Production of Odd-Carbon Dicarboxylic Acids in Escherichia coli Using an Engineered Biotin–Fatty Acid Biosynthetic Pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Haushalter, Robert W.; Phelan, Ryan M.; Hoh, Kristina M.

Dicarboxylic acids are commodity chemicals used in the production of plastics, polyesters, nylons, fragrances, and medications. Bio-based routes to dicarboxylic acids are gaining attention due to environmental concerns about petroleum-based production of these compounds. Some industrial applications require dicarboxylic acids with specific carbon chain lengths, including odd-carbon species. Biosynthetic pathways involving cytochrome P450-catalyzed oxidation of fatty acids in yeast and bacteria have been reported, but these systems produce almost exclusively even-carbon species. Here in this paper we report a novel pathway to odd-carbon dicarboxylic acids directly from glucose in Escherichia coli by employing an engineered pathway combining enzymes from biotinmore » and fatty acid synthesis. Optimization of the pathway will lead to industrial strains for the production of valuable odd-carbon diacids.« less

Effects of EPSPS Copy Number Variation (CNV) and Glyphosate Application on the Aromatic and Branched Chain Amino Acid Synthesis Pathways in Amaranthus palmeri

PubMed Central

Fernández-Escalada, Manuel; Zulet-González, Ainhoa; Gil-Monreal, Miriam; Zabalza, Ana; Ravet, Karl; Gaines, Todd; Royuela, Mercedes

2017-01-01

A key enzyme of the shikimate pathway, 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS; EC 2.5.1.19), is the known target of the widely used herbicide glyphosate. Glyphosate resistance in Amaranthus palmeri, one of the most troublesome weeds in agriculture, has evolved through increased EPSPS gene copy number. The aim of this work was to study the pleiotropic effects of (i) EPSPS increased transcript abundance due to gene copy number variation (CNV) and of (ii) glyphosate application on the aromatic amino acid (AAA) and branched chain amino acid (BCAA) synthesis pathways. Hydroponically grown glyphosate sensitive (GS) and glyphosate resistant (GR) plants were treated with glyphosate 3 days after treatment. In absence of glyphosate treatment, high EPSPS gene copy number had only a subtle effect on transcriptional regulation of AAA and BCAA pathway genes. In contrast, glyphosate treatment provoked a general accumulation of the transcripts corresponding to genes of the AAA pathway leading to synthesis of chorismate in both GS and GR. After chorismate, anthranilate synthase transcript abundance was higher while chorismate mutase transcription showed a small decrease in GR and remained stable in GS, suggesting a regulatory branch point in the pathway that favors synthesis toward tryptophan over phenylalanine and tyrosine after glyphosate treatment. This was confirmed by studying enzyme activities in vitro and amino acid analysis. Importantly, this upregulation was glyphosate dose dependent and was observed similarly in both GS and GR populations. Glyphosate treatment also had a slight effect on the expression of BCAA genes but no general effect on the pathway could be observed. Taken together, our observations suggest that the high CNV of EPSPS in A. palmeri GR populations has no major pleiotropic effect on the expression of AAA biosynthetic genes, even in response to glyphosate treatment. This finding supports the idea that the fitness cost associated with EPSPS CNV

Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver stage development

PubMed Central

Lindner, Scott E.; Sartain, Mark J.; Hayes, Kiera; Harupa, Anke; Moritz, Robert L.; Kappe, Stefan H. I.; Vaughan, Ashley M.

2014-01-01

SUMMARY Malaria parasites scavenge nutrients from their host but also harbor enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbor genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic synthesis. Our research shows that apicoplast-targeted P. yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver stage development and deletion of the encoding genes resulted in late liver stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite lifecycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver stage maturation. PMID:24330260

Bile acid synthesis in man. In vivo activity of the 25-hydroxylation pathway

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duane, W.C.; Pooler, P.A.; Hamilton, J.N.

1988-07-01

During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side-chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. We have previously shown in the rat that the contribution of the 25-hydroxylation pathway can be quantitated in vivo by measuring production of (/sup 14/C)acetone from (/sup 14/C)26-cholesterol. In the present study, we adapted this method to human subjects. 4 d after oral administration of 100 microCi of (/sup 14/C)26-cholesterol andmore » 1 d after beginning a constant infusion of 16.6 mumol/min unlabeled acetone, three men and two women underwent breath collections. Expired acetone was trapped and purified as the 2,4 dinitrophenylhydrazine derivative. /sup 14/CO/sub 2/ was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied by the acetone infusion rate to calculate production of (/sup 14/C)acetone. (/sup 14/C)Acetone production averaged 4.9% of total release of /sup 14/C from (/sup 14/C)26-cholesterol, estimated by /sup 14/CO2 output. The method was validated by showing that (/sup 14/C)acetone production from (/sup 14/C)isopropanol averaged 86.9% of the (/sup 14/C)-isopropanol infusion rate. We conclude that in man, as in the rat, the 25-hydroxylation pathway accounts for less than 5% of bile acid synthesis.« less

Arbuscular mycorrhizal fungal inoculation increases phenolic synthesis in clover roots via hydrogen peroxide, salicylic acid and nitric oxide signaling pathways.

PubMed

Zhang, Rui-Qin; Zhu, Hong-Hui; Zhao, Hai-Quan; Yao, Qing

2013-01-01

Arbuscular mycorrhizal fungi can increase the host resistance to pathogens via promoted phenolic synthesis, however, the signaling pathway responsible for it still remains unclear. In this study, in order to reveal the signaling molecules involved in this process, we inoculated Trifolium repense L. with an arbuscular mycorrhizal fungus (AMF), Glomus mosseae, and monitored the contents of phenolics and signaling molecules (hydrogen peroxide (H(2)O(2)), salicylic acid (SA), and nitric oxide (NO)) in roots, measured the activities of l-phenylalanine ammonia-lyase (PAL) and nitric oxide synthase (NOS), and the expression of pal and chs genes. Results demonstrated that AMF colonization promoted the phenolic synthesis, in parallel with the increase in related enzyme activity and gene expression. Meanwhile, the accumulation of all three signaling molecules was also up-regulated by AMF. This study suggested that AMF increased the phenolic synthesis in roots probably via signaling pathways of H(2)O(2), SA and NO in a signaling cascade. Copyright © 2012 Elsevier GmbH. All rights reserved.

Enzymes involved in plastid-targeted phosphatidic acid synthesis are essential for Plasmodium yoelii liver-stage development.

PubMed

Lindner, Scott E; Sartain, Mark J; Hayes, Kiera; Harupa, Anke; Moritz, Robert L; Kappe, Stefan H I; Vaughan, Ashley M

2014-02-01

Malaria parasites scavenge nutrients from their host but also harbour enzymatic pathways for de novo macromolecule synthesis. One such pathway is apicoplast-targeted type II fatty acid synthesis, which is essential for late liver-stage development in rodent malaria. It is likely that fatty acids synthesized in the apicoplast are ultimately incorporated into membrane phospholipids necessary for exoerythrocytic merozoite formation. We hypothesized that these synthesized fatty acids are being utilized for apicoplast-targeted phosphatidic acid synthesis, the phospholipid precursor. Phosphatidic acid is typically synthesized in a three-step reaction utilizing three enzymes: glycerol 3-phosphate dehydrogenase, glycerol 3-phosphate acyltransferase and lysophosphatidic acid acyltransferase. The Plasmodium genome is predicted to harbour genes for both apicoplast- and cytosol/endoplasmic reticulum-targeted phosphatidic acid synthesis. Our research shows that apicoplast-targeted Plasmodium yoelii glycerol 3-phosphate dehydrogenase and glycerol 3-phosphate acyltransferase are expressed only during liver-stage development and deletion of the encoding genes resulted in late liver-stage growth arrest and lack of merozoite differentiation. However, the predicted apicoplast-targeted lysophosphatidic acid acyltransferase gene was refractory to deletion and was expressed solely in the endoplasmic reticulum throughout the parasite life cycle. Our results suggest that P. yoelii has an incomplete apicoplast-targeted phosphatidic acid synthesis pathway that is essential for liver-stage maturation. © 2013 John Wiley & Sons Ltd.

Regulation of protein synthesis by amino acids in muscle of neonates

PubMed Central

Suryawan, Agus; Davis, Teresa A.

2011-01-01

The marked increase in skeletal muscle mass during the neonatal period is largely due to a high rate of postprandial protein synthesis that is modulated by an enhanced sensitivity to insulin and amino acids. The amino acid signaling pathway leading to the stimulation of protein synthesis has not been fully elucidated. Among the amino acids, leucine is considered to be a principal anabolic agent that regulates protein synthesis. mTORC1, which controls protein synthesis, has been implicated as a target for leucine. Until recently, there have been few studies exploring the role of amino acids in enhancing muscle protein synthesis in vivo. In this review, we discuss amino acid-induced protein synthesis in muscle in the neonate, focusing on current knowledge of the role of amino acids in the activation of mTORC1 leading to mRNA translation. The role of the amino acid transporters, SNAT2, LAT1, and PAT, in the modulation of mTORC1 activation and the role of amino acids in the activation of putative regulators of mTORC1, i.e., raptor, Rheb, MAP4K3, Vps34, and Rag GTPases, are discussed. PMID:21196241

Inhibition of rotavirus replication by downregulation of fatty acid synthesis.

PubMed

Gaunt, Eleanor R; Cheung, Winsome; Richards, James E; Lever, Andrew; Desselberger, Ulrich

2013-06-01

Recently the recruitment of lipid droplets (LDs) to sites of rotavirus (RV) replication was reported. LDs are polymorphic organelles that store triacylglycerols, cholesterol and cholesterol esters. The neutral fats are derived from palmitoyl-CoA, synthesized via the fatty acid biosynthetic pathway. RV-infected cells were treated with chemical inhibitors of the fatty acid biosynthetic pathway, and the effects on viral replication kinetics were assessed. Treatment with compound C75, an inhibitor of the fatty acid synthase enzyme complex (FASN), reduced RV infectivity 3.2-fold (P = 0.07) and modestly reduced viral RNA synthesis (1.2-fold). Acting earlier in the fatty acid synthesis pathway, TOFA [5-(Tetradecyloxy)-2-furoic acid] inhibits the enzyme acetyl-CoA carboxylase 1 (ACC1). TOFA reduced the infectivity of progeny RV 31-fold and viral RNA production 6-fold. The effect of TOFA on RV infectivity and RNA replication was dose-dependent, and infectivity was reduced by administering TOFA up to 4 h post-infection. Co-treatment of RV-infected cells with C75 and TOFA synergistically reduced viral infectivity. Knockdown by siRNA of FASN and ACC1 produced findings similar to those observed by inhibiting these proteins with the chemical compounds. Inhibition of fatty acid synthesis using a range of approaches uniformly had a more marked impact on viral infectivity than on viral RNA yield, inferring a role for LDs in virus assembly and/or egress. Specific inhibitors of fatty acid metabolism may help pinpoint the critical structural and biochemical features of LDs that are essential for RV replication, and facilitate the development of antiviral therapies.

Pyroglutamic acid stimulates DNA synthesis in rat primary hepatocytes through the mitogen-activated protein kinase pathway.

PubMed

Inoue, Shinjiro; Okita, Yoichi; de Toledo, Andreia; Miyazaki, Hiroyuki; Hirano, Eiichi; Morinaga, Tetsuo

2015-01-01

We purified pyroglutamic acid from human placental extract and identified it as a potent stimulator of rat primary hepatocyte DNA synthesis. Pyroglutamic acid dose-dependently stimulated DNA synthesis, and this effect was inhibited by PD98059, a dual specificity mitogen-activated protein kinase kinase 1 (MAP2K1) inhibitor. Therefore, pyroglutamic acid stimulated DNA synthesis in rat primary hepatocytes via MAPK signaling.

trans-10,cis-12 conjugated linoleic acid alters lipid metabolism of goat mammary epithelial cells by regulation of de novo synthesis and the AMPK signaling pathway.

PubMed

Zhang, T Y; Huang, J T; Tian, H B; Ma, Y; Chen, Z; Wang, J J; Shi, H P; Luo, J

2018-06-01

The trans-10,cis-12 isomer of conjugated linoleic acid (t10c12-CLA) is a biohydrogenation intermediate in the rumen and has been shown to cause milk fat depression in dairy goats. However, few studies have focused on the in vitro molecular mechanisms involved in the response of the goat mammary gland to t10c12-CLA. In the present study, RNA sequencing technology was used to investigate the effects of t10c12-CLA on goat mammary epithelial cells. From the data, 25,153 annotated transcripts were obtained, and differentially expressed genes were selected based on a false discovery rate <0.05. Candidate genes and potent cellular signaling pathways were identified through Gene Ontology (GO) and pathway analysis. Next, real-time quantitative PCR and Western blot analyses were used to verify the results of the RNA sequencing data. The results indicated that t10c12-CLA inhibits fatty acid synthesis through downregulation of genes involved in de novo fatty acid synthesis, and this process is likely correlated with the activation of the AMP-activated protein kinase signaling pathways. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.

Decreased hepatotoxic bile acid composition and altered synthesis in progressive human nonalcoholic fatty liver disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lake, April D.; Novak, Petr; Shipkova, Petia

2013-04-15

Bile acids (BAs) have many physiological roles and exhibit both toxic and protective influences within the liver. Alterations in the BA profile may be the result of disease induced liver injury. Nonalcoholic fatty liver disease (NAFLD) is a prevalent form of chronic liver disease characterized by the pathophysiological progression from simple steatosis to nonalcoholic steatohepatitis (NASH). The hypothesis of this study is that the ‘classical’ (neutral) and ‘alternative’ (acidic) BA synthesis pathways are altered together with hepatic BA composition during progression of human NAFLD. This study employed the use of transcriptomic and metabolomic assays to study the hepatic toxicologic BAmore » profile in progressive human NAFLD. Individual human liver samples diagnosed as normal, steatosis, and NASH were utilized in the assays. The transcriptomic analysis of 70 BA genes revealed an enrichment of downregulated BA metabolism and transcription factor/receptor genes in livers diagnosed as NASH. Increased mRNA expression of BAAT and CYP7B1 was observed in contrast to decreased CYP8B1 expression in NASH samples. The BA metabolomic profile of NASH livers exhibited an increase in taurine together with elevated levels of conjugated BA species, taurocholic acid (TCA) and taurodeoxycholic acid (TDCA). Conversely, cholic acid (CA) and glycodeoxycholic acid (GDCA) were decreased in NASH liver. These findings reveal a potential shift toward the alternative pathway of BA synthesis during NASH, mediated by increased mRNA and protein expression of CYP7B1. Overall, the transcriptomic changes of BA synthesis pathway enzymes together with altered hepatic BA composition signify an attempt by the liver to reduce hepatotoxicity during disease progression to NASH. - Highlights: ► Altered hepatic bile acid composition is observed in progressive NAFLD. ► Bile acid synthesis enzymes are transcriptionally altered in NASH livers. ► Increased levels of taurine and conjugated bile

Mitochondrial fatty acid synthesis, fatty acids and mitochondrial physiology.

PubMed

Kastaniotis, Alexander J; Autio, Kaija J; Kerätär, Juha M; Monteuuis, Geoffray; Mäkelä, Anne M; Nair, Remya R; Pietikäinen, Laura P; Shvetsova, Antonina; Chen, Zhijun; Hiltunen, J Kalervo

2017-01-01

Mitochondria and fatty acids are tightly connected to a multiplicity of cellular processes that go far beyond mitochondrial fatty acid metabolism. In line with this view, there is hardly any common metabolic disorder that is not associated with disturbed mitochondrial lipid handling. Among other aspects of mitochondrial lipid metabolism, apparently all eukaryotes are capable of carrying out de novo fatty acid synthesis (FAS) in this cellular compartment in an acyl carrier protein (ACP)-dependent manner. The dual localization of FAS in eukaryotic cells raises the questions why eukaryotes have maintained the FAS in mitochondria in addition to the "classic" cytoplasmic FAS and what the products are that cannot be substituted by delivery of fatty acids of extramitochondrial origin. The current evidence indicates that mitochondrial FAS is essential for cellular respiration and mitochondrial biogenesis. Although both β-oxidation and FAS utilize thioester chemistry, CoA acts as acyl-group carrier in the breakdown pathway whereas ACP assumes this role in the synthetic direction. This arrangement metabolically separates these two pathways running towards opposite directions and prevents futile cycling. A role of this pathway in mitochondrial metabolic sensing has recently been proposed. This article is part of a Special Issue entitled: Lipids of Mitochondria edited by Guenther Daum. Copyright © 2016 Elsevier B.V. All rights reserved.

A new regulatory mechanism for bacterial lipoic acid synthesis

PubMed Central

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-01

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. PMID

A new regulatory mechanism for bacterial lipoic acid synthesis.

PubMed

Zhang, Huimin; Luo, Qixia; Gao, Haichun; Feng, Youjun

2015-01-22

Lipoic acid, an essential enzyme cofactor, is required in three domains of life. In the past 60 years since its discovery, most of the pathway for lipoic acid synthesis and metabolism has been elucidated. However, genetic control of lipoic acid synthesis remains unclear. Here, we report integrative evidence that bacterial cAMP-dependent signaling is linked to lipoic acid synthesis in Shewanella species, the certain of unique marine-borne bacteria with special ability of metal reduction. Physiological requirement of protein lipoylation in γ-proteobacteria including Shewanella oneidensis was detected using Western blotting with rabbit anti-lipoyl protein primary antibody. The two genes (lipB and lipA) encoding lipoic acid synthesis pathway were proved to be organized into an operon lipBA in Shewanella, and the promoter was mapped. Electrophoretic mobility shift assays confirmed that the putative CRP-recognizable site (AAGTGTGATCTATCTTACATTT) binds to cAMP-CRP protein with origins of both Escherichia coli and Shewanella. The native lipBA promoter of Shewanella was fused to a LacZ reporter gene to create a chromosome lipBA-lacZ transcriptional fusion in E. coli and S. oneidensis, allowing us to directly assay its expression level by β-galactosidase activity. As anticipated, the removal of E. coli crp gene gave above fourfold increment of lipBA promoter-driven β-gal expression. The similar scenario was confirmed by both the real-time quantitative PCR and the LacZ transcriptional fusion in the crp mutant of Shewanella. Furthermore, the glucose effect on the lipBA expression of Shewanella was evaluated in the alternative microorganism E. coli. As anticipated, an addition of glucose into media effectively induces the transcriptional level of Shewanella lipBA in that the lowered cAMP level relieves the repression of lipBA by cAMP-CRP complex. Therefore, our finding might represent a first paradigm mechanism for genetic control of bacterial lipoic acid synthesis. © 2015

The Significance of Different Diacylgycerol Synthesis Pathways on Plant Oil Composition and Bioengineering

PubMed Central

Bates, Philip D.; Browse, John

2012-01-01

The unique properties of vegetable oils from different plants utilized for food, industrial feedstocks, and fuel is dependent on the fatty acid (FA) composition of triacylglycerol (TAG). Plants can use two main pathways to produce diacylglycerol (DAG), the immediate precursor molecule to TAG synthesis: (1) De novo DAG synthesis, and (2) conversion of the membrane lipid phosphatidylcholine (PC) to DAG. The FA esterified to PC are also the substrate for FA modification (e.g., desaturation, hydroxylation, etc.), such that the FA composition of PC-derived DAG can be substantially different than that of de novo DAG. Since DAG provides two of the three FA in TAG, the relative flux of TAG synthesis from de novo DAG or PC-derived DAG can greatly affect the final oil FA composition. Here we review how the fluxes through these two alternate pathways of DAG/TAG synthesis are determined and present evidence that suggests which pathway is utilized in different plants. Additionally, we present examples of how the endogenous DAG synthesis pathway in a transgenic host plant can produce bottlenecks for engineering of plant oil FA composition, and discuss alternative strategies to overcome these bottlenecks to produce crop plants with designer vegetable oil compositions. PMID:22783267

Rational engineering of p-hydroxybenzoate hydroxylase to enable efficient gallic acid synthesis via a novel artificial biosynthetic pathway.

