at submarine hydrothermal fields

    PubMed Central

    McDermott, Jill M.; Seewald, Jeffrey S.; German, Christopher R.; Sylva, Sean P.

    2015-01-01

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  4. Pathways for abiotic organic synthesis at submarine hydrothermal fields.

    PubMed

    McDermott, Jill M; Seewald, Jeffrey S; German, Christopher R; Sylva, Sean P

    2015-06-23

    Arguments for an abiotic origin of low-molecular weight organic compounds in deep-sea hot springs are compelling owing to implications for the sustenance of deep biosphere microbial communities and their potential role in the origin of life. Theory predicts that warm H2-rich fluids, like those emanating from serpentinizing hydrothermal systems, create a favorable thermodynamic drive for the abiotic generation of organic compounds from inorganic precursors. Here, we constrain two distinct reaction pathways for abiotic organic synthesis in the natural environment at the Von Damm hydrothermal field and delineate spatially where inorganic carbon is converted into bioavailable reduced carbon. We reveal that carbon transformation reactions in a single system can progress over hours, days, and up to thousands of years. Previous studies have suggested that CH4 and higher hydrocarbons in ultramafic hydrothermal systems were dependent on H2 generation during active serpentinization. Rather, our results indicate that CH4 found in vent fluids is formed in H2-rich fluid inclusions, and higher n-alkanes may likely be derived from the same source. This finding implies that, in contrast with current paradigms, these compounds may form independently of actively circulating serpentinizing fluids in ultramafic-influenced systems. Conversely, widespread production of formate by ΣCO2 reduction at Von Damm occurs rapidly during shallow subsurface mixing of the same fluids, which may support anaerobic methanogenesis. Our finding of abiogenic formate in deep-sea hot springs has significant implications for microbial life strategies in the present-day deep biosphere as well as early life on Earth and beyond. PMID:26056279

  5. Ascorbate synthesis pathway: dual role of ascorbate in bone homeostasis.

    PubMed

    Gabbay, Kenneth H; Bohren, Kurt M; Morello, Roy; Bertin, Terry; Liu, Jeff; Vogel, Peter

    2010-06-18

    Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) mice show that the two enzymes, GR and AR, provide approximately 85 and approximately 15% of L-gulonate, respectively. GRKO/ARKO double knock-out mice are unable to synthesize ASC (>95% ASC deficit) and develop scurvy. The GRKO mice ( approximately 85% ASC deficit) develop and grow normally when fed regular mouse chow (ASC content = 0) but suffer severe osteopenia and spontaneous fractures with stresses that increase ASC requirements, such as pregnancy or castration. Castration greatly increases osteoclast numbers and activity in GRKO mice and promotes increased bone loss as compared with wild-type controls and additionally induces proliferation of immature dysplastic osteoblasts likely because of an ASC-sensitive block(s) in early differentiation. ASC and the antioxidants pycnogenol and resveratrol block osteoclast proliferation and bone loss, but only ASC feeding restores osteoblast differentiation and prevents their dysplastic proliferation. This is the first in vivo demonstration of two independent roles for ASC as an antioxidant suppressing osteoclast activity and number as well as a cofactor promoting osteoblast differentiation. Although humans have lost the ability to synthesize ASC, our mouse models suggest the mechanisms by which suboptimal ASC availability facilitates the development of osteoporosis, which has important implications for human osteoporosis. PMID:20410296

  6. Folic acid promotes the myogenic differentiation of C2C12 murine myoblasts through the Akt signaling pathway.

    PubMed

    Hwang, Seong Yeon; Kang, Yong Jung; Sung, Bokyung; Kim, Minjung; Kim, Dong Hwan; Lee, Yujin; Yoo, Mi-Ae; Kim, Cheol Min; Chung, Hae Young; Kim, Nam Deuk

    2015-10-01

    Folic acid is a water-soluble vitamin in the B-complex group, and an exogenous intake is required for health, growth and development. As a precursor to co-factors, folic acid is required for one-carbon donors in the synthesis of DNA bases and other essential biomolecules. A lack of dietary folic acid can lead to folic acid deficiency and can therefore result in several health problems, including macrocytic anemia, elevated plasma homocysteine levels, cardiovascular disease, birth defects, carcinogenesis, muscle weakness and difficulty in walking. Previous studies have indicated that folic acid exerts a positive effect on skeletal muscle functions. However, the precise role of folic acid in skeletal muscle cell differentiation remains poorly understood. Thus, in the present study, we examined the effects of folic acid on neo-myotube maturation and differentiation using C2C12 murine myoblasts. We found that folic acid promoted the formation of multinucleated myotubes, and increased the fusion index and creatine kinase (CK) activity in a concentration-dependent manner. In addition, western blot analysis revealed that the expression levels of the muscle-specific marker, myosin heavy chain (MyHC), as well as those of the myogenic regulatory factors (MRFs), MyoD and myogenin, were increased in the folic acid-treated myotubes during myogenic differentiation. Folic acid also promoted the activation of the Akt pathway, and this effect was inhibited by treatment of the C2C12 cells with LY294002 (Akt inhibitor). Blocking of the Akt pathway with a specific inhibitor revealed that it was necessary for mediating the stimulatory effects of folic acid on muscle cell differentiation and fusion. Taken together, our data suggest that folic acid promotes the differentiation of C2C12 cells through the activation of the Akt pathway. PMID:26310574

  7. Total synthesis of legionaminic acid as basis for serological studies.

    PubMed

    Matthies, Stefan; Stallforth, Pierre; Seeberger, Peter H

    2015-03-01

    Legionaminic acid is a nine-carbon diamino monosaccharide that is found coating the surface of various bacterial human pathogens. Its unique structure makes it a valuable biological probe, but access via isolation is difficult and no practical synthesis has been reported. We describe a stereoselective synthesis that yields a legionaminic acid building block as well as linker-equipped conjugation-ready legionaminic acid starting from cheap d-threonine. To set the desired amino and hydroxyl group pattern of the target, we designed a concise sequence of stereoselective reactions. The key transformations rely on chelation-controlled organometallic additions and a Petasis multicomponent reaction. The legionaminic acid was synthesized in a form that enables attachment to surfaces. Glycan microarray containing legionaminic acid revealed that human antibodies bind the synthetic glycoside. The synthetic bacterial monosaccharide is a valuable probe to detect an immune response to bacterial pathogens such as Legionella pneumophila, the causative agent of Legionnaire's disease. PMID:25668389

  8. Synthesis of α-aminoboronic acids.

    PubMed

    Andrés, Patricia; Ballano, Gema; Calaza, M Isabel; Cativiela, Carlos

    2016-04-21

    This review describes available methods for the preparation of α-aminoboronic acids in their racemic or in their enantiopure form. Both, highly stereoselective syntheses and asymmetric procedures leading to the stereocontrolled generation of α-aminoboronic acid derivatives are included. The preparation of acyclic, carbocyclic and azacyclic α-aminoboronic acid derivatives is covered. Within each section, the different synthetic approaches have been classified according to the key bond which is formed to complete the α-aminoboronic acid skeleton. PMID:26853637

  9. Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

    PubMed Central

    Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

    2015-01-01

    To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

  10. Redundant pathways for Cdc2 activation in Xenopus oocyte: either cyclin B or Mos synthesis

    PubMed Central

    Haccard, Olivier; Jessus, Catherine

    2006-01-01

    Xenopus oocytes are arrested in meiotic prophase I. Progesterone induces the resumption of meiotic maturation, which requires continuous protein synthesis to bring about Cdc2 activation. The identification of the newly synthesized proteins has long been a goal. Two plausible candidates have received extensive study. The synthesis of cyclin B and of c-Mos, a kinase that activates the mitogen-activated protein kinase pathway in oocytes, is clearly upregulated by translational control in response to progesterone. Recent studies suggest that ablation of either c-Mos or cyclin B synthesis by antisense oligonucleotides does not block meiotic maturation. Here, however, we show that when both pathways are simultaneously inhibited, progesterone no longer triggers maturation; adding back either c-Mos or cyclin B restores meiotic maturation. We conclude that the specific synthesis of either B-type cyclins or c-Mos, induced by progesterone, is required to induce meiotic maturation. The two pathways seem to be functionally redundant. PMID:16374506

  11. Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

    PubMed

    Awasthi, Neeraj Praphulla; Singh, R P

    2007-01-01

    Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %. PMID:17898456

  12. Organochlorines inhibit acetaminophen glucuronidation by redirecting UDP-glucuronic acid towards the D-glucuronate pathway

    SciTech Connect

    Chan, Tom S. Wilson, John X.; Selliah, Subajini; Bilodeau, Marc; Zwingmann, Claudia; Poon, Raymond; O'Brien, Peter J.

    2008-11-01

    Industry-derived organochlorines are persistent environmental pollutants that are a continuing health concern. The effects of these compounds on drug metabolism are not well understood. In the current study we present evidence that the inhibition of acetaminophen (APAP) glucuronidation by minute concentrations of organochlorines correlates well with their ability to stimulate the D-glucuronate pathway leading to ascorbate synthesis. A set of 6 arylated organochlorines, including 5 PCB (polychlorinated biphenyl) congeners, were assessed for their effects on APAP glucuronidation in isolated hepatocytes from male Sprague-Dawley rats. The capacity of each organochlorine to inhibit APAP glucuronidation was found to be directly proportional to its capacity to stimulate ascorbate synthesis. PCB153, PCB28 and bis-(4-chlorophenyl sulfone) (BCPS) in increasing order were the most effective organochlorines for inhibiting APAP glucuronidation and stimulating the D-glucuronate pathway. None of the 3 inhibitors of APAP glucuronidation were able to alter the expression of UGT1A6, UGT1A7 and UGT1A8 (the major isoforms responsible for APAP glucuronidation in the rat), however, their efficacy at inhibiting APAP glucuronidation was proportional to their capacity to deplete UDP-glucuronic acid (UDPGA). BCPS-mediated inhibition of APAP glucuronidation in isolated hepatocytes had non-competitive characteristics and was insensitive to the inactivation of cytochrome P450. The effective organochlorines were also able to selectively stimulate the hydrolysis of UDPGA to UDP and glucuronate in isolated microsomes, but could not inhibit APAP glucuronidation in microsomes when UDPGA was in excess. We conclude that organochlorines are able to inhibit APAP glucuronidation in hepatocytes by depleting UDPGA via redirecting UDPGA towards the D-glucuronate pathway. Because the inhibition is non-competitive, low concentrations of these compounds could have long term inhibitory effects on the

  13. Comparison of bile acid synthesis determined by isotope dilution versus fecal acidic sterol output in human subjects

    SciTech Connect

    Duane, W.C.; Holloway, D.E.; Hutton, S.W.; Corcoran, P.J.; Haas, N.A.

    1982-05-01

    Fecal acidic sterol output has been found to be much lower than bile acid synthesis determined by isotope dilution. Because of this confusing discrepancy, we compared these 2 measurements done simultaneously on 13 occasions in 5 normal volunteers. In contrast to previous findings, bile acid synthesis by the Lindstedt isotope dilution method averaged 16.3% lower than synthesis simultaneously determined by fecal acidic sterol output (95% confidence limit for the difference - 22.2 to -10.4%). When one-sample determinations of bile acid pools were substituted for Lindstedt pools, bile acid synthesis by isotope dilution averaged 5.6% higher than synthesis by fecal acidic sterol output (95% confidence limits -4.9 to 16.1%). These data indicate that the 2 methods yield values in reasonably close agreement with one another. If anything, fecal acidic sterol outputs are slightly higher than synthesis by isotope dilution.

  14. Synthesis of biobased succinonitrile from glutamic acid and glutamine.

    PubMed

    Lammens, Tijs M; Le Nôtre, Jérôme; Franssen, Maurice C R; Scott, Elinor L; Sanders, Johan P M

    2011-06-20

    Succinonitrile is the precursor of 1,4-diaminobutane, which is used for the industrial production of polyamides. This paper describes the synthesis of biobased succinonitrile from glutamic acid and glutamine, amino acids that are abundantly present in many plant proteins. Synthesis of the intermediate 3-cyanopropanoic amide was achieved from glutamic acid 5-methyl ester in an 86 mol% yield and from glutamine in a 56 mol % yield. 3-Cyanopropanoic acid can be converted into succinonitrile, with a selectivity close to 100% and a 62% conversion, by making use of a palladium(II)-catalyzed equilibrium reaction with acetonitrile. Thus, a new route to produce biobased 1,4-diaminobutane has been discovered. PMID:21557494

  15. Stereoselective synthesis of unsaturated α-amino acids.

    PubMed

    Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

    2015-06-01

    Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid. PMID:25715756

  16. By-products of electrochemical synthesis of suberic acid

    SciTech Connect

    Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.; Antonenko, N.S.; Grudtsyn, Yu.D.

    1988-05-10

    By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

  17. Investigation of phospholipid synthesis and the disposition of amino acid and carbohydrate

    SciTech Connect

    Boehme, D.S.

    1986-01-01

    The synthesis of pulmonary phospholipids by offspring of diabetic female rats was assessed by means of high performance liquid chromatography combined with automated phosphate analysis. No changes in the pool sizes of the major phospholipids or their precursors were observed. However, offspring of both insulin-treated and untreated diabetic mothers displayed increased pulmonary lyso-phosphatidylcholine. The concentration of glycerylphosphorylcholine, the metabolic product of lyso-phosphatidylcholine, was also increased in these offspring, providing further evidence of a reduced reacylation pathway in the offspring of diabetic mothers. The concentration of phosphatidylglycerol was reduced in the lungs from offspring of diabetic mothers. Preliminary investigation suggested that the mechanism of insulin action on lungs from offspring of diabetic rats may be the diversion of substrate from lipid synthetic pathways into protein synthesis. The utilization of (14C)-labeled amino acids and carbohydrates by normal fetal rat lung, however, revealed no direct insulin effect on protein synthesis. The ability of the fetal lung to convert amino acids into Krebs Cycle intermediates was demonstrated.

  18. The spark discharge synthesis of amino acids from various hydrocarbons

    NASA Technical Reports Server (NTRS)

    Ring, D.; Miller, S. L.

    1984-01-01

    The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

  19. Enantioselective synthesis of isotopically labeled homocitric acid lactone.

    PubMed

    Moore, Jared T; Hanhan, Nadine V; Mahoney, Maximillian E; Cramer, Stephen P; Shaw, Jared T

    2013-11-15

    A concise synthesis of homocitric acid lactone was developed to accommodate systematic placement of carbon isotopes (specifically (13)C) for detailed studies of this cofactor. This new route uses a chiral allylic alcohol, available in multigram quantities from enzymatic resolution, as a starting material, which transposes asymmetry through an Ireland-Claisen rearrangement. PMID:24180620

  20. Synthesis of monomethyl 5,5'-dehydrodiferulic acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

  1. Reconstruction of cytosolic fumaric acid biosynthetic pathways in Saccharomyces cerevisiae

    PubMed Central

    2012-01-01

    Background Fumaric acid is a commercially important component of foodstuffs, pharmaceuticals and industrial materials, yet the current methods of production are unsustainable and ecologically destructive. Results In this study, the fumarate biosynthetic pathway involving reductive reactions of the tricarboxylic acid cycle was exogenously introduced in S. cerevisiae by a series of simple genetic modifications. First, the Rhizopus oryzae genes for malate dehydrogenase (RoMDH) and fumarase (RoFUM1) were heterologously expressed. Then, expression of the endogenous pyruvate carboxylase (PYC2) was up-regulated. The resultant yeast strain, FMME-001 ↑PYC2 + ↑RoMDH, was capable of producing significantly higher yields of fumarate in the glucose medium (3.18 ± 0.15 g liter-1) than the control strain FMME-001 empty vector. Conclusions The results presented here provide a novel strategy for fumarate biosynthesis, which represents an important advancement in producing high yields of fumarate in a sustainable and ecologically-friendly manner. PMID:22335940

  2. Amino acid metabolism and protein synthesis in malarial parasites*

    PubMed Central

    Sherman, I. W.

    1977-01-01

    Malaria-infected red cells and free parasites have limited capabilities for the biosynthesis of amino acids. Therefore, the principal amino acid sources for parasite protein synthesis are the plasma free amino acids and host cell haemoglobin. Infected cells and plasmodia incorporate exogenously supplied amino acids into protein. However, the hypothesis that amino acid utilization (from an external source) is related to availability of that amino acid in haemoglobin is without universal support: it is true for isoleucine and for Plasmodium knowlesi and P. falciparum, but not for methionine, cysteine, and other amino acids, and it does not apply to P. lophurae. More by default than by direct evidence, haemoglobin is believed to be the main amino acid reservoir available to the intraerythrocytic plasmodium. Haemoglobin, ingested via the cytostome, is held in food vacuoles where auto-oxidation takes place. As a consequence, haem is released and accumulates in the vacuole as particulate haemozoin (= malaria pigment). Current evidence favours the view that haemozoin is mainly haematin. Acid and alkaline proteases (identified in crude extracts from mammalian and avian malarias) are presumably secreted directly into the food vacuole. They then digest the denatured globin and the resulting amino acids are incorporated into parasite protein. Cell-free protein synthesizing systems have been developed using P. knowlesi and P. lophurae ribosomes. In the main these systems are typically eukaryotic. Studies of amino acid metabolism are exceedingly limited. Arginine, lysine, methionine, and proline are incorporated into protein, whereas glutamic acid is metabolized via an NADP-specific glutamic dehydrogenase. Glutamate oxidation generates NADPH and auxiliary energy (in the form of α-ketoglutarate). The role of red cell glutathione in the economy of the parasite remains obscure. Important goals for future research should be: quantitative assessment of the relative importance of

  3. Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha[OPEN

    PubMed Central

    Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.

    2015-01-01

    The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

  4. Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

    PubMed

    Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

    2012-10-01

    Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. PMID:22766489

  5. The intracellular parasite Toxoplasma gondii depends on the synthesis of long chain and very long-chain unsaturated fatty acids not supplied by the host cell

    PubMed Central

    Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Ralton, Julie E.; Rupasinghe, Thusitha; McConville, Malcolm J.; Striepen, Boris

    2015-01-01

    SUMMARY Apicomplexa are parasitic protozoa that cause important human diseases including malaria, cryptosporidiosis and toxoplasmosis. The replication of these parasites within their target host cell is dependent on both salvage as well as de novo synthesis of fatty acids. In T. gondii, fatty acid synthesis via the apicoplast-localized FASII is essential for pathogenesis, while the role of two other fatty acid biosynthetic complexes remains unclear. Here we demonstrate that the ER-localized fatty acid elongation (ELO) is essential for parasite growth. Conditional knock-down of the non-redundant hydroxyacyl-CoA dehydratase and enoyl-CoA reductase enzymes in the ELO pathway severely repressed intracellular parasite growth. 13C-glucose and 13C-acetate labeling and comprehensive lipidomic analyses of these mutants showed a selective defect in synthesis of unsaturated long and very long chain fatty acids (LCFAs and VLCFAs) and depletion of phosphatidylinositol and phosphatidylethanolamine species containing unsaturated LCFAs and VLCFAs. This requirement for ELO pathway was by-passed by supplementing the media with specific fatty acids, indicating active, but inefficient import of host fatty acids. Our experiments highlight a gap between the fatty acid needs of the parasite and availability of specific fatty acids in the host cell that the parasite has to close using a dedicated synthesis and modification pathway. PMID:25825226

  6. Shock synthesis of amino acids from impacting cometary and icy planet surface analogues

    NASA Astrophysics Data System (ADS)

    Martins, Zita; Price, Mark C.; Goldman, Nir; Sephton, Mark A.; Burchell, Mark J.

    2013-12-01

    Comets are known to harbour simple ices and the organic precursors of the building blocks of proteins--amino acids--that are essential to life. Indeed, glycine, the simplest amino acid, was recently confirmed to be present on comet 81P/Wild-2 from samples returned by NASA's Stardust spacecraft. Impacts of icy bodies (such as comets) onto rocky surfaces, and, equally, impacts of rocky bodies onto icy surfaces (such as the jovian and saturnian satellites), could have been responsible for the manufacture of these complex organic molecules through a process of shock synthesis. Here we present laboratory experiments in which we shocked ice mixtures analogous to those found in a comet with a steel projectile fired at high velocities in a light gas gun to test whether amino acids could be produced. We found that the hypervelocity impact shock of a typical comet ice mixture produced several amino acids after hydrolysis. These include equal amounts of D- and L-alanine, and the non-protein amino acids α-aminoisobutyric acid and isovaline as well as their precursors. Our findings suggest a pathway for the synthetic production of the components of proteins within our Solar System, and thus a potential pathway towards life through icy impacts.

  7. Stereoselective synthesis of stable-isotope-labeled amino acids

    SciTech Connect

    Unkefer, C.J.; Martinez, R.A.; Silks, L.A. III; Lodwig, S.N.

    1994-12-01

    For magnetic resonance and vibrational spectroscopies to reach their full potential, they must be used in combination with sophisticated site-specific stable isotope labeling of biological macromolecules. Labeled amino acids are required for the study of the structure and function of enzymes and proteins. Because there are 20 common amino acids, each with its own distinguishing chemistry, they remain a synthetic challenge. The Oppolzer chiral auxiliary provides a general tool with which to approach the synthesis of labeled amino acids. By using the Oppolzer auxiliary, amino acids can be constructed from several small molecules, which is ideal for stable isotope labeling. In addition to directing the stereochemistry at the {alpha}-carbon, the camphorsultam can be used for stereo-specific isotope labeling at prochiral centers in amino acids. By using the camphorsultam auxiliary we have the potential to synthesize virtually any isotopomer of all of the common amino acids.

  8. Benzylidene Acetal Protecting Group as Carboxylic Acid Surrogate: Synthesis of Functionalized Uronic Acids and Sugar Amino Acids.

    PubMed

    Banerjee, Amit; Senthilkumar, Soundararasu; Baskaran, Sundarababu

    2016-01-18

    Direct oxidation of the 4,6-O-benzylidene acetal protecting group to C-6 carboxylic acid has been developed that provides an easy access to a wide range of biologically important and synthetically challenging uronic acid and sugar amino acid derivatives in good yields. The RuCl3 -NaIO4 -mediated oxidative cleavage method eliminates protection and deprotection steps and the reaction takes place under mild conditions. The dual role of the benzylidene acetal, as a protecting group and source of carboxylic acid, was exploited in the efficient synthesis of six-carbon sialic acid analogues and disaccharides bearing uronic acids, including glycosaminoglycan analogues. PMID:26572799

  9. Abscisic-acid-induced cellular apoptosis and differentiation in glioma via the retinoid acid signaling pathway.

    PubMed

    Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying

    2016-04-15

    Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. PMID:26594836

  10. Synthesis and chirality of amino acids under interstellar conditions.

    PubMed

    Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

    2013-01-01

    Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices. PMID:22976459

  11. Glucose and Insulin Induction of Bile Acid Synthesis

    PubMed Central

    Li, Tiangang; Francl, Jessica M.; Boehme, Shannon; Ochoa, Adrian; Zhang, Youcai; Klaassen, Curtis D.; Erickson, Sandra K.; Chiang, John Y. L.

    2012-01-01

    Bile acids facilitate postprandial absorption of nutrients. Bile acids also activate the farnesoid X receptor (FXR) and the G protein-coupled receptor TGR5 and play a major role in regulating lipid, glucose, and energy metabolism. Transgenic expression of cholesterol 7α-hydroxylase (CYP7A1) prevented high fat diet-induced diabetes and obesity in mice. In this study, we investigated the nutrient effects on bile acid synthesis. Refeeding of a chow diet to fasted mice increased CYP7A1 expression, bile acid pool size, and serum bile acids in wild type and humanized CYP7A1-transgenic mice. Chromatin immunoprecipitation assays showed that glucose increased histone acetylation and decreased histone methylation on the CYP7A1 gene promoter. Refeeding also induced CYP7A1 in fxr-deficient mice, indicating that FXR signaling did not play a role in postprandial regulation of bile acid synthesis. In streptozocin-induced type I diabetic mice and genetically obese type II diabetic ob/ob mice, hyperglycemia increased histone acetylation status on the CYP7A1 gene promoter, leading to elevated basal Cyp7a1 expression and an enlarged bile acid pool with altered bile acid composition. However, refeeding did not further increase CYP7A1 expression in diabetic mice. In summary, this study demonstrates that glucose and insulin are major postprandial factors that induce CYP7A1 gene expression and bile acid synthesis. Glucose induces CYP7A1 gene expression mainly by epigenetic mechanisms. In diabetic mice, CYP7A1 chromatin is hyperacetylated, and fasting to refeeding response is impaired and may exacerbate metabolic disorders in diabetes. PMID:22144677

  12. Amino Acid Synthesis in Photosynthesizing Spinach Cells 1

    PubMed Central

    Larsen, Peder Olesen; Cornwell, Karen L.; Gee, Sherry L.; Bassham, James A.

    1981-01-01

    Isolated cells from leaves of Spinacia oleracea have been maintained in a state capable of high rates of photosynthetic CO2 fixation for more than 60 hours. The incorporation of 14CO2 under saturating CO2 conditions into carbohydrates, carboxylic acids, and amino acids, and the effect of ammonia on this incorporation have been studied. Total incorporation, specific radioactivity, and pool size have been determined as a function of time for most of the protein amino acids and for γ-aminobutyric acid. The measurements of specific radio-activities and of the approaches to 14C “saturation” of some amino acids indicate the presence and relative sizes of metabolically active and passive pools of these amino acids. Added ammonia decreased carbon fixation into carbohydrates and increased fixation into carboxylic acids and amino acids. Different amino acids were, however, affected in different and highly specific ways. Ammonia caused large stimulatory effects in incorporation of 14C into glutamine (a factor of 21), aspartate, asparagine, valine, alanine, arginine, and histidine. No effect or slight decreases were seen in glycine, serine, phenylalanine, and tyrosine labeling. In the case of glutamate, 14C labeling decreased, but specific radioactivity increased. The production of labeled γ-aminobutyric acid was virtually stopped by ammonia. The results indicate that added ammonia stimulates the reactions mediated by pyruvate kinase and phosphoenolpyruvate carboxylase, as seen with other plant systems. The data on the effects of added ammonia on total labeling, pool sizes, and specific radioactivities of several amino acids provides a number of indications about the intracellular sites of principal synthesis from carbon skeletons of these amino acids and the selective nature of effects of increased intracellular ammonia concentration on such synthesis. PMID:16661904

  13. Physiology and molecular genetics of poly(beta-hydroxy-alkanoic acid) synthesis in Alcaligenes eutrophus.

    PubMed

    Steinbüchel, A; Schlegel, H G

    1991-03-01

    The Alcaligenes eutrophus genes for beta-ketothiolase, NADPH-dependent acetoacetyl-CoA reductase and poly(beta-hydroxybutyric acid) synthase (PHB synthase) which comprise the three-step PHB-biosynthetic pathway, were cloned. Molecular studies revealed that these genes are organized in a single operon. The A. eutrophus PHB-biosynthetic genes are readily expressed in other bacteria, and DNA fragments harbouring the operon can be used as a cartridge to confer to other bacteria the ability to synthesize PHB from acetyl-CoA. The biochemical and physiological capabilities of A. eutrophus for the synthesis of a wide variety of polyhydroxyalkanoates are discussed. PMID:2046547

  14. Leucine alleviates dexamethasone-induced suppression of muscle protein synthesis via synergy involvement of mTOR and AMPK pathways.

    PubMed

    Wang, Xiao J; Yang, Xin; Wang, Ru X; Jiao, Hong C; Zhao, Jing P; Song, Zhi G; Lin, Hai

    2016-07-01

    Glucocorticoids (GCs) are negative muscle protein regulators that contribute to the whole-body catabolic state during stress. Mammalian target of rapamycin (mTOR)-signalling pathway, which acts as a central regulator of protein metabolism, can be activated by branched-chain amino acids (BCAA). In the present study, the effect of leucine on the suppression of protein synthesis induced by GCs and the pathway involved were investigated. In vitro experiments were conducted using cultured C2C12 myoblasts to study the effect of GCs on protein synthesis, and the involvement of mTOR pathway was investigated as well. After exposure to dexamethasone (DEX, 100 μmol/l) for 24 h, protein synthesis in muscle cells was significantly suppressed (P<0.05), the phosphorylations of mTOR, ribosomal protein S6 protein kinase 1 (p70s6k1) and eukaryotic initiation factor 4E binding protein 1 (4EBP1) were significantly reduced (P<0.05). Leucine supplementation (5 mmol/l, 10 mmol/l and 15 mmol/l) for 1 h alleviated the suppression of protein synthesis induced by DEX (P<0.05) and was accompanied with the increased phosphorylation of mTOR and decreased phosphorylation of AMPK (P<0.05). Branched-chain amino transferase 2 (BCAT2) mRNA level was not influenced by DEX (P>0.05) but was increased by leucine supplementation at a dose of 5 mmol/l (P<0.05). PMID:27129299

  15. Simple, high-yield synthesis of polyhedral carborane amino acids

    SciTech Connect

    Kahl, S.B.; Kasar, R.A.

    1996-02-07

    Boron neutron capture therapy (BNCT) is a form of binary cancer therapy that offers the potential of delivering spatially selective, high linear energy transfer radiation to the target cells while sparing surrounding normal tissue. We have demonstarted a versatile, general method for the conversion of o- ,m-, and p-carborane to their corresponding Boc-protected amino acids. Heterobifunctional polyhedral carboranes are exceedingly rare in the literature, and the amino acids prepared by this general method may prove to be valuable synthons for use in the synthesis of tumor-seeking compounds for BNCT or PDT. Morever, these conformationally constrained amino acids should be particularly interesting for use in peptide synthesis. The dihedral angle between the carbon atoms of these polyhedra increases in the order 60{degree} (ortho), 110{degree} (meta), and 180{degree} (para), allowing the peptide chemist to select a desired conformation. 11 refs.

  16. Lactide Synthesis and Chirality Control for Polylactic acid Production.

    PubMed

    Van Wouwe, Pieter; Dusselier, Michiel; Vanleeuw, Evelien; Sels, Bert

    2016-05-10

    Polylactic acid (PLA) is a very promising biodegradable, renewable, and biocompatible polymer. Aside from its production, its application field is also increasing, with use not only in commodity applications but also as durables and in biomedicine. In the current PLA production scheme, the most expensive part is not the polymerization itself but obtaining the building blocks lactic acid (LA) and lactide, the actual cyclic monomer for polymerization. Although the synthesis of LA and the polymerization have been studied systematically, reports of lactide synthesis are scarce. Most lactide synthesis methods are described in patent literature, and current energy-intensive, aselective industrial processes are based on archaic scientific literature. This Review, therefore, highlights new methods with a technical comparison and description of the different approaches. Water-removal methodologies are compared, as this is a crucial factor in PLA production. Apart from the synthesis of lactide, this Review also emphasizes the use of chemically produced racemic lactic acid (esters) as a starting point in the PLA production scheme. Stereochemically tailored PLA can be produced according to such a strategy, giving access to various polymer properties. PMID:27071863

  17. Bile Acid Synthesis in the Isolated, Perfused Rabbit Liver

    PubMed Central

    Mosbach, E. H.; Rothschild, M. A.; Bekersky, I.; Oratz, M.; Mongelli, J.

    1971-01-01

    These experiments were carried out to demonstrate the usefulness of the perfused rabbit liver for studies of bile acid metabolism, and to determine the rate-limiting enzyme of bile acid synthesis. Rabbits were fed a semisynthetic diet, with or without the addition of 1% cholestyramine, under controlled conditions. At the end of 2-5 wk, the livers were removed and perfused for 2.5 hr employing various 14C-labeled precursors to measure de novo cholic acid synthesis. The livers were then analyzed for cholesterol, and the bile collected during the perfusion was analyzed for cholesterol and bile acids. Control bile contained, on the average, 0.34 mg of glycocholate, 7.4 mg of glycodeoxycholate, and 0.06 mg of cholesterol. After cholestyramine treatment of the donor rabbits, the bile contained 3.3 mg of glycocholate, 3.7 mg of glycodeoxycholate, and 0.05 mg of cholesterol. It was assumed that in cholestyramine-treated animals the enterohepatic circulation of the bile acids had been interrupted sufficiently to release the feedback inhibition of the rate-controlling enzyme of bile acid synthesis. Therefore, a given precursor should be incorporated into bile acids at a more rapid rate in livers of cholestyramine-treated animals, provided that the precursor was acted upon by the rate-controlling enzyme. It was found that the incorporation of acetate-14C, mevalonolactone-14C, and cholesterol-14C into cholate was 5-20 times greater in the livers of cholestyramine-treated animals than in the controls. In contrast, there was no difference in the incorporation of 7α-hydroxycholesterol-14C into cholate regardless of dietary pretreatment. It was concluded that given an adequate precursor pool, the 7α-hydroxylation of cholesterol is the rate-limiting step in bile acid formation. PMID:5097576

  18. The regulation of triglyceride synthesis and fatty acid synthesis in rat epididymal adipose tissue. Effects of altered dietary and hormonal conditions

    PubMed Central

    Saggerson, E. D.; Greenbaum, A. L.

    1970-01-01

    1. Epididymal adipose tissues obtained from rats that had been previously starved, starved and refed a high fat diet for 72h, starved and refed bread for 144h or fed a normal diet were incubated in the presence of insulin+glucose or insulin+glucose+acetate. 2. Measurements were made of the whole-tissue concentrations of hexose phosphates, triose phosphates, glycerol 1-phosphate, 3-phosphoglycerate, 6-phosphogluconate, adenine nucleotides, acid-soluble CoA, long-chain fatty acyl-CoA, malate and citrate after 1h of incubation. The release of lactate, pyruvate and glycerol into the incubation medium during this period was also determined. 3. The rates of metabolism of glucose in the hexose monophosphate pathway, the glycolytic pathway, the citric acid cycle and into glyceride glycerol, fatty acids and lactate+pyruvate were also determined over a 2h period in similarly treated tissues. The metabolism of acetate to CO2 and fatty acids in the presence of glucose was also measured. 4. The activities of acetyl-CoA carboxylase, fatty acid synthetase and isocitrate dehydrogenase were determined in adipose tissues from starved, starved and fat-refed, and alloxan-diabetic animals and also in tissues from animals that had been starved and refed bread for up to 96h. Changes in these activities were compared with the ability of similar tissues to incorporate [14C]glucose into fatty acids in vitro. 5. The activities of acetyl-CoA carboxylase and fatty acid synthetase roughly paralleled the ability of tissues to incorporate glucose into fatty acids. 6. Rates of triglyceride synthesis and fatty acid synthesis could not be correlated with tissue concentrations of long-chain fatty acyl-CoA, citrate or glycerol 1-phosphate. In some cases changes in phosphofructokinase flux rates could be correlated with changes in citrate concentration. 7. The main lesion in fatty acid synthesis in tissues from starved, starved and fat-refed, and alloxan-diabetic rats appeared to reside at the level of

  19. New pathways for organic synthesis. Practical applications of transition metals

    SciTech Connect

    Colquhoun, H.M.; Holton, J.; Thompson, D.J.; Twigg, M.V.

    1984-01-01

    This book contains a considerable number of transition-metal-based procedures that have genuine applications in synthesis, and which are arranged according to the nature of the organic product or synthetic transformation being carried out. The objective is to provide those engaged in the preparation of pharmaceuticals, natural products, herbicides, dyestuffs, and other organic chemicals with a practical guide to the application of transition metals in organic synthesis. Topics considered include the formation of carbon-carbon bonds, the formation of carbocyclic compounds, the formation of heterocyclic compounds, the isomerization of alkenes, the direct introduction and removal of carbonyl groups, reduction, oxidation, and preparing and handling transition metal catalysts.

  20. Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

    PubMed Central

    Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

    2013-01-01

    There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

  1. Ribosomal Synthesis of Peptides with Multiple β-Amino Acids.

    PubMed

    Fujino, Tomoshige; Goto, Yuki; Suga, Hiroaki; Murakami, Hiroshi

    2016-02-17

    The compatibility of β-amino acids with ribosomal translation was studied for decades, but it has been still unclear whether the ribosome can accept various β-amino acids, and whether the ribosome can introduce multiple β-amino acids in a peptide. In the present study, by using the Escherichia coli reconstituted cell-free translation system with a reprogramed genetic code, we screened β-amino acids that give high single incorporation efficiency and used them to synthesize peptides containing multiple β-amino acids. The experiments of single β-amino acid incorporation into a peptide revealed that 13 β-amino acids are compatible with ribosomal translation. Six of the tested β-amino acids (βhGly, l-βhAla, l-βhGln, l-βhPhg, l-βhMet, and d-βhPhg) showed high incorporation efficiencies, and seven (l-βhLeu, l-βhIle, l-βhAsn, l-βhPhe, l-βhLys, d-βhAla, and d-βhLeu) showed moderate incorporation efficiencies; whereas no full-length peptide was produced using other β-amino acids (l-βhPro, l-βhTrp, and l-βhGlu). Subsequent double-incorporation experiments using β-amino acids with high single incorporation efficiency revealed that elongation of peptides with successive β-amino acids is prohibited. Efficiency of the double-incorporation of the β-amino acids was restored by the insertion of Tyr or Ile between the two β-amino acids. On the basis of these experiments, we also designed mRNA sequences of peptides, and demonstrated the ribosomal synthesis of peptides containing different types of β-amino acids at multiple positions. PMID:26807980

  2. Evolution of a Genome-Encoded Bias in Amino Acid Biosynthetic Pathways Is a Potential Indicator of Amino Acid Dynamics in the Environment

    PubMed Central

    Fasani, Rick A.; Savageau, Michael A.

    2014-01-01

    Overcoming the stress of starvation is one of an organism’s most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype–environment–phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism’s existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product—the cognate amino acid of the pathway—may require that very amino acid when it is no longer available. To study this potential “catch-22,” we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell’s fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism’s natural environment. PMID:25118252

  3. The cockroach Blattella germanica obtains nitrogen from uric acid through a metabolic pathway shared with its bacterial endosymbiont.

    PubMed

    Patiño-Navarrete, Rafael; Piulachs, Maria-Dolors; Belles, Xavier; Moya, Andrés; Latorre, Amparo; Peretó, Juli

    2014-07-01

    Uric acid stored in the fat body of cockroaches is a nitrogen reservoir mobilized in times of scarcity. The discovery of urease in Blattabacterium cuenoti, the primary endosymbiont of cockroaches, suggests that the endosymbiont may participate in cockroach nitrogen economy. However, bacterial urease may only be one piece in the entire nitrogen recycling process from insect uric acid. Thus, in addition to the uricolytic pathway to urea, there must be glutamine synthetase assimilating the released ammonia by the urease reaction to enable the stored nitrogen to be metabolically usable. None of the Blattabacterium genomes sequenced to date possess genes encoding for those enzymes. To test the host's contribution to the process, we have sequenced and analysed Blattella germanica transcriptomes from the fat body. We identified transcripts corresponding to all genes necessary for the synthesis of uric acid and its catabolism to urea, as well as for the synthesis of glutamine, asparagine, proline and glycine, i.e. the amino acids required by the endosymbiont. We also explored the changes in gene expression with different dietary protein levels. It appears that the ability to use uric acid as a nitrogen reservoir emerged in cockroaches after its age-old symbiotic association with bacteria. PMID:25079497

  4. Synthesis of Branched Methyl Hydroxy Stearates Including an Ester from Bio-Based Levulinic Acid

    Technology Transfer Automated Retrieval System (TEKTRAN)

    We report the synthesis of 5 useful branched methyl alpha-hydroxy oleate esters from commercially available methyl oleate and common organic acids. Of special interest is the synthesis utilizing the natural byproduct, levulinic acid. The other common organic acids used herein were propionic acid, ...

  5. Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway

    PubMed Central

    He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao

    2013-01-01

    Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway

  6. Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

    PubMed

    Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

    2016-07-01

    Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids. PMID:27159147

  7. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, Arthur L.

    1987-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20 percent for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  8. Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

    NASA Technical Reports Server (NTRS)

    Weber, A. L.

    1986-01-01

    The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

  9. A New Process for Acrylic Acid Synthesis by Fermentative Process

    NASA Astrophysics Data System (ADS)

    Lunelli, B. H.; Duarte, E. R.; de Toledo, E. C. Vasco; Wolf Maciel, M. R.; Maciel Filho, R.

    With the synthesis of chemical products through biotechnological processes, it is possible to discover and to explore innumerable routes that can be used to obtain products of high addes value. Each route may have particular advantages in obtaining a desired product, compared with others, especially in terms of yield, productivity, easiness to separate the product, economy, and environmental impact. The purpose of this work is the development of a deterministic model for the biochemical synthesis of acrylic acid in order to explore an alternative process. The model is built-up with the tubular reactor equations together with the kinetic representation based on the structured model. The proposed process makes possible to obtain acrylic acid continuously from the sugar cane fermentation.

  10. Regulation of protein degradation pathways by amino acids and insulin in skeletal muscle of neonatal pigs

    Technology Transfer Automated Retrieval System (TEKTRAN)

    The rapid gain in lean mass in neonates requires greater rates of protein synthesis than degradation. We previously delineated the molecular mechanisms by which insulin and amino acids, especially leucine, modulate skeletal muscle protein synthesis and how this changes with development. In the curre...

  11. Synthesis of methylphosphonic acid by marine microbes: a source for methane in the aerobic ocean

    PubMed Central

    Metcalf, William W.; Griffin, Benjamin M.; Cicchillo, Robert M.; Gao, Jiangtao; Janga, Sarath Chandra; Cooke, Heather A.; Circello, Benjamin T.; Evans, Bradley S.; Martens-Habbena, Willm; Stahl, David A.; van der Donk, Wilfred A.

    2012-01-01

    Relative to the atmosphere, much of the aerobic ocean is supersaturated with methane; however, the source of this important greenhouse gas remains enigmatic. Catabolism of methylphosphonic acid by phosphorus-starved marine microbes, with concomitant release of methane, has been suggested to explain this phenomenon, yet methylphosphonate is not a known natural product, nor has it been detected in natural systems. Further, its synthesis from known natural products would require unknown biochemistry. Here we show that the marine archaeon Nitrosopumilus maritimus encodes a pathway for methylphosphonate biosynthesis and that it produces cell-associated methylphosphonate esters. The abundance of a key gene in this pathway in metagenomic datasets suggests that methylphosphonate biosynthesis is relatively common in marine microbes, providing a plausible explanation for the methane paradox. PMID:22936780

  12. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper

    PubMed Central

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  13. Involvement of a universal amino acid synthesis impediment in cytoplasmic male sterility in pepper.

    PubMed

    Fang, Xianping; Fu, Hong-Fei; Gong, Zhen-Hui; Chai, Wei-Guo

    2016-01-01

    To explore the mechanisms of pepper (Capsicum annuum L.) cytoplasmic male sterility (CMS), we studied the different maturation processes of sterile and fertile pepper anthers. A paraffin section analysis of the sterile anthers indicated an abnormality of the tapetal layer and an over-vacuolization of the cells. The quantitative proteomics results showed that the expression of histidinol dehydrogenase (HDH), dihydroxy-acid dehydratase (DAD), aspartate aminotransferase (ATAAT), cysteine synthase (CS), delta-1-pyrroline-5-carboxylate synthase (P5CS), and glutamate synthetase (GS) in the amino acid synthesis pathway decreased by more than 1.5-fold. Furthermore, the mRNA and protein expression levels of DAD, ATAAT, CS and P5CS showed a 2- to 16-fold increase in the maintainer line anthers. We also found that most of the amino acid content levels decreased to varying degrees during the anther tapetum period of the sterile line, whereas these levels increased in the maintainer line. The results of our study indicate that during pepper anther development, changes in amino acid synthesis are significant and accompany abnormal tapetum maturity, which is most likely an important cause of male sterility in pepper. PMID:26987793

  14. Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

    PubMed

    Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

    2016-04-01

    The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5 % based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications. PMID:26895244

  15. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus.

    PubMed

    Gandara, Ana Caroline P; Oliveira, José Henrique M; Nunes, Rodrigo D; Goncalves, Renata L S; Dias, Felipe A; Hecht, Fabio; Fernandes, Denise C; Genta, Fernando A; Laurindo, Francisco R M; Oliveira, Marcus F; Oliveira, Pedro L

    2016-01-01

    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  16. Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus

    PubMed Central

    Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.

    2016-01-01

    Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

  17. Synthesis of classical pathway complement components by chondrocytes.

    PubMed Central

    Bradley, K; North, J; Saunders, D; Schwaeble, W; Jeziorska, M; Woolley, D E; Whaley, K

    1996-01-01

    Using immunohistochemical studies, C1q, C1s, C4 and C2 were detected in chondrocytes in normal human articular cartilage and macroscopically normal articular cartilage from the inferior surfaces of hip joints of patients with osteoarthritis. Using reverse-transcribed polymerase chain reaction (RT-PCR), mRNA for C1q, C1s, C4 and C2 was also detected in RNA extracted from articular cartilage. C1r, C3, C1-inhibitor, C4-binding protein and factor I were not detected by either technique. Articular chondrocytes cultured in vitro synthesized C1r, C1s, C4, C2, C3 and C1-inhibitor but not C1q, C4-binding protein or factor I, as assessed by enzyme-linked immunosorbent assay (ELISA) and Northern blot analysis. Thus cultured articular chondrocytes have a complement profile that is similar to that of cultured human fibroblasts rather than that of articular chondrocytes in vivo. Complement synthesis in cultured chondrocytes was modulated by the cytokines interleukin-1 beta (IL-1 beta), tumour necrosis factor-alpha (TNF-alpha) and interferon-gamma (IFN-gamma), showing that cytokines can probably regulate complement synthesis in intact cartilage. The possible roles of local synthesis of complement components by chondrocytes in matrix turnover and the regulation chondrocyte function are discussed. Images Figure 1 Figure 2 Figure 4 PMID:8881771

  18. Synthesis of bosutinib from 3-methoxy-4-hydroxybenzoic acid.

    PubMed

    Yin, Xiao Jia; Xu, Guan Hong; Sun, Xu; Peng, Yan; Ji, Xing; Jiang, Ke; Li, Fei

    2010-06-01

    This paper reports a novel synthesis of bosutinib starting from 3-methoxy-4-hydroxybenzoic acid. The process starts with esterification of the starting material, followed by alkylation, nitration, reduction, cyclization, chlorination and two successive amination reactions. The intermediates and target molecule were characterized by (1)H-NMR, (13)C-NMR, MS and the purities of all the compounds were determined by HPLC. PMID:20657439

  19. Is acetylcarnitine a substrate for fatty acid synthesis in plants

    SciTech Connect

    Roughan, G. ); Post-Beittenmiller, D.; Ohlrogge, J. ); Browse, J. )

    1993-04-01

    Long-chain fatty acid synthesis from [1-[sup 14]C]acetylcarnitine by chloroplasts isolated from spinach (Spinacia oleracea), pea (Pisum sativum), amaranthus (Amaranthus lividus), or maize (Zea mays) occurred at less than 2% of the rate of fatty acid synthesis from [1-[sup 14]C]acetate irrespective of the maturity of the leaves or whether the plastids were purified using sucrose or Percoll medium. [1-[sup 14]C]Acetylcarnitine was not significantly utilized by highly active chloroplasts rapidly prepared from pea and spinach using methods not involving density gradient centrifugation. [1-[sup 14]C]Acetylcarnitine was recovered quantitatively from chloroplast incubations following 10 min in the light. Unlabeled acetyl-L-carnitine (0.4 mM) did not compete with [1-[sup 14]C]acetate (0.2 mM) as a substrate for fatty acid synthesis by any of the more than 70 chloroplast preparations tested in this study. Carnitine acetyltransferase activity was not detected in any chloroplast preparation and was present in whole leaf homogenates at about 0.1% of the level of acetyl-coenzyme A synthetase activity. When supplied to detached pea shoots and detached spinach, amaranthus, and maize leaves via the transpiration stream, 1 to 4% of the [1-[sup 14]C]acetylcarnitine and 47 to 57% of the [1-[sup 14]C]acetate taken up was incorporated into lipids. Most (78--82%) of the [1-[sup 14]C]acetylcarnitine taken up was recovered intact. It is concluded that acetylcarnitine is not a major precursor for fatty acid synthesis in plants. 29 refs., 5 tabs.

  20. Strategies for the Total Synthesis of Clavicipitic Acid.

    PubMed

    Ito, Mamoru; Tahara, Yu-Ki; Shibata, Takanori

    2016-04-11

    Clavicipitic acid is an ergot alkaloid, which was isolated from Claviceps strain and Claviceps fusiformis. Its unique tricyclic azepinoindole skeleton has attracted synthetic chemists, and various strategies have been developed for its total synthesis. These strategies can be generally categorized into two types based on the synthetic intermediates, namely, 4-substituted gramine derivatives and 4-substituted tryptophan derivatives. This Minireview summarizes the reported total syntheses from the point of these two key intermediates. PMID:26822254

  1. Total Synthesis of (−)-Nodulisporic Acid D

    PubMed Central

    Zou, Yike; Melvin, Jason E.; Gonzales, Stephen S.; Spafford, Matthew J.; Smith, Amos B.

    2015-01-01

    A convergent total synthesis of the architecturally complex indole diterpenoid (−)-nodulisporic acid D has been achieved. Key synthetic transformations include vicinal difunctionalization of an advanced α,β-unsaturated aldehyde to form the E,F-transfused 5,6-ring system of the eastern hemisphere and a cascade cross-coupling/indolization protocol leading to the CDE multisubstituted indole core. PMID:26029849

  2. Synthesis of Rosin Acid Starch Catalyzed by Lipase

    PubMed Central

    Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

    2014-01-01

    Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

  3. A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

    ERIC Educational Resources Information Center

    Barrelle, M.; And Others

    1983-01-01

    Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

  4. Synthesis and role of salicylic acid in wheat varieties with different levels of cadmium tolerance.

    PubMed

    Kovács, Viktória; Gondor, Orsolya K; Szalai, Gabriella; Darkó, Eva; Majláth, Imre; Janda, Tibor; Pál, Magda

    2014-09-15

    Wheat genotypes with different endogenous SA contents were investigated, in order to reveal how cadmium influences salicylic acid (SA) synthesis, and to find possible relationships between SA and certain protective compounds (members of the antioxidants and the heavy metal detoxification system) and between the SA content and the level of cadmium tolerance. Cadmium exposure induced SA synthesis, especially in the leaves, and it is suggested that the phenyl-propanoid synthesis pathway is responsible for the accumulation of SA observed after cadmium stress. Cadmium influenced the synthesis and activation of protective compounds to varying extents in wheat genotypes with different levels of tolerance; the roots and leaves also responded differently to cadmium stress. Although a direct relationship was not found between the initial SA levels and the degree of cadmium tolerance, the results suggest that the increase in the root SA level during cadmium stress in the Mv varieties could be related with the enhancement of the internal glutathione cycle, thus inducing the antioxidant and metal detoxification systems, which promote Cd stress tolerance in wheat seedlings. The positive correlation between certain SA-related compounds and protective compounds suggests that SA-related signalling may also play a role in the acclimation to heavy metal stress. PMID:25113613

  5. In Vitro Fatty Acid Synthesis and Complex Lipid Metabolism in the Cyanobacterium Anabaena variabilis: I. Some Characteristics of Fatty Acid Synthesis.

    PubMed

    Lem, N W; Stumpf, P K

    1984-01-01

    In vitro fatty acid synthesis was examined in crude cell extracts, soluble fractions, and 80% (NH(4))(2)SO(4) fractions from Anabaena variabilis M3. Fatty acid synthesis was absolutely dependent upon acyl carrier protein and required NADPH and NADH. Moreover, fatty acid synthesis and elongation occurred in the cytoplasm of the cell. The major fatty acid products were palmitic acid (16:0) and stearic acid (18:0). Of considerable interest, both stearoyl-acyl carrier protein and stearoyl-coenzyme A desaturases were not detected in any of the fractions from A. variabilis. The similarities and differences in fatty acid synthesis between A. variabilis and higher plant tissues are discussed with respect to the endosymbiotic theory of chloroplast evolution. PMID:16663367

  6. Amino acid biosynthesis in the spirochete Leptospira: evidence for a novel pathway of isoleucine biosynthesis.

    PubMed

    Charon, N W; Johnson, R C; Peterson, D

    1974-01-01

    Radioactive carbon dioxide was incubated with growing cells of Leptospira interrogans serotypes semaranga and tarassovi, and the specific activities and distribution of the label within the cellular amino acids were determined. The origins of the carbon skeletons of all the acid-stable amino acids except isoleucine were found to be consistent with known biosynthetic pathways for these amino acids. Experiments using radioactive carbon dioxide and other tracers indicated that most of the isoleucine was synthesized by a pathway not involving threonine. The origin of the carbon skeleton of isoleucine consisted of two residues of pyruvate (carbons 2 and 3) and acetate of acetyl-coenzyme A by this pathway. Isotope competition studies indicated that the pathway was regulated by isoleucine. The results are discussed in relation to two proposed pathways of isoleucine biosynthesis involving citramalate as an intermediate. PMID:4808901

  7. Hepatic long-chain acyl-CoA synthetase 5 mediates fatty acid channeling between anabolic and catabolic pathways.

    PubMed

    Bu, So Young; Mashek, Douglas G

    2010-11-01

    Long-chain acyl-CoA synthetases (ACSLs) and fatty acid transport proteins (FATPs) activate fatty acids (FAs) to acyl-CoAs prior to their downstream metabolism. Of numerous ACSL and FATP isoforms, ACSL5 is expressed predominantly in tissues with high rates of triacylglycerol (TAG) synthesis, suggesting it may have an anabolic role in lipid metabolism. To characterize the role of ACSL5 in hepatic energy metabolism, we used small interference RNA (siRNA) to knock down ACSL5 in rat primary hepatocytes. Compared with cells transfected with control siRNA, suppression of ACSL5 expression significantly decreased FA-induced lipid droplet formation. These findings were further extended with metabolic labeling studies showing that ACSL5 knockdown resulted in decreased [1-(14)C]oleic acid or acetic acid incorporation into intracellular TAG, phospholipids, and cholesterol esters without altering FA uptake or lipogenic gene expression. ACSL5 knockdown also decreased hepatic TAG secretion proportionate to the observed decrease in neutral lipid synthesis. ACSL5 knockdown did not alter lipid turnover or mediate the effects of insulin on lipid metabolism. Hepatocytes treated with ACSL5 siRNA had increased rates of FA oxidation without changing PPAR-α activity and target gene expression. These results suggest that ACSL5 activates and channels FAs toward anabolic pathways and, therefore, is an important branch point in hepatic FA metabolism. PMID:20798351

  8. Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

    PubMed Central

    Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A

    2011-01-01

    Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

  9. Evidence for transport intermediates in aromatic amino acid synthesis of non-green tissues

    SciTech Connect

    Leuschner, C.; Schultz, G. )

    1990-05-01

    Quinate (QA) is the predominant pre-aromatic compound formed at high rates in leaves of many plants at the early vegetation stage and transported through the phloem. The transfer of 3-dehydroquinate, 3-dehydroshikimate and (SkA) across the plastidial membranes has been evidenced. The question was whether the rate of QA uptake is comparable to that of the 3 SkA-pathway intermediates. To demonstrate this, /U-{sup 14}C/QA and /U-{sup 14}C/SkA were applied to Brassica rapa roots. Both compounds were uptaken at considerable rates and incorporated into aromatic amino acids (Phe + Tyr + Trp formation, in nmol/g fresh wt x h: applying 145 {mu}mol QA: 21.2; applying 156 {mu}mol Ska: 31.8). Thus, QA is a possible candidate for transport into non-green tissues for aromatic amino acid synthesis.

  10. Differential involvement of indole-3-acetic acid biosynthetic pathways in pathogenicity and epiphytic fitness of Erwinia herbicola pv. gypsophilae.

    PubMed

    Manulis, S; Haviv-Chesner, A; Brandl, M T; Lindow, S E; Barash, I

    1998-07-01

    Erwinia herbicola pv. gypsophilae (Ehg), which induces galls on Gypsophila paniculata, harbors two major pathways for indole-3-acetic acid (IAA) synthesis, the indole-3-acetamide (IAM) and indole-3-pyruvate (IPyA) routes, as well as cytokinin biosynthetic genes. Mutants were generated in which the various biosynthetic routes were disrupted separately or jointly in order to assess the contribution of IAA of various origins and cytokinins to pathogenicity and epiphytic fitness. Inactivation of the IAM pathway or cytokinin biosynthesis caused the largest reduction in gall size. Inactivation of the IPyA pathway caused a minor, nonsignificant decrease in pathogenicity. No further reduction in gall size was observed by the simultaneous inactivation of both IAA pathways only or in combination with that of cytokinin production. However, inactivation of the IPyA pathway caused a 14-fold reduction in the population of Ehg on bean plants. Inactivation of the IAM pathway or cytokinin production did not affect epiphytic fitness. While the apparent transcriptional activity of iaaM-inaZ fusion increased slightly in cells of Ehg on bean and gypsophila leaves, compared with that in culture, very high levels of induction were observed in cells injected into gypsophila stems. In contrast, moderate levels of induction of ipdC-inaZ in Ehg were observed on leaves of these plants and in gypsophila stems, when compared with that in culture. These results suggest that the IAM pathway is involved primarily in gall formation and support the main contribution of the IpyA pathway to the epiphytic fitness of this bacterial species. PMID:9650296

  11. A distinct pathway for tetrahymanol synthesis in bacteria

    NASA Astrophysics Data System (ADS)

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.

    2015-11-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol.

  12. A distinct pathway for tetrahymanol synthesis in bacteria.

    PubMed

    Banta, Amy B; Wei, Jeremy H; Welander, Paula V

    2015-11-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  13. A distinct pathway for tetrahymanol synthesis in bacteria

    PubMed Central

    Banta, Amy B.; Wei, Jeremy H.; Welander, Paula V.

    2015-01-01

    Tetrahymanol is a polycyclic triterpenoid lipid first discovered in the ciliate Tetrahymena pyriformis whose potential diagenetic product, gammacerane, is often used as a biomarker for water column stratification in ancient ecosystems. Bacteria are also a potential source of tetrahymanol, but neither the distribution of this lipid in extant bacteria nor the significance of bacterial tetrahymanol synthesis for interpreting gammacerane biosignatures is known. Here we couple comparative genomics with genetic and lipid analyses to link a protein of unknown function to tetrahymanol synthesis in bacteria. This tetrahymanol synthase (Ths) is found in a variety of bacterial genomes, including aerobic methanotrophs, nitrite-oxidizers, and sulfate-reducers, and in a subset of aquatic and terrestrial metagenomes. Thus, the potential to produce tetrahymanol is more widespread in the bacterial domain than previously thought. However, Ths is not encoded in any eukaryotic genomes, nor is it homologous to eukaryotic squalene-tetrahymanol cyclase, which catalyzes the cyclization of squalene directly to tetrahymanol. Rather, heterologous expression studies suggest that bacteria couple the cyclization of squalene to a hopene molecule by squalene-hopene cyclase with a subsequent Ths-dependent ring expansion to form tetrahymanol. Thus, bacteria and eukaryotes have evolved distinct biochemical mechanisms for producing tetrahymanol. PMID:26483502

  14. A heteromeric membrane-bound prenyltransferase complex from hop catalyzes three sequential aromatic prenylations in the bitter acid pathway.

    PubMed

    Li, Haoxun; Ban, Zhaonan; Qin, Hao; Ma, Liya; King, Andrew J; Wang, Guodong

    2015-03-01

    Bitter acids (α and β types) account for more than 30% of the fresh weight of hop (Humulus lupulus) glandular trichomes and are well known for their contribution to the bitter taste of beer. These multiprenylated chemicals also show diverse biological activities, some of which have potential benefits to human health. The bitter acid biosynthetic pathway has been investigated extensively, and the genes for the early steps of bitter acid synthesis have been cloned and functionally characterized. However, little is known about the enzyme(s) that catalyze three sequential prenylation steps in the β-bitter acid pathway. Here, we employed a yeast (Saccharomyces cerevisiae) system for the functional identification of aromatic prenyltransferase (PT) genes. Two PT genes (HlPT1L and HlPT2) obtained from a hop trichome-specific complementary DNA library were functionally characterized using this yeast system. Coexpression of codon-optimized PT1L and PT2 in yeast, together with upstream genes, led to the production of bitter acids, but no bitter acids were detected when either of the PT genes was expressed by itself. Stepwise mutation of the aspartate-rich motifs in PT1L and PT2 further revealed the prenylation sequence of these two enzymes in β-bitter acid biosynthesis: PT1L catalyzed only the first prenylation step, and PT2 catalyzed the two subsequent prenylation steps. A metabolon formed through interactions between PT1L and PT2 was demonstrated using a yeast two-hybrid system, reciprocal coimmunoprecipitation, and in vitro biochemical assays. These results provide direct evidence of the involvement of a functional metabolon of membrane-bound prenyltransferases in bitter acid biosynthesis in hop. PMID:25564559

  15. Ribonucleic Acid Regulation in Permeabilized Cells of Escherichia coli Capable of Ribonucleic Acid and Protein Synthesis1

    PubMed Central

    Atherly, Alan G.

    1974-01-01

    A cell permeabilization procedure is described that reduces viability less than 10% and does not significantly reduce the rates of ribonucleic acid and protein synthesis when appropriately supplemented. Permeabilization abolishes the normal stringent coupling of protein and ribonucleic acid synthesis. PMID:4364330

  16. The effect of eicosapentaenoic and docosahexaenoic acid on protein synthesis and breakdown in murine C2C12 myotubes

    SciTech Connect

    Kamolrat, Torkamol; Gray, Stuart R.

    2013-03-22

    Highlights: ► EPA can enhance protein synthesis and retard protein breakdown in muscle cells. ► These effects were concurrent with increases in p70s6k and FOXO3a phosphorylation. ► EPA may be a useful tool in the treatment of muscle wasting conditions. -- Abstract: Eicosapentaenoic acid (EPA) and docosahexaenoic acid (DHA) have been found to stimulate protein synthesis with little information regarding their effects on protein breakdown. Furthermore whether there are distinct effects of EPA and DHA remains to be established. The aim of the current study was to determine the distinct effects of EPA and DHA on protein synthesis, protein breakdown and signalling pathways in C2C12 myotubes. Fully differentiated C2C12 cells were incubated for 24 h with 0.1% ethanol (control), 50 μM EPA or 50 μM DHA prior to experimentation. After serum (4 h) and amino acid (1 h) starvation cells were stimulated with 2 mM L-leucine and protein synthesis measured using {sup 3}H-labelled phenylalanine. Protein breakdown was measured using {sup 3}H-labelled phenylalanine and signalling pathways (Akt, mTOR, p70S6k, 4EBP1, rps6 and FOXO3a) via Western blots. Data revealed that after incubation with EPA protein synthesis was 25% greater (P < 0.05) compared to control cells, with no effect of DHA. Protein breakdown was 22% (P < 0.05) lower, compared to control cells, after incubation with EPA, with no effect of DHA. Analysis of signalling pathways revealed that both EPA and DHA incubation increased (P < 0.05) p70s6k phosphorylation, EPA increased (P < 0.05) FOXO3a phosphorylation, with no alteration in other signalling proteins. The current study has demonstrated distinct effects of EPA and DHA on protein metabolism with EPA showing a greater ability to result in skeletal muscle protein accretion.

  17. Synthesis and characterization of magnetite nanoparticles coated with lauric acid

    SciTech Connect

    Mamani, J.B.; Costa-Filho, A.J.; Cornejo, D.R.; Vieira, E.D.; Gamarra, L.F.

    2013-07-15

    Understanding the process of synthesis of magnetic nanoparticles is important for its implementation in in vitro and in vivo studies. In this work we report the synthesis of magnetic nanoparticles made from ferrous oxide through coprecipitation chemical process. The nanostructured material was coated with lauric acid and dispersed in aqueous medium containing surfactant that yielded a stable colloidal suspension. The characterization of magnetic nanoparticles with distinct physico-chemical configurations is fundamental for biomedical applications. Therefore magnetic nanoparticles were characterized in terms of their morphology by means of TEM and DLS, which showed a polydispersed set of spherical nanoparticles (average diameter of ca. 9 nm) as a result of the protocol. The structural properties were characterized by using X-ray diffraction (XRD). XRD pattern showed the presence of peaks corresponding to the spinel phase of magnetite (Fe{sub 3}O{sub 4}). The relaxivities r{sub 2} and r{sub 2}* values were determined from the transverse relaxation times T{sub 2} and T{sub 2}* at 3 T. Magnetic characterization was performed using SQUID and FMR, which evidenced the superparamagnetic properties of the nanoparticles. Thermal characterization using DSC showed exothermic events associated with the oxidation of magnetite to maghemite. - Highlights: • Synthesis of magnetic nanoparticles coated with lauric acid • Characterization of magnetic nanoparticles • Morphological, structural, magnetic, calorimetric and relaxometric characterization.

  18. Increased Bile Acid Synthesis and Deconjugation After Biliopancreatic Diversion.

    PubMed

    Ferrannini, Ele; Camastra, Stefania; Astiarraga, Brenno; Nannipieri, Monica; Castro-Perez, Jose; Xie, Dan; Wang, Liangsu; Chakravarthy, Manu; Haeusler, Rebecca A

    2015-10-01

    Biliopancreatic diversion (BPD) improves insulin sensitivity and decreases serum cholesterol out of proportion with weight loss. Mechanisms of these effects are unknown. One set of proposed contributors to metabolic improvements after bariatric surgeries is bile acids (BAs). We investigated the early and late effects of BPD on plasma BA levels, composition, and markers of BA synthesis in 15 patients with type 2 diabetes (T2D). We compared these to the early and late effects of Roux-en-Y gastric bypass (RYGB) in 22 patients with T2D and 16 with normal glucose tolerance. Seven weeks after BPD, insulin sensitivity had doubled and serum cholesterol had halved. At this time, BA synthesis markers and total plasma BAs, particularly unconjugated BAs, had markedly risen; this effect could not be entirely explained by low FGF19. In contrast, after RYGB, insulin sensitivity improved gradually with weight loss and cholesterol levels declined marginally; BA synthesis markers were decreased at an early time point (2 weeks) after surgery and returned to the normal range 1 year later. These findings indicate that BA synthesis contributes to the decreased serum cholesterol after BPD. Moreover, they suggest a potential role for altered enterohepatic circulation of BAs in improving insulin sensitivity and cholesterol metabolism after BPD. PMID:26015549

  19. Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

    Technology Transfer Automated Retrieval System (TEKTRAN)

    Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

  20. Cloning and characterization of a locus encoding an indolepyruvate decarboxylase involved in indole-3-acetic acid synthesis in Erwinia herbicola.

    PubMed Central

    Brandl, M T; Lindow, S E

    1996-01-01

    Erwinia herbicola 299R synthesizes indole-3-acetic acid (IAA) primarily by the indole-3-pyruvic acid pathway. A gene involved in the biosynthesis of IAA was cloned from strain 299R. This gene (ipdC) conferred the synthesis of indole-3-acetaldehyde and tryptophol upon Escherichia coli DH5 alpha in cultures supplemented with L-tryptophan. The deduced amino acid sequence of the gene product has high similarity to that of the indolepyruvate decarboxylase of Enterobacter cloacae. Regions within pyruvate decarboxylases of various fungal and plant species also exhibited considerable homology to portions of this gene. This gene therefore presumably encodes an indolepyruvate decarboxylase (IpdC) which catalyzes the conversion of indole-3-pyruvic acid to indole-3-acetaldehyde. Insertions of Tn3-spice within ipdC abolished the ability of strain 299R to synthesize indole-3-acetaldehyde and tryptophol and reduced its IAA production in tryptophan-supplemented minimal medium by approximately 10-fold, thus providing genetic evidence for the role of the indolepyruvate pathway in IAA synthesis in this strain. An ipdC probe hybridized strongly with the genomic DNA of all E. herbicola strains tested in Southern hybridization studies, suggesting that the indolepyruvate pathway is common in this species. Maximum parsimony analysis revealed that the ipdC gene is highly conserved within this group and that strains of diverse geographic origin were very similar with respect to ipdC. PMID:8900003

  1. The acid tolerance response of Salmonella typhimurium involves transient synthesis of key acid shock proteins.

    PubMed Central

    Foster, J W

    1993-01-01

    Although Salmonella typhimurium prefers neutral-pH environments, it can adapt to survive conditions of severe low-pH stress (pH 3.3). The process, termed the acid tolerance response (ATR), includes two distinct stages. The first stage, called pre-acid shock, is induced at pH 5.8 and involves the production of an inducible pH homeostasis system functional at external pH values below 4.0. The second stage occurs following an acid shock shift to pH 4.5 or below and is called the post-acid shock stage. During this stage of the ATR, 43 acid shock proteins (ASPs) are synthesized. The present data reveal that several ASPs important for pH 3.3 acid tolerance are only transiently produced. Their disappearance after 30 to 40 min of pH 4.4 acid shock coincides with an inability to survive subsequent pH 3.3 acid challenge. Clearly, an essential feature of inducible acid tolerance is an ability to synthesize these key ASPs. The pre-acid shock stage, with its inducible pH homeostasis system, offers the cell an enhanced ability to synthesize ASPs following rapid shifts to conditions below pH 4.0, an external pH that normally prevents ASP synthesis. The data also address possible signals for ASP synthesis. The inducing signal for 22 ASPs appears to be internal acidification, while external pH serves to induce 13 others. Of the 14 transient ASPs, 10 are induced in response to changes in internal pH. Mutations in the fur (ferric uptake regulator) locus that produce an Atr- acid-sensitive phenotype also eliminate induction of six transiently induced ASPs. Images PMID:8458840

  2. Early increase in phosphatidyl choline synthesis by choline and transmethylation pathways in spreading fibroblasts

    SciTech Connect

    Maziere, C.; Maziere, J.C.; Mora, L.; Polonovski, J.

    1986-11-01

    Phosphatidyl choline (PC) synthesis in trypsinized and reattaching fibroblasts during the spreading state was studied by incorporation of (/sup 14/C)choline and (methyl-/sup 14/C)methionine. The choline and phosphatidyl-ethanolamine (PE) transmethylation pathways were both transiently increased about 2-fold during the first 2 h after replating. Maximum increase appeared to be simultaneous with maximum spreading. Incorporation of (/sup 32/P)orthophosphate showed that the increase in PC synthesis was specific and most probably related to establishment of cell-substrate adhesion sites.

  3. Enzymatic synthesis of oligo- and polysaccharide fatty acid esters.

    PubMed

    van den Broek, Lambertus A M; Boeriu, Carmen G

    2013-03-01

    Amphiphilic oligo- and polysaccharides (e.g. polysaccharide alkyl or alkyl-aryl esters) form a new class of polymers with exceptional properties. They function as polymeric surfactants, whilst maintaining most of the properties of the starting polymeric material such as emulsifying, gelling, and film forming properties combined with partial water solubility or permeability. At present carbohydrate fatty acid esters are generally obtained by chemical methods using toxic solvents and organic and inorganic catalysts that leave residual traces in the final products. Enzymatic reactions offer an attractive alternative route for the synthesis of polysaccharide esters. In this review the state of the art of enzymatic synthesis of oligo- and polysaccharides fatty esters has been described. PMID:23465902

  4. Simian Virus 40 Deoxyribonucleic Acid Synthesis: Analysis by Gel Electrophoresis

    PubMed Central

    Tegtmeyer, Peter; Macasaet, Francisco

    1972-01-01

    An agarose-gel electrophoresis technique has been developed to study simian virus 40 deoxyribonucleic acid (DNA) synthesis. Superhelical DNA I, relaxed DNA II, and replicative intermediate (RI) molecules were clearly resolved from one another for analytical purposes. Moreover, the RI molecules could be identified as early or late forms on the basis of their electrophoretic migration in relation to that of DNA II. The technique has been utilized to study the kinetics of simian virus 40 DNA synthesis in pulse and in pulse-chase experiments. The average time required to complete the replication of prelabeled RI molecules and to convert them into DNA I was approximately 10 min under the experimental conditions employed. PMID:4343542

  5. Enhancement of arachidonic acid signaling pathway by nicotinic acid receptor HM74A

    SciTech Connect

    Tang, Yuting . E-mail: ytang@prdus.jnj.com; Zhou, Lubing; Gunnet, Joseph W.; Wines, Pamela G.; Cryan, Ellen V.; Demarest, Keith T.

    2006-06-23

    HM74A is a G protein-coupled receptor for nicotinic acid (niacin), which has been used clinically to treat dyslipidemia for decades. The molecular mechanisms whereby niacin exerts its pleiotropic effects on lipid metabolism remain largely unknown. In addition, the most common side effect in niacin therapy is skin flushing that is caused by prostaglandin release, suggesting that the phospholipase A{sub 2} (PLA{sub 2})/arachidonic acid (AA) pathway is involved. Various eicosanoids have been shown to activate peroxisome-proliferator activated receptors (PPAR) that play a diverse array of roles in lipid metabolism. To further elucidate the potential roles of HM74A in mediating the therapeutic effects and/or side effects of niacin, we sought to explore the signaling events upon HM74A activation. Here we demonstrated that HM74A synergistically enhanced UTP- and bradykinin-mediated AA release in a pertussis toxin-sensitive manner in A431 cells. Activation of HM74A also led to Ca{sup 2+}-mobilization and enhanced bradykinin-promoted Ca{sup 2+}-mobilization through Gi protein. While HM74A increased ERK1/2 activation by the bradykinin receptor, it had no effects on UTP-promoted ERK1/2 activation.Furthermore, UTP- and bradykinin-mediated AA release was significantly decreased in the presence of both MAPK kinase inhibitor PD 098059 and PKC inhibitor GF 109203X. However, the synergistic effects of HM74A were not dramatically affected by co-treatment with both inhibitors, indicating the cross-talk occurred at the receptor level. Finally, stimulation of A431 cells transiently transfected with PPRE-luciferase with AA significantly induced luciferase activity, mimicking the effects of PPAR{gamma} agonist rosiglitazone, suggesting that alteration of AA signaling pathway can regulate gene expression via endogenous PPARs.

  6. (-)-Hydroxycitric Acid Nourishes Protein Synthesis via Altering Metabolic Directions of Amino Acids in Male Rats.

    PubMed

    Han, Ningning; Li, Longlong; Peng, Mengling; Ma, Haitian

    2016-08-01

    (-)-Hydroxycitric acid (HCA), a major active ingredient of Garcinia Cambogia extracts, had shown to suppress body weight gain and fat accumulation in animals and humans. While, the underlying mechanism of (-)-HCA has not fully understood. Thus, this study was aimed to investigate the effects of long-term supplement with (-)-HCA on body weight gain and variances of amino acid content in rats. Results showed that (-)-HCA treatment reduced body weight gain and increased feed conversion ratio in rats. The content of hepatic glycogen, muscle glycogen, and serum T4 , T3 , insulin, and Leptin were increased in (-)-HCA treatment groups. Protein content in liver and muscle were significantly increased in (-)-HCA treatment groups. Amino acid profile analysis indicated that most of amino acid contents in serum and liver, especially aromatic amino acid and branched amino acid, were higher in (-)-HCA treatment groups. However, most of the amino acid contents in muscle, especially aromatic amino acid and branched amino acid, were reduced in (-)-HCA treatment groups. These results indicated that (-)-HCA treatment could reduce body weight gain through promoting energy expenditure via regulation of thyroid hormone levels. In addition, (-)-HCA treatment could promote protein synthesis by altering the metabolic directions of amino acids. Copyright © 2016 John Wiley & Sons, Ltd. PMID:27145492

  7. Synthesis and evaluation of colletoic acid core derivatives.

    PubMed

    Ling, Taotao; Gautam, Lekh Nath; Griffith, Elizabeth; Das, Sourav; Lang, Walter; Shadrick, William R; Shelat, Anang; Lee, Richard; Rivas, Fatima

    2016-03-01

    Cortisol homeostasis has been linked to the pathogenesis of metabolic syndrome (MetS), since it stimulates hepatic gluconeogenesis and adipogenesis. MetS is classified as a constellation of health conditions that increase the risk of type 2 diabetes and cardiovascular disease. Intracellular cortisol levels are regulated by 11β-hydroxysteroid dehydrogenase (type 1 and type 2) in a tissue dependent manner. The type 1 enzyme (11β-HSD1) is widely expressed in glucocorticoid targeted tissues and is responsible for the conversion of cortisone to the active cortisol. Local reduction of cortisol regeneration presents a potential strategy for MetS treatment. Recently we disclosed the total synthesis of (+)-colletoic acid as a potent 11β-HSD1 inhibitor. Herein, we describe our improved processing chemistry for the synthesis of the colletoic acid core to access a diverse number of derivatives for evaluation against 11β-HSD1. The Evan's chiral auxiliary was utilized to construct the acyclic precursor 12 to afford the acorane core 9 using a modified Heck reaction in excellent chemical yields. The colletoic acid core derivatives showed modest activity against 11β-HSD1 and will serve for further biological evaluation. PMID:26820555

  8. The Suf Iron-Sulfur Cluster Synthesis Pathway Is Required for Apicoplast Maintenance in Malaria Parasites

    PubMed Central

    Gisselberg, Jolyn E.; Dellibovi-Ragheb, Teegan A.; Matthews, Krista A.; Bosch, Gundula; Prigge, Sean T.

    2013-01-01

    The apicoplast organelle of the malaria parasite Plasmodium falciparum contains metabolic pathways critical for liver-stage and blood-stage development. During the blood stages, parasites lacking an apicoplast can grow in the presence of isopentenyl pyrophosphate (IPP), demonstrating that isoprenoids are the only metabolites produced in the apicoplast which are needed outside of the organelle. Two of the isoprenoid biosynthesis enzymes are predicted to rely on iron-sulfur (FeS) cluster cofactors, however, little is known about FeS cluster synthesis in the parasite or the roles that FeS cluster proteins play in parasite biology. We investigated two putative FeS cluster synthesis pathways (Isc and Suf) focusing on the initial step of sulfur acquisition. In other eukaryotes, these proteins can be located in multiple subcellular compartments, raising the possibility of cross-talk between the pathways or redundant functions. In P. falciparum, SufS and its partner SufE were found exclusively the apicoplast and SufS was shown to have cysteine desulfurase activity in a complementation assay. IscS and its effector Isd11 were solely mitochondrial, suggesting that the Isc pathway cannot contribute to apicoplast FeS cluster synthesis. The Suf pathway was disrupted with a dominant negative mutant resulting in parasites that were only viable when supplemented with IPP. These parasites lacked the apicoplast organelle and its organellar genome – a phenotype not observed when isoprenoid biosynthesis was specifically inhibited with fosmidomycin. Taken together, these results demonstrate that the Suf pathway is essential for parasite survival and has a fundamental role in maintaining the apicoplast organelle in addition to any role in isoprenoid biosynthesis. PMID:24086138

  9. Biological function of the dTDP-rhamnose synthesis pathway in Streptococcus mutans.

    PubMed Central

    Tsukioka, Y; Yamashita, Y; Oho, T; Nakano, Y; Koga, T

    1997-01-01

    We have cloned a new gene locus that comprises three genes concerned with the biosynthesis of the serotype c-specific polysaccharide antigen in Streptococcus mutans. The genes encode proteins exhibiting significant homology to the rfbA, rfbB, and rfbD gene products that are involved in the anabolism of dTDP-L-rhamnose from D-glucose-1-phosphate. This anabolism pathway pertains to biosynthesis of the O antigen of lipopolysaccharide in gram-negative bacteria. The cell extract of Escherichia coli expressing each of the cloned genes of S. mutans exhibited enzymatic activity corresponding to the homologous counterpart of the rfb gene products. Rhamnose was not detected in the cell wall preparation purified from the mutant in which each of the three cloned genes was insertionally inactivated. Rabbit antiserum against S. mutans serotype c-specific antigen did not react with the autoclaved extracts from these mutants. These results indicate that the gene products identified in the present study are involved in the dTDP-L-rhamnose synthesis pathway and that the pathway relates to the biosynthesis of the serotype-specific polysaccharide antigen of S. mutans. Southern hybridization analysis revealed that genes homologous to the cloned genes involved in the dTDP-L-rhamnose synthesis pathway were widely distributed in a variety of streptococci. This is the first report of the biological function of the dTDP-rhamnose pathway in streptococci. PMID:9023194

  10. Synthesis and evaluation of novel benzylphthalazine derivatives as hedgehog signaling pathway inhibitors.

    PubMed

    Bao, Xiaolong; Peng, Yuanqiu; Lu, Xiuhong; Yang, Jun; Zhao, Weili; Tan, Wenfu; Dong, Xiaochun

    2016-07-01

    We report herein the design and synthesis of a series of novel benzylphthalazine derivatives as hedgehog signaling pathway inhibitors. Gli-luciferase assay demonstrated that changing piperazine ring of Anta XV to different four, five or six-membered heterocyclic building blocks afforded significant influences on Hh pathway inhibition. In particular, compound 10e with piperidin-4-amine moiety was found to possess 12-fold higher Hh inhibitory activities comparing to the lead compound in vitro. In vivo efficacy of 10e in a ptch(+/-)p53(-/-) mouse medulloblastoma allograft model also indicated encouraging results. PMID:27180012