Manandhar, Miglena; Cronan, John E
2017-05-01
Biotin synthetic pathways are readily separated into two stages, synthesis of the seven carbon α, ω-dicarboxylic acid pimelate moiety and assembly of the fused heterocyclic rings. The biotin pathway genes responsible for pimelate moiety synthesis vary widely among bacteria whereas the ring synthesis genes are highly conserved. Bacillus subtilis seems to have redundant genes, bioI and bioW, for generation of the pimelate intermediate. Largely consistent with previous genetic studies it was found that deletion of bioW caused a biotin auxotrophic phenotype whereas deletion of bioI did not. BioW is a pimeloyl-CoA synthetase that converts pimelic acid to pimeloyl-CoA. The essentiality of BioW for biotin synthesis indicates that the free form of pimelic acid is an intermediate in biotin synthesis although this is not the case in E. coli. Since the origin of pimelic acid in Bacillus subtilis is unknown, 13 C-NMR studies were carried out to decipher the pathway for its generation. The data provided evidence for the role of free pimelate in biotin synthesis and the involvement of fatty acid synthesis in pimelate production. Cerulenin, an inhibitor of the key fatty acid elongation enzyme, FabF, markedly decreased biotin production by B. subtilis resting cells whereas a strain having a cerulenin-resistant FabF mutant produced more biotin. In addition, supplementation with pimelic acid fully restored biotin production in cerulenin-treated cells. These results indicate that pimelic acid originating from fatty acid synthesis pathway is a bona fide precursor of biotin in B. subtilis. © 2017 John Wiley & Sons Ltd.
Origin of fatty acid synthesis - Thermodynamics and kinetics of reaction pathways
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1991-01-01
The primitiveness of contemporary fatty acid biosynthesis was evaluated by using the thermodynamics and kinetics of its component reactions to estimate the extent of its dependence on powerful and selective catalysis by enzymes. Since this analysis indicated that the modern pathway is not primitive because it requires sophisticated enzymatic catalysis, an alternative pathway of primitive fatty acid synthesis is proposed that uses glycolaldehyde as a substrate. In contrast to the modern pathway, this primitive pathway is not dependent on an exogenous source of phosphoanhydride energy. Furthermore, the chemical spontaneity of its reactions suggests that it could have been readily catalyzed by the rudimentary biocatalysts available at an early stage in the origin of life.
Jawed, Kamran; Mattam, Anu Jose; Fatma, Zia; Wajid, Saima; Abdin, Malik Z.; Yazdani, Syed Shams
2016-01-01
Short-chain fatty acids (SCFAs), such as butyric acid, have a broad range of applications in chemical and fuel industries. Worldwide demand of sustainable fuels and chemicals has encouraged researchers for microbial synthesis of SCFAs. In this study we compared three thioesterases, i.e., TesAT from Anaerococcus tetradius, TesBF from Bryantella formatexigens and TesBT from Bacteroides thetaiotaomicron, for production of SCFAs in Escherichia coli utilizing native fatty acid synthesis (FASII) pathway and modulated the genetic and bioprocess parameters to improve its yield and productivity. E. coli strain expressing tesBT gene yielded maximum butyric acid titer at 1.46 g L-1, followed by tesBF at 0.85 g L-1 and tesAT at 0.12 g L-1. The titer of butyric acid varied significantly depending upon the plasmid copy number and strain genotype. The modulation of genetic factors that are known to influence long chain fatty acid production, such as deletion of the fadD and fadE that initiates the fatty acid degradation cycle and overexpression of fadR that is a global transcriptional activator of fatty acid biosynthesis and repressor of degradation cycle, did not improve the butyric acid titer significantly. Use of chemical inhibitor cerulenin, which restricts the fatty acid elongation cycle, increased the butyric acid titer by 1.7-fold in case of TesBF, while it had adverse impact in case of TesBT. In vitro enzyme assay indicated that cerulenin also inhibited short chain specific thioesterase, though inhibitory concentration varied according to the type of thioesterase used. Further process optimization followed by fed-batch cultivation under phosphorous limited condition led to production of 14.3 g L-1 butyric acid and 17.5 g L-1 total free fatty acid at 28% of theoretical yield. This study expands our understanding of SCFAs production in E. coli through FASII pathway and highlights role of genetic and process optimization to enhance the desired product. PMID:27466817
DOE Office of Scientific and Technical Information (OSTI.GOV)
Chander, A.; Gullo, J.; Reicherter, J.
1987-05-01
Regulation of phosphatidylcholine (PC) synthesis in rat granular pneumocytes isolated by tryptic digestion of lungs and maintained in primary culture for 24 h was investigated by following effects of exogenous fatty acids on (/sup 3/H-methyl)choline incorporation into PC and disaturated PC (DSPC). At 0.1 mM choline, the rate of choline incorporation into PC and DSPC was 440 +/- and 380 +/- 50 pmol/h/ug Pi (mean +/- SE, n=3-5), respectively, and was linear for up to 3 h. PC synthesis was significantly increased by 0.1 mM each of palmitic, oleic, linoleic, or linolenic acid. However, synthesis of DSPC was increased onlymore » by palmitic acid and this increase was prevented by addition of oleic acid suggesting lack of effect on the remodeling pathway. Pulse-chase experiments with choline in absence or presence of palmitic or oleic acid showed that the label declined in choline phosphate and increased in PC more rapidly in presence of either of the fatty acids, suggesting rapid conversion of choline phosphate to PC. Microsomal choline phosphate cytidyltransferase activity in cells preincubated without or with palmitic acid for 3 h was 0.81 +/- 0.07 and 1.81 +/- 0.09 nmol choline phosphate converted/min/mg protein (n=4). These results suggest that in granular pneumocytes, exogenous fatty acids modulate PC synthesis by increasing choline phosphate cytidyltransferase activity.« less
Clay, Hayley B.; Parl, Angelika K.; Mitchell, Sabrina L.; Singh, Larry; Bell, Lauren N.; Murdock, Deborah G.
2016-01-01
Despite the presence of a cytosolic fatty acid synthesis pathway, mitochondria have retained their own means of creating fatty acids via the mitochondrial fatty acid synthesis (mtFASII) pathway. The reason for its conservation has not yet been elucidated. Therefore, to better understand the role of mtFASII in the cell, we used thin layer chromatography to characterize the contribution of the mtFASII pathway to the fatty acid composition of selected mitochondrial lipids. Next, we performed metabolomic analysis on HeLa cells in which the mtFASII pathway was either hypofunctional (through knockdown of mitochondrial acyl carrier protein, ACP) or hyperfunctional (through overexpression of mitochondrial enoyl-CoA reductase, MECR). Our results indicate that the mtFASII pathway contributes little to the fatty acid composition of mitochondrial lipid species examined. Additionally, loss of mtFASII function results in changes in biochemical pathways suggesting alterations in glucose utilization and redox state. Interestingly, levels of bioactive lipids, including lysophospholipids and sphingolipids, directly correlate with mtFASII function, indicating that mtFASII may be involved in the regulation of bioactive lipid levels. Regulation of bioactive lipid levels by mtFASII implicates the pathway as a mediator of intracellular signaling. PMID:26963735
Lovelock, Sarah L; Lloyd, Richard C; Turner, Nicholas J
2014-04-25
Phenylalanine ammonia lyases (PALs) belong to a family of 4-methylideneimidazole-5-one (MIO) cofactor dependent enzymes which are responsible for the conversion of L-phenylalanine into trans-cinnamic acid in eukaryotic and prokaryotic organisms. Under conditions of high ammonia concentration, this deamination reaction is reversible and hence there is considerable interest in the development of PALs as biocatalysts for the enantioselective synthesis of non-natural amino acids. Herein the discovery of a previously unobserved competing MIO-independent reaction pathway, which proceeds in a non-stereoselective manner and results in the generation of both L- and D-phenylalanine derivatives, is described. The mechanism of the MIO-independent pathway is explored through isotopic-labeling studies and mutagenesis of key active-site residues. The results obtained are consistent with amino acid deamination occurring by a stepwise E1 cB elimination mechanism. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Changes in isoprenoid lipid synthesis by gemfibrozil and clofibric acid in rat hepatocytes.
Hashimoto, F; Taira, S; Hayashi, H
2000-05-15
We studied whether gemfibrozil and clofibric acid alter isoprenoid lipid synthesis in rat hepatocytes. After incubation of the cells with the agent for 74 hr, [(14)C]acetate or [(3)H]mevalonate was added, and the cells were further incubated for 4 hr. Gemfibrozil and clofibric acid increased ubiquinone synthesis from [(14)C]acetate and [(3)H]mevalonate. The effect of gemfibrozil was greater than that of clofibric acid. Also, gemfibrozil decreased dolichol synthesis from [(14)C]acetate and [(3)H]mevalonate. However, clofibric acid increased dolichol synthesis from [(3)H]mevalonate. Gemfibrozil decreased cholesterol synthesis from [(14)C]acetate and [(3)H]mevalonate. Clofibric acid decreased cholesterol synthesis from [(14)C]acetate, but did not affect synthesis from [(3)H]mevalonate. These results suggest that both agents, at different rates, activate the synthetic pathway of ubiquinone, at least from mevalonate. Gemfibrozil may inhibit the synthetic pathway of dolichol, at least from mevalonate. Contrary to gemfibrozil, clofibric acid may activate the synthetic pathway of dolichol from mevalonate. Gemfibrozil may inhibit the synthetic pathway of cholesterol from mevalonate in addition to the pathway from acetate to mevalonate inhibited by both agents.
Chen, Cong; Han, Xiao; Zou, Xuan; Li, Yuan; Yang, Liang; Cao, Ke; Xu, Jie; Long, Jiangang; Liu, Jiankang; Feng, Zhihui
2014-01-01
4-Methylene-2-octyl-5-oxotetrahydrofuran-3-carboxylic acid (C75) is a synthetic fatty-acid synthase (FASN) inhibitor with potential therapeutic effects in several cancer models. Human mitochondrial β-ketoacyl-acyl carrier protein synthase (HsmtKAS) is a key enzyme in the newly discovered mitochondrial fatty acid synthesis pathway that can produce the substrate for lipoic acid (LA) synthesis. HsmtKAS shares conserved catalytic domains with FASN, which are responsible for binding to C75. In our study, we explored the possible effect of C75 on HsmtKAS and mitochondrial function. C75 treatment decreased LA content, impaired mitochondrial function, increased reactive oxygen species content, and reduced cell viability. HsmtKAS but not FASN knockdown had an effect that was similar to C75 treatment. In addition, an LA supplement efficiently inhibited C75-induced mitochondrial dysfunction and oxidative stress. Overexpression of HsmtKAS showed cellular protection against low dose C75 addition, whereas there was no protective effect upon high dose C75 addition. In summary, the mitochondrial fatty acid synthesis pathway has a vital role in mitochondrial function. Besides FASN, C75 might also inhibit HsmtKAS, thereby reducing LA production, impairing mitochondrial function, and potentially having toxic effects. LA supplements sufficiently ameliorated the toxicity of C75, showing that a combination of C75 and LA may be a reliable cancer treatment. PMID:24784139
Brandi, Jessica; Dando, Ilaria; Pozza, Elisa Dalla; Biondani, Giulia; Jenkins, Rosalind; Elliott, Victoria; Park, Kevin; Fanelli, Giuseppina; Zolla, Lello; Costello, Eithne; Scarpa, Aldo; Cecconi, Daniela; Palmieri, Marta
2017-01-06
Recently, we have shown that the secretome of pancreatic cancer stem cells (CSCs) is characterized by proteins that participate in cancer differentiation, invasion, and metastasis. However, the differentially expressed intracellular proteins that lead to the specific characteristics of pancreatic CSCs have not yet been identified, and as a consequence the deranged metabolic pathways are yet to be elucidated. To identify the modulated proteins of pancreatic CSCs, iTRAQ-based proteomic analysis was performed to compare the proteome of Panc1 CSCs and Panc1 parental cells, identifying 230 modulated proteins. Pathway analysis revealed activation of glycolysis, the pentose phosphate pathway, the pyruvate-malate cycle, and lipid metabolism as well as downregulation of the Krebs cycle, the splicesome and non-homologous end joining. These findings were supported by metabolomics and immunoblotting analysis. It was also found that inhibition of fatty acid synthase by cerulenin and of mevalonate pathways by atorvastatin have a greater anti-proliferative effect on cancer stem cells than parental cells. Taken together, these results clarify some important aspects of the metabolic network signature of pancreatic cancer stem cells, shedding light on key and novel therapeutic targets and suggesting that fatty acid synthesis and mevalonate pathways play a key role in ensuring their viability. To better understand the altered metabolic pathways of pancreatic cancer stem cells (CSCs), a comprehensive proteomic analysis and metabolite profiling investigation of Panc1 and Panc1 CSCs were carried out. The findings obtained indicate that Panc1 CSCs are characterized by upregulation of glycolysis, pentose phosphate pathway, pyruvate-malate cycle, and lipid metabolism and by downregulation of Krebs cycle, spliceosome and non-homologous end joining. Moreover, fatty acid synthesis and mevalonate pathways are shown to play a critical contribution to the survival of pancreatic cancer stem cells
Engineering Sialic Acid Synthesis Ability in Insect Cells.
Viswanathan, Karthik; Narang, Someet; Betenbaugh, Michael J
2015-01-01
Insect cells lack the ability to synthesize the sialic acid donor molecule CMP-sialic acid or its precursor, sialic acid. In this chapter, we describe a method to engineer CMP-sialic acid synthesis capability into Spodoptera frugiperda (Sf9) cells, a prototypical insect cell line, by recombinant expression of sialic acid synthesis pathway genes using baculovirus technology. Co-expression of a sialuria mutant UDP-GlcNAc-2-epimerase/ManNAc kinase (EKR263L), wild-type sialic acid 9-phosphate synthase (SAS), and wild-type CMP-sialic acid synthetase (CSAS) in the presence of GlcNAc leads to synthesis of CMP-sialic acids synthesis to support sialylation of N-glycans on glycoproteins.
Chen, Nanhua; LaCrue, Alexis N.; Teuscher, Franka; Waters, Norman C.; Gatton, Michelle L.; Kyle, Dennis E.
2014-01-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. PMID:24913167
Chen, Nanhua; LaCrue, Alexis N; Teuscher, Franka; Waters, Norman C; Gatton, Michelle L; Kyle, Dennis E; Cheng, Qin
2014-08-01
Artemisinin (ART)-based combination therapy (ACT) is used as the first-line treatment of uncomplicated falciparum malaria worldwide. However, despite high potency and rapid action, there is a high rate of recrudescence associated with ART monotherapy or ACT long before the recent emergence of ART resistance. ART-induced ring-stage dormancy and recovery have been implicated as possible causes of recrudescence; however, little is known about the characteristics of dormant parasites, including whether dormant parasites are metabolically active. We investigated the transcription of 12 genes encoding key enzymes in various metabolic pathways in P. falciparum during dihydroartemisinin (DHA)-induced dormancy and recovery. Transcription analysis showed an immediate downregulation for 10 genes following exposure to DHA but continued transcription of 2 genes encoding apicoplast and mitochondrial proteins. Transcription of several additional genes encoding apicoplast and mitochondrial proteins, particularly of genes encoding enzymes in pyruvate metabolism and fatty acid synthesis pathways, was also maintained. Additions of inhibitors for biotin acetyl-coenzyme A (CoA) carboxylase and enoyl-acyl carrier reductase of the fatty acid synthesis pathways delayed the recovery of dormant parasites by 6 and 4 days, respectively, following DHA treatment. Our results demonstrate that most metabolic pathways are downregulated in DHA-induced dormant parasites. In contrast, fatty acid and pyruvate metabolic pathways remain active. These findings highlight new targets to interrupt recovery of parasites from ART-induced dormancy and to reduce the rate of recrudescence following ART treatment. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
The synthesis of glutamic acid in the absence of enzymes: Implications for biogenesis
NASA Technical Reports Server (NTRS)
Morowitz, Harold; Peterson, Eta; Chang, Sherwood
1995-01-01
This paper reports on the non-enzymatic aqueous phase synthesis of amino acids from keto acids, ammonia and reducing agents. The facile synthesis of key metabolic intermediates, particularly in the glycolytic pathway, the citric acid cycle, and the first step of amino acid synthesis, lead to new ways of looking at the problem of biogenesis.
Parsons, Joshua B.; Frank, Matthew W.; Jackson, Pamela; Subramanian, Chitra; Rock, Charles O.
2014-01-01
Summary Acyl-CoA and acyl-acyl carrier protein (ACP) synthetases activate exogenous fatty acids for incorporation into phospholipids in Gram-negative bacteria. However, Gram-positive bacteria utilize an acyltransferase pathway for the biogenesis of phosphatidic acid that begins with the acylation of sn-glycerol-3-phosphate by PlsY using an acyl-phosphate (acyl-PO4) intermediate. PlsX generates acyl-PO4 from the acyl-ACP end-products of fatty acid synthesis. The plsX gene of Staphylococcus aureus was inactivated and the resulting strain was both a fatty acid auxotroph and required de novo fatty acid synthesis for growth. Exogenous fatty acids were only incorporated into the 1-position and endogenous acyl groups were channeled into the 2-position of the phospholipids in strain PDJ39 (ΔplsX). Extracellular fatty acids were not elongated. Removal of the exogenous fatty acid supplement led to the rapid accumulation of intracellular acyl-ACP and the abrupt cessation of fatty acid synthesis. Extracts from the ΔplsX strain exhibited an ATP-dependent fatty acid kinase activity, and the acyl-PO4 was converted to acyl-ACP when purified PlsX is added. These data reveal the existence of a novel fatty acid kinase pathway for the incorporation of exogenous fatty acids into S. aureus phospholipids. PMID:24673884
Maeda-Sano, Katsura; Gotoh, Mari; Morohoshi, Toshiro; Someya, Takao; Murofushi, Hiromu; Murakami-Murofushi, Kimiko
2014-09-01
Cyclic phosphatidic acid (cPA) is a naturally occurring phospholipid mediator and an analog of the growth factor-like phospholipid lysophosphatidic acid (LPA). cPA has a unique cyclic phosphate ring at the sn-2 and sn-3 positions of its glycerol backbone. We showed before that a metabolically stabilized cPA derivative, 2-carba-cPA, relieved osteoarthritis pathogenesis in vivo and induced hyaluronic acid synthesis in human osteoarthritis synoviocytes in vitro. This study focused on hyaluronic acid synthesis in human fibroblasts, which retain moisture and maintain health in the dermis. We investigated the effects of cPA and LPA on hyaluronic acid synthesis in human fibroblasts (NB1RGB cells). Using particle exclusion and enzyme-linked immunosorbent assays, we found that both cPA and LPA dose-dependently induced hyaluronic acid synthesis. We revealed that the expression of hyaluronan synthase 2 messenger RNA and protein is up-regulated by cPA and LPA treatment time dependently. We then characterized the signaling pathways up-regulating hyaluronic acid synthesis mediated by cPA and LPA in NB1RGB cells. Pharmacological inhibition and reporter gene assays revealed that the activation of the LPA receptor LPAR1, Gi/o protein, phosphatidylinositol-3 kinase (PI3K), extracellular-signal-regulated kinase (ERK), and cyclic adenosine monophosphate response element-binding protein (CREB) but not nuclear factor κB induced hyaluronic acid synthesis by the treatment with cPA and LPA in NB1RGB cells. These results demonstrate for the first time that cPA and LPA induce hyaluronic acid synthesis in human skin fibroblasts mainly through the activation of LPAR1-Gi/o followed by the PI3K, ERK, and CREB signaling pathway. Copyright © 2014 The Authors. Published by Elsevier B.V. All rights reserved.
PlsX deletion impacts fatty acid synthesis and acid adaptation in Streptococcus mutans.
Cross, Benjamin; Garcia, Ariana; Faustoferri, Roberta; Quivey, Robert G
2016-04-01
Streptococcus mutans, one of the primary causative agents of dental caries in humans, ferments dietary sugars in the mouth to produce organic acids. These acids lower local pH values, resulting in demineralization of the tooth enamel, leading to caries. To survive acidic environments, Strep. mutans employs several adaptive mechanisms, including a shift from saturated to unsaturated fatty acids in membrane phospholipids. PlsX is an acyl-ACP : phosphate transacylase that links the fatty acid synthase II (FASII) pathway to the phospholipid synthesis pathway, and is therefore central to the movement of unsaturated fatty acids into the membrane. Recently, we discovered that plsX is not essential in Strep. mutans. A plsX deletion mutant was not a fatty acid or phospholipid auxotroph. Gas chromatography of fatty acid methyl esters indicated that membrane fatty acid chain length in the plsX deletion strain differed from those detected in the parent strain, UA159. The deletion strain displayed a fatty acid shift similar to WT, but had a higher percentage of unsaturated fatty acids at low pH. The deletion strain survived significantly longer than the parent strain when cultures were subjected to an acid challenge of pH 2.5.The ΔplsX strain also exhibited elevated F-ATPase activity at pH 5.2, compared with the parent. These results indicate that the loss of plsX affects both the fatty acid synthesis pathway and the acid-adaptive response of Strep. mutans.
Haushalter, Robert W; Phelan, Ryan M; Hoh, Kristina M; Su, Cindy; Wang, George; Baidoo, Edward E K; Keasling, Jay D
2017-04-05
Dicarboxylic acids are commodity chemicals used in the production of plastics, polyesters, nylons, fragrances, and medications. Bio-based routes to dicarboxylic acids are gaining attention due to environmental concerns about petroleum-based production of these compounds. Some industrial applications require dicarboxylic acids with specific carbon chain lengths, including odd-carbon species. Biosynthetic pathways involving cytochrome P450-catalyzed oxidation of fatty acids in yeast and bacteria have been reported, but these systems produce almost exclusively even-carbon species. Here we report a novel pathway to odd-carbon dicarboxylic acids directly from glucose in Escherichia coli by employing an engineered pathway combining enzymes from biotin and fatty acid synthesis. Optimization of the pathway will lead to industrial strains for the production of valuable odd-carbon diacids.
Induction of phytic acid synthesis by abscisic acid in suspension-cultured cells of rice.
Matsuno, Koya; Fujimura, Tatsuhito
2014-03-01
A pathway of phytic acid (PA) synthesis in plants has been revealed via investigations of low phytic acid mutants. However, the regulation of this pathway is not well understood because it is difficult to control the environments of cells in the seeds, where PA is mainly synthesized. We modified a rice suspension culture system in order to study the regulation of PA synthesis. Rice cells cultured with abscisic acid (ABA) accumulate PA at higher levels than cells cultured without ABA, and PA accumulation levels increase with ABA concentration. On the other hand, higher concentrations of sucrose or inorganic phosphorus do not affect PA accumulation. Mutations in the genes RINO1, OsMIK, OsIPK1 and OsLPA1 have each been reported to confer low phytic acid phenotypes in seeds. Each of these genes is upregulated in cells cultured with ABA. OsITPK4 and OsITPK6 are upregulated in cells cultured with ABA and in developing seeds. These results suggest that the regulation of PA synthesis is similar between developing seeds and cells in this suspension culture system. This system will be a powerful tool for elucidating the regulation of PA synthesis. Copyright © 2014 Elsevier Ireland Ltd. All rights reserved.
Is Bacterial Fatty Acid Synthesis a Valid Target for Antibacterial Drug Discovery?
Parsons, Joshua B.; Rock, Charles O.
2011-01-01
The emergence of resistance against most current drugs emphasizes the need to develop new approaches to control bacterial pathogens, particularly Staphylococcus aureus. Bacterial fatty acid synthesis is one such target that is being actively pursued by several research groups to develop anti-Staphylococcal agents. Recently, the wisdom of this approach has been challenged based on the ability of a Gram-positive bacterium to incorporate extracellular fatty acids and thus circumvent the inhibition of de novo fatty acid synthesis. The generality of this conclusion has been challenged, and there is enough diversity in the enzymes and regulation of fatty acid synthesis in bacteria to conclude that there isn’t a single organism that can be considered typical and representative of bacteria as a whole. We are left without a clear resolution to this ongoing debate and await new basic research to define the pathways for fatty acid uptake and that determine the biochemical and genetic mechanisms for the regulation of fatty acid synthesis in Gram-positive bacteria. These crucial experiments will determine whether diversity in the control of this important pathway accounts for the apparently different responses of Gram-positive bacteria to the inhibition of de novo fatty acid synthesis in presence of extracellular fatty acid supplements. PMID:21862391
Biotin and Lipoic Acid: Synthesis, Attachment and Regulation
Cronan, John E.
2014-01-01
Summary Two vitamins, biotin and lipoic acid, are essential in all three domains of life. Both coenzymes function only when covalently attached to key metabolic enzymes. There they act as “swinging arms” that shuttle intermediates between two active sites (= covalent substrate channeling) of key metabolic enzymes. Although biotin was discovered over 100 years ago and lipoic acid 60 years ago, it was not known how either coenzyme is made until recently. In Escherichia coli the synthetic pathways for both coenzymes have now been worked out for the first time. The late steps of biotin synthesis, those involved in assembling the fused rings, were well-described biochemically years ago, although recent progress has been made on the BioB reaction, the last step of the pathway in which the biotin sulfur moiety is inserted. In contrast, the early steps of biotin synthesis, assembly of the fatty acid-like “arm” of biotin were unknown. It has now been demonstrated that the arm is made by using disguised substrates to gain entry into the fatty acid synthesis pathway followed by removal of the disguise when the proper chain length is attained. The BioC methyltransferase is responsible for introducing the disguise and the BioH esterase for its removal. In contrast to biotin, which is attached to its cognate proteins as a finished molecule, lipoic acid is assembled on its cognate proteins. An octanoyl moiety is transferred from the octanoyl-ACP of fatty acid synthesis to a specific lysine residue of a cognate protein by the LipB octanoyl transferase followed by sulfur insertion at carbons C6 and C8 by the LipA lipoyl synthetase. Assembly on the cognate proteins regulates the amount of lipoic acid synthesized and thus there is no transcriptional control of the synthetic genes. In contrast transcriptional control of the biotin synthetic genes is wielded by a remarkably sophisticated, yet simple, system, exerted through BirA a dual function protein that both represses
DOE Office of Scientific and Technical Information (OSTI.GOV)
Haushalter, Robert W.; Phelan, Ryan M.; Hoh, Kristina M.
Dicarboxylic acids are commodity chemicals used in the production of plastics, polyesters, nylons, fragrances, and medications. Bio-based routes to dicarboxylic acids are gaining attention due to environmental concerns about petroleum-based production of these compounds. Some industrial applications require dicarboxylic acids with specific carbon chain lengths, including odd-carbon species. Biosynthetic pathways involving cytochrome P450-catalyzed oxidation of fatty acids in yeast and bacteria have been reported, but these systems produce almost exclusively even-carbon species. Here in this paper we report a novel pathway to odd-carbon dicarboxylic acids directly from glucose in Escherichia coli by employing an engineered pathway combining enzymes from biotinmore » and fatty acid synthesis. Optimization of the pathway will lead to industrial strains for the production of valuable odd-carbon diacids.« less
Fernández-Escalada, Manuel; Zulet-González, Ainhoa; Gil-Monreal, Miriam; Zabalza, Ana; Ravet, Karl; Gaines, Todd; Royuela, Mercedes
2017-01-01
A key enzyme of the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19), is the known target of the widely used herbicide glyphosate. Glyphosate resistance in Amaranthus palmeri, one of the most troublesome weeds in agriculture, has evolved through increased EPSPS gene copy number. The aim of this work was to study the pleiotropic effects of (i) EPSPS increased transcript abundance due to gene copy number variation (CNV) and of (ii) glyphosate application on the aromatic amino acid (AAA) and branched chain amino acid (BCAA) synthesis pathways. Hydroponically grown glyphosate sensitive (GS) and glyphosate resistant (GR) plants were treated with glyphosate 3 days after treatment. In absence of glyphosate treatment, high EPSPS gene copy number had only a subtle effect on transcriptional regulation of AAA and BCAA pathway genes. In contrast, glyphosate treatment provoked a general accumulation of the transcripts corresponding to genes of the AAA pathway leading to synthesis of chorismate in both GS and GR. After chorismate, anthranilate synthase transcript abundance was higher while chorismate mutase transcription showed a small decrease in GR and remained stable in GS, suggesting a regulatory branch point in the pathway that favors synthesis toward tryptophan over phenylalanine and tyrosine after glyphosate treatment. This was confirmed by studying enzyme activities in vitro and amino acid analysis. Importantly, this upregulation was glyphosate dose dependent and was observed similarly in both GS and GR populations. Glyphosate treatment also had a slight effect on the expression of BCAA genes but no general effect on the pathway could be observed. Taken together, our observations suggest that the high CNV of EPSPS in A. palmeri GR populations has no major pleiotropic effect on the expression of AAA biosynthetic genes, even in response to glyphosate treatment. This finding supports the idea that the fitness cost associated with EPSPS CNV
Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.
2014-01-01
SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260
Bile acid synthesis in man. In vivo activity of the 25-hydroxylation pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duane, W.C.; Pooler, P.A.; Hamilton, J.N.
1988-07-01
During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side-chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. We have previously shown in the rat that the contribution of the 25-hydroxylation pathway can be quantitated in vivo by measuring production of (/sup 14/C)acetone from (/sup 14/C)26-cholesterol. In the present study, we adapted this method to human subjects. 4 d after oral administration of 100 microCi of (/sup 14/C)26-cholesterol andmore » 1 d after beginning a constant infusion of 16.6 mumol/min unlabeled acetone, three men and two women underwent breath collections. Expired acetone was trapped and purified as the 2,4 dinitrophenylhydrazine derivative. /sup 14/CO/sub 2/ was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied by the acetone infusion rate to calculate production of (/sup 14/C)acetone. (/sup 14/C)Acetone production averaged 4.9% of total release of /sup 14/C from (/sup 14/C)26-cholesterol, estimated by /sup 14/CO2 output. The method was validated by showing that (/sup 14/C)acetone production from (/sup 14/C)isopropanol averaged 86.9% of the (/sup 14/C)-isopropanol infusion rate. We conclude that in man, as in the rat, the 25-hydroxylation pathway accounts for less than 5% of bile acid synthesis.« less
Zhang, Rui-Qin; Zhu, Hong-Hui; Zhao, Hai-Quan; Yao, Qing
2013-01-01
Arbuscular mycorrhizal fungi can increase the host resistance to pathogens via promoted phenolic synthesis, however, the signaling pathway responsible for it still remains unclear. In this study, in order to reveal the signaling molecules involved in this process, we inoculated Trifolium repense L. with an arbuscular mycorrhizal fungus (AMF), Glomus mosseae, and monitored the contents of phenolics and signaling molecules (hydrogen peroxide (H(2)O(2)), salicylic acid (SA), and nitric oxide (NO)) in roots, measured the activities of l-phenylalanine ammonia-lyase (PAL) and nitric oxide synthase (NOS), and the expression of pal and chs genes. Results demonstrated that AMF colonization promoted the phenolic synthesis, in parallel with the increase in related enzyme activity and gene expression. Meanwhile, the accumulation of all three signaling molecules was also up-regulated by AMF. This study suggested that AMF increased the phenolic synthesis in roots probably via signaling pathways of H(2)O(2), SA and NO in a signaling cascade. Copyright © 2012 Elsevier GmbH. All rights reserved.
Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M
2014-02-01
Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.
Regulation of protein synthesis by amino acids in muscle of neonates
Suryawan, Agus; Davis, Teresa A.
2011-01-01
The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241
Inhibition of rotavirus replication by downregulation of fatty acid synthesis.
Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich
2013-06-01
Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.
Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo
2015-01-01
We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.
Zhang, T Y; Huang, J T; Tian, H B; Ma, Y; Chen, Z; Wang, J J; Shi, H P; Luo, J
2018-06-01
The trans-10,cis-12 isomer of conjugated linoleic acid (t10c12-CLA) is a biohydrogenation intermediate in the rumen and has been shown to cause milk fat depression in dairy goats. However, few studies have focused on the in vitro molecular mechanisms involved in the response of the goat mammary gland to t10c12-CLA. In the present study, RNA sequencing technology was used to investigate the effects of t10c12-CLA on goat mammary epithelial cells. From the data, 25,153 annotated transcripts were obtained, and differentially expressed genes were selected based on a false discovery rate <0.05. Candidate genes and potent cellular signaling pathways were identified through Gene Ontology (GO) and pathway analysis. Next, real-time quantitative PCR and Western blot analyses were used to verify the results of the RNA sequencing data. The results indicated that t10c12-CLA inhibits fatty acid synthesis through downregulation of genes involved in de novo fatty acid synthesis, and this process is likely correlated with the activation of the AMP-activated protein kinase signaling pathways. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lake, April D.; Novak, Petr; Shipkova, Petia
2013-04-15
Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile
Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.
Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo
2017-01-01
Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.
A new regulatory mechanism for bacterial lipoic acid synthesis
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-01
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID
A new regulatory mechanism for bacterial lipoic acid synthesis.
Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun
2015-01-22
Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015
Bates, Philip D.; Browse, John
2012-01-01
The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267
Chen, Zhenya; Shen, Xiaolin; Wang, Jian; Wang, Jia; Yuan, Qipeng; Yan, Yajun
2017-11-01
Gallic acid (GA) is a naturally occurring phytochemical that has strong antioxidant and antibacterial activities. It is also used as a potential platform chemical for the synthesis of diverse high-value compounds. Hydrolytic degradation of tannins by acids, bases or microorganisms serves as a major way for GA production, which however, might cause environmental pollution and low yield and efficiency. Here, we report a novel approach for efficient microbial production of GA. First, structure-based rational engineering of PobA, a p-hydroxybenzoate hydroxylase from Pseudomonas aeruginosa, generated a new mutant, Y385F/T294A PobA, which displayed much higher activity toward 3,4-dihydroxybenzoic acid (3,4-DHBA) than the wild-type and any other reported mutants. Remarkably, expression of this mutant in Escherichia coli enabled generation of 1149.59 mg/L GA from 1000 mg/L 4-hydroxybenzoic acid (4-HBA), representing a 93% molar conversion ratio. Based on that, we designed and reconstituted a novel artificial biosynthetic pathway of GA and achieved 440.53 mg/L GA production from simple carbon sources in E. coli. Further enhancement of precursor supply through reinforcing shikimate pathway was able to improve GA de novo production to 1266.39 mg/L in shake flasks. Overall, this study not only led to the development of a highly active PobA variant for hydroxylating 3,4-DHBA into GA via structure-based protein engineering approach, but also demonstrated a promising pathway for bio-based manufacturing of GA and its derived compounds. Biotechnol. Bioeng. 2017;114: 2571-2580. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.
Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.
Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide
2012-05-18
A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.
Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo
2016-01-15
Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.
Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen
2017-04-01
Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.
A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development
Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David
2013-01-01
SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300
2016-01-01
Redox neutral photocatalytic transformations often require careful pairing of the substrates and photoredox catalysts in order to achieve a catalytic cycle. This can limit the range of viable transformations, as we recently observed in attempting to extend the scope of the photocatalytic synthesis of N-heterocycles using silicon amine protocol (SLAP) reagents to include starting materials that require higher oxidation potentials. We now report that the inclusion of Lewis acids in photocatalytic reactions of organosilanes allows access to a distinct reaction pathway featuring an Ir(III)*/Ir(IV) couple instead of the previously employed Ir(III)*/Ir(II) pathway, enabling the transformation of aromatic and aliphatic aldehydes to thiomorpholines and thiazepanes. The role of the Lewis acid in accepting an electron—either directly or via coordination to an imine—can be extended to other classes of photocatalysts and transformations, including oxidative cyclizations. The combination of light induced reactions and Lewis acids therefore promises access to new pathways and transformations that are not viable using the photocatalysts alone. PMID:28149955
Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.
2013-01-01
Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease. PMID:24161390
Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics.
Price, Morgan N; Zane, Grant M; Kuehl, Jennifer V; Melnyk, Ryan A; Wall, Judy D; Deutschbauer, Adam M; Arkin, Adam P
2018-01-01
For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. We studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fill 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes.
Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
DOE Office of Scientific and Technical Information (OSTI.GOV)
Price, Morgan N.; Zane, Grant M.; Kuehl, Jennifer V.
For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. Here, we studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fillmore » 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes.« less
Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
Price, Morgan N.; Zane, Grant M.; Kuehl, Jennifer V.; ...
2018-01-11
For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. Here, we studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fillmore » 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes.« less
Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics
Kuehl, Jennifer V.; Melnyk, Ryan A.; Deutschbauer, Adam M.; Arkin, Adam P.
2018-01-01
For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. We studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fill 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes. PMID:29324779
Gonçalves, Ana Teresa; Farlora, Rodolfo; Gallardo-Escárate, Cristian
2014-10-01
The goal of this study was to identify and analyze the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the ectoparasite copepod Caligus rogercresseyi. Massive transcriptome sequencing analysis was performed during the infectious copepodid larval stage, during the attached chalimus larval stage, and also in female and male adults. Thirty genes were selected for describing the pathways, and these were annotated for proteins or enzymes involved in lipid digestion, absorption, and transport; fatty acid degradation; the synthesis and degradation of ketone bodies; and steroid and ecdysteroid syntheses. Differential expression of these genes was analyzed by ontogenic stage and discussed considering each stage's feeding habits and energetic needs. Copepodids showed a low expression of fatty acid digestion genes, reflected by a non-feeding behavior, and the upregulation of genes involved in steroid biosynthesis, which was consistent with a pathway for cholesterol synthesis during ecdysis. The chalimus stage showed an upregulation of genes related to fatty acid digestion, absorption, and transport, as well as to fatty acid degradation and the synthesis of ketone bodies, therefore suggesting that lipids ingested from the mucus and skin of the host fish are metabolized as important sources of energy. Adult females also showed a pattern of high lipid metabolism for energy supply and mobilization in relation to reproduction and vitellogenesis. Adult females and males revealed different lipid metabolism patterns that reflected different energetic needs. This study reports for the first time the probable lipid metabolic pathways involved in the energy production and ecdysteroid synthesis of C. rogercresseyi. Copyright © 2014 Elsevier Inc. All rights reserved.
Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang
2016-01-01
The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527
Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang
2016-03-28
The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.
Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus
2012-10-01
Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.
Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.
2015-01-01
The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256
Smith, Stuart; Witkowski, Andrzej; Moghul, Ayesha; Yoshinaga, Yuko; Nefedov, Michael; de Jong, Pieter; Feng, Dejiang; Fong, Loren; Tu, Yiping; Hu, Yan; Young, Stephen G.; Pham, Thomas; Cheung, Carling; Katzman, Shana M.; Brand, Martin D.; Quinlan, Casey L.; Fens, Marcel; Kuypers, Frans; Misquitta, Stephanie; Griffey, Stephen M.; Tran, Son; Gharib, Afshin; Knudsen, Jens; Hannibal-Bach, Hans Kristian; Wang, Grace; Larkin, Sandra; Thweatt, Jennifer; Pasta, Saloni
2012-01-01
A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor. PMID:23077570
Atorvastatin inhibits insulin synthesis by inhibiting the Ras/Raf/ERK/CREB pathway in INS-1 cells
Sun, Hongxi; Li, Yu; Sun, Bei; Hou, Ningning; Yang, Juhong; Zheng, Miaoyan; Xu, Jie; Wang, Jingyu; Zhang, Yi; Zeng, Xianwei; Shan, Chunyan; Chang, Bai; Chen, Liming; Chang, Baocheng
2016-01-01
Abstract Backround: Type 2 diabetes has become a global epidemic disease. Atorvastatin has become a cornerstone in the prevention and treatment of atherosclerosis. However, increasing evidence showed that statins can dose-dependently increase the risk of diabetes mellitus. The mechanism is not clear. Objective: The Ras complex pathway (Ras/Raf/extracellular signal-regulated kinase [ERK]/cAMP response element-binding protein [CREB]) is the major pathway that regulates the gene transcription. Except for the inhibition of cholesterol synthesis by inhibiting the 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-COA) reductase, statins can also downregulate the phosphorylation of a series of downstream substrates including the key proteins of the Ras complex pathway, therefore may inhibit the insulin syntheses in pancreatic beta cells. In our study, we investigated the inhibitory effect and the underlying mechanism of atorvastatin on insulin synthesis in rat islets. Methods: Islets were isolated from Wistar rats and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium. The insulin content in the medium was measured by radioimmunoassay before and after the treatment of 50 μM atorvastatin. Effect of atorvastatin on the expression of insulin message Ribonucleic acid (mRNA) in pancreatic islet beta cells was also detected using quantitative real-time polymerase chain reaction. Western blotting was used to explore the possible role of the Ras complex pathway (Ras/Raf/ERK/CREB) in atorvastatin-inhibited insulin synthesis. The effects of atorvastatin on the binding of nuclear transcription factor p-CREB with CRE in INS-1 cells were examined via chromatin immunoprecipitation assay. Results: Compared with the control group, the insulin level decreased by 27.1% at 24 hours after atorvastatin treatment. Atorvastatin inhibited insulin synthesis by decreasing insulin mRNA expression of pancreatic islet beta cells. The activities of Ras, Raf-1, and p-CREB in the Ras complex
Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-07-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.
Saturated fatty acids enhance TLR4 immune pathways in human trophoblasts.
Yang, Xiaohua; Haghiac, Maricela; Glazebrook, Patricia; Minium, Judi; Catalano, Patrick M; Hauguel-de Mouzon, Sylvie
2015-09-01
What are the effects of fatty acids on placental inflammatory cytokine with respect to toll-like receptor-4/nuclear factor-kappa B (TLR4/NF-kB)? Exogenous fatty acids induce a pro-inflammatory cytokine response in human placental cells in vitro via activation of TLR4 signaling pathways. The placenta is exposed to changes in circulating maternal fatty acid concentrations throughout pregnancy. Fatty acids are master regulators of innate immune pathways through recruitment of toll-like receptors and activation of cytokine synthesis. Trophoblast cells isolated from 14 normal term human placentas were incubated with long chain fatty acids (FA) of different carbon length and degree of saturation. The expression and secretion of interleukin-6 (IL-6), IL-8 and tumor necrosis factor-alpha (TNF-α) were measured by reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay. Antibodies against TLR4 ligand binding domain, downstream signaling and anti-p65 NFkB-inhibitor were used to characterize the pathways of FA action. General approach used primary human term trophoblast cell culture. Methods and end-points used real-time quantitative PCR, cytokine measurements, immunohistochemistry, western blots. The long chain saturated fatty acids, stearic and palmitic (PA), stimulated the synthesis as well as the release of TNF-α, IL-6 and IL-8 by trophoblast cells (2- to 6-fold, P < 0.001). In contrast, the unsaturated (palmitoleic, oleic, linoleic) acids did not modify cytokine expression significantly. Palmitate-induced inflammatory effects were mediated via TLR4 activation, NF-kB phosphorylation and nuclear translocation. TNF-α protein level was close to the limit of detection in the culture medium even when cells were cultured with PA. These mechanisms open the way to a better understanding of how changes in maternal lipid homeostasis may regulate placental inflammatory status. X.Y. was recipient of fellowship award from West China Second University
Bi, Hongkai; Wang, Haihong; Cronan, John E.
2015-01-01
SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938
Liu, Jingjing; Xie, Zhipeng; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Chen, Jian; Liu, Long
2017-07-10
Aspergillus oryzae finds wide application in the food, feed, and wine industries, and is an excellent cell factory platform for production of organic acids. In this work, we achieved the overproduction of L-malate by rewiring the reductive tricarboxylic acid (rTCA) pathway and L-malate transport pathway of A. oryzae NRRL 3488. First, overexpression of native pyruvate carboxylase and malate dehydrogenase in the rTCA pathway improved the L-malate titer from 26.1gL -1 to 42.3gL -1 in shake flask culture. Then, the oxaloacetate anaplerotic reaction was constructed by heterologous expression of phosphoenolpyruvate carboxykinase and phosphoenolpyruvate carboxylase from Escherichia coli, increasing the L-malate titer to 58.5gL -1 . Next, the export of L-malate from the cytoplasm to the external medium was strengthened by overexpression of a C4-dicarboxylate transporter gene from A. oryzae and an L-malate permease gene from Schizosaccharomyces pombe, improving the L-malate titer from 58.5gL -1 to 89.5gL -1 . Lastly, guided by transcription analysis of the expression profile of key genes related to L-malate synthesis, the 6-phosphofructokinase encoded by the pfk gene was identified as a potential limiting step for L-malate synthesis. Overexpression of pfk with the strong sodM promoter increased the L-malate titer to 93.2gL -1 . The final engineered A. oryzae strain produced 165gL -1 L-malate with a productivity of 1.38gL -1 h -1 in 3-L fed-batch culture. Overall, we constructed an efficient L-malate producer by rewiring the rTCA pathway and L-malate transport pathway of A. oryzae NRRL 3488, and the engineering strategy adopted here may be useful for the construction of A. oryzae cell factories to produce other organic acids. Copyright © 2017 Elsevier B.V. All rights reserved.
Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula
2015-01-01
Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705
Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo
2014-07-01
Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.
Wang, Yijin; Wang, Wenshi; Xu, Lei; Zhou, Xinying; Shokrollahi, Ehsan; Felczak, Krzysztof; van der Laan, Luc J. W.; Pankiewicz, Krzysztof W.; Sprengers, Dave; Raat, Nicolaas J. H.; Metselaar, Herold J.; Peppelenbosch, Maikel P.
2016-01-01
in HEV infection and its potential for antiviral drug development. We show that targeting the later but not the early steps of the purine synthesis pathway exerts strong anti-HEV activity. In particular, IMP dehydrogenase (IMPDH) is the most important anti-HEV target of this cascade. Importantly, the clinically used IMPDH inhibitors, including mycophenolic acid and ribavirin, have potent anti-HEV activity. Furthermore, targeting the pyrimidine synthesis pathway also exerts potent antiviral activity against HEV. Interestingly, antiviral effects of nucleotide synthesis pathway inhibitors appear to depend on the medication-induced transcription of antiviral interferon-stimulated genes. Thus, this study reveals an unconventional novel mechanism as to how nucleotide synthesis pathway inhibitors can counteract HEV replication. PMID:26926637
Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K
2012-01-15
The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.
Radhakrishnan, Ramalingam; Park, Jae-Man; Lee, In-Jung
2016-12-01
Very few bacterial species were identified as bio-herbicides for weed control. The present research was focused to elucidate the plant growth retardant properties of Enterobacter sp. I-3 during their interaction by determining the changes in endogenous photosynthetic pigments, plant hormones and amino acids. The two bacterial isolates I-4-5 and I-3 were used to select the superior bacterium for controlling weed seeds (Echinochloa crus-galli L. and Portulaca oleracea L.) germination. The post-inoculation of I-3 (Enterobacter sp. I-3) significantly inhibited the weeds seed germination than their controls. The mechanism of bacterium induced plant growth reduction was identified in lettuce treated with I-3 bacterium and compared their effects with known chemical herbicide, trinexapac-ethyl (TE). The treatment of I-3 and TE showed a significant inhibitory effect on shoot length, leaf number, leaf length, leaf width, shoot weight, root weight and chlorophyll content in lettuce seedlings. The endogenous gibberellins (GAs) and abscisic acid (ABA) analysis showed that Enterobacter sp. I-3 treated plants had lower levels of GAs (GA 12 , GA 19 , GA 20 and GA 8 ) and GAs/ABA ratio and then, the higher level of ABA when compared to their controls. Indeed, the individual amino acids ie., aspartic acid, glutamic acid, glycine, threonine, alanine, serine, leucine, isoleucine and tyrosine were declined in TE and I-3 exposed plants. Our results suggest that the utilization of Enterobacter sp. I-3 inhibits the GAs pathway and amino acids synthesis in weeds to control their growth can be an alternative to chemical herbicides. Copyright © 2016 Elsevier GmbH. All rights reserved.
Diner, Bruce A; Fan, Janine; Scotcher, Miles C; Wells, Derek H; Whited, Gregory M
2018-01-01
There is a growing interest in the use of microbial fermentation for the generation of high-demand, high-purity chemicals using cheap feedstocks in an environmentally friendly manner. One example explored here is the production of isoprene (C 5 H 8 ), a hemiterpene, which is primarily polymerized to polyisoprene in synthetic rubber in tires but which can also be converted to C 10 and C 15 biofuels. The strictly anaerobic, acetogenic bacterium Clostridium ljungdahlii , used in all of the work described here, is capable of glycolysis using the Embden-Meyerhof-Parnas pathway and of carbon fixation using the Wood-Ljungdahl pathway. Clostridium - Escherichia coli shuttle plasmids, each bearing either 2 or 3 different heterologous genes of the eukaryotic mevalonic acid (MVA) pathway or eukaryotic isopentenyl pyrophosphate isomerase (Idi) and isoprene synthase (IspS), were constructed and electroporated into C. ljungdahlii These plasmids, one or two of which were introduced into the host cells, enabled the synthesis of mevalonate and of isoprene from fructose and from syngas (H 2 , CO 2 , and CO) and the conversion of mevalonate to isoprene. All of the heterologous enzymes of the MVA pathway, as well as Idi and IspS, were shown to be synthesized at high levels in C. ljungdahlii , as demonstrated by Western blotting, and were enzymatically active, as demonstrated by in vivo product synthesis. The quantities of mevalonate and isoprene produced here are far below what would be required of a commercial production strain. However, proposals are made that could enable a substantial increase in the mass yield of product formation. IMPORTANCE This study demonstrates the ability to synthesize a heterologous metabolic pathway in C. ljungdahlii , an organism capable of metabolizing either simple sugars or syngas or both together (mixotrophy). Syngas, an inexpensive source of carbon and reducing equivalents, is produced as a major component of some industrial waste gas, and it can be
Fan, Janine; Scotcher, Miles C.; Wells, Derek H.; Whited, Gregory M.
2017-01-01
ABSTRACT There is a growing interest in the use of microbial fermentation for the generation of high-demand, high-purity chemicals using cheap feedstocks in an environmentally friendly manner. One example explored here is the production of isoprene (C5H8), a hemiterpene, which is primarily polymerized to polyisoprene in synthetic rubber in tires but which can also be converted to C10 and C15 biofuels. The strictly anaerobic, acetogenic bacterium Clostridium ljungdahlii, used in all of the work described here, is capable of glycolysis using the Embden-Meyerhof-Parnas pathway and of carbon fixation using the Wood-Ljungdahl pathway. Clostridium-Escherichia coli shuttle plasmids, each bearing either 2 or 3 different heterologous genes of the eukaryotic mevalonic acid (MVA) pathway or eukaryotic isopentenyl pyrophosphate isomerase (Idi) and isoprene synthase (IspS), were constructed and electroporated into C. ljungdahlii. These plasmids, one or two of which were introduced into the host cells, enabled the synthesis of mevalonate and of isoprene from fructose and from syngas (H2, CO2, and CO) and the conversion of mevalonate to isoprene. All of the heterologous enzymes of the MVA pathway, as well as Idi and IspS, were shown to be synthesized at high levels in C. ljungdahlii, as demonstrated by Western blotting, and were enzymatically active, as demonstrated by in vivo product synthesis. The quantities of mevalonate and isoprene produced here are far below what would be required of a commercial production strain. However, proposals are made that could enable a substantial increase in the mass yield of product formation. IMPORTANCE This study demonstrates the ability to synthesize a heterologous metabolic pathway in C. ljungdahlii, an organism capable of metabolizing either simple sugars or syngas or both together (mixotrophy). Syngas, an inexpensive source of carbon and reducing equivalents, is produced as a major component of some industrial waste gas, and it can be
Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun
2014-05-01
cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites. Copyright © 2014. Published by Elsevier Inc.
Ouellette, Catherine; Cormier, Hubert; Rudkowska, Iwona; Guénard, Frédéric; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude
2013-01-01
Marine omega-3 (n-3) polyunsaturated fatty acids (PUFA) reduce plasma triglyceride (TG) levels. Genetic factors such as single nucleotide polymorphisms (SNPs) could be responsible for the variability of the plasma TG response to n-3 PUFA supplementation. Previous studies have demonstrated that n-3 PUFA supplementation using fish oil modified the expression levels of three genes involved in the TG synthesis pathway (GPAM, AGPAT3 and AGPAT4) in peripheral blood mononuclear cells. A total of 210 subjects consumed 5 g/day of a fish oil supplement for 6 weeks. Plasma lipids were measured before and after the supplementation period. Three SNPs in GPAM, 13 SNPs in AGPAT3 and 35 SNPs in AGPAT4 were genotyped. In an ANOVA for repeated measures adjusted for age, sex and BMI, genotype effects on plasma TG levels were observed for rs1838452 in AGPAT3 as well as for rs746731 and rs2293286 in AGPAT4. Genotype × supplementation interaction effects on plasma TG levels were observed for rs2792751 and rs17129561 in GPAM as well as for rs3798943 and rs9458172 in AGPAT4 (p < 0.05). These results suggest that SNPs in genes involved in the TG synthesis pathway may influence plasma TG levels after n-3 PUFA supplementation. © 2014 S. Karger AG, Basel.
Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow
NASA Astrophysics Data System (ADS)
Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.
2017-05-01
Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.
NASA Astrophysics Data System (ADS)
Fu, Qi; Socki, Richard A.; Niles, Paul B.
2015-04-01
Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic
Phosphatidic Acid Synthesis in Bacteria
Yao, Jiangwei; Rock, Charles O.
2012-01-01
Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714
Wu, Yue; Jin, Xin; Liao, Weibiao; Hu, Linli; Dawuda, Mohammed M; Zhao, Xingjie; Tang, Zhongqi; Gong, Tingyu; Yu, Jihua
2018-01-01
5-Aminolevulinic acid (ALA) is a common precursor of tetrapyrroles as well as a crucial growth regulator in higher plants. ALA has been proven to be effective in improving photosynthesis and alleviating the adverse effects of various abiotic stresses in higher plants. However, little is known about the mechanism of ALA in ameliorating the photosynthesis of plant under abiotic stress. In this paper, we studied the effects of exogenous ALA on salinity-induced damages of photosynthesis in cucumber ( Cucumis sativus L.) seedlings. We found that the morphology (plant height, leave area), light utilization capacity of PS II [qL, Y(II)] and gas exchange capacity (Pn, gs, Ci, and Tr) were significantly retarded under NaCl stress, but these parameters were all recovered by the foliar application of 25 mg L -1 ALA. Besides, salinity caused heme accumulation and up-regulation of gene expression of ferrochelatase ( HEMH ) with suppression of other genes involved in chlorophyll synthesis pathway. Exogenously application of ALA under salinity down-regulated the heme content and HEMH expression, but increased the gene expression levels of glutamyl-tRNA reductase ( HEMA1 ), Mg-chelatase ( CHLH ), and protochlorophyllide oxidoreductase ( POR ). Moreover, the contents of intermediates involved in chlorophyll branch were increased by ALA, including protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX, protochlorophyllide (Pchlide), and chlorophyll (Chl a and Chl b ) under salt stress. Ultrastructural observation of mesophyll cell showed that the damages of photosynthetic apparatus under salinity were fixed by ALA. Collectively, the chlorophyll biosynthesis pathway was enhanced by exogenous ALA to improve the tolerance of cucumber under salinity.
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis
DOE Office of Scientific and Technical Information (OSTI.GOV)
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the
Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng
2013-01-01
There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979
Tsogtbaatar, Enkhtuul; Cocuron, Jean -Christophe; Sonera, Marcos Corchado; ...
2015-02-22
Pennycress ( Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis ofmore » oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. In conclusion, this study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.« less
DOE Office of Scientific and Technical Information (OSTI.GOV)
Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.
2013-01-01
Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less
Deshmukh, Dattatray G; Bangal, Mukund N; Patekar, Mukunda R; Medhane, Vijay J; Mathad, Vijayavitthal Thippannachar
2018-03-01
The present work describes investigation of mechanistic pathway for trimethyl borate mediated amidation of (R)-mandelic acid (3) with 4-nitophenylethylamine (2) to provide (R)-2-hydroxy-N-[2-(4-nitrophenyl)ethyl]-2-phenylacetamide (4) during mirabegron synthesis. Plausible reaction mechanism is proposed by isolating and elucidating the active α-hydroxy ester intermediate 16 from the reaction mass. Trimethyl borate mediated approach proved to be selective in providing 4 without disturbing α-hydroxyl group and stereochemistry of the chiral center, and is also a greener, more economic and production friendly over the reported methods. The developed approach is rapid and efficient for the preparation of 4 with an overall yield of 85-87% and around 99.0% purity by HPLC at scale.
Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W
Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence
2009-01-01
In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326
Midzak, Andrew; Papadopoulos, Vassilios
2014-09-01
Steroid hormones, bioactive oxysterols and bile acids are all derived from the biological metabolism of lipid cholesterol. The enzymatic pathways generating these compounds have been an area of intense research for almost a century, as cholesterol and its metabolites have substantial impacts on human health. Owing to its high degree of hydrophobicity and the chemical properties that it confers to biological membranes, the distribution of cholesterol in cells is tightly controlled, with subcellular organelles exhibiting highly divergent levels of cholesterol. The manners in which cells maintain such sterol distributions are of great interest in the study of steroid and bile acid synthesis, as limiting cholesterol substrate to the enzymatic pathways is the principal mechanism by which production of steroids and bile acids is regulated. The mechanisms by which cholesterol moves within cells, however, remain poorly understood. In this review, we examine the subcellular machinery involved in cholesterol metabolism to steroid hormones and bile acid, relating it to both lipid- and protein-based mechanisms facilitating intracellular and intraorganellar cholesterol movement and delivery to these pathways. In particular, we examine evidence for the involvement of specific protein domains involved in cholesterol binding, which impact cholesterol movement and metabolism in steroidogenesis and bile acid synthesis. A better understanding of the physical mechanisms by which these protein- and lipid-based systems function is of fundamental importance to understanding physiological homeostasis and its perturbation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.
Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G
2017-04-26
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.
Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis
2017-01-01
Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050
NASA Technical Reports Server (NTRS)
Weber, Arthur L.
1998-01-01
Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.
Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids
Matthessen, Roman; Fransaer, Jan; Binnemans, Koen
2014-01-01
Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120
Defining a Role for Acid Sphingomyelinase in the p38/Interleukin-6 Pathway*
Perry, David M.; Newcomb, Benjamin; Adada, Mohamad; Wu, Bill X.; Roddy, Patrick; Kitatani, Kazuyuki; Siskind, Leah; Obeid, Lina M.; Hannun, Yusuf A.
2014-01-01
Acid sphingomyelinase (ASM) is one of the key enzymes involved in regulating the metabolism of the bioactive sphingolipid ceramide in the sphingolipid salvage pathway, yet defining signaling pathways by which ASM exerts its effects has proven difficult. Previous literature has implicated sphingolipids in the regulation of cytokines such as interleukin-6 (IL-6), but the specific sphingolipid pathways and mechanisms involved in inflammatory signaling need to be further elucidated. In this work, we sought to define the role of ASM in IL-6 production because our previous work showed that a parallel pathway of ceramide metabolism, acid β-glucosidase 1, negatively regulates IL-6. First, silencing ASM with siRNA abrogated IL-6 production in response to the tumor promoter, 4β-phorbol 12-myristate 13-acetate (PMA), in MCF-7 cells, in distinction to acid β-glucosidase 1 and acid ceramidase, suggesting specialization of the pathways. Moreover, treating cells with siRNA to ASM or with the indirect pharmacologic inhibitor desipramine resulted in significant inhibition of TNFα- and PMA-induced IL-6 production in MDA-MB-231 and HeLa cells. Knockdown of ASM was found to significantly inhibit PMA-dependent IL-6 induction at the mRNA level, probably ruling out mechanisms of translation or secretion of IL-6. Further, ASM knockdown or desipramine blunted p38 MAPK activation in response to TNFα, revealing a key role for ASM in activating p38, a signaling pathway known to regulate IL-6 induction. Last, knockdown of ASM dramatically blunted invasion of HeLa and MDA-MB-231 cells through Matrigel. Taken together, these results demonstrate that ASM plays a critical role in p38 signaling and IL-6 synthesis with implications for tumor pathobiology. PMID:24951586
Donini, Pierluigi
1970-01-01
Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067
Jiang, Xian; Yan, Xiaoxiao; Ren, Wangyu; Jia, Yufeng; Chen, Jianian; Sun, Dongmei; Xu, Lin; Tang, Yawen
2016-11-16
For direct formic acid fuel cells (DFAFCs), the dehydrogenation pathway is a desired reaction pathway, to boost the overall cell efficiency. Elaborate composition tuning and nanostructure engineering provide two promising strategies to design efficient electrocatalysts for DFAFCs. Herein, we present a facile synthesis of porous AgPt bimetallic nanooctahedra with enriched Pt surface (denoted as AgPt@Pt nanooctahedra) by a selective etching strategy. The smart integration of geometric and electronic effect confers a substantial enhancement of desired dehydrogenation pathway as well as electro-oxidation activity for the formic acid oxidation reaction (FAOR). We anticipate that the obtained nanocatalyst may hold great promises in fuel cell devices, and furthermore, the facile synthetic strategy demonstrated here can be extendable for the fabrication of other multicomponent nanoalloys with desirable morphologies and enhanced electrocatalytic performances.
Sayanova, Olga; Haslam, Richard P; Calerón, Monica Venegas; López, Noemi Ruiz; Worthy, Charlotte; Rooks, Paul; Allen, Michael J; Napier, Johnathan A
2011-05-01
The Prymnesiophyceae coccolithophore Emiliania huxleyi is one of the most abundant alga in our oceans and therefore plays a central role in marine foodwebs. E. huxleyi is notable for the synthesis and accumulation of the omega-3 long chain polyunsaturated fatty acid docosahexaenoic acid (DHA; 22:6Δ(4,7,10,13,16,19), n-3) which is accumulated in fish oils and known to have health-beneficial properties to humans, preventing cardiovascular disease and related pathologies. Here we describe the identification and functional characterisation of the five E. huxleyi genes which direct the synthesis of docosahexaenoic acid in this alga. Surprisingly, E. huxleyi does not use the conventional Δ6-pathway, instead using the alternative Δ8-desaturation route which has previously only been observed in a few unrelated microorganisms. Given that E. huxleyi accumulates significant levels of the Δ6-desaturated fatty acid stearidonic acid (18:4Δ(6,9,12,15), n-3), we infer that the biosynthesis of DHA is likely to be metabolically compartmentalised from the synthesis of stearidonic acid. Copyright © 2011 Elsevier Ltd. All rights reserved.
Malcher-Lopes, Renato; Franco, Alier; Tasker, Jeffrey G.
2008-01-01
Glucocorticoids are capable of exerting both genomic and non-genomic actions in target cells of multiple tissues, including the brain, which trigger an array of electrophysiological, metabolic, secretory and inflammatory regulatory responses. Here, we have attempted to show how glucocorticoids may generate a rapid anti-inflammatory response by promoting arachidonic acid-derived endocannabinoid biosynthesis. According to our hypothesized model, non-genomic action of glucocorticoids results in the global shift of membrane lipid metabolism, subverting metabolic pathways toward the synthesis of the anti-inflammatory endocannabinoids, anandamide (AEA) and 2-arachidonoyl-glycerol (2-AG), and away from arachidonic acid production. Post-transcriptional inhibition of cyclooxygenase-2 (COX2) synthesis by glucocorticoids assists this mechanism by suppressing the synthesis of pro-inflammatory prostaglandins as well as endocannabinoid-derived prostanoids. In the central nervous system (CNS) this may represent a major neuroprotective system, which may cross-talk with leptin signaling in the hypothalamus allowing for the coordination between energy homeostasis and the inflammatory response. PMID:18295199
Energetics of amino acid synthesis in hydrothermal ecosystems
NASA Technical Reports Server (NTRS)
Amend, J. P.; Shock, E. L.
1998-01-01
Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.
Identification of an itaconic acid degrading pathway in itaconic acid producing Aspergillus terreus.
Chen, Mei; Huang, Xuenian; Zhong, Chengwei; Li, Jianjun; Lu, Xuefeng
2016-09-01
Itaconic acid, one of the most promising and flexible bio-based chemicals, is mainly produced by Aspergillus terreus. Previous studies to improve itaconic acid production in A. terreus through metabolic engineering were mainly focused on its biosynthesis pathway, while the itaconic acid-degrading pathway has largely been ignored. In this study, we used transcriptomic, proteomic, bioinformatic, and in vitro enzymatic analyses to identify three key enzymes, itaconyl-CoA transferase (IctA), itaconyl-CoA hydratase (IchA), and citramalyl-CoA lyase (CclA), that are involved in the catabolic pathway of itaconic acid in A. terreus. In the itaconic acid catabolic pathway in A. terreus, itaconic acid is first converted by IctA into itaconyl-CoA with succinyl-CoA as the CoA donor, and then itaconyl-CoA is hydrated into citramalyl-CoA by IchA. Finally, citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by CclA. Moreover, IctA can also catalyze the reaction between citramalyl-CoA and succinate to generate succinyl-CoA and citramalate. These results, for the first time, identify the three key enzymes, IctA, IchA, and CclA, involved in the itaconic acid degrading pathway in itaconic acid producing A. terreus. The results will facilitate the improvement of itaconic acid production by metabolically engineering the catabolic pathway of itaconic acid in A. terreus.
Rincon, Gonzalo; Islas-Trejo, Alma; Castillo, Alejandro R; Bauman, Dale E; German, Bruce J; Medrano, Juan F
2012-02-01
Genes in the sterol regulatory element-binding protein-1 (SREBP1) pathway play a central role in regulation of milk fat synthesis, especially the de-novo synthesis of saturated fatty acids. SCD, a SREBP-responsive gene, is the key enzyme in the synthesis of monounsaturated fatty acids in the mammary gland. In the present study, we discovered SNP in candidate genes associated with this signalling pathway and SCD to identify genetic markers that can be used for genetic and metabolically directed selection in cattle. We resequenced six candidate genes in the SREBP1 pathway (SREBP1, SCAP, INSIG1, INSIG2, MBTPS1, MBTPS2) and two genes for SCD (SCD1 and SCD5) and discovered 47 Tag SNP that were used in a marker-trait association study. Milk and blood samples were collected from Holstein cows in their 1st or 2nd parity at 100-150 days of lactation. Individual fatty acids from C4 to C20, saturated fatty acid (SFA) content, monounsaturated fatty acid content, polyunsaturated fatty acid content and desaturase indexes were measured and used to perform the asociation analysis. Polymorphisms in the SCD5 and INSIG2 genes were the most representative markers associated with SFA/unsaturated fatty acid (UFA) ratio in milk. The analysis of desaturation activity determined that markers in the SCD1 and SCD5 genes showed the most significant effects. DGAT1 K232A marker was included in the study to examine the effect of this marker on the variation of milk fatty acids in our Holstein population. The percentage of variance explained by DGAT1 in the analysis was only 6% of SFA/UFA ratio. Milk fat depression was observed in one of the dairy herds and in this particular dairy one SNP in the SREBP1 gene (rs41912290) accounted for 40% of the phenotypic variance. Our results provide detailed SNP information for key genes in the SREBP1 signalling pathway and SCD that can be used to change milk fat composition by marker-assisted breeding to meet consumer demands regarding human health, as well
Jin, Eunsook S; Sherry, A Dean; Malloy, Craig R
2016-09-02
Drugs and other interventions for high impact hepatic diseases often target biochemical pathways such as gluconeogenesis, lipogenesis, or the metabolic response to oxidative stress. However, traditional liver function tests do not provide quantitative data about these pathways. In this study, we developed a simple method to evaluate these processes by NMR analysis of plasma metabolites. Healthy subjects ingested [U-(13)C3]glycerol, and blood was drawn at multiple times. Each subject completed three visits under differing nutritional states. High resolution (13)C NMR spectra of plasma triacylglycerols and glucose provided new insights into a number of hepatic processes including fatty acid esterification, the pentose phosphate pathway, and gluconeogenesis through the tricarboxylic acid cycle. Fasting stimulated pentose phosphate pathway activity and metabolism of [U-(13)C3]glycerol in the tricarboxylic acid cycle prior to gluconeogenesis or glyceroneogenesis. Fatty acid esterification was transient in the fasted state but continuous under fed conditions. We conclude that a simple NMR analysis of blood metabolites provides an important biomarker of pentose phosphate pathway activity, triacylglycerol synthesis, and flux through anaplerotic pathways in mitochondria of human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Model of the synthesis of trisporic acid in Mucorales showing bistability.
Werner, S; Schroeter, A; Schimek, C; Vlaic, S; Wöstemeyer, J; Schuster, S
2012-12-01
An important substance in the signalling between individuals of Mucor-like fungi is trisporic acid (TA). This compound, together with some of its precursors, serves as a pheromone in mating between (+)- and (-)-mating types. Moreover, intermediates of the TA pathway are exchanged between the two mating partners. Based on differential equations, mathematical models of the synthesis pathways of TA in the two mating types of an idealised Mucor-fungus are here presented. These models include the positive feedback of TA on its own synthesis. The authors compare three sub-models in view of bistability, robustness and the reversibility of transitions. The proposed modelling study showed that, in a system where intermediates are exchanged, a reversible transition between the two stable steady states occurs, whereas an exchange of the end product leads to an irreversible transition. The reversible transition is physiologically favoured, because the high-production state of TA must come to an end eventually. Moreover, the exchange of intermediates and TA is compared with the 3-way handshake widely used by computers linked in a network.
Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives
Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A
2011-01-01
Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513
Dayal, B; Tint, G S; Batta, A K; Shefer, S; Salen, G; Bose, A K; Pramanik, B N
1983-02-01
This paper describes the chemical synthesis of 3 alpha,7 alpha,12 alpha,25-tetrahydroxy-5 beta-cholestan-24-one via selective oxidation of 5 beta-cholestane-3 alpha,7 alpha,12 alpha, 24 xi,25-pentol with silver carbonate on celite. The structure of this 24-keto bile alcohol was confirmed by gas-liquid chromatography and mass spectrometry. Synthesis of this compound via pyridinium chlorochromate oxidation of the triacetoxy derivative of 5 beta-cholestane-3 alpha,7 alpha,12 alpha,24 xi,25-pentol followed by saponification further established its structure. 3 alpha,7 alpha,12 alpha,25-Tetrahydroxy-5 beta-cholestan-24-one was required for the in vivo and in vitro studies of side-chain oxidation and cleavage in the 25-hydroxylation pathway of cholic acid biosynthesis.
Urata, Shuzo; Uno, Yukiko; Kurosaki, Yohei; Yasuda, Jiro
2018-06-12
Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease caused by the SFTS virus (SFTSV), which has a high mortality rate. Currently, no licensed vaccines or therapeutic agents have been approved for use against SFTSV infection. Here, we report that the cholesterol, fatty acid, and triglyceride synthesis pathways regulated by S1P is involved in SFTSV replication, using CHO-K1 cell line (SRD-12B) that is deficient in site 1 protease (S1P) enzymatic activity, PF-429242, a small compound targeting S1P enzymatic activity, and Fenofibrate and Lovastatin, which inhibit triglyceride and cholesterol synthesis, respectively. These results enhance our understanding of the SFTSV replication mechanism and may contribute to the development of novel therapies for SFTSV infection. Copyright © 2018. Published by Elsevier Inc.
Davis, J.W. Jr.
1979-09-21
A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Fasani, Rick A; Savageau, Michael A
2014-11-01
Overcoming the stress of starvation is one of an organism's most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype-environment-phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism's existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product-the cognate amino acid of the pathway-may require that very amino acid when it is no longer available. To study this potential "catch-22," we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell's fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism's natural environment. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Das, Utpal; Scott, David; Ganguly, Archan; Koo, Edward H.; Tang, Yong; Roy, Subhojit
2013-01-01
The convergence of APP (substrate) and BACE-1 (enzyme) is a rate-limiting, obligatory event triggering the amyloidogenic pathway – a key step in Alzheimer’s disease (AD) pathology. However, as both APP/BACE-1 are highly expressed in brain, mechanisms precluding their unabated convergence are unclear. Exploring dynamic localization of APP/BACE-1 in cultured hippocampal neurons, we found that after synthesis via the secretory-pathway, dendritic APP/BACE-1-containing vesicles are largely segregated in physiologic states. While BACE-1 is largely sorted into acidic recycling endosomes, APP is conveyed in Golgi-derived vesicles. However upon activity-induction – a known trigger of the amyloidogenic pathway – APP is routed into BACE-1-positive recycling endosomes via a clathrin-dependent mechanism. A partitioning/convergence of APP/BACE-1 vesicles is also apparent in control/AD brains respectively. Considering BACE-1 is optimally active in an acidic environment, our experiments suggest that neurons have evolved trafficking strategies that normally limit APP/BACE-1 proximity; and also uncover a pathway routing APP into BACE-1-containing organelles – triggering amyloidogenesis. PMID:23931995
Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao
2011-01-01
Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122
Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis
Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet
2011-01-01
Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689
Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.
Awasthi, Neeraj Praphulla; Singh, R P
2007-01-01
Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.
My, L.; Ghandour Achkar, N.; Viala, J. P.
2015-01-01
ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator
[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].
Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua
2016-03-01
Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.
Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L
2017-04-07
Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the
Mir, Rafia; Jallu, Shais; Singh, T P
2015-06-01
The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.
Fasani, Rick A.; Savageau, Michael A.
2014-01-01
Overcoming the stress of starvation is one of an organism’s most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype–environment–phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism’s existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product—the cognate amino acid of the pathway—may require that very amino acid when it is no longer available. To study this potential “catch-22,” we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell’s fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism’s natural environment. PMID:25118252
Vitamins and aging: pathways to NAD+ synthesis.
Denu, John M
2007-05-04
Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction.
ERIC Educational Resources Information Center
Forster, Denis; DeKleva, Thomas W.
1986-01-01
Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)
Weber, Christian; Brückner, Christine; Weinreb, Sheila; Lehr, Claudia; Essl, Christine; Boles, Eckhard
2012-12-01
Adipic acid is a high-value compound used primarily as a precursor for the synthesis of nylon, coatings, and plastics. Today it is produced mainly in chemical processes from petrochemicals like benzene. Because of the strong environmental impact of the production processes and the dependence on fossil resources, biotechnological production processes would provide an interesting alternative. Here we describe the first engineered Saccharomyces cerevisiae strain expressing a heterologous biosynthetic pathway converting the intermediate 3-dehydroshikimate of the aromatic amino acid biosynthesis pathway via protocatechuic acid and catechol into cis,cis-muconic acid, which can be chemically dehydrogenated to adipic acid. The pathway consists of three heterologous microbial enzymes, 3-dehydroshikimate dehydratase, protocatechuic acid decarboxylase composed of three different subunits, and catechol 1,2-dioxygenase. For each heterologous reaction step, we analyzed several potential candidates for their expression and activity in yeast to compose a functional cis,cis-muconic acid synthesis pathway. Carbon flow into the heterologous pathway was optimized by increasing the flux through selected steps of the common aromatic amino acid biosynthesis pathway and by blocking the conversion of 3-dehydroshikimate into shikimate. The recombinant yeast cells finally produced about 1.56 mg/liter cis,cis-muconic acid.
Role of fatty-acid synthesis in dendritic cell generation and function.
Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George
2013-05-01
Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.
Synthesis of new kojic acid based unnatural α-amino acid derivatives.
Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan
2015-11-01
An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.
Ahadome, Sarah D.; Mathew, Rose; Reyes, Nancy J.; Mettu, Priyatham S.; Cousins, Scott W.; Calder, Virginia L.; Saban, Daniel R.
2016-01-01
Fibrosis is a shared end-stage pathway to lung, liver, and heart failure. In the ocular mucosa (conjunctiva), fibrosis leads to blindness in trachoma, pemphigoid, and allergy. The indirect fibrogenic role of DCs via T cell activation and inflammatory cell recruitment is well documented. However, here we demonstrate that DCs can directly induce fibrosis. In the mouse model of allergic eye disease (AED), classical CD11b+ DCs in the ocular mucosa showed increased activity of aldehyde dehydrogenase (ALDH), the enzyme required for retinoic acid synthesis. In vitro, CD11b+ DC–derived ALDH was associated with 9-cis-retinoic acid ligation to retinoid x receptor (RXR), which induced conjunctival fibroblast activation. In vivo, stimulating RXR led to rapid onset of ocular mucosal fibrosis, whereas inhibiting ALDH activity in DCs or selectively depleting DCs markedly reduced fibrosis. Collectively, these data reveal a profibrotic ALDH-dependent pathway by DCs and uncover a role for DC retinoid metabolism. PMID:27595139
Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function
Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George
2013-01-01
Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633
Rewiring protein synthesis: From natural to synthetic amino acids.
Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang
2017-11-01
The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.
Transaminases for the synthesis of enantiopure beta-amino acids
2012-01-01
Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122
Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.
2013-01-01
All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be
SCD1 Inhibition Causes Cancer Cell Death by Depleting Mono-Unsaturated Fatty Acids
Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L.; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G. F.; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara
2012-01-01
Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway. PMID:22457791
SCD1 inhibition causes cancer cell death by depleting mono-unsaturated fatty acids.
Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G F; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara
2012-01-01
Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway.
Genetics Home Reference: congenital bile acid synthesis defect type 1
... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...
Synthesis of alpha-amino acids
Davis, J.W. Jr.
1983-01-25
A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings
Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.
Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S
1996-01-01
Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847
Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa
2013-01-01
Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-01-01
Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830
An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.
Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P
2006-12-06
Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.
Decreased mTOR signaling pathway in human idiopathic autism and in rats exposed to valproic acid.
Nicolini, Chiara; Ahn, Younghee; Michalski, Bernadeta; Rho, Jong M; Fahnestock, Margaret
2015-01-20
The molecular mechanisms underlying autistic behaviors remain to be elucidated. Mutations in genes linked to autism adversely affect molecules regulating dendritic spine formation, function and plasticity, and some increase the mammalian target of rapamycin, mTOR, a regulator of protein synthesis at spines. Here, we investigated whether the Akt/mTOR pathway is disrupted in idiopathic autism and in rats exposed to valproic acid, an animal model exhibiting autistic-like behavior. Components of the mTOR pathway were assayed by Western blotting in postmortem fusiform gyrus samples from 11 subjects with idiopathic autism and 13 controls and in valproic acid versus saline-exposed rat neocortex. Additionally, protein levels of brain-derived neurotrophic factor receptor (TrkB) isoforms and the postsynaptic organizing molecule PSD-95 were measured in autistic versus control subjects. Full-length TrkB, PI3K, Akt, phosphorylated and total mTOR, p70S6 kinase, eIF4B and PSD-95 were reduced in autistic versus control fusiform gyrus. Similarly, phosphorylated and total Akt, mTOR and 4E-BP1 and phosphorylated S6 protein were decreased in valproic acid- versus saline-exposed rats. However, no changes in 4E-BP1 or eIF4E were found in autistic brains. In contrast to some monogenic disorders with high rates of autism, our data demonstrate down-regulation of the Akt/mTOR pathway, specifically via p70S6K/eIF4B, in idiopathic autism. These findings suggest that disruption of this pathway in either direction is widespread in autism and can have adverse consequences for synaptic function. The use of valproic acid, a histone deacetylase inhibitor, in rats successfully modeled these changes, implicating an epigenetic mechanism in these pathway disruptions.
Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver
Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.
1969-01-01
1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319
2-Keto acids based biosynthesis pathways for renewable fuels and chemicals.
Tashiro, Yohei; Rodriguez, Gabriel M; Atsumi, Shota
2015-03-01
Global energy and environmental concerns have driven the development of biological chemical production from renewable sources. Biological processes using microorganisms are efficient and have been traditionally utilized to convert biomass (i.e., glucose) to useful chemicals such as amino acids. To produce desired fuels and chemicals with high yield and rate, metabolic pathways have been enhanced and expanded with metabolic engineering and synthetic biology approaches. 2-Keto acids, which are key intermediates in amino acid biosynthesis, can be converted to a wide range of chemicals. 2-Keto acid pathways were engineered in previous research efforts and these studies demonstrated that 2-keto acid pathways have high potential for novel metabolic routes with high productivity. In this review, we discuss recently developed 2-keto acid-based pathways.
Heterologous pathway assembly reveals molecular steps of fungal terreic acid biosynthesis.
Kong, Chuixing; Huang, Hezhou; Xue, Ying; Liu, Yiqi; Peng, Qiangqiang; Liu, Qi; Xu, Qin; Zhu, Qiaoyun; Yin, Ying; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao
2018-02-01
Terreic acid is a potential anticancer drug as it inhibits Bruton's tyrosine kinase; however, its biosynthetic molecular steps remain unclear. In this work, the individual reactions of terreic acid biosynthesis were determined by stepwise pathway assembly in a heterologous host, Pichia pastoris, on the basis of previous knockout studies in a native host, Aspergillus terreus. Polyketide synthase AtX was found to catalyze the formation of partially reduced polyketide 6-methylsalicylic acid, followed by 3-methylcatechol synthesis by salicylate 1-monooxygenase AtA-mediated decarboxylative hydroxylation of 6-methylsalicylic acid. Our results show that cytochrome P450 monooxygenase AtE hydroxylates 3-methylcatechol, thus producing the next product, 3-methyl-1,2,4-benzenetriol. A smaller putative cytochrome P450 monooxygenase, AtG, assists with this step. Then, AtD causes epoxidation and hydroxyl oxidation of 3-methyl-1,2,4-benzenetriol and produces a compound terremutin, via which the previously unknown function of AtD was identified as cyclooxygenation. The final step involves an oxidation reaction of a hydroxyl group by a glucose-methanol-choline oxidoreductase, AtC, which leads to the final product: terreic acid. Functions of AtD and AtG were determined for the first time. All the genes were reanalyzed and all intermediates and final products were isolated and identified. Our model fully defines the molecular steps and corrects previous results from the literature.
Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles
NASA Astrophysics Data System (ADS)
Berti, Lorenzo; Burley, Glenn A.
2008-02-01
Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.
Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine
2016-01-01
Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725
Su, Tzu-Rong; Lin, Jen-Jie; Tsai, Chi-Chu; Huang, Tsu-Kei; Yang, Zih-Yan; Wu, Ming-O; Zheng, Yu-Qing; Su, Ching-Chyuan; Wu, Yu-Jen
2013-01-01
Gallic acid is one of the major flavonoids found in plants. It acts as an antioxidant, and seems to have anti-inflammatory, anti-viral, and anti-cancer properties. In this study, we investigated the effects of gallic acid on melanogenesis, including the activation of melanogenesis signaling pathways. Gallic acid significantly inhibited both melanin synthesis and tyrosinase activity in a dose- and time-dependent manner, and decreased the expression of melanogenesis-related proteins, such as microphthalmia-associated transcription factor (MITF), tyrosinase, tyrosinase-related protein-1 (TRP1), and dopachrome tautomerase (Dct). In addition, gallic acid also acts by phosphorylating and activating melanogenesis inhibitory proteins such as Akt and mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK). Using inhibitors against PI3K/Akt (LY294002) or MEK/ERK-specific (PD98059), the hypopigmentation effect was suppressed, and the gallic acid-initiated activation of MEK/ERK and PI3K/Akt was also revoked. Gallic acid also increased GSK3β and p-β-catenin expression but down-regulated p-GSK3β. Moreover, GSK3β-specific inhibitor (SB216763) restored gallic acid-induced melanin reduction. These results suggest that activation of the MEK/ERK, PI3K/Akt, and inhibition of Wnt/β-catenin signaling pathways is involved in the melanogenesis signaling cascade, and that activation by gallic acid reduces melanin synthesis via down-regulation of MITF and its downstream signaling pathway. In conclusion, gallic acid may be a potentially agent for the treatment of certain skin conditions. PMID:24129178
Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo
2018-01-20
Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.
Amino Acid Sensing in Skeletal Muscle
Moro, Tatiana; Ebert, Scott M.; Adams, Christopher M.; Rasmussen, Blake B.
2016-01-01
Aging impairs skeletal muscle protein synthesis, leading to muscle weakness and atrophy. However, the underlying molecular mechanisms remain poorly understood. Here, we review evidence that mTORC1- and ATF4-mediated amino acid sensing pathways, triggered by impaired amino acid delivery to aged skeletal muscle, may play important roles in skeletal muscle aging. Interventions that alleviate age-related impairments in muscle protein synthesis, strength and/or muscle mass appear to do so by reversing age-related changes in skeletal muscle amino acid delivery, mTORC1 activity and/or ATF4 activity. An improved understanding of the mechanisms and roles of amino acid sensing pathways in skeletal muscle may lead to evidence-based strategies to attenuate sarcopenia. PMID:27444066
The spark discharge synthesis of amino acids from various hydrocarbons
NASA Technical Reports Server (NTRS)
Ring, D.; Miller, S. L.
1984-01-01
The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).
Rao, Reeta Prusty; Hunter, Ally; Kashpur, Olga; Normanly, Jennifer
2010-01-01
Many plant-associated microbes synthesize the auxin indole-3-acetic acid (IAA), and several IAA biosynthetic pathways have been identified in microbes and plants. Saccharomyces cerevisiae has previously been shown to respond to IAA by inducing pseudohyphal growth. We observed that IAA also induced hyphal growth in the human pathogen Candida albicans and thus may function as a secondary metabolite signal that regulates virulence traits such as hyphal transition in pathogenic fungi. Aldehyde dehydrogenase (Ald) is required for IAA synthesis from a tryptophan (Trp) precursor in Ustilago maydis. Mutant S. cerevisiae with deletions in two ALD genes are unable to convert radiolabeled Trp to IAA, yet produce IAA in the absence of exogenous Trp and at levels higher than wild type. These data suggest that yeast may have multiple pathways for IAA synthesis, one of which is not dependent on Trp. PMID:20233857
Synthesis of L-ascorbic acid in the phloem
Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto
2003-01-01
Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288
Synthesis of alpha-amino acids
Davis, Jr., Jefferson W.
1983-01-01
A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.
Bacterial synthesis of N-hydroxycinnamoyl phenethylamines and tyramines.
Sim, Geun Young; Yang, So-Mi; Kim, Bong Gyu; Ahn, Joong-Hoon
2015-10-13
Hydroxycinnamic acids (HCAs) including cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid, are C6-C3 phenolic compounds that are synthesized via the phenylpropanoid pathway. HCAs serve as precursors for the synthesis of lignins, flavonoids, anthocyanins, stilbenes and other phenolic compounds. HCAs can also be conjugated with diverse compounds including quinic acid, hydroxyl acids, and amines. Hydroxycinnamoyl (HC) amine conjugates such as N-HC tyramines and N-HC phenethylamines have been considered as potential starting materials to develop antiviral and anticancer drugs. We synthesized N-HC tyramines and N-HC phenethylamines using three different approaches in Escherichia coli. Five N-HC phenethylamines and eight N-HC tyramines were synthesized by feeding HCAs and phenethylamine or tyramine to E. coli harboring 4CL (encoding 4-coumarate CoA:ligase) and either SHT (encoding phenethylamine N-HC transferase) or THT (encoding tyramine N-HC transferase). Also, N-(p-coumaroyl) phenethylamine and N-(p-coumaroyl) tyramine were synthesized from p-coumaric acid using E. coli harboring an additional gene, PDC (encoding phenylalanine decarboxylase) or TDC (encoding tyrosine decarboxylase). Finally, we synthesized N-(p-coumaroyl) phenethylamine and N-(p-coumaroyl) tyramine from glucose by reconstructing the metabolic pathways for their synthesis in E. coli. Productivity was maximized by optimizing the cell concentration and incubation temperature. We reconstructed the metabolic pathways for synthesis of N-HC tyramines and N-HC phenethylamines by expressing several genes including 4CL, TST or SHT, PDC or TDC, and TAL (encoding tyrosine ammonia lyase) and engineering the shikimate metabolic pathway to increase endogenous tyrosine concentration in E. coli. Approximately 101.9 mg/L N-(p-coumaroyl) phenethylamine and 495.4 mg/L N-(p-coumaroyl) tyramine were synthesized from p-coumaric acid. Furthermore, 152.5 mg/L N-(p-coumaroyl) phenethylamine and 94.7 mg/L N
USDA-ARS?s Scientific Manuscript database
Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...
Koshio, Aya; Hasegawa, Tomomi; Okada, Rieko; Takeno, Kiyotoshi
2015-01-15
The short-day plant pharbitis (also called Japanese morning glory), Ipomoea nil (formerly Pharbitis nil), was induced to flower by poor-nutrition stress. This stress-induced flowering was inhibited by aminooxyacetic acid (AOA), which is a known inhibitor of phenylalanine ammonia-lyase (PAL) and the synthesis of indole-3-acetic acid (IAA) and 1-aminocycropropane-1-carboxylic acid (ACC) and thus regulates endogenous levels of salicylic acid (SA), IAA and polyamine (PA). Stress treatment increased PAL activity in cotyledons, and AOA suppressed this increase. The observed PAL activity and flowering response correlate positively, indicating that AOA functions as a PAL inhibitor. The inhibition of stress-induced flowering by AOA was also overcome by IAA. An antiauxin, 4-chlorophenoxy isobutyric acid, inhibited stress-induced flowering. Both SA and IAA promoted flowering induced by stress. PA also promoted flowering, and the effective PA was found to be putrescine (Put). These results suggest that all of the pathways leading to the synthesis of SA, IAA and Put are responsive to the flowering inhibition by AOA and that these endogenous factors may be involved in the regulation of stress-induced flowering. However, as none of them induced flowering under non-stress conditions, they may function cooperatively to promote flowering. Copyright © 2014 Elsevier GmbH. All rights reserved.
Distribution, industrial applications, and enzymatic synthesis of D-amino acids.
Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang
2015-04-01
D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.
Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B
2011-07-01
A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.
Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.
2016-01-01
Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025
Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko
2018-01-01
Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.
Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus
DOE Office of Scientific and Technical Information (OSTI.GOV)
Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.
Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.
Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus
Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; ...
2014-09-29
Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.
Derivatives of diphosphonic acids: synthesis and biological activity
NASA Astrophysics Data System (ADS)
Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.
1993-07-01
The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.
Corominas, Jordi; Ramayo-Caldas, Yuliaxis; Puig-Oliveras, Anna; Estellé, Jordi; Castelló, Anna; Alves, Estefania; Pena, Ramona N; Ballester, Maria; Folch, Josep M
2013-12-01
In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases.
Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael
2017-05-15
Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our
Sanchez, Erica L.; Pulliam, Thomas H.; Dimaio, Terri A.; Thalhofer, Angel B.; Delgado, Tracie
2017-01-01
ABSTRACT Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation
Abiotic synthesis of fatty acids
NASA Technical Reports Server (NTRS)
Leach, W. W.; Nooner, D. W.; Oro, J.
1978-01-01
The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.
Maniscalco, W M; Finkelstein, J N; Parkhurst, A B
1989-05-01
De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.
Sikalidis, Angelos K.; Mazor, Kevin M.; Lee, Jeong-In; Roman, Heather B.; Hirschberger, Lawrence L.; Stipanuk, Martha H.
2014-01-01
Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser51 phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597
NASA Astrophysics Data System (ADS)
Wang, P. L.; Hsiao, K. T.; Lin, L. H.
2017-12-01
Amino acids represent one of the most important categories of biomolecule. Their abundance and isotopic patterns have been broadly used to address issues related to biochemical processes and elemental cycling in natural environments. Previous studies have shown that various carbon assimilative pathways of microorganisms (e.g. autotrophy, heterotrophy and acetotrophy) could be distinguished by carbon isotopic patterns of amino acids. However, the taxonomic and catabolic coverage are limited in previous examination. This study aims to uncover the carbon isotopic patterns of amino acids for microorganisms remaining uncharacterized but bearing biogeochemical and ecological significance in anoxic environments. To fulfill the purpose, two anaerobic strains were isolated from riverine wetland and mud volcano in Taiwan. One strain is a sulfate reducing bacterium (related to Desulfovibrio marrakechensis), which is capable of utilizing either H2 or lactate, and the other is a methanogen (related to Methanolobus profundi), which grows solely with methyl-group compounds. Carbon isotope analyses of amino acids were performed on cells grown in exponential and stationary phase. The isotopic patterns were similar for all examined cultures, showing successive 13C depletion along synthetic pathways. No significant difference was observed for the methanogen and lactate-utilizing sulfate reducer harvested in exponential and stationary phases. In contrast, the H2-utilizing sulfate reducer harvested in stationary phase depleted and enriched 13C in aspartic acid and glycine, respectively when compared with that harvested in exponential phase. Such variations might infer the change of carbon flux during synthesis of these two amino acids in the reverse TCA cycle. In addition, the discriminant function analysis for all available data from culture studies further attests the capability of using carbon isotope patterns of amino acids in identifying microbial metabolisms.
Quantitative importance of the 25-hydroxylation pathway for bile acid biosynthesis in the rat
DOE Office of Scientific and Technical Information (OSTI.GOV)
Duane, W.C.; Bjoerkhem, I.H.; Hamilton, J.N.
1988-05-01
During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. In the present study, we have quantitated the relative importance of these two pathways in vivo by measuring production of (14C) acetone from (14C)-26-cholesterol. Four days after intraperitoneal injection of 20 to 40 muCi (14C)-26-cholesterol and 1 day after beginning a constant intravenous infusion of unlabeled acetone at 25 mumolesmore » per kg per min, 6 male and 2 female Sprague-Dawley rats underwent breath collections. Expired acetone was trapped and purified as the 2,4-dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied times the acetone infusion rate to calculate production of (14C)acetone. (14C) Acetone production averaged 1.7% of total release of 14C from (14C)-26-cholesterol, estimated by 14CO2 output. The method was validated by showing that (14C) acetone production from (14C)isopropanol averaged 111% of the (14C)isopropanol infusion rate. We conclude that, in the normal rat, the 25-hydroxylation pathway accounts for less than 2% of bile acid synthesis.« less
Quantitative importance of the 25-hydroxylation pathway for bile acid biosynthesis in the rat.
Duane, W C; Björkhem, I; Hamilton, J N; Mueller, S M
1988-01-01
During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. In the present study, we have quantitated the relative importance of these two pathways in vivo by measuring production of [14C] acetone from [14C]-26-cholesterol. Four days after intraperitoneal injection of 20 to 40 muCi [14C]-26-cholesterol and 1 day after beginning a constant intravenous infusion of unlabeled acetone at 25 mumoles per kg per min, 6 male and 2 female Sprague-Dawley rats underwent breath collections. Expired acetone was trapped and purified as the 2,4-dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied times the acetone infusion rate to calculate production of [14C]acetone. [14C] Acetone production averaged 1.7% of total release of 14C from [14C]-26-cholesterol, estimated by 14CO2 output. The method was validated by showing that [14C] acetone production from [14C]isopropanol averaged 111% of the [14C]isopropanol infusion rate. We conclude that, in the normal rat, the 25-hydroxylation pathway accounts for less than 2% of bile acid synthesis.
Enzymatic routes for the synthesis of ursodeoxycholic acid.
Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner
2014-12-10
Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.
Fox, Simon R.; Rawsthorne, Stephen; Hills, Matthew J.
2001-01-01
The uptake in vitro of glucose (Glc)-6-phosphate (Glc-6-P) into plastids from the roots of 10- to 14-d-old pea (Pisum sativum L. cv Puget) plants was inhibited by oleoyl-coenzyme A (CoA) concentrations in the low micromolar range (1–2 μm). The IC50 (the concentration of inhibitor that reduces enzyme activity by 50%) for the inhibition of Glc-6-P uptake was approximately 750 nm; inhibition was reversed by recombinant rapeseed (Brassica napus) acyl-CoA binding protein. In the presence of ATP (3 mm) and CoASH (coenzyme A; 0.3 mm), Glc-6-P uptake was inhibited by 60%, due to long-chain acyl-CoA synthesis, presumably from endogenous sources of fatty acids present in the preparations. Addition of oleoyl-CoA (1 μm) decreased carbon flux from Glc-6-P into the synthesis of starch and through the oxidative pentose phosphate (OPP) pathway by up to 73% and 40%, respectively. The incorporation of carbon from Glc-6-P into fatty acids was not detected under any conditions. Oleoyl-CoA inhibited the incorporation of acetate into fatty acids by 67%, a decrease similar to that when ATP was excluded from incubations. The oleoyl-CoA-dependent inhibition of fatty acid synthesis was attributable to a direct inhibition of the adenine nucleotide translocator by oleoyl-CoA, which indirectly reduced fatty acid synthesis by ATP deprivation. The Glc-6-P-dependent stimulation of acetate incorporation into fatty acids was reversed by the addition of oleoyl-CoA. PMID:11457976
USDA-ARS?s Scientific Manuscript database
Arginine, a precursor for the synthesis of nitric oxide (NO) and polyamines, is critical for implantation and development of the conceptus. We first reported that the arginine decarboxylase (ADC)/agmatinase(AGMAT) pathway as an alternative pathway for synthesis of polyamines in the ovine conceptuses...
Pathak, Preeti; Liu, Hailiang; Boehme, Shannon; Xie, Cen; Krausz, Kristopher W; Gonzalez, Frank; Chiang, John Y L
2017-06-30
The bile acid-activated receptors, nuclear farnesoid X receptor (FXR) and the membrane Takeda G-protein receptor 5 (TGR5), are known to improve glucose and insulin sensitivity in obese and diabetic mice. However, the metabolic roles of these two receptors and the underlying mechanisms are incompletely understood. Here, we studied the effects of the dual FXR and TGR5 agonist INT-767 on hepatic bile acid synthesis and intestinal secretion of glucagon-like peptide-1 (GLP-1) in wild-type, Fxr -/- , and Tgr5 -/- mice. INT-767 efficaciously stimulated intracellular Ca 2+ levels, cAMP activity, and GLP-1 secretion and improved glucose and lipid metabolism more than did the FXR-selective obeticholic acid and TGR5-selective INT-777 agonists. Interestingly, INT-767 reduced expression of the genes in the classic bile acid synthesis pathway but induced those in the alternative pathway, which is consistent with decreased taurocholic acid and increased tauromuricholic acids in bile. Furthermore, FXR activation induced expression of FXR target genes, including fibroblast growth factor 15, and unexpectedly Tgr5 and prohormone convertase 1/3 gene expression in the ileum. We identified an FXR-responsive element on the Tgr5 gene promoter. Fxr -/- and Tgr5 -/- mice exhibited reduced GLP-1 secretion, which was stimulated by INT-767 in the Tgr5 -/- mice but not in the Fxr -/- mice. Our findings uncovered a novel mechanism in which INT-767 activation of FXR induces Tgr5 gene expression and increases Ca 2+ levels and cAMP activity to stimulate GLP-1 secretion and improve hepatic glucose and lipid metabolism in high-fat diet-induced obese mice. Activation of both FXR and TGR5 may therefore represent an effective therapy for managing hepatic steatosis, obesity, and diabetes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
NASA Technical Reports Server (NTRS)
Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.
2012-01-01
Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.
Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.
Halvorson, D L; McCune, S A
1984-11-01
The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.
Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.
Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2017-08-01
Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.
Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K
2016-08-01
Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.
The pentose phosphate pathway and cancer
Patra, Krushna C.; Hay, Nissim
2015-01-01
The pentose phosphate pathway (PPP), which branches from glycolysis at the first committed step of glucose metabolism, is required for the synthesis of ribonucleotides and is a major source of NADPH. NADPH is required for and consumed during fatty acid synthesis and the scavenging of reactive oxygen species. Therefore, the PPP plays a pivotal role in helping glycolytic cancer cells to meet their anabolic demands and combat oxidative stress. Recently, several neoplastic lesions were shown to have evolved to facilitate the flux of glucose into the pentose phosphate pathway. This review summarizes the fundamental functions of the PPP, its regulation in cancer cells, and its importance in cancer cell metabolism and survival. PMID:25037503
de Cesaro, Alessandra; da Silva, Suse Botelho; Ayub, Marco Antônio Záchia
2014-09-01
The aims of this study were to evaluate the effects of the addition of metabolic precursors and polydimethylsiloxane (PDMS) as an oxygen carrier to cultures of Bacillus subtilis BL53 during the production of γ-PGA. Kinetics analyses of cultivations of different media showed that B. subtilis BL53 is an exogenous glutamic acid-dependent strain. When the metabolic pathway precursors of γ-PGA synthesis, L-glutamine and a-ketoglutaric acid, were added to the culture medium, production of the biopolymer was increased by 20 % considering the medium without these precursors. The addition of 10 % of the oxygen carrier PDMS to cultures caused a two-fold increase in the volumetric oxygen mass transfer coefficient (kLa), improving γ-PGA production and productivity. Finally, bioreactor cultures of B. subtilis BL53 adopting the combination of optimized medium E, added of glutamine, α-ketoglutaric acid, and PDMS, showed a productivity of 1 g L(-1) h(-1) of g-PGA after only 24 h of cultivation. Results of this study suggest that the use of metabolic pathway precursors glutamine and a-ketolgutaric acid, combined with the addition of PDMS as an oxygen carrier in bioreactors, can improve γ-PGA production and productivity by Bacillus strains .
Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M
2005-08-07
Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.
Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli
Broda, Paul
1968-01-01
Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126
A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.
Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L
2015-04-01
The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.
Tripathy, Sasmita; Jump, Donald B.
2013-01-01
Elevated hepatic expression of fatty acid elongase-5 (Elovl5) induces FoxO1 phosphorylation, lowers FoxO1 nuclear content, and suppresses expression of genes involved in gluconeogenesis (GNG). In this report, we define the molecular and metabolic basis of Elovl5 control of FoxO1 phosphorylation. Adenoviral-mediated (Ad-Elovl5) induction of hepatic Elovl5 in diet-induced obese, glucose-intolerant mice and HepG2 cells increased the phosphorylation of Akt2-S473 [mammalian target of rapamycin complex-2 (mTORC2) site], but not Akt2-T308 (PDK1 site). The Akt2 inhibitor Akti1/2 blocked Elovl5 induction of FoxO1-S256 phosphorylation in HepG2 cells. Elevated Elovl5 activity in liver and HepG2 cells induced rictor mRNA, rictor protein, and rictor-mTOR interaction, whereas rictor knockdown (siRNA) attenuated Elovl5 induction of Akt2-S473 and FoxO1-S256 phosphorylation in HepG2 cells. FA analysis revealed that the abundance of cis-vaccenic acid (18:1,n-7) was increased in livers of obese mice and HepG2 cells following Ad-Elovl5 infection. Treating HepG2 cells with Elovl5 substrates established that palmitoleic acid (16:1,n-7), but not γ-linolenic acid (18:3,n-6), induced rictor protein, Akt-S473, and FoxO1-S256 phosphorylation. Inhibition of FA elongation blocked 16:1,n-7 but not 18:1,n-7 induction of rictor protein and Akt-S473 and FoxO1-S256 phosphorylation. These results establish a novel link between Elovl5-mediated synthesis of 18:1,n-7 and GNG through the control of the mTORC2-Akt-FoxO1 pathway. PMID:23099444
Hsu, Ann; Siegler, Karen E.
2017-01-01
ABSTRACT Amino acid sequence differences in the variable region of immunoglobulin (Ig) cause wide variations in secretion outputs. To address how a primary sequence difference comes to modulate Ig secretion, we investigated the biosynthetic process of 2 human IgG2κ monoclonal antibodies (mAbs) that differ only by one amino acid in the light chain complementarity-determining region 1 while showing ∼20-fold variance in secretion titer. Although poorly secreted, the lower-secreting mAb of the 2 was by no means defective in terms of its folding stability, antigen binding, and in vitro biologic activity. However, upon overexpression in HEK293 cells, the low-secreting mAb revealed a high propensity to aggregate into enlarged globular structures called Russell bodies (RBs) in the endoplasmic reticulum. While Golgi morphology was affected by the formation of RBs, secretory pathway membrane traffic remained operational in those cells. Importantly, cellular protein synthesis was severely suppressed in RB-positive cells through the phosphorylation of eIF2α. PERK-dependent signaling was implicated in this event, given the upregulation and nuclear accumulation of downstream effectors such as ATF4 and CHOP. These findings illustrated that the underlining process of poor Ig secretion in RB-positive cells was due to downregulation of Ig synthesis instead of a disruption or blockade of secretory pathway trafficking. Therefore, RB formation signifies an end of active Ig production at the protein translation level. Consequently, depending on how soon and how severely an antibody-expressing cell develops the RB phenotype, the productive window of Ig secretion can vary widely among the cells expressing different mAbs. PMID:28379093
Synthesis and chirality of amino acids under interstellar conditions.
Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J
2013-01-01
Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.
Sharma, Upendra K; Sharma, Nandini; Salwan, Richa; Kumar, Rakesh; Kasana, Ramesh C; Sinha, Arun K
2012-02-01
Decarboxylation of substituted cinnamic acids is a predominantly followed pathway for obtaining hydroxystyrenes-one of the most extensively explored bioactive compounds in the food and flavor industry (e.g. FEMA GRAS approved 4-vinylguaiacol). For this, mild and green strategies providing good yields with high product selectivity are needed. Two newly isolated bacterial strains, i.e. Pantoea agglomerans KJLPB4 and P. agglomerans KJPB2, are reported for mild and effective decarboxylation of substituted cinnamic acids into corresponding hydroxystyrenes. Key operational parameters for the process, such as incubation temperature, incubation time, substrate concentration and effect of co-solvent, were optimized using ferulic acid as a model substrate. With strain KJLPB4, 1.51 g L⁻¹ 4-vinyl guaiacol (98% yield) was selectively obtained from 2 g L⁻¹ ferulic acid at 28 °C after 48 h incubation. However, KJPB2 provided vanillic acid in 85% yield after 72 h following the oxidative decarboxylation pathway. In addition, KJLPB4 was effectively exploited for the deacetylation of acetylated α-phenylcinnamic acids, providing corresponding compounds in 65-95% yields. Two newly isolated microbial strains are reported for the mild and selective decarboxylation of substituted cinnamic acids into hydroxystyrenes. Preparative-scale synthesis of vinyl guaiacol and utilization of renewable feedstock (ferulic acid extracted from maize bran) have been demonstrated to enhance the practical utility of the process. Copyright © 2011 Society of Chemical Industry.
Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester
NASA Technical Reports Server (NTRS)
Weber, A. L.
1986-01-01
The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.
Arunima, Sakunthala; Rajamohan, Thankappan
2014-05-28
The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.
Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.
Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan
2011-12-01
In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.
NASA Astrophysics Data System (ADS)
Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.
2012-09-01
Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.
Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P
2016-09-01
Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian
2015-11-01
Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.
Fatty acid metabolism in breast cancer subtypes
Monaco, Marie E.
2017-01-01
Dysregulation of fatty acid metabolism is recognized as a component of malignant transformation in many different cancers, including breast; yet the potential for targeting this pathway for prevention and/or treatment of cancer remains unrealized. Evidence indicates that proteins involved in both synthesis and oxidation of fatty acids play a pivotal role in the proliferation, migration and invasion of breast cancer cells. The following essay summarizes data implicating specific fatty acid metabolic enzymes in the genesis and progression of breast cancer, and further categorizes the relevance of specific metabolic pathways to individual intrinsic molecular subtypes of breast cancer. Based on mRNA expression data, the less aggressive luminal subtypes appear to rely on a balance between de novo fatty acid synthesis and oxidation as sources for both biomass and energy requirements, while basal-like, receptor negative subtypes overexpress genes involved in the utilization of exogenous fatty acids. With these differences in mind, treatments may need to be tailored to individual subtypes. PMID:28412757
PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.
Feng, Youjun; Cronan, John E
2014-01-01
Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.
1983-01-01
Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284
Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold.
Gao, Jinpeng; Wallis, James G; Browse, John
2015-09-01
The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C-6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. © 2015 American Society of Plant Biologists. All Rights Reserved.
Grewal, Savraj S; Evans, Justin R; Edgar, Bruce A
2007-12-17
Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA(-/-) mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth-regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components.
New hydrazones of ferulic acid: synthesis, characterization and biological activity.
Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa
2014-01-01
The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.
Daniëls, Veerle W.; Smans, Karine; Royaux, Ines; Chypre, Melanie
2014-01-01
Increased lipogenesis is a hallmark of a wide variety of cancers and is under intense investigation as potential antineoplastic target. Although brisk lipogenesis is observed in the presence of exogenous lipids, evidence is mounting that these lipids may adversely affect the efficacy of inhibitors of lipogenic pathways. Therefore, to fully exploit the therapeutic potential of lipid synthesis inhibitors, a better understanding of the interrelationship between de novo lipid synthesis and exogenous lipids and their respective role in cancer cell proliferation and therapeutic response to lipogenesis inhibitors is of critical importance. Here, we show that the proliferation of various cancer cell lines (PC3M, HepG2, HOP62 and T24) is attenuated when cultured in lipid-reduced conditions in a cell line-dependent manner, with PC3M being the least affected. Interestingly, all cell lines - lipogenic (PC3M, HepG2, HOP62) as well as non-lipogenic (T24) - raised their lipogenic activity in these conditions, albeit to a different degree. Cells that attained the highest lipogenic activity under these conditions were best able to cope with lipid reduction in term of proliferative capacity. Supplementation of the medium with very low density lipoproteins, free fatty acids and cholesterol reversed this activation, indicating that the mere lack of lipids is sufficient to activate de novo lipogenesis in cancer cells. Consequently, cancer cells grown in lipid-reduced conditions became more dependent on de novo lipid synthesis pathways and were more sensitive to inhibitors of lipogenic pathways, like Soraphen A and Simvastatin. Collectively, these data indicate that limitation of access to exogenous lipids, as may occur in intact tumors, activates de novo lipogenesis is cancer cells, helps them to thrive under these conditions and makes them more vulnerable to lipogenesis inhibitors. These observations have important implications for the design of new antineoplastic strategies targeting
Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.
Jiang, Jianghui; Xu, Jiaxi
2017-04-16
4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.
Synthesis of monomethyl 5,5'-dehydrodiferulic acid
USDA-ARS?s Scientific Manuscript database
Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...
Design of nucleic acid strands with long low-barrier folding pathways.
Condon, Anne; Kirkpatrick, Bonnie; Maňuch, Ján
2017-01-01
A major goal of natural computing is to design biomolecules, such as nucleic acid sequences, that can be used to perform computations. We design sequences of nucleic acids that are "guaranteed" to have long folding pathways relative to their length. This particular sequences with high probability follow low-barrier folding pathways that visit a large number of distinct structures. Long folding pathways are interesting, because they demonstrate that natural computing can potentially support long and complex computations. Formally, we provide the first scalable designs of molecules whose low-barrier folding pathways, with respect to a simple, stacked pair energy model, grow superlinearly with the molecule length, but for which all significantly shorter alternative folding pathways have an energy barrier that is [Formula: see text] times that of the low-barrier pathway for any [Formula: see text] and a sufficiently long sequence.
Carballeira, Néstor M.; Sanabria, David; Oyola, Delise
2006-01-01
An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032
Effect of the quality of dietary amino acids composition on the urea synthesis in rats.
Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko
2011-01-01
We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.
Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.
Lund, F; Telhag, H
1978-12-01
The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.
Total amino acid stabilization during cell-free protein synthesis reactions.
Calhoun, Kara A; Swartz, James R
2006-05-17
Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.
Cytochrome and Alternative Pathway Respiration in Tobacco (Effects of Salicylic Acid).
Rhoads, D. M.; McIntosh, L.
1993-11-01
In suspension cultures of NT1 tobacco (Nicotiana tabacum L. cv Bright Yellow) cells the cytochrome pathway capacity increased between d 3 and d 4 following subculturing and reached the highest level observed on d 7. The capacity decreased significantly by d 10 and was at the same level on d 14. Both alternative pathway capacity and the amount of the 35-kD alternative oxidase protein increased significantly between d 5 and d 6, reached the highest point observed on d 7, remained constant until d 10, and decreased by d 14. The highest capacities of the alternative and cytochrome pathways and the highest amount of the 35-kD protein were attained on the day that cell cultures reached a stationary phase of growth. Addition of salicylic acid to cell cultures on d 4 caused a significant increase in alternative pathway capacity and a dramatic accumulation of the 35-kD protein by 12 h. The alternative pathway capacity and the protein level reached the highest level observed by 16 h after salicylic acid addition, and the cytochrome pathway capacity was at about the same level at each time point. The accumulation of the 35-kD alternative oxidase protein was significantly decreased by addition of actinomycin D 1 h before salicylic acid and was blocked by addition of cycloheximide. These results indicate that de novo transcription and translation were necessary for salicylic acid to cause the maximum accumulation of the 35-kD protein.
Wakashima, Takeshi; Abe, Kensuke; Kihara, Akio
2014-01-01
The sphingolipid metabolite sphingosine 1-phosphate (S1P) functions as a lipid mediator and as a key intermediate of the sole sphingolipid to glycerophospholipid metabolic pathway (S1P metabolic pathway). In this pathway, S1P is converted to palmitoyl-CoA through 4 reactions, then incorporated mainly into glycerophospholipids. Although most of the genes responsible for the S1P metabolic pathway have been identified, the gene encoding the trans-2-enoyl-CoA reductase, responsible for the saturation step (conversion of trans-2-hexadecenoyl-CoA to palmitoyl-CoA) remains unidentified. In the present study, we show that TER is the missing gene in mammals using analyses involving yeast cells, deleting the TER homolog TSC13, and TER-knockdown HeLa cells. TER is known to be involved in the production of very long-chain fatty acids (VLCFAs). A significant proportion of the saturated and monounsaturated VLCFAs are used for sphingolipid synthesis. Therefore, TER is involved in both the production of VLCFAs used in the fatty acid moiety of sphingolipids as well as in the degradation of the sphingosine moiety of sphingolipids via S1P. PMID:25049234
Stereoselective synthesis of unsaturated α-amino acids.
Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine
2015-06-01
Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.
Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis
USDA-ARS?s Scientific Manuscript database
Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...
Tiso, Till; Sabelhaus, Petra; Behrens, Beate; Wittgens, Andreas; Rosenau, Frank; Hayen, Heiko; Blank, Lars Mathias
2016-12-01
Metabolic engineering of microbial cell factories for the production of heterologous secondary metabolites implicitly relies on the intensification of intracellular flux directed toward the product of choice. Apart from reactions following peripheral pathways, enzymes of the central carbon metabolism are usually targeted for the enhancement of precursor supply. In Pseudomonas putida , a Gram-negative soil bacterium, central carbon metabolism, i.e., the reactions required for the synthesis of all 12 biomass precursors, was shown to be regulated at the metabolic level and not at the transcriptional level. The bacterium's central carbon metabolism appears to be driven by demand to react rapidly to ever-changing environmental conditions. In contrast, peripheral pathways that are only required for growth under certain conditions are regulated transcriptionally. In this work, we show that this regulation regime can be exploited for metabolic engineering. We tested this driven-by-demand metabolic engineering strategy using rhamnolipid production as an example. Rhamnolipid synthesis relies on two pathways, i.e., fatty acid de novo synthesis and the rhamnose pathway, providing the required precursors hydroxyalkanoyloxy-alkanoic acid (HAA) and activated (dTDP-)rhamnose, respectively. In contrast to single-pathway molecules, rhamnolipid synthesis causes demand for two central carbon metabolism intermediates, i.e., acetyl-CoA for HAA and glucose-6-phosphate for rhamnose synthesis. Following the above-outlined strategy of driven by demand, a synthetic promoter library was developed to identify the optimal expression of the two essential genes ( rhlAB ) for rhamnolipid synthesis. The best rhamnolipid-synthesizing strain had a yield of 40% rhamnolipids on sugar [Cmol RL /Cmol Glc ], which is approximately 55% of the theoretical yield. The rate of rhamnolipid synthesis of this strain was also high. Compared to an exponentially growing wild type, the rhamnose pathway increased its
Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.
Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie
2016-04-01
The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.
Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D
2014-05-20
Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.
Coffey, Marcus J; Jarvis, Gavin E; Gibbins, Jonathan M; Coles, Barbara; Barrett, Natasha E; Wylie, Oliver R E; O'Donnell, Valerie B
2004-06-25
Lipoxygenases (LOX) contribute to vascular disease and inflammation through generation of bioactive lipids, including 12-hydro(pero)xyeicosatetraenoic acid (12-H(P)ETE). The physiological mechanisms that acutely control LOX product generation in mammalian cells are uncharacterized. Human platelets that contain a 12-LOX isoform (p12-LOX) were used to define pathways that activate H(P)ETE synthesis in the vasculature. Collagen and collagen-related peptide (CRP) (1 to 10 microg/mL) acutely induced platelet 12-H(P)ETE synthesis. This implicated the collagen receptor glycoprotein VI (GPVI), which signals via the immunoreceptor-based activatory motif (ITAM)-containing FcRgamma chain. Conversely, thrombin only activated at high concentrations (> 0.2 U/mL), whereas U46619 and ADP alone were ineffective. Collagen or CRP-stimulated 12-H(P)ETE generation was inhibited by staurosporine, PP2, wortmannin, BAPTA/AM, EGTA, and L-655238, implicating src-tyrosine kinases, PI3-kinase, Ca2+ mobilization, and p12-LOX translocation. In contrast, protein kinase C (PKC) inhibition potentiated 12-H(P)ETE generation. Finally, activation of the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing platelet endothelial cell adhesion molecule (PECAM-1) inhibited p12-LOX product generation. This study characterizes a receptor-dependent pathway for 12-H(P)ETE synthesis via the collagen receptor GPVI, which is negatively regulated by PECAM-1 and PKC, and demonstrates a novel link between immune receptor signaling and lipid mediator generation in the vasculature.
Amino acid metabolism in dairy cows and their regulation in milk synthesis.
Wang, Feiran; Shi, Haitao; Wang, Shuxiang; Wang, Yajing; Cao, Zhijun; Li, Shengli
2018-06-10
Reducing dietary crude protein (CP) and supplementing with certain amino acids (AAs) has been known as a potential solution to improve nitrogen (N) efficiency in dairy production. Thus understanding how AAs are utilized in various sites along the gut is critical. AA flow from the intestine to portal-drained viscera (PDV) and liver then to the mammary gland was elaborated in this article. Recoveries in individual AA in PDV and liver seem to share similar AA pattern with input: output ratio in mammary gland, which subdivides essential AA (EAA) into two groups, lysine (Lys) and branched-chain AA (BCAA) in group 1, input: output ratio > 1; methionine (Met), histidine (His), phenylalanine (Phe) etc. in group 2, input: output ratio close to 1. AAs in the mammary gland are either utilized for milk protein synthesis or retained as body tissue, or catabolized. The fractional removal of AAs and the number and activity of AA transporters together contribute to the ability of AAs going through mammary cells. Mammalian target of rapamycin (mTOR) pathway is closely related to milk protein synthesis and provides alternatives for AA regulation of milk protein synthesis, which connects AA with lactose synthesis via α-lactalbumin (gene: LALBA) and links with milk fat synthesis via sterol regulatory element-binding transcription protein 1 (SREBP1) and peroxisome proliferator-activated receptor (PPAR). Overall, AA flow across various tissues reveal AA metabolism and utilization in dairy cows on one hand. While the function of AA in the biosynthesis of milk protein, fat and lactose at both transcriptional and posttranscriptional level from another angle provides the possibility for us to regulate them for higher efficiency. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.
Schonbaum, Gregory R.; Bonner, Walter D.; Storey, Bayard T.; Bahr, James T.
1971-01-01
Hydroxamic acids, R-CONHOH, are inhibitors specific to the respiratory pathway through the alternate, cyanide-insensitive terminal oxidase of plant mitochondria. The nature of the R group in these compounds affects the concentration at which the hydroxamic acids are effective, but it appears that all hydroxamic acids inhibit if high enough concentrations are used. The benzhydroxamic acids are effective at relatively low concentrations; of these, the most effective are m-chlorobenzhydroxamic acid and m-iodobenzhydroxamic acid. The concentrations required for half-maximal inhibition of the alternate oxidase pathway in mung bean (Phaseolus aureus) mitochondria are 0.03 mm for m-chlorobenzhydroxamic acid and 0.02 mm for m-iodobenzhydroxamic acid. With skunk cabbage (Symplocarpus foetidus) mitochondria, the required concentrations are 0.16 for m-chlorobenzhydroxamic acid and 0.05 for m-iodobenzhydroxamic acid. At concentrations which inhibit completely the alternate oxidase pathway, these two compounds have no discernible effect on either the respiratory pathway through cytochrome oxidase, or on the energy coupling reactions of these mitochondria. These inhibitors make it possible to isolate the two respiratory pathways and study their mode of action separately. These inhibitors also enhance an electron paramagnetic resonance signal near g = 2 in anaerobic, submitochondrial particles from skunk cabbage, which appears to be specific to the alternate oxidase and thus provides a means for its assay. PMID:5543780
Harnessing Intracellular Biochemical Pathways for In Vitro Synthesis of Designer Tellurium Nanorods.
Xiong, Ling-Hong; Cui, Ran; Zhang, Zhi-Ling; Tu, Jia-Wei; Shi, Yun-Bo; Pang, Dai-Wen
2015-10-28
Synthesizing nanomaterials of desired properties is a big challenge, which requires extremely harsh conditions and/or use of toxic materials. More recently developed in vivo methods have brought a different set of problems such as separation and purification of nanomaterials made in vivo. Here, a novel approach that harnesses cellular pathways for in vitro synthesis of high-quality tellurium nanorods with tunable lengths and optical properties is reported. It is first demonstrated that in vivo biochemical pathways could be used to synthesize Te nanorods via the intracellular reduction of TeO3(2-) in living Staphylococcus aureus cells. The pathways to set up a quasi-biological system for Te precursor formation are then utilized, which could further synthesize Te nanorods in vitro. This allows to successfully synthesize in vitro, under routine laboratory conditions, Te nanorods with uniform and tunable lengths, ranging from about 10 to 200 nm, and controllable optical properties with high molar extinction coefficients. The approach here should open new avenues for controllable, facile, and efficient synthesis of designer nanomaterials for diverse industrial and biomedical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.
Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip
2016-07-02
Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.
Fernández-Murray, J Pedro; McMaster, Christopher R
2005-11-18
In eukaryotes, neuropathy target esterase (Nte1p in yeast) deacylates phosphatidylcholine derived exclusively from the CDP-choline pathway to produce glycerophosphocholine (GroPCho) and release two fatty acids. The metabolic fate of GroPCho in eukaryotic cells is currently not known. Saccharomyces cerevisiae contains two open reading frames predicted to contain glycerophosphodiester phosphodiesterase domains, YPL110c and YPL206c. Pulse-chase experiments were conducted to monitor GroPCho metabolic fate under conditions known to alter CDP-choline pathway flux and consequently produce different rates of formation of GroPCho. From this analysis, it was revealed that GroPCho was metabolized to choline, with this choline serving as substrate for renewed synthesis of phosphatidylcholine. YPL110c played the major role in this metabolic pathway. To extend and confirm the metabolic studies, the ability of the ypl110cDelta and ypl206cDelta strains to utilize exogenous GroPCho or glycerophosphoinositol as the sole source of phosphate was analyzed. Consistent with our metabolic profiling, the ypl206cDelta strain grew on both substrates with a similar rate to wild type, whereas the ypl110cDelta strain grew very poorly on GroPCho and with moderately reduced growth on glycerophosphoinositol.
Grewal, Savraj S.; Evans, Justin R.; Edgar, Bruce A.
2007-01-01
Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA −/− mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth–regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components. PMID:18086911
Cytochrome and Alternative Pathway Respiration in Tobacco (Effects of Salicylic Acid).
Rhoads, D. M.; McIntosh, L.
1993-01-01
In suspension cultures of NT1 tobacco (Nicotiana tabacum L. cv Bright Yellow) cells the cytochrome pathway capacity increased between d 3 and d 4 following subculturing and reached the highest level observed on d 7. The capacity decreased significantly by d 10 and was at the same level on d 14. Both alternative pathway capacity and the amount of the 35-kD alternative oxidase protein increased significantly between d 5 and d 6, reached the highest point observed on d 7, remained constant until d 10, and decreased by d 14. The highest capacities of the alternative and cytochrome pathways and the highest amount of the 35-kD protein were attained on the day that cell cultures reached a stationary phase of growth. Addition of salicylic acid to cell cultures on d 4 caused a significant increase in alternative pathway capacity and a dramatic accumulation of the 35-kD protein by 12 h. The alternative pathway capacity and the protein level reached the highest level observed by 16 h after salicylic acid addition, and the cytochrome pathway capacity was at about the same level at each time point. The accumulation of the 35-kD alternative oxidase protein was significantly decreased by addition of actinomycin D 1 h before salicylic acid and was blocked by addition of cycloheximide. These results indicate that de novo transcription and translation were necessary for salicylic acid to cause the maximum accumulation of the 35-kD protein. PMID:12231986
Myrtle, J D; Beekman, A M; Barrow, R A
2016-09-21
A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).
Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease
DOE Office of Scientific and Technical Information (OSTI.GOV)
Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.
1983-09-01
We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less
Fukuda, N; Ontko, J A
1984-08-01
In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of
Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.
2009-01-01
The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020
Grison, Claire M; Renard, Brice-Loïc; Grison, Claude
2014-02-01
2-Keto-3-deoxy-D-erythro-hexonic acid (KDG) is the key intermediate metabolite of the Entner Doudoroff (ED) pathway. A simple, efficient and stereoselective synthesis of KDG isopropyl ester is described in five steps from 2,3-O-isopropylidene-D-threitol with an overall yield of 47%. KDG isopropyl ester is studied as an attractive marker of a functional Entner Doudoroff pathway. KDG isopropyl ester is used to promote growth of ammonium producing bacterial strains, showing interesting features in the remediation of heavy-metal polluted soils. Copyright © 2013 Elsevier Inc. All rights reserved.
All-trans retinoic acid regulates hepatic bile acid homeostasis
Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne
2014-01-01
Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738
By-products of electrochemical synthesis of suberic acid
DOE Office of Scientific and Technical Information (OSTI.GOV)
Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.
By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.
Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A
2007-11-01
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.
Fatty acid synthesis in Escherichia coli
Knivett, V. A.; Cullen, Julia
1967-01-01
1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364
Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R
2014-07-01
The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.
Zhao, Ben; Li, Yafei; Li, Changling; Yang, Hailin; Wang, Wu
2018-03-01
Schizochytrium sp. accumulates valuable polyunsaturated fatty acid (PUFA), such as docosahexaenoic acid (DHA). In order to increase DHA synthesis in this microorganism, physical or chemical mutagenesis aided with powerful screening methods are still preferable, as its DHA synthetic pathway has not yet been clearly defined for gene manipulation. To breed this agglomerate microorganism of thick cell wall and rather large genome for increasing lipid content and DHA percentage, a novel strategy of atmospheric and room temperature plasma (ARTP) mutagenesis coupled with stepped malonic acid (MA) and zeocin resistance screening was developed. The final resulted mutant strain mz-17 was selected with 1.8-fold increased DHA production. Accompanied with supplementation of Fe 2+ in shake flask cultivation, DHA production of 14.0 g/L on average was achieved. This work suggests that ARTP mutation combined with stepped MA and zeocin resistance screening is an efficient method of breeding Schizochytrium sp. of high DHA production, and might be applied on other microorganisms for obtaining higher desired PUFA products.
Targeting arachidonic acid pathway by natural products for cancer prevention and therapy.
Yarla, Nagendra Sastry; Bishayee, Anupam; Sethi, Gautam; Reddanna, Pallu; Kalle, Arunasree M; Dhananjaya, Bhadrapura Lakkappa; Dowluru, Kaladhar S V G K; Chintala, Ramakrishna; Duddukuri, Govinda Rao
2016-10-01
Arachidonic acid (AA) pathway, a metabolic process, plays a key role in carcinogenesis. Hence, AA pathway metabolic enzymes phospholipase A 2 s (PLA 2 s), cyclooxygenases (COXs) and lipoxygenases (LOXs) and their metabolic products, such as prostaglandins and leukotrienes, have been considered novel preventive and therapeutic targets in cancer. Bioactive natural products are a good source for development of novel cancer preventive and therapeutic drugs, which have been widely used in clinical practice due to their safety profiles. AA pathway inhibitory natural products have been developed as chemopreventive and therapeutic agents against several cancers. Curcumin, resveratrol, apigenin, anthocyans, berberine, ellagic acid, eugenol, fisetin, ursolic acid, [6]-gingerol, guggulsteone, lycopene and genistein are well known cancer chemopreventive agents which act by targeting multiple pathways, including COX-2. Nordihydroguaiaretic acid and baicalein can be chemopreventive molecules against various cancers by inhibiting LOXs. Several PLA 2 s inhibitory natural products have been identified with chemopreventive and therapeutic potentials against various cancers. In this review, we critically discuss the possible utility of natural products as preventive and therapeutic agents against various oncologic diseases, including prostate, pancreatic, lung, skin, gastric, oral, blood, head and neck, colorectal, liver, cervical and breast cancers, by targeting AA pathway. Further, the current status of clinical studies evaluating AA pathway inhibitory natural products in cancer is reviewed. In addition, various emerging issues, including bioavailability, toxicity and explorability of combination therapy, for the development of AA pathway inhibitory natural products as chemopreventive and therapeutic agents against human malignancy are also discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.
Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.
Dacquin, J P; Lee, A F; Pirez, C; Wilson, K
2012-01-07
Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012
Synthesis of acid-soluble spore proteins by Bacillus subtilis.
Leventhal, J M; Chambliss, G H
1982-12-01
The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.
NASA Astrophysics Data System (ADS)
Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele
2017-07-01
The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.
Bile Acid Signaling Pathways from the Enterohepatic Circulation to the Central Nervous System
Mertens, Kim L.; Kalsbeek, Andries; Soeters, Maarten R.; Eggink, Hannah M.
2017-01-01
Bile acids are best known as detergents involved in the digestion of lipids. In addition, new data in the last decade have shown that bile acids also function as gut hormones capable of influencing metabolic processes via receptors such as FXR (farnesoid X receptor) and TGR5 (Takeda G protein-coupled receptor 5). These effects of bile acids are not restricted to the gastrointestinal tract, but can affect different tissues throughout the organism. It is still unclear whether these effects also involve signaling of bile acids to the central nervous system (CNS). Bile acid signaling to the CNS encompasses both direct and indirect pathways. Bile acids can act directly in the brain via central FXR and TGR5 signaling. In addition, there are two indirect pathways that involve intermediate agents released upon interaction with bile acids receptors in the gut. Activation of intestinal FXR and TGR5 receptors can result in the release of fibroblast growth factor 19 (FGF19) and glucagon-like peptide 1 (GLP-1), both capable of signaling to the CNS. We conclude that when plasma bile acids levels are high all three pathways may contribute in signal transmission to the CNS. However, under normal physiological circumstances, the indirect pathway involving GLP-1 may evoke the most substantial effect in the brain. PMID:29163019
NASA Astrophysics Data System (ADS)
Islam, Saidul; Bučar, Dejan-Krešimir; Powner, Matthew W.
2017-06-01
A central problem for the prebiotic synthesis of biological amino acids and nucleotides is to avoid the concomitant synthesis of undesired or irrelevant by-products. Additionally, multistep pathways require mechanisms that enable the sequential addition of reactants and purification of intermediates that are consistent with reasonable geochemical scenarios. Here, we show that 2-aminothiazole reacts selectively with two- and three-carbon sugars (glycolaldehyde and glyceraldehyde, respectively), which results in their accumulation and purification as stable crystalline aminals. This permits ribonucleotide synthesis, even from complex sugar mixtures. Remarkably, aminal formation also overcomes the thermodynamically favoured isomerization of glyceraldehyde into dihydroxyacetone because only the aminal of glyceraldehyde separates from the equilibrating mixture. Finally, we show that aminal formation provides a novel pathway to amino acids that avoids the synthesis of the non-proteinogenic α,α-disubstituted analogues. The common physicochemical mechanism that controls the proteinogenic amino acid and ribonucleotide assembly from prebiotic mixtures suggests that these essential classes of metabolite had a unified chemical origin.
WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN
Browse, John
2016-01-01
Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047
Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A
2008-10-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.
Guo, Long; Liang, Ziqi; Zheng, Chen; Liu, Baolong; Yin, Qingyan; Cao, Yangchun; Yao, Junhu
2018-05-23
Dietary nutrient utilization, particularly starch, is potentially limited by digestion in dairy cow small intestine because of shortage of α-amylase. Leucine acts as an effective signal molecular in the mTOR signaling pathway, which regulates a series of biological processes, especially protein synthesis. It has been reported that leucine could affect α-amylase synthesis and secretion in ruminant pancreas, but mechanisms have not been elaborated. In this study, pancreatic acinar (PA) cells were used as a model to determine the cellular signal of leucine influence on α-amylase synthesis. PA cells were isolated from newborn Holstein dairy bull calves and cultured in Dulbecco's modifed Eagle's medium/nutrient mixture F12 liquid media containing four leucine treatments (0, 0.23, 0.45, and 0.90 mM, respectively), following α-amylase activity, zymogen granule, and signal pathway factor expression detection. Rapamycin, a specific inhibitor of mTOR, was also applied to PA cells. Results showed that leucine increased ( p < 0.05) synthesis of α-amylase as well as phosphorylation of PI3K, Akt, mTOR, and S6K1 while reduced ( p < 0.05) GCN2 expression. Inhibition of mTOR signaling downregulated the α-amylase synthesis. In addition, the extracellular leucine dosage significantly influenced intracellular metabolism of isoleucine ( p < 0.05). Overall, leucine regulates α-amylase synthesis through promoting the PI3K/Akt-mTOR pathway and reducing the GCN2 pathway in PA cells of dairy calves. These pathways form the signaling network that controls the protein synthesis and metabolism. It would be of great interest in future studies to explore the function of leucine in ruminant nutrition.
In response to 'Can sugars be produced from fatty acids? A test case for pathway analysis tools'.
Faust, Karoline; Croes, Didier; van Helden, Jacques
2009-12-01
In their article entitled 'Can sugars be produced from fatty acids? A test case for pathway analysis tools' de Figueiredo and co-authors assess the performance of three pathway prediction tools (METATOOL, PathFinding and Pathway Hunter Tool) using the synthesis of glucose-6-phosphate (G6P) from acetyl-CoA in humans as a test case. We think that this article is biased for three reasons: (i) the metabolic networks used as input for the respective tools were of very different sizes; (ii) the 'assessment' is restricted to two study cases; (iii) developers are inherently more skilled to use their own tools than those developed by other people. We extended the analyses led by de Figueiredo and clearly show that the apparent superior performance of their tool (METATOOL) is partly due to the differences in input network sizes. We also see a conceptual problem in the comparison of tools that serve different purposes. In our opinion, metabolic path finding and elementary mode analysis are answering different biological questions, and should be considered as complementary rather than competitive approaches. Supplementary data are available at Bioinformatics online.
Anaerobic biosynthesis of unsaturated fatty acids in the cyanobacterium, Oscillatoria limnetica
NASA Technical Reports Server (NTRS)
Jahnke, L. L.; Lee, B.; Sweeney, M. J.; Klein, H. P.
1989-01-01
The mechanism for synthesis of monounsaturated fatty acids under aerobic and anaerobic conditions was studied in the facultative anaerobic cyanobacterium, Oscillatoria limnetica. The hexadecenoic acid (C16:1) of aerobically grown O. limnetica was shown to contain both the delta 7 (79%) and delta 9 (21%) isomers, while the octadecenoic (C18:1) acid was entirely the delta 9 acid. Incorporation of [2-14C] acetate into the fatty acids under aerobic conditions resulted in synthesis of the delta 7 and delta 9 C16:1 and the delta 9 C18:1. Synthesis of unsaturated fatty acids in the presence of DCMU required sulfide. Anaerobic incubations in the presence of DCMU and sulfide (less than 0.003% atmospheric oxygen) resulted in a two-fold increase in monounsaturated fatty acids of both delta 7 and delta 9 C16:1 and delta 9 and delta 11 C18:1. The synthesis of these is characteristic of a bacterial-type, anaerobic pathway.
2014-01-01
Background Branched-chain amino acids, especially leucine, are known to interact with insulin signaling pathway and glucose metabolism. However, the mechanism by which this is exerted, remain to be clearly defined. In order to examine the effect of leucine on muscle insulin signaling, a set of experiments was carried out to quantitate phosphorylation events along the insulin signaling pathway in human skeletal muscle cell cultures. Cells were exposed to insulin, leucine or both, and phosphorylation events of key insulin signaling molecules were tracked over time so as to monitor time-related responses that characterize the signaling events and could be missed by a single sampling strategy limited to pre/post stimulus events. Results Leucine is shown to increase the magnitude of insulin-dependent phosphorylation of protein kinase B (AKT) at Ser473 and glycogen synthase kinase (GSK3β) at Ser21-9. Glycogen synthesis follows the same pattern of GSK3β, with a significant increase at 100 μM leucine plus insulin stimulus. Moreover, data do not show any statistically significant increase of pGSK3β and glycogen synthesis at higher leucine concentrations. Leucine is also shown to increase the magnitude of insulin-mediated extracellularly regulated kinase (ERK) phosphorylation; however, differently from AKT and GSK3β, ERK shows a transient behavior, with an early peak response, followed by a return to the baseline condition. Conclusions These experiments demonstrate a complementary effect of leucine on insulin signaling in a human skeletal muscle cell culture, promoting insulin-activated GSK3β phosphorylation and glycogen synthesis. PMID:24646332
Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.
Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M
2012-03-27
In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society
Synthesis of new Cα-tetrasubstituted α-amino acids
Grauer, Andreas A
2009-01-01
Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341
ERIC Educational Resources Information Center
Barrelle, M.; And Others
1983-01-01
Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)
Bacterial fatty acid metabolism in modern antibiotic discovery.
Yao, Jiangwei; Rock, Charles O
2017-11-01
Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.
Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water
NASA Technical Reports Server (NTRS)
Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.
2017-01-01
Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing
Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam
2015-01-01
Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623
Scalschi, Loredana; Vicedo, Begonya; Camañes, Gemma; Fernandez-Crespo, Emma; Lapeña, Leonor; González-Bosch, Carmen; García-Agustín, Pilar
2013-05-01
Hexanoic acid-induced resistance (Hx-IR) is effective against several pathogens in tomato plants. Our study of the mechanisms implicated in Hx-IR against Pseudomonas syringae pv. tomato DC3000 suggests that hexanoic acid (Hx) treatment counteracts the negative effect of coronatine (COR) and jasmonyl-isoleucine (JA-Ile) on the salicylic acid (SA) pathway. In Hx-treated plants, an increase in the expression of jasmonic acid carboxyl methyltransferase (JMT) and the SA marker genes PR1 and PR5 indicates a boost in this signalling pathway at the expense of a decrease in JA-Ile. Moreover, Hx treatment potentiates 12-oxo-phytodienoic acid accumulation, which suggests that this molecule might play a role per se in Hx-IR. These results support a positive relationship between the SA and JA pathways in Hx-primed plants. Furthermore, one of the mechanisms of virulence mediated by COR is stomatal re-opening on infection with P. syringae. In this work, we observed that Hx seems to inhibit stomatal opening in planta in the presence of COR, which suggests that, on infection in tomato, this treatment suppresses effector action to prevent bacterial entry into the mesophyll. © 2012 BSPP AND BLACKWELL PUBLISHING LTD.
Synthesis of novel acid electrolytes for phosphoric acid fuel cells
NASA Astrophysics Data System (ADS)
Adcock, James L.
1988-11-01
A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.
l-Tartaric acid synthesis from vitamin C in higher plants
DeBolt, Seth; Cook, Douglas R.; Ford, Christopher M.
2006-01-01
The biosynthetic pathway of l-tartaric acid, the form most commonly encountered in nature, and its catabolic ties to vitamin C, remain a challenge to plant scientists. Vitamin C and l-tartaric acid are plant-derived metabolites with intrinsic human value. In contrast to most fruits during development, grapes accumulate l-tartaric acid, which remains within the berry throughout ripening. Berry taste and the organoleptic properties and aging potential of wines are intimately linked to levels of l-tartaric acid present in the fruit, and those added during vinification. Elucidation of the reactions relating l-tartaric acid to vitamin C catabolism in the Vitaceae showed that they proceed via the oxidation of l-idonic acid, the proposed rate-limiting step in the pathway. Here we report the use of transcript and metabolite profiling to identify candidate cDNAs from genes expressed at developmental times and in tissues appropriate for l-tartaric acid biosynthesis in grape berries. Enzymological analyses of one candidate confirmed its activity in the proposed rate-limiting step of the direct pathway from vitamin C to tartaric acid in higher plants. Surveying organic acid content in Vitis and related genera, we have identified a non-tartrate-forming species in which this gene is deleted. This species accumulates in excess of three times the levels of vitamin C than comparably ripe berries of tartrate-accumulating species, suggesting that modulation of tartaric acid biosynthesis may provide a rational basis for the production of grapes rich in vitamin C. PMID:16567629
Anderson, Donald D; Woeller, Collynn F; Chiang, En-Pei; Shane, Barry; Stover, Patrick J
2012-03-02
The de novo thymidylate biosynthetic pathway in mammalian cells translocates to the nucleus for DNA replication and repair and consists of the enzymes serine hydroxymethyltransferase 1 and 2α (SHMT1 and SHMT2α), thymidylate synthase, and dihydrofolate reductase. In this study, we demonstrate that this pathway forms a multienzyme complex that is associated with the nuclear lamina. SHMT1 or SHMT2α is required for co-localization of dihydrofolate reductase, SHMT, and thymidylate synthase to the nuclear lamina, indicating that SHMT serves as scaffold protein that is essential for complex formation. The metabolic complex is enriched at sites of DNA replication initiation and associated with proliferating cell nuclear antigen and other components of the DNA replication machinery. These data provide a mechanism for previous studies demonstrating that SHMT expression is rate-limiting for de novo thymidylate synthesis and indicate that de novo thymidylate biosynthesis occurs at replication forks.
Differential effects of long-term leucine infusion on tissue protein synthesis in neonatal pigs
USDA-ARS?s Scientific Manuscript database
Leucine is unique among the amino acids in its ability to promote protein synthesis by activating translation initiation via the mammalian target of rapamycin (mTOR) pathway. Previously, we showed that leucine infusion acutely stimulates protein synthesis in fast-twitch glycolytic muscle of neonatal...
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492
Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan
2018-01-01
It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.
Aldehyde dehydrogenase 1a1 mediates a GABA synthesis pathway in midbrain dopaminergic neurons.
Kim, Jae-Ick; Ganesan, Subhashree; Luo, Sarah X; Wu, Yu-Wei; Park, Esther; Huang, Eric J; Chen, Lu; Ding, Jun B
2015-10-02
Midbrain dopamine neurons are an essential component of the basal ganglia circuitry, playing key roles in the control of fine movement and reward. Recently, it has been demonstrated that γ-aminobutyric acid (GABA), the chief inhibitory neurotransmitter, is co-released by dopamine neurons. Here, we show that GABA co-release in dopamine neurons does not use the conventional GABA-synthesizing enzymes, glutamate decarboxylases GAD65 and GAD67. Our experiments reveal an evolutionarily conserved GABA synthesis pathway mediated by aldehyde dehydrogenase 1a1 (ALDH1a1). Moreover, GABA co-release is modulated by ethanol (EtOH) at concentrations seen in blood alcohol after binge drinking, and diminished ALDH1a1 leads to enhanced alcohol consumption and preference. These findings provide insights into the functional role of GABA co-release in midbrain dopamine neurons, which may be essential for reward-based behavior and addiction. Copyright © 2015, American Association for the Advancement of Science.
Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik
2016-01-01
Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1–0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. PMID:26969746
Synthesis and antituberculosis activity of new fatty acid amides.
D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes
2010-09-01
This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.
Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.
Evans, R M; Scholz, R W
1977-04-01
Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.
Synthesis of the sulfur amino acids: cysteine and methionine.
Wirtz, Markus; Droux, Michel
2005-12-01
This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.
Yao, Jiangwei; Dodson, V. Joshua; Frank, Matthew W.; Rock, Charles O.
2015-01-01
The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634
Wang, Huicong; Ma, Fangfang; Cheng, Lailiang
2010-07-01
Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.
Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.
Hansen, Alexandar L; Behrman, Edward J
2016-08-05
We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.
Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.
Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos
2016-08-29
α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.
Evolution of Abscisic Acid Synthesis and Signaling Mechanisms
Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.
2011-01-01
The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957
Jones, J A; Blecher, M
1966-05-01
The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.
The kynurenine pathway in schizophrenia and bipolar disorder.
Erhardt, Sophie; Schwieler, Lilly; Imbeault, Sophie; Engberg, Göran
2017-01-01
The kynurenine pathway of tryptophan degradation generates several neuroactive compounds. Of those, kynurenic acid is an N-methyl-d-aspartate (NMDA) and alpha7 nicotinic receptor antagonist. The kynurenic acid hypothesis of schizophrenia is built upon the fact that kynurenic acid blocks glutamate receptors and is elevated in schizophrenia. Kynurenic acid tightly controls glutamatergic and dopaminergic neurotransmission and elevated brain levels appear related to psychotic symptoms and cognitive impairments. Contributing to enhanced production of kynurenic acid, the expression and enzyme activity of kynurenine 3-monooxygenase (KMO) are reduced in schizophrenia and in bipolar patients with a history of psychosis. The kynurenine pathway is also critically regulated by cytokines, and, indeed, the pro-inflammatory cytokines interleukin (IL)-1β and IL-6 are elevated in schizophrenia and bipolar disorder and stimulate the production of kynurenic acid. One physiological mechanism controlling the activity of the kynurenine pathway originates from the protein sorting nexin 7 (SNX7). This glial signaling pathway initiates a caspase-8-driven activation of IL-1β that induces tryptophan-2,3-dioxygenase 2 (TDO2), an enzyme in the kynurenine pathway. A recent study shows that a genetic variation resulting in decreased expression of SNX7 is linked to increased central levels of kynurenic acid and ultimately to psychosis and cognitive dysfunction in bipolar disorder. Experimental studies highlight the detrimental effects of increased synthesis of kynurenic acid during sensitive periods of early brain development. Furthermore, experimental studies strongly support inhibition of kynurenine aminotransferase (KAT) II as a novel target and a valuable pharmacological strategy in the treatment of psychosis and for improving cognitive performance relevant for schizophrenia. This article is part of the Special Issue entitled 'The Kynurenine Pathway in Health and Disease'. Copyright
Cabezas-Cruz, Alejandro; Espinosa, Pedro J; Obregón, Dasiel A; Alberdi, Pilar; de la Fuente, José
2017-01-01
The obligate intracellular pathogen, Anaplasma phagocytophilum , is the causative agent of life-threatening diseases in humans and animals. A. phagocytophilum is an emerging tick-borne pathogen in the United States, Europe, Africa and Asia, with increasing numbers of infected people and animals every year. It is increasingly recognized that intracellular pathogens modify host cell metabolic pathways to increase infection and transmission in both vertebrate and invertebrate hosts. Recent reports have shown that amino acids are central to the host-pathogen metabolic interaction. In this study, a genome-wide search for components of amino acid metabolic pathways was performed in Ixodes scapularis , the main tick vector of A. phagocytophilum in the United States, for which the genome was recently published. The enzymes involved in the synthesis and degradation pathways of the twenty amino acids were identified. Then, the available transcriptomics and proteomics data was used to characterize the mRNA and protein levels of I. scapularis amino acid metabolic pathway components in response to A. phagocytophilum infection of tick tissues and ISE6 tick cells. Our analysis was focused on the interplay between carbohydrate and amino acid metabolism during A. phagocytophilum infection in ISE6 cells. The results showed that tick cells increase the synthesis of phosphoenolpyruvate (PEP) from tyrosine to control A. phagocytophilum infection. Metabolic pathway analysis suggested that this is achieved by (i) increasing the transcript and protein levels of mitochondrial phosphoenolpyruvate carboxykinase (PEPCK-M), (ii) shunting tyrosine into the tricarboxylic acid (TCA) cycle to increase fumarate and oxaloacetate which will be converted into PEP by PEPCK-M, and (iii) blocking all the pathways that use PEP downstream gluconeogenesis (i.e., de novo serine synthesis pathway (SSP), glyceroneogenesis and gluconeogenesis). While sequestering host PEP may be critical for this bacterium
Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.
Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko
2016-09-01
Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.
Dhamankar, Himanshu; Prather, Kristala L J
2011-08-01
The dwindling nature of petroleum and other fossil reserves has provided impetus towards microbial synthesis of fuels and value added chemicals from biomass-derived sugars as a renewable resource. Microbes have naturally evolved enzymes and pathways that can convert biomass into hundreds of unique chemical structures, a property that can be effectively exploited for their engineering into Microbial Chemical Factories (MCFs). De novo pathway engineering facilitates expansion of the repertoire of microbially synthesized compounds beyond natural products. In this review, we visit some recent successes in such novel pathway engineering and optimization, with particular emphasis on the selection and engineering of pathway enzymes and balancing of their accessory cofactors. Copyright © 2011 Elsevier Ltd. All rights reserved.
α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions
NASA Astrophysics Data System (ADS)
Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.
1980-09-01
Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.
Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.
2008-01-01
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537
Wang, Min; Wang, Qiong; Gao, Xiang; Su, Zhong
2017-06-27
Lipoic acid is a cofactor for α-keto acid dehydrogenase system that is involved in the central energy metabolism. In the apicomplexan parasite, Plasmodium, lipoic acid protein ligase 1 (LplA1) and LplA2 catalyse the ligation of acquired lipoic acid to the dehydrogenase complexes in the mitochondrion. The enzymes LipB and LipA mediate lipoic acid synthesis and ligation to the enzymes in the apicoplast. These enzymes in the lipoic acid metabolism machinery have been shown to play important roles in the biology of Plasmodium parasites, but the relationship between the enzymes is not fully elucidated. We used an anhydrotetracycline (ATc)-inducible transcription system to generate transgenic P. berghei parasites in which the lplA1 gene was conditionally knocked out (LplA1-cKO). Phenotypic changes and the lplA1 and lplA2 gene expression profiles of cloned LplA1-cKO parasites were analysed. LplA1-cKO parasites showed severely impaired growth in vivo in the first 8 days of infection, and retarded blood-stage development in vitro, in the absence of ATc. However, these parasites resumed viability in the late stage of infection and mounted high levels of parasitemia leading to the death of the hosts. Although lplA1 mRNA expression was regulated tightly by ATc during the whole course of infection, lplA2 mRNA expression was significantly increased in the late stage of infection only in the LplA1-cKO parasites that were not exposed to ATc. The lplA2 gene can be activated as an alternative pathway to compensate for the loss of LplA1 activity and to maintain lipoic acid metabolism.
Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.
Galardon, Erwan; Lec, Jean-Chrstophe
2018-05-20
A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.
Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D
1980-06-01
The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.
Markowski, Michał; Długosz, Marek; Szakiel, Anna; Durli, Mathieu; Poinsignon, Sophie; Bouguet-Bonnet, Sabine; Vernex-Loset, Lionel; Krier, Gabriel; Henry, Max
2018-04-18
Native plant of marigold (Calendula officinalis L.) synthesizes oleanolic acid saponins classified as glucosides or glucuronides according to the first residue in sugar chain bound to C-3 hydroxyl group. Hairy root culture, obtained by transformation with Agrobacterium rhizogenes strain 15834, exhibit a potent ability of synthesis of oleanolic acid glycosides. The HPLC profile of saponin fraction obtained from C. officinalis hairy roots treated with plant stress hormone, jasmonic acid, showed the 10-times increase of the content of one particular compound, determined by NMR and MALDI TOF as a new bisdesmoside saponin, 3-O-β-d-glucuronopyranosyl-28-O-β-d-galactopyranosyl-oleanolic acid. Such a diglycoside does not occur in native C. officinalis plant. It is a glucuronide, whereas in the native plant glucuronides are mainly accumulated in flowers, while glucosides are the most abundant saponins in roots. Thus, our results revealed that the pathways of saponin biosynthesis, particularly reactions of glycosylation, are altered in C. officinalis hairy root culture.
The aromatic amino acids biosynthetic pathway: A core platform for products
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lievense, J.C.; Frost, J.W.
The aromatic amino acids biosynthetic pathway is viewed conventionally and primarily as the source of the amino acids L-tyrosine, L-phenylalanine. The authors have recognized the expanded role of the pathway as the major source of aromatic raw materials on earth. With the development of metabolic engineering approaches, it is now possible to biosynthesize a wide variety of aromatic compounds from inexpensive, clean, abundant, renewable sugars using fermentation methods. Examples of already and soon-to-be commercialized biosynthesis of such compounds are described. The long-term prospects are also assessed.
Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P
1990-02-01
During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.
Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways.
Mur, Luis A J; Prats, Elena; Pierre, Sandra; Hall, Michael A; Hebelstrup, Kim H
2013-01-01
Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used.
Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways
Mur, Luis A. J.; Prats, Elena; Pierre, Sandra; Hall, Michael A.; Hebelstrup, Kim H.
2013-01-01
Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used. PMID:23818890
Grant, Ross; Nguyen, Susan; Guillemin, Gilles
2010-01-01
Efficient synthesis of NAD+ is critical to maintaining cell viability in all organs of the body. However, little is known of the pathway(s) by which cells of the central nervous system produce NAD+. The aim of this study was to investigate the relationship, between tryptophan degradation via the kynurenine pathway (KP) and de novo NAD+ synthesis in human astrocytes, a major cell type within the brain. In this study we observed that inhibition of single enzymes of the KP resulted in significant decreases in NAD+ levels in astroglial cells after a 24 hr period. We also observed that astrocytes cultured in media deficient in tryptophan, nicotinic acid and nicotinamide resulted in a 50% decrease in NAD+ levels after 24 hrs. This decrease in NAD+ was partially restored by supplementation of the culture media with either tryptophan or kynurenine, or nicotinic acid or with supply of the salvage pathway precursor nicotinamide. PMID:22084595
Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen
2012-01-01
During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451
Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes
2010-01-01
Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should
Roles of Fe-S proteins: from cofactor synthesis to iron homeostasis to protein synthesis.
Pain, Debkumar; Dancis, Andrew
2016-06-01
Fe-S cluster assembly is an essential process for all cells. Impairment of Fe-S cluster assembly creates diseases in diverse and surprising ways. In one scenario, the loss of function of lipoic acid synthase, an enzyme with Fe-S cluster cofactor in mitochondria, impairs activity of various lipoamide-dependent enzymes with drastic consequences for metabolism. In a second scenario, the heme biosynthetic pathway in red cell precursors is specifically targeted, and iron homeostasis is perturbed, but lipoic acid synthesis is unaffected. In a third scenario, tRNA modifications arising from action of the cysteine desulfurase and/or Fe-S cluster proteins are lost, which may lead to impaired protein synthesis. These defects can then result in cancer, neurologic dysfunction or type 2 diabetes. Copyright © 2016 Elsevier Ltd. All rights reserved.
Wu, Junjun; Yu, Oliver; Du, Guocheng
2014-01-01
Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5′-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. PMID:25239896
Wu, Junjun; Yu, Oliver; Du, Guocheng; Zhou, Jingwen; Chen, Jian
2014-12-01
Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5'-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. Copyright © 2014, American Society for Microbiology. All Rights Reserved.
Ahlers, Laura R H; Goodman, Alan G
2016-09-01
Innate immunity refers to the body's initial response to curb infection upon exposure to invading organisms. While the detection of pathogen-associated molecules is an ancient form of host defense, if dysfunctional, autoimmune disease may result. The innate immune response during pathogenic infection is initiated through the activation of receptors recognizing conserved molecular patterns, such as nucleic acids from a virus' genome or replicative cycle. Additionally, the host's own nucleic acids are capable of activating an immune response. Therefore, it follows that the nucleic acid-sensing pathways must be tightly controlled to avoid an autoimmune response from recognition of self, yet still be unimpeded to respond to viral infections. In this review, we will describe the nucleic acid sensing pathways and how they respond to virus infection. Moreover, we will discuss autoimmune diseases that develop when these pathways fail to signal properly and identify knowledge gaps that are prime for interrogation.
[Study on Precursors for Synthesis of Anthraquinone Metabolites from Rheum tanguticum].
Hasi, Qi-mei-ge; Lj, Hai-ling; Cheng, Yan; Menggen, Qi-qi-ge; Zhang, Yang
2015-01-01
To explore the potential precursors of the anthraquinone metabolites from Rheum tanguticum and preliminanly identify the synthesis pathway thereof. Sterile seedlings sprouted from the seeds of Rheum tanguticum were chosen as materials for inducing callus. The effects of different precursors and feeding duration on the callus of Rheum tanguticum and the anthraquinone yield in adult rheum were studied. The greatest improvement of anthraquinone yield was achieved by acetic acid, increasing 43. 9% for the callus and 45. 8% in the adult rheum; the second greatest improvement was achieved by malonic acid, increasing 15. 8% for the callus and only 3. 6% in the adult rheum. The yield of anthraquinone was not influenced significantly by benzoic acid and p-benzoquinone, and in contrast, was inhibited in some degree by shikimic acid and α-ketoglutaric acid. A suitable feeding duration was 36 h, which worked well for the effects of precursors. The precursor for synthesis of anthraquinone metabolites from Rheum tan- guticum is acetic acid, which improves the yields of callus and anthraquinone in adult rheum, concluding that the anthraquinone metabolites are synthesized via polyketone pathway.
Wang, Dan; Wan, Xuebin; Peng, Jian; Xiong, Qi; Niu, Hongdan; Li, Huanan; Chai, Jin; Jiang, Siwen
2017-04-01
Amino acid transporter plays an important role in regulating mTOR signaling pathway. This study investigated the effects of reduced dietary protein levels on amino acid transporters and mTOR signaling pathway. A total of 54 weaning pigs were randomly allocated into a 3 × 3 factorial design, followed by slaughtering the pigs separately after 10-, 25- and 45-day feeding, with 18 pigs from each feeding period divided into three subgroups for treatment with three different protein-level diets: 20% crude protein (CP) diet (normal recommended, high protein, HP), 17% CP diet (medium protein, MP) and 14% CP diet (low protein, LP). The results indicated that reduced dietary protein level decreased the weight of longissimus dorsi. Additionally, quantitative PCR chip analysis showed that mRNA expression of amino acid transporters SLC38A2, SLC1A7, SLC7A1, SLC7A5, SLC16A10 and SLC3A2 in the LP group were significantly (P < 0.05) higher than those in the MP or HP group, and the phosphorylation of mTOR and S6K1 decreased in the LP group after 25-day feeding. Furthermore, the vitro experimental results further confirmed that the mRNA levels for SLC7A1, SLC7A5, SLC3A2, SLC38A2 and SLC36A1 were increased and the phosphorylation of mTOR and S6K1 was decreased when the concentration of amino acids in C2C12 myoblasts was reduced. All these results indicated that the LP diet induced a high expression of amino acid transporters and the inhibition of the mTOR activity, which resulting in restriction on protein synthesis and longissimus dorsi growth. Copyright © 2017 Elsevier Inc. All rights reserved.
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.
2017-01-01
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357
Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.
Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A
2017-04-14
mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.
Synthesis and characterization of bis-thiourea having amino acid derivatives
NASA Astrophysics Data System (ADS)
Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah
2016-11-01
In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.
Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël
2009-11-07
The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.
Hossain, Md Sharoare; Afrose, Sadia; Sawada, Tomio; Hamano, Koh-Ichi; Tsujii, Hirotada
2010-03-01
For understanding the roles of fatty acids on the induction of acrosome reaction which occurs under association of cholesterol efflux and PKA or PKC pathways in boar spermatozoa, metabolic fate of alone and combined radiolabeled 14 C-oleic acid and 3 H-linoleic acid incorporated in the sperm was compared, and behavior of cholesterol and effects of PKA and PKC inhibitors upon fatty acid-induced acrosome reaction were examined. Semen was collected from a Duroc boar, and the metabolic activities of fatty acids in the spermatozoa were measured using radioactive compounds and thin layer chromatography. Cholesterol efflux was measured with a cholesterol determination assay kit. Participation of fatty acids on the AR through PKA and PKC pathways was evaluated using a specific inhibitor of these enzymes. Incorporation rate of 14 C-oleic acid into the sperm lipids was significantly higher than that of 3 H-linoleic acid ( P < 0.05). The oxidation of 14 C-oleic acid was higher in combined radiolabeling rather than in one. The highest amounts of 3 H-linoleic acid and 14 C-oleic acid were recovered mainly in the triglycerides and phospholipids fraction, and 14 C-oleic acid distribution was higher than the 3 H-linoleic acid in both labeled ( P < 0.05) sperm lipids. In the 3 H-linoleic and 14 C-oleic acid combined radiolabeling, the incorporation rate of the radioactive fatty acids in all the lipid fractions increased 15 times more than the alone radiolabeling. Boar sperm utilize oleic acid to generate energy for hyperactivation ( P < 0.05). Supplementation of arachidonic acid significantly increased ( P < 0.05) cholesterol efflux in sperm. When spermatozoa were incubated with PKA or PKC inhibitors, there was a significant reduction of arachidonic acid-induced acrosome reaction (AR) ( P < 0.05), and inhibition by PKA inhibitor is stronger than that by PKC inhibitor. Incorporation of unsaturated fatty acids, especially oleic acid, into triglycerides and phospholipids provides
USDA-ARS?s Scientific Manuscript database
The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...
Revealing the Bacterial Butyrate Synthesis Pathways by Analyzing (Meta)genomic Data
Vital, Marius; Howe, Adina Chuang
2014-01-01
ABSTRACT Butyrate-producing bacteria have recently gained attention, since they are important for a healthy colon and when altered contribute to emerging diseases, such as ulcerative colitis and type II diabetes. This guild is polyphyletic and cannot be accurately detected by 16S rRNA gene sequencing. Consequently, approaches targeting the terminal genes of the main butyrate-producing pathway have been developed. However, since additional pathways exist and alternative, newly recognized enzymes catalyzing the terminal reaction have been described, previous investigations are often incomplete. We undertook a broad analysis of butyrate-producing pathways and individual genes by screening 3,184 sequenced bacterial genomes from the Integrated Microbial Genome database. Genomes of 225 bacteria with a potential to produce butyrate were identified, including many previously unknown candidates. The majority of candidates belong to distinct families within the Firmicutes, but members of nine other phyla, especially from Actinobacteria, Bacteroidetes, Fusobacteria, Proteobacteria, Spirochaetes, and Thermotogae, were also identified as potential butyrate producers. The established gene catalogue (3,055 entries) was used to screen for butyrate synthesis pathways in 15 metagenomes derived from stool samples of healthy individuals provided by the HMP (Human Microbiome Project) consortium. A high percentage of total genomes exhibited a butyrate-producing pathway (mean, 19.1%; range, 3.2% to 39.4%), where the acetyl-coenzyme A (CoA) pathway was the most prevalent (mean, 79.7% of all pathways), followed by the lysine pathway (mean, 11.2%). Diversity analysis for the acetyl-CoA pathway showed that the same few firmicute groups associated with several Lachnospiraceae and Ruminococcaceae were dominating in most individuals, whereas the other pathways were associated primarily with Bacteroidetes. PMID:24757212
Chemoselective synthesis of sialic acid 1,7-lactones.
Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario
2010-08-20
The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.
Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua
2017-06-15
N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E
2017-08-21
Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Moscovitz, Jamie E.; Kong, Bo; Buckley, Kyle
The farnesoid X receptor (Fxr) controls bile acid homeostasis by coordinately regulating the expression of synthesizing enzymes (Cyp7a1, Cyp8b1), conjugating enzymes (Bal, Baat) and transporters in the ileum (Asbt, Ostα/β) and liver (Ntcp, Bsep, Ostβ). Transcriptional regulation by Fxr can be direct, or through the ileal Fgf15/FGF19 and hepatic Shp pathways. Circulating bile acids are increased during pregnancy due to hormone-mediated disruption of Fxr signaling. While this adaptation enhances lipid absorption, elevated bile acids may predispose women to develop maternal cholestasis. The objective of this study was to determine whether short-term treatment of pregnant mice with GW4064 (a potent FXRmore » agonist) restores Fxr signaling to the level observed in virgin mice. Plasma, liver and ilea were collected from virgin and pregnant mice administered vehicle or GW4064 by oral gavage. Treatment of pregnant mice with GW4064 induced ileal Fgf15, Shp and Ostα/β mRNAs, and restored hepatic Shp, Bal, Ntcp, and Bsep back to vehicle-treated virgin levels. Pregnant mice exhibited 2.5-fold increase in Cyp7a1 mRNA compared to virgin controls, which was reduced by GW4064. Similarly treatment of mouse primary hepatocytes with plasma isolated from pregnant mice induced Cyp7a1 mRNA by nearly 3-fold as compared to virgin plasma, which could be attenuated by co-treatment with either GW4064 or recombinant FGF19 protein. Collectively, these data reveal that repressed activity of intestinal and hepatic Fxr in pregnancy, as previously demonstrated, may be restored by pharmacological activation. This study provides the basis for a novel approach to restore bile acid homeostasis in patients with maternal cholestasis. - Highlights: • Ileal bile acid pathways are altered in pregnancy in an Fxr-dependent manner. • Ileal Fxr/Fgf contributes to changes in hepatic bile acid synthesis and transport. • Treatment of pregnant mice with an Fxr agonist restores bile acid homeostasis.« less
Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia.
Brose, Stephen A; Golovko, Svetlana A; Golovko, Mikhail Y
2016-01-01
Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA) biosynthesis followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FA synthesis maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FA synthesis inhibition on [Formula: see text]/NAD + and [Formula: see text]/NADP + ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FA synthesis inhibitors, TOFA (inhibits Acetyl-CoA carboxylase) and cerulenin (inhibits FA synthase), increased [Formula: see text]/NAD + and [Formula: see text]/NADP + ratios under hypoxia. Further, FA synthesis inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke.
Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia
Brose, Stephen A.; Golovko, Svetlana A.; Golovko, Mikhail Y.
2016-01-01
Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA) biosynthesis followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FA synthesis maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FA synthesis inhibition on NADH2+/NAD+ and NADPH2+/NADP+ ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FA synthesis inhibitors, TOFA (inhibits Acetyl-CoA carboxylase) and cerulenin (inhibits FA synthase), increased NADH2+/NAD+ and NADPH2+/NADP+ ratios under hypoxia. Further, FA synthesis inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke. PMID:27965531
Synthesis of Triamino Acid Building Blocks with Different Lipophilicities
Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger
2015-01-01
To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040
Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment
NASA Technical Reports Server (NTRS)
Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.
2011-01-01
Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.
Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian
2015-01-01
SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902
Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik
2016-04-01
Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1-0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.
Overlapping the Tryptophan Catabolite (TRYCAT) and Melatoninergic Pathways in Alzheimer's Disease.
Maes, Michael; Anderson, George
2016-01-01
Activation of the trptophan catabolite (TRYCAT) pathways by oxidative and nitrosative stress and proinflammatory cytokine-driven indoleamine 2,3-dioxygenase (IDO) and tryptophan 2,3-dioxygenase (TDO) leads to the synthesis of a number of neuroregulatory TRYCATs, such as kynurenic acid and quinolinic acid. Such TRYCATs have significant impacts on neuronal functioning and survival contributing to the changes seen in Alzheimer's disease (AD), including in its association with depression as well as alterations in the reactivity of immune and glia cells. By decreasing the availability of tryptophan for serotonin synthesis, such IDO and TDO-driven TRYCATs, also decrease the availability of serotonin for N-acetylserotonin (NAS) and melatonin synthesis. The loss of NAS and melatonin has significant consequences for the etiology, course and treatment of AD, including via interactions with altered TRYCATs, but also by changing the levels of trophic support and modulating the patterning of immune activity. In this review, we look at how such interactions of the TRYCAT and melatoninergic pathways link a plethora of previously diffuse data in AD as well as the treatment implications and future research directions that such data would suggest.
Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara
2015-01-01
This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.
NASA Astrophysics Data System (ADS)
Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng
2014-03-01
MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.
Ma, Wenjie; Wu, Jason H Y; Wang, Qianyi; Lemaitre, Rozenn N; Mukamal, Kenneth J; Djoussé, Luc; King, Irena B; Song, Xiaoling; Biggs, Mary L; Delaney, Joseph A; Kizer, Jorge R; Siscovick, David S; Mozaffarian, Dariush
2015-01-01
Experimental evidence suggests that hepatic de novo lipogenesis (DNL) affects insulin homeostasis via synthesis of saturated fatty acids (SFAs) and monounsaturated fatty acids (MUFAs). Few prospective studies have used fatty acid biomarkers to assess associations with type 2 diabetes. We investigated associations of major circulating SFAs [palmitic acid (16:0) and stearic acid (18:0)] and MUFA [oleic acid (18:1n-9)] in the DNL pathway with metabolic risk factors and incident diabetes in community-based older U.S. adults in the Cardiovascular Health Study. We secondarily assessed other DNL fatty acid biomarkers [myristic acid (14:0), palmitoleic acid (16:1n-7), 7-hexadecenoic acid (16:1n-9), and vaccenic acid (18:1n-7)] and estimated dietary SFAs and MUFAs. In 3004 participants free of diabetes, plasma phospholipid fatty acids were measured in 1992, and incident diabetes was identified by medication use and blood glucose. Usual diets were assessed by using repeated food-frequency questionnaires. Multivariable linear and Cox regression were used to assess associations with metabolic risk factors and incident diabetes, respectively. At baseline, circulating palmitic acid and stearic acid were positively associated with adiposity, triglycerides, inflammation biomarkers, and insulin resistance (P-trend < 0.01 each), whereas oleic acid showed generally beneficial associations (P-trend < 0.001 each). During 30,763 person-years, 297 incident diabetes cases occurred. With adjustment for demographics and lifestyle, palmitic acid (extreme-quintile HR: 1.89; 95% CI: 1.27, 2.83; P-trend = 0.001) and stearic acid (HR: 1.62; 95% CI: 1.09, 2.41; P-trend = 0.006) were associated with higher diabetes risk, whereas oleic acid was not significantly associated. In secondary analyses, vaccenic acid was inversely associated with diabetes (HR: 0.56; 95% CI: 0.38, 0.83; P-trend = 0.005). Other fatty acid biomarkers and estimated dietary SFAs or MUFAs were not significantly associated with
Wang, Liping; Kazachkov, Michael; Shen, Wenyun; Bai, Mei; Wu, Hong; Zou, Jitao
2014-12-01
Phosphatidylcholine (PC) is a key intermediate in the metabolic network of glycerolipid biosynthesis. Lysophosphatidylcholine acyltransferase (LPCAT) and phosphatidic acid phosphatase (PAH) are two key enzymes of PC homeostasis. We report that LPCAT activity is markedly induced in the Arabidopsis pah mutant. The quadruple pah lpcat mutant, with dual defects in PAH and LPCAT, had a level of lysophosphatidylcholine (LPC) that was much higher than that in the lpcat mutants and a PC content that was higher than that in the pah mutant. Comparative molecular profile analysis of monogalactosyldiacylglycerol and digalactosyldiacylglycerol revealed that both the pah and pah lpcat mutants had increased proportions of 34:6 from the prokaryotic pathway despite differing levels of LPCAT activity. We show that a decreased representation of the C16:0 C18:2 diacylglycerol moiety in PC was a shared feature of pah and pah lpcat, and that this change in PC metabolic profile correlated with the increased prokaryotic contribution to chloroplast lipid synthesis. We detected increased PC deacylation in the pah lpcat mutant that was attributable at least in part to the induced phospholipases. Increased LPC generation was also evident in the pah mutant, but the phospholipases were not induced, raising the possibility that PC deacylation is mediated by the reverse reaction of LPCAT. We discuss possible roles of LPCAT and PAH in PC turnover that impacts lipid pathway coordination for chloroplast lipid synthesis. © 2014 National Research Council Canada. The Plant Journal © 2014 Society For Experimental Biology and John Wiley & Sons.
Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S
Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats
2014-01-01
Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631
USDA-ARS?s Scientific Manuscript database
Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...
Probabilistic pathway construction.
Yousofshahi, Mona; Lee, Kyongbum; Hassoun, Soha
2011-07-01
Expression of novel synthesis pathways in host organisms amenable to genetic manipulations has emerged as an attractive metabolic engineering strategy to overproduce natural products, biofuels, biopolymers and other commercially useful metabolites. We present a pathway construction algorithm for identifying viable synthesis pathways compatible with balanced cell growth. Rather than exhaustive exploration, we investigate probabilistic selection of reactions to construct the pathways. Three different selection schemes are investigated for the selection of reactions: high metabolite connectivity, low connectivity and uniformly random. For all case studies, which involved a diverse set of target metabolites, the uniformly random selection scheme resulted in the highest average maximum yield. When compared to an exhaustive search enumerating all possible reaction routes, our probabilistic algorithm returned nearly identical distributions of yields, while requiring far less computing time (minutes vs. years). The pathways identified by our algorithm have previously been confirmed in the literature as viable, high-yield synthesis routes. Prospectively, our algorithm could facilitate the design of novel, non-native synthesis routes by efficiently exploring the diversity of biochemical transformations in nature. Copyright © 2011 Elsevier Inc. All rights reserved.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.
1989-04-01
We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less
Synthesis of Rosin Acid Starch Catalyzed by Lipase
Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin
2014-01-01
Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156
Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis
Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki
2017-01-01
Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321
Synthesis and properties of fatty acid starch esters.
Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik
2013-10-15
Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Pujol, François M.; Brooks, Carrie F.; van Dooren, Giel G.; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.; McConville, Malcolm J.; Striepen, Boris
2012-01-01
Apicomplexan parasites are responsible for high impact human diseases such as malaria, toxoplasmosis, and cryptosporidiosis. These obligate intracellular pathogens are dependent on both de novo lipid biosynthesis as well as the uptake of host lipids for biogenesis of parasite membranes. Genome annotations and biochemical studies indicate that apicomplexan parasites can synthesize fatty acids via a number of different biosynthetic pathways that are differentially compartmentalized. However, the relative contribution of each of these biosynthetic pathways to total fatty acid composition of intracellular parasite stages remains poorly defined. Here, we use a combination of genetic, biochemical, and metabolomic approaches to delineate the contribution of fatty acid biosynthetic pathways in Toxoplasma gondii. Metabolic labeling studies with [13C]glucose showed that intracellular tachyzoites synthesized a range of long and very long chain fatty acids (C14:0–26:1). Genetic disruption of the apicoplast-localized type II fatty-acid synthase resulted in greatly reduced synthesis of saturated fatty acids up to 18 carbons long. Ablation of type II fatty-acid synthase activity resulted in reduced intracellular growth that was partially restored by addition of long chain fatty acids. In contrast, synthesis of very long chain fatty acids was primarily dependent on a fatty acid elongation system comprising three elongases, two reductases, and a dehydratase that were localized to the endoplasmic reticulum. The function of these enzymes was confirmed by heterologous expression in yeast. This elongase pathway appears to have a unique role in generating very long unsaturated fatty acids (C26:1) that cannot be salvaged from the host. PMID:22179608
Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker
2012-01-01
Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398
Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis.
Bai, Xupeng; Hong, Weipeng; Cai, Peiheng; Chen, Yibei; Xu, Chuncao; Cao, Di; Yu, Weibang; Zhao, Zhongxiang; Huang, Min; Jin, Jing
2017-06-01
Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36), an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) - extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.
Guanine- Formation During the Thermal Polymerization of Amino Acids
NASA Technical Reports Server (NTRS)
Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.
1964-01-01
The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.
Cario, Anaïs; Lormières, Florence; Xiang, Xiao; Oger, Philippe
2015-11-01
We have established a defined growth medium for the piezophilic hyperthermophilic archaeon Thermococcus barophilus, which allows growth yields of ca. 10(8) cells/ml under both atmospheric and high hydrostatic pressure. Our results demonstrate a major impact of hydrostatic pressure on amino acid metabolism, with increases from 3 amino acids required at atmospheric pressure to 17 at 40 MPa. We observe in T. barophilus and other Thermococcales a similar discrepancy between the presence/absence of amino acid synthesis pathways and amino acid requirements, which supports the existence of alternate, but yet unknown, amino acid synthesis pathways, and may explain the low number of essential amino acids observed in T. barophilus and other Thermococcales. T. barophilus displays a strong metabolic preference for organic polymers such as polypeptides and chitin, which may constitute a more readily available resource of carbon and energy in situ in deep-sea hydrothermal vents. We hypothesize that the low energy yields of fermentation of organic polymers, together with energetic constraints imposed by high hydrostatic pressure, may render de novo synthesis of amino acids ecologically unfavorable. Induction of this metabolic switch to amino acid recycling can explain the requirement for non-essential amino acids by Thermococcales for efficient growth in defined medium. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.
The metabolic burden of creatine synthesis.
Brosnan, John T; da Silva, Robin P; Brosnan, Margaret E
2011-05-01
Creatine synthesis is required in adult animals to replace creatine that is spontaneously converted to creatinine and excreted in the urine. Additionally, in growing animals it is necessary to provide creatine to the expanding tissue mass. Creatine synthesis requires three amino acids: glycine, methionine and arginine, and three enzymes: L-arginine:glycine amidinotransferase (AGAT), methionine adenosyltransferase (MAT) and guanidinoacetate methyltransferase (GAMT). The entire glycine molecule is consumed in creatine synthesis but only the methyl and amidino groups, respectively, from methionine and arginine. Creatinine loss averages approximately 2 g (14.6 mmol) for 70 kg males in the 20- to 39-year age group. Creatinine loss is lower in females and in older age groups because of lower muscle mass. Approximately half of this creatine lost to creatinine can be replaced, in omnivorous individuals, by dietary creatine. However, since dietary creatine is only provided in animal products, principally in meat and fish, virtually all of the creatine loss in vegetarians must be replaced via endogenous synthesis. Creatine synthesis does not appear to place a major burden on glycine metabolism in adults since this amino acid is readily synthesized. However, creatine synthesis does account for approximately 40% of all of the labile methyl groups provided by S-adenosylmethionine (SAM) and, as such, places an appreciable burden on the provision of such methyl groups, either from the diet or via de novo methylneogenesis. Creatine synthesis consumes some 20-30% of arginine's amidino groups, whether provided in the diet or synthesized within the body. Creatine synthesis is, therefore, a quantitatively major pathway in amino acid metabolism and imposes an appreciable burden on the metabolism of methionine and of arginine.
Oleic acid-enhanced transdermal delivery pathways of fluorescent nanoparticles
NASA Astrophysics Data System (ADS)
Lo, Wen; Ghazaryan, Ara; Tso, Chien-Hsin; Hu, Po-Sheng; Chen, Wei-Liang; Kuo, Tsung-Rong; Lin, Sung-Jan; Chen, Shean-Jen; Chen, Chia-Chun; Dong, Chen-Yuan
2012-05-01
Transdermal delivery of nanocarriers provides an alternative pathway to transport therapeutic agents, alleviating pain, improving compliance of patients, and increasing overall effectiveness of delivery. In this work, enhancement of transdermal delivery of fluorescent nanoparticles and sulforhodamine B with assistance of oleic acid was visualized utilizing multiphoton microscopy (MPM) and analyzed quantitatively using multi-photon excitation-induced fluorescent signals. Results of MPM imaging and MPM intensity-based spatial depth-dependent analysis showed that oleic acid is effective in facilitating transdermal delivery of nanoparticles.
Liu, Mengjin; Bienfait, Bruno; Sacher, Oliver; Gasteiger, Johann; Siezen, Roland J; Nauta, Arjen; Geurts, Jan M W
2014-01-01
The incompleteness of genome-scale metabolic models is a major bottleneck for systems biology approaches, which are based on large numbers of metabolites as identified and quantified by metabolomics. Many of the revealed secondary metabolites and/or their derivatives, such as flavor compounds, are non-essential in metabolism, and many of their synthesis pathways are unknown. In this study, we describe a novel approach, Reverse Pathway Engineering (RPE), which combines chemoinformatics and bioinformatics analyses, to predict the "missing links" between compounds of interest and their possible metabolic precursors by providing plausible chemical and/or enzymatic reactions. We demonstrate the added-value of the approach by using flavor-forming pathways in lactic acid bacteria (LAB) as an example. Established metabolic routes leading to the formation of flavor compounds from leucine were successfully replicated. Novel reactions involved in flavor formation, i.e. the conversion of alpha-hydroxy-isocaproate to 3-methylbutanoic acid and the synthesis of dimethyl sulfide, as well as the involved enzymes were successfully predicted. These new insights into the flavor-formation mechanisms in LAB can have a significant impact on improving the control of aroma formation in fermented food products. Since the input reaction databases and compounds are highly flexible, the RPE approach can be easily extended to a broad spectrum of applications, amongst others health/disease biomarker discovery as well as synthetic biology.
Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat
2016-05-01
Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway. Copyright © 2016 Elsevier B.V. All rights reserved.
Willrodt, Christian; Halan, Babu; Karthaus, Lisa; Rehdorf, Jessica; Julsing, Mattijs K; Buehler, Katja; Schmid, Andreas
2017-02-01
The efficiency of biocatalytic reactions involving industrially interesting reactants is often constrained by toxification of the applied biocatalyst. Here, we evaluated the combination of biologically and technologically inspired strategies to overcome toxicity-related issues during the multistep oxyfunctionalization of (R)-(+)-limonene to (R)-(+)-perillic acid. Pseudomonas putida GS1 catalyzing selective limonene oxidation via the p-cymene degradation pathway and recombinant Pseudomonas taiwanensis VLB120 were evaluated for continuous perillic acid production. A tubular segmented-flow biofilm reactor was used in order to relieve oxygen limitations and to enable membrane mediated substrate supply as well as efficient in situ product removal. Both P. putida GS1 and P. taiwanensis VLB120 developed a catalytic biofilm in this system. The productivity of wild-type P. putida GS1 encoding the enzymes for limonene bioconversion was highly dependent on the carbon source and reached 34 g L tube -1 day -1 when glycerol was supplied. More than 10-fold lower productivities were reached irrespective of the applied carbon source when the recombinant P. taiwanensis VLB120 harboring p-cymene monooxygenase and p-cumic alcohol dehydrogenase was used as biocatalyst. The technical applicability for preparative perillic acid synthesis in the applied system was verified by purification of perillic acid from the outlet stream using an anion exchanger resin. This concept enabled the multistep production of perillic acid and which might be transferred to other reactions involving volatile reactants and toxic end-products. Biotechnol. Bioeng. 2017;114: 281-290. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.
Prebiotic synthesis of phosphoenol pyruvate by α-phosphorylation-controlled triose glycolysis
NASA Astrophysics Data System (ADS)
Coggins, Adam J.; Powner, Matthew W.
2017-04-01
Phosphoenol pyruvate is the highest-energy phosphate found in living organisms and is one of the most versatile molecules in metabolism. Consequently, it is an essential intermediate in a wide variety of biochemical pathways, including carbon fixation, the shikimate pathway, substrate-level phosphorylation, gluconeogenesis and glycolysis. Triose glycolysis (generation of ATP from glyceraldehyde 3-phosphate via phosphoenol pyruvate) is among the most central and highly conserved pathways in metabolism. Here, we demonstrate the efficient and robust synthesis of phosphoenol pyruvate from prebiotic nucleotide precursors, glycolaldehyde and glyceraldehyde. Furthermore, phosphoenol pyruvate is derived within an α-phosphorylation controlled reaction network that gives access to glyceric acid 2-phosphate, glyceric acid 3-phosphate, phosphoserine and pyruvate. Our results demonstrate that the key components of a core metabolic pathway central to energy transduction and amino acid, sugar, nucleotide and lipid biosyntheses can be reconstituted in high yield under mild, prebiotically plausible conditions.
Feng, Jun; Quan, Yufen; Gu, Yanyan; Liu, Fenghong; Huang, Xiaozhong; Shen, Haosheng; Dang, Yulei; Cao, Mingfeng; Gao, Weixia; Lu, Xiaoyun; Wang, Yi; Song, Cunjiang; Wang, Shufang
2017-05-22
Poly-γ-glutamic acid (γ-PGA) is a valuable polymer with glutamate as its sole precursor. Enhancement of the intracellular glutamate synthesis is a very important strategy for the improvement of γ-PGA production, especially for those glutamate-independent γ-PGA producing strains. Corynebacterium glutamicum has long been used for industrial glutamate production and it exhibits some unique features for glutamate synthesis; therefore introduction of these metabolic characters into the γ-PGA producing strain might lead to increased intracellular glutamate availability, and thus ultimate γ-PGA production. In this study, the unique glutamate synthesis features from C. glutamicum was introduced into the glutamate-independent γ-PGA producing Bacillus amyloliquefaciens NK-1 strain. After introducing the energy-saving NADPH-dependent glutamate dehydrogenase (NADPH-GDH) pathway, the NK-1 (pHT315-gdh) strain showed slightly increase (by 9.1%) in γ-PGA production. Moreover, an optimized metabolic toggle switch for controlling the expression of ɑ-oxoglutarate dehydrogenase complex (ODHC) was introduced into the NK-1 strain, because it was previously shown that the ODHC in C. glutamicum was completely inhibited when glutamate was actively produced. The obtained NK-PO1 (pHT01-xylR) strain showed 66.2% higher γ-PGA production than the NK-1 strain. However, the further combination of these two strategies (introducing both NADPH-GDH pathway and the metabolic toggle switch) did not lead to further increase of γ-PGA production but rather the resultant γ-PGA production was even lower than that in the NK-1 strain. We proposed new metabolic engineering strategies to improve the γ-PGA production in B. amyloliquefaciens. The NK-1 (pHT315-gdh) strain with the introduction of NADPH-GDH pathway showed 9.1% improvement in γ-PGA production. The NK-PO1 (pHT01-xylR) strain with the introduction of a metabolic toggle switch for controlling the expression of ODHC showed 66.2% higher
Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid-derived hydrocarbons.
Zhang, Yiming; Nielsen, Jens; Liu, Zihe
2018-06-05
Fatty acid-derived hydrocarbons attract increasing attention as biofuels due to their immiscibility with water, high-energy content, low freezing point, and high compatibility with existing refineries and end-user infrastructures. Yeast Saccharomyces cerevisiae has advantages for production of fatty acid-derived hydrocarbons as its native routes toward fatty acid synthesis involve only a few reactions that allow more efficient conversion of carbon substrates. Here we describe major biosynthetic pathways of fatty acid-derived hydrocarbons in yeast, and summarize key metabolic engineering strategies, including enhancing precursor supply, eliminating competing pathways, and expressing heterologous pathways. With recent advances in yeast production of fatty acid-derived hydrocarbons, our review identifies key research challenges and opportunities for future optimization, and concludes with perspectives and outlooks for further research directions. © 2018 Wiley Periodicals, Inc.
Lee, Ho-Joo; Choi, Mun Hwan; Kim, Tae-Un; Yoon, Sung Chul
2001-01-01
-bromooctanoic acid was determined to be 60 μM, assuming a single-site binding of the inhibitor at a specific inhibition site. Thus, it seems likely that a coenzyme A thioester derivative of 2-bromooctanoic acid specifically inhibits an enzyme linking the two pathways, fatty acid de novo synthesis and PHA synthesis. We suggest that 2-bromooctanoic acid can substitute for the far more expensive (2,000 times) and cell-growth-inhibiting PHA synthesis inhibitor, cerulenin. PMID:11679314
Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli
Luzzati, Denise
1966-01-01
Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402
Zhang, Shiqi; Liu, Guowen; Xu, Chuang; Liu, Lei; Zhang, Qiang; Xu, Qiushi; Jia, Hongdou; Li, Xiaobing; Li, Xinwei
2018-01-01
Dairy cows with ketosis displayed lipid metabolic disorder and high inflammatory levels. Adipose tissue is an active lipid metabolism and endocrine tissue and is closely related to lipid metabolism homeostasis and inflammation. Perilipin 1 (PLIN1), an adipocyte-specific lipid-coated protein, may be involved in the above physiological function. The aim of this study is to investigate the role of PLIN1 in lipid metabolism regulation and inflammatory factor synthesis in cow adipocytes. The results showed that PLIN1 overexpression upregulated the expression of fatty acid and triglyceride (TAG) synthesis molecule sterol regulator element-binding protein-1c (SREBP-1c) and its target genes, diacylglycerol acyltransferase (DGAT) 1, and DGAT2, but inhibited the expression of lipolysis enzymes hormone-sensitive lipase (HSL) and CGI-58 for adipose triglyceride lipase (ATGL), thus augmenting the fatty acids and TAG synthesis and inhibiting lipolysis. Importantly, PLIN1 overexpression inhibited the activation of the NF-κB inflammatory pathway and decreased the expression and content of tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), and interleukin 6 (IL-6) induced by lipopolysaccharide. Conversely, PLIN1 silencing inhibited TAG synthesis, promoted lipolysis, and overinduced the activation of the NF-κB inflammatory pathway in cow adipocytes. In ketotic cows, the expression of PLIN1 was markedly decreased, whereas lipid mobilization, NF-κB pathway, and downstream inflammatory cytokines were overinduced in adipose tissue. Taken together, these results indicate that PLIN1 can maintain lipid metabolism homeostasis and inhibit the NF-κB inflammatory pathway in adipocytes. However, low levels of PLIN1 reduced the inhibitory effect on fat mobilization, NF-κB pathway, and inflammatory cytokine synthesis in ketotic cows. PMID:29593725
Zhang, Shiqi; Liu, Guowen; Xu, Chuang; Liu, Lei; Zhang, Qiang; Xu, Qiushi; Jia, Hongdou; Li, Xiaobing; Li, Xinwei
2018-01-01
Dairy cows with ketosis displayed lipid metabolic disorder and high inflammatory levels. Adipose tissue is an active lipid metabolism and endocrine tissue and is closely related to lipid metabolism homeostasis and inflammation. Perilipin 1 (PLIN1), an adipocyte-specific lipid-coated protein, may be involved in the above physiological function. The aim of this study is to investigate the role of PLIN1 in lipid metabolism regulation and inflammatory factor synthesis in cow adipocytes. The results showed that PLIN1 overexpression upregulated the expression of fatty acid and triglyceride (TAG) synthesis molecule sterol regulator element-binding protein-1c (SREBP-1c) and its target genes, diacylglycerol acyltransferase (DGAT) 1, and DGAT2, but inhibited the expression of lipolysis enzymes hormone-sensitive lipase (HSL) and CGI-58 for adipose triglyceride lipase (ATGL), thus augmenting the fatty acids and TAG synthesis and inhibiting lipolysis. Importantly, PLIN1 overexpression inhibited the activation of the NF-κB inflammatory pathway and decreased the expression and content of tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), and interleukin 6 (IL-6) induced by lipopolysaccharide. Conversely, PLIN1 silencing inhibited TAG synthesis, promoted lipolysis, and overinduced the activation of the NF-κB inflammatory pathway in cow adipocytes. In ketotic cows, the expression of PLIN1 was markedly decreased, whereas lipid mobilization, NF-κB pathway, and downstream inflammatory cytokines were overinduced in adipose tissue. Taken together, these results indicate that PLIN1 can maintain lipid metabolism homeostasis and inhibit the NF-κB inflammatory pathway in adipocytes. However, low levels of PLIN1 reduced the inhibitory effect on fat mobilization, NF-κB pathway, and inflammatory cytokine synthesis in ketotic cows.
A novel role of cytosolic protein synthesis inhibition in aminoglycoside ototoxicity
Francis, Shimon P.; Katz, Joshua; Fanning, Kathryn D.; Harris, Kimberly A.; Nicholas, Brian D.; Lacy, Michael; Pagana, James; Agris, Paul F.; Shin, Jung-Bum
2013-01-01
Ototoxicity is a main dose-limiting factor in the clinical application of aminoglycoside antibiotics. Despite longstanding research efforts, our understanding of the mechanisms underlying aminoglycoside ototoxicity remains limited. Here we report the discovery of a novel stress pathway that contributes to aminoglycoside-induced hair cell degeneration. Modifying the recently developed bioorthogonal noncanonical amino acid tagging (BONCAT) method, we used click-chemistry to study the role of protein synthesis activity in aminoglycoside-induced hair cell stress. We demonstrate that aminoglycosides inhibit protein synthesis in hair cells and activate a signaling pathway similar to ribotoxic stress response, contributing to hair cell degeneration. The ability of a particular aminoglycoside to inhibit protein synthesis and to activate the c-Jun N-terminal kinase (JNK) pathway correlated well with its ototoxic potential. Finally, we report that a FDA-approved drug known to inhibit ribotoxic stress response also prevents JNK activation and improves hair cell survival, opening up novel strategies to prevent and treat aminoglycoside ototoxicity. PMID:23407963
One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.
Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef
2018-04-01
Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.
Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway
2016-01-01
SUMMARY Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917
Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent
USDA-ARS?s Scientific Manuscript database
Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...
SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,
The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters
Kanoh, H.; Lindsay, D. B.
1972-01-01
1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795
Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.
Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra
2016-09-01
α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.
The role of uric acid in the pathogenesis of diabetic retinopathy based on notch pathway.
Zhu, Dan-Dan; Wang, Yun-Zhi; Zou, Chen; She, Xin-Ping; Zheng, Zhi
2018-06-19
Uric acid has been proposed as an independent risk factor of diabetic retinopathy. Although Notch signaling was reported to be affected in the presence of high concentrations of uric acid or glucose, the underlying mechanisms of hyperuricemia through the Notch signaling pathway to promote the development of diabetic retinopathy remain unknown. We incubated human retinal endothelial cells (HRECs) with high glucose, high uric acid and high glucose plus high glucose respectively and evaluated the apoptosis rate in different treated cells by Tunel staining. We induced diabetic model by intraperitoneally streptozotocin. Then healthy rats and diabetic rats were given with adenine and oteracil potassium by gavage. Using automatic biochemical analyzer to detect blood glucose, uric acid, urea nitrogen, creatinine levels, to verify the success of modeling. The expression and mRNA levels of ICAM-1, IL-6, MCP-1, TNF-a, receptors Notch 1, ligands Dll 1, Dll 4, Jagged 1, Jagged 2 were detected by RT-PCR and Western-Blot. Notch1 siRNA was used to interfere Notch signaling pathway, the expression and mRNA levels of ICAM-1, IL-6, MCP-1 and TNF-α was detected by RT-PCR and Western blot respectively. In vitro models, the apoptosis of HRECs cells in high uric acid plus high glucose group was the most significant. In vitro and vivo models, detection of inflammatory cytokines revealed that the expression of inflammatory cytokines increased most significantly in high uric acid plus high glucose group. Notch signaling pathway activity was also increased most significantly in high uric acid plus high glucose group. After Notch 1 siRNA transfection in high glucose and high glucose plus uric acid group, the activity of Notch signaling pathway was successfully down-regulated. We found that the apoptosis of HRECs was significantly decreased in cells transfected with Notch 1 siRNA compared to the blank vector group, and the expression of inflammatory cytokines in cells was also significantly
Higgins, Michael L.; Daneo-Moore, Lolita
1972-01-01
The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926
Sharma, Parveen K; Fu, Jilagamazhi; Spicer, Victor; Krokhin, Oleg V; Cicek, Nazim; Sparling, Richard; Levin, David B
2016-12-01
Synthesis of poly-[3-hydroxybutyrate] (PHB) by Cupriavidus necator H16 in batch cultures was evaluated using three biodiesel-derived by-products as the sole carbon sources: waste glycerol (REG-80, refined to 80 % purity with negligible free fatty acids); glycerol bottom (REG-GB, with up to 65 % glycerol and 35 % free fatty acids), and free fatty acids (REG-FFA, with up to 75 % FFA and no glycerol). All the three substrates supported growth and PHB production by C. necator, with polymer accumulation ranging from 9 to 84 % cell dry weight (cdw), depending on the carbon source. To help understand these differences, proteomic analysis indicated that although C. necator H16 was able to accumulate PHB during growth on all three biodiesel by-products, no changes in the levels of PHB synthesis enzymes were observed. However, significant changes in the levels of expression were observed for two Phasin proteins involved with PHB accumulation, and for a number of gene products in the fatty acid β-oxidation pathway, the Glyoxylate Shunt, and the hydrogen (H2) synthesis pathways in C. necator cells cultured with different substrates. The glycerol transport protein (GlpF) was induced in REG-GB and REG-80 glycerol cultures only. Cupriavidus necator cells cultured with REG-GB and REG-FFA showed up-regulation of β-oxidation and Glyoxylate Shunt pathways proteins at 24 h pi, but H2 synthesis pathways enzymes were significantly down-regulated, compared with cells cultured with waste glycerol. Our data confirmed earlier observations of constitutive expression of PHB synthesis proteins, but further suggested that C. necator H16 cells growing on biodiesel-derived glycerol were under oxidative stress.
Cheng, Xuefang; Li, Qingran; Liu, Fang; Ye, Hui; Zhao, Min; Wang, Hong; Wang, Guangji; Hao, Haiping
2016-01-01
Tryptophan metabolism is essential in diverse kinds of tumors via regulating tumor immunology. However, the direct role of tryptophan metabolism and its signaling pathway in cancer cells remain largely elusive. Here, we establish a mechanistic link from L-type amino acid transporter 1 (LAT1) mediated transport of tryptophan and the subsequent de-novo NAD+ synthesis to SIRT1-FOXO1 regulated apoptotic signaling in A549 cells in response to NQO1 activation. In response to NQO1 activation, SIRT1 is repressed leading to the increased cellular accumulation of acetylated FOXO1 that transcriptionally activates apoptotic signaling. Decreased uptake of tryptophan due to the downregulation of LAT1 coordinates with PARP-1 hyperactivation to induce rapid depletion of NAD+ pool. Particularly, the LAT1-NAD+-SIRT1 signaling is activated in tumor tissues of patients with non-small cell lung cancer. Because NQO1 activation is characterized with oxidative challenge induced DNA damage, these results suggest that LAT1 and de-novo NAD+ synthesis in NSCLC cells may play essential roles in sensing excessive oxidative stress. PMID:27566573
Liu, Huiying; Xing, Rong; Cheng, Xuefang; Li, Qingran; Liu, Fang; Ye, Hui; Zhao, Min; Wang, Hong; Wang, Guangji; Hao, Haiping
2016-09-20
Tryptophan metabolism is essential in diverse kinds of tumors via regulating tumor immunology. However, the direct role of tryptophan metabolism and its signaling pathway in cancer cells remain largely elusive. Here, we establish a mechanistic link from L-type amino acid transporter 1 (LAT1) mediated transport of tryptophan and the subsequent de-novo NAD+ synthesis to SIRT1-FOXO1 regulated apoptotic signaling in A549 cells in response to NQO1 activation. In response to NQO1 activation, SIRT1 is repressed leading to the increased cellular accumulation of acetylated FOXO1 that transcriptionally activates apoptotic signaling. Decreased uptake of tryptophan due to the downregulation of LAT1 coordinates with PARP-1 hyperactivation to induce rapid depletion of NAD+ pool. Particularly, the LAT1-NAD+-SIRT1 signaling is activated in tumor tissues of patients with non-small cell lung cancer. Because NQO1 activation is characterized with oxidative challenge induced DNA damage, these results suggest that LAT1 and de-novo NAD+ synthesis in NSCLC cells may play essential roles in sensing excessive oxidative stress.
In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.
Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup
2017-05-18
Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.
Yao, Jiangwei; Bruhn, David F.; Frank, Matthew W.; Lee, Richard E.; Rock, Charles O.
2016-01-01
Neisseria is a Gram-negative pathogen with phospholipids composed of straight chain saturated and monounsaturated fatty acids, the ability to incorporate exogenous fatty acids, and lipopolysaccharides that are not essential. The FabI inhibitor, AFN-1252, was deployed as a chemical biology tool to determine whether Neisseria can bypass the inhibition of fatty acid synthesis by incorporating exogenous fatty acids. Neisseria encodes a functional FabI that was potently inhibited by AFN-1252. AFN-1252 caused a dose-dependent inhibition of fatty acid synthesis in growing Neisseria, a delayed inhibition of growth phenotype, and minimal inhibition of DNA, RNA, and protein synthesis, showing that its mode of action is through inhibiting fatty acid synthesis. Isotopic fatty acid labeling experiments showed that Neisseria encodes the ability to incorporate exogenous fatty acids into its phospholipids by an acyl-acyl carrier protein-dependent pathway. However, AFN-1252 remained an effective antibacterial when Neisseria were supplemented with exogenous fatty acids. These results demonstrate that extracellular fatty acids are activated by an acyl-acyl carrier protein synthetase (AasN) and validate type II fatty acid synthesis (FabI) as a therapeutic target against Neisseria. PMID:26567338
The return of metabolism: biochemistry and physiology of the pentose phosphate pathway
Stincone, Anna; Prigione, Alessandro; Cramer, Thorsten; Wamelink, Mirjam M. C.; Campbell, Kate; Cheung, Eric; Olin-Sandoval, Viridiana; Grüning, Nana-Maria; Krüger, Antje; Alam, Mohammad Tauqeer; Keller, Markus A.; Breitenbach, Michael; Brindle, Kevin M.; Rabinowitz, Joshua D.; Ralser, Markus
2015-01-01
The pentose phosphate pathway (PPP) is a fundamental component of cellular metabolism. The PPP is important to maintain carbon homoeostasis, to provide precursors for nucleotide and amino acid biosynthesis, to provide reducing molecules for anabolism, and to defeat oxidative stress. The PPP shares reactions with the Entner–Doudoroff pathway and Calvin cycle and divides into an oxidative and non-oxidative branch. The oxidative branch is highly active in most eukaryotes and converts glucose 6-phosphate into carbon dioxide, ribulose 5-phosphate and NADPH. The latter function is critical to maintain redox balance under stress situations, when cells proliferate rapidly, in ageing, and for the ‘Warburg effect’ of cancer cells. The non-oxidative branch instead is virtually ubiquitous, and metabolizes the glycolytic intermediates fructose 6-phosphate and glyceraldehyde 3-phosphate as well as sedoheptulose sugars, yielding ribose 5-phosphate for the synthesis of nucleic acids and sugar phosphate precursors for the synthesis of amino acids. Whereas the oxidative PPP is considered unidirectional, the non-oxidative branch can supply glycolysis with intermediates derived from ribose 5-phosphate and vice versa, depending on the biochemical demand. These functions require dynamic regulation of the PPP pathway that is achieved through hierarchical interactions between transcriptome, proteome and metabolome. Consequently, the biochemistry and regulation of this pathway, while still unresolved in many cases, are archetypal for the dynamics of the metabolic network of the cell. In this comprehensive article we review seminal work that led to the discovery and description of the pathway that date back now for 80 years, and address recent results about genetic and metabolic mechanisms that regulate its activity. These biochemical principles are discussed in the context of PPP deficiencies causing metabolic disease and the role of this pathway in biotechnology, bacterial and
Oxygen and the evolution of metabolic pathways
NASA Technical Reports Server (NTRS)
Jahnke, L. L.
1986-01-01
While a considerable amount of evidence has been accumulated about the history of oxygen on this planet, little is known about the relative amounts to which primitive cells might have been exposed. One clue may be found in the metabolic pathways of extant microorganisms. While eucaryotes are principally aerobic organisms, a number are capable of anaerobic growth by fermentation. One such eucaryotic microorganism, Saccharomyces cerevisiae, will grow in the complete absence of oxygen when supplemented with unsaturated fatty acid and sterol. Oxygen-requiring enzymes are involved in the synthesis of both of these compounds. Studies have demonstrated that the oxidative desaturation of palmitic acid and the conversion of squalene to sterols occur in the range of 10-(3) to 10(-2) PAL. Thus, if the oxygen requirements of these enzymatic processes are an indication, eucaryotes might be more primitive than anticipated from the microfossil record. Results of studies on the oxygen requirements for sterol and unsaturated fatty acid synthesis in a more primitive procaryotic system are also discussed.
Chen, Liwei; Lee, Jaslyn Jie Lin; Zhang, Jianhua; Chen, Wei Ning
2016-02-01
The engineered Saccharomyces cerevisiae strain △faa1△faa4 [Acot5s] was demonstrated to accumulate more free fatty acids (FFA) previously. Here, comparative proteomic analysis was performed to get a global overview of metabolic regulation in the strain. Over 500 proteins were identified, and 82 of those proteins were found to change significantly in the engineered strains. Proteins involved in glycolysis, acetate metabolism, fatty acid synthesis, TCA cycle, glyoxylate cycle, the pentose phosphate pathway, respiration, transportation, and stress response were found to be upregulated in △faa1△faa4 [Acot5s] as compared to the wild type. On the other hand, proteins involved in glycerol, ethanol, ergosterol, and cell wall synthesis were downregulated. Taken together with our metabolite analysis, our results showed that the disruption of Faa1 and Faa4 and expression of Acot5s in the engineered strain △faa1△faa4 [Acot5s] not only relieved the feedback inhibition of fatty acyl-CoAs on fatty acid synthesis, but also caused a major metabolic rearrangement. The rearrangement redirected carbon flux toward the pathways which generate the essential substrates and cofactors for fatty acid synthesis, such as acetyl-CoA, ATP, and NADPH. Therefore, our results help shed light on the mechanism for the increased production of fatty acids in the engineered strains, which is useful in providing information for future studies in biofuel production.
Ma, Jun; Yan, Ruilan; Zu, Xuyu; Cheng, Ji-Ming; Rao, Krishna; Liao, Duan-Fang; Cao, Deliang
2008-02-08
Recent studies have demonstrated that aldo-keto reductase family 1 B10 (AKR1B10), a novel protein overexpressed in human hepatocellular carcinoma and non-small cell lung carcinoma, may facilitate cancer cell growth by detoxifying intracellular reactive carbonyls. This study presents a novel function of AKR1B10 in tumorigenic mammary epithelial cells (RAO-3), regulating fatty acid synthesis. In RAO-3 cells, Sephacryl-S 300 gel filtration and DEAE-Sepharose ion exchange chromatography demonstrated that AKR1B10 exists in two distinct forms, monomers (approximately 40 kDa) bound to DEAE-Sepharose column and protein complexes (approximately 300 kDa) remaining in flow-through. Co-immunoprecipitation with AKR1B10 antibody and protein mass spectrometry analysis identified that AKR1B10 associates with acetyl-CoA carboxylase-alpha (ACCA), a rate-limiting enzyme of de novo fatty acid synthesis. This association between AKR1B10 and ACCA proteins was further confirmed by co-immunoprecipitation with ACCA antibody and pulldown assays with recombinant AKR1B10 protein. Intracellular fluorescent studies showed that AKR1B10 and ACCA proteins co-localize in the cytoplasm of RAO-3 cells. More interestingly, small interfering RNA-mediated AKR1B10 knock down increased ACCA degradation through ubiquitination-proteasome pathway and resulted in >50% decrease of fatty acid synthesis in RAO-3 cells. These data suggest that AKR1B10 is a novel regulator of the biosynthesis of fatty acid, an essential component of the cell membrane, in breast cancer cells.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Reich, I.L.; Reich, H.J.; Menahan, L.A.
1987-01-01
Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.
Sato, Naoki; Awai, Koichiro
2017-11-01
Lipid biosynthesis within the chloroplast, or more generally plastids, was conventionally called "prokaryotic pathway," which produces glycerolipids bearing C18 acids at the sn-1 position and C16 acids at the sn-2 position, as in cyanobacteria such as Anabaena and Synechocystis. This positional specificity is determined during the synthesis of phosphatidate, which is a precursor to diacylglycerol, the acceptor of galactose for the synthesis of galactolipids. The first acylation at sn-1 is catalyzed by glycerol-3-phosphate acyltransferase (GPAT or GPT), whereas the second acylation at sn-2 is performed by lysophosphatidate acyltransferase (LPAAT, AGPAT, or PlsC). Here we present comprehensive phylogenomic analysis of the origins of various acyltransferases involved in the synthesis of phosphatidate, as well as phosphatidate phosphatases in the chloroplasts. The results showed that the enzymes involved in the two steps of acylation in cyanobacteria and chloroplasts are entirely phylogenetically unrelated despite a previous report stating that the chloroplast LPAAT (ATS2) and cyanobacterial PlsC were sister groups. Phosphatidate phosphatases were separated into eukaryotic and prokaryotic clades, and the chloroplast enzymes were not of cyanobacterial origin, in contrast with another previous report. These results indicate that the lipid biosynthetic pathway in the chloroplasts or plastids did not originate from the cyanobacterial endosymbiont and is not "prokaryotic" in the context of endosymbiotic theory of plastid origin. This is another line of evidence for the discontinuity of plastids and cyanobacteria, which has been suggested in the glycolipid biosynthesis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Adverse Outcome Pathway (AOP) Network Development for ...
Adverse outcome pathways (AOPs) are descriptive biological sequences that start from a molecular initiating event (MIE) and end with an adverse health outcome. AOPs provide biological context for high throughput chemical testing and further prioritize environmental health risk research. According to the Organization for Economic Co-operation and Development guidelines, AOPs are pathways with one MIE anchored to an adverse outcome (AO) by key events (KEs) and key event relationships (KERs). However, this approach does not always capture the cumulative impacts of multiple MIEs on the AO. For example, hepatic lipid flux due to chemical-induced toxicity initiates from multiple ligand-activated receptors and signaling pathways that cascade across biology to converge upon a common fatty liver (FL, also known as steatosis) outcome. To capture this complexity, a top-down strategy was used to develop a FL AOP network (AOPnet). Literature was queried based on the terms steatosis, fatty liver, cirrhosis, and hepatocellular carcinoma. Search results were analyzed for physiological and pathophysiological organ level, cellular and molecular processes, as well as pathway intermediates, to identify potential KEs and MIEs that are key for hepatic lipid metabolism, maintenance, and dysregulation. The analysis identified four apical KE nodes (hepatic fatty acid uptake, de novo fatty acid and lipid synthesis, fatty acid oxidation, and lipid efflux) juxtaposed to the FL AO. The apic
Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.
Knipprath, W G; Stein, R A
1966-01-01
Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.
Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.
Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco
2002-07-01
We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.
Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J
2013-08-19
Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.
Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert
2017-11-30
Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.
A new family of extraterrestrial amino acids in the Murchison meteorite.
Koga, Toshiki; Naraoka, Hiroshi
2017-04-04
The occurrence of extraterrestrial organic compounds is a key for understanding prebiotic organic synthesis in the universe. In particular, amino acids have been studied in carbonaceous meteorites for almost 50 years. Here we report ten new amino acids identified in the Murchison meteorite, including a new family of nine hydroxy amino acids. The discovery of mostly C 3 and C 4 structural isomers of hydroxy amino acids provides insight into the mechanisms of extraterrestrial synthesis of organic compounds. A complementary experiment suggests that these compounds could be produced from aldehydes and ammonia on the meteorite parent body. This study indicates that the meteoritic amino acids could be synthesized by mechanisms in addition to the Strecker reaction, which has been proposed to be the main synthetic pathway to produce amino acids.
Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.
Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij
2016-08-01
The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).
Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.
Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D
1995-01-01
The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.
Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying
2016-04-15
Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. © 2015 UICC.
Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang
2015-09-01
Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.
Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid
NASA Technical Reports Server (NTRS)
Nakashima, T.; Fox, S. W.
1980-01-01
The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.
Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer
Bruntz, Ronald C.; Lindsley, Craig W.
2014-01-01
Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928
Jia, Xiaochen; Meng, Qingshan; Zeng, Haihong; Wang, Wenxia; Yin, Heng
2016-01-01
Chitosan is one of the most abundant carbohydrate biopolymers in the world, and chitosan oligosaccharide (COS), which is prepared from chitosan, is a plant immunity regulator. The present study aimed to validate the effect of COS on inducing resistance to tobacco mosaic virus (TMV) in Arabidopsis and to investigate the potential defence-related signalling pathways involved. Optimal conditions for the induction of TMV resistance in Arabidopsis were COS pretreatment at 50 mg/L for 1 day prior to inoculation with TMV. Multilevel indices, including phenotype data, and TMV coat protein expression, revealed that COS induced TMV resistance in wild-type and jasmonic acid pathway- deficient (jar1) Arabidopsis plants, but not in salicylic acid pathway deficient (NahG) Arabidopsis plants. Quantitative-PCR and analysis of phytohormone levels confirmed that COS pretreatment enhanced the expression of the defence-related gene PR1, which is a marker of salicylic acid signalling pathway, and increased the amount of salicylic acid in WT and jar1, but not in NahG plants. Taken together, these results confirm that COS induces TMV resistance in Arabidopsis via activation of the salicylic acid signalling pathway. PMID:27189192
Jia, Xiaochen; Meng, Qingshan; Zeng, Haihong; Wang, Wenxia; Yin, Heng
2016-05-18
Chitosan is one of the most abundant carbohydrate biopolymers in the world, and chitosan oligosaccharide (COS), which is prepared from chitosan, is a plant immunity regulator. The present study aimed to validate the effect of COS on inducing resistance to tobacco mosaic virus (TMV) in Arabidopsis and to investigate the potential defence-related signalling pathways involved. Optimal conditions for the induction of TMV resistance in Arabidopsis were COS pretreatment at 50 mg/L for 1 day prior to inoculation with TMV. Multilevel indices, including phenotype data, and TMV coat protein expression, revealed that COS induced TMV resistance in wild-type and jasmonic acid pathway- deficient (jar1) Arabidopsis plants, but not in salicylic acid pathway deficient (NahG) Arabidopsis plants. Quantitative-PCR and analysis of phytohormone levels confirmed that COS pretreatment enhanced the expression of the defence-related gene PR1, which is a marker of salicylic acid signalling pathway, and increased the amount of salicylic acid in WT and jar1, but not in NahG plants. Taken together, these results confirm that COS induces TMV resistance in Arabidopsis via activation of the salicylic acid signalling pathway.
Inhibitors targeting on cell wall biosynthesis pathway of MRSA.
Hao, Haihong; Cheng, Guyue; Dai, Menghong; Wu, Qinghua; Yuan, Zonghui
2012-11-01
Methicillin resistant Staphylococcus aureus (MRSA), widely known as a type of new superbug, has aroused world-wide concern. Cell wall biosynthesis pathway is an old but good target for the development of antibacterial agents. Peptidoglycan and wall teichoic acids (WTAs) biosynthesis are two main processes of the cell wall biosynthesis pathway (CWBP). Other than penicillin-binding proteins (PBPs), some key factors (Mur enzymes, lipid I or II precursor, etc.) in CWBP are becoming attractive molecule targets for the discovery of anti-MRSA compounds. A number of new compounds, with higher affinity for PBPs or with inhibitory activity on such molecule targets in CWBP of MRSA, have been in the pipeline recently. This review concludes recent research achievements and provides a complete picture of CWBP of MRSA, including the peptidoglycan and wall teichoic acids synthesis pathway. The potential inhibitors targeting on CWBP are subsequently presented to improve development of novel therapeutic strategies for MRSA.
Maciąg-Dorszyńska, Monika; Węgrzyn, Grzegorz; Guzow-Krzemińska, Beata
2014-04-01
Usnic acid, a compound produced by various lichen species, has been demonstrated previously to inhibit growth of different bacteria and fungi; however, mechanism of its antimicrobial activity remained unknown. In this report, we demonstrate that usnic acid causes rapid and strong inhibition of RNA and DNA synthesis in Gram-positive bacteria, represented by Bacillus subtilis and Staphylococcus aureus, while it does not inhibit production of macromolecules (DNA, RNA, and proteins) in Escherichia coli, which is resistant to even high doses of this compound. However, we also observed slight inhibition of RNA synthesis in a Gram-negative bacterium, Vibrio harveyi. Inhibition of protein synthesis in B. subtilis and S. aureus was delayed, which suggest indirect action (possibly through impairment of transcription) of usnic acid on translation. Interestingly, DNA synthesis was halted rapidly in B. subtilis and S. aureus, suggesting interference of usnic acid with elongation of DNA replication. We propose that inhibition of RNA synthesis may be a general mechanism of antibacterial action of usnic acid, with additional direct mechanisms, such as impairment of DNA replication in B. subtilis and S. aureus. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Lu, Naisheng; Li, Mengjiao; Lei, Hulong; Jiang, Xueyuan; Tu, Weilong; Lu, Yang; Xia, Dong
2017-09-01
Butyric acid (BA), one of the short chain fatty acids (SCFAs), has positive actions on the metabolism, inflammation, etc. However, whether it influences the reproductive physiology and if so the detail mechanism involved has not yet been determined. In this study, the porcine granulosa cells (PGCs) were treated with gradient concentrations of BA. After 24h culture, 0.05mM BA significantly stimulated the progesterone (P 4 ) secretion (P<0.05), 5mM and 10mM BA significantly inhibited the P 4 secretion (P<0.05). Simultaneously, BA up-regulated the estradiol (E 2 ) secretion in a dose dependent manner, 5mM and 10mM BA significantly promoted the E 2 level (P<0.05). In addition, 10mM BA significantly promoted the G-protein-coupled receptor 41/43 mRNA (P<0.05). Interestingly, 5mM BA treatment significantly down-regulated cyclic adenosine monophosphate (cAMP) content (P<0.05), steroidogenic acute regulatory (StAR), steroidogenic factor 1 (SF1), P450scc in the mRNA and/or protein level (P<0.05), and these actions were reversed by cAMP activator forskolin (FK). Moreover, the co-treatment of 5mM BA and bupivacaine (BPC, the cAMP inhibitor) significantly accumulated the inhibition action of BPC on cAMP, the secretion of P 4 , and the abundance of StAR mRNA (P<0.05), inhibited the up-regulation of 5mM BA on the E 2 secretion (P<0.05). Further, the Global Proteome and KEGG pathway analysis found that 5mM BA significantly up-regulated the I3LM80 proteins (P<0.05), which is involved in the steroid biosynthesis signaling pathway. 5mM BA significantly decreased the F2Z5G3 protein level (P<0.05), and the cAMP signaling pathway. In conclusion, present findings for the first time demonstrated that BA could regulate the P 4 and E 2 hormone synthesis in PGCs via the cAMP signaling pathway. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.
Tuning of acyl-ACP thioesterase activity directed for tailored fatty acid synthesis.
Feng, Yanbin; Zhang, Yunxiu; Wang, Yayue; Liu, Jiao; Liu, Yinghui; Cao, Xupeng; Xue, Song
2018-04-01
Medium-chain fatty acids have attracted significant attention as sources of biofuels in recent years. Acyl-ACP thioesterase, which is considered as the key enzyme to determine the carbon chain length, catalyzes the termination of de novo fatty acid synthesis. Although recombinant medium-chain acyl-ACP thioesterase (TE) affects the fatty acid profile in heterologous cells, tailoring of the fatty acid composition merely by engineering a specific TE is still intractable. In this study, the activity of a C8-C10-specific thioesterase FatB2 from Cuphea hookeriana on C10-ACP was quantified twice as high as that on C8-ACP based on a synthetic C8-C16 acyl-ACP pool in vitro. Whereas in vivo, it was demonstrated that ChFatB2 preferred to accumulate C8 fatty acids with 84.9% composition in the ChFatB2-engineered E. coli strain. To achieve C10 fatty acid production, ChFatB2 was rationally tuned based on structural investigation and enzymatic analysis. An I198E mutant was identified to redistribute the C8-ACP flow, resulting in C10 fatty acid being produced as the principal component at 57.6% of total fatty acids in vivo. It was demonstrated that the activity of TE relative to β-ketoacyl-ACP synthases (KAS) directly determined the fatty acid composition. Our results provide a prospective strategy in tailoring fatty acid synthesis by tuning of TE activities based on TE-ACP interaction.
Dulermo, Thierry; Lazar, Zbigniew; Dulermo, Rémi; Rakicka, Magdalena; Haddouche, Ramedane; Nicaud, Jean-Marc
2015-09-01
The role of the two key enzymes of fatty acid (FA) synthesis, ATP-citrate lyase (Acl) and malic enzyme (Mae), was analyzed in the oleaginous yeast Yarrowia lipolytica. In most oleaginous yeasts, Acl and Mae are proposed to provide, respectively, acetyl-CoA and NADPH for FA synthesis. Acl was mainly studied at the biochemical level but no strain depleted for this enzyme was analyzed in oleaginous microorganisms. On the other hand the role of Mae in FA synthesis in Y. lipolytica remains unclear since it was proposed to be a mitochondrial NAD(H)-dependent enzyme and not a cytosolic NADP(H)-dependent enzyme. In this study, we analyzed for the first time strains inactivated for corresponding genes. Inactivation of ACL1 decreases FA synthesis by 60 to 80%, confirming its essential role in FA synthesis in Y. lipolytica. Conversely, inactivation of MAE1 has no effects on FA synthesis, except in a FA overaccumulating strain where it improves FA synthesis by 35%. This result definitively excludes Mae as a major key enzyme for FA synthesis in Y. lipolytica. During the analysis of both mutants, we observed a negative correlation between FA and mannitol level. As mannitol and FA pathways may compete for carbon storage, we inactivated YlSDR, encoding a mannitol dehydrogenase converting fructose and NADPH into mannitol and NADP+. The FA content of the resulting mutant was improved by 60% during growth on fructose, demonstrating that mannitol metabolism may modulate FA synthesis in Y. lipolytica. Copyright © 2015. Published by Elsevier B.V.
USDA-ARS?s Scientific Manuscript database
Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were...
NASA Astrophysics Data System (ADS)
Weiss, Julia; Alcantud-Rodriguez, Raquel; Toksöz, Tugba; Egea-Cortines, Marcos
2016-01-01
Plants grow under climatic changing conditions that cause modifications in vegetative and reproductive development. The degree of changes in organ development i.e. its phenotypic plasticity seems to be determined by the organ identity and the type of environmental cue. We used intraspecific competition and found that Antirrhinum majus behaves as a decoupled species for lateral organ size and number. Crowding causes decreases in leaf size and increased leaf number whereas floral size is robust and floral number is reduced. Genes involved in shoot apical meristem maintenance like ROA and HIRZ, cell cycle (CYCD3a; CYCD3b, HISTONE H4) or organ polarity (GRAM) were not significantly downregulated under crowding conditions. A transcriptomic analysis of inflorescence meristems showed Gene Ontology enriched pathways upregulated including Jasmonic and Abscisic acid synthesis and or signalling. Genes involved in auxin synthesis such as AmTAR2 and signalling AmANT were not affected by crowding. In contrast, AmJAZ1, AmMYB21, AmOPCL1 and AmABA2 were significantly upregulated. Our work provides a mechanistic working hypothesis where a robust SAM and stable auxin signalling enables a homogeneous floral size while changes in JA and ABA signalling maybe responsible for the decreased leaf size and floral number.
Leber, Christopher; Choi, Jin Wook; Polson, Brian; Da Silva, Nancy A
2016-04-01
Biologically derived fatty acids have gained tremendous interest as an alternative to petroleum-derived fuels and chemical precursors. We previously demonstrated the synthesis of short chain fatty acids in Saccharomyces cerevisiae by introduction of the Homo sapiens fatty acid synthase (hFAS) with heterologous phosphopantetheine transferases and heterologous thioesterases. In this study, short chain fatty acid production was improved by combining a variety of novel enzyme and metabolic engineering strategies. The use of a H. sapiens-derived thioesterase and phosphopantetheine transferase were evaluated. In addition, strains were engineered to disrupt either the full β-oxidation (by deleting FAA2, PXA1, and POX1) or short chain-specific β-oxidation (by deleting FAA2, ANT1, and PEX11) pathways. Prohibiting full β-oxidation increased hexanoic and octanoic acid levels by 8- and 79-fold relative to the parent strain expressing hFAS. However, by targeting only short chain β-oxidation, hexanoic and octanoic acid levels increased further to 31- and 140-fold over the parent. In addition, an optimized hFAS gene increased hexanoic, octanoic, decanoic and total short chain fatty acid levels by 2.9-, 2.0-, 2.3-, and 2.2-fold, respectively, relative to the non-optimized counterpart. By combining these unique enzyme and metabolic engineering strategies, octanoic acid was increased more than 181-fold over the parent strain expressing hFAS. © 2015 Wiley Periodicals, Inc.
Dai, Zhongxue; Zhou, Huiyuan; Zhang, Shangjie; Gu, Honglian; Yang, Qiao; Zhang, Wenming; Dong, Weiliang; Ma, Jiangfeng; Fang, Yan; Jiang, Min; Xin, Fengxue
2018-06-01
Malic acid (2-hydroxybutanedioic acid) is a four-carbon dicarboxylic acid, which has attracted great interest due to its wide usage as a precursor of many industrially important chemicals in the food, chemicals, and pharmaceutical industries. Several mature routes for malic acid production have been developed, such as chemical synthesis, enzymatic conversion and biological fermentation. With depletion of fossil fuels and concerns regarding environmental issues, biological production of malic acid has attracted more attention, which mainly consists of three pathways, namely non-oxidative pathway, oxidative pathway and glyoxylate cycle. In recent decades, metabolic engineering of model strains, and process optimization for malic acid production have been rapidly developed. Hence, this review comprehensively introduces an overview of malic acid producers and highlight some of the successful metabolic engineering approaches. Copyright © 2018 Elsevier Ltd. All rights reserved.
Mechanisms of fatty acid synthesis in marine fungus-like protists.
Xie, Yunxuan; Wang, Guangyi
2015-10-01
Thraustochytrids are unicellular fungus-like protists and are well known for their ability to produce interesting nutraceutical compounds. Significant efforts have been made to improve their efficient production of important fatty acids (FAs), mostly by optimizing fermentation conditions and selecting highly productive thraustochytrid strains. Furthermore, noticeable improvements have been made in understanding the mechanism of FA biosynthesis, allowing for a better understanding of how thraustochytrids assemble these unique metabolites and how their biosynthesis is coupled with other related pathways. This review summarizes recent achievements on two major FA biosynthesis pathways, the standard pathway and the polyketide synthase pathway, and detail features of individual enzymes involved in FA biosynthesis, biotechnological advances in pathway engineering and enzyme characterization, and the discovery of other pathways that affect the efficiency of FA accumulation. Perspectives of biotechnological potential application of thraustochytrids are also discussed.
Formal synthesis of berkelic acid: a lesson in α-alkylation chemistry.
McLeod, Michael C; Wilson, Zoe E; Brimble, Margaret A
2012-01-06
The full details of our enantioselective formal synthesis of the biologically active natural product berkelic acid are described. The insertion of the C-18 methyl group proved challenging, with three different approaches investigated to install the correct stereochemistry. Our initial Horner-Wadsworth-Emmons/oxa-Michael approach to the berkelic acid core proved unsuccessful upon translation to the natural product itself. However, addition of a silyl enol ether to an oxonium ion, followed by a one-pot debenzylation/spiroketalisation/thermodynamic equilibration procedure, afforded the tetracyclic structure of the berkelic acid core as a single diastereoisomer.
A nitrous acid biosynthetic pathway for diazo group formation in bacteria.
Sugai, Yoshinori; Katsuyama, Yohei; Ohnishi, Yasuo
2016-02-01
Although some diazo compounds have bioactivities of medicinal interest, little is known about diazo group formation in nature. Here we describe an unprecedented nitrous acid biosynthetic pathway responsible for the formation of a diazo group in the biosynthesis of the ortho-diazoquinone secondary metabolite cremeomycin in Streptomyces cremeus. This finding provides important insights into the biosynthetic pathways not only for diazo compounds but also for other naturally occurring compounds containing nitrogen-nitrogen bonds.
Lopez, Adam M; Chuang, Jen-Chieh; Posey, Kenneth S; Turley, Stephen D
2017-01-01
Mutations in the X-linked gene methyl-CpG-binding protein 2 (MECP2) are the principal cause of Rett syndrome, a progressive neurodevelopmental disorder afflicting 1 in 10,000 to 15,000 females. Studies using hemizygous Mecp2 mouse models have revealed disruptions to some aspects of their lipid metabolism including a partial suppression of cholesterol synthesis in the brains of mature Mecp2 mutants. The present studies investigated whether this suppression is evident from early neonatal life, or becomes manifest at a later stage of development. We measured the rate of cholesterol synthesis, in vivo, in the brains of male Mecp2 - /y and their Mecp2 +/y littermates at 7, 14, 21, 28, 42 and 56 days of age. Brain weight was consistently lower in the Mecp2 -/y mice than in their Mecp2 +/y controls except at 7 days of age. In the 7- and 14-day-old mice there was no genotypic difference in the rate of brain cholesterol synthesis but, from 21 days and later, it was always marginally lower in the Mecp2 -/y mice than in age-matched Mecp2 +/y littermates. At no age was a genotypic difference detected in either the rate of fatty acid synthesis or cholesterol concentration in the brain. Cholesterol synthesis rates in the liver and lungs of 56-day-old Mecp2 -/y mice were normal. The onset of lower rates of brain cholesterol synthesis at about the time closure of the blood brain barrier purportedly occurs might signify a disruption to mechanism(s) that dictate intracellular levels of cholesterol metabolites including oxysterols known to exert a regulatory influence on the cholesterol biosynthetic pathway. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.
Zawadzke, Laura E; Norcia, Michael; Desbonnet, Charlene R; Wang, Hong; Freeman-Cook, Kevin; Dougherty, Thomas J
2008-02-01
The pathway for synthesis of the peptidoglycan precursor UDP-N-acetylmuramyl pentapeptide is essential in Gram-positive and Gram-negative bacteria. This pathway has been exploited in the recent past to identify potential new antibiotics as inhibitors of one or more of the Mur enzymes. In the present study, a high-throughput screen was employed to identify potential inhibitors of the Escherichia coli MurC (UDP-N-acetylmuramic acid:L-alanine ligase), the first of four paralogous amino acid-adding enzymes. Inhibition of ATP consumed during the MurC reaction, using an adaptation of a kinase assay format, identified a number of potential inhibitory chemotypes. After nonspecific inhibition testing and chemical attractiveness were assessed, C-1 emerged as a compound for further characterization. The inhibition of MurC by this compound was confirmed in both a kinetic-coupled enzyme assay and a direct nuclear magnetic resonance product detection assay. C-1 was found to be a low micromolar inhibitor of the E. coli MurC reaction, with preferential inhibition by one of two enantiomeric forms. Experiments indicated that it was a competitive inhibitor of ATP binding to the MurC enzyme. Further work with MurC enzymes from several bacterial sources revealed that while the compound was equally effective at inhibiting MurC from genera (Proteus mirabilis and Klebsiella pneumoniae) closely related to E. coli, MurC enzymes from more distant Gram-negative species such as Haemophilus influenzae, Acinetobacter baylyi, and Pseudomonas aeruginosa were not inhibited.
Perez-Benito, Joaquin F
2011-09-08
The reactions of permanganate ion with seven α-amino acids in aqueous KH(2)PO(4)/K(2)HPO(4) buffers have been followed spectrophotometrically at two different wavelengths: 526 nm (decay of MnO(4)(-)) and 418 nm (formation of colloidal MnO(2)). All of the reactions studied were autocatalyzed by colloidal MnO(2), with the contribution of the autocatalytic reaction pathway decreasing in the order glycine > l-threonine > l-alanine > l-glutamic acid > l-leucine > l-isoleucine > l-valine. The rate constants corresponding to the nonautocatalytic and autocatalytic pathways were obtained by means of either a differential rate law or an integrated one, the latter requiring the use of an iterative method for its implementation. The activation parameters for the two pathways were determined and analyzed to obtain statistically significant correlations for the series of reactions studied. The activation enthalpy of the nonautocatalytic pathway showed a strong, positive dependence on the standard Gibbs energy for the dissociation of the protonated amino group of the α-amino acid. Linear enthalpy-entropy correlations were found for both pathways, leading to isokinetic temperatures of 370 ± 21 K (nonautocatalytic) and 364 ± 28 K (autocatalytic). Mechanisms in agreement with the experimental data are proposed for the two reaction pathways.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Donnelly, M. I.; Millard, C. S.; Clark, D. P.
1998-04-01
Escherichia coli strain NZN111, which is unable to grow fermentatively because of insertional inactivation of the genes encoding pyruvate: formate lyase and the fermentative lactate dehydrogenase, gave rise spontaneously to a chromosomal mutation that restored its ability to ferment glucose. The mutant strain, named AFP111, fermented glucose more slowly than did its wild-type ancestor, strain W1485, and generated a very different spectrum of products. AFP111 produced succinic acid, acetic acid, and ethanol in proportions of approx 2:1:1. Calculations of carbon and electron balances accounted fully for the observed products; 1 mol of glucose was converted to 1 mol of succinicmore » acid and 0.5 mol each of acetic acid and ethanol. The data support the emergence in E.coli of a novel succinic acid:acetic acid:ethanol fermentation pathway.« less
RETINOIC ACID SYNTHESIS AND DEGRADATION
Kedishvili, Natalia Y.
2017-01-01
Retinoic acid was identified as the biologically active form of vitamin A almost 70 years ago, but the exact enzymes and control mechanisms that regulate its biosynthesis and degradation are yet to be fully defined. The currently accepted model postulates that RA is produced in two sequential oxidative steps: first, retinol is oxidized reversibly to retinaldehyde, and then retinaldehyde is oxidized irreversibly to RA, which is inactivated by conversion to hydroxylated derivatives. This chapter describes the history, development and recent advances in our understanding of the enzymatic pathways and mechanisms that control the rate of RA production and degradation. Gene knockout studies provided strong evidence that the members of the short chain dehydrogenase reductase superfamily of proteins play indispensable roles in retinoic acid biosynthesis during development. Furthermore, recent finding that two of these proteins regulate the rate of retinoic acid biosynthesis by mutually activating each other provided a novel insight into the mechanism of this regulation. Despite significant progress made since the middle of the 20th century many unanswered questions still remain, and there is much to be learned, especially about trafficking of the hydrophobic retinoid substrates between membrane bound and cytosolic enzymes and the roles of the retinoid binding proteins. PMID:27830503
Wu, Jason HY; Wang, Qianyi; Lemaitre, Rozenn N; Mukamal, Kenneth J; Djoussé, Luc; King, Irena B; Song, Xiaoling; Biggs, Mary L; Delaney, Joseph A; Kizer, Jorge R; Siscovick, David S; Mozaffarian, Dariush
2015-01-01
Background: Experimental evidence suggests that hepatic de novo lipogenesis (DNL) affects insulin homeostasis via synthesis of saturated fatty acids (SFAs) and monounsaturated fatty acids (MUFAs). Few prospective studies have used fatty acid biomarkers to assess associations with type 2 diabetes. Objectives: We investigated associations of major circulating SFAs [palmitic acid (16:0) and stearic acid (18:0)] and MUFA [oleic acid (18:1n–9)] in the DNL pathway with metabolic risk factors and incident diabetes in community-based older U.S. adults in the Cardiovascular Health Study. We secondarily assessed other DNL fatty acid biomarkers [myristic acid (14:0), palmitoleic acid (16:1n–7), 7-hexadecenoic acid (16:1n–9), and vaccenic acid (18:1n–7)] and estimated dietary SFAs and MUFAs. Design: In 3004 participants free of diabetes, plasma phospholipid fatty acids were measured in 1992, and incident diabetes was identified by medication use and blood glucose. Usual diets were assessed by using repeated food-frequency questionnaires. Multivariable linear and Cox regression were used to assess associations with metabolic risk factors and incident diabetes, respectively. Results: At baseline, circulating palmitic acid and stearic acid were positively associated with adiposity, triglycerides, inflammation biomarkers, and insulin resistance (P-trend < 0.01 each), whereas oleic acid showed generally beneficial associations (P-trend < 0.001 each). During 30,763 person-years, 297 incident diabetes cases occurred. With adjustment for demographics and lifestyle, palmitic acid (extreme-quintile HR: 1.89; 95% CI: 1.27, 2.83; P-trend = 0.001) and stearic acid (HR: 1.62; 95% CI: 1.09, 2.41; P-trend = 0.006) were associated with higher diabetes risk, whereas oleic acid was not significantly associated. In secondary analyses, vaccenic acid was inversely associated with diabetes (HR: 0.56; 95% CI: 0.38, 0.83; P-trend = 0.005). Other fatty acid biomarkers and estimated dietary SFAs
Delekta, Phillip C; Shook, John C; Lydic, Todd A; Mulks, Martha H; Hammer, Neal D
2018-03-26
Methicillin-resistant Staphylococcus aureus (MRSA) is a threat to global health. Consequently, much effort has focused on the development of new antimicrobials that target novel aspects of S. aureus physiology. Fatty acids are required to maintain cell viability, and bacteria synthesize fatty acids using the type II fatty acid synthesis pathway (FASII). FASII is significantly different from human fatty acid synthesis, underscoring the therapeutic potential of inhibiting this pathway. However, many Gram-positive pathogens incorporate exogenous fatty acids, bypassing FASII inhibition and leaving the clinical potential of FASII inhibitors uncertain. Importantly, the source(s) of fatty acids available to pathogens within the host environment remains unclear. Fatty acids are transported throughout the body by lipoprotein particles in the form of triglycerides and esterified cholesterol. Thus, lipoproteins, such as low-density lipoprotein (LDL) represent a potentially rich source of exogenous fatty acids for S. aureus during infection. We sought to test the ability of LDLs to serve as a fatty acid source for S. aureus and show that cells cultured in the presence of human LDLs demonstrate increased tolerance to the FASII inhibitor, triclosan. Using mass spectrometry, we observed that host-derived fatty acids present in the LDLs are incorporated into the staphylococcal membrane and that tolerance to triclosan is facilitated by the fatty acid kinase A, FakA, and Geh, a triacylglycerol lipase. Finally, we demonstrate that human LDLs support the growth of S. aureus fatty acid auxotrophs. Together, these results suggest that human lipoprotein particles are a viable source of exogenous fatty acids for S. aureus during infection. IMPORTANCE Inhibition of bacterial fatty acid synthesis is a promising approach to combating infections caused by S. aureus and other human pathogens. However, S. aureus incorporates exogenous fatty acids into its phospholipid bilayer. Therefore, the
Thraustochytrids as production organisms for docosahexaenoic acid (DHA), squalene, and carotenoids.
Aasen, Inga Marie; Ertesvåg, Helga; Heggeset, Tonje Marita Bjerkan; Liu, Bin; Brautaset, Trygve; Vadstein, Olav; Ellingsen, Trond E
2016-05-01
Thraustochytrids have been applied for industrial production of the omega-3 fatty acid docosahexaenoic (DHA) since the 1990s. During more than 20 years of research on this group of marine, heterotrophic microorganisms, considerable increases in DHA productivities have been obtained by process and medium optimization. Strains of thraustochytrids also produce high levels of squalene and carotenoids, two other commercially interesting compounds with a rapidly growing market potential, but where yet few studies on process optimization have been reported. Thraustochytrids use two pathways for fatty acid synthesis. The saturated fatty acids are produced by the standard fatty acid synthesis, while DHA is synthesized by a polyketide synthase. However, fundamental knowledge about the relationship between the two pathways is still lacking. In the present review, we extract main findings from the high number of reports on process optimization for DHA production and interpret these in the light of the current knowledge of DHA synthesis in thraustochytrids and lipid accumulation in oleaginous microorganisms in general. We also summarize published reports on squalene and carotenoid production and review the current status on strain improvement, which has been hampered by the yet very few published genome sequences and the lack of tools for gene transfer to the organisms. As more sequences now are becoming available, targets for strain improvement can be identified and open for a system-level metabolic engineering for improved productivities.
USDA-ARS?s Scientific Manuscript database
Bile acids (BAs) have an important role in the control of fat, glucose and cholesterol metabolism. Synthesis of bile acids is the major pathway for the metabolism of cholesterol and for the excretion of excess cholesterol in mammals. Bile acid intermediates and/or their metabolites are excreted in...
Proline Coordination with Fatty Acid Synthesis and Redox Metabolism of Chloroplast and Mitochondria.
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Sharma, Sandeep; Verslues, Paul E
2016-10-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1 pro :LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1 pro :LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1 pro :LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1 pro :LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4 These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. © 2016 American Society of Plant Biologists. All Rights Reserved.
Komori, Kazuhiko; Tsujimura, Akira; Takao, Tetsuya; Matsuoka, Yasuhiro; Miyagawa, Yasushi; Takada, Shingo; Nonomura, Norio; Okuyama, Akihiko
2008-07-01
Vascular smooth muscle cells express endothelial nitric oxide synthase (eNOS) and produce nitric oxide (NO). Recently, increased NO production has been reported to induce the synthesis and secretion of vascular endothelial growth factor (VEGF) via the NO/cyclic guanosine 3',5'-monophosphate (cGMP) pathway. L-arginine (L-arg), the precursor of NO, and selective phosphodiesterase type 5 (PDE-5) inhibitors that increase levels of intracellular cGMP may complementarily enhance VEGF synthesis in corpus cavernosal smooth muscle cells (CCSMCs), and may consequently restore impaired endothelial function. Expression of eNOS in corpus cavernosal smooth muscle has also been reported. However, it is unclear whether CCSMCs can generate NO. To elucidate whether CCSMCs can synthesize NO and whether NO synthesis enhances VEGF synthesis via the NO/cGMP pathway. Corpus cavernosal cells were cultured and characterized by immunocytochemistry and immunoblotting. CCSMCs were treated with L-arg. CCSMCs were also incubated with L-arg and with vardenafil, an inhibitor of PDE-5. Release of NO from cells was confirmed by assay of NO metabolites (NOx). Intracellular cGMP concentration and VEGF concentration in the medium were measured. Isolated cells were determined to be CCSMCs. The expression of eNOS by CCSMCs was also identified. NOx and cGMP levels in the L-arg-treated group were significantly greater than those in the control group. VEGF and cGMP levels in the L-arg-treated group were also significantly greater than those in the control group. VEGF and cGMP levels in the L-arg + vardenafil-treated group were significantly greater than those in the L-arg-treated group and the control group. CCSMCs express eNOS and synthesize NO. NO synthesis leads to enhancement of VEGF synthesis via the NO/cGMP pathway. Combined L-arg and vardenafil treatment, which can enhance VEGF production, may provide a novel therapeutic strategy for the treatment of erectile dysfunction as well as endothelial
Kothapalli, Kumar S. D.; Ye, , Kaixiong; Gadgil, Maithili S.; Carlson, Susan E.; O’Brien, Kimberly O.; Zhang, Ji Yao; Park, Hui Gyu; Ojukwu, Kinsley; Zou, James; Hyon, Stephanie S.; Joshi, Kalpana S.; Gu, Zhenglong; Keinan, Alon; Brenna, J.Thomas
2016-01-01
Long chain polyunsaturated fatty acids (LCPUFA) are bioactive components of membrane phospholipids and serve as substrates for signaling molecules. LCPUFA can be obtained directly from animal foods or synthesized endogenously from 18 carbon precursors via the FADS2 coded enzyme. Vegans rely almost exclusively on endogenous synthesis to generate LCPUFA and we hypothesized that an adaptive genetic polymorphism would confer advantage. The rs66698963 polymorphism, a 22-bp insertion–deletion within FADS2, is associated with basal FADS1 expression, and coordinated induction of FADS1 and FADS2 in vitro. Here, we determined rs66698963 genotype frequencies from 234 individuals of a primarily vegetarian Indian population and 311 individuals from the US. A much higher I/I genotype frequency was found in Indians (68%) than in the US (18%). Analysis using 1000 Genomes Project data confirmed our observation, revealing a global I/I genotype of 70% in South Asians, 53% in Africans, 29% in East Asians, and 17% in Europeans. Tests based on population divergence, site frequency spectrum, and long-range haplotype consistently point to positive selection encompassing rs66698963 in South Asian, African, and some East Asian populations. Basal plasma phospholipid arachidonic acid (ARA) status was 8% greater in I/I compared with D/D individuals. The biochemical pathway product–precursor difference, ARA minus linoleic acid, was 31% and 13% greater for I/I and I/D compared with D/D, respectively. This study is consistent with previous in vitro data suggesting that the insertion allele enhances n-6 LCPUFA synthesis and may confer an adaptive advantage in South Asians because of the traditional plant-based diet practice. PMID:27188529
5'to 3' nucleic acid synthesis using 3'-photoremovable protecting group
Pirrung, Michael C.; Shuey, Steven W.; Bradley, Jean-Claude
1999-01-01
The present invention relates, in general, to a method of synthesizing a nucleic acid, and, in particular, to a method of effecting 5' to 3' nucleic acid synthesis. The method can be used to prepare arrays of oligomers bound to a support via their 5' end. The invention also relates to a method of effecting mutation analysis using such arrays. The invention further relates to compounds and compositions suitable for use in such methods.
USDA-ARS?s Scientific Manuscript database
In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study...
Essential role of Bordetella NadC in a quinolinate salvage pathway for NAD biosynthesis.
Brickman, Timothy J; Suhadolc, Ryan J; McKelvey, Pamela J; Armstrong, Sandra K
2017-02-01
Nicotinamide adenine dinucleotide (NAD) is produced via de novo biosynthesis pathways and by salvage or recycling routes. The classical Bordetella bacterial species are known to be auxotrophic for nicotinamide or nicotinic acid. This study confirmed that Bordetella bronchiseptica, Bordetella pertussis and Bordetella parapertussis have the recycling/salvage pathway genes pncA and pncB, for use of nicotinamide or nicotinic acid, respectively, for NAD synthesis. Although these Bordetellae lack the nadA and nadB genes needed for de novo NAD biosynthesis, remarkably, they have one de novo pathway gene, nadC, encoding quinolinate phosphoribosyltransferase. Genomic analyses of taxonomically related Bordetella and Achromobacter species also indicated the presence of an 'orphan' nadC and the absence of nadA and nadB. When supplied as the sole NAD precursor, quinolinate promoted B. bronchiseptica growth, and the ability to use it required nadC. Co-expression of Bordetella nadC with the nadB and nadA genes of Paraburkholderia phytofirmans allowed B. bronchiseptica to grow in the absence of supplied pyridines, indicative of de novo NAD synthesis and functional confirmation of Bordetella NadC activity. Expression of nadC in B. bronchiseptica was influenced by nicotinic acid and by a NadQ family transcriptional repressor, indicating that these organisms prioritize their use of pyridines for NAD biosynthesis. © 2016 John Wiley & Sons Ltd.
Brocardo, Patrícia de Souza; Budni, Josiane; Lobato, Kelly Ribas; Kaster, Manuella Pinto; Rodrigues, Ana Lúcia S
2008-11-19
Antidepressant-like activity of folic acid in forced swimming test and in the tail suspension test was demonstrated previously by our group. In this study we investigated the involvement of N-methyl-d-aspartate (NMDA) receptors and l-arginine-nitric oxide (NO)-cyclic guanosine monophosphate pathway in its antidepressant-like effect in the forced swimming test in mice. The antidepressant-like effect of folic acid (10 nmol/site, i.c.v.) was prevented by the pretreatment of mice with NMDA (0.1 pmol/site, i.c.v.), l-arginine (750 mg/kg, i.p., substrate for nitric oxide synthase), S-nitroso-N-acetyl-penicillamine (SNAP, 25 microg/site, i.c.v, a NO donor) or sildenafil (5 mg/kg, i.p., phosphodiesterase 5 inhibitor). The administration of 7-nitroindazole (25 and 50 mg/kg, i.p., a specific neuronal nitric oxide synthase (nNOS) inhibitor) or methylene blue (20 mg/kg, i.p., direct inhibitor of both nitric oxide synthase and soluble guanylate cyclase) in combination with a sub-effective dose of folic acid (1 nmol/site, i.c.v.) reduced the immobility time in the FST as compared with either drug alone. Together the results suggest that the antidepressant-like effect of folic acid in the forced swimming test is dependent on an inhibition of either NMDA receptors or NO and cGMP synthesis.
Lipase-catalyzed synthesis of fattythioic acids from palm oil.
Al-Mulla, Emad A Jaffar
2011-01-01
The present work focuses on the synthesis of fattythioic acids (FTAs) by a one-step lipase catalyzed reaction of palm oil with carbonothioic S,S-acid using Lipozyme. The product was characterized using Fourier transform infrared (FTIR) spectroscopy, proton nuclear magnetic resonance ((1)H NMR) technique and elemental analysis. The effects of various reaction parameters such as reaction time, temperature, amount of enzyme, molar ratio of substrates, and various organic solvents of the reaction system were investigated. The optimum conditions to produce FTAs were respectively, incubation time, 20 h, temperature, 40°C, amount of enzyme, 0.05 g and molar ratio of carbonothioic S,S-acid to palm oil, 5.0:1.0. Hexane was the best solvent for this reaction. The conversion of the products at optimum conditions was around 91%.
Synthesis of glyceryl ferulate by immobilized ferulic acid esterase.
Matsuo, Takemasa; Kobayashi, Takashi; Kimura, Yukitaka; Tsuchiyama, Moriyasu; Oh, Tadanobu; Sakamoto, Tatsuji; Adachi, Shuji
2008-12-01
Glyceryl ferulate was synthesized by the condensation of ferulic acid with glycerol using Pectinase PL "Amano" from Aspergillus niger, which contained ferulic acid esterase, to improve the water-solubility of ferulic acid. The optimum reaction medium was glycerol/0.1 M acetate buffer, pH 4.0, (98:2 v/v). The enzyme immobilized onto Chitopearl BCW3003 exhibited the highest activity among the those immobilized onto various kinds of Chitopearl BCW resins. The optimum temperature for the immobilized enzyme was 50 degrees C, and it could be reused at least five times without a significant loss in activity for the synthesis of glyceryl ferulate in batch reaction. Storage of the reaction mixture at 25 degrees C improved the molar fraction of glyceryl ferulate relative to the dissolved ferulic residues.
Phospholipase D signaling pathways and phosphatidic acid as therapeutic targets in cancer.
Bruntz, Ronald C; Lindsley, Craig W; Brown, H Alex
2014-10-01
Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein-coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. Copyright © 2014 by The American Society for Pharmacology and Experimental Therapeutics.
Branched Chain Amino Acids: Beyond Nutrition Metabolism.
Nie, Cunxi; He, Ting; Zhang, Wenju; Zhang, Guolong; Ma, Xi
2018-03-23
Branched chain amino acids (BCAAs), including leucine (Leu), isoleucine (Ile), and valine (Val), play critical roles in the regulation of energy homeostasis, nutrition metabolism, gut health, immunity and disease in humans and animals. As the most abundant of essential amino acids (EAAs), BCAAs are not only the substrates for synthesis of nitrogenous compounds, they also serve as signaling molecules regulating metabolism of glucose, lipid, and protein synthesis, intestinal health, and immunity via special signaling network, especially phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) signal pathway. Current evidence supports BCAAs and their derivatives as the potential biomarkers of diseases such as insulin resistance (IR), type 2 diabetes mellitus (T2DM), cancer, and cardiovascular diseases (CVDs). These diseases are closely associated with catabolism and balance of BCAAs. Hence, optimizing dietary BCAA levels should have a positive effect on the parameters associated with health and diseases. This review focuses on recent findings of BCAAs in metabolic pathways and regulation, and underlying the relationship of BCAAs to related disease processes.
Branched Chain Amino Acids: Beyond Nutrition Metabolism
2018-01-01
Branched chain amino acids (BCAAs), including leucine (Leu), isoleucine (Ile), and valine (Val), play critical roles in the regulation of energy homeostasis, nutrition metabolism, gut health, immunity and disease in humans and animals. As the most abundant of essential amino acids (EAAs), BCAAs are not only the substrates for synthesis of nitrogenous compounds, they also serve as signaling molecules regulating metabolism of glucose, lipid, and protein synthesis, intestinal health, and immunity via special signaling network, especially phosphoinositide 3-kinase/protein kinase B/mammalian target of rapamycin (PI3K/AKT/mTOR) signal pathway. Current evidence supports BCAAs and their derivatives as the potential biomarkers of diseases such as insulin resistance (IR), type 2 diabetes mellitus (T2DM), cancer, and cardiovascular diseases (CVDs). These diseases are closely associated with catabolism and balance of BCAAs. Hence, optimizing dietary BCAA levels should have a positive effect on the parameters associated with health and diseases. This review focuses on recent findings of BCAAs in metabolic pathways and regulation, and underlying the relationship of BCAAs to related disease processes. PMID:29570613
NASA Astrophysics Data System (ADS)
Rontani, Jean-François; Aubert, Claude; Belt, Simon T.
2015-09-01
EI mass fragmentation pathways of TMS derivatives οf 7α/β-hydroxy-dehydroabietic acids resulting from NaBH4-reduction of oxidation products of dehydroabietic acid (a component of conifers) were investigated and deduced by a combination of (1) low energy CID-GC-MS/MS, (2) deuterium labeling, (3) different derivatization methods, and (4) GC-QTOF accurate mass measurements. Having identified the main fragmentation pathways, the TMS-derivatized 7α/β-hydroxy-dehydroabietic acids could be quantified in multiple reaction monitoring (MRM) mode in sea ice and sediment samples collected from the Arctic. These newly characterized transformation products of dehydroabietic acid constitute potential tracers of biotic and abiotic degradation of terrestrial higher plants in the environment.
Narnoliya, Lokesh K; Sangwan, Rajender S; Singh, Sudhir P
2018-06-01
Rose-scented geranium (Pelargonium sp.) is widely known as aromatic and medicinal herb, accumulating specialized metabolites of high economic importance, such as essential oils, ascorbic acid, and tartaric acid. Ascorbic acid and tartaric acid are multifunctional metabolites of human value to be used as vital antioxidants and flavor enhancing agents in food products. No information is available related to the structural and functional properties of the enzymes involved in ascorbic acid and tartaric acid biosynthesis in rose-scented geranium. In the present study, transcriptome mining was done to identify full-length genes, followed by their bioinformatic and molecular modeling investigations and understanding of in silico structural and functional properties of these enzymes. Evolutionary conserved domains were identified in the pathway enzymes. In silico physicochemical characterization of the catalytic enzymes revealed isoelectric point (pI), instability index, aliphatic index, and grand average hydropathy (GRAVY) values of the enzymes. Secondary structural prediction revealed abundant proportion of alpha helix and random coil confirmations in the pathway enzymes. Three-dimensional homology models were developed for these enzymes. The predicted structures showed significant structural similarity with their respective templates in root mean square deviation analysis. Ramachandran plot analysis of the modeled enzymes revealed that more than 84% of the amino acid residues were within the favored regions. Further, functionally important residues were identified corresponding to catalytic sites located in the enzymes. To, our best knowledge, this is the first report which provides a foundation on functional annotation and structural determination of ascorbic acid and tartaric acid pathway enzymes in rose-scanted geranium.
Sato, Norihiro; Tsuzuki, Mikio; Kawaguchi, Akihiko
2003-07-04
In the accompanying paper, we demonstrated that Chlorella kessleri uses prokaryotic and eukaryotic pathways to synthesize sn-1-C18-sn-2-C16 (C18/C16, prokaryotic lipids) and sn-1-C18-sn-2-C18 (C18/C18, eukaryotic lipids) species, respectively, in chloroplast lipids such as monogalactosyl diacylglycerol (MGDG) and digalactosyl diacylglycerol (DGDG). In this study, to examine the effect of CO2 on lipid metabolism, we compared the fatty acid distributions at the sn-1 and sn-2 positions of each major lipid, i.e. MGDG, DGDG, phosphatidylcholine (PC), and phosphatidylethanolamine (PE), and the patterns of incorporation of [14C]acetate into fatty acids and lipids in vivo between cells of C. kessleri grown under ordinary air (low-CO2 cells) and ones grown under CO2-enriched air (high-CO2 cells). Low-CO2 cells, as compared with high-CO2 cells, showed elevated contents of 18:3(9,12,15), especially at both the sn-1 and sn-2 positions of MGDG and DGDG, and also at the sn-2 position of PC and PE. When the cells were labeled with [14C]acetate, slower rates of 18:3 synthesis in the respective major lipids with lower incorporation of 14C into total membrane lipids were observed in low-CO2 cells than in high-CO2 cells. These results thus indicate that the higher unsaturation levels in low-CO2 cells are at least partially due to repressed fatty acid synthesis, which promotes the desaturation of pre-existing fatty acids, rather than to up-regulation of desaturation activity. It was also noted that, in both MGDG and DGDG, the contents of eukaryotic lipids were higher at the expense of prokaryotic lipids in low-CO2 cells than in high-CO2 cells, suggesting relatively greater metabolic flow in the eukaryotic pathway compared to the prokaryotic pathway for galactolipid synthesis in low-CO2 cells. We propose that, together with the repression of fatty acid synthesis, the increased synthesis of C18/C18 species of galactolipids, which are suitable substrates for chloroplast desaturation
Ursolic Acid Inhibits Adipogenesis in 3T3-L1 Adipocytes through LKB1/AMPK Pathway
He, Yonghan; Li, Ying; Zhao, Tiantian; Wang, Yanwen; Sun, Changhao
2013-01-01
Background Ursolic acid (UA) is a triterpenoid compound with multiple biological functions. This compound has recently been reported to possess an anti-obesity effect; however, the mechanisms are less understood. Objective As adipogenesis plays a critical role in obesity, the present study was conducted to investigate the effect of UA on adipogenesis and mechanisms of action in 3T3-L1 preadipocytes. Methods and Results The 3T3-L1 preadipocytes were induced to differentiate in the presence or absence of UA for 6 days. The cells were determined for proliferation, differentiation, fat accumulation as well as the protein expressions of molecular targets that regulate or are involved in fatty acid synthesis and oxidation. The results demonstrated that ursolic acid at concentrations ranging from 2.5 µM to 10 µM dose-dependently attenuated adipogenesis, accompanied by reduced protein expression of CCAAT element binding protein β (C/EBPβ), peroxisome proliferator-activated receptor γ (PPARγ), CCAAT element binding protein α (C/EBPα) and sterol regulatory element binding protein 1c (SREBP-1c), respectively. Ursolic acid increased the phosphorylation of acetyl-CoA carboxylase (ACC) and protein expression of carnitine palmitoyltransferase 1 (CPT1), but decreased protein expression of fatty acid synthase (FAS) and fatty acid-binding protein 4 (FABP4). Ursolic acid increased the phosphorylation of AMP-activated protein kinase (AMPK) and protein expression of (silent mating type information regulation 2, homolog) 1 (Sirt1). Further studies demonstrated that the anti-adipogenic effect of UA was reversed by the AMPK siRNA, but not by the Sirt1 inhibitor nicotinamide. Liver kinase B1 (LKB1), the upstream kinase of AMPK, was upregulated by UA. When LKB1 was silenced with siRNA or the inhibitor radicicol, the effect of UA on AMPK activation was diminished. Conclusions Ursolic acid inhibited 3T3-L1 preadipocyte differentiation and adipogenesis through the LKB1/AMPK pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Hempel, K.
1962-01-01
New methods for synthesis of tritium-labeled amino acids with high specific activity (1000 mc/m mole and above) are described. Changes in tritium- labeled amino acids during storage are studied. An absorbed BETA energy of 10/ sup 5/ rad results in radiochemical disintegration of 1.5%. Autoradiographic studies were made with several amino acids. It was demonstrated that protein production is 2 to 3 times higher in butter-vellux, tumors than in liver tissue. Synthesis of melanine was studied in vivo with melanineproducing tumors. (Gmelin Inst.)
Carballeira, N M; Emiliano, A; Hernández-Alonso, N; González, F A
1998-12-01
The total synthesis of the naturally occurring (Z)-2-methoxy-5-hexadecenoic acid and (Z)-2-methoxy-6-hexadecenoic acid was accomplished using as a key step Mukaiyama's trimethylsilyl cyanide addition to 4- and 5-pentadecenal, respectively. These syntheses further confirm the structures of the natural marine fatty acids and corroborate their cis double-bond stereochemistry. The title compounds were antimicrobial against the Gram-positive bacteria Staphylococcus aureus (MIC 0.35 micromol/mL) and Streptococcus faecalis (MIC 0.35 micromol/mL).
Li, Yang
2011-01-01
We have accomplished an asymmetric synthesis of each enantiomer of 4,4-difluoroglutamic acid. This α-amino acid has been of interest in medicinal chemistry circles. Key features of the synthesis include highly scalable procedures, a Reformatsky-based coupling reaction, and straightforward functional group manipulations to make the parent amino acid. Enantioenrichment derives from an enzymatic resolution of the synthetic material. Conversion of the optically enriched compounds to orthogonally protected forms allows selective formation of peptide bonds. 4,4- Difluoroglutamic acid, in a suitably protected form, is also shown to exhibit enhanced catalytic activity in both an oxidation reaction and a reduction reaction, in comparison to the analogous glutamic acid derivative. PMID:22039908
Browne, Christopher M.; Samir, Parimal; Fites, J. Scott; Villarreal, Seth A.
2013-01-01
Using affinity purifications coupled with mass spectrometry and yeast two-hybrid assays, we show the Saccharomyces cerevisiae translation initiation factor complex eukaryotic translation initiation factor 2B (eIF2B) and the very-long-chain fatty acid (VLCFA) synthesis keto-reductase enzyme YBR159W physically interact. The data show that the interaction is specifically between YBR159W and eIF2B and not between other members of the translation initiation or VLCFA pathways. A ybr159wΔ null strain has a slow-growth phenotype and a reduced translation rate but a normal GCN4 response to amino acid starvation. Although YBR159W localizes to the endoplasmic reticulum membrane, subcellular fractionation experiments show that a fraction of eIF2B cofractionates with lipid membranes in a YBR159W-independent manner. We show that a ybr159wΔ yeast strain and other strains with null mutations in the VLCFA pathway cause eIF2B to appear as numerous foci throughout the cytoplasm. PMID:23263984
Cao, Jing; Dong, Shuding; Jiang, Delu; Zhu, Peiyu; Zhang, Han; Li, Rui; Li, Zhanyi; Wang, Xuanyu; Tang, Weifang; Du, Ding
2017-04-21
β-Functionalization of indolin-2-one-derived aliphatic acids has been applied in formal [3 + 2] annualtions for catalyst-free and divergent synthesis of two series of structurally interesting 3,3'-spirooxindole γ-butyrolactones that may be attractive for potential drug discovery. These findings also pave the way for further diversity-oriented synthesis of spirooxindoles starting from indolin-2-one-derived aliphatic acids or their derivatives.
Baude, Jessica; Vial, Ludovic; Villard, Camille; Campillo, Tony; Lavire, Céline; Nesme, Xavier
2016-01-01
ABSTRACT The rhizosphere-inhabiting species Agrobacterium fabrum (genomospecies G8 of the Agrobacterium tumefaciens species complex) is known to degrade hydroxycinnamic acids (HCAs), especially ferulic acid and p-coumaric acid, via the novel A. fabrum HCA degradation pathway. Gene expression profiles of A. fabrum strain C58 were investigated in the presence of HCAs, using a C58 whole-genome oligoarray. Both ferulic acid and p-coumaric acid caused variations in the expression of more than 10% of the C58 genes. Genes of the A. fabrum HCA degradation pathway, together with the genes involved in iron acquisition, were among the most highly induced in the presence of HCAs. Two operons coding for the biosynthesis of a particular siderophore, as well as genes of the A. fabrum HCA degradation pathway, have been described as being specific to the species. We demonstrate here their coordinated expression, emphasizing the interdependence between the iron concentration in the growth medium and the rate at which ferulic acid is degraded by cells. The coordinated expression of these functions may be advantageous in HCA-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. The present results confirm that there is cooperation between the A. fabrum-specific genes, defining a particular ecological niche. IMPORTANCE We previously identified seven genomic regions in Agrobacterium fabrum that were specifically present in all of the members of this species only. Here we demonstrated that two of these regions, encoding the hydroxycinnamic acid degradation pathway and the iron acquisition pathway, were regulated in a coordinated manner. The coexpression of these functions may be advantageous in hydroxycinnamic acid-rich but iron-starved environments in which microorganisms have to compete for both iron and carbon sources, such as in plant roots. These data support the view that bacterial genomic species
NASA Astrophysics Data System (ADS)
Šoral, Michal; Markus, Jozef; Doháňošová, Jana; Šoralová, Stanislava; Dvoranová, Dana; Chyba, Andrej; Moncol, Ján; Berkeš, Dušan; Liptaj, Tibor
2017-01-01
Acid-catalyzed cyclization of spirocyclic 1‧-benzyl-2‧-(prop-2-en-1-yl)spiro[indole-3,3‧-pyrrolidine]-5‧-one (1) was performed. The pentacyclic product of Povarov-like imino-Diels-Alder reaction was isolated in high yield instead of expected tetracyclic aza-Prins intermediate. The unusual exotic alkaloid-type structure of the resulting molecule 2 was unambiguously confirmed by a detailed NMR analysis using a set of 2D NMR spectra including an INADEQUATE experiment. The relative configuration of 2 was predicted from the synthesis mechanism and DFT geometry calculations and independently confirmed using NOESY and residual dipolar coupling (RDC) assisted NMR analysis in stretched crosslinked polystyrene gels. The reversibility of the cycloaddition in aprotic solvents was observed. A new reaction pathway yielding a rare 6-5-5-5 tetracyclic spiroindoline 3 was suggested. The relative configuration within the tetracyclic framework was ultimately proved using Single-crystal X-ray diffraction analysis of compound 4.
Patel, Unisha; Chauhan, Kishor; Gupte, Shilpa
2018-04-01
In the present work, magnetic nanoparticles (MNPs) were prepared by chemical precipitation of trivalent and divalent iron ions which were functionalized using citric acid. The bacterial isolate Staphylococcus epidermidis KX781317 was isolated from oil-contaminated site. The isolate produced lipase, which was purified and immobilized on magnetic nanoparticles (MNPs) for ester synthesis from waste frying oil (WFO). The characterization of MNPs employed conventional TEM, XRD and FTIR techniques. TEM analysis of MNPs showed the particle size in the range of 20-50 nm. FTIR spectra revealed the binding of citric acid to Fe 3 O 4 and lipase on citric acid-coated MNPs. The citric acid-coated MNPs and lipase-conjugated citric acid-coated MNPs had similar XRD patterns which indicate MNPs could preserve their magnetic properties. The maximum immobilization efficiency 98.21% of lipase-containing citric acid-coated MNPs was observed at ratio 10:1 of Cit-MNPs:lipase. The pH and temperature optima for lipase conjugated with Cit-MNPs were 7 and 35 °C, respectively. Isobutanol was found to be an effective solvent for ester synthesis and 1:2 ratio of oil:alcohol observed significant for ester formation. The ester formation was determined using TLC and the % yield of ester conversion was calculated. The rate of ester formation is directly proportional to the enzyme load. Formed esters were identified as isobutyl laurate ester and isobutyl myristate ester through GC-MS analysis.
Heimer, Gali; Kerätär, Juha M; Riley, Lisa G; Balasubramaniam, Shanti; Eyal, Eran; Pietikäinen, Laura P; Hiltunen, J Kalervo; Marek-Yagel, Dina; Hamada, Jeffrey; Gregory, Allison; Rogers, Caleb; Hogarth, Penelope; Nance, Martha A; Shalva, Nechama; Veber, Alvit; Tzadok, Michal; Nissenkorn, Andreea; Tonduti, Davide; Renaldo, Florence; Kraoua, Ichraf; Panteghini, Celeste; Valletta, Lorella; Garavaglia, Barbara; Cowley, Mark J; Gayevskiy, Velimir; Roscioli, Tony; Silberstein, Jonathon M; Hoffmann, Chen; Raas-Rothschild, Annick; Tiranti, Valeria; Anikster, Yair; Christodoulou, John; Kastaniotis, Alexander J; Ben-Zeev, Bruria; Hayflick, Susan J
2016-12-01
Mitochondrial fatty acid synthesis (mtFAS) is an evolutionarily conserved pathway essential for the function of the respiratory chain and several mitochondrial enzyme complexes. We report here a unique neurometabolic human disorder caused by defective mtFAS. Seven individuals from five unrelated families presented with childhood-onset dystonia, optic atrophy, and basal ganglia signal abnormalities on MRI. All affected individuals were found to harbor recessive mutations in MECR encoding the mitochondrial trans-2-enoyl-coenzyme A-reductase involved in human mtFAS. All six mutations are extremely rare in the general population, segregate with the disease in the families, and are predicted to be deleterious. The nonsense c.855T>G (p.Tyr285 ∗ ), c.247_250del (p.Asn83Hisfs ∗ 4), and splice site c.830+2_830+3insT mutations lead to C-terminal truncation variants of MECR. The missense c.695G>A (p.Gly232Glu), c.854A>G (p.Tyr285Cys), and c.772C>T (p.Arg258Trp) mutations involve conserved amino acid residues, are located within the cofactor binding domain, and are predicted by structural analysis to have a destabilizing effect. Yeast modeling and complementation studies validated the pathogenicity of the MECR mutations. Fibroblast cell lines from affected individuals displayed reduced levels of both MECR and lipoylated proteins as well as defective respiration. These results suggest that mutations in MECR cause a distinct human disorder of the mtFAS pathway. The observation of decreased lipoylation raises the possibility of a potential therapeutic strategy. Copyright © 2016 American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Chi, Shuang; He, Yanfeng; Ren, Jie; Su, Qian; Liu, Xingchao; Chen, Zhi; Wang, Mingan; Li, Ying; Li, Jilun
2015-06-18
A moderate-temperature, astaxanthin-overproducing mutant strain (termed MK19) of Phaffia rhodozyma was generated in our laboratory. The intracellular astaxanthin content of MK19 was 17-fold higher than that of wild-type. The TLC profile of MK19 showed a band for an unknown carotenoid pigment between those of β-carotene and astaxanthin. In the present study, we attempted to identify the unknown pigment and to enhance astaxanthin synthesis in MK19 by overexpression of the crtS gene that encodes astaxanthin synthase (CrtS). A crtS-overexpressing strain was constructed without antibiotic marker. A recombinant plasmid with lower copy numbers was shown to be stable in MK19. In the positive recombinant strain (termed CSR19), maximal astaxanthin yield was 33.5% higher than MK19, and the proportion of astaxanthin as a percentage of total carotenoids was 84%. The unknown carotenoid was identified as 3-hydroxy-3',4'-didehydro-β,Ψ-carotene-4-one (HDCO) by HPLC, mass spectrometry, and NMR spectroscopy. CrtS was found to be a bifunctional enzyme that helped convert HDCO to astaxanthin. Enhancement of crtS transcriptional level increased transcription levels of related genes (crtE, crtYB, crtI) in the astaxanthin synthesis pathway. A scheme of carotenoid biosynthesis in P. rhodozyma involving alternative bicyclic and monocyclic pathways is proposed. CrtS overexpression leads to up-regulation of synthesis-related genes and increased astaxanthin production. The transformant CSR19 is a stable, secure strain suitable for feed additive production. The present findings help clarify the regulatory mechanisms that underlie metabolic fluxes in P. rhodozyma carotenoid biosynthesis pathways.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Fulvio, Pasquale F; Mahurin, Shannon Mark; Mayes, Richard T
2012-01-01
Soft-templated phosphorylated mesoporous carbons with homogeneous distributions of phosphate groups were prepared by a 'one-pot' synthesis method using mixtures of phosphoric acid with hydrochloric, or nitric acids in the presence of Pluronic F127 triblock copolymer. Adjusting the various ratios of phosphoric acid used in these mixtures resulted in carbons with distinct adsorption, structural and surface acidity properties. The pore size distributions (PSDs) from nitrogen adsorption at -196 C showed that mesoporous carbons exhibit specific surface areas as high as 551 m{sup 2}/g and mesopores as large as 13 nm. Both structural ordering of the mesopores and the final phosphate contentsmore » were strongly dependent on the ratios of H{sub 3}PO{sub 4} in the synthesis gels, as shown by transmission electron microscopy (TEM), X-ray photoelectron (XPS) and energy dispersive X-ray spectroscopy (EDS). The number of surface acid sites determined from temperature programmed desorption of ammonia (NH{sub 3}-TPD) were in the range of 0.3-1.5 mmol/g while the active surface areas are estimated to comprise 5-54% of the total surface areas. Finally, the conversion temperatures for the isopropanol dehydration were lowered by as much as 100 C by transitioning from the least acidic to the most acidic catalysts surface.« less
Microalgae Synthesize Hydrocarbons from Long-Chain Fatty Acids via a Light-Dependent Pathway1[OPEN
Légeret, Bertrand; Mirabella, Boris; Guédeney, Geneviève; Jetter, Reinhard; Peltier, Gilles
2016-01-01
Microalgae are considered a promising platform for the production of lipid-based biofuels. While oil accumulation pathways are intensively researched, the possible existence of a microalgal pathways converting fatty acids into alka(e)nes has received little attention. Here, we provide evidence that such a pathway occurs in several microalgal species from the green and the red lineages. In Chlamydomonas reinhardtii (Chlorophyceae), a C17 alkene, n-heptadecene, was detected in the cell pellet and the headspace of liquid cultures. The Chlamydomonas alkene was identified as 7-heptadecene, an isomer likely formed by decarboxylation of cis-vaccenic acid. Accordingly, incubation of intact Chlamydomonas cells with per-deuterated D31-16:0 (palmitic) acid yielded D31-18:0 (stearic) acid, D29-18:1 (oleic and cis-vaccenic) acids, and D29-heptadecene. These findings showed that loss of the carboxyl group of a C18 monounsaturated fatty acid lead to heptadecene formation. Amount of 7-heptadecene varied with growth phase and temperature and was strictly dependent on light but was not affected by an inhibitor of photosystem II. Cell fractionation showed that approximately 80% of the alkene is localized in the chloroplast. Heptadecane, pentadecane, as well as 7- and 8-heptadecene were detected in Chlorella variabilis NC64A (Trebouxiophyceae) and several Nannochloropsis species (Eustigmatophyceae). In contrast, Ostreococcus tauri (Mamiellophyceae) and the diatom Phaeodactylum tricornutum produced C21 hexaene, without detectable C15-C19 hydrocarbons. Interestingly, no homologs of known hydrocarbon biosynthesis genes were found in the Nannochloropsis, Chlorella, or Chlamydomonas genomes. This work thus demonstrates that microalgae have the ability to convert C16 and C18 fatty acids into alka(e)nes by a new, light-dependent pathway. PMID:27288359
Alanine synthesis from glyceraldehyde and ammonium ion in aqueous solution
NASA Technical Reports Server (NTRS)
Weber, A. L.
1985-01-01
The formation of alanine (ala) form C(14)-glyceraldehyde and ammonium phosphate in the presence or absence of a thiol is reported. At ambient temperature, ala synthesis was six times more rapid in the presence of 3-mercaptopropionic acid than in its absence (0.6 and 0.1 percent, respectively, after 60 days). Similarly, the presence of another thiol, N-acetylcysteinate, increased the production of ala, as well as of lactate. The reaction pathway of thiol-catalyzed synthesis of ala, with the lactic acid formed in a bypath, is suggested. In this, dehydration of glyceraldehyde is followed by the formation of hemithioacetal. In the presence of ammonia, an imine is formed, which eventually yields ala. This pathway is consistent with the observation that the rate ratio of ala/lactate remains constant throughout the process. The fact that the reaction takes place under anaerobic conditions in the presence of H2O and with the low concentrations of simple substrates and catalysts makes it an attractive model prebiotic reaction in the process of molecular evolution.
Synthesis and Characterization of Fatty Acid/Amino Acid Self-Assemblies
Gajowy, Joanna; Bolikal, Durgadas; Kohn, Joachim; El Fray, Miroslawa
2014-01-01
In this paper, we discuss the synthesis and self-assembling behavior of new copolymers derived from fatty acid/amino acid components, namely dimers of linoleic acid (DLA) and tyrosine derived diphenols containing alkyl ester pendent chains, designated as “R” (DTR). Specific pendent chains were ethyl (E) and hexyl (H). These poly(aliphatic/aromatic-ester-amide)s were further reacted with poly(ethylene glycol) (PEG) and poly(ethylene glycol methyl ether) of different molecular masses, thus resulting in ABA type (hydrophilic-hydrophobic-hydrophilic) triblock copolymers. We used Fourier transform infrared (FTIR) and nuclear magnetic resonance (NMR) spectroscopies to evaluate the chemical structure of the final materials. The molecular masses were estimated by gel permeation chromatography (GPC) measurements. The self-organization of these new polymeric systems into micellar/nanospheric structures in aqueous environment was evaluated using ultraviolet/visible (UV-VIS) spectroscopy, dynamic light scattering (DLS) and transmission electron microscopy (TEM). The polymers were found to spontaneously self-assemble into nanoparticles with sizes in the range 196–239 nm and critical micelle concentration (CMC) of 0.125–0.250 mg/mL. The results are quite promising and these materials are capable of self-organizing into well-defined micelles/nanospheres encapsulating bioactive molecules, e.g., vitamins or antibacterial peptides for antibacterial coatings on medical devices. PMID:25347356
Abscisic Acid Synthesis and Response
Finkelstein, Ruth
2013-01-01
Abscisic acid (ABA) is one of the “classical” plant hormones, i.e. discovered at least 50 years ago, that regulates many aspects of plant growth and development. This chapter reviews our current understanding of ABA synthesis, metabolism, transport, and signal transduction, emphasizing knowledge gained from studies of Arabidopsis. A combination of genetic, molecular and biochemical studies has identified nearly all of the enzymes involved in ABA metabolism, almost 200 loci regulating ABA response, and thousands of genes regulated by ABA in various contexts. Some of these regulators are implicated in cross-talk with other developmental, environmental or hormonal signals. Specific details of the ABA signaling mechanisms vary among tissues or developmental stages; these are discussed in the context of ABA effects on seed maturation, germination, seedling growth, vegetative stress responses, stomatal regulation, pathogen response, flowering, and senescence. PMID:24273463
Synthesis and antiplasmodial activity of betulinic acid and ursolic acid analogues.
Innocente, Adrine M; Silva, Gloria N S; Cruz, Laura Nogueira; Moraes, Miriam S; Nakabashi, Myna; Sonnet, Pascal; Gosmann, Grace; Garcia, Célia R S; Gnoatto, Simone C B
2012-10-12
More than 40% of the World population is at risk of contracting malaria, which affects primarily poor populations in tropical and subtropical areas. Antimalarial pharmacotherapy has utilised plant-derived products such as quinine and artemisinin as well as their derivatives. However, worldwide use of these antimalarials has caused the spread of resistant parasites, resulting in increased malaria morbidity and mortality. Considering that the literature has demonstrated the antimalarial potential of triterpenes, specially betulinic acid (1) and ursolic acid (2), this study investigated the antimalarial activity against P. falciparum chloroquine-sensitive 3D7 strain of some new derivatives of 1 and 2 with modifications at C-3 and C-28. The antiplasmodial study employed flow cytometry and spectrofluorimetric analyses using YOYO-1, dihydroethidium and Fluo4/AM for staining. Among the six analogues obtained, compounds 1c and 2c showed excellent activity (IC₅₀ = 220 and 175 nM, respectively) while 1a and b demonstrated good activity (IC₅₀ = 4 and 5 μM, respectively). After cytotoxicity evaluation against HEK293T cells, 1a was not toxic, while 1c and 2c showed IC₅₀ of 4 μM and a selectivity index (SI) value of 18 and 23, respectively. Moreover, compound 2c, which presents the best antiplasmodial activity, is involved in the calcium-regulated pathway(s).
Fischer, Carol L; Dawson, Deborah V; Blanchette, Derek R; Drake, David R; Wertz, Philip W; Brogden, Kim A
2016-01-01
Lipids endogenous to skin and mucosal surfaces exhibit potent antimicrobial activity against Porphyromonas gingivalis, an important colonizer of the oral cavity implicated in periodontitis. Our previous work demonstrated the antimicrobial activity of the fatty acid sapienic acid (C(16:1Δ6)) against P. gingivalis and found that sapienic acid treatment alters both protein and lipid composition from those in controls. In this study, we further examined whole-cell protein differences between sapienic acid-treated bacteria and untreated controls, and we utilized open-source functional association and annotation programs to explore potential mechanisms for the antimicrobial activity of sapienic acid. Our analyses indicated that sapienic acid treatment induces a unique stress response in P. gingivalis resulting in differential expression of proteins involved in a variety of metabolic pathways. This network of differentially regulated proteins was enriched in protein-protein interactions (P = 2.98 × 10(-8)), including six KEGG pathways (P value ranges, 2.30 × 10(-5) to 0.05) and four Gene Ontology (GO) molecular functions (P value ranges, 0.02 to 0.04), with multiple suggestive enriched relationships in KEGG pathways and GO molecular functions. Upregulated metabolic pathways suggest increases in energy production, lipid metabolism, iron acquisition and processing, and respiration. Combined with a suggested preferential metabolism of serine, which is necessary for fatty acid biosynthesis, these data support our previous findings that the site of sapienic acid antimicrobial activity is likely at the bacterial membrane. P. gingivalis is an important opportunistic pathogen implicated in periodontitis. Affecting nearly 50% of the population, periodontitis is treatable, but the resulting damage is irreversible and eventually progresses to tooth loss. There is a great need for natural products that can be used to treat and/or prevent the overgrowth of periodontal pathogens and
Wang, Chao-Xian; Chen, Fang; Zhang, Wen-Fei; Zhang, Shi-Hai; Shi, Kui; Song, Han-Qing; Wang, Yi-Jiang; Kim, Sung Woo; Guan, Wu-Tai
2018-04-18
Leucine (Leu) plays an important role in protein synthesis and metabolism. The present study tested whether Leu supplementation in the diet for sows during late pregnancy could improve piglet birth weight, and it also investigated the possible underlying mechanism. Two hundred sows at day 70 of pregnancy were selected and assigned to four groups fed with following four diets until farrowing, respectively: corn and soybean meal-based diet group (CON), CON + 0.40% Leu, CON + 0.80% Leu, and CON + 1.20% Leu. We found that supplementing with 0.80% Leu significantly increased mean piglet birth weight ( P < 0.05). Supplementation with 0.40, 0.80, and 1.20% Leu increased the plasma concentration of Leu, while decreasing the plasma concentrations of valine (Val) and isoleucine (Ile) in both farrowing sows and newborn piglets ( P < 0.05). The protein expressions of amino acid transporters (including LAT1, SNAT1, SNAT2, 4F2hc, and rBAT) in duodenum, jejunum, ileum, longissimus dorsi muscle of newborn piglets, and placenta of sows showed a difference among the CON group and Leu supplemented groups. Expressions of p-mTOR, p-4E-BP1, and p-S6K1 in longissimus dorsi muscle were also enhanced in each of the supplemental Leu groups compared to CON ( P < 0.05). Collectively, these results indicated that 0.40-0.80% Leu supplementation during late gestation enhanced birth weight of fetal pigs by increasing protein synthesis through modulation of the plasma amino acids profile, amino acid transporters expression, and mTOR signaling pathway.
McNichols, Brett W.; Koubek, Joshua T.; Sellinger, Alan
2017-10-27
Here, we have developed a single step palladium-catalyzed Heck coupling of aryl halides with vinyl phosphonic acid to produce functionalized (E)-styryl phosphonic acids. This pathway utilizes a variety of commercially available aryl halides, vinyl phosphonic acid and Pd(P(tBu) 3) 2 as catalyst. These conditions produce a wide range of styryl phosphonic acids with high purities and good to excellent yields (31–80%).
DOE Office of Scientific and Technical Information (OSTI.GOV)
McNichols, Brett W.; Koubek, Joshua T.; Sellinger, Alan
Here, we have developed a single step palladium-catalyzed Heck coupling of aryl halides with vinyl phosphonic acid to produce functionalized (E)-styryl phosphonic acids. This pathway utilizes a variety of commercially available aryl halides, vinyl phosphonic acid and Pd(P(tBu) 3) 2 as catalyst. These conditions produce a wide range of styryl phosphonic acids with high purities and good to excellent yields (31–80%).
Kostman, Todd A.; Tarlyn, Nathan M.; Loewus, Frank A.; Franceschi, Vincent R.
2001-01-01
l-Ascorbic acid (AsA) and its metabolic precursors give rise to oxalic acid (OxA) found in calcium oxalate crystals in specialized crystal idioblast cells in plants; however, it is not known if AsA and OxA are synthesized within the crystal idioblast cell or transported in from surrounding mesophyll cells. Isolated developing crystal idioblasts from Pistia stratiotes were used to study the pathway of OxA biosynthesis and to determine if idioblasts contain the entire path and are essentially independent in OxA synthesis. Idioblasts were supplied with various 14C-labeled compounds and examined by micro-autoradiography for incorporation of 14C into calcium oxalate crystals. [14C]OxA gave heavy labeling of crystals, indicating the isolated idioblasts are functional in crystal formation. Incubation with [1-14C]AsA also gave heavy labeling of crystals, whereas [6-14C]AsA gave no labeling. Labeled precursors of AsA (l-[1-14C]galactose; d-[1-14C]mannose) also resulted in crystal labeling, as did the ascorbic acid analog, d-[1-14C]erythorbic acid. Intensity of labeling of isolated idioblasts followed the pattern OxA > AsA (erythorbic acid) > l-galactose > d-mannose. Our results demonstrate that P. stratiotes crystal idioblasts synthesize the OxA used for crystal formation, the OxA is derived from the number 1 and 2 carbons of AsA, and the proposed pathway of ascorbic acid synthesis via d-mannose and l-galactose is operational in individual P. stratiotes crystal idioblasts. These results are discussed with respect to fine control of calcium oxalate precipitation and the concept of crystal idioblasts as independent physiological compartments. PMID:11161021
Simple amides of oleanolic acid as effective penetration enhancers.
Bednarczyk-Cwynar, Barbara; Partyka, Danuta; Zaprutko, Lucjusz
2015-01-01
Transdermal transport is now becoming one of the most convenient and safe pathways for drug delivery. In some cases it is necessary to use skin penetration enhancers in order to allow for the transdermal transport of drugs that are otherwise insufficiently skin-permeable. A series of oleanolic acid amides as potential transdermal penetration enhancers was formed by multistep synthesis and the synthesis of all newly prepared compounds is presented. The synthetized amides of oleanolic acid were tested for their in vitro penetration promoter activity. The above activity was evaluated by means of using the Fürst method. The relationships between the chemical structure of the studied compounds and penetration activity are presented.
Simple Amides of Oleanolic Acid as Effective Penetration Enhancers
Bednarczyk-Cwynar, Barbara; Partyka, Danuta; Zaprutko, Lucjusz
2015-01-01
Transdermal transport is now becoming one of the most convenient and safe pathways for drug delivery. In some cases it is necessary to use skin penetration enhancers in order to allow for the transdermal transport of drugs that are otherwise insufficiently skin-permeable. A series of oleanolic acid amides as potential transdermal penetration enhancers was formed by multistep synthesis and the synthesis of all newly prepared compounds is presented. The synthetized amides of oleanolic acid were tested for their in vitro penetration promoter activity. The above activity was evaluated by means of using the Fürst method. The relationships between the chemical structure of the studied compounds and penetration activity are presented. PMID:26010090
van Geldermalsen, Michelle; Quek, Lake-Ee; Turner, Nigel; Freidman, Natasha; Pang, Angel; Guan, Yi Fang; Krycer, James R; Ryan, Renae; Wang, Qian; Holst, Jeff
2018-06-26
Cancer cells require increased levels of nutrients such as amino acids to sustain their rapid growth. In particular, leucine and glutamine have been shown to be important for growth and proliferation of some breast cancers, and therefore targeting the primary cell-surface transporters that mediate their uptake, L-type amino acid transporter 1 (LAT1) and alanine, serine, cysteine-preferring transporter 2 (ASCT2), is a potential therapeutic strategy. The ASCT2 inhibitor, benzylserine (BenSer), is also able to block LAT1 activity, thus inhibiting both leucine and glutamine uptake. We therefore aimed to investigate the effects of BenSer in breast cancer cell lines to determine whether combined LAT1 and ASCT2 inhibition could inhibit cell growth and proliferation. BenSer treatment significantly inhibited both leucine and glutamine uptake in MCF-7, HCC1806 and MDA-MB-231 breast cancer cells, causing decreased cell viability and cell cycle progression. These effects were not primarily leucine-mediated, as BenSer was more cytostatic than the LAT family inhibitor, BCH. Oocyte uptake assays with ectopically expressed amino acid transporters identified four additional targets of BenSer, and gas chromatography-mass spectrometry (GCMS) analysis of intracellular amino acid concentrations revealed that this BenSer-mediated inhibition of amino acid uptake was sufficient to disrupt multiple pathways of amino acid metabolism, causing reduced lactate production and activation of an amino acid response (AAR) through activating transcription factor 4 (ATF4). Together these data showed that BenSer blockade inhibited breast cancer cell growth and viability through disruption of intracellular amino acid homeostasis and inhibition of downstream metabolic and growth pathways.
Metabolic pathways for lipid synthesis under nitrogen stress in Chlamydomonas and Nannochloropsis.
Banerjee, Avik; Maiti, Subodh K; Guria, Chandan; Banerjee, Chiranjib
2017-01-01
Microalgae are currently being considered as a clean, sustainable and renewable energy source. Enzymes that catalyse the metabolic pathways for biofuel production are specific and require strict regulation and co-ordination. Thorough knowledge of these key enzymes along with their regulatory molecules is essential to enable rational metabolic engineering, to drive the metabolic flux towards the desired metabolites of importance. This paper reviews two key enzymes that play their role in production of bio-oil: DGAT (acyl-CoA:diacylglycerol acyltransferase) and PDAT (phospholipid:diacylglycerol acyltransferase). It also deals with the transcription factors that control the enzymes while cell undergoes a metabolic shift under stress. The paper also discusses the association of other enzymes and pathways that provide substrates and precursors for oil accumulation. Finally a futuristic solution has been proposed about a synthetic algal cell platform that would be committed towards biofuel synthesis.
Kursu, V. A. Samuli; Pietikäinen, Laura P.; Fontanesi, Flavia; Aaltonen, Mari J.; Suomi, Fumi; Nair, Remya Raghavan; Schonauer, Melissa S.; Dieckmann, Carol L.; Barrientos, Antoni; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.
2014-01-01
Summary Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild heme deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a coordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. PMID:24102902
Kursu, V A Samuli; Pietikäinen, Laura P; Fontanesi, Flavia; Aaltonen, Mari J; Suomi, Fumi; Raghavan Nair, Remya; Schonauer, Melissa S; Dieckmann, Carol L; Barrientos, Antoni; Hiltunen, J Kalervo; Kastaniotis, Alexander J
2013-11-01
Mitochondrial fatty acid synthesis (mtFAS) shares acetyl-CoA with the Krebs cycle as a common substrate and is required for the production of octanoic acid (C8) precursors of lipoic acid (LA) in mitochondria. MtFAS is a conserved pathway essential for respiration. In a genetic screen in Saccharomyces cerevisiae designed to further elucidate the physiological role of mtFAS, we isolated mutants with defects in mitochondrial post-translational gene expression processes, indicating a novel link to mitochondrial gene expression and respiratory chain biogenesis. In our ensuing analysis, we show that mtFAS, but not lipoylation per se, is required for respiratory competence. We demonstrate that mtFAS is required for mRNA splicing, mitochondrial translation and respiratory complex assembly, and provide evidence that not LA per se, but fatty acids longer than C8 play a role in these processes. We also show that mtFAS- and LA-deficient strains suffer from a mild haem deficiency that may contribute to the respiratory complex assembly defect. Based on our data and previously published information, we propose a model implicating mtFAS as a sensor for mitochondrial acetyl-CoA availability and a co-ordinator of nuclear and mitochondrial gene expression by adapting the mitochondrial compartment to changes in the metabolic status of the cell. © 2013 John Wiley & Sons Ltd.
2010-06-11
the cinnamic acid phenyl ring. Although compound 4c proved to be very cytotoxic in HUVEC over a 24 h period, the toxicity is less apparent over a 5 h...drug development process, as it determines how much of the initial dose actually reaches the target site. Cinnamic acid -derived amides are known to...Synthesis of a series of caffeic acid phenethyl amide (CAPA) fluorinated derivatives: Comparison of cytoprotective effects to caffeic acid phenethyl
Microbial synthesis of propane by engineering valine pathway and aldehyde-deformylating oxygenase.
Zhang, Lei; Liang, Yajing; Wu, Wei; Tan, Xiaoming; Lu, Xuefeng
2016-01-01
Propane, a major component of liquid petroleum gas (LPG) derived from fossil fuels, has widespread applications in vehicles, cooking, and ambient heating. Given the concerns about fossil fuel depletion and carbon emission, exploiting alternative and renewable source of propane have become attractive. In this study, we report the construction of a novel propane biosynthetic pathway in Escherichia coli. We constructed an aldehyde reductases (ALR)-deprived E. coli strain BW25113(DE3) Δ13 via genetic engineering, which produced sufficient isobutyraldehyde precursors and finally achieved de novo synthesis of propane (91 μg/L) by assembling the engineered valine pathway and cyanobacterial aldehyde-deformylating oxygenase (ADO). Additionally, after extensive screening of ADO mutants generated by engineering the active center to accommodate branched-chain isobutyraldehyde, we identified two ADO mutants (I127G, I127G/A48G) which exhibited higher catalytic activity for isobutyraldehyde and improved propane productivity by three times (267 μg/L). The propane biosynthetic pathway constructed here through the engineered valine pathway can produce abundant isobutyraldehyde for ADO and overcome the low availability of precursors in propane production. Furthermore, the rational design aiming at the ADO active center illustrates the plasticity and catalytic potential of ADO. These results together highlight the potential for developing a microbial biomanufacturing platform for propane.
Nuclear Synthesis of Cytoplasmic Ribonucleic Acid in Amoeba proteus
Prescott, David M.
1959-01-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells. PMID:14434750
Nuclear synthesis of cytoplasmic ribonucleic acid in Amoeba proteus.
PRESCOTT, D M
1959-10-01
The enucleation technique has been applied to Amoeba proteus by several laboratories in attempts to determine whether the cytoplasm is capable of nucleus-independent ribonucleic acid synthesis. This cell is very convenient for micrurgy, but its use requires a thorough starvation period to eliminate the possibility of metabolic influence by food vacuoles and frequent washings and medium renewal to maintain asepsis. In the experiments described here, amoebae were starved for periods of 24 to 96 hours, cut into nucleated and enucleated halves, and exposed to either C-14 uracil, C-14 adenine, C-14 orotic acid, or a mixture of all three. When the starvation period was short (less than 72 hours), organisms (especially yeast cells) contained within amoeba food vacuoles frequently showed RNA synthesis in both nucleated and enucleated amoebae. When the preperiod of starvation was longer than 72 hours, food vacuole influence was apparently negligible, and a more meaningful comparison between enucleated and nucleated amoebae was possible. Nucleated cells incorporated all three precursors into RNA; enucleated cells were incapable of such incorporation. The experiments indicate a complete dependence on the nucleus for RNA synthesis. The conflict with the experimental results of others on this problem could possibly stem from differences in culture conditions, starvation treatment, or experimental conditions. For an unequivocal answer in experiments of this design, ideally the cells should be capable of growth on an entirely synthetic medium under aseptic conditions. The use of a synthetic medium (experiments with A. proteus are done under starvation conditions) would permit, moreover, a more realistic comparison of metabolic capacities of nucleated and enucleated cells.
Velasco-Lozano, Susana; da Silva, Eunice S; Llop, Jordi; López-Gallego, Fernando
2018-02-16
The enzymatic synthesis of α-amino acids is a sustainable and efficient alternative to chemical processes, through which achieving enantiopure products is difficult. To more address this synthesis efficiently, a hierarchical architecture that irreversibly co-immobilises an amino acid dehydrogenase with polyethyleneimine on porous agarose beads has been designed and fabricated. The cationic polymer acts as an irreversible anchoring layer for the formate dehydrogenase. In this architecture, the two enzymes and polymer colocalise across the whole microstructure of the porous carrier. This multifunctional heterogeneous biocatalyst was kinetically characterised and applied to the enantioselective synthesis of a variety of canonical and noncanonical α-amino acids in both discontinuous (batch) and continuous modes. The co-immobilised bienzymatic system conserves more than 50 % of its initial effectiveness after five batch cycles and 8 days of continuous operation. Additionally, the environmental impact of this process has been semiquantitatively calculated and compared with the state of the art. © 2018 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.
Li, Pei; Gan, Yibo; Xu, Yuan; Li, Songtao; Song, Lei; Li, Sukai; Li, Huijuan; Zhou, Qiang
2016-06-01
Matrix homeostasis within the nucleus pulposus (NP) is important for disc function. Unfortunately, the effects of osmolarity on NP matrix synthesis in a disc organ culture system and the underlying mechanisms are largely unknown. The present study was to investigate the effects of different osmolarity modes (constant and cyclic) and osmolarity levels (hypo-, iso-, and hyper-) on NP matrix synthesis using a disc organ culture system and determine whether ERK1/2 or p38MAPK pathway has a role in this process. Porcine discs were cultured for 7 days in various osmotic media, including constant hypo-, iso-, hyper-osmolarity (330, 430, and 550 mOsm/kg, respectively) and cyclic-osmolarity (430 mOsm/kg for 8 h, followed by 550 mOsm/kg for 16 h). The role of ERK1/2 and p38MAPK pathways were determined by their inhibitors U0126 and SB202190 respectively. The expression of SOX9 and downstream aggrecan and collagen II, biochemical content, and histology were used to assess NP matrix synthesis. The findings revealed that NP matrix synthesis was promoted in iso- and cyclic-osmolarity cultures compared to hypo- or hyper-osmolarity culture although the level of matrix synthesis in cyclic-osmolarity culture did not reach that in iso-osmolarity culture. Further analysis suggested that inhibition of the ERK1/2 or p38MAPK pathway in iso- and cyclic-osmolarity cultures reduced NP matrix production. Therefore, we concluded that the effects of osmolarity on NP matrix synthesis depend on osmolarity level (hypo-, iso-, or hyper-) and osmolarity mode (constant or cyclic), and the ERK1/2 and p38MAPK pathways may participate in this process. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc. J Orthop Res 34:1092-1100, 2016. © 2015 Orthopaedic Research Society. Published by Wiley Periodicals, Inc.
van Rossum, Harmen M; Kozak, Barbara U; Pronk, Jack T; van Maris, Antonius J A
2016-07-01
Saccharomyces cerevisiae is an important industrial cell factory and an attractive experimental model for evaluating novel metabolic engineering strategies. Many current and potential products of this yeast require acetyl coenzyme A (acetyl-CoA) as a precursor and pathways towards these products are generally expressed in its cytosol. The native S. cerevisiae pathway for production of cytosolic acetyl-CoA consumes 2 ATP equivalents in the acetyl-CoA synthetase reaction. Catabolism of additional sugar substrate, which may be required to generate this ATP, negatively affects product yields. Here, we review alternative pathways that can be engineered into yeast to optimize supply of cytosolic acetyl-CoA as a precursor for product formation. Particular attention is paid to reaction stoichiometry, free-energy conservation and redox-cofactor balancing of alternative pathways for acetyl-CoA synthesis from glucose. A theoretical analysis of maximally attainable yields on glucose of four compounds (n-butanol, citric acid, palmitic acid and farnesene) showed a strong product dependency of the optimal pathway configuration for acetyl-CoA synthesis. Moreover, this analysis showed that combination of different acetyl-CoA production pathways may be required to achieve optimal product yields. This review underlines that an integral analysis of energy coupling and redox-cofactor balancing in precursor-supply and product-formation pathways is crucial for the design of efficient cell factories. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
Bile acid disease: the emerging epidemic.
Oduyebo, Ibironke; Camilleri, Michael
2017-05-01
Our objective was to review advances in bile acids in health and disease published in the last 2 years. Bile acid diarrhea (BAD) is recognized as a common cause of chronic diarrhea, and its recognition has been facilitated by development of new screening tests. Primary BAD can account for 30% of cases of chronic diarrhea. The mechanisms leading to BAD include inadequate feedback regulation by fibroblast growth factor 19 (FGF-19) from ileal enterocytes, abnormalities in synthesis or degradation of proteins involved in FGF-19 regulation in hepatocytes and variations as a function of the bile acid receptor, TGR5 (GPBAR1). SeHCAT is the most widely used test for diagnosis of BAD. There has been significant validation of fasting serum FGF-19 and 7 α-hydroxy-cholesten-3-one (C4), a surrogate measure of bile acid synthesis. Bile acid sequestrants are the primary treatments for BAD; the farnesoid X-receptor-FGF-19 pathway provides alternative therapeutic targets for BAD. Bile acid-stimulated intestinal mechanisms contribute to the beneficial effects of bariatric surgery on obesity, glycemic control and the treatment of recurrent Clostridium difficile infection. Renewed interest in the role of bile acids is leading to novel management of diverse diseases besides BAD.
Huang, Huan; McIntosh, Avery L.; Martin, Gregory G.; Petrescu, Anca D.; Landrock, Kerstin K.; Landrock, Danilo; Kier, Ann B.; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor-α (PPARα) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPARα transcription of the fatty acid β-oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPARα in the context of high glucose at levels similar to those in uncontrolled diabetes. PMID:23533380
Rahman, Taha Abd El; Oirdi, Mohamed El; Gonzalez-Lamothe, Rocio; Bouarab, Kamal
2012-12-01
Plants use different immune pathways to combat pathogens. The activation of the jasmonic acid (JA)-signaling pathway is required for resistance against necrotrophic pathogens; however, to combat biotrophic pathogens, the plants activate mainly the salicylic acid (SA)-signaling pathway. SA can antagonize JA signaling and vice versa. NPR1 (noninducible pathogenesis-related 1) is considered a master regulator of SA signaling. NPR1 interacts with TGA transcription factors, ultimately leading to the activation of SA-dependent responses. SA has been shown to promote disease development caused by the necrotrophic pathogen Botrytis cinerea through NPR1, by suppressing the expression of two JA-dependent defense genes, proteinase inhibitors I and II. We show here that the transcription factor TGA1.a contributes to disease development caused by B. cinerea in tomato by suppressing the expression of proteinase inhibitors I and II. Finally, we present evidence that the SA-signaling pathway contributes to disease development caused by another necrotrophic pathogen, Alternaria solani, in tomato. Disease development promoted by SA through NPR1 requires the TGA1.a transcription factor. These data highlight how necrotrophs manipulate the SAsignaling pathway to promote their disease in tomato.
USDA-ARS?s Scientific Manuscript database
The postprandial rise in amino acids, particularly leucine, stimulates muscle protein synthesis in neonates. Previously, we showed that a 1-h infusion of leucine increased protein synthesis, but this response was not sustained for 2 h unless the leucine-induced decrease in amino acids was prevented....
Viegas, Ivan; Rito, João; Jarak, Ivana; Leston, Sara; Carvalho, Rui A; Metón, Isidoro; Pardal, Miguel A; Baanante, Isabel V; Jones, John G
2012-09-01
Hepatic glycogen synthesis fluxes from direct and indirect pathways were quantified in seabass by postmortem (2)H NMR analysis of plasma water (PW) and glycogen glucosyl (2)H enrichments from (2)H-enriched seawater. Eighteen fish (28.0 ± 1.7 cm and 218.0 ± 43.0 g) were divided into three groups of 6 and studied over 24 days with transfer to 5% (2)H-seawater after day 21. Over this period, one group was fed daily with fishmeal, a second group was fasted, and a third group was fasted for 21 days followed by 3 days refeeding. Glycogen turnover and sources were determined from the ratio of glucosyl position 5 enrichment to that of plasma water (H5/PW). Glycogen levels of fed fish were significantly higher than fasted (665.4 ± 345.2 μmol.g(-1) liver versus 77.2 ± 59.5 μmol.g(-1) liver, P<0.05) while refed fish had comparable levels to fed (584.6 ± 140.4 μmol.g(-1) liver). Glycogen enrichment of fed fish was undetectable indicating negligible turnover over 3 days. For fasted fish, H5/PW was ~50% indicating that half of the glycogen had turned over via indirect pathway flux. For refed fish, H5/PW was ~100% indicating that the indirect pathway accounted for all net glycogen synthesis. Direct pathway conversion of dietary carbohydrate to glycogen was not detected in any of the groups. Copyright © 2012 Elsevier Inc. All rights reserved.
Al-Bogami, Abdullah S; Saleh, Tamer S; Zayed, Ehab M
2013-09-01
The present paper deal with the multi-component condensation of 8-hydroxy quinoline, aromatic aldehydes, and sulfone derivatives catalyzed by p-toluenesulfonic acid for the synthesis of a series of 4H-pyrano[3,2-h]quinoline derivatives in ethanol under ultrasonic irradiations. We provide a series of quinoline derivatives containing sulfone moiety interesting for biological screening tests. The reactions were carried out under both conventional and ultrasonic irradiation conditions. In general, improvement in rates and yields were observed when reactions were carried out under sonication compared with classical silent conditions. Also, also, sonochemical reaction give different reaction pathway other than silent reaction. These remarkable effects appeared in sonicated reactions can be reasonably interpreted in terms of acoustic cavitation phenomenon. Structures of the products were established on analytical and spectral data. Copyright © 2013 Elsevier B.V. All rights reserved.
PROTEASOME INHIBITOR TREATMENT REDUCED FATTY ACID, TRIACYLGLYCEROL AND CHOLESTEROL SYNTHESIS
Oliva, Joan; French, Samuel W.; Li, Jun; Bardag-Gorce, Fawzia
2014-01-01
In the present study, the beneficial effects of proteasome inhibitor treatment in reducing ethanol-induced steatosis were investigated. A microarray analysis was performed on the liver of rats injected with PS-341 (Bortezomib, Velcade®), and the results showed that proteasome inhibitor treatment significantly reduced the mRNA expression of SREBP-1c, and the downstream lipogenic enzymes, such as fatty acid synthase (FAS) and acetyl-CoA carboxylase (ACC), which catalyzes the carboxylation of acetyl-CoA to malonyl-CoA, the rate-limiting step in fatty acid synthesis. ELOVL6, which is responsible for fatty acids long chain elongation, was also significantly down regulated by proteasome inhibitor treatment. Moreover, PS-341 administration significantly reduced the expression of acyl-glycerol-3-phosphate acyltransferase (AGPAT), and diacylglycerol acyltransferase (DGAT), enzyme involved in triacylglycerol (TAG) synthesis. Finally, PS-341 was found to down regulate the enzymes 3-hydroxy-3-methylglutaryl-CoenzymeA synthase (HMG-CoA synthase) that is responsible for cholesterol synthesis. Proteasome inhibitor was also found to play a role in intestinal lipid adsorption because apolipoproteins A (apoA-I, apoAII, apoA-IV and ApoCIII) were down regulated by proteasome inhibitor treatment, especially ApoA-II that is known to be a marker of alcohol consumption. Proteasome inhibitor treatment also decreased apobec-1 complementation factor (ACF) leading to lower level of editing and production of ApoB protein. Moreover apolipoprotein C-III, a major component of chylomicrons was significantly down regulated. However, lipoprotein lipase (Lpl) and High density lipoprotein binding protein (Hdlbp) mRNA levels were increased by proteasome inhibitor treatment. These results suggested that proteasome inhibitor treatment could be used to reduce the alcohol-enhanced lipogenesis and alcohol-induced liver steatosis. A morphologic analysis, performed on the liver of rats fed ethanol for one
Ibeagha-Awemu, Eveline M; Li, Ran; Ammah, Adolf A; Dudemaine, Pier-Luc; Bissonnette, Nathalie; Benchaar, Chaouki; Zhao, Xin
2016-02-09
Nutritional strategies can decrease saturated fatty acids (SFAs) and increase health beneficial fatty acids (FAs) in bovine milk. The pathways/genes involved in these processes are not properly defined. Next-generation RNA-sequencing was used to investigate the bovine mammary gland transcriptome following supplemental feeding with 5% linseed oil (LSO) or 5% safflower oil (SFO). Holstein cows in mid-lactation were fed a control diet for 28 days (control period) followed by supplementation with 5% LSO (12 cows) or 5% SFO (12 cows) for 28 days (treatment period). Milk and mammary gland biopsies were sampled on days-14 (control period), +7 and +28 (treatment period). Milk was used to measure fat(FP)/protein(PP) percentages and individual FAs while RNA was subjected to sequencing. Milk FP was decreased by 30.38% (LSO) or 32.42% (SFO) while PP was unaffected (LSO) or increased (SFO). Several beneficial FAs were increased by LSO (C18:1n11t, CLA:10t12c, CLA:9c11t, C20:3n3, C20:5n3, C22:5n3) and SFO (C18:1n11t, CLA:10t12c, C20:1c11, C20:2, C20:3n3) while several SFAs (C4:0, C6:0, C8:0, C14:0, C16:0, C17:0, C24:0) were decreased by both treatments (P < 0.05). 1006 (460 up- and 546 down-regulated) and 199 (127 up- and 72 down-regulated) genes were significantly differentially regulated (DE) by LSO and SFO, respectively. Top regulated genes (≥ 2 fold change) by both treatments (FBP2, UCP2, TIEG2, ANGPTL4, ALDH1L2) are potential candidate genes for milk fat traits. Involvement of SCP2, PDK4, NQO1, F2RL1, DBI, CPT1A, CNTFR, CALB1, ACADVL, SPTLC3, PIK3CG, PIGZ, ADORA2B, TRIB3, HPGD, IGFBP2 and TXN in FA/lipid metabolism in dairy cows is being reported for the first time. Functional analysis indicated similar and different top enriched functions for DE genes. DE genes were predicted to significantly decrease synthesis of FA/lipid by both treatments and FA metabolism by LSO. Top canonical pathways associated with DE genes of both treatments might be involved in lipid
An adaptation to life in acid through a novel mevalonate pathway
Vinokur, Jeffrey M.; Cummins, Matthew C.; Korman, Tyler P.; ...
2016-12-22
Here, extreme acidophiles are capable of growth at pH values near zero. Sustaining life in acidic environments requires extensive adaptations of membranes, proton pumps, and DNA repair mechanisms. Here we describe an adaptation of a core biochemical pathway, the mevalonate pathway, in extreme acidophiles. Two previously known mevalonate pathways involve ATP dependent decarboxylation of either mevalonate 5-phosphate or mevalonate 5-pyrophosphate, in which a single enzyme carries out two essential steps: (1) phosphorylation of the mevalonate moiety at the 3-OH position and (2) subsequent decarboxylation. We now demonstrate that in extreme acidophiles, decarboxylation is carried out by two separate steps: previouslymore » identified enzymes generate mevalonate 3,5-bisphosphate and a new decarboxylase we describe here, mevalonate 3,5-bisphosphate decarboxylase, produces isopentenyl phosphate. Why use two enzymes in acidophiles when one enzyme provides both functionalities in all other organisms examined to date? We find that at low pH, the dual function enzyme, mevalonate 5-phosphate decarboxylase is unable to carry out the first phosphorylation step, yet retains its ability to perform decarboxylation. We therefore propose that extreme acidophiles had to replace the dual-purpose enzyme with two specialized enzymes to efficiently produce isoprenoids in extremely acidic environments.« less
An adaptation to life in acid through a novel mevalonate pathway
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vinokur, Jeffrey M.; Cummins, Matthew C.; Korman, Tyler P.
Here, extreme acidophiles are capable of growth at pH values near zero. Sustaining life in acidic environments requires extensive adaptations of membranes, proton pumps, and DNA repair mechanisms. Here we describe an adaptation of a core biochemical pathway, the mevalonate pathway, in extreme acidophiles. Two previously known mevalonate pathways involve ATP dependent decarboxylation of either mevalonate 5-phosphate or mevalonate 5-pyrophosphate, in which a single enzyme carries out two essential steps: (1) phosphorylation of the mevalonate moiety at the 3-OH position and (2) subsequent decarboxylation. We now demonstrate that in extreme acidophiles, decarboxylation is carried out by two separate steps: previouslymore » identified enzymes generate mevalonate 3,5-bisphosphate and a new decarboxylase we describe here, mevalonate 3,5-bisphosphate decarboxylase, produces isopentenyl phosphate. Why use two enzymes in acidophiles when one enzyme provides both functionalities in all other organisms examined to date? We find that at low pH, the dual function enzyme, mevalonate 5-phosphate decarboxylase is unable to carry out the first phosphorylation step, yet retains its ability to perform decarboxylation. We therefore propose that extreme acidophiles had to replace the dual-purpose enzyme with two specialized enzymes to efficiently produce isoprenoids in extremely acidic environments.« less
Appearance of an Alternate Pathway Cyanide-resistant during Germination of Seeds of Cicer arietinum
Burguillo, Placido De La Fuente; Nicolás, Gregorio
1977-01-01
The combined action of the inhibitors antimycin A and cyanide with benzohydroxamic acid indicates the presence of a cyanide-resistant pathway of respiration in chick pea (Cicer arietinum L.) seeds. The appearance of this pathway takes place during germination. During the first 12 hours of germination, the respiration is predominantly cyanide-sensitive, showing after this time a shift to an “alternate” respiration which is sensitive to benzohydroxamic acid, reaching the maximal cyanide resistance between 72 and 96 hours of germination. The appearance of the alternate pathway is initiated by high O2 concentrations and depends on cytoplasmic protein synthesis, since its appearance is inhibited by cycloheximide but not by chloramphenicol. Actinomycin D has no effect on the appearance of the alternate pathway. Our results indicate, in agreement with other authors, that the branching point is located between the flavoproteins and cytochromes b, probably at the level of ubiquinone, but the possibility of more than one branching point of the electron flow is also considered. PMID:16660130
NASA Astrophysics Data System (ADS)
Karunakaran, Gopalu; Maduraiveeran, Govindhan; Kolesnikov, Evgeny; Balasingam, Suresh Kannan; Viktorovich, Lysov Dmitry; Ilinyh, Igor; Gorshenkov, Mikhail V.; Sasidharan, Manickam; Kuznetsov, Denis; Kundu, Manab
2018-05-01
We have synthesized NiCo2O4 nanoparticles (NCO NPs) using an ascorbic acid-assisted co-precipitation method for the first time. When NCO NPs are used as an anode material for lithium-ion batteries, the cell exhibits superior lithium storage properties, such as high capacity (700 mA h g-1 after 300 cycles at 200 mA g-1), excellent rate capabilities (applied current density range 100-1200 mA g-1), and impressive cycling stability (at 1200 mA g-1 up to 650 cycles). The enhanced electrochemical properties of NCO NPs are due to the nanometer dimensions which not only offers a smooth charge-transport pathway and short diffusion paths of the lithium ions but also adequate spaces for volume expansion during Li storage. Hence, this eco-friendly synthesis approach will provide a new strategy for the synthesis of various nanostructured metal oxide compounds, for energy conversion and storage systems applications.
Parallel evolution of Nitric Oxide signaling: Diversity of synthesis & memory pathways
Moroz, Leonid L.; Kohn, Andrea B.
2014-01-01
The origin of NO signaling can be traceable back to the origin of life with the large scale of parallel evolution of NO synthases (NOSs). Inducible-like NOSs may be the most basal prototype of all NOSs and that neuronal-like NOS might have evolved several times from this prototype. Other enzymatic and non-enzymatic pathways for NO synthesis have been discovered using reduction of nitrites, an alternative source of NO. Diverse synthetic mechanisms can co-exist within the same cell providing a complex NO-oxygen microenvironment tightly coupled with cellular energetics. The dissection of multiple sources of NO formation is crucial in analysis of complex biological processes such as neuronal integration and learning mechanisms when NO can act as a volume transmitter within memory-forming circuits. In particular, the molecular analysis of learning mechanisms (most notably in insects and gastropod molluscs) opens conceptually different perspectives to understand the logic of recruiting evolutionarily conserved pathways for novel functions. Giant uniquely identified cells from Aplysia and related species precent unuque opportunities for integrative analysis of NO signaling at the single cell level. PMID:21622160
Amino acid homeostasis and signalling in mammalian cells and organisms
Bröer, Angelika
2017-01-01
Cells have a constant turnover of proteins that recycle most amino acids over time. Net loss is mainly due to amino acid oxidation. Homeostasis is achieved through exchange of essential amino acids with non-essential amino acids and the transfer of amino groups from oxidised amino acids to amino acid biosynthesis. This homeostatic condition is maintained through an active mTORC1 complex. Under amino acid depletion, mTORC1 is inactivated. This increases the breakdown of cellular proteins through autophagy and reduces protein biosynthesis. The general control non-derepressable 2/ATF4 pathway may be activated in addition, resulting in transcription of genes involved in amino acid transport and biosynthesis of non-essential amino acids. Metabolism is autoregulated to minimise oxidation of amino acids. Systemic amino acid levels are also tightly regulated. Food intake briefly increases plasma amino acid levels, which stimulates insulin release and mTOR-dependent protein synthesis in muscle. Excess amino acids are oxidised, resulting in increased urea production. Short-term fasting does not result in depletion of plasma amino acids due to reduced protein synthesis and the onset of autophagy. Owing to the fact that half of all amino acids are essential, reduction in protein synthesis and amino acid oxidation are the only two measures to reduce amino acid demand. Long-term malnutrition causes depletion of plasma amino acids. The CNS appears to generate a protein-specific response upon amino acid depletion, resulting in avoidance of an inadequate diet. High protein levels, in contrast, contribute together with other nutrients to a reduction in food intake. PMID:28546457
Lipid Synthesis in Protozoan Parasites: a Comparison Between Kinetoplastids and Apicomplexans
Ramakrishnan, Srinivasan; Serricchio, Mauro; Striepen, Boris; Bütikofer, Peter
2013-01-01
Lipid metabolism is of crucial importance for pathogens. Lipids serve as cellular building blocks, signalling molecules, energy stores, posttranslational modifiers, and pathogenesis factors. Parasites rely on a complex system of uptake and synthesis mechanisms to satisfy their lipid needs. The parameters of this system change dramatically as the parasite transits through the various stages of its life cycle. Here we discuss the tremendous recent advances that have been made in the understanding of the synthesis and uptake pathways for fatty acids and phospholipids in apicomplexan and kinetoplastid parasites, including Plasmodium, Toxoplasma, Cryptosporidium, Trypanosoma and Leishmania. Lipid synthesis differs in significant ways between parasites from both phyla and the human host. Parasites have acquired novel pathways through endosymbiosis, as in the case of the apicoplast, have dramatically reshaped substrate and product profiles, and have evolved specialized lipids to interact with or manipulate the host. These differences potentially provide opportunities for drug development. We outline the lipid pathways for key species in detail as they progress through the developmental cycle and highlight those that are of particular importance to the biology of the pathogens and/or are the most promising targets for parasite-specific treatment. PMID:23827884
Targeting Cytosolic Nucleic Acid-Sensing Pathways for Cancer Immunotherapies.
Iurescia, Sandra; Fioretti, Daniela; Rinaldi, Monica
2018-01-01
The innate immune system provides the first line of defense against pathogen infection though also influences pathways involved in cancer immunosurveillance. The innate immune system relies on a limited set of germ line-encoded sensors termed pattern recognition receptors (PRRs), signaling proteins and immune response factors. Cytosolic receptors mediate recognition of danger damage-associated molecular patterns (DAMPs) signals. Once activated, these sensors trigger multiple signaling cascades, converging on the production of type I interferons and proinflammatory cytokines. Recent studies revealed that PRRs respond to nucleic acids (NA) released by dying, damaged, cancer cells, as danger DAMPs signals, and presence of signaling proteins across cancer types suggests that these signaling mechanisms may be involved in cancer biology. DAMPs play important roles in shaping adaptive immune responses through the activation of innate immune cells and immunological response to danger DAMPs signals is crucial for the host response to cancer and tumor rejection. Furthermore, PRRs mediate the response to NA in several vaccination strategies, including DNA immunization. As route of double-strand DNA intracellular entry, DNA immunization leads to expression of key components of cytosolic NA-sensing pathways. The involvement of NA-sensing mechanisms in the antitumor response makes these pathways attractive drug targets. Natural and synthetic agonists of NA-sensing pathways can trigger cell death in malignant cells, recruit immune cells, such as DCs, CD8 + T cells, and NK cells, into the tumor microenvironment and are being explored as promising adjuvants in cancer immunotherapies. In this minireview, we discuss how cGAS-STING and RIG-I-MAVS pathways have been targeted for cancer treatment in preclinical translational researches. In addition, we present a targeted selection of recent clinical trials employing agonists of cytosolic NA-sensing pathways showing how these pathways
Enzymology of the Wood–Ljungdahl Pathway of Acetogenesis
Ragsdale, Stephen W.
2011-01-01
The biochemistry of acetogenesis is reviewed. The microbes that catalyze the reactions that are central to acetogenesis are described and the focus is on the enzymology of the process. These microbes play a key role in the global carbon cycle, producing over 10 trillion kilograms of acetic acid annually. Acetogens have the ability to anaerobically convert carbon dioxide and CO into acetyl-CoA by the Wood–Ljungdahl pathway, which is linked to energy conservation. They also can convert the six carbons of glucose stoichiometrically into 3 mol of acetate using this pathway. Acetogens and other anaerobic microbes (e.g., sulfate reducers and methanogens) use the Wood–Ljungdahl pathway for cell carbon synthesis. Important enzymes in this pathway that are covered in this review are pyruvate ferredoxin oxidoreductase, CO dehydrogenase/acetyl-CoA synthase, a corrinoid iron-sulfur protein, a methyltransferase, and the enzymes involved in the conversion of carbon dioxide to methyl-tetrahydrofolate. PMID:18378591
Hashim, Puziah
2014-03-01
Centella asiatica (Linn.) Urban is well known in promoting wound healing and provides significant benefits in skin care and therapeutic products formulation. Glycolic acid and vitamins also play a role in the enhancement of collagen and fibronectin synthesis. Here, we evaluate the specific effect of Centella asiatica (CA), vitamins, glycolic acid and their mixture preparations to stimulate collagen and fibronectin synthesis in cultured human fibroblast cells. The fibroblast cells are incubated with CA, glycolic acid, vitamins and their mixture preparations for 48 h. The cell lysates were analyzed for protein content and collagen synthesis by direct binding enzyme immunoassay. The fibronectin of the cultured supernatant was measured by sandwich enzyme immunoassay. The results showed that CA, glycolic acid, vitamins A, E and C significantly stimulate collagen and fibronectin synthesis in the fibroblast. Addition of glycolic acid and vitamins to CA further increased the levels of collagen and fibronectin synthesis to 8.55 and 23.75 μg/100 μg, respectively. CA, glycolic acid, vitamins A, E, and C, and their mixtures demonstrated stimulatory effect on both extra-cellular matrix synthesis of collagen and fibronectin in in vitro studies on human foreskin fibroblasts, which is beneficial to skin care and therapeutic products formulation.
Fu, Jilagamazhi; Sharma, Parveen; Spicer, Vic; Krokhin, Oleg V.; Zhang, Xiangli; Fristensky, Brian; Cicek, Nazim; Sparling, Richard; Levin, David. B.
2015-01-01
Transcriptomes and proteomes of Pseudomonas putida LS46 cultured with biodiesel-derived waste glycerol or waste free fatty acids, as sole carbon sources, were compared under conditions that were either permissive or non-permissive for synthesis of medium chain length polyhydroxyalkanoates (mcl-PHA). The objectives of this study were to elucidate mechanisms that influence activation of biopolymer synthesis, intra-cellular accumulation, and monomer composition, and determine if these were physiologically specific to the carbon sources used for growth of P. putida LS46. Active mcl-PHA synthesis by P. putida LS46 was associated with high expression levels of key mcl-PHA biosynthesis genes and/or gene products including monomer-supplying proteins, PHA synthases, and granule-associated proteins. ‘Omics data suggested that expression of these genes were regulated by different genetic mechanisms in P. putida LS46 cells in different physiological states, when cultured on the two waste carbon sources. Optimal polymer production by P. putida LS46 was primarily limited by less efficient glycerol metabolism during mcl-PHA synthesis on waste glycerol. Mapping the ‘Omics data to the mcl-PHA biosynthetic pathway revealed significant variations in gene expression, primarily involved in: 1) glycerol transportation; 2) enzymatic reactions that recycle reducing equivalents and produce key mcl-PHA biosynthesis pathway intermediates (e.g. NADH/NADPH, acetyl-CoA). Active synthesis of mcl-PHAs was observed during exponential phase in cultures with waste free fatty acids, and was associated with the fatty acid beta-oxidation pathway. A putative Thioesterase in the beta-oxidation pathway that may regulate the level of fatty acid beta-oxidation intermediates, and thus carbon flux to mcl-PHA biosynthesis, was highly up-regulated. Finally, the data suggested that differences in expression of selected fatty acid metabolism and mcl-PHA monomer-supplying enzymes may play a role in determining
NASA Astrophysics Data System (ADS)
Li, Li; Liu, Jianbo; Yang, Xiaohai; Huang, Jin; He, Dinggeng; Guo, Xi; Wan, Lan; He, Xiaoxiao; Wang, Kemin
2016-03-01
Amino acid-dithiocarbamate (amino acid-DTC) was developed as both the reductant and ligand stabilizer for biomimetic synthesis of gold nanoparticles (AuNPs), which served as an excellent surface-enhanced Raman scattering (SERS) contrast nanoprobe for cell imaging. Glycine (Gly), glutamic acid (Glu), and histidine (His) with different isoelectric points were chosen as representative amino acid candidates to synthesize corresponding amino acid-DTC compounds through mixing with carbon disulfide (CS2), respectively. The pyrogenic decomposition of amino acid-DTC initiated the reduction synthesis of AuNPs, and the strong coordinating dithiocarbamate group of amino acid-DTC served as a stabilizer that grafted onto the surface of the AuNPs, which rendered the as-prepared nanoparticles a negative surface charge and high colloidal stability. MTT cell viability assay demonstrated that the biomimetic AuNPs possessed neglectful toxicity to the human hepatoma cell, which guaranteed them good biocompatibility for biomedical application. Meanwhile, the biomimetic AuNPs showed a strong SERS effect with an enhancement factor of 9.8 × 105 for the sensing of Rhodamine 6G, and two distinct Raman peaks located at 1363 and 1509 cm-1 could be clearly observed in the cell-imaging experiments. Therefore, biomimetic AuNPs can be explored as an excellent SERS contrast nanoprobe for biomedical imaging, and the amino acid-DTC mediated synthesis of the AuNPs has a great potential in bio-engineering and biomedical imaging applications.
Craig, Sandra
2011-01-01
Carbohydrates in various forms play a vital role in numerous critical biological processes. The detection of such saccharides can give insight into the progression of such diseases such as cancer. Boronic acids react with 1,2 and 1,3 diols of saccharides in non-aqueous or basic aqueous media. Herein, we describe the design, synthesis and evaluation of three bisboronic acid fluorescent probes, each having about ten linear steps in its synthesis. Among these compounds that were evaluated, 9b was shown to selectively label HepG2, liver carcinoma cell line within a concentration range of 0.5–10 μM in comparison to COS-7, a normal fibroblast cell line. PMID:22177855
Hansen, H O; Grunnet, I; Knudsen, J
1984-01-01
Goat mammary-gland microsomal fraction by itself induces synthesis of medium-chain-length fatty acids by goat mammary fatty acid synthetase and incorporates short- and medium-chain fatty acids into triacylglycerol. Addition of ATP in the absence or presence of Mg2+ totally inhibits triacylglycerol synthesis from short- and medium-chain fatty acids, and severely inhibits synthesis de novo of medium-chain fatty acids. The inhibition by ATP of fatty acid synthesis and triacylglycerol synthesis de novo can be relieved by glycerol 3-phosphate. The effect of ATP could not be mimicked by the non-hydrolysable ATP analogue, adenosine 5'-[beta,gamma-methylene]triphosphate and could not be shown to be caused by inhibition of the diacylglycerol acyltransferase by a phosphorylation reaction. Possible explanations for the mechanism of the inhibition by ATP are discussed, and a hypothetical model for its action is outlined. PMID:6547605
The Synthesis of an Amino Acid Derivative and Spectroscopic Monitoring of Dipeptide Formation.
ERIC Educational Resources Information Center
Simmonds, Richard J.
1987-01-01
Described are experiments to give students experience in the synthesis of peptides from amino acids and to use visible spectroscopy to measure a rate of reaction. The activities were designed for undergraduate courses. (RH)
Zhang, Jiayu; Zhou, Xue; Wu, Wenbo; Wang, Jiachun; Xie, Hong; Wu, Zhigang
2017-04-01
Alpha-lipoic acid (α-LA) is an important antioxidant that is capable of regenerating other antioxidants, such as glutathione (GSH). However, the underlying molecular mechanism by which α-LA regenerates GSH remains poorly understood. The current study aimed to investigate whether α-LA regenerates GSH by activation of Nrf2 to alleviate cadmium-induced cytotoxicity in HepG2 cells. In the present study, we found that cadmium induced cell death by depletion of GSH through inactivation of Nrf2. Addition of α-LA to cadmium-treated cells reactivated Nrf2 and regenerated GSH through elevating the Nrf2-downstream genes γ-glutamate-cysteine ligase (γ-GCL) and GR, both of which are key enzymes for GSH synthesis. However, blocking Nrf2 with brusatol in the cells co-treated with α-LA and cadmium reduced the mRNA and the protein levels of γ-GCL and GR, thus suppressed GSH regeneration by α-LA. Our results indicated that α-LA activated Nrf2 signaling pathway, which upregulated the transcription of the enzymes for GSH synthesis and therefore GSH contents to alleviate cadmium-induced cytotoxicity in HepG2 cells. Copyright © 2017. Published by Elsevier B.V.
Reaction pathway mechanism of thermally induced isomerization of 9,12-linoleic acid triacylglycerol.
Guo, Qin; Jiang, Fan; Deng, Zhaoxuan; Li, Qingpeng; Jin, Jing; Ha, Yiming; Wang, Feng
2017-04-01
To clarify the formation mechanism of trans linoleic acid isomers in edible oils during the heating process, trilinolein and trilinoelaidin, as representative oils, were placed in glass ampoules and sealed before heating at 180, 240 and 320 °C. The glass ampoules were removed at regular time intervals, and the contents were analyzed by infrared spectroscopy. The samples were then subjected to derivatization into their methyl esters for gas chromatographic analysis. Analysis results show that 9c,12c and 9t,12t fatty acids from trilinolein and trilinoelaidin molecules undergo chemical bond rotation, migration and degradation, leading to the formation of non-conjugated linoleic acids (NLAs), conjugated linoleic acids (CLAs) and aldehydes. The formation rate of isomers from the 9c,12c fatty acid is higher than that of the 9t,12t fatty acid. The production of aldehydes increases with heating temperature and time. The isomerization pathways involved in the formation of NLAs and CLAs during heating are clearly presented. These findings suggest possible pathways of NFA and CFA formation from heated trilinolein and trilinoelaidin, complement the mechanistic studies previously published in the literature, and provide a theoretical basis for future control of the quality and safety of fats and oils. © 2016 Society of Chemical Industry. © 2016 Society of Chemical Industry.
Synthesis and antimycobacterial activity of isoniazid derivatives from renewable fatty acids.
Rodrigues, Marieli O; Cantos, Jéssica B; D'Oca, Caroline R Montes; Soares, Karina L; Coelho, Tatiane S; Piovesan, Luciana A; Russowsky, Dennis; da Silva, Pedro A; D'Oca, Marcelo G Montes
2013-11-15
This work describes the synthesis of a series of fatty acid hydrazide derivatives of isoniazid (INH). The compounds were tested against Mycobacterium tuberculosis H37Rv (ATCC 27294) as well as INH-resistant (ATCC 35822 and 1896 HF) and rifampicin-resistant (ATCC 35338) M. tuberculosis strains. The fatty acid derivatives of INH showed high antimycobacterial potency against the studied strains, which is desirable for a pharmaceutical compound, suggesting that the increased lipophilicity of isoniazid plays an important role in its antimycobacterial activity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Ngamskulrungroj, Popchai; Himmelreich, Uwe; Breger, Julia A.; Wilson, Christabel; Chayakulkeeree, Methee; Krockenberger, Mark B.; Malik, Richard; Daniel, Heide-Marie; Toffaletti, Dena; Djordjevic, Julianne T.; Mylonakis, Eleftherios; Meyer, Wieland; Perfect, John R.
2009-01-01
The trehalose pathway is essential for stress tolerance and virulence in fungi. We investigated the importance of this pathway for virulence of the pathogenic yeast Cryptococcus gattii using the highly virulent Vancouver Island, Canada, outbreak strain R265. Three genes putatively involved in trehalose biosynthesis, TPS1 (trehalose-6-phosphate [T6P] synthase) and TPS2 (T6P phosphatase), and degradation, NTH1 (neutral trehalose), were deleted in this strain, creating the R265tps1Δ, R265tps2Δ, and R265nth1Δ mutants. As in Cryptococcus neoformans, cellular trehalose was reduced in the R265tps1Δ and R265tps2Δ mutants, which could not grow and died, respectively, at 37°C on yeast extract-peptone-dextrose agar, suggesting that T6P accumulation in R265tps2Δ is directly toxic. Characterizations of the cryptococcal hexokinases and trehalose mutants support their linkage to the control of glycolysis in this species. However, unlike C. neoformans, the C. gattii R265tps1Δ mutant demonstrated, in addition, defects in melanin and capsule production, supporting an influence of T6P on these virulence pathways. Attenuated virulence of the R265tps1Δ mutant was not due solely to its 37°C growth defect, as shown in worm studies and confirmed by suppressor mutants. Furthermore, an intact trehalose pathway controls protein secretion, mating, and cell wall integrity in C. gattii. Thus, the trehalose synthesis pathway plays a central role in the virulence composites of C. gattii through multiple mechanisms. Deletion of NTH1 had no effect on virulence, but inactivation of the synthesis genes, TPS1 and TPS2, has profound effects on survival of C. gattii in the invertebrate and mammalian hosts. These results highlight the central importance of this pathway in the virulence composites of both pathogenic cryptococcal species. PMID:19651856
Lange, Kerstin; Schmid, Andreas; Julsing, Mattijs K
2015-10-10
Δ(9)-Tetrahydrocannabinol (THC) is of increasing interest as a pharmaceutical and bioactive compound. Chemical synthesis of THC uses a laborious procedure and does not satisfy the market demand. The implementation of biocatalysts for specific synthesis steps might be beneficial for making natural product availability independent from the plant. Δ(9)-Tetrahydrocannabinolic acid synthase (THCAS) from C. sativa L. catalyzes the cyclization of cannabigerolic acid (CBGA) to Δ(9)-tetrahydrocannabinolic acid (THCA), which is non-enzymatically decarboxylated to THC. We report the preparation of THCAS in amounts sufficient for the biocatalytic production of THC(A). Active THCAS was most efficiently obtained from Pichia pastoris. THCAS was produced on a 2L bioreactor scale and the enzyme was isolated by single-step chromatography with a specific activity of 73Ug(-1)total protein. An organic/aqueous two-liquid phase setup for continuous substrate delivery facilitated in situ product removal. In addition, THCAS activity in aqueous environments lasted for only 20min whereas the presence of hexane stabilized the activity over 3h. In conclusion, production of THCAS in P. pastoris Mut(S) KM71 KE1, subsequent isolation, and its application in a two-liquid phase setup enables the synthesis of THCA on a mg scale. Copyright © 2015 Elsevier B.V. All rights reserved.
Parsons, Joshua B.; Frank, Matthew W.; Subramanian, Chitra; Saenkham, Panatda; Rock, Charles O.
2011-01-01
The rationale for the pursuit of bacterial type 2 fatty acid synthesis (FASII) as a target for antibacterial drug discovery in Gram-positive organisms is being debated vigorously based on their ability to incorporate extracellular fatty acids. The regulation of FASII by extracellular fatty acids was examined in Staphylococcus aureus and Streptococcus pneumoniae, representing two important groups of pathogens. Both bacteria use the same enzymatic tool kit for the conversion of extracellular fatty acids to acyl-acyl carrier protein, elongation, and incorporation into phospholipids. Exogenous fatty acids completely replace the endogenous fatty acids in S. pneumoniae but support only 50% of phospholipid synthesis in S. aureus. Fatty acids overcame FASII inhibition in S. pneumoniae but not in S. aureus. Extracellular fatty acids strongly suppress malonyl-CoA levels in S. pneumoniae but not in S. aureus, showing a feedback regulatory system in S. pneumoniae that is absent in S. aureus. Fatty acids overcame either a biochemical or a genetic block at acetyl-CoA carboxylase (ACC) in S. aureus, confirming that regulation at the ACC step is the key difference between these two species. Bacteria that possess a stringent biochemical feedback inhibition of ACC and malonyl-CoA formation triggered by environmental fatty acids are able to circumvent FASII inhibition. However, if exogenous fatty acids do not suppress malonyl-CoA formation, FASII inhibitors remain effective in the presence of fatty acid supplements. PMID:21876172
Lutnicki, K; Szpringer, E; Czerny, K; Ledwozyw, A
2001-01-01
Cytoprotection in the stomach, consisting in the mucus secretion, mucous circulation intensification and bicarbonate secretion to the gastric lumen, is highly dependent on the products of arachidonic acid pathway and peroxidative-antioxidative balance. The aim of the paper was to examine the effects of selected inhibitors of arachidonic acid pathway on the natural protective system of the gastric mucosa exposed to 50% ethanol. The results show that leukotrienes, thromboxane and oxygen reactive forms significantly impair the protective function of the gastric mucosa while prostaglandins and antioxidant enzymes act protectively.
Qiu, Zhongyang; Gao, Qiuqiang; Bao, Jie
2017-12-01
Xylose-assimilating pathway was constructed in a d-lactic acid producing Pediococcus acidilactici strain and evolutionary adapted to yield a co-fermentation strain P. acidilactici ZY15 with 97.3g/L of d-lactic acid and xylose conversion of 92.6% obtained in the high solids content simultaneous saccharification and co-fermentation (SSCF) of dry dilute acid pretreated and biodetoxified corn stover feedstock. The heterologous genes encoding xylose isomerase (xylA) and xylulokinase (xylB) were screened and integrated into the P. acidilactici chromosome. The metabolic flux to acetic acid in phosphoketolase pathway was re-directed to pentose phosphate pathway by substituting the endogenous phosphoketolase gene (pkt) with the heterologous transketolase (tkt) and transaldolase (tal) genes. The xylose-assimilating ability of the newly constructed P. acidilactici strain was significantly improved by adaptive evolution. This study provided an important strain and process prototype for high titer d-lactic acid production from lignocellulose feedstock with efficient xylose assimilation. Copyright © 2017 Elsevier Ltd. All rights reserved.
Efficient synthesis of anacardic acid analogues and their antibacterial activities.
Mamidyala, Sreeman K; Ramu, Soumya; Huang, Johnny X; Robertson, Avril A B; Cooper, Matthew A
2013-03-15
Anacardic acid derivatives exhibit a broad range of biological activities. In this report, an efficient method for the synthesis of anacardic acid derivatives was explored, and a small set of salicylic acid variants synthesised retaining a constant hydrophobic element (a naphthyl tail). The naphthyl side chain was introduced via Wittig reaction and the aldehyde installed using directed ortho-metalation reaction of the substituted o-anisic acids. The failure of ortho-metalation using unprotected carboxylic acid group compelled us to use directed ortho-metalation in which a tertiary amide was used as a strong ortho-directing group. In the initial route, tertiary amide cleavage during final step was challenging, but cleaving the tertiary amide before Wittig reaction was beneficial. The Wittig reaction with protected carboxylic group (methyl ester) resulted in side-products whereas using sodium salt resulted in higher yields. The novel compounds were screened for antibacterial activity and cytotoxicity. Although substitution on the salicylic head group enhanced antibacterial activities they also enhanced cytotoxicity. Copyright © 2013 Elsevier Ltd. All rights reserved.
Meganathan, R; Bentley, R
1983-01-01
Cell-free extracts of various strains of Escherichia coli synthesize the menaquinone biosynthetic intermediate o-succinylbenzoic acid (OSB) when supplied with chorismic acid, 2-ketoglutaric acid, and thiamine pyrophosphate (TPP). To assay for OSB synthesis, 2-[U-14C]ketoglutaric acid was used as substrate, and the synthesized OSB was examined by radiogas chromatography (as the dimethyl ester). [U-14C]Shikimic acid also gave rise to radioactive OSB if the cofactors necessary for enzymatic conversion to chorismic acid were added. Use of 2-[1-14C]ketoglutaric acid does not give rise to labeled OSB. In the absence of TPP during the incubations, OSB synthesis was much reduced; these observations are consistent with the proposed role for the succinic semialdehyde-TPP anion as the reagent adding to chorismic acid. Extracts of cells from menC and menD mutants did not form OSB separately, but did so in combination. There was evidence for formation of a product, X, by extracts of a menC mutant incubated with chorismic acid, TPP, and 2-ketoglutaric acid; X was converted to OSB by extracts of a menD mutant. It appears that the intermediate, X, is formed by one gene product and converted to OSB by the second gene product. PMID:6337125
Trip, Hein; Mulder, Niels L.; Lolkema, Juke S.
2012-01-01
Degradative amino acid decarboxylation pathways in bacteria generate secondary metabolic energy and provide resistance against acid stress. The histidine decarboxylation pathway of Streptococcus thermophilus CHCC1524 was functionally expressed in the heterologous host Lactococcus lactis NZ9000, and the benefits of the newly acquired pathway for the host were analyzed. During growth in M17 medium in the pH range of 5–6.5, a small positive effect was observed on the biomass yield in batch culture, whereas no growth rate enhancement was evident. In contrast, a strong benefit for the engineered L. lactis strain was observed in acid stress survival. In the presence of histidine, the pathway enabled cells to survive at pH values as low as 3 for at least 2 h, conditions under which the host cells were rapidly dying. The flux through the histidine decarboxylation pathway in cells grown at physiological pH was under strict control of the electrochemical proton gradient (pmf) across the membrane. Ionophores that dissipated the membrane potential (ΔΨ) and/or the pH gradient (ΔpH) strongly increased the flux, whereas the presence of glucose almost completely inhibited the flux. Control of the pmf over the flux was exerted by both ΔΨ and ΔpH and was distributed over the transporter HdcP and the decarboxylase HdcA. The control allowed for a synergistic effect between the histidine decarboxylation and glycolytic pathways in acid stress survival. In a narrow pH range around 2.5 the synergism resulted in a 10-fold higher survival rate. PMID:22351775
Synthesis and Anti-microbial Activity of Novel Phosphatidylethanolamine-N-amino Acid Derivatives.
Vijeetha, Tadla; Balakrishna, Marrapu; Karuna, Mallampalli Sri Lakshmi; Surya Koppeswara Rao, Bhamidipati Venkata; Prasad, Rachapudi Badari Narayana; Kumar, Koochana Pranay; Surya Narayana Murthy, Upadyaula
2015-01-01
The study involved synthesis of five novel amino acid derivatives of phosphatidylethanolamine isolated from egg yolk lecithin employing a three step procedure i) N-protection of L-amino acids with BOC anhydride in alkaline medium ii) condensation of - CO2H group of N-protected amino acid with free -NH2 of PE by a peptide linkage and iii) deprotection of N-protected group of amino acids to obtain phosphatidylethanolamine-N-amino acid derivatives in 60-75% yield. The five L-amino acids used were L glycine, L-valine, L-leucine, L-isoleucine and L-phenylalanine. The amino acid derivatives were screened for anti-baterial activity against B. subtilis, S. aureus, P. aeroginosa and E. coli taking Streptomycin as reference compound and anti-fungal activity against C. albicans, S. cervisiae, A. niger taking AmphotericinB as reference compound. All the amino acid derivatives exhibited extraordinary anti-bacterial activities about 3 folds or comparable to Streptomycin and moderate or no anti-fungal activity against Amphotericin-B.
Guo, Huijuan; Sun, Yucheng; Peng, Xinhong; Wang, Qinyang; Harris, Marvin; Ge, Feng
2016-02-01
The activation of the abscisic acid (ABA) signaling pathway reduces water loss from plants challenged by drought stress. The effect of drought-induced ABA signaling on the defense and nutrition allocation of plants is largely unknown. We postulated that these changes can affect herbivorous insects. We studied the effects of drought on different feeding stages of pea aphids in the wild-type A17 of Medicago truncatula and ABA signaling pathway mutant sta-1. We examined the impact of drought on plant water status, induced plant defense signaling via the abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA) pathways, and on the host nutritional quality in terms of leaf free amino acid content. During the penetration phase of aphid feeding, drought decreased epidermis/mesophyll resistance but increased mesophyll/phloem resistance of A17 but not sta-1 plants. Quantification of transcripts associated with ABA, JA and SA signaling indicated that the drought-induced up-regulation of ABA signaling decreased the SA-dependent defense but increased the JA-dependent defense in A17 plants. During the phloem-feeding phase, drought had little effect on the amino acid concentrations and the associated aphid phloem-feeding parameters in both plant genotypes. In the xylem absorption stage, drought decreased xylem absorption time of aphids in both genotypes because of decreased water potential. Nevertheless, the activation of the ABA signaling pathway increased water-use efficiency of A17 plants by decreasing the stomatal aperture and transpiration rate. In contrast, the water potential of sta-1 plants (unable to close stomata) was too low to support xylem absorption activity of aphids; the aphids on sta-1 plants had the highest hemolymph osmolarity and lowest abundance under drought conditions. Taken together this study illustrates the significance of cross-talk between biotic-abiotic signaling pathways in plant-aphid interaction, and reveals the mechanisms leading to alter
Guo, Huijuan; Sun, Yucheng; Peng, Xinhong; Wang, Qinyang; Harris, Marvin; Ge, Feng
2016-01-01
The activation of the abscisic acid (ABA) signaling pathway reduces water loss from plants challenged by drought stress. The effect of drought-induced ABA signaling on the defense and nutrition allocation of plants is largely unknown. We postulated that these changes can affect herbivorous insects. We studied the effects of drought on different feeding stages of pea aphids in the wild-type A17 of Medicago truncatula and ABA signaling pathway mutant sta-1. We examined the impact of drought on plant water status, induced plant defense signaling via the abscisic acid (ABA), jasmonic acid (JA), and salicylic acid (SA) pathways, and on the host nutritional quality in terms of leaf free amino acid content. During the penetration phase of aphid feeding, drought decreased epidermis/mesophyll resistance but increased mesophyll/phloem resistance of A17 but not sta-1 plants. Quantification of transcripts associated with ABA, JA and SA signaling indicated that the drought-induced up-regulation of ABA signaling decreased the SA-dependent defense but increased the JA-dependent defense in A17 plants. During the phloem-feeding phase, drought had little effect on the amino acid concentrations and the associated aphid phloem-feeding parameters in both plant genotypes. In the xylem absorption stage, drought decreased xylem absorption time of aphids in both genotypes because of decreased water potential. Nevertheless, the activation of the ABA signaling pathway increased water-use efficiency of A17 plants by decreasing the stomatal aperture and transpiration rate. In contrast, the water potential of sta-1 plants (unable to close stomata) was too low to support xylem absorption activity of aphids; the aphids on sta-1 plants had the highest hemolymph osmolarity and lowest abundance under drought conditions. Taken together this study illustrates the significance of cross-talk between biotic-abiotic signaling pathways in plant-aphid interaction, and reveals the mechanisms leading to alter
Filgueiras, Camila Cramer; Willett, Denis S.; Junior, Alcides Moino; Pareja, Martin; Borai, Fahiem El; Dickson, Donald W.; Stelinski, Lukasz L.; Duncan, Larry W.
2016-01-01
Plant defense pathways play a critical role in mediating tritrophic interactions between plants, herbivores, and natural enemies. While the impact of plant defense pathway stimulation on natural enemies has been extensively explored aboveground, belowground ramifications of plant defense pathway stimulation are equally important in regulating subterranean pests and still require more attention. Here we investigate the effect of aboveground stimulation of the salicylic acid pathway through foliar application of the elicitor methyl salicylate on belowground recruitment of the entomopathogenic nematode, Steinernema diaprepesi. Also, we implicate a specific root-derived volatile that attracts S. diaprepesi belowground following aboveground plant stimulation by an elicitor. In four-choice olfactometer assays, citrus plants treated with foliar applications of methyl salicylate recruited S. diaprepesi in the absence of weevil feeding as compared with negative controls. Additionally, analysis of root volatile profiles of citrus plants receiving foliar application of methyl salicylate revealed production of d-limonene, which was absent in negative controls. The entomopathogenic nematode S. diaprepesi was recruited to d-limonene in two-choice olfactometer trials. These results reinforce the critical role of plant defense pathways in mediating tritrophic interactions, suggest a broad role for plant defense pathway signaling belowground, and hint at sophisticated plant responses to pest complexes. PMID:27136916
Huang, Huan; McIntosh, Avery L; Martin, Gregory G; Petrescu, Anca D; Landrock, Kerstin K; Landrock, Danilo; Kier, Ann B; Schroeder, Friedhelm
2013-01-01
While TOFA (acetyl CoA carboxylase inhibitor) and C75 (fatty acid synthase inhibitor) prevent lipid accumulation by inhibiting fatty acid synthesis, the mechanism of action is not simply accounted for by inhibition of the enzymes alone. Liver fatty acid binding protein (L-FABP), a mediator of long chain fatty acid signaling to peroxisome proliferator-activated receptor- α (PPAR α ) in the nucleus, was found to bind TOFA and its activated CoA thioester, TOFyl-CoA, with high affinity while binding C75 and C75-CoA with lower affinity. Binding of TOFA and C75-CoA significantly altered L-FABP secondary structure. High (20 mM) but not physiological (6 mM) glucose conferred on both TOFA and C75 the ability to induce PPAR α transcription of the fatty acid β -oxidative enzymes CPT1A, CPT2, and ACOX1 in cultured primary hepatocytes from wild-type (WT) mice. However, L-FABP gene ablation abolished the effects of TOFA and C75 in the context of high glucose. These effects were not associated with an increased cellular level of unesterified fatty acids but rather by increased intracellular glucose. These findings suggested that L-FABP may function as an intracellular fatty acid synthesis inhibitor binding protein facilitating TOFA and C75-mediated induction of PPAR α in the context of high glucose at levels similar to those in uncontrolled diabetes.
Modak, Sohan P.; Setlow, Jane K.
1969-01-01
Synthesis of deoxyribonucleic acid (DNA) has been measured as a function of ultraviolet (UV) radiation dose in wild-type and seven UV-sensitive strains of Haemophilus influenzae. At the UV doses used, all strains were able to resume DNA synthesis, even those which are unable to excise pyrimidine dimers from their DNA. These excisionless strains showed longer UV-induced delays in DNA synthesis than all but one of the other strains. The longest delay was shown by DB117, a strain which can excise dimers but which is recombination deficient and unable to rejoin X ray-induced single-strand breaks. All strains showed a progressive decrease in sensitivity as they approached the stationary phase. PMID:5305934
Zhang, Lin; Veres-Schalnat, Tracey A; Somogyi, Arpad; Pemberton, Jeanne E; Maier, Raina M
2012-12-01
Rhamnolipids have multiple potential applications as "green" surfactants for industry, remediation, and medicine. As a result, they have been intensively investigated to add to our understanding of their biosynthesis and improve yields. Several studies have noted that the addition of a fatty acid cosubstrate increases rhamnolipid yields, but a metabolic explanation has not been offered, partly because biosynthesis studies to date have used sugar or sugar derivatives as the carbon source. The objective of this study was to investigate the role of fatty acid cosubstrates in improving rhamnolipid biosynthesis. A combination of stable isotope tracing and gene expression assays was used to identify lipid precursors and potential lipid metabolic pathways used in rhamnolipid synthesis when fatty acid cosubstrates are present. To this end, we compared the rhamnolipids produced and their yields using either glucose alone or glucose and octadecanoic acid-d(35) as cosubstrates. Using a combination of sugar and fatty acids, the rhamnolipid yield was significantly higher (i.e., doubled) than when glucose was used alone. Two patterns of deuterium incorporation (either 1 or 15 deuterium atoms) in a single Rha-C(10) lipid chain were observed for octadecanoic acid-d(35) treatment, indicating that in the presence of a fatty acid cosubstrate, both de novo fatty acid synthesis and β-oxidation are used to provide lipid precursors for rhamnolipids. Gene expression assays showed a 200- to 600-fold increase in the expression of rhlA and rhlB rhamnolipid biosynthesis genes and a more modest increase of 3- to 4-fold of the fadA β-oxidation pathway gene when octadecanoic acid was present. Taken together, these results suggest that the simultaneous use of de novo fatty acid synthesis and β-oxidation pathways allows for higher production of lipid precursors, resulting in increased rhamnolipid yields.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Vickers, Alison E.M., E-mail: vickers_alison@allergan.com; Heale, Jason; Sinclair, John R.
Drug induced thyroid effects were evaluated in organotypic models utilizing either a rat thyroid lobe or human thyroid slices to compare rodent and human response. An inhibition of thyroid peroxidase (TPO) function led to a perturbation in the expression of key genes in thyroid hormone synthesis and release pathways. The clinically used thiourea drugs, methimazole (MMI) and 6-n-propyl-2-thioruacil (PTU), were used to evaluate thyroid drug response in these models. Inhibition of TPO occurred early as shown in rat thyroid lobes (2 h) and was sustained in both rat (24–48 h) and human (24 h) with ≥ 10 μM MMI. Thyroidmore » from rats treated with single doses of MMI (30–1000 mg/kg) exhibited sustained TPO inhibition at 48 h. The MMI in vivo thyroid concentrations were comparable to the culture concentrations (∼ 15–84 μM), thus demonstrating a close correlation between in vivo and ex vivo thyroid effects. A compensatory response to TPO inhibition was demonstrated in the rat thyroid lobe with significant up-regulation of genes involved in the pathway of thyroid hormone synthesis (Tpo, Dio1, Slc5a5, Tg, Tshr) and the megalin release pathway (Lrp2) by 24 h with MMI (≥ 10 μM) and PTU (100 μM). Similarly, thyroid from the rat in vivo study exhibited an up-regulation of Dio1, Slc5a5, Lrp2, and Tshr. In human thyroid slices, there were few gene expression changes (Slc5a5, ∼ 2-fold) and only at higher MMI concentrations (≥ 1500 μM, 24 h). Extended exposure (48 h) resulted in up-regulation of Tpo, Dio1 and Lrp2, along with Slc5a5 and Tshr. In summary, TPO was inhibited by similar MMI concentrations in rat and human tissue, however an increased sensitivity to drug treatment in rat is indicated by the up-regulation of thyroid hormone synthesis and release gene pathways at concentrations found not to affect human tissue. -- Highlights: ► Novel model of rat thyroid or human thyroid slices to evaluate pathways of injury. ► TPO inhibition by MMI or PTU
Shinde, Suhas; Villamor, Joji Grace; Lin, Wendar; Verslues, Paul E.
2016-01-01
Proline (Pro) accumulation is one of the most prominent changes in plant metabolism during drought and low water potential; however, the regulation and function of Pro metabolism remain unclear. We used a combination of forward genetic screening based on a Proline Dehydrogenase1 (PDH1) promoter-luciferase reporter (PDH1pro:LUC2) and RNA sequencing of the Pro synthesis mutant p5cs1-4 to identify multiple loci affecting Pro accumulation in Arabidopsis (Arabidopsis thaliana). Two mutants having high PDH1pro:LUC2 expression and increased Pro accumulation at low water potential were found to be alleles of Cytochrome P450, Family 86, Subfamily A, Polypeptide2 (CYP86A2) and Long Chain Acyl Synthetase2 (LACS2), which catalyze two successive steps in very-long-chain fatty acid (VLCFA) synthesis. Reverse genetic experiments found additional VLCFA and lipid metabolism-related mutants with increased Pro accumulation. Altered cellular redox status is a key factor in the coordination of Pro and VLCFA metabolism. The NADPH oxidase inhibitor diphenyleneiodonium (DPI) induced high levels of Pro accumulation and strongly repressed PDH1pro:LUC2 expression. cyp86a2 and lacs2 mutants were hypersensitive to diphenyleneiodonium but could be reverted to wild-type Pro and PDH1pro:LUC2 expression by reactive oxygen species scavengers. The coordination of Pro and redox metabolism also was indicated by the altered expression of chloroplast and mitochondria electron transport genes in p5cs1-4. These results show that Pro metabolism is both influenced by and influences cellular redox status via previously unknown coordination with several metabolic pathways. In particular, Pro and VLCFA synthesis share dual roles to help buffer cellular redox status while producing products useful for stress resistance, namely the compatible solute Pro and cuticle lipids. PMID:27512016
Ledinko, Nada; Fong, Caroline K. Y.
1969-01-01
Infection of human embryonic kidney (HEK) cell cultures with adenovirus types 2 or 12 resulted in an initial drop in the rate of incorporation of 3H-thymidine into deoxyribonucleic acid (DNA) during the early latent period of virus growth, followed by a marked rise in label uptake. It was shown by cesium chloride isopycnic centrifugation that, after adenovirus 2 infection, there was a decrease in the rate of incorporation of thymidine into cellular DNA. Moreover, DNA-DNA hybridization experiments revealed that, by 28 to 32 hr after infection with either adenovirus 2 or 12, the amount of isolated pulse-labeled DNA capable of hybridizing with HEK cell DNA was reduced by approximately 60 to 70%. Autoradiographic measurements showed that the inhibition of cellular DNA synthesis was due to a decrease in the ability of an infected cell to synthesize DNA. The adenovirus-induced inhibition of host cell DNA synthesis was not due to degradation of cellular DNA. 3H-thymidine incorporated into cellular DNA at the time of infection remained acid-precipitable, and labeled material was not incorporated into viral DNA. Furthermore, when zone sedimentation through neutral or alkaline sucrose density gradients was employed, no detectable change was observed in the sedimentation rate of this cellular DNA at various times after infection with adenovirus 2 or 12. In addition, there was no increase in deoxyribonuclease activity in cells infected with either virus. Cultures infected for 38 hr with adenovirus 2 or 12 incorporated three to four times as much 3H-uridine into ribonucleic acid (RNA) as did non-infected cultures. Furthermore, the net RNA synthesized by infected cultures substantially exceeded that of control cultures. The activity of thymidine kinase was induced, but there was no stimulation of uridine kinase. PMID:5806981
CO- and HCl-free synthesis of acid chlorides from unsaturated hydrocarbons via shuttle catalysis
NASA Astrophysics Data System (ADS)
Fang, Xianjie; Cacherat, Bastien; Morandi, Bill
2017-11-01
The synthesis of carboxylic acid derivatives from unsaturated hydrocarbons is an important process for the preparation of polymers, pharmaceuticals, cosmetics and agrochemicals. Despite its industrial relevance, the traditional Reppe-type carbonylation reaction using pressurized CO is of limited applicability to laboratory-scale synthesis because of: (1) the safety hazards associated with the use of CO, (2) the need for special equipment to handle pressurized gas, (3) the low reactivity of several relevant nucleophiles and (4) the necessity to employ different, often tailor-made, catalytic systems for each nucleophile. Herein we demonstrate that a shuttle-catalysis approach enables a CO- and HCl-free transfer process between an inexpensive reagent, butyryl chloride, and a wide range of unsaturated substrates to access the corresponding acid chlorides in good yields. This new transformation provides access to a broad range of carbonyl-containing products through the in situ transformation of the reactive acid chloride intermediate. In a broader context, this work demonstrates that isodesmic shuttle-catalysis reactions can unlock elusive catalytic reactions.
Yin, Haisong; Zhang, Renkuan; Xia, Menglei; Bai, Xiaolei; Mou, Jun; Zheng, Yu; Wang, Min
2017-06-15
Acetic acid bacteria (AAB) are widely applied in food, bioengineering and medicine fields. However, the acid stress at low pH conditions limits acetic acid fermentation efficiency and high concentration of vinegar production with AAB. Therefore, how to enhance resistance ability of the AAB remains as the major challenge. Amino acids play an important role in cell growth and cell survival under severe environment. However, until now the effects of amino acids on acetic fermentation and acid stress resistance of AAB have not been fully studied. In the present work the effects of amino acids on metabolism and acid stress resistance of Acetobacter pasteurianus were investigated. Cell growth, culturable cell counts, acetic acid production, acetic acid production rate and specific production rate of acetic acid of A. pasteurianus revealed an increase of 1.04, 5.43, 1.45, 3.30 and 0.79-folds by adding aspartic acid (Asp), and cell growth, culturable cell counts, acetic acid production and acetic acid production rate revealed an increase of 0.51, 0.72, 0.60 and 0.94-folds by adding glutamate (Glu), respectively. For a fully understanding of the biological mechanism, proteomic technology was carried out. The results showed that the strengthening mechanism mainly came from the following four aspects: (1) Enhancing the generation of pentose phosphates and NADPH for the synthesis of nucleic acid, fatty acids and glutathione (GSH) throughout pentose phosphate pathway. And GSH could protect bacteria from low pH, halide, oxidative stress and osmotic stress by maintaining the viability of cells through intracellular redox equilibrium; (2) Reinforcing deamination of amino acids to increase intracellular ammonia concentration to maintain stability of intracellular pH; (3) Enhancing nucleic acid synthesis and reparation of impaired DNA caused by acid stress damage; (4) Promoting unsaturated fatty acids synthesis and lipid transport, which resulted in the improvement of cytomembrane
Sundram, Kalyana; French, Margaret A; Clandinin, M Thomas
2003-08-01
Partial hydrogenation of oil results in fats containing unusual isomeric fatty acids characterized by cis and trans configurations. Hydrogenated fats containing trans fatty acids increase plasma total cholesterol (TC) and LDL-cholesterol while depressing HDL-cholesterol levels. Identifying the content of trans fatty acids by food labeling is overshadowed by a reluctance of health authorities to label saturates and trans fatty acids separately. Thus, it is pertinent to compare the effects of trans to saturated fatty acids using stable isotope methodology to establish if the mechanism of increase in TC and LDL-cholesterol is due to the increase in the rate of endogenous synthesis of cholesterol. Ten healthy normocholesterolemic female subjects consumed each of two diets containing approximately 30% of energy as fat for a fourweek period. One diet was high in palmitic acid (10.6% of energy) from palm olein and the other diet exchanged 5.6% of energy as partially hydrogenated fat for palmitic acid. This fat blend resulted in monounsaturated fatty acids decreasing by 4.9 % and polyunsaturated fats increasing by 2.7%. The hydrogenated fat diet treatment provided 3.1% of energy as elaidic acid. For each dietary treatment, the fractional synthesis rates for cholesterol were measured using deuterium-labeling procedures and blood samples were obtained for blood lipid and lipoprotein measurements. Subjects exhibited a higher total cholesterol and LDL-cholesterol level when consuming the diet containing trans fatty acids while also depressing the HDL-cholesterol level. Consuming the partially hydrogenated fat diet treatment increased the fractional synthesis rate of free cholesterol. Consumption of hydrogenated fats containing trans fatty acids in comparison to a mixtur e of palmitic and oleic acids increase plasma cholesterol levels apparently by increasing endogenous synthesis of cholesterol.
NASA Astrophysics Data System (ADS)
Rahmayetty, Sukirno, Prasetya, Bambang; Gozan, Misri
2017-02-01
Lactide is the monomer for the polymer polylactic acid (PLA) from lactic acid through polycondensation and depolymerization process. The properties of PLA strongly depend on the quality of the lactide monomer from which it is synthesized. Optical purity of lactide produced in depolymerization process confirmed to be L-lactide. The highest yield of crude lactide was 38.5% at temperature 210 °C with average molecular weight (Mn) of oligomer was 2389. Ring opening polymerization of lactide using Candida rugosa lipase as biocatalyst to PLLA synthesis has been achieved to generate useful biomedical materials free from heavy metal.
One-step synthesis of hydrothermally stable mesoporous aluminosilicates with strong acidity
DOE Office of Scientific and Technical Information (OSTI.GOV)
Yang Dongjiang; School of Physical and Chemical Sciences, Queensland University of Technology, Brisbane, QLD 4001; Xu Yao
2008-09-15
Using tetraethylorthosilicate (TEOS), polymethylhydrosiloxane (PMHS) and aluminium isopropoxide (AIP) as the reactants, through a one-step nonsurfactant route based on PMHS-TEOS-AIP co-polycondensation, hydrothermally stable mesoporous aluminosilicates with different Si/Al molar ratios were successfully prepared. All samples exclusively showed narrow pore size distribution centered at 3.6 nm. To assess the hydrothermal stability, samples were subjected to 100 deg. C distilled water for 300 h. The boiled mesoporous aluminosilicates have nearly the same N{sub 2} adsorption-desorption isotherms and the same pore size distributions as those newly synthesized ones, indicating excellent hydrothermal stability. The {sup 29}Si MAS NMR spectra confirmed that PMHS and TEOSmore » have jointly condensed and CH{sub 3} groups have been introduced into the materials. The {sup 27}Al MAS NMR spectra indicated that Al atoms have been incorporated in the mesopore frameworks. The NH{sub 3} temperature-programmed desorption showed strong acidity. Due to the existence of large amount of CH{sub 3} groups, the mesoporous aluminosilicates obtained good hydrophobicity. Owing to the relatively large pore and the strong acidity provided by the uniform four-coordinated Al atoms, the excellent catalytic performance for 1,3,5-triisopropylbenzene cracking was acquired easily. The materials may be a profitable complement for the synthesis of solid acid catalysts. - Graphical abstract: Based on the nonsurfactant method, a facile one-step synthesis route has been developed to prepare methyl-modified mesoporous aluminosilicates that possessed hydrothermal stability and strong acidity.« less
Kitamura, Takuya; Seki, Naoya; Kihara, Akio
2017-03-28
Although normal fatty acids (FAs) are degraded via β-oxidation, unusual FAs such as 2-hydroxy (2-OH) FAs and 3-methyl-branched FAs are degraded via α-oxidation. Phytosphingosine (PHS) is one of the long-chain bases (the sphingolipid components) and exists in specific tissues, including the epidermis and small intestine in mammals. In the degradation pathway, PHS is converted to 2-OH palmitic acid and then to pentadecanoic acid (C15:0-COOH) via FA α-oxidation. However, the detailed reactions and genes involved in the α-oxidation reactions of the PHS degradation pathway have yet to be determined. In the present study, we reveal the entire PHS degradation pathway: PHS is converted to C15:0-COOH via six reactions [phosphorylation, cleavage, oxidation, CoA addition, cleavage (C1 removal), and oxidation], in which the last three reactions correspond to the α-oxidation. The aldehyde dehydrogenase ALDH3A2 catalyzes both the first and second oxidation reactions (fatty aldehydes to FAs). In Aldh3a2 -deficient cells, the unmetabolized fatty aldehydes are reduced to fatty alcohols and are incorporated into ether-linked glycerolipids. We also identify HACL2 (2-hydroxyacyl-CoA lyase 2) [previous name, ILVBL; ilvB (bacterial acetolactate synthase)-like] as the major 2-OH acyl-CoA lyase involved in the cleavage (C1 removal) reaction in the FA α-oxidation of the PHS degradation pathway. HACL2 is localized in the endoplasmic reticulum. Thus, in addition to the already-known FA α-oxidation in the peroxisomes, we have revealed the existence of FA α-oxidation in the endoplasmic reticulum in mammals.
Sites of abscisic acid synthesis and metabolism in Ricinus communis L
DOE Office of Scientific and Technical Information (OSTI.GOV)
Zeevaart, J.A.D.
1977-05-01
The sites of abscisic acid (ABA) synthesis and metabolism in Ricinus communis L. were investigated by analyzing the levels of ABA and its two metabolites phaseic acid (PA) and dihydrophaseic acid (DPA) in the shoot tips, mature leaves, and phloem sap of stressed and nonstressed plants. Water stress increased the concentration of ABA, PA, and DPA in phloem exudate and also increased the levels of all three compounds in mature leaves and in shoot tips. The latter had a very high DPA content (18.7 ..mu..g/g fresh weight) even in plants not subjected to water stress. When young and mature leavesmore » were excised and allowed to wilt, the level of ABA increased in both, demonstrating that leaves at an early stage of development have the capacity to produce ABA. These results have been interpreted to mean that in mature leaves of nonstressed Ricinus plants, ABA is synthesized and metabolized, and that ABA itself, as well as its metabolites, are translocated in the phloem to the shoot tips (sinks). Since DPA, but not ABA, accumulates in the shoot tips, it follows that ABA is metabolized rapidly in the apical region. To what extent ABA present in young leaves of nonstressed plants is the consequence of synthesis in situ and of import from older leaves remains to be determined.« less
Choi, Geun-Hee; Lee, Hyoung Yool; Back, Kyoungwhan
2017-08-01
Recent analyses of the enzymatic features of various melatonin biosynthetic genes from bacteria, animals, and plants have led to the hypothesis that melatonin could be synthesized via the 5-methoxytryptamine (5-MT) pathway. 5-MT is known to be synthesized in vitro from serotonin by the enzymatic action of O-methyltransferases, including N-acetylserotonin methyltransferase (ASMT) and caffeic acid O-methyltransferase (COMT), leading to melatonin synthesis by the subsequent enzymatic reaction with serotonin N-acetyltransferase (SNAT). Here, we show that 5-MT was produced and served as a precursor for melatonin synthesis in plants. When rice seedlings were challenged with senescence treatment, 5-MT levels and melatonin production were increased in transgenic rice seedlings overexpressing the rice COMT in chloroplasts, while no such increases were observed in wild-type or transgenic seedlings overexpressing the rice COMT in the cytosol, suggesting a 5-MT transport limitation from the cytosol to chloroplasts. In contrast, cadmium treatment led to results different from those in senescence. The enhanced melatonin production was not observed in the chloroplast COMT lines relative over the cytosol COMT lines although 5-MT levels were equally induced in all genotypes upon cadmium treatment. The transgenic seedlings with enhanced melatonin in their chloroplasts exhibited improved seedling growth vs the wild type under continuous light conditions. This is the first report describing enhanced melatonin production in chloroplasts via the 5-MT pathway with the ectopic overexpression of COMT in chloroplasts in plants. © 2017 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.
Gabriel, Frédéric; Accoceberry, Isabelle; Bessoule, Jean-Jacques; Salin, Bénédicte; Lucas-Guérin, Marine; Manon, Stephen; Dementhon, Karine; Noël, Thierry
2014-01-01
It is generally admitted that the ascomycete yeasts of the subphylum Saccharomycotina possess a single fatty acid ß-oxidation pathway located exclusively in peroxisomes, and that they lost mitochondrial ß-oxidation early during evolution. In this work, we showed that mutants of the opportunistic pathogenic yeast Candida lusitaniae which lack the multifunctional enzyme Fox2p, a key enzyme of the ß-oxidation pathway, were still able to grow on fatty acids as the sole carbon source, suggesting that C. lusitaniae harbored an alternative pathway for fatty acid catabolism. By assaying 14Cα-palmitoyl-CoA consumption, we demonstrated that fatty acid catabolism takes place in both peroxisomal and mitochondrial subcellular fractions. We then observed that a fox2Δ null mutant was unable to catabolize fatty acids in the mitochondrial fraction, thus indicating that the mitochondrial pathway was Fox2p-dependent. This finding was confirmed by the immunodetection of Fox2p in protein extracts obtained from purified peroxisomal and mitochondrial fractions. Finally, immunoelectron microscopy provided evidence that Fox2p was localized in both peroxisomes and mitochondria. This work constitutes the first demonstration of the existence of a Fox2p-dependent mitochondrial β-oxidation pathway in an ascomycetous yeast, C. lusitaniae. It also points to the existence of an alternative fatty acid catabolism pathway, probably located in peroxisomes, and functioning in a Fox2p-independent manner.
DOE Office of Scientific and Technical Information (OSTI.GOV)
Lynch, Caitlin; Pan, Yongmei; Li, Linhao
Objective: Accumulating evidence suggests that activation of mouse constitutive androstane receptor (mCAR) alleviates type 2 diabetes and obesity by inhibiting hepatic gluconeogenesis, lipogenesis, and fatty acid synthesis. However, the role of human (h) CAR in energy metabolism is largely unknown. The present study aims to investigate the effects of selective hCAR activators on hepatic energy metabolism in human primary hepatocytes (HPH). Methods: Ligand-based structure–activity models were used for virtual screening of the Specs database ( (www.specs.net)) followed by biological validation in cell-based luciferase assays. The effects of two novel hCAR activators (UM104 and UM145) on hepatic energy metabolism were evaluatedmore » in HPH. Results: Real-time PCR and Western blotting analyses reveal that activation of hCAR by UM104 and UM145 significantly repressed the expression of glucose-6-phosphatase and phosphoenolpyruvate carboxykinase, two pivotal gluconeogenic enzymes, while exerting negligible effects on the expression of genes associated with lipogenesis and fatty acid synthesis. Functional experiments show that UM104 and UM145 markedly inhibit hepatic synthesis of glucose but not triglycerides in HPH. In contrast, activation of mCAR by 1,4-bis[2-(3,5-dichloropyridyloxy)]benzene, a selective mCAR activator, repressed the expression of genes associated with gluconeogenesis, lipogenesis, and fatty acid synthesis in mouse primary hepatocytes, which were consistent with previous observations in mouse model in vivo. Conclusion: Our findings uncover an important species difference between hCAR and mCAR in hepatic energy metabolism, where hCAR selectively inhibits gluconeogenesis without suppressing fatty acid synthesis. Implications: Such species selectivity should be considered when exploring CAR as a potential therapeutic target for metabolic disorders. - Highlights: • Novel hCAR activators were identified by computational and biological approaches.
Ventto, Laura; Leskinen, Heidi; Kairenius, Piia; Stefański, Tomasz; Bayat, Ali R; Vilkki, Johanna; Shingfield, Kevin J
2017-02-01
The biohydrogenation theory of milk fat depression (MFD) attributes decreases in milk fat in cows to the formation of specific fatty acids (FA) in the rumen. Trans-10, cis-12-CLA is the only biohydrogenation intermediate known to inhibit milk fat synthesis, but it is uncertain if increased ruminal synthesis is the sole explanation of MFD. Four lactating cows were used in a 4×4 Latin square with a 2×2 factorial arrangement of treatments and 35-d experimental periods to evaluate the effect of diets formulated to cause differences in ruminal lipid metabolism and milk fat synthesis on the flow of FA and dimethyl acetal at the omasum. Treatments comprised total mixed rations based on grass silage with a forage:concentrate ratio of 35:65 or 65:35 containing 0 or 50 g/kg sunflower oil (SO). Supplementing the high-concentrate diet with SO lowered milk fat synthesis from -20·2 to -31·9 % relative to other treatments. Decreases in milk fat were accompanied by alterations in ruminal biohydrogenation favouring the trans-10 pathway and an increase in the formation of specific intermediates including trans-4 to trans-10-18 : 1, trans-8, trans-10-CLA, trans-9, cis-11-CLA and trans-10, cis-15-18 : 2. Flow of trans-10, cis-12-CLA at the omasum was greater on high- than low-concentrate diets but unaffected by SO. In conclusion, ruminal trans-10, cis-12-CLA formation was not increased on a diet causing MFD suggesting that other biohydrogenation intermediates or additional mechanisms contribute to the regulation of fat synthesis in the bovine mammary gland.
Discovery and characterization of de novo sialic acid biosynthesis in the phylum Fusobacterium
Lewis, Amanda L; Robinson, Lloyd S; Agarwal, Kavita; Lewis, Warren G
2016-01-01
Sialic acids are nine-carbon backbone carbohydrates found in prominent outermost positions of glycosylated molecules in mammals. Mimicry of sialic acid (N-acetylneuraminic acid, Neu5Ac) enables some pathogenic bacteria to evade host defenses. Fusobacterium nucleatum is a ubiquitous oral bacterium also linked with invasive infections throughout the body. We employed multidisciplinary approaches to test predictions that F. nucleatum engages in de novo synthesis of sialic acids. Here we show that F. nucleatum sbsp. polymorphum ATCC10953 NeuB (putative Neu5Ac synthase) restores Neu5Ac synthesis to an Escherichia coli neuB mutant. Moreover, purified F. nucleatum NeuB participated in synthesis of Neu5Ac from N-acetylmannosamine and phosphoenolpyruvate in vitro. Further studies support the interpretation that F. nucleatum ATCC10953 NeuA encodes a functional CMP-sialic acid synthetase and suggest that it may also contain a C-terminal sialic acid O-acetylesterase. We also performed BLAST queries of F. nucleatum genomes, revealing that only 4/31 strains encode a complete pathway for de novo Neu5Ac synthesis. Biochemical studies including mass spectrometry were consistent with the bioinformatic predictions, showing that F. nucleatum ATCC10953 synthesizes high levels of Neu5Ac, whereas ATCC23726 and ATCC25586 do not express detectable levels above background. While there are a number of examples of sialic acid mimicry in other phyla, these experiments provide the first biochemical and genetic evidence that a member of the phylum Fusobacterium can engage in de novo Neu5Ac synthesis. PMID:27613803
Recent Progress on the Stereoselective Synthesis of Cyclic Quaternary α-Amino Acids
Cativiela, Carlos; Ordóñez, Mario
2010-01-01
The most recent papers describing the stereoselective synthesis of cyclic quaternary α-amino acids are collected in this review. The diverse synthetic approaches are classified according to the size of the ring and taking into account the bond that is formed to complete the quaternary skeleton. PMID:20300486
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments
NASA Astrophysics Data System (ADS)
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Energetics of Amino Acid Synthesis in Alkaline Hydrothermal Environments.
Kitadai, Norio
2015-12-01
Alkaline hydrothermal systems have received considerable attention as candidates for the origin and evolution of life on the primitive Earth. Nevertheless, sufficient information has not yet been obtained for the thermodynamic properties of amino acids, which are necessary components for life, at high temperatures and alkaline pH. These properties were estimated using experimental high-temperature volume and heat capacity data reported in the literature for several amino acids, together with correlation algorithms and the revised Helgeson-Kirkham-Flowers (HKF) equations of state. This approach enabled determination of a complete set of the standard molal thermodynamic data and the revised HKF parameters for the 20 protein amino acids in their zwitterionic and ionization states. The obtained dataset was then used to evaluate the energetics of amino acid syntheses from simple inorganic precursors (CO2, H2, NH3 and H2S) in a simulated alkaline hydrothermal system on the Hadean Earth. Results show that mixing between CO2-rich seawater and the H2-rich hydrothermal fluid can produce energetically favorable conditions for amino acid syntheses, particularly in the lower-temperature region of such systems. Together with data related to the pH and temperature dependences of the energetics of amino acid polymerizations presented in earlier reports, these results suggest the following. Hadean alkaline hydrothermal settings, where steep pH and temperature gradients may have existed between cool, slightly acidic Hadean ocean water and hot, alkaline hydrothermal fluids at the vent-ocean interface, may be energetically the most suitable environment for the synthesis and polymerization of amino acids.
Qi, Yunpeng; Jiang, Changtao; Cheng, Jie; Krausz, Kristopher W.; Li, Tiangang; Ferrell, Jessica M.; Gonzalez, Frank J.; Chiang, John Y.L.
2014-01-01
Bile acid synthesis is the major pathway for catabolism of cholesterol. Cholesterol 7α-hydroxylase (CYP7A1) is the rate-limiting enzyme in the bile acid biosynthetic pathway in the liver and plays an important role in regulating lipid, glucose and energy metabolism. Transgenic mice overexpressing CYP7A1 (CYP7A1-tg mice) were resistant to high-fat diet (HFD)-induced obesity, fatty liver, and diabetes. However the mechanism of resistance to HFD-induced obesity of CYP7A1-tg mice has not been determined. In this study, metabolomic and lipidomic profiles of CYP7A1-tg mice were analyzed to explore the metabolic alterations in CYP7A1-tg mice that govern the protection against obesity and insulin resistance by using ultra-performance liquid chromatography-coupled with electrospray ionization quadrupole time-of-flight mass spectrometry combined with multivariate analyses. Lipidomics analysis identified seven lipid markers including lysophosphatidylcholines, phosphatidylcholines, sphingomyelins and ceramides that were significantly decreased in serum of HFD-fed CYP7A1-tg mice. Metabolomics analysis identified 13 metabolites in bile acid synthesis including taurochenodeoxycholic acid, taurodeoxycholic acid, tauroursodeoxycholic acid, taurocholic acid, and tauro-β-muricholic acid (T-β-MCA) that differed between CYP7A1-tg and wild-type mice. Notably, T-β-MCA, an antagonist of the farnesoid X receptor (FXR) was significantly increased in intestine of CYP7A1-tg mice. This study suggests that reducing 12α-hydroxylated bile acids and increasing intestinal T-β-MCA may reduce high fat diet-induced increase of phospholipids, sphingomyelins and ceramides, and ameliorate diabetes and obesity. PMID:24796972
Increasing the fidelity of noncanonical amino acid incorporation in cell-free protein synthesis.
Gan, Qinglei; Fan, Chenguang
2017-11-01
Cell-free protein synthesis provides a robust platform for co-translational incorporation of noncanonical amino acid (ncAA) into proteins to facilitate biological studies and biotechnological applications. Recently, eliminating the activity of release factor 1 has been shown to increase ncAA incorporation in response to amber codons. However, this approach could promote mis-incorporation of canonical amino acids by near cognate suppression. We performed a facile protocol to remove near cognate tRNA isoacceptors of the amber codon from total tRNAs, and used the phosphoserine (Sep) incorporation system as validation. By manipulating codon usage of target genes and tRNA species introduced into the cell-free protein synthesis system, we increased the fidelity of Sep incorporation at a specific position. By removing three near cognate tRNA isoacceptors of the amber stop codon [tRNA Lys , tRNA Tyr , and tRNA Gln (CUG)] from the total tRNA, the near cognate suppression decreased by 5-fold without impairing normal protein synthesis in the cell-free protein synthesis system. Mass spectrometry analyses indicated that the fidelity of ncAA incorporation was improved. Removal of near cognate tRNA isoacceptors of the amber codon could increase ncAA incorporation fidelity towards the amber stop codon in release factor deficiency systems. We provide a general strategy to improve fidelity of ncAA incorporation towards stop, quadruplet and sense codons in cell-free protein synthesis systems. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2016 Elsevier B.V. All rights reserved.
Chen, Zhuo; Luo, Ling; Chen, Runfa; Hu, Hanhua; Pan, Yufang; Jiang, Haibo; Wan, Xia; Jin, Hu; Gong, Yangmin
2018-03-01
N ε -lysine acetylation represents a highly dynamic and reversibly regulated post-translational modification widespread in almost all organisms, and plays important roles for regulation of protein function in diverse metabolic pathways. However, little is known about the role of lysine acetylation in photosynthetic eukaryotic microalgae. We integrated proteomic approaches to comprehensively characterize the lysine acetylome in the model diatom Phaeodactylum tricornutum In total, 2324 acetylation sites from 1220 acetylated proteins were identified, representing the largest data set of the lysine acetylome in plants to date. Almost all enzymes involved in fatty acid synthesis were found to be lysine acetylated. Six putative lysine acetylation sites were identified in a plastid-localized long-chain acyl-CoA synthetase. Site-directed mutagenesis and site-specific incorporation of N-acetyllysine in acyl-CoA synthetase show that acetylation at K407 and K425 increases its enzyme activity. Moreover, the nonenzymatically catalyzed overall hyperacetylation of acyl-CoA synthetase by acetyl-phosphate can be effectively deacetylated and reversed by a sirtuin-type NAD + -dependent deacetylase with subcellular localization of both the plastid and nucleus in Phaeodactylum This work indicates the regulation of acyl-CoA synthetase activity by site-specific lysine acetylation and highlights the potential regulation of fatty acid metabolism by lysine actetylation in the plastid of the diatom Phaeodactylum . © 2018 by The American Society for Biochemistry and Molecular Biology, Inc.
Pachymic acid promotes induction of autophagy related to IGF-1 signaling pathway in WI-38 cells.
Lee, Su-Gyeong; Kim, Moon-Moo
2017-12-01
The insulin-like growth factor 1 (IGF-1) signaling pathway has spotlighted as a mechanism to elucidate aging associated with autophagy in recent years. Therefore, we have tried to screen an effective compound capable of inducing autophagy to delay aging process. The aim of this study is to investigate whether pachymic acid, a main compound in Poria cocos, induces autophagy in the aged cells. The aging of young cells was induced by treatment with IGF-1 at 50 ng/ml three times every two days. The effect of pachymic acid on cell viability was evaluated in human lung fibroblasts, WI-38 cells, using MTT assay. The induction of autophagy was detected using autophagy detection kit. The expression of proteins related to autophagy and IGF-1 signaling pathway was examined by western blot analysis and immunofluorescence assay. In this study, pachymic acid showed cytotoxic effect in a dose dependent manner and remarkably induced autophagy at the same time. Moreover, pachymic acid increased the expression of proteins related to autophagy such as LC3-II and Beclin1 and decreased the levels of mTor phosphorylation and p70S6K in the aged cells. In particular, pachymic acid increased the expression of p-PI3K, p-FoxO and Catalase. In addition, pachymic acid remarkably increased the expression of IGFBP-3. Above results suggest that pachymic acid could induce autophagy related to IGF-1 signaling pathway in the aged cells. Copyright © 2017 Elsevier GmbH. All rights reserved.
McCune, S A; Durant, P J; Harris, R A
1984-02-01
Hepatocytes were isolated from 3 and 5 month old female genetically obese Zucker rats and their lean littermate controls. An age-dependent loss in sensitivity of fatty acid synthesis to inhibition by both glucagon and dibutyryl cyclic AMP was observed with hepatocytes from the obese rats. Hepatocytes from lean animals were much more sensitive to these agents, regardless of age. Low concentrations of glucagon and dibutyryl cyclic AMP actually produced some stimulation of fatty acid synthesis with hepatocytes prepared from the older obese rats. 5-Tetradecyloxy-2-furoic acid, a compound which inhibits fatty acid synthesis, was a very effective inhibitor of fatty acid synthesis by hepatocytes isolated from all rats used in the study. An inhibition of lactate plus pyruvate accumulation and a strong stimulation of glycogenolysis occurred in response to both glucagon and dibutyryl cyclic AMP with hepatocytes from both age groups of lean and obese rats. The results suggest that with aging of the obese female Zucker rat some step of hepatic fatty acid synthesis becomes progressively less sensitive to inhibition by glucagon and dibutyryl cyclic AMP. This may play an important role in maintenance of obesity in these animals.
Lipoic acid metabolism in Trypanosoma cruzi as putative target for chemotherapy.
Vacchina, Paola; Lambruschi, Daniel A; Uttaro, Antonio D
2018-03-01
Lipoic acid (LA) is a cofactor of relevant enzymatic complexes including the glycine cleave system and 2-ketoacid dehydrogenases. Intervention on LA de novo synthesis or salvage could have pleiotropic deleterious effect in cells, making both pathways attractive for chemotherapy. We show that Trypanosoma cruzi was susceptible to treatment with LA analogues. 8-Bromo-octanic acid (BrO) inhibited the growth of epimastigote forms of both Dm28c and CL Brener strains, although only at high (chemotherapeutically irrelevant) concentrations. The methyl ester derivative MBrO, was much more effective, with EC 50 values one order of magnitude lower (62-66 μM). LA did not bypass the toxic effect of its analogues. Small monocarboxylic acids appear to be poorly internalized by T. cruzi: [ 14 C]-octanoic acid was taken up 12 fold less efficiently than [ 14 C]-palmitic acid. Western blot analysis of lipoylated proteins allowed the detection of the E2 subunits of pyruvate dehydrogenase (PDH), branched chain 2-ketoacid dehydrogenase and 2-ketoglutarate dehydrogenase complexes. Growth of parasites in medium with 10 fold lower glucose content, notably increased PDH activity and the level of its lipoylated E2 subunit. Treatment with BrO (1 mM) and MBrO (0.1 mM) completely inhibited E2 lipoylation and all three dehydrogenases activities. These observations indicate the lack of specific transporters for octanoic acid and most probably also for BrO and LA, which is in agreement with the lack of a LA salvage pathway, as previously suggested for T. brucei. They also indicate that the LA synthesis/protein lipoylation pathway could be a valid target for drug intervention. Moreover, the free LA available in the host would not interfere with such chemotherapeutic treatments. Copyright © 2018 Elsevier Inc. All rights reserved.
Nanson, Jeffrey D; Forwood, Jade K
2015-01-01
Ketoacyl-acyl carrier protein reductases (FabG) are ubiquitously expressed enzymes that catalyse the reduction of acyl carrier protein (ACP) linked thioesters within the bacterial type II fatty acid synthesis (FASII) pathway. The products of these enzymes, saturated and unsaturated fatty acids, are essential components of the bacterial cell envelope. The FASII reductase enoyl-ACP reductase (FabI) has been the focus of numerous drug discovery efforts, some of which have led to clinical trials, yet few studies have focused on FabG. Like FabI, FabG appears to be essential for survival in many bacteria, similarly indicating the potential of this enzyme as a drug target. FabG enzymes are members of the short-chain alcohol dehydrogenase/reductase (SDR) family, and like other SDRs, exhibit highly conserved secondary and tertiary structures, and contain a number of conserved sequence motifs. Here we describe the crystal structures of FabG from Yersinia pestis (YpFabG), the causative agent of bubonic, pneumonic, and septicaemic plague, and three human pandemics. Y. pestis remains endemic in many parts of North America, South America, Southeast Asia, and Africa, and a threat to human health. YpFabG shares a high degree of structural similarity with bacterial homologues, and the ketoreductase domain of the mammalian fatty acid synthase from both Homo sapiens and Sus scrofa. Structural characterisation of YpFabG, and comparison with other bacterial FabGs and the mammalian fatty acid synthase, provides a strong platform for virtual screening of potential inhibitors, rational drug design, and the development of new antimicrobial agents to combat Y. pestis infections.
Liu, Ting-Wu; Niu, Li; Fu, Bin; Chen, Juan; Wu, Fei-Hua; Chen, Juan; Wang, Wen-Hua; Hu, Wen-Jun; He, Jun-Xian; Zheng, Hai-Lei
2013-01-01
Acid rain, as a worldwide environmental issue, can cause serious damage to plants. In this study, we provided the first case study on the systematic responses of arabidopsis (Arabidopsis thaliana (L.) Heynh.) to simulated acid rain (SiAR) by transcriptome approach. Transcriptomic analysis revealed that the expression of a set of genes related to primary metabolisms, including nitrogen, sulfur, amino acid, photosynthesis, and reactive oxygen species metabolism, were altered under SiAR. In addition, transport and signal transduction related pathways, especially calcium-related signaling pathways, were found to play important roles in the response of arabidopsis to SiAR stress. Further, we compared our data set with previously published data sets on arabidopsis transcriptome subjected to various stresses, including wound, salt, light, heavy metal, karrikin, temperature, osmosis, etc. The results showed that many genes were overlapped in several stresses, suggesting that plant response to SiAR is a complex process, which may require the participation of multiple defense-signaling pathways. The results of this study will help us gain further insights into the response mechanisms of plants to acid rain stress.
Kawasaki, Regiane; Baraúna, Rafael A; Silva, Artur; Carepo, Marta S P; Oliveira, Rui; Marques, Rodolfo; Ramos, Rommel T J; Schneider, Maria P C
2016-01-01
Exiguobacterium antarcticum B7 is extremophile Gram-positive bacteria able to survive in cold environments. A key factor to understanding cold adaptation processes is related to the modification of fatty acids composing the cell membranes of psychrotrophic bacteria. In our study we show the in silico reconstruction of the fatty acid biosynthesis pathway of E. antarcticum B7. To build the stoichiometric model, a semiautomatic procedure was applied, which integrates genome information using KEGG and RAST/SEED. Constraint-based methods, namely, Flux Balance Analysis (FBA) and elementary modes (EM), were applied. FBA was implemented in the sense of hexadecenoic acid production maximization. To evaluate the influence of the gene expression in the fluxome analysis, FBA was also calculated using the log2FC values obtained in the transcriptome analysis at 0°C and 37°C. The fatty acid biosynthesis pathway showed a total of 13 elementary flux modes, four of which showed routes for the production of hexadecenoic acid. The reconstructed pathway demonstrated the capacity of E. antarcticum B7 to de novo produce fatty acid molecules. Under the influence of the transcriptome, the fluxome was altered, promoting the production of short-chain fatty acids. The calculated models contribute to better understanding of the bacterial adaptation at cold environments.
Kawasaki, Regiane; Carepo, Marta S. P.; Oliveira, Rui; Marques, Rodolfo; Ramos, Rommel T. J.; Schneider, Maria P. C.
2016-01-01
Exiguobacterium antarcticum B7 is extremophile Gram-positive bacteria able to survive in cold environments. A key factor to understanding cold adaptation processes is related to the modification of fatty acids composing the cell membranes of psychrotrophic bacteria. In our study we show the in silico reconstruction of the fatty acid biosynthesis pathway of E. antarcticum B7. To build the stoichiometric model, a semiautomatic procedure was applied, which integrates genome information using KEGG and RAST/SEED. Constraint-based methods, namely, Flux Balance Analysis (FBA) and elementary modes (EM), were applied. FBA was implemented in the sense of hexadecenoic acid production maximization. To evaluate the influence of the gene expression in the fluxome analysis, FBA was also calculated using the log2FC values obtained in the transcriptome analysis at 0°C and 37°C. The fatty acid biosynthesis pathway showed a total of 13 elementary flux modes, four of which showed routes for the production of hexadecenoic acid. The reconstructed pathway demonstrated the capacity of E. antarcticum B7 to de novo produce fatty acid molecules. Under the influence of the transcriptome, the fluxome was altered, promoting the production of short-chain fatty acids. The calculated models contribute to better understanding of the bacterial adaptation at cold environments. PMID:27595107
Yang, Hua; Jiang, Tingshu; Li, Ping; Mao, Qishan
2015-09-01
Acetaminophen (APAP)-induced liver toxicity remains the key factor limiting the clinical application of APAP, and herbs are the important sources for isolation of compounds preventing APAP-induced toxicity. To investigate the protection mechanism of glycyrrhetinic acid towards APAP-induced liver damage using metabolomics method. APAP-induced liver toxicity model was made through intraperitoneal injection (i.p.) of APAP (400 mg/kg). Glycyrrhetinic acid was dissolved in corn oil, and intraperitoneal injection (i.p.) of glycyrrhetinic acid (500 mg/kg body weight) was performed for 20 days before the injection of APAP. UPLC-ESI-QTOF MS was employed to analyze the metabolomic profile of serum samples. The pre-treatment of glycyrrhetinic acid significantly protected APAP-induced toxicity, indicated by the histology of liver, the activity of ALT and AST. Metabolomics showed that the level of palmtioylcarnitine and oleoylcarnitine significantly increased in serum of APAP-treated mice, and the pre-treatment with GA can prevent this elevation of these two fatty acid-carnitines. Reversing the metabolism pathway of fatty acid is an important mechanism for the protection of glycyrrhetinic acid towards acetaminophen-induced liver toxicity.