PubMed

Chen, Zhenya; Shen, Xiaolin; Wang, Jian; Wang, Jia; Yuan, Qipeng; Yan, Yajun

2017-11-01

Gallic acid (GA) is a naturally occurring phytochemical that has strong antioxidant and antibacterial activities. It is also used as a potential platform chemical for the synthesis of diverse high-value compounds. Hydrolytic degradation of tannins by acids, bases or microorganisms serves as a major way for GA production, which however, might cause environmental pollution and low yield and efficiency. Here, we report a novel approach for efficient microbial production of GA. First, structure-based rational engineering of PobA, a p-hydroxybenzoate hydroxylase from Pseudomonas aeruginosa, generated a new mutant, Y385F/T294A PobA, which displayed much higher activity toward 3,4-dihydroxybenzoic acid (3,4-DHBA) than the wild-type and any other reported mutants. Remarkably, expression of this mutant in Escherichia coli enabled generation of 1149.59 mg/L GA from 1000 mg/L 4-hydroxybenzoic acid (4-HBA), representing a 93% molar conversion ratio. Based on that, we designed and reconstituted a novel artificial biosynthetic pathway of GA and achieved 440.53 mg/L GA production from simple carbon sources in E. coli. Further enhancement of precursor supply through reinforcing shikimate pathway was able to improve GA de novo production to 1266.39 mg/L in shake flasks. Overall, this study not only led to the development of a highly active PobA variant for hydroxylating 3,4-DHBA into GA via structure-based protein engineering approach, but also demonstrated a promising pathway for bio-based manufacturing of GA and its derived compounds. Biotechnol. Bioeng. 2017;114: 2571-2580. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

Copper-catalyzed formic acid synthesis from CO2 with hydrosilanes and H2O.

PubMed

Motokura, Ken; Kashiwame, Daiki; Miyaji, Akimitsu; Baba, Toshihide

2012-05-18

A copper-catalyzed formic acid synthesis from CO2 with hydrosilanes has been accomplished. The Cu(OAc)2·H2O-1,2-bis(diphenylphosphino)benzene system is highly effective for the formic acid synthesis under 1 atm of CO2. The TON value approached 8100 in 6 h. The reaction pathway was revealed by in situ NMR analysis and isotopic experiments.

Intracellular synthesis of glutamic acid in Bacillus methylotrophicus SK19.001, a glutamate-independent poly(γ-glutamic acid)-producing strain.

PubMed

Peng, Yingyun; Zhang, Tao; Mu, Wanmeng; Miao, Ming; Jiang, Bo

2016-01-15

Bacillus methylotrophicus SK19.001 is a glutamate-independent strain that produces poly(γ-glutamic acid) (γ-PGA), a polymer of D- and L-glutamic acids that possesses applications in food, the environment, agriculture, etc. This study was undertaken to explore the synthetic pathway of intracellular L- and D-glutamic acid in SK19.001 by investigating the effects of tricarboxylic acid cycle intermediates and different amino acids as metabolic precursors on the production of γ-PGA and analyzing the activities of the enzymes involved in the synthesis of L- and D-glutamate. Tricarboxylic acid cycle intermediates and amino acids could participate in the synthesis of γ-PGA via independent pathways in SK19.001. L-Aspartate aminotransferase, L-glutaminase and L-glutamate synthase were the enzymatic sources of L-glutamate. Glutamate racemase was responsible for the formation of D-glutamate for the synthesis of γ-PGA, and the synthetase had stereoselectivity for glutamate substrate. The enzymatic sources of L-glutamate were investigated for the first time in the glutamate-independent γ-PGA-producing strain, and multiple enzymatic sources of L-glutamate were verified in SK19.001, which will benefit efforts to improve production of γ-PGA with metabolic engineering strategies. © 2015 Society of Chemical Industry.

Glutamate dehydrogenase (RocG) in Bacillus licheniformis WX-02: Enzymatic properties and specific functions in glutamic acid synthesis for poly-γ-glutamic acid production.

PubMed

Tian, Guangming; Wang, Qin; Wei, Xuetuan; Ma, Xin; Chen, Shouwen

2017-04-01

Poly-γ-glutamic acid (γ-PGA), a natural biopolymer, is widely used in cosmetics, medicine, food, water treatment, and agriculture owing to its features of moisture sequestration, cation chelation, non-toxicity and biodegradability. Intracellular glutamic acid, the substrate of γ-PGA, is a limiting factor for high yield in γ-PGA production. Bacillus subtilis and Bacillus licheniformis are both important γ-PGA producing strains, and B. subtilis synthesizes glutamic acid in vivo using the unique GOGAT/GS pathway. However, little is known about the glutamate synthesis pathway in B. licheniformis. The aim of this work was to characterize the glutamate dehydrogenase (RocG) in glutamic acid synthesis from B. licheniformis with both in vivo and in vitro experiments. By re-directing the carbon flux distribution, the rocG gene deletion mutant WX-02ΔrocG produced intracellular glutamic acid with a concentration of 90ng/log(CFU), which was only 23.7% that of the wild-type WX-02 (380ng/log(CFU)). Furthermore, the γ-PGA yield of mutant WX-02ΔrocG was 5.37g/L, a decrease of 45.3% compared to the wild type (9.82g/L). In vitro enzymatic assays of RocG showed that RocG has higher affinity for 2-oxoglutarate than glutamate, and the glutamate synthesis rate was far above degradation. This is probably the first study to reveal the glutamic acid synthesis pathway and the specific functions of RocG in B. licheniformis. The results indicate that γ-PGA production can be enhanced through improving intracellular glutamic acid synthesis. Copyright © 2017 Elsevier Inc. All rights reserved.

A Key Role for Lipoic Acid Synthesis During Plasmodium Liver stage Development

PubMed Central

Falkard, Brie; Santha Kumar, T. R.; Hecht, Leonie-Sophie; Matthews, Krista A.; Henrich, Philipp P.; Gulati, Sonia; Lewis, Rebecca E.; Manary, Micah J.; Winzeler, Elizabeth A.; Sinnis, Photini; Prigge, Sean T.; Heussler, Volker; Deschermeier, Christina; Fidock, David

2013-01-01

SUMMARY The successful navigation of malaria parasites through their life cycle, which alternates between vertebrate hosts and mosquito vectors, requires a complex interplay of metabolite synthesis and salvage pathways. Using the rodent parasite Plasmodium berghei, we have explored the synthesis and scavenging pathways for lipoic acid, a short-chain fatty acid derivative that regulates the activity of α-ketoacid dehydrogenases including pyruvate dehydrogenase. In Plasmodium, lipoic acid is either synthesized de novo in the apicoplast or is scavenged from the host into the mitochondrion. Our data show that sporozoites lacking the apicoplast lipoic acid protein ligase LipB are markedly attenuated in their infectivity for mice, and in vitro studies document a very late liver stage arrest shortly before the final phase of intra-hepatic parasite maturation. LipB-deficient asexual blood stage parasites show unimpaired rates of growth in normal in vitro or in vivo conditions. However, these parasites showed reduced growth in lipid-restricted conditions induced by treatment with the lipoic acid analog 8-bromo-octanoate or with the lipid-reducing agent clofibrate. This finding has implications for understanding Plasmodium pathogenesis in malnourished children that bear the brunt of malarial disease. This study also highlights the potential of exploiting lipid metabolism pathways for the design of genetically attenuated sporozoite vaccines. PMID:23490300

Lewis Acid Induced Toggle from Ir(II) to Ir(IV) Pathways in Photocatalytic Reactions: Synthesis of Thiomorpholines and Thiazepanes from Aldehydes and SLAP Reagents

PubMed Central

2016-01-01

Redox neutral photocatalytic transformations often require careful pairing of the substrates and photoredox catalysts in order to achieve a catalytic cycle. This can limit the range of viable transformations, as we recently observed in attempting to extend the scope of the photocatalytic synthesis of N-heterocycles using silicon amine protocol (SLAP) reagents to include starting materials that require higher oxidation potentials. We now report that the inclusion of Lewis acids in photocatalytic reactions of organosilanes allows access to a distinct reaction pathway featuring an Ir(III)*/Ir(IV) couple instead of the previously employed Ir(III)*/Ir(II) pathway, enabling the transformation of aromatic and aliphatic aldehydes to thiomorpholines and thiazepanes. The role of the Lewis acid in accepting an electron—either directly or via coordination to an imine—can be extended to other classes of photocatalysts and transformations, including oxidative cyclizations. The combination of light induced reactions and Lewis acids therefore promises access to new pathways and transformations that are not viable using the photocatalysts alone. PMID:28149955

The mitochondrial fatty acid synthesis (mtFASII) pathway is capable of mediating nuclear-mitochondrial cross talk through the PPAR system of transcriptional activation

PubMed Central

Parl, Angelika; Mitchell, Sabrina L.; Clay, Hayley B.; Reiss, Sara; Li, Zhen; Murdock, Deborah G.

2013-01-01

Mammalian cells contain two fatty acid synthesis pathways, the cytosolic FASI pathway, and the mitochondrial FASII pathway. The selection behind the conservation of the mitochondrial pathway is not completely understood, given the presence of the cytosolic FAS pathway. In this study, we show through heterologous gene reporter systems and PCR based arrays that overexpression of MECR, the last step in the mtFASII pathway, causes modulation of gene expression through the PPAR pathway. Electromobility shift assays (EMSAs) demonstrate that overexpression of MECR causes increased binding of PPARs to DNA, while cell fractionation and imaging studies show that MECR remains localized to the mitochondria. Interestingly, knock down of the mtFASII pathway lessens the effect of MECR on this transcriptional modulation. Our data are most consistent with MECR-mediated transcriptional activation through products of the mtFASII pathway, although we cannot rule out MECR acting as a coactivator. Further investigation into the physiological relevance of this communication will be necessary to better understand some of the phenotypic consequences of deficits in this pathway observed in animal models and human disease. PMID:24161390

Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics.

PubMed

Price, Morgan N; Zane, Grant M; Kuehl, Jennifer V; Melnyk, Ryan A; Wall, Judy D; Deutschbauer, Adam M; Arkin, Adam P

2018-01-01

For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. We studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fill 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes.

Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics

DOE Office of Scientific and Technical Information (OSTI.GOV)

Price, Morgan N.; Zane, Grant M.; Kuehl, Jennifer V.

For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. Here, we studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fillmore » 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes.« less

Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics

DOE PAGES

Price, Morgan N.; Zane, Grant M.; Kuehl, Jennifer V.; ...

2018-01-11

For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. Here, we studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fillmore » 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes.« less

Filling gaps in bacterial amino acid biosynthesis pathways with high-throughput genetics

PubMed Central

Kuehl, Jennifer V.; Melnyk, Ryan A.; Deutschbauer, Adam M.; Arkin, Adam P.

2018-01-01

For many bacteria with sequenced genomes, we do not understand how they synthesize some amino acids. This makes it challenging to reconstruct their metabolism, and has led to speculation that bacteria might be cross-feeding amino acids. We studied heterotrophic bacteria from 10 different genera that grow without added amino acids even though an automated tool predicts that the bacteria have gaps in their amino acid synthesis pathways. Across these bacteria, there were 11 gaps in their amino acid biosynthesis pathways that we could not fill using current knowledge. Using genome-wide mutant fitness data, we identified novel enzymes that fill 9 of the 11 gaps and hence explain the biosynthesis of methionine, threonine, serine, or histidine by bacteria from six genera. We also found that the sulfate-reducing bacterium Desulfovibrio vulgaris synthesizes homocysteine (which is a precursor to methionine) by using DUF39, NIL/ferredoxin, and COG2122 proteins, and that homoserine is not an intermediate in this pathway. Our results suggest that most free-living bacteria can likely make all 20 amino acids and illustrate how high-throughput genetics can uncover previously-unknown amino acid biosynthesis genes. PMID:29324779

Transcriptome survey of the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the salmon louse Caligus rogercresseyi (Crustacea: Copepoda).

PubMed

Gonçalves, Ana Teresa; Farlora, Rodolfo; Gallardo-Escárate, Cristian

2014-10-01

The goal of this study was to identify and analyze the lipid metabolic pathways involved in energy production and ecdysteroid synthesis in the ectoparasite copepod Caligus rogercresseyi. Massive transcriptome sequencing analysis was performed during the infectious copepodid larval stage, during the attached chalimus larval stage, and also in female and male adults. Thirty genes were selected for describing the pathways, and these were annotated for proteins or enzymes involved in lipid digestion, absorption, and transport; fatty acid degradation; the synthesis and degradation of ketone bodies; and steroid and ecdysteroid syntheses. Differential expression of these genes was analyzed by ontogenic stage and discussed considering each stage's feeding habits and energetic needs. Copepodids showed a low expression of fatty acid digestion genes, reflected by a non-feeding behavior, and the upregulation of genes involved in steroid biosynthesis, which was consistent with a pathway for cholesterol synthesis during ecdysis. The chalimus stage showed an upregulation of genes related to fatty acid digestion, absorption, and transport, as well as to fatty acid degradation and the synthesis of ketone bodies, therefore suggesting that lipids ingested from the mucus and skin of the host fish are metabolized as important sources of energy. Adult females also showed a pattern of high lipid metabolism for energy supply and mobilization in relation to reproduction and vitellogenesis. Adult females and males revealed different lipid metabolism patterns that reflected different energetic needs. This study reports for the first time the probable lipid metabolic pathways involved in the energy production and ecdysteroid synthesis of C. rogercresseyi. Copyright © 2014 Elsevier Inc. All rights reserved.

TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål)

PubMed Central

Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

2016-01-01

The “target of rapamycin” (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens. PMID:27043527

TOR Pathway-Mediated Juvenile Hormone Synthesis Regulates Nutrient-Dependent Female Reproduction in Nilaparvata lugens (Stål).

PubMed

Lu, Kai; Chen, Xia; Liu, Wen-Ting; Zhou, Qiang

2016-03-28

The "target of rapamycin" (TOR) nutritional signaling pathway and juvenile hormone (JH) regulation of vitellogenesis has been known for a long time. However, the interplay between these two pathways regulating vitellogenin (Vg) expression remains obscure. Here, we first demonstrated the key role of amino acids (AAs) in activation of Vg synthesis and egg development in Nilaparvata lugens using chemically defined artificial diets. AAs induced the expression of TOR and S6K (S6 kinase), whereas RNAi-mediated silencing of these two TOR pathway genes and rapamycin application strongly inhibited the AAs-induced Vg synthesis. Furthermore, knockdown of Rheb (Ras homologue enriched in brain), TOR, S6K and application of rapamycin resulted in a dramatic reduction in the mRNA levels of jmtN (juvenile hormone acid methyltransferase, JHAMT). Application of JH III on the RNAi (Rheb and TOR) and rapamycin-treated females partially rescued the Vg expression. Conversely, knockdown of either jmtN or met (methoprene-tolerant, JH receptor) and application of JH III had no effects on mRNA levels of Rheb, TOR and S6K and phosphorylation of S6K. In summary, our results demonstrate that the TOR pathway induces JH biosynthesis that in turn regulates AAs-mediated Vg synthesis in N. lugens.

Arachidonic acid stimulates DNA synthesis in brown preadipocytes through the activation of protein kinase C and MAPK.

PubMed

Garcia, Bibian; Martinez-de-Mena, Raquel; Obregon, Maria-Jesus

2012-10-01

Arachidonic acid (AA) is a polyunsaturated fatty acid that stimulates the proliferation of many cellular types. We studied the mitogenic potential of AA in rat brown preadipocytes in culture and the signaling pathways involved. AA is a potent mitogen which induces 4-fold DNA synthesis in brown preadipocytes. The AA mitogenic effect increases by NE addition. AA also increases the mitogenic action of different growth factor combinations. Other unsaturated and saturated fatty acids do not stimulate DNA synthesis to the same extent as AA. We analyzed the role of PKC and MEK/MAPK signaling pathways. PKC inhibition by bisindolilmaleimide I (BIS) abolishes AA and phorbol ester stimulation of DNA synthesis and reduces the mitogenic activity of different growth factors in brown preadipocytes. Brown preadipocytes in culture express PKC α, δ, ε and ζ isoforms. Pretreatment with high doses of the phorbol ester PDBu, induces downregulation of PKCs ε and δ and reproduces the effect of BIS indicating that AA-dependent induction of DNA synthesis requires PKC activity. AA also activates MEK/MAPK pathway and the inhibition of MEK activity inhibits AA stimulation of DNA synthesis and brown adipocyte proliferation. Inhibition of PKC δ by rottlerin abolishes AA-dependent stimulation of DNA synthesis and MAPK activation, whereas PKC ε inhibition does not produce any effect. In conclusion, our results identify AA as a potent mitogen for brown adipocytes and demonstrate the involvement of the PDBu-sensitive PKC δ isoform and MEK/MAPK pathway in AA-induced proliferation of brown adipocytes. Increased proliferative activity might increase the thermogenic capacity of brown fat. Copyright © 2012 Elsevier B.V. All rights reserved.

Auxin Produced by the Indole-3-Pyruvic Acid Pathway Regulates Development and Gemmae Dormancy in the Liverwort Marchantia polymorpha[OPEN

PubMed Central

Eklund, D. Magnus; Ishizaki, Kimitsune; Flores-Sandoval, Eduardo; Kikuchi, Saya; Takebayashi, Yumiko; Tsukamoto, Shigeyuki; Hirakawa, Yuki; Nonomura, Maiko; Kato, Hirotaka; Kouno, Masaru; Bhalerao, Rishikesh P.; Lagercrantz, Ulf; Kasahara, Hiroyuki; Kohchi, Takayuki; Bowman, John L.

2015-01-01

The plant hormone auxin (indole-3-acetic acid [IAA]) has previously been suggested to regulate diverse forms of dormancy in both seed plants and liverworts. Here, we use loss- and gain-of-function alleles for auxin synthesis- and signaling-related genes, as well as pharmacological approaches, to study how auxin regulates development and dormancy in the gametophyte generation of the liverwort Marchantia polymorpha. We found that M. polymorpha possess the smallest known toolkit for the indole-3-pyruvic acid (IPyA) pathway in any land plant and that this auxin synthesis pathway mainly is active in meristematic regions of the thallus. Previously a Trp-independent auxin synthesis pathway has been suggested to produce a majority of IAA in bryophytes. Our results indicate that the Trp-dependent IPyA pathway produces IAA that is essential for proper development of the gametophyte thallus of M. polymorpha. Furthermore, we show that dormancy of gemmae is positively regulated by auxin synthesized by the IPyA pathway in the apex of the thallus. Our results indicate that auxin synthesis, transport, and signaling, in addition to its role in growth and development, have a critical role in regulation of gemmae dormancy in M. polymorpha. PMID:26036256

Compromised Mitochondrial Fatty Acid Synthesis in Transgenic Mice Results in Defective Protein Lipoylation and Energy Disequilibrium

PubMed Central

Smith, Stuart; Witkowski, Andrzej; Moghul, Ayesha; Yoshinaga, Yuko; Nefedov, Michael; de Jong, Pieter; Feng, Dejiang; Fong, Loren; Tu, Yiping; Hu, Yan; Young, Stephen G.; Pham, Thomas; Cheung, Carling; Katzman, Shana M.; Brand, Martin D.; Quinlan, Casey L.; Fens, Marcel; Kuypers, Frans; Misquitta, Stephanie; Griffey, Stephen M.; Tran, Son; Gharib, Afshin; Knudsen, Jens; Hannibal-Bach, Hans Kristian; Wang, Grace; Larkin, Sandra; Thweatt, Jennifer; Pasta, Saloni

2012-01-01

A mouse model with compromised mitochondrial fatty acid synthesis has been engineered in order to assess the role of this pathway in mitochondrial function and overall health. Reduction in the expression of mitochondrial malonyl CoA-acyl carrier protein transacylase, a key enzyme in the pathway encoded by the nuclear Mcat gene, was achieved to varying extents in all examined tissues employing tamoxifen-inducible Cre-lox technology. Although affected mice consumed more food than control animals, they failed to gain weight, were less physically active, suffered from loss of white adipose tissue, reduced muscle strength, kyphosis, alopecia, hypothermia and shortened lifespan. The Mcat-deficient phenotype is attributed primarily to reduced synthesis, in several tissues, of the octanoyl precursors required for the posttranslational lipoylation of pyruvate and α-ketoglutarate dehydrogenase complexes, resulting in diminished capacity of the citric acid cycle and disruption of energy metabolism. The presence of an alternative lipoylation pathway that utilizes exogenous free lipoate appears restricted to liver and alone is insufficient for preservation of normal energy metabolism. Thus, de novo synthesis of precursors for the protein lipoylation pathway plays a vital role in maintenance of mitochondrial function and overall vigor. PMID:23077570

Atorvastatin inhibits insulin synthesis by inhibiting the Ras/Raf/ERK/CREB pathway in INS-1 cells

PubMed Central

Sun, Hongxi; Li, Yu; Sun, Bei; Hou, Ningning; Yang, Juhong; Zheng, Miaoyan; Xu, Jie; Wang, Jingyu; Zhang, Yi; Zeng, Xianwei; Shan, Chunyan; Chang, Bai; Chen, Liming; Chang, Baocheng

2016-01-01

Abstract Backround: Type 2 diabetes has become a global epidemic disease. Atorvastatin has become a cornerstone in the prevention and treatment of atherosclerosis. However, increasing evidence showed that statins can dose-dependently increase the risk of diabetes mellitus. The mechanism is not clear. Objective: The Ras complex pathway (Ras/Raf/extracellular signal-regulated kinase [ERK]/cAMP response element-binding protein [CREB]) is the major pathway that regulates the gene transcription. Except for the inhibition of cholesterol synthesis by inhibiting the 3-hydroxy-3-methyl glutaryl coenzyme A (HMG-COA) reductase, statins can also downregulate the phosphorylation of a series of downstream substrates including the key proteins of the Ras complex pathway, therefore may inhibit the insulin syntheses in pancreatic beta cells. In our study, we investigated the inhibitory effect and the underlying mechanism of atorvastatin on insulin synthesis in rat islets. Methods: Islets were isolated from Wistar rats and cultured in Roswell Park Memorial Institute (RPMI)-1640 medium. The insulin content in the medium was measured by radioimmunoassay before and after the treatment of 50 μM atorvastatin. Effect of atorvastatin on the expression of insulin message Ribonucleic acid (mRNA) in pancreatic islet beta cells was also detected using quantitative real-time polymerase chain reaction. Western blotting was used to explore the possible role of the Ras complex pathway (Ras/Raf/ERK/CREB) in atorvastatin-inhibited insulin synthesis. The effects of atorvastatin on the binding of nuclear transcription factor p-CREB with CRE in INS-1 cells were examined via chromatin immunoprecipitation assay. Results: Compared with the control group, the insulin level decreased by 27.1% at 24 hours after atorvastatin treatment. Atorvastatin inhibited insulin synthesis by decreasing insulin mRNA expression of pancreatic islet beta cells. The activities of Ras, Raf-1, and p-CREB in the Ras complex

Abscisic acid negatively regulates elicitor-induced synthesis of capsidiol in wild tobacco.

PubMed

Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

2009-07-01

In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8'-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8'-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants.

Saturated fatty acids enhance TLR4 immune pathways in human trophoblasts.

PubMed

Yang, Xiaohua; Haghiac, Maricela; Glazebrook, Patricia; Minium, Judi; Catalano, Patrick M; Hauguel-de Mouzon, Sylvie

2015-09-01

What are the effects of fatty acids on placental inflammatory cytokine with respect to toll-like receptor-4/nuclear factor-kappa B (TLR4/NF-kB)? Exogenous fatty acids induce a pro-inflammatory cytokine response in human placental cells in vitro via activation of TLR4 signaling pathways. The placenta is exposed to changes in circulating maternal fatty acid concentrations throughout pregnancy. Fatty acids are master regulators of innate immune pathways through recruitment of toll-like receptors and activation of cytokine synthesis. Trophoblast cells isolated from 14 normal term human placentas were incubated with long chain fatty acids (FA) of different carbon length and degree of saturation. The expression and secretion of interleukin-6 (IL-6), IL-8 and tumor necrosis factor-alpha (TNF-α) were measured by reverse transcription-polymerase chain reaction and enzyme-linked immunosorbent assay. Antibodies against TLR4 ligand binding domain, downstream signaling and anti-p65 NFkB-inhibitor were used to characterize the pathways of FA action. General approach used primary human term trophoblast cell culture. Methods and end-points used real-time quantitative PCR, cytokine measurements, immunohistochemistry, western blots. The long chain saturated fatty acids, stearic and palmitic (PA), stimulated the synthesis as well as the release of TNF-α, IL-6 and IL-8 by trophoblast cells (2- to 6-fold, P < 0.001). In contrast, the unsaturated (palmitoleic, oleic, linoleic) acids did not modify cytokine expression significantly. Palmitate-induced inflammatory effects were mediated via TLR4 activation, NF-kB phosphorylation and nuclear translocation. TNF-α protein level was close to the limit of detection in the culture medium even when cells were cultured with PA. These mechanisms open the way to a better understanding of how changes in maternal lipid homeostasis may regulate placental inflammatory status. X.Y. was recipient of fellowship award from West China Second University

FabQ, a Dual-Function Dehydratase/Isomerase, Circumvents the Last Step of the Classical Fatty Acid Synthesis Cycle

PubMed Central

Bi, Hongkai; Wang, Haihong; Cronan, John E.

2015-01-01

SUMMARY In the classical anaerobic pathway of unsaturated fatty acid biosynthesis, that of Escherichia coli, the double bond is introduced into the growing acyl chain by the FabA dehydratase/isomerase. Another dehydratase, FabZ, functions in the chain elongation cycle. In contrast, Aerococcus viridans has only a single FabA/FabZ homolog we designate FabQ. FabQ can not only replace the function of E. coli FabZ in vivo, but it also catalyzes the isomerization required for unsaturated fatty acid biosynthesis. Most strikingly, FabQ in combination with E. coli FabB imparts the surprising ability to bypass reduction of the trans-2-acyl-ACP intermediates of classical fatty acid synthesis. FabQ allows elongation by progressive isomerization reactions to form the polyunsaturated fatty acid, 3-hydroxy-cis-5, 7-hexadecadienoic acid, both in vitro and in vivo. FabQ therefore provides a potential pathway for bacterial synthesis of polyunsaturated fatty acids. PMID:23972938

Rewiring the reductive tricarboxylic acid pathway and L-malate transport pathway of Aspergillus oryzae for overproduction of L-malate.

PubMed

Liu, Jingjing; Xie, Zhipeng; Shin, Hyun-Dong; Li, Jianghua; Du, Guocheng; Chen, Jian; Liu, Long

2017-07-10

Aspergillus oryzae finds wide application in the food, feed, and wine industries, and is an excellent cell factory platform for production of organic acids. In this work, we achieved the overproduction of L-malate by rewiring the reductive tricarboxylic acid (rTCA) pathway and L-malate transport pathway of A. oryzae NRRL 3488. First, overexpression of native pyruvate carboxylase and malate dehydrogenase in the rTCA pathway improved the L-malate titer from 26.1gL -1 to 42.3gL -1 in shake flask culture. Then, the oxaloacetate anaplerotic reaction was constructed by heterologous expression of phosphoenolpyruvate carboxykinase and phosphoenolpyruvate carboxylase from Escherichia coli, increasing the L-malate titer to 58.5gL -1 . Next, the export of L-malate from the cytoplasm to the external medium was strengthened by overexpression of a C4-dicarboxylate transporter gene from A. oryzae and an L-malate permease gene from Schizosaccharomyces pombe, improving the L-malate titer from 58.5gL -1 to 89.5gL -1 . Lastly, guided by transcription analysis of the expression profile of key genes related to L-malate synthesis, the 6-phosphofructokinase encoded by the pfk gene was identified as a potential limiting step for L-malate synthesis. Overexpression of pfk with the strong sodM promoter increased the L-malate titer to 93.2gL -1 . The final engineered A. oryzae strain produced 165gL -1 L-malate with a productivity of 1.38gL -1 h -1 in 3-L fed-batch culture. Overall, we constructed an efficient L-malate producer by rewiring the rTCA pathway and L-malate transport pathway of A. oryzae NRRL 3488, and the engineering strategy adopted here may be useful for the construction of A. oryzae cell factories to produce other organic acids. Copyright © 2017 Elsevier B.V. All rights reserved.

Metabolite fingerprinting of pennycress (Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

PubMed Central

Tsogtbaatar, Enkhtuul; Cocuron, Jean-Christophe; Sonera, Marcos Corchado; Alonso, Ana Paula

2015-01-01

Pennycress (Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis of oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography–mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography–tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. This study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos. PMID:25711705

Role of AMACR (α-methylacyl-CoA racemase) and MFE-1 (peroxisomal multifunctional enzyme-1) in bile acid synthesis in mice.

PubMed

Autio, Kaija J; Schmitz, Werner; Nair, Remya R; Selkälä, Eija M; Sormunen, Raija T; Miinalainen, Ilkka J; Crick, Peter J; Wang, Yuqin; Griffiths, William J; Reddy, Janardan K; Baes, Myriam; Hiltunen, J Kalervo

2014-07-01

Cholesterol is catabolized to bile acids by peroxisomal β-oxidation in which the side chain of C27-bile acid intermediates is shortened by three carbon atoms to form mature C24-bile acids. Knockout mouse models deficient in AMACR (α-methylacyl-CoA racemase) or MFE-2 (peroxisomal multifunctional enzyme type 2), in which this β-oxidation pathway is prevented, display a residual C24-bile acid pool which, although greatly reduced, implies the existence of alternative pathways of bile acid synthesis. One alternative pathway could involve Mfe-1 (peroxisomal multifunctional enzyme type 1) either with or without Amacr. To test this hypothesis, we generated a double knockout mouse model lacking both Amacr and Mfe-1 activities and studied the bile acid profiles in wild-type, Mfe-1 and Amacr single knockout mouse line and Mfe-1 and Amacr double knockout mouse lines. The total bile acid pool was decreased in Mfe-1-/- mice compared with wild-type and the levels of mature C24-bile acids were reduced in the double knockout mice when compared with Amacr-deficient mice. These results indicate that Mfe-1 can contribute to the synthesis of mature bile acids in both Amacr-dependent and Amacr-independent pathways.

Cross Talk between Nucleotide Synthesis Pathways with Cellular Immunity in Constraining Hepatitis E Virus Replication

PubMed Central

Wang, Yijin; Wang, Wenshi; Xu, Lei; Zhou, Xinying; Shokrollahi, Ehsan; Felczak, Krzysztof; van der Laan, Luc J. W.; Pankiewicz, Krzysztof W.; Sprengers, Dave; Raat, Nicolaas J. H.; Metselaar, Herold J.; Peppelenbosch, Maikel P.

2016-01-01

in HEV infection and its potential for antiviral drug development. We show that targeting the later but not the early steps of the purine synthesis pathway exerts strong anti-HEV activity. In particular, IMP dehydrogenase (IMPDH) is the most important anti-HEV target of this cascade. Importantly, the clinically used IMPDH inhibitors, including mycophenolic acid and ribavirin, have potent anti-HEV activity. Furthermore, targeting the pyrimidine synthesis pathway also exerts potent antiviral activity against HEV. Interestingly, antiviral effects of nucleotide synthesis pathway inhibitors appear to depend on the medication-induced transcription of antiviral interferon-stimulated genes. Thus, this study reveals an unconventional novel mechanism as to how nucleotide synthesis pathway inhibitors can counteract HEV replication. PMID:26926637

Demonstration of diet-induced decoupling of fatty acid and cholesterol synthesis by combining gene expression array and 2H2O quantification.

PubMed

Jensen, Kristian K; Previs, Stephen F; Zhu, Lei; Herath, Kithsiri; Wang, Sheng-Ping; Bhat, Gowri; Hu, Guanghui; Miller, Paul L; McLaren, David G; Shin, Myung K; Vogt, Thomas F; Wang, Liangsu; Wong, Kenny K; Roddy, Thomas P; Johns, Douglas G; Hubbard, Brian K

2012-01-15

The liver is a crossroad for metabolism of lipid and carbohydrates, with acetyl-CoA serving as an important metabolic intermediate and a precursor for fatty acid and cholesterol biosynthesis pathways. A better understanding of the regulation of these pathways requires an experimental approach that provides both quantitative metabolic flux measurements and mechanistic insight. Under conditions of high carbohydrate availability, excess carbon is converted into free fatty acids and triglyceride for storage, but it is not clear how excessive carbohydrate availability affects cholesterol biosynthesis. To address this, C57BL/6J mice were fed either a low-fat, high-carbohydrate diet or a high-fat, carbohydrate-free diet. At the end of the dietary intervention, the two groups received (2)H(2)O to trace de novo fatty acid and cholesterol synthesis, and livers were collected for gene expression analysis. Expression of lipid and glucose metabolism genes was determined using a custom-designed pathway focused PCR-based gene expression array. The expression analysis showed downregulation of cholesterol biosynthesis genes and upregulation of fatty acid synthesis genes in mice receiving the high-carbohydrate diet compared with the carbohydrate-free diet. In support of these findings, (2)H(2)O tracer data showed that fatty acid synthesis was increased 10-fold and cholesterol synthesis was reduced by 1.6-fold in mice fed the respective diets. In conclusion, by applying gene expression analysis and tracer methodology, we show that fatty acid and cholesterol synthesis are differentially regulated when the carbohydrate intake in mice is altered.

Enterobacter sp. I-3, a bio-herbicide inhibits gibberellins biosynthetic pathway and regulates abscisic acid and amino acids synthesis to control plant growth.

PubMed

Radhakrishnan, Ramalingam; Park, Jae-Man; Lee, In-Jung

2016-12-01

Very few bacterial species were identified as bio-herbicides for weed control. The present research was focused to elucidate the plant growth retardant properties of Enterobacter sp. I-3 during their interaction by determining the changes in endogenous photosynthetic pigments, plant hormones and amino acids. The two bacterial isolates I-4-5 and I-3 were used to select the superior bacterium for controlling weed seeds (Echinochloa crus-galli L. and Portulaca oleracea L.) germination. The post-inoculation of I-3 (Enterobacter sp. I-3) significantly inhibited the weeds seed germination than their controls. The mechanism of bacterium induced plant growth reduction was identified in lettuce treated with I-3 bacterium and compared their effects with known chemical herbicide, trinexapac-ethyl (TE). The treatment of I-3 and TE showed a significant inhibitory effect on shoot length, leaf number, leaf length, leaf width, shoot weight, root weight and chlorophyll content in lettuce seedlings. The endogenous gibberellins (GAs) and abscisic acid (ABA) analysis showed that Enterobacter sp. I-3 treated plants had lower levels of GAs (GA 12 , GA 19 , GA 20 and GA 8 ) and GAs/ABA ratio and then, the higher level of ABA when compared to their controls. Indeed, the individual amino acids ie., aspartic acid, glutamic acid, glycine, threonine, alanine, serine, leucine, isoleucine and tyrosine were declined in TE and I-3 exposed plants. Our results suggest that the utilization of Enterobacter sp. I-3 inhibits the GAs pathway and amino acids synthesis in weeds to control their growth can be an alternative to chemical herbicides. Copyright © 2016 Elsevier GmbH. All rights reserved.

Synthesis of Heterologous Mevalonic Acid Pathway Enzymes in Clostridium ljungdahlii for the Conversion of Fructose and of Syngas to Mevalonate and Isoprene.

PubMed

Diner, Bruce A; Fan, Janine; Scotcher, Miles C; Wells, Derek H; Whited, Gregory M

2018-01-01

There is a growing interest in the use of microbial fermentation for the generation of high-demand, high-purity chemicals using cheap feedstocks in an environmentally friendly manner. One example explored here is the production of isoprene (C 5 H 8 ), a hemiterpene, which is primarily polymerized to polyisoprene in synthetic rubber in tires but which can also be converted to C 10 and C 15 biofuels. The strictly anaerobic, acetogenic bacterium Clostridium ljungdahlii , used in all of the work described here, is capable of glycolysis using the Embden-Meyerhof-Parnas pathway and of carbon fixation using the Wood-Ljungdahl pathway. Clostridium - Escherichia coli shuttle plasmids, each bearing either 2 or 3 different heterologous genes of the eukaryotic mevalonic acid (MVA) pathway or eukaryotic isopentenyl pyrophosphate isomerase (Idi) and isoprene synthase (IspS), were constructed and electroporated into C. ljungdahlii These plasmids, one or two of which were introduced into the host cells, enabled the synthesis of mevalonate and of isoprene from fructose and from syngas (H 2 , CO 2 , and CO) and the conversion of mevalonate to isoprene. All of the heterologous enzymes of the MVA pathway, as well as Idi and IspS, were shown to be synthesized at high levels in C. ljungdahlii , as demonstrated by Western blotting, and were enzymatically active, as demonstrated by in vivo product synthesis. The quantities of mevalonate and isoprene produced here are far below what would be required of a commercial production strain. However, proposals are made that could enable a substantial increase in the mass yield of product formation. IMPORTANCE This study demonstrates the ability to synthesize a heterologous metabolic pathway in C. ljungdahlii , an organism capable of metabolizing either simple sugars or syngas or both together (mixotrophy). Syngas, an inexpensive source of carbon and reducing equivalents, is produced as a major component of some industrial waste gas, and it can be

Synthesis of Heterologous Mevalonic Acid Pathway Enzymes in Clostridium ljungdahlii for the Conversion of Fructose and of Syngas to Mevalonate and Isoprene

PubMed Central

Fan, Janine; Scotcher, Miles C.; Wells, Derek H.; Whited, Gregory M.

2017-01-01

ABSTRACT There is a growing interest in the use of microbial fermentation for the generation of high-demand, high-purity chemicals using cheap feedstocks in an environmentally friendly manner. One example explored here is the production of isoprene (C5H8), a hemiterpene, which is primarily polymerized to polyisoprene in synthetic rubber in tires but which can also be converted to C10 and C15 biofuels. The strictly anaerobic, acetogenic bacterium Clostridium ljungdahlii, used in all of the work described here, is capable of glycolysis using the Embden-Meyerhof-Parnas pathway and of carbon fixation using the Wood-Ljungdahl pathway. Clostridium-Escherichia coli shuttle plasmids, each bearing either 2 or 3 different heterologous genes of the eukaryotic mevalonic acid (MVA) pathway or eukaryotic isopentenyl pyrophosphate isomerase (Idi) and isoprene synthase (IspS), were constructed and electroporated into C. ljungdahlii. These plasmids, one or two of which were introduced into the host cells, enabled the synthesis of mevalonate and of isoprene from fructose and from syngas (H2, CO2, and CO) and the conversion of mevalonate to isoprene. All of the heterologous enzymes of the MVA pathway, as well as Idi and IspS, were shown to be synthesized at high levels in C. ljungdahlii, as demonstrated by Western blotting, and were enzymatically active, as demonstrated by in vivo product synthesis. The quantities of mevalonate and isoprene produced here are far below what would be required of a commercial production strain. However, proposals are made that could enable a substantial increase in the mass yield of product formation. IMPORTANCE This study demonstrates the ability to synthesize a heterologous metabolic pathway in C. ljungdahlii, an organism capable of metabolizing either simple sugars or syngas or both together (mixotrophy). Syngas, an inexpensive source of carbon and reducing equivalents, is produced as a major component of some industrial waste gas, and it can be

Extending shikimate pathway for the production of muconic acid and its precursor salicylic acid in Escherichia coli.

PubMed

Lin, Yuheng; Sun, Xinxiao; Yuan, Qipeng; Yan, Yajun

2014-05-01

cis,cis-Muconic acid (MA) and salicylic acid (SA) are naturally-occurring organic acids having great commercial value. MA is a potential platform chemical for the manufacture of several widely-used consumer plastics; while SA is mainly used for producing pharmaceuticals (for example, aspirin and lamivudine) and skincare and haircare products. At present, MA and SA are commercially produced by organic chemical synthesis using petro-derived aromatic chemicals, such as benzene, as starting materials, which is not environmentally friendly. Here, we report a novel approach for efficient microbial production of MA via extending shikimate pathway by introducing the hybrid of an SA biosynthetic pathway with its partial degradation pathway. First, we engineered a well-developed phenylalanine producing Escherichia coli strain into an SA overproducer by introducing isochorismate synthase and isochorismate pyruvate lyase. The engineered strain is able to produce 1.2g/L of SA from simple carbon sources, which is the highest titer reported so far. Further, the partial SA degradation pathway involving salicylate 1-monoxygenase and catechol 1,2-dioxygenase is established to achieve the conversion of SA to MA. Finally, a de novo MA biosynthetic pathway is assembled by integrating the established SA biosynthesis and degradation modules. Modular optimization enables the production of up to 1.5g/L MA within 48h in shake flasks. This study not only establishes an efficient microbial platform for the production of SA and MA, but also demonstrates a generalizable pathway design strategy for the de novo biosynthesis of valuable degradation metabolites. Copyright © 2014. Published by Elsevier Inc.

Polymorphisms in genes involved in the triglyceride synthesis pathway and marine omega-3 polyunsaturated fatty acid supplementation modulate plasma triglyceride levels.

PubMed

Ouellette, Catherine; Cormier, Hubert; Rudkowska, Iwona; Guénard, Frédéric; Lemieux, Simone; Couture, Patrick; Vohl, Marie-Claude

2013-01-01

Marine omega-3 (n-3) polyunsaturated fatty acids (PUFA) reduce plasma triglyceride (TG) levels. Genetic factors such as single nucleotide polymorphisms (SNPs) could be responsible for the variability of the plasma TG response to n-3 PUFA supplementation. Previous studies have demonstrated that n-3 PUFA supplementation using fish oil modified the expression levels of three genes involved in the TG synthesis pathway (GPAM, AGPAT3 and AGPAT4) in peripheral blood mononuclear cells. A total of 210 subjects consumed 5 g/day of a fish oil supplement for 6 weeks. Plasma lipids were measured before and after the supplementation period. Three SNPs in GPAM, 13 SNPs in AGPAT3 and 35 SNPs in AGPAT4 were genotyped. In an ANOVA for repeated measures adjusted for age, sex and BMI, genotype effects on plasma TG levels were observed for rs1838452 in AGPAT3 as well as for rs746731 and rs2293286 in AGPAT4. Genotype × supplementation interaction effects on plasma TG levels were observed for rs2792751 and rs17129561 in GPAM as well as for rs3798943 and rs9458172 in AGPAT4 (p < 0.05). These results suggest that SNPs in genes involved in the TG synthesis pathway may influence plasma TG levels after n-3 PUFA supplementation. © 2014 S. Karger AG, Basel.

Photoredox activation of carbon dioxide for amino acid synthesis in continuous flow

NASA Astrophysics Data System (ADS)

Seo, Hyowon; Katcher, Matthew H.; Jamison, Timothy F.

2017-05-01

Although carbon dioxide (CO2) is highly abundant, its low reactivity has limited its use in chemical synthesis. In particular, methods for carbon-carbon bond formation generally rely on two-electron mechanisms for CO2 activation and require highly activated reaction partners. Alternatively, radical pathways accessed via photoredox catalysis could provide new reactivity under milder conditions. Here we demonstrate the direct coupling of CO2 and amines via the single-electron reduction of CO2 for the photoredox-catalysed continuous flow synthesis of α-amino acids. By leveraging the advantages of utilizing gases and photochemistry in flow, a commercially available organic photoredox catalyst effects the selective α-carboxylation of amines that bear various functional groups and heterocycles. The preliminary mechanistic studies support CO2 activation and carbon-carbon bond formation via single-electron pathways, and we expect that this strategy will inspire new perspectives on using this feedstock chemical in organic synthesis.

Evaluating reaction pathways of hydrothermal abiotic organic synthesis at elevated temperatures and pressures using carbon isotopes

NASA Astrophysics Data System (ADS)

Fu, Qi; Socki, Richard A.; Niles, Paul B.

2015-04-01

Experiments were performed to better understand the role of environmental factors on reaction pathways and corresponding carbon isotope fractionations during abiotic hydrothermal synthesis of organic compounds using piston cylinder apparatus at 750 °C and 5.5 kbars. Chemical compositions of experimental products and corresponding carbon isotopic values were obtained by a Pyrolysis-GC-MS-IRMS system. Alkanes (methane and ethane), straight-chain saturated alcohols (ethanol and n-butanol) and monocarboxylic acids (formic and acetic acids) were generated with ethanol being the only organic compound with higher δ13C than CO2. CO was not detected in experimental products owing to the favorable water-gas shift reaction under high water pressure conditions. The pattern of δ13C values of CO2, carboxylic acids and alkanes are consistent with their equilibrium isotope relationships: CO2 > carboxylic acids > alkanes, but the magnitude of the fractionation among them is higher than predicted isotope equilibrium values. In particular, the isotopic fractionation between CO2 and CH4 remained constant at ∼31‰, indicating a kinetic effect during CO2 reduction processes. No "isotope reversal" of δ13C values for alkanes or carboxylic acids was observed, which indicates a different reaction pathway than what is typically observed during Fischer-Tropsch synthesis under gas phase conditions. Under constraints imposed in experiments, the anomalous 13C isotope enrichment in ethanol suggests that hydroxymethylene is the organic intermediate, and that the generation of other organic compounds enriched in 12C were facilitated by subsequent Rayleigh fractionation of hydroxymethylene reacting with H2 and/or H2O. Carbon isotope fractionation data obtained in this study are instrumental in assessing the controlling factors on abiotic formation of organic compounds in hydrothermal systems. Knowledge on how environmental conditions affect reaction pathways of abiotic synthesis of organic

Phosphatidic Acid Synthesis in Bacteria

PubMed Central

Yao, Jiangwei; Rock, Charles O.

2012-01-01

Membrane phospholipid synthesis is a vital facet of bacterial physiology. Although the spectrum of phospholipid headgroup structures produced by bacteria is large, the key precursor to all of these molecules is phosphatidic acid (PtdOH). Glycerol-3-phosphate derived from the glycolysis via glycerol-phosphate synthase is the universal source for the glycerol backbone of PtdOH. There are two distinct families of enzymes responsible for the acylation of the 1-position of glycerol-3-phosphate. The PlsB acyltransferase was discovered in Escherichia coli, and homologs are present in many eukaryotes. This protein family primarily uses acyl-acyl carrier protein (ACP) endproducts of fatty acid synthesis as acyl donors, but may also use acyl-CoA derived from exogenous fatty acids. The second protein family, PlsY, is more widely distributed in bacteria and utilizes the unique acyl donor, acyl-phosphate, which is produced from acyl-ACP by the enzyme PlsX. The acylation of the 2-position is carried out by members of the PlsC protein family. All PlsCs use acyl-ACP as the acyl donor, although the PlsCs of the γ-proteobacteria also may use acyl-CoA. Phospholipid headgroups are precursors in the biosynthesis of other membrane-associated molecules and the diacylglycerol product of these reactions is converted to PtdOH by one of two distinct families of lipid kinases. The central importance of the de novo and recycling pathways to PtdOH in cell physiology suggest these enzymes are suitable targets for the development of antibacterial therapeutics in Gram-positive pathogens. This article is part of a Special Issue entitled Phospholipids and Phospholipid Metabolism. PMID:22981714

5-Aminolevulinic Acid (ALA) Alleviated Salinity Stress in Cucumber Seedlings by Enhancing Chlorophyll Synthesis Pathway.

PubMed

Wu, Yue; Jin, Xin; Liao, Weibiao; Hu, Linli; Dawuda, Mohammed M; Zhao, Xingjie; Tang, Zhongqi; Gong, Tingyu; Yu, Jihua

2018-01-01

5-Aminolevulinic acid (ALA) is a common precursor of tetrapyrroles as well as a crucial growth regulator in higher plants. ALA has been proven to be effective in improving photosynthesis and alleviating the adverse effects of various abiotic stresses in higher plants. However, little is known about the mechanism of ALA in ameliorating the photosynthesis of plant under abiotic stress. In this paper, we studied the effects of exogenous ALA on salinity-induced damages of photosynthesis in cucumber ( Cucumis sativus L.) seedlings. We found that the morphology (plant height, leave area), light utilization capacity of PS II [qL, Y(II)] and gas exchange capacity (Pn, gs, Ci, and Tr) were significantly retarded under NaCl stress, but these parameters were all recovered by the foliar application of 25 mg L -1 ALA. Besides, salinity caused heme accumulation and up-regulation of gene expression of ferrochelatase ( HEMH ) with suppression of other genes involved in chlorophyll synthesis pathway. Exogenously application of ALA under salinity down-regulated the heme content and HEMH expression, but increased the gene expression levels of glutamyl-tRNA reductase ( HEMA1 ), Mg-chelatase ( CHLH ), and protochlorophyllide oxidoreductase ( POR ). Moreover, the contents of intermediates involved in chlorophyll branch were increased by ALA, including protoporphyrin IX (Proto IX), Mg-protoporphyrin IX (Mg-Proto IX, protochlorophyllide (Pchlide), and chlorophyll (Chl a and Chl b ) under salt stress. Ultrastructural observation of mesophyll cell showed that the damages of photosynthetic apparatus under salinity were fixed by ALA. Collectively, the chlorophyll biosynthesis pathway was enhanced by exogenous ALA to improve the tolerance of cucumber under salinity.

Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis

DOE Office of Scientific and Technical Information (OSTI.GOV)

Bai, Xupeng; Hong, Weipeng; Cai, Peiheng

Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36),more » an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) – extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. - Highlights: • VPA induced hepatic steatosis and modulated genes associated with lipid metabolism. • CD36-mediated fatty acid uptake contributed to VPA-induced lipid accumulation. • PA increased the

Dual Role for Phospholipid:Diacylglycerol Acyltransferase: Enhancing Fatty Acid Synthesis and Diverting Fatty Acids from Membrane Lipids to Triacylglycerol in Arabidopsis Leaves[C][W

PubMed Central

Fan, Jilian; Yan, Chengshi; Zhang, Xuebin; Xu, Changcheng

2013-01-01

There is growing interest in engineering green biomass to expand the production of plant oils as feed and biofuels. Here, we show that PHOSPHOLIPID:DIACYLGLYCEROL ACYLTRANSFERASE1 (PDAT1) is a critical enzyme involved in triacylglycerol (TAG) synthesis in leaves. Overexpression of PDAT1 increases leaf TAG accumulation, leading to oil droplet overexpansion through fusion. Ectopic expression of oleosin promotes the clustering of small oil droplets. Coexpression of PDAT1 with oleosin boosts leaf TAG content by up to 6.4% of the dry weight without affecting membrane lipid composition and plant growth. PDAT1 overexpression stimulates fatty acid synthesis (FAS) and increases fatty acid flux toward the prokaryotic glycerolipid pathway. In the trigalactosyldiacylglycerol1-1 mutant, which is defective in eukaryotic thylakoid lipid synthesis, the combined overexpression of PDAT1 with oleosin increases leaf TAG content to 8.6% of the dry weight and total leaf lipid by fourfold. In the plastidic glycerol-3-phosphate acyltransferase1 mutant, which is defective in the prokaryotic glycerolipid pathway, PDAT1 overexpression enhances TAG content at the expense of thylakoid membrane lipids, leading to defects in chloroplast division and thylakoid biogenesis. Collectively, these results reveal a dual role for PDAT1 in enhancing fatty acid and TAG synthesis in leaves and suggest that increasing FAS is the key to engineering high levels of TAG accumulation in green biomass. PMID:24076979

Metabolite fingerprinting of pennycress ( Thlaspi arvense L.) embryos to assess active pathways during oil synthesis

DOE PAGES

Tsogtbaatar, Enkhtuul; Cocuron, Jean -Christophe; Sonera, Marcos Corchado; ...

2015-02-22

Pennycress ( Thlaspi arvense L.), a plant naturalized to North America, accumulates high levels of erucic acid in its seeds, which makes it a promising biodiesel and industrial crop. The main carbon sinks in pennycress embryos were found to be proteins, fatty acids, and cell wall, which respectively represented 38.5, 33.2, and 27.0% of the biomass at 21 days after pollination. Erucic acid reached a maximum of 36% of the total fatty acids. Together these results indicate that total oil and erucic acid contents could be increased to boost the economic competitiveness of this crop. Understanding the biochemical basis ofmore » oil synthesis in pennycress embryos is therefore timely and relevant to guide future breeding and/or metabolic engineering efforts. For this purpose, a combination of metabolomics approaches was conducted to assess the active biochemical pathways during oil synthesis. First, gas chromatography-mass spectrometry (GC-MS) profiling of intracellular metabolites highlighted three main families of compounds: organic acids, amino acids, and sugars/sugar alcohols. Secondly, these intermediates were quantified in developing pennycress embryos by liquid chromatography-tandem mass spectrometry (LC-MS/MS) in multiple reaction monitoring mode. Finally, partitional clustering analysis grouped the intracellular metabolites that shared a similar pattern of accumulation over time into eight clusters. In conclusion, this study underlined that: (i) sucrose might be stored rather than cleaved into hexoses; (ii) glucose and glutamine would be the main sources of carbon and nitrogen, respectively; and (iii) glycolysis, the oxidative pentose phosphate pathway, the tricarboxylic acid cycle, and the Calvin cycle were active in developing pennycress embryos.« less

Increased Production of Fatty Acids and Triglycerides in Aspergillus oryzae by Enhancing Expressions of Fatty Acid Synthesis-Related Genes

DOE Office of Scientific and Technical Information (OSTI.GOV)

Tamano, Koichi; Bruno, Kenneth S.; Karagiosis, Sue A.

2013-01-01

Microbial production of fats and oils is being developedas a means of converting biomass to biofuels. Here we investigate enhancing expression of enzymes involved in the production of fatty acids and triglycerides as a means to increase production of these compounds in Aspergillusoryzae. Examination of the A.oryzaegenome demonstrates that it contains twofatty acid synthases and several other genes that are predicted to be part of this biosynthetic pathway. We enhancedthe expressionof fatty acid synthesis-related genes by replacing their promoters with thepromoter fromthe constitutively highly expressedgene tef1. We demonstrate that by simply increasing the expression of the fatty acid synthasegenes wemore » successfullyincreasedtheproduction of fatty acids and triglyceridesby more than two fold. Enhancement of expression of the fatty acid pathway genes ATP-citrate lyase and palmitoyl-ACP thioesteraseincreasedproductivity to a lesser extent.Increasing expression ofacetyl-CoA carboxylase caused no detectable change in fatty acid levels. Increases in message level for each gene were monitored usingquantitative real-time RT-PCR. Our data demonstrates that a simple increase in the abundance of fatty acid synthase genes can increase the detectable amount of fatty acids.« less

Investigation of Mechanistic Pathway for Trimethyl Borate Mediated Amidation of (R)-Mandelic Acid for the Synthesis of Mirabegron, an Antimuscarinic Agent.

PubMed

Deshmukh, Dattatray G; Bangal, Mukund N; Patekar, Mukunda R; Medhane, Vijay J; Mathad, Vijayavitthal Thippannachar

2018-03-01

The present work describes investigation of mechanistic pathway for trimethyl borate mediated amidation of (R)-mandelic acid (3) with 4-nitophenylethylamine (2) to provide (R)-2-hydroxy-N-[2-(4-nitrophenyl)ethyl]-2-phenylacetamide (4) during mirabegron synthesis. Plausible reaction mechanism is proposed by isolating and elucidating the active α-hydroxy ester intermediate 16 from the reaction mass. Trimethyl borate mediated approach proved to be selective in providing 4 without disturbing α-hydroxyl group and stereochemistry of the chiral center, and is also a greener, more economic and production friendly over the reported methods. The developed approach is rapid and efficient for the preparation of 4 with an overall yield of 85-87% and around 99.0% purity by HPLC at scale.

Abscisic Acid Negatively Regulates Elicitor-Induced Synthesis of Capsidiol in Wild Tobacco1[W

PubMed Central

Mialoundama, Alexis Samba; Heintz, Dimitri; Debayle, Delphine; Rahier, Alain; Camara, Bilal; Bouvier, Florence

2009-01-01

In the Solanaceae, biotic and abiotic elicitors induce de novo synthesis of sesquiterpenoid stress metabolites known as phytoalexins. Because plant hormones play critical roles in the induction of defense-responsive genes, we have explored the effect of abscisic acid (ABA) on the synthesis of capsidiol, the major wild tobacco (Nicotiana plumbaginifolia) sesquiterpenoid phytoalexin, using wild-type plants versus nonallelic mutants Npaba2 and Npaba1 that are deficient in ABA synthesis. Npaba2 and Npaba1 mutants exhibited a 2-fold higher synthesis of capsidiol than wild-type plants when elicited with either cellulase or arachidonic acid or when infected by Botrytis cinerea. The same trend was observed for the expression of the capsidiol biosynthetic genes 5-epi-aristolochene synthase and 5-epi-aristolochene hydroxylase. Treatment of wild-type plants with fluridone, an inhibitor of the upstream ABA pathway, recapitulated the behavior of Npaba2 and Npaba1 mutants, while the application of exogenous ABA reversed the enhanced synthesis of capsidiol in Npaba2 and Npaba1 mutants. Concomitant with the production of capsidiol, we observed the induction of ABA 8′-hydroxylase in elicited plants. In wild-type plants, the induction of ABA 8′-hydroxylase coincided with a decrease in ABA content and with the accumulation of ABA catabolic products such as phaseic acid and dihydrophaseic acid, suggesting a negative regulation exerted by ABA on capsidiol synthesis. Collectively, our data indicate that ABA is not required per se for the induction of capsidiol synthesis but is essentially implicated in a stress-response checkpoint to fine-tune the amplification of capsidiol synthesis in challenged plants. PMID:19420326

Binding domain-driven intracellular trafficking of sterols for synthesis of steroid hormones, bile acids and oxysterols.

PubMed

Midzak, Andrew; Papadopoulos, Vassilios

2014-09-01

Steroid hormones, bioactive oxysterols and bile acids are all derived from the biological metabolism of lipid cholesterol. The enzymatic pathways generating these compounds have been an area of intense research for almost a century, as cholesterol and its metabolites have substantial impacts on human health. Owing to its high degree of hydrophobicity and the chemical properties that it confers to biological membranes, the distribution of cholesterol in cells is tightly controlled, with subcellular organelles exhibiting highly divergent levels of cholesterol. The manners in which cells maintain such sterol distributions are of great interest in the study of steroid and bile acid synthesis, as limiting cholesterol substrate to the enzymatic pathways is the principal mechanism by which production of steroids and bile acids is regulated. The mechanisms by which cholesterol moves within cells, however, remain poorly understood. In this review, we examine the subcellular machinery involved in cholesterol metabolism to steroid hormones and bile acid, relating it to both lipid- and protein-based mechanisms facilitating intracellular and intraorganellar cholesterol movement and delivery to these pathways. In particular, we examine evidence for the involvement of specific protein domains involved in cholesterol binding, which impact cholesterol movement and metabolism in steroidogenesis and bile acid synthesis. A better understanding of the physical mechanisms by which these protein- and lipid-based systems function is of fundamental importance to understanding physiological homeostasis and its perturbation. © 2014 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis.

PubMed

Wagner, Alexander J; Zubarev, Dmitry Yu; Aspuru-Guzik, Alán; Blackmond, Donna G

2017-04-26

Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins.

Chiral Sugars Drive Enantioenrichment in Prebiotic Amino Acid Synthesis

PubMed Central

2017-01-01

Chiral pentose sugars mediate the enantioselective synthesis of amino acid precursors, with the magnitude of the chiral induction dictated by a subtle cooperativity between sugar hydroxyl groups. Ribose and lyxose give opposite chiral preferences, and theoretical calculations reveal the pseudoenantiomeric nature of transition state structures from the two sugars. Prebiotically plausible mixtures of natural d-sugars lead to enantioenrichment of natural l-amino acid precursors. Temporal monitoring and kinetic modeling of the reaction reveal an unusual dynamic kinetic resolution that shifts toward an enantioselective pathway over time, providing an amplification mechanism for the transfer of chiral information. This work adds to growing evidence for synergy in the etiology of the single chirality of the two most important classes of biological molecules, the sugars that make up DNA and RNA and the amino acids that form proteins. PMID:28470050

Prebiotic Amino Acid Thioester Synthesis: Thiol-Dependent Amino Acid Synthesis from Formose substrates (Formaldehyde and Glycolaldehyde) and Ammonia

NASA Technical Reports Server (NTRS)

Weber, Arthur L.

1998-01-01

Formaldehyde and glycolaldehyde (substrates of the formose autocatalytic cycle) were shown to react with ammonia yielding alanine and homoserine under mild aqueous conditions in the presence of thiol catalysts. Since similar reactions carried out without ammonia yielded alpha-hydroxy acid thioesters, the thiol-dependent synthesis of alanine and homoserine is presumed to occur via amino acid thioesters-intermediates capable of forming peptides. A pH 5.2 solution of 20 mM formaldehyde, 20 mM glycolaldehyde, 20 mM ammonium chloride, 23 mM 3-mercaptopropionic acid, and 23 mM acetic acid that reacted for 35 days at 40 C yielded (based on initial formaldehyde) 1.8% alanine and 0.08% homoserine. In the absence of thiol catalyst, the synthesis of alanine and homoserine was negligible. Alanine synthesis required both formaldehyde and glycolaldehyde, but homoserine synthesis required only glycolaldehyde. At 25 days the efficiency of alanine synthesis calculated from the ratio of alanine synthesized to formaldehyde reacted was 2.1%, and the yield (based on initial formaldehyde) of triose and tetrose intermediates involved in alanine and homoserine synthesis was 0.3 and 2.1%, respectively. Alanine synthesis was also seen in similar reactions containing only 10 mM each of aldehyde substrates, ammonia, and thiol. The prebiotic significance of these reactions that use the formose reaction to generate sugar intermediates that are converted to reactive amino acid thioesters is discussed.

Electrocarboxylation: towards sustainable and efficient synthesis of valuable carboxylic acids

PubMed Central

Matthessen, Roman; Fransaer, Jan; Binnemans, Koen

2014-01-01

Summary The near-unlimited availability of CO2 has stimulated a growing research effort in creating value-added products from this greenhouse gas. This paper presents the trends on the most important methods used in the electrochemical synthesis of carboxylic acids from carbon dioxide. An overview is given of different substrate groups which form carboxylic acids upon CO2 fixation, including mechanistic considerations. While most work focuses on the electrocarboxylation of substrates with sacrificial anodes, this review considers the possibilities and challenges of implementing other synthetic methodologies. In view of potential industrial application, the choice of reactor setup, electrode type and reaction pathway has a large influence on the sustainability and efficiency of the process. PMID:25383120

Defining a Role for Acid Sphingomyelinase in the p38/Interleukin-6 Pathway*

PubMed Central

Perry, David M.; Newcomb, Benjamin; Adada, Mohamad; Wu, Bill X.; Roddy, Patrick; Kitatani, Kazuyuki; Siskind, Leah; Obeid, Lina M.; Hannun, Yusuf A.

2014-01-01

Acid sphingomyelinase (ASM) is one of the key enzymes involved in regulating the metabolism of the bioactive sphingolipid ceramide in the sphingolipid salvage pathway, yet defining signaling pathways by which ASM exerts its effects has proven difficult. Previous literature has implicated sphingolipids in the regulation of cytokines such as interleukin-6 (IL-6), but the specific sphingolipid pathways and mechanisms involved in inflammatory signaling need to be further elucidated. In this work, we sought to define the role of ASM in IL-6 production because our previous work showed that a parallel pathway of ceramide metabolism, acid β-glucosidase 1, negatively regulates IL-6. First, silencing ASM with siRNA abrogated IL-6 production in response to the tumor promoter, 4β-phorbol 12-myristate 13-acetate (PMA), in MCF-7 cells, in distinction to acid β-glucosidase 1 and acid ceramidase, suggesting specialization of the pathways. Moreover, treating cells with siRNA to ASM or with the indirect pharmacologic inhibitor desipramine resulted in significant inhibition of TNFα- and PMA-induced IL-6 production in MDA-MB-231 and HeLa cells. Knockdown of ASM was found to significantly inhibit PMA-dependent IL-6 induction at the mRNA level, probably ruling out mechanisms of translation or secretion of IL-6. Further, ASM knockdown or desipramine blunted p38 MAPK activation in response to TNFα, revealing a key role for ASM in activating p38, a signaling pathway known to regulate IL-6 induction. Last, knockdown of ASM dramatically blunted invasion of HeLa and MDA-MB-231 cells through Matrigel. Taken together, these results demonstrate that ASM plays a critical role in p38 signaling and IL-6 synthesis with implications for tumor pathobiology. PMID:24951586

Amino Acid Control over Deoxyribonucleic Acid Synthesis in Escherichia coli Infected With T-Even Bacteriophage

PubMed Central

Donini, Pierluigi

1970-01-01

Starvation for a required amino acid of normal or RCstrEscherichia coli infected with T-even phages arrests further synthesis of phage deoxyribonucleic acid (DNA). This amino acid control over phage DNA synthesis does not occur in RCrelE. coli mutants. Heat inactivation of a temperature-sensitive aminoacyl-transfer ribonucleic acid (RNA) synthetase similarly causes an arrest of phage DNA synthesis in infected cells of RCstr phenotype but not in cells of RCrel phenotype. Inhibition of phage DNA synthesis in amino acid-starved RCstr host cells can be reversed by addition of chloramphenicol to the culture. Thus, the general features of amino acid control over T-even phage DNA synthesis are entirely analogous to those known for amino acid control over net RNA synthesis of uninfected bacteria. This analogy shows that the bacterial rel locus controls a wider range of macromolecular syntheses than had been previously thought. PMID:4914067

Porous AgPt@Pt Nanooctahedra as an Efficient Catalyst toward Formic Acid Oxidation with Predominant Dehydrogenation Pathway.

PubMed

Jiang, Xian; Yan, Xiaoxiao; Ren, Wangyu; Jia, Yufeng; Chen, Jianian; Sun, Dongmei; Xu, Lin; Tang, Yawen

2016-11-16

For direct formic acid fuel cells (DFAFCs), the dehydrogenation pathway is a desired reaction pathway, to boost the overall cell efficiency. Elaborate composition tuning and nanostructure engineering provide two promising strategies to design efficient electrocatalysts for DFAFCs. Herein, we present a facile synthesis of porous AgPt bimetallic nanooctahedra with enriched Pt surface (denoted as AgPt@Pt nanooctahedra) by a selective etching strategy. The smart integration of geometric and electronic effect confers a substantial enhancement of desired dehydrogenation pathway as well as electro-oxidation activity for the formic acid oxidation reaction (FAOR). We anticipate that the obtained nanocatalyst may hold great promises in fuel cell devices, and furthermore, the facile synthetic strategy demonstrated here can be extendable for the fabrication of other multicomponent nanoalloys with desirable morphologies and enhanced electrocatalytic performances.

Identification and functional characterisation of genes encoding the omega-3 polyunsaturated fatty acid biosynthetic pathway from the coccolithophore Emiliania huxleyi.

PubMed

Sayanova, Olga; Haslam, Richard P; Calerón, Monica Venegas; López, Noemi Ruiz; Worthy, Charlotte; Rooks, Paul; Allen, Michael J; Napier, Johnathan A

2011-05-01

The Prymnesiophyceae coccolithophore Emiliania huxleyi is one of the most abundant alga in our oceans and therefore plays a central role in marine foodwebs. E. huxleyi is notable for the synthesis and accumulation of the omega-3 long chain polyunsaturated fatty acid docosahexaenoic acid (DHA; 22:6Δ(4,7,10,13,16,19), n-3) which is accumulated in fish oils and known to have health-beneficial properties to humans, preventing cardiovascular disease and related pathologies. Here we describe the identification and functional characterisation of the five E. huxleyi genes which direct the synthesis of docosahexaenoic acid in this alga. Surprisingly, E. huxleyi does not use the conventional Δ6-pathway, instead using the alternative Δ8-desaturation route which has previously only been observed in a few unrelated microorganisms. Given that E. huxleyi accumulates significant levels of the Δ6-desaturated fatty acid stearidonic acid (18:4Δ(6,9,12,15), n-3), we infer that the biosynthesis of DHA is likely to be metabolically compartmentalised from the synthesis of stearidonic acid. Copyright © 2011 Elsevier Ltd. All rights reserved.

Glucocorticoids shift arachidonic acid metabolism toward endocannabinoid synthesis: a non-genomic anti-inflammatory switch

PubMed Central

Malcher-Lopes, Renato; Franco, Alier; Tasker, Jeffrey G.

2008-01-01

Glucocorticoids are capable of exerting both genomic and non-genomic actions in target cells of multiple tissues, including the brain, which trigger an array of electrophysiological, metabolic, secretory and inflammatory regulatory responses. Here, we have attempted to show how glucocorticoids may generate a rapid anti-inflammatory response by promoting arachidonic acid-derived endocannabinoid biosynthesis. According to our hypothesized model, non-genomic action of glucocorticoids results in the global shift of membrane lipid metabolism, subverting metabolic pathways toward the synthesis of the anti-inflammatory endocannabinoids, anandamide (AEA) and 2-arachidonoyl-glycerol (2-AG), and away from arachidonic acid production. Post-transcriptional inhibition of cyclooxygenase-2 (COX2) synthesis by glucocorticoids assists this mechanism by suppressing the synthesis of pro-inflammatory prostaglandins as well as endocannabinoid-derived prostanoids. In the central nervous system (CNS) this may represent a major neuroprotective system, which may cross-talk with leptin signaling in the hypothalamus allowing for the coordination between energy homeostasis and the inflammatory response. PMID:18295199

Energetics of amino acid synthesis in hydrothermal ecosystems

NASA Technical Reports Server (NTRS)

Amend, J. P.; Shock, E. L.

1998-01-01

Thermodynamic calculations showed that the autotrophic synthesis of all 20 protein-forming amino acids was energetically favored in hot (100 degrees C), moderately reduced, submarine hydrothermal solutions relative to the synthesis in cold (18 degrees C), oxidized, surface seawater. The net synthesis reactions of 11 amino acids were exergonic in the hydrothermal solution, but all were endergonic in surface seawater. The synthesis of the requisite amino acids of nine thermophilic and hyperthermophilic proteins in a 100 degreesC hydrothermal solution yielded between 600 and 8000 kilojoules per mole of protein, which is energy that is available to drive the intracellular synthesis of enzymes and other biopolymers in hyperthermophiles thriving in these ecosystems.

Identification of an itaconic acid degrading pathway in itaconic acid producing Aspergillus terreus.

PubMed

Chen, Mei; Huang, Xuenian; Zhong, Chengwei; Li, Jianjun; Lu, Xuefeng

2016-09-01

Itaconic acid, one of the most promising and flexible bio-based chemicals, is mainly produced by Aspergillus terreus. Previous studies to improve itaconic acid production in A. terreus through metabolic engineering were mainly focused on its biosynthesis pathway, while the itaconic acid-degrading pathway has largely been ignored. In this study, we used transcriptomic, proteomic, bioinformatic, and in vitro enzymatic analyses to identify three key enzymes, itaconyl-CoA transferase (IctA), itaconyl-CoA hydratase (IchA), and citramalyl-CoA lyase (CclA), that are involved in the catabolic pathway of itaconic acid in A. terreus. In the itaconic acid catabolic pathway in A. terreus, itaconic acid is first converted by IctA into itaconyl-CoA with succinyl-CoA as the CoA donor, and then itaconyl-CoA is hydrated into citramalyl-CoA by IchA. Finally, citramalyl-CoA is cleaved into acetyl-CoA and pyruvate by CclA. Moreover, IctA can also catalyze the reaction between citramalyl-CoA and succinate to generate succinyl-CoA and citramalate. These results, for the first time, identify the three key enzymes, IctA, IchA, and CclA, involved in the itaconic acid degrading pathway in itaconic acid producing A. terreus. The results will facilitate the improvement of itaconic acid production by metabolically engineering the catabolic pathway of itaconic acid in A. terreus.

Polymorphisms in genes in the SREBP1 signalling pathway and SCD are associated with milk fatty acid composition in Holstein cattle.

PubMed

Rincon, Gonzalo; Islas-Trejo, Alma; Castillo, Alejandro R; Bauman, Dale E; German, Bruce J; Medrano, Juan F

2012-02-01

Genes in the sterol regulatory element-binding protein-1 (SREBP1) pathway play a central role in regulation of milk fat synthesis, especially the de-novo synthesis of saturated fatty acids. SCD, a SREBP-responsive gene, is the key enzyme in the synthesis of monounsaturated fatty acids in the mammary gland. In the present study, we discovered SNP in candidate genes associated with this signalling pathway and SCD to identify genetic markers that can be used for genetic and metabolically directed selection in cattle. We resequenced six candidate genes in the SREBP1 pathway (SREBP1, SCAP, INSIG1, INSIG2, MBTPS1, MBTPS2) and two genes for SCD (SCD1 and SCD5) and discovered 47 Tag SNP that were used in a marker-trait association study. Milk and blood samples were collected from Holstein cows in their 1st or 2nd parity at 100-150 days of lactation. Individual fatty acids from C4 to C20, saturated fatty acid (SFA) content, monounsaturated fatty acid content, polyunsaturated fatty acid content and desaturase indexes were measured and used to perform the asociation analysis. Polymorphisms in the SCD5 and INSIG2 genes were the most representative markers associated with SFA/unsaturated fatty acid (UFA) ratio in milk. The analysis of desaturation activity determined that markers in the SCD1 and SCD5 genes showed the most significant effects. DGAT1 K232A marker was included in the study to examine the effect of this marker on the variation of milk fatty acids in our Holstein population. The percentage of variance explained by DGAT1 in the analysis was only 6% of SFA/UFA ratio. Milk fat depression was observed in one of the dairy herds and in this particular dairy one SNP in the SREBP1 gene (rs41912290) accounted for 40% of the phenotypic variance. Our results provide detailed SNP information for key genes in the SREBP1 signalling pathway and SCD that can be used to change milk fat composition by marker-assisted breeding to meet consumer demands regarding human health, as well

An Oral Load of [13C3]Glycerol and Blood NMR Analysis Detect Fatty Acid Esterification, Pentose Phosphate Pathway, and Glycerol Metabolism through the Tricarboxylic Acid Cycle in Human Liver.

PubMed

Jin, Eunsook S; Sherry, A Dean; Malloy, Craig R

2016-09-02

Drugs and other interventions for high impact hepatic diseases often target biochemical pathways such as gluconeogenesis, lipogenesis, or the metabolic response to oxidative stress. However, traditional liver function tests do not provide quantitative data about these pathways. In this study, we developed a simple method to evaluate these processes by NMR analysis of plasma metabolites. Healthy subjects ingested [U-(13)C3]glycerol, and blood was drawn at multiple times. Each subject completed three visits under differing nutritional states. High resolution (13)C NMR spectra of plasma triacylglycerols and glucose provided new insights into a number of hepatic processes including fatty acid esterification, the pentose phosphate pathway, and gluconeogenesis through the tricarboxylic acid cycle. Fasting stimulated pentose phosphate pathway activity and metabolism of [U-(13)C3]glycerol in the tricarboxylic acid cycle prior to gluconeogenesis or glyceroneogenesis. Fatty acid esterification was transient in the fasted state but continuous under fed conditions. We conclude that a simple NMR analysis of blood metabolites provides an important biomarker of pentose phosphate pathway activity, triacylglycerol synthesis, and flux through anaplerotic pathways in mitochondria of human liver. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

Model of the synthesis of trisporic acid in Mucorales showing bistability.

PubMed

Werner, S; Schroeter, A; Schimek, C; Vlaic, S; Wöstemeyer, J; Schuster, S

2012-12-01

An important substance in the signalling between individuals of Mucor-like fungi is trisporic acid (TA). This compound, together with some of its precursors, serves as a pheromone in mating between (+)- and (-)-mating types. Moreover, intermediates of the TA pathway are exchanged between the two mating partners. Based on differential equations, mathematical models of the synthesis pathways of TA in the two mating types of an idealised Mucor-fungus are here presented. These models include the positive feedback of TA on its own synthesis. The authors compare three sub-models in view of bistability, robustness and the reversibility of transitions. The proposed modelling study showed that, in a system where intermediates are exchanged, a reversible transition between the two stable steady states occurs, whereas an exchange of the end product leads to an irreversible transition. The reversible transition is physiologically favoured, because the high-production state of TA must come to an end eventually. Moreover, the exchange of intermediates and TA is compared with the 3-way handshake widely used by computers linked in a network.

Synthesis and Pro-Apoptotic Activity of Novel Glycyrrhetinic Acid Derivatives

PubMed Central

Logashenko, Evgeniya B; Salomatina, Oksana V; Markov, A V; Korchagina, Dina V; Salakhutdinov, Nariman F; Tolstikov, Genrikh A; Vlassov, Valentin V; Zenkova, Marina A

2011-01-01

Triterpenoids are used for medicinal purposes in many countries. Some, such as oleanolic and glycyrrhetinic acids, are known to be anti-inflammatory and anticarcinogenic. However, the biological activities of these naturally occurring molecules against their particular targets are weak, so the synthesis of new synthetic analogues with enhanced potency is needed. By combining modifications to both the A and C rings of 18βH-glycyrrhetinic acid, the novel synthetic derivative methyl 2-cyano-3,12-dioxo-18βH-olean-9(11),1(2)-dien-30-oate was obtained. This derivative displays high antiproliferative activity in cancer cells, including a cell line with a multidrug-resistance phenotype. It causes cell death by inducing the intrinsic caspase-dependent apoptotic pathway. PMID:21328513

Synthesis of 3 alpha,7 alpha,12 alpha,25-tetrahydroxy-5 beta-cholestan-24-one, an intermediate in the 25-hydroxylation pathway of cholic acid biosynthesis from cholesterol.

PubMed

Dayal, B; Tint, G S; Batta, A K; Shefer, S; Salen, G; Bose, A K; Pramanik, B N

1983-02-01

This paper describes the chemical synthesis of 3 alpha,7 alpha,12 alpha,25-tetrahydroxy-5 beta-cholestan-24-one via selective oxidation of 5 beta-cholestane-3 alpha,7 alpha,12 alpha, 24 xi,25-pentol with silver carbonate on celite. The structure of this 24-keto bile alcohol was confirmed by gas-liquid chromatography and mass spectrometry. Synthesis of this compound via pyridinium chlorochromate oxidation of the triacetoxy derivative of 5 beta-cholestane-3 alpha,7 alpha,12 alpha,24 xi,25-pentol followed by saponification further established its structure. 3 alpha,7 alpha,12 alpha,25-Tetrahydroxy-5 beta-cholestan-24-one was required for the in vivo and in vitro studies of side-chain oxidation and cleavage in the 25-hydroxylation pathway of cholic acid biosynthesis.

The cholesterol, fatty acid and triglyceride synthesis pathways regulated by site 1 protease (S1P) are required for efficient replication of severe fever with thrombocytopenia syndrome virus.

PubMed

Urata, Shuzo; Uno, Yukiko; Kurosaki, Yohei; Yasuda, Jiro

2018-06-12

Severe fever with thrombocytopenia syndrome (SFTS) is an emerging infectious disease caused by the SFTS virus (SFTSV), which has a high mortality rate. Currently, no licensed vaccines or therapeutic agents have been approved for use against SFTSV infection. Here, we report that the cholesterol, fatty acid, and triglyceride synthesis pathways regulated by S1P is involved in SFTSV replication, using CHO-K1 cell line (SRD-12B) that is deficient in site 1 protease (S1P) enzymatic activity, PF-429242, a small compound targeting S1P enzymatic activity, and Fenofibrate and Lovastatin, which inhibit triglyceride and cholesterol synthesis, respectively. These results enhance our understanding of the SFTSV replication mechanism and may contribute to the development of novel therapies for SFTSV infection. Copyright © 2018. Published by Elsevier Inc.

Synthesis of amino acids

DOEpatents

Davis, J.W. Jr.

1979-09-21

A method is described for synthesizing amino acids preceding through novel intermediates of the formulas: R/sub 1/R/sub 2/C(OSOC1)CN, R/sub 1/R/sub 2/C(C1)CN and (R/sub 1/R/sub 2/C(CN)O)/sub 2/SO wherein R/sub 1/ and R/sub 2/ are each selected from hydrogen and monovalent hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Evolution of a genome-encoded bias in amino acid biosynthetic pathways is a potential indicator of amino acid dynamics in the environment.

PubMed

Fasani, Rick A; Savageau, Michael A

2014-11-01

Overcoming the stress of starvation is one of an organism's most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype-environment-phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism's existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product-the cognate amino acid of the pathway-may require that very amino acid when it is no longer available. To study this potential "catch-22," we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell's fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism's natural environment. © The Author 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Activity-induced convergence of APP and BACE-1 in acidic microdomains via an endocytosis-dependent pathway

PubMed Central

Das, Utpal; Scott, David; Ganguly, Archan; Koo, Edward H.; Tang, Yong; Roy, Subhojit

2013-01-01

The convergence of APP (substrate) and BACE-1 (enzyme) is a rate-limiting, obligatory event triggering the amyloidogenic pathway – a key step in Alzheimer’s disease (AD) pathology. However, as both APP/BACE-1 are highly expressed in brain, mechanisms precluding their unabated convergence are unclear. Exploring dynamic localization of APP/BACE-1 in cultured hippocampal neurons, we found that after synthesis via the secretory-pathway, dendritic APP/BACE-1-containing vesicles are largely segregated in physiologic states. While BACE-1 is largely sorted into acidic recycling endosomes, APP is conveyed in Golgi-derived vesicles. However upon activity-induction – a known trigger of the amyloidogenic pathway – APP is routed into BACE-1-positive recycling endosomes via a clathrin-dependent mechanism. A partitioning/convergence of APP/BACE-1 vesicles is also apparent in control/AD brains respectively. Considering BACE-1 is optimally active in an acidic environment, our experiments suggest that neurons have evolved trafficking strategies that normally limit APP/BACE-1 proximity; and also uncover a pathway routing APP into BACE-1-containing organelles – triggering amyloidogenesis. PMID:23931995

Ursolic Acid Inhibits Na+/K+-ATPase Activity and Prevents TNF-α-Induced Gene Expression by Blocking Amino Acid Transport and Cellular Protein Synthesis

PubMed Central

Yokomichi, Tomonobu; Morimoto, Kyoko; Oshima, Nana; Yamada, Yuriko; Fu, Liwei; Taketani, Shigeru; Ando, Masayoshi; Kataoka, Takao

2011-01-01

Pro-inflammatory cytokines, such as tumor necrosis factor (TNF)-α, induce the expression of a wide variety of genes, including intercellular adhesion molecule-1 (ICAM-1). Ursolic acid (3β-hydroxy-urs-12-en-28-oic acid) was identified to inhibit the cell-surface ICAM-1 expression induced by pro-inflammatory cytokines in human lung carcinoma A549 cells. Ursolic acid was found to inhibit the TNF-α-induced ICAM-1 protein expression almost completely, whereas the TNF-α-induced ICAM-1 mRNA expression and NF-κB signaling pathway were decreased only partially by ursolic acid. In line with these findings, ursolic acid prevented cellular protein synthesis as well as amino acid uptake, but did not obviously affect nucleoside uptake and the subsequent DNA/RNA syntheses. This inhibitory profile of ursolic acid was similar to that of the Na+/K+-ATPase inhibitor, ouabain, but not the translation inhibitor, cycloheximide. Consistent with this notion, ursolic acid was found to inhibit the catalytic activity of Na+/K+-ATPase. Thus, our present study reveals a novel molecular mechanism in which ursolic acid inhibits Na+/K+-ATPase activity and prevents the TNF-α-induced gene expression by blocking amino acid transport and cellular protein synthesis. PMID:24970122

Boron Stress Activates the General Amino Acid Control Mechanism and Inhibits Protein Synthesis

PubMed Central

Uluisik, Irem; Kaya, Alaattin; Fomenko, Dmitri E.; Karakaya, Huseyin C.; Carlson, Bradley A.; Gladyshev, Vadim N.; Koc, Ahmet

2011-01-01

Boron is an essential micronutrient for plants, and it is beneficial for animals. However, at high concentrations boron is toxic to cells although the mechanism of this toxicity is not known. Atr1 has recently been identified as a boron efflux pump whose expression is upregulated in response to boron treatment. Here, we found that the expression of ATR1 is associated with expression of genes involved in amino acid biosynthesis. These mechanisms are strictly controlled by the transcription factor Gcn4 in response to boron treatment. Further analyses have shown that boron impaired protein synthesis by promoting phosphorylation of eIF2α in a Gcn2 kinase dependent manner. The uncharged tRNA binding domain (HisRS) of Gcn2 is necessary for the phosphorylation of eIF2α in the presence of boron. We postulate that boron exerts its toxic effect through activation of the general amino acid control system and inhibition of protein synthesis. Since the general amino acid control pathway is conserved among eukaryotes, this mechanism of boron toxicity may be of general importance. PMID:22114689

Lipase-catalyzed synthesis of fatty acid amide (erucamide) using fatty acid and urea.

PubMed

Awasthi, Neeraj Praphulla; Singh, R P

2007-01-01

Ammonolysis of fatty acids to the corresponding fatty acid amides is efficiently catalysed by Candida antartica lipase (Novozym 435). In the present paper lipase-catalysed synthesis of erucamide by ammonolysis of erucic acid and urea in organic solvent medium was studied and optimal conditions for fatty amides synthesis were established. In this process erucic acid gave 88.74 % pure erucamide after 48 hour and 250 rpm at 60 degrees C with 1:4 molar ratio of erucic acid and urea, the organic solvent media is 50 ml tert-butyl alcohol (2-methyl-2-propanol). This process for synthesis is economical as we used urea in place of ammonia or other amidation reactant at atmospheric pressure. The amount of catalyst used is 3 %.

Reassessment of the Genetic Regulation of Fatty Acid Synthesis in Escherichia coli: Global Positive Control by the Dual Functional Regulator FadR

PubMed Central

My, L.; Ghandour Achkar, N.; Viala, J. P.

2015-01-01

ABSTRACT In Escherichia coli, the FadR transcriptional regulator represses the expression of fatty acid degradation (fad) genes. However, FadR is also an activator of the expression of fabA and fabB, two genes involved in unsaturated fatty acid synthesis. Therefore, FadR plays an important role in maintaining the balance between saturated and unsaturated fatty acids in the membrane. We recently showed that FadR also activates the promoter upstream of the fabH gene (L. My, B. Rekoske, J. J. Lemke, J. P. Viala, R. L. Gourse, and E. Bouveret, J Bacteriol 195:3784–3795, 2013, doi:10.1128/JB.00384-13). Furthermore, recent transcriptomic and proteomic data suggested that FadR activates the majority of fatty acid (FA) synthesis genes. In the present study, we tested the role of FadR in the expression of all genes involved in FA synthesis. We found that FadR activates the transcription of all tested FA synthesis genes, and we identified the FadR binding site for each of these genes. This necessitated the reassessment of the transcription start sites for accA and accB genes described previously, and we provide evidence for the presence of multiple promoters driving the expression of these genes. We showed further that regulation by FadR impacts the amount of FA synthesis enzymes in the cell. Our results show that FadR is a global regulator of FA metabolism in E. coli, acting both as a repressor of catabolism and an activator of anabolism, two directly opposing pathways. IMPORTANCE In most bacteria, a transcriptional regulator tunes the level of FA synthesis enzymes. Oddly, such a global regulator still was missing for E. coli, which nonetheless is one of the prominent model bacteria used for engineering biofuel production using the FA synthesis pathway. Our work identifies the FadR functional dual regulator as a global activator of almost all FA synthesis genes in E. coli. Because FadR also is the repressor of FA degradation, FadR acts both as a repressor and an activator

[Lipid synthesis by an acidic acid tolerant Rhodotorula glutinis].

PubMed

Lin, Zhangnan; Liu, Hongjuan; Zhang, Jian'an; Wang, Gehua

2016-03-01

Acetic acid, as a main by-product generated in the pretreatment process of lignocellulose hydrolysis, significantly affects cell growth and lipid synthesis of oleaginous microorganisms. Therefore, we studied the tolerance of Rhodotorula glutinis to acetic acid and its lipid synthesis from substrate containing acetic acid. In the mixed sugar medium containing 6 g/L glucose and 44 g/L xylose, and supplemented with acetic acid, the cell growth was not:inhibited when the acetic acid concentration was below 10 g/L. Compared with the control, the biomass, lipid concentration and lipid content of R. glutinis increased 21.5%, 171% and 122% respectively when acetic acid concentration was 10 g/L. Furthermore, R. glutinis could accumulate lipid with acetate as the sole carbon source. Lipid concentration and lipid yield reached 3.20 g/L and 13% respectively with the initial acetic acid concentration of 25 g/L. The lipid composition was analyzed by gas chromatograph. The main composition of lipid produced with acetic acid was palmitic acid, stearic acid, oleic acid, linoleic acid and linolenic acid, including 40.9% saturated fatty acids and 59.1% unsaturated fatty acids. The lipid composition was similar to that of plant oil, indicating that lipid from oleaginous yeast R. glutinis had potential as the feedstock of biodiesel production. These results demonstrated that a certain concentration of acetic acid need not to be removed in the detoxification process when using lignocelluloses hydrolysate to produce microbial lipid by R. glutinis.

Acetolactate synthase regulatory subunits play divergent and overlapping roles in branched-chain amino acid synthesis and Arabidopsis development.

PubMed

Dezfulian, Mohammad H; Foreman, Curtis; Jalili, Espanta; Pal, Mrinal; Dhaliwal, Rajdeep K; Roberto, Don Karl A; Imre, Kathleen M; Kohalmi, Susanne E; Crosby, William L

2017-04-07

Branched-chain amino acids (BCAAs) are synthesized by plants, fungi, bacteria, and archaea with plants being the major source of these amino acids in animal diets. Acetolactate synthase (ALS) is the first enzyme in the BCAA synthesis pathway. Although the functional contribution of ALS to BCAA biosynthesis has been extensively characterized, a comprehensive understanding of the regulation of this pathway at the molecular level is still lacking. To characterize the regulatory processes governing ALS activity we utilized several complementary approaches. Using the ALS catalytic protein subunit as bait we performed a yeast two-hybrid (Y2H) screen which resulted in the identification of a set of interacting proteins, two of which (denoted as ALS-INTERACTING PROTEIN1 and 3 [AIP1 and AIP3, respectively]) were found to be evolutionarily conserved orthologues of bacterial feedback-regulatory proteins and therefore implicated in the regulation of ALS activity. To investigate the molecular role AIPs might play in BCAA synthesis in Arabidopsis thaliana, we examined the functional contribution of aip1 and aip3 knockout alleles to plant patterning and development and BCAA synthesis under various growth conditions. Loss-of-function genetic backgrounds involving these two genes exhibited differential aberrant growth responses in valine-, isoleucine-, and sodium chloride-supplemented media. While BCAA synthesis is believed to be localized to the chloroplast, both AIP1 and AIP3 were found to localize to the peroxisome in addition to the chloroplast. Analysis of free amino acid pools in the mutant backgrounds revealed that they differ in the absolute amount of individual BCAAs accumulated and exhibit elevated levels of BCAAs in leaf tissues. Despite the phenotypic differences observed in aip1 and aip3 backgrounds, functional redundancy between these loci was suggested by the finding that aip1/aip3 double knockout mutants are severely developmentally compromised. Taken together the

The shikimate pathway: review of amino acid sequence, function and three-dimensional structures of the enzymes.

PubMed

Mir, Rafia; Jallu, Shais; Singh, T P

2015-06-01

The aromatic compounds such as aromatic amino acids, vitamin K and ubiquinone are important prerequisites for the metabolism of an organism. All organisms can synthesize these aromatic metabolites through shikimate pathway, except for mammals which are dependent on their diet for these compounds. The pathway converts phosphoenolpyruvate and erythrose 4-phosphate to chorismate through seven enzymatically catalyzed steps and chorismate serves as a precursor for the synthesis of variety of aromatic compounds. These enzymes have shown to play a vital role for the viability of microorganisms and thus are suggested to present attractive molecular targets for the design of novel antimicrobial drugs. This review focuses on the seven enzymes of the shikimate pathway, highlighting their primary sequences, functions and three-dimensional structures. The understanding of their active site amino acid maps, functions and three-dimensional structures will provide a framework on which the rational design of antimicrobial drugs would be based. Comparing the full length amino acid sequences and the X-ray crystal structures of these enzymes from bacteria, fungi and plant sources would contribute in designing a specific drug and/or in developing broad-spectrum compounds with efficacy against a variety of pathogens.

Evolution of a Genome-Encoded Bias in Amino Acid Biosynthetic Pathways Is a Potential Indicator of Amino Acid Dynamics in the Environment

PubMed Central

Fasani, Rick A.; Savageau, Michael A.

2014-01-01

Overcoming the stress of starvation is one of an organism’s most challenging phenotypic responses. Those organisms that frequently survive the challenge, by virtue of their fitness, will have evolved genomes that are shaped by their specific environments. Understanding this genotype–environment–phenotype relationship at a deep level will require quantitative predictive models of the complex molecular systems that link these aspects of an organism’s existence. Here, we treat one of the most fundamental molecular systems, protein synthesis, and the amino acid biosynthetic pathways involved in the stringent response to starvation. These systems face an inherent logical dilemma: Building an amino acid biosynthetic pathway to synthesize its product—the cognate amino acid of the pathway—may require that very amino acid when it is no longer available. To study this potential “catch-22,” we have created a generic model of amino acid biosynthesis in response to sudden starvation. Our mathematical analysis and computational results indicate that there are two distinctly different outcomes: Partial recovery to a new steady state, or full system failure. Moreover, the cell’s fate is dictated by the cognate bias, the number of cognate amino acids in the corresponding biosynthetic pathway relative to the average number of that amino acid in the proteome. We test these implications by analyzing the proteomes of over 1,800 sequenced microbes, which reveals statistically significant evidence of low cognate bias, a genetic trait that would avoid the biosynthetic quandary. Furthermore, these results suggest that the pattern of cognate bias, which is readily derived by genome sequencing, may provide evolutionary clues to an organism’s natural environment. PMID:25118252

Vitamins and aging: pathways to NAD+ synthesis.

PubMed

Denu, John M

2007-05-04

Recent genetic evidence reveals additional salvage pathways for NAD(+) synthesis. In this issue, Belenky et al. (2007) report that nicotinamide riboside, a new NAD(+) precursor, regulates Sir2 deacetylase activity and life span in yeast. The ability of nicotinamide riboside to enhance life span does not depend on calorie restriction.

Catalysis of the Carbonylation of Alcohols to Carboxylic Acids Including Acetic Acid Synthesis from Methanol.

ERIC Educational Resources Information Center

Forster, Denis; DeKleva, Thomas W.

1986-01-01

Monsanto's highly successful synthesis of acetic acid from methanol and carbon monoxide illustrates use of new starting materials to replace pretroleum-derived ethylene. Outlines the fundamental aspects of the acetic acid process and suggests ways of extending the synthesis to higher carboxylic acids. (JN)

Biosynthesis of cis,cis-muconic acid and its aromatic precursors, catechol and protocatechuic acid, from renewable feedstocks by Saccharomyces cerevisiae.

PubMed

Weber, Christian; Brückner, Christine; Weinreb, Sheila; Lehr, Claudia; Essl, Christine; Boles, Eckhard

2012-12-01

Adipic acid is a high-value compound used primarily as a precursor for the synthesis of nylon, coatings, and plastics. Today it is produced mainly in chemical processes from petrochemicals like benzene. Because of the strong environmental impact of the production processes and the dependence on fossil resources, biotechnological production processes would provide an interesting alternative. Here we describe the first engineered Saccharomyces cerevisiae strain expressing a heterologous biosynthetic pathway converting the intermediate 3-dehydroshikimate of the aromatic amino acid biosynthesis pathway via protocatechuic acid and catechol into cis,cis-muconic acid, which can be chemically dehydrogenated to adipic acid. The pathway consists of three heterologous microbial enzymes, 3-dehydroshikimate dehydratase, protocatechuic acid decarboxylase composed of three different subunits, and catechol 1,2-dioxygenase. For each heterologous reaction step, we analyzed several potential candidates for their expression and activity in yeast to compose a functional cis,cis-muconic acid synthesis pathway. Carbon flow into the heterologous pathway was optimized by increasing the flux through selected steps of the common aromatic amino acid biosynthesis pathway and by blocking the conversion of 3-dehydroshikimate into shikimate. The recombinant yeast cells finally produced about 1.56 mg/liter cis,cis-muconic acid.

Role of fatty-acid synthesis in dendritic cell generation and function.

PubMed

Rehman, Adeel; Hemmert, Keith C; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R; Barilla, Rocky; Quesada, Juan P; Zambirinis, Constantinos P; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H Leon; Graffeo, Christopher S; Acehan, Devrim; Miller, George

2013-05-01

Dendritic cells (DC) are professional APCs that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of cleaved caspase-3 and BCL-xL and downregulation of cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHC class II, ICAM-1, B7-1, and B7-2 but increased their production of selected proinflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacity to activate allogeneic as well as Ag-restricted CD4(+) and CD8(+) T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune phenotype and IFN-γ production. Because endoplasmic reticulum (ER) stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAPK and Akt signaling. Further, lowering ER stress by 4-phenylbutyrate mitigated the enhanced immune stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 12 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art.

Synthesis of new kojic acid based unnatural α-amino acid derivatives.

PubMed

Balakrishna, C; Payili, Nagaraju; Yennam, Satyanarayana; Uma Devi, P; Behera, Manoranjan

2015-11-01

An efficient method for the preparation of kojic acid based α-amino acid derivatives by alkylation of glycinate schiff base with bromokojic acids have been described. Using this method, mono as well as di alkylated kojic acid-amino acid conjugates have been prepared. This is the first synthesis of C-linked kojic acid-amino acid conjugate where kojic acid is directly linked to amino acid through a C-C bond. Copyright © 2015 Elsevier Ltd. All rights reserved.

Classical dendritic cells mediate fibrosis directly via the retinoic acid pathway in severe eye allergy

PubMed Central

Ahadome, Sarah D.; Mathew, Rose; Reyes, Nancy J.; Mettu, Priyatham S.; Cousins, Scott W.; Calder, Virginia L.; Saban, Daniel R.

2016-01-01

Fibrosis is a shared end-stage pathway to lung, liver, and heart failure. In the ocular mucosa (conjunctiva), fibrosis leads to blindness in trachoma, pemphigoid, and allergy. The indirect fibrogenic role of DCs via T cell activation and inflammatory cell recruitment is well documented. However, here we demonstrate that DCs can directly induce fibrosis. In the mouse model of allergic eye disease (AED), classical CD11b+ DCs in the ocular mucosa showed increased activity of aldehyde dehydrogenase (ALDH), the enzyme required for retinoic acid synthesis. In vitro, CD11b+ DC–derived ALDH was associated with 9-cis-retinoic acid ligation to retinoid x receptor (RXR), which induced conjunctival fibroblast activation. In vivo, stimulating RXR led to rapid onset of ocular mucosal fibrosis, whereas inhibiting ALDH activity in DCs or selectively depleting DCs markedly reduced fibrosis. Collectively, these data reveal a profibrotic ALDH-dependent pathway by DCs and uncover a role for DC retinoid metabolism. PMID:27595139

Role of Fatty-acid Synthesis in Dendritic Cell Generation and Function

PubMed Central

Rehman, Adeel; Hemmert, Keith C.; Ochi, Atsuo; Jamal, Mohsin; Henning, Justin R.; Barilla, Rocky; Quesada, Juan P.; Zambirinis, Constantinos P.; Tang, Kerry; Ego-Osuala, Melvin; Rao, Raghavendra S.; Greco, Stephanie; Deutsch, Michael; Narayan, Suchithra; Pachter, H. Leon; Graffeo, Christopher S.; Acehan, Devrim; Miller, George

2013-01-01

Dendritic cells (DC) are professional antigen presenting cells that regulate innate and adaptive immunity. The role of fatty-acid synthesis in DC development and function is uncertain. We found that blockade of fatty-acid synthesis markedly decreases dendropoiesis in the liver and in primary and secondary lymphoid organs in mice. Human DC development from PBMC precursors was also diminished by blockade of fatty-acid synthesis. This was associated with higher rates of apoptosis in precursor cells and increased expression of Cleaved Caspase 3 and BCL-xL, and down-regulation of Cyclin B1. Further, blockade of fatty-acid synthesis decreased DC expression of MHCII, ICAM-1, B7-1, B7-2 but increased their production of selected pro-inflammatory cytokines including IL-12 and MCP-1. Accordingly, inhibition of fatty-acid synthesis enhanced DC capacityto activate allogeneic as well as antigen-restricted CD4+ and CD8+ T cells and induce CTL responses. Further, blockade of fatty-acid synthesis increased DC expression of Notch ligands and enhanced their ability to activate NK cell immune-phenotype and IFN-γ production. Since endoplasmic reticular (ER)-stress can augment the immunogenic function of APC, we postulated that this may account for the higher DC immunogenicity. We found that inhibition of fatty-acid synthesis resulted in elevated expression of numerous markers of ER stress in humans and mice and was associated with increased MAP kinase and Akt signaling. Further, lowering ER-stress by 4-phenylbutyrate mitigated the enhanced immune-stimulation associated with fatty-acid synthesis blockade. Our findings elucidate the role of fatty-acid synthesis in DC development and function and have implications to the design of DC vaccines for immunotherapy. PMID:23536633

Rewiring protein synthesis: From natural to synthetic amino acids.

PubMed

Fan, Yongqiang; Evans, Christopher R; Ling, Jiqiang

2017-11-01

The protein synthesis machinery uses 22 natural amino acids as building blocks that faithfully decode the genetic information. Such fidelity is controlled at multiple steps and can be compromised in nature and in the laboratory to rewire protein synthesis with natural and synthetic amino acids. This review summarizes the major quality control mechanisms during protein synthesis, including aminoacyl-tRNA synthetases, elongation factors, and the ribosome. We will discuss evolution and engineering of such components that allow incorporation of natural and synthetic amino acids at positions that deviate from the standard genetic code. The protein synthesis machinery is highly selective, yet not fixed, for the correct amino acids that match the mRNA codons. Ambiguous translation of a codon with multiple amino acids or complete reassignment of a codon with a synthetic amino acid diversifies the proteome. Expanding the genetic code with synthetic amino acids through rewiring protein synthesis has broad applications in synthetic biology and chemical biology. Biochemical, structural, and genetic studies of the translational quality control mechanisms are not only crucial to understand the physiological role of translational fidelity and evolution of the genetic code, but also enable us to better design biological parts to expand the proteomes of synthetic organisms. This article is part of a Special Issue entitled "Biochemistry of Synthetic Biology - Recent Developments" Guest Editor: Dr. Ilka Heinemann and Dr. Patrick O'Donoghue. Copyright © 2017 Elsevier B.V. All rights reserved.

Transaminases for the synthesis of enantiopure beta-amino acids

PubMed Central

2012-01-01

Optically pure β-amino acids constitute interesting building blocks for peptidomimetics and a great variety of pharmaceutically important compounds. Their efficient synthesis still poses a major challenge. Transaminases (also known as aminotransferases) possess a great potential for the synthesis of optically pure β-amino acids. These pyridoxal 5'-dependent enzymes catalyze the transfer of an amino group from a donor substrate to an acceptor, thus enabling the synthesis of a wide variety of chiral amines and amino acids. Transaminases can be applied either for the kinetic resolution of racemic compounds or the asymmetric synthesis starting from a prochiral substrate. This review gives an overview over microbial transaminases with activity towards β-amino acids and their substrate spectra. It also outlines current strategies for the screening of new biocatalysts. Particular emphasis is placed on activity assays which are applicable to high-throughput screening. PMID:22293122

Increased Long Chain acyl-Coa Synthetase Activity and Fatty Acid Import Is Linked to Membrane Synthesis for Development of Picornavirus Replication Organelles

PubMed Central

Scott, Alison J.; Ford, Lauren A.; Pei, Zhengtong; Watkins, Paul A.; Ernst, Robert K.; Belov, George A.

2013-01-01

All positive strand (+RNA) viruses of eukaryotes replicate their genomes in association with membranes. The mechanisms of membrane remodeling in infected cells represent attractive targets for designing future therapeutics, but our understanding of this process is very limited. Elements of autophagy and/or the secretory pathway were proposed to be hijacked for building of picornavirus replication organelles. However, even closely related viruses differ significantly in their requirements for components of these pathways. We demonstrate here that infection with diverse picornaviruses rapidly activates import of long chain fatty acids. While in non-infected cells the imported fatty acids are channeled to lipid droplets, in infected cells the synthesis of neutral lipids is shut down and the fatty acids are utilized in highly up-regulated phosphatidylcholine synthesis. Thus the replication organelles are likely built from de novo synthesized membrane material, rather than from the remodeled pre-existing membranes. We show that activation of fatty acid import is linked to the up-regulation of cellular long chain acyl-CoA synthetase activity and identify the long chain acyl-CoA syntheatse3 (Acsl3) as a novel host factor required for polio replication. Poliovirus protein 2A is required to trigger the activation of import of fatty acids independent of its protease activity. Shift in fatty acid import preferences by infected cells results in synthesis of phosphatidylcholines different from those in uninfected cells, arguing that the viral replication organelles possess unique properties compared to the pre-existing membranes. Our data show how poliovirus can change the overall cellular membrane homeostasis by targeting one critical process. They explain earlier observations of increased phospholipid synthesis in infected cells and suggest a simple model of the structural development of the membranous scaffold of replication complexes of picorna-like viruses, that may be

SCD1 Inhibition Causes Cancer Cell Death by Depleting Mono-Unsaturated Fatty Acids

PubMed Central

Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L.; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G. F.; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara

2012-01-01

Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway. PMID:22457791

SCD1 inhibition causes cancer cell death by depleting mono-unsaturated fatty acids.

PubMed

Mason, Paul; Liang, Beirong; Li, Lingyun; Fremgen, Trisha; Murphy, Erin; Quinn, Angela; Madden, Stephen L; Biemann, Hans-Peter; Wang, Bing; Cohen, Aharon; Komarnitsky, Svetlana; Jancsics, Kate; Hirth, Brad; Cooper, Christopher G F; Lee, Edward; Wilson, Sean; Krumbholz, Roy; Schmid, Steven; Xiang, Yibin; Booker, Michael; Lillie, James; Carter, Kara

2012-01-01

Increased metabolism is a requirement for tumor cell proliferation. To understand the dependence of tumor cells on fatty acid metabolism, we evaluated various nodes of the fatty acid synthesis pathway. Using RNAi we have demonstrated that depletion of fatty-acid synthesis pathway enzymes SCD1, FASN, or ACC1 in HCT116 colon cancer cells results in cytotoxicity that is reversible by addition of exogenous fatty acids. This conditional phenotype is most pronounced when SCD1 is depleted. We used this fatty-acid rescue strategy to characterize several small-molecule inhibitors of fatty acid synthesis, including identification of TOFA as a potent SCD1 inhibitor, representing a previously undescribed activity for this compound. Reference FASN and ACC inhibitors show cytotoxicity that is less pronounced than that of TOFA, and fatty-acid rescue profiles consistent with their proposed enzyme targets. Two reference SCD1 inhibitors show low-nanomolar cytotoxicity that is offset by at least two orders of magnitude by exogenous oleate. One of these inhibitors slows growth of HCT116 xenograft tumors. Our data outline an effective strategy for interrogation of on-mechanism potency and pathway-node-specificity of fatty acid synthesis inhibitors, establish an unambiguous link between fatty acid synthesis and cancer cell survival, and point toward SCD1 as a key target in this pathway.

Genetics Home Reference: congenital bile acid synthesis defect type 1

MedlinePlus

... type 1 Congenital bile acid synthesis defect type 1 Printable PDF Open All Close All Enable Javascript to view the expand/collapse boxes. Description Congenital bile acid synthesis defect type 1 ...

Synthesis of alpha-amino acids

DOEpatents

Davis, J.W. Jr.

1983-01-25

A method is described for synthesizing alpha amino acids proceeding through novel intermediates of the formulas: R[sub 1]R[sub 2]C(OSOCl)CN, R[sub 1]R[sub 2]C(Cl)CN and [R[sub 1]R[sub 2]C(CN)O][sub 2]SO wherein R[sub 1] and R[sub 2] are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the synthesis methods of the prior art. No Drawings

Antimycobacterial action of thiolactomycin: an inhibitor of fatty acid and mycolic acid synthesis.

PubMed Central

Slayden, R A; Lee, R E; Armour, J W; Cooper, A M; Orme, I M; Brennan, P J; Besra, G S

1996-01-01

Thiolactomycin (TLM) possesses in vivo antimycobacterial activity against the saprophytic strain Mycobacterium smegmatis mc2155 and the virulent strain M. tuberculosis Erdman, resulting in complete inhibition of growth on solid media at 75 and 25 micrograms/ml, respectively. Use of an in vitro murine macrophage model also demonstrated the killing of viable intracellular M. tuberculosis in a dose-dependent manner. Through the use of in vivo [1,2-14C]acetate labeling of M. smegmatis, TLM was shown to inhibit the synthesis of both fatty acids and mycolic acids. However, synthesis of the shorter-chain alpha'-mycolates of M. smegmatis was not inhibited by TLM, whereas synthesis of the characteristic longer-chain alpha-mycolates and epoxymycolates was almost completely inhibited at 75 micrograms/ml. The use of M. smegmatis cell extracts demonstrated that TLM specifically inhibited the mycobacterial acyl carrier protein-dependent type II fatty acid synthase (FAS-II) but not the multifunctional type I fatty acid synthase (FAS-I). In addition, selective inhibition of long-chain mycolate synthesis by TLM was demonstrated in a dose-response manner in purified, cell wall-containing extracts of M. smegmatis cells. The in vivo and in vitro data and knowledge of the mechanism of TLM resistance in Escherichia coli suggest that two distinct TLM targets exist in mycobacteria, the beta-ketoacyl-acyl carrier protein synthases involved in FAS-II and the elongation steps leading to the synthesis of the alpha-mycolates and oxygenated mycolates. The efficacy of TLM against M. smegmatis and M. tuberculosis provides the prospects of identifying fatty acid and mycolic acid biosynthetic genes and revealing a novel range of chemotherapeutic agents directed against M. tuberculosis. PMID:9124847

Salicylic acid induces vanillin synthesis through the phospholipid signaling pathway in Capsicum chinense cell cultures

PubMed Central

Rodas-Junco, Beatriz A; Cab-Guillen, Yahaira; Muñoz-Sanchez, J Armando; Vázquez-Flota, Felipe; Monforte-Gonzalez, Miriam; Hérnandez-Sotomayor, S M Teresa

2013-01-01

Signal transduction via phospholipids is mediated by phospholipases such as phospholipase C (PLC) and D (PLD), which catalyze hydrolysis of plasma membrane structural phospholipids. Phospholipid signaling is also involved in plant responses to phytohormones such as salicylic acid (SA). The relationships between phospholipid signaling, SA, and secondary metabolism are not fully understood. Using a Capsicum chinense cell suspension as a model, we evaluated whether phospholipid signaling modulates SA-induced vanillin production through the activation of phenylalanine ammonia lyase (PAL), a key enzyme in the biosynthetic pathway. Salicylic acid was found to elicit PAL activity and consequently vanillin production, which was diminished or reversed upon exposure to the phosphoinositide-phospholipase C (PI-PLC) signaling inhibitors neomycin and U73122. Exposure to the phosphatidic acid inhibitor 1-butanol altered PLD activity and prevented SA-induced vanillin production. Our results suggest that PLC and PLD-generated secondary messengers may be modulating SA-induced vanillin production through the activation of key biosynthetic pathway enzymes.

An efficient synthesis of tetramic acid derivatives with extended conjugation from L-Ascorbic Acid

PubMed Central

Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

2006-01-01

Background Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L- ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. Results 5,6-O-Isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. Conclusion An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance. PMID:17147830

An efficient synthesis of tetramic acid derivatives with extended conjugation from L-ascorbic acid.

PubMed

Singh, Biswajit K; Bisht, Surendra S; Tripathi, Rama P

2006-12-06

Tetramic acids with polyenyl substituents are an important class of compounds in medicinal chemistry. Both solid and solution phase syntheses of such molecules have been reported recently. Thiolactomycin, a clinical candidate for treatment of tuberculosis has led to further explorations in this class. We have recently developed an efficient synthesis of tetramic acids derivatives from L-ascorbic acid. In continuation of this work, we have synthesised dienyl tetramic acid derivatives. 5,6-O-isopropylidene-ascorbic acid on reaction with DBU led to the formation of tetronolactonyl allyl alcohol, which on oxidation with pyridinium chlorochromate gave the respective tetranolactonyl allylic aldehydes. Wittig olefination followed by reaction of the resulting tetranolactonyl dienyl esters with different amines resulted in the respective 5-hydroxy lactams. Subsequent dehydration of the hydroxy lactams with p-toluene sulphonic acid afforded the dienyl tetramic acid derivatives. All reactions were performed at ambient temperature and the yields are good. An efficient and practical method for the synthesis of dienyl tetramic acid derivatives from inexpensive and easily accessible ascorbic acid has been developed. The compounds bear structural similarities to the tetramic acid based polyenic antibiotics and thus this method offers a new and short route for the synthesis of tetramic acid derivatives of biological significance.

Decreased mTOR signaling pathway in human idiopathic autism and in rats exposed to valproic acid.

PubMed

Nicolini, Chiara; Ahn, Younghee; Michalski, Bernadeta; Rho, Jong M; Fahnestock, Margaret

2015-01-20

The molecular mechanisms underlying autistic behaviors remain to be elucidated. Mutations in genes linked to autism adversely affect molecules regulating dendritic spine formation, function and plasticity, and some increase the mammalian target of rapamycin, mTOR, a regulator of protein synthesis at spines. Here, we investigated whether the Akt/mTOR pathway is disrupted in idiopathic autism and in rats exposed to valproic acid, an animal model exhibiting autistic-like behavior. Components of the mTOR pathway were assayed by Western blotting in postmortem fusiform gyrus samples from 11 subjects with idiopathic autism and 13 controls and in valproic acid versus saline-exposed rat neocortex. Additionally, protein levels of brain-derived neurotrophic factor receptor (TrkB) isoforms and the postsynaptic organizing molecule PSD-95 were measured in autistic versus control subjects. Full-length TrkB, PI3K, Akt, phosphorylated and total mTOR, p70S6 kinase, eIF4B and PSD-95 were reduced in autistic versus control fusiform gyrus. Similarly, phosphorylated and total Akt, mTOR and 4E-BP1 and phosphorylated S6 protein were decreased in valproic acid- versus saline-exposed rats. However, no changes in 4E-BP1 or eIF4E were found in autistic brains. In contrast to some monogenic disorders with high rates of autism, our data demonstrate down-regulation of the Akt/mTOR pathway, specifically via p70S6K/eIF4B, in idiopathic autism. These findings suggest that disruption of this pathway in either direction is widespread in autism and can have adverse consequences for synaptic function. The use of valproic acid, a histone deacetylase inhibitor, in rats successfully modeled these changes, implicating an epigenetic mechanism in these pathway disruptions.

Effect of tannic acid on the synthesis of protein and nucleic acid by rat liver

PubMed Central

Badawy, A. A.-B.; White, Audrey E.; Lathe, G. H.

1969-01-01

1. As early as 1hr. after the intraperitoneal administration of tannic acid to rats, it could be demonstrated in the liver. At 3hr. the nuclear fraction contained the largest amount of tannic acid. 2. Nuclear RNA synthesis was inhibited in vivo 2hr. after the administration of tannic acid. Induction by cortisol of tryptophan pyrrolase was 90% inhibited at 24hr. 3. Incorporation of [1-14C]leucine into protein by liver slices from treated rats was decreased by 50% after 24hr. Its incorporation into postmitochondrial supernatant from treated animals was not inhibited. Incorporation into slices and postmitochondrial supernatants were inhibited in vitro by tannic acid. 4. The sequence of events: concentration of tannic acid in nuclei, inhibition of nuclear RNA synthesis, inhibition of protein synthesis and production of necrosis, is discussed. PMID:5808319

2-Keto acids based biosynthesis pathways for renewable fuels and chemicals.

PubMed

Tashiro, Yohei; Rodriguez, Gabriel M; Atsumi, Shota

2015-03-01

Global energy and environmental concerns have driven the development of biological chemical production from renewable sources. Biological processes using microorganisms are efficient and have been traditionally utilized to convert biomass (i.e., glucose) to useful chemicals such as amino acids. To produce desired fuels and chemicals with high yield and rate, metabolic pathways have been enhanced and expanded with metabolic engineering and synthetic biology approaches. 2-Keto acids, which are key intermediates in amino acid biosynthesis, can be converted to a wide range of chemicals. 2-Keto acid pathways were engineered in previous research efforts and these studies demonstrated that 2-keto acid pathways have high potential for novel metabolic routes with high productivity. In this review, we discuss recently developed 2-keto acid-based pathways.

Heterologous pathway assembly reveals molecular steps of fungal terreic acid biosynthesis.

PubMed

Kong, Chuixing; Huang, Hezhou; Xue, Ying; Liu, Yiqi; Peng, Qiangqiang; Liu, Qi; Xu, Qin; Zhu, Qiaoyun; Yin, Ying; Zhou, Xiangshan; Zhang, Yuanxing; Cai, Menghao

2018-02-01

Terreic acid is a potential anticancer drug as it inhibits Bruton's tyrosine kinase; however, its biosynthetic molecular steps remain unclear. In this work, the individual reactions of terreic acid biosynthesis were determined by stepwise pathway assembly in a heterologous host, Pichia pastoris, on the basis of previous knockout studies in a native host, Aspergillus terreus. Polyketide synthase AtX was found to catalyze the formation of partially reduced polyketide 6-methylsalicylic acid, followed by 3-methylcatechol synthesis by salicylate 1-monooxygenase AtA-mediated decarboxylative hydroxylation of 6-methylsalicylic acid. Our results show that cytochrome P450 monooxygenase AtE hydroxylates 3-methylcatechol, thus producing the next product, 3-methyl-1,2,4-benzenetriol. A smaller putative cytochrome P450 monooxygenase, AtG, assists with this step. Then, AtD causes epoxidation and hydroxyl oxidation of 3-methyl-1,2,4-benzenetriol and produces a compound terremutin, via which the previously unknown function of AtD was identified as cyclooxygenation. The final step involves an oxidation reaction of a hydroxyl group by a glucose-methanol-choline oxidoreductase, AtC, which leads to the final product: terreic acid. Functions of AtD and AtG were determined for the first time. All the genes were reanalyzed and all intermediates and final products were isolated and identified. Our model fully defines the molecular steps and corrects previous results from the literature.

Nucleic acid and nucleotide-mediated synthesis of inorganic nanoparticles

NASA Astrophysics Data System (ADS)

Berti, Lorenzo; Burley, Glenn A.

2008-02-01

Since the advent of practical methods for achieving DNA metallization, the use of nucleic acids as templates for the synthesis of inorganic nanoparticles (NPs) has become an active area of study. It is now widely recognized that nucleic acids have the ability to control the growth and morphology of inorganic NPs. These biopolymers are particularly appealing as templating agents as their ease of synthesis in conjunction with the possibility of screening nucleotide composition, sequence and length, provides the means to modulate the physico-chemical properties of the resulting NPs. Several synthetic procedures leading to NPs with interesting photophysical properties as well as studies aimed at rationalizing the mechanism of nucleic acid-templated NP synthesis are now being reported. This progress article will outline the current understanding of the nucleic acid-templated process and provides an up to date reference in this nascent field.

Leucine-Enriched Essential Amino Acids Augment Mixed Protein Synthesis, But Not Collagen Protein Synthesis, in Rat Skeletal Muscle after Downhill Running

PubMed Central

Kato, Hiroyuki; Suzuki, Hiromi; Inoue, Yoshiko; Suzuki, Katsuya; Kobayashi, Hisamine

2016-01-01

Mixed and collagen protein synthesis is elevated for as many as 3 days following exercise. Immediately after exercise, enhanced amino acid availability increases synthesis of mixed muscle protein, but not muscle collagen protein. However, the potential for synergic effects of amino acid ingestion with exercise on both mixed and collagen protein synthesis remains unclear. We investigated muscle collagen protein synthesis in rats following post-exercise ingestion of leucine-enriched essential amino acids. We determined fractional protein synthesis rates (FSR) at different time points following exercise. Mixed protein and collagen protein FSRs in skeletal muscle were determined by measuring protein-bound enrichments of hydroxyproline and proline, and by measuring the intracellular enrichment of proline, using injections of flooding d3-proline doses. A leucine-enriched mixture of essential amino acids (or distilled water as a control) was administrated 30 min or 1 day post-exercise. The collagen protein synthesis in the vastus lateralis was elevated for 2 days after exercise. Although amino acid administration did not increase muscle collagen protein synthesis, it did lead to augmented mixed muscle protein synthesis 1 day following exercise. Thus, contrary to the regulation of mixed muscle protein synthesis, muscle collagen protein synthesis is not affected by amino acid availability after damage-inducing exercise. PMID:27367725

Inhibition of Melanogenesis by Gallic Acid: Possible Involvement of the PI3K/Akt, MEK/ERK and Wnt/β-Catenin Signaling Pathways in B16F10 Cells

PubMed Central

Su, Tzu-Rong; Lin, Jen-Jie; Tsai, Chi-Chu; Huang, Tsu-Kei; Yang, Zih-Yan; Wu, Ming-O; Zheng, Yu-Qing; Su, Ching-Chyuan; Wu, Yu-Jen

2013-01-01

Gallic acid is one of the major flavonoids found in plants. It acts as an antioxidant, and seems to have anti-inflammatory, anti-viral, and anti-cancer properties. In this study, we investigated the effects of gallic acid on melanogenesis, including the activation of melanogenesis signaling pathways. Gallic acid significantly inhibited both melanin synthesis and tyrosinase activity in a dose- and time-dependent manner, and decreased the expression of melanogenesis-related proteins, such as microphthalmia-associated transcription factor (MITF), tyrosinase, tyrosinase-related protein-1 (TRP1), and dopachrome tautomerase (Dct). In addition, gallic acid also acts by phosphorylating and activating melanogenesis inhibitory proteins such as Akt and mitogen-activated protein kinase (MEK)/extracellular signal-regulated kinase (ERK). Using inhibitors against PI3K/Akt (LY294002) or MEK/ERK-specific (PD98059), the hypopigmentation effect was suppressed, and the gallic acid-initiated activation of MEK/ERK and PI3K/Akt was also revoked. Gallic acid also increased GSK3β and p-β-catenin expression but down-regulated p-GSK3β. Moreover, GSK3β-specific inhibitor (SB216763) restored gallic acid-induced melanin reduction. These results suggest that activation of the MEK/ERK, PI3K/Akt, and inhibition of Wnt/β-catenin signaling pathways is involved in the melanogenesis signaling cascade, and that activation by gallic acid reduces melanin synthesis via down-regulation of MITF and its downstream signaling pathway. In conclusion, gallic acid may be a potentially agent for the treatment of certain skin conditions. PMID:24129178

Synthesis, physicochemical properties, and biological activity of bile acids 3-glucuronides: Novel insights into bile acid signalling and detoxification.

PubMed

Mostarda, Serena; Passeri, Daniela; Carotti, Andrea; Cerra, Bruno; Colliva, Carolina; Benicchi, Tiziana; Macchiarulo, Antonio; Pellicciari, Roberto; Gioiello, Antimo

2018-01-20

Glucuronidation is considered an important detoxification pathway of bile acids especially in cholestatic conditions. Glucuronides are less toxic than the parent free forms and are more easily excreted in urine. However, the pathophysiological significance of bile acid glucuronidation is still controversial and debated among the scientific community. Progress in this field has been strongly limited by the lack of appropriate methods for the preparation of pure glucuronides in the amount needed for biological and pharmacological studies. In this work, we have developed a new synthesis of bile acid C3-glucuronides enabling the convenient preparation of gram-scale quantities. The synthesized compounds have been characterized in terms of physicochemical properties and abilities to modulate key nuclear receptors including the farnesoid X receptor (FXR). In particular, we found that C3-glucuronides of chenodeoxycholic acid and lithocholic acid, respectively the most abundant and potentially cytotoxic species formed in patients affected by cholestasis, behave as FXR agonists and positively regulate the gene expression of transporter proteins, the function of which is critical in human conditions related to imbalances of bile acid homeostasis. Copyright © 2017 Elsevier Masson SAS. All rights reserved.

Amino Acid Sensing in Skeletal Muscle

PubMed Central

Moro, Tatiana; Ebert, Scott M.; Adams, Christopher M.; Rasmussen, Blake B.

2016-01-01

Aging impairs skeletal muscle protein synthesis, leading to muscle weakness and atrophy. However, the underlying molecular mechanisms remain poorly understood. Here, we review evidence that mTORC1- and ATF4-mediated amino acid sensing pathways, triggered by impaired amino acid delivery to aged skeletal muscle, may play important roles in skeletal muscle aging. Interventions that alleviate age-related impairments in muscle protein synthesis, strength and/or muscle mass appear to do so by reversing age-related changes in skeletal muscle amino acid delivery, mTORC1 activity and/or ATF4 activity. An improved understanding of the mechanisms and roles of amino acid sensing pathways in skeletal muscle may lead to evidence-based strategies to attenuate sarcopenia. PMID:27444066

The spark discharge synthesis of amino acids from various hydrocarbons

NASA Technical Reports Server (NTRS)

Ring, D.; Miller, S. L.

1984-01-01

The spark discharge synthesis of amino acids using an atmosphere of CH4+N2+H2O+NH3 has been investigated with variable pNH3. The amino acids produced using higher hydrocarbons (ethane, ethylene, acetylene, propane, butane, and isobutane) instead of CH4 were also investigated. There was considerable range in the absolute yields of amino acids, but the yields relative to glycine (or alpha-amino-n-butyric acid) were more uniform. The relative yields of the C3 to C6 aliphatic alpha-amino acids are nearly the same (with a few exceptions) with all the hydrocarbons. The glycine yields are more variable. The precursors to the C3-C6 aliphatic amino acids seem to be produced in the same process, which is separate from the synthesis of glycine precursors. It may be possible to use these relative yields as a signature for a spark discharge synthesis provided corrections can be made for subsequent decomposition events (e.g. in the Murchison meteorite).

Aberrant Synthesis of Indole-3-Acetic Acid in Saccharomyces cerevisiae Triggers Morphogenic Transition, a Virulence Trait of Pathogenic Fungi

PubMed Central

Rao, Reeta Prusty; Hunter, Ally; Kashpur, Olga; Normanly, Jennifer

2010-01-01

Many plant-associated microbes synthesize the auxin indole-3-acetic acid (IAA), and several IAA biosynthetic pathways have been identified in microbes and plants. Saccharomyces cerevisiae has previously been shown to respond to IAA by inducing pseudohyphal growth. We observed that IAA also induced hyphal growth in the human pathogen Candida albicans and thus may function as a secondary metabolite signal that regulates virulence traits such as hyphal transition in pathogenic fungi. Aldehyde dehydrogenase (Ald) is required for IAA synthesis from a tryptophan (Trp) precursor in Ustilago maydis. Mutant S. cerevisiae with deletions in two ALD genes are unable to convert radiolabeled Trp to IAA, yet produce IAA in the absence of exogenous Trp and at levels higher than wild type. These data suggest that yeast may have multiple pathways for IAA synthesis, one of which is not dependent on Trp. PMID:20233857

Synthesis of L-ascorbic acid in the phloem

PubMed Central

Hancock, Robert D; McRae, Diane; Haupt, Sophie; Viola, Roberto

2003-01-01

Background Although plants are the main source of vitamin C in the human diet, we still have a limited understanding of how plants synthesise L-ascorbic acid (AsA) and what regulates its concentration in different plant tissues. In particular, the enormous variability in the vitamin C content of storage organs from different plants remains unexplained. Possible sources of AsA in plant storage organs include in situ synthesis and long-distance transport of AsA synthesised in other tissues via the phloem. In this paper we examine a third possibility, that of synthesis within the phloem. Results We provide evidence for the presence of AsA in the phloem sap of a wide range of crop species using aphid stylectomy and histochemical approaches. The activity of almost all the enzymes of the primary AsA biosynthetic pathway were detected in phloem-rich vascular exudates from Cucurbita pepo fruits and AsA biosynthesis was demonstrated in isolated phloem strands from Apium graveolens petioles incubated with a range of precursors (D-glucose, D-mannose, L-galactose and L-galactono-1,4-lactone). Phloem uptake of D-[U-14C]mannose and L-[1-14C]galactose (intermediates of the AsA biosynthetic pathway) as well as L-[1-14C]AsA and L-[1-14C]DHA, was observed in Nicotiana benthamiana leaf discs. Conclusions We present the novel finding that active AsA biosynthesis occurs in the phloem. This process must now be considered in the context of mechanisms implicated in whole plant AsA distribution. This work should provoke studies aimed at elucidation of the in vivo substrates for phloem AsA biosynthesis and its contribution to AsA accumulation in plant storage organs. PMID:14633288

Synthesis of alpha-amino acids

DOEpatents

Davis, Jr., Jefferson W.

1983-01-01

A method for synthesizing alpha amino acids proceding through novel intermediates of the formulas: R.sub.1 R.sub.2 C(OSOCl)CN, R.sub.1 R.sub.2 C(Cl)CN and [R.sub.1 R.sub.2 C(CN)O].sub.2 SO wherein R.sub.1 and R.sub.2 are each selected from hydrogen monovalent substituted and unsubstituted hydrocarbon radicals of 1 to 10 carbon atoms. The use of these intermediates allows the synthesis steps to be exothermic and results in an overall synthesis method which is faster than the snythesis methods of the prior art.

Bacterial synthesis of N-hydroxycinnamoyl phenethylamines and tyramines.

PubMed

Sim, Geun Young; Yang, So-Mi; Kim, Bong Gyu; Ahn, Joong-Hoon

2015-10-13

Hydroxycinnamic acids (HCAs) including cinnamic acid, p-coumaric acid, caffeic acid, and ferulic acid, are C6-C3 phenolic compounds that are synthesized via the phenylpropanoid pathway. HCAs serve as precursors for the synthesis of lignins, flavonoids, anthocyanins, stilbenes and other phenolic compounds. HCAs can also be conjugated with diverse compounds including quinic acid, hydroxyl acids, and amines. Hydroxycinnamoyl (HC) amine conjugates such as N-HC tyramines and N-HC phenethylamines have been considered as potential starting materials to develop antiviral and anticancer drugs. We synthesized N-HC tyramines and N-HC phenethylamines using three different approaches in Escherichia coli. Five N-HC phenethylamines and eight N-HC tyramines were synthesized by feeding HCAs and phenethylamine or tyramine to E. coli harboring 4CL (encoding 4-coumarate CoA:ligase) and either SHT (encoding phenethylamine N-HC transferase) or THT (encoding tyramine N-HC transferase). Also, N-(p-coumaroyl) phenethylamine and N-(p-coumaroyl) tyramine were synthesized from p-coumaric acid using E. coli harboring an additional gene, PDC (encoding phenylalanine decarboxylase) or TDC (encoding tyrosine decarboxylase). Finally, we synthesized N-(p-coumaroyl) phenethylamine and N-(p-coumaroyl) tyramine from glucose by reconstructing the metabolic pathways for their synthesis in E. coli. Productivity was maximized by optimizing the cell concentration and incubation temperature. We reconstructed the metabolic pathways for synthesis of N-HC tyramines and N-HC phenethylamines by expressing several genes including 4CL, TST or SHT, PDC or TDC, and TAL (encoding tyrosine ammonia lyase) and engineering the shikimate metabolic pathway to increase endogenous tyrosine concentration in E. coli. Approximately 101.9 mg/L N-(p-coumaroyl) phenethylamine and 495.4 mg/L N-(p-coumaroyl) tyramine were synthesized from p-coumaric acid. Furthermore, 152.5 mg/L N-(p-coumaroyl) phenethylamine and 94.7 mg/L N

Cinnamic acid 4-hydroxylase of sorghum [Sorghum biocolor (L.) Moench] gene SbC4H1 restricts lignin synthesis in Arabidopsis

USDA-ARS?s Scientific Manuscript database

Cinnamic acid 4-hydroxylase (C4H) is the first hydroxylase enzyme of the phenylpropanoid pathway, and its content and activity affects the lignin synthesis. In this study, we isolated a C4H gene SbC4H1 from the suppression subtractive hybridization library of brown midrib (bmr) mutants of Sorghum b...

Endogenous factors regulating poor-nutrition stress-induced flowering in pharbitis: The involvement of metabolic pathways regulated by aminooxyacetic acid.

PubMed

Koshio, Aya; Hasegawa, Tomomi; Okada, Rieko; Takeno, Kiyotoshi

2015-01-15

The short-day plant pharbitis (also called Japanese morning glory), Ipomoea nil (formerly Pharbitis nil), was induced to flower by poor-nutrition stress. This stress-induced flowering was inhibited by aminooxyacetic acid (AOA), which is a known inhibitor of phenylalanine ammonia-lyase (PAL) and the synthesis of indole-3-acetic acid (IAA) and 1-aminocycropropane-1-carboxylic acid (ACC) and thus regulates endogenous levels of salicylic acid (SA), IAA and polyamine (PA). Stress treatment increased PAL activity in cotyledons, and AOA suppressed this increase. The observed PAL activity and flowering response correlate positively, indicating that AOA functions as a PAL inhibitor. The inhibition of stress-induced flowering by AOA was also overcome by IAA. An antiauxin, 4-chlorophenoxy isobutyric acid, inhibited stress-induced flowering. Both SA and IAA promoted flowering induced by stress. PA also promoted flowering, and the effective PA was found to be putrescine (Put). These results suggest that all of the pathways leading to the synthesis of SA, IAA and Put are responsive to the flowering inhibition by AOA and that these endogenous factors may be involved in the regulation of stress-induced flowering. However, as none of them induced flowering under non-stress conditions, they may function cooperatively to promote flowering. Copyright © 2014 Elsevier GmbH. All rights reserved.

Distribution, industrial applications, and enzymatic synthesis of D-amino acids.

PubMed

Gao, Xiuzhen; Ma, Qinyuan; Zhu, Hailiang

2015-04-01

D-Amino acids exist widely in microbes, plants, animals, and food and can be applied in pharmaceutical, food, and cosmetics. Because of their widespread applications in industry, D-amino acids have recently received more and more attention. Enzymes including D-hydantoinase, N-acyl-D-amino acid amidohydrolase, D-amino acid amidase, D-aminopeptidase, D-peptidase, L-amino acid oxidase, D-amino acid aminotransferase, and D-amino acid dehydrogenase can be used for D-amino acids synthesis by kinetic resolution or asymmetric amination. In this review, the distribution, industrial applications, and enzymatic synthesis methods are summarized. And, among all the current enzymatic methods, D-amino acid dehydrogenase method not only produces D-amino acid by a one-step reaction but also takes environment and atom economics into consideration; therefore, it is deserved to be paid more attention.

TOFA (5-tetradecyl-oxy-2-furoic acid) reduces fatty acid synthesis, inhibits expression of AR, neuropilin-1 and Mcl-1 and kills prostate cancer cells independent of p53 status.

PubMed

Guseva, Natalya V; Rokhlin, Oskar W; Glover, Rebecca A; Cohen, Michael B

2011-07-01

A key player in prostate cancer development and progression is the androgen receptor (AR). Tumor-associated lipogenesis can protect cancer cells from carcinogenic- and therapeutic-associated treatments. Increased synthesis of fatty acids and cholesterol is regulated by androgens through induction of several genes in androgen-responsive cancer cells. Acetyl-CoA-carboxylase-α (ACCA) is a key enzyme in the regulation of fatty acids synthesis. Here we show that AR binds in vivo to intron regions of human ACCA gene. We also show that the level of ACCA protein in LNCaP depends on AR expression and that DHT treatment increases ACCA expression and fatty acid synthesis. Inhibition of ACCA by TOFA (5-tetradecyl-oxy-2-furoic acid) decreases fatty acid synthesis and induces caspase activation and cell death in most PCa cell lines. Our data suggest that TOFA can kill cells via the mitochondrial pathway since we found cytochrome c release after TOFA treatment in androgen sensitive cell lines. The results also imply that the pro-apoptotic effect of TOFA may be mediated via a decrease of neuropilin-1(NRP1) and Mcl-1expression. We have previously reported that Mcl-1 is under AR regulation and plays an important role in resistance to drug-induced apoptosis in prostate cancer cells, and NRP1 is known to regulate Mcl-1 expression. Here, we show for the first time that NRP1 expression is under AR control. Taken together, our data suggest that TOFA is a potent cell death inducing agent in prostate cancer cells.

Amino acids trigger down-regulation of superoxide via TORC pathway in the midgut of Rhodnius prolixus

PubMed Central

Gandara, Ana Caroline P.; Oliveira, José Henrique M.; Nunes, Rodrigo D.; Goncalves, Renata L.S.; Dias, Felipe A.; Hecht, Fabio; Fernandes, Denise C.; Genta, Fernando A.; Laurindo, Francisco R.M.; Oliveira, Marcus F.; Oliveira, Pedro L.

2016-01-01

Sensing incoming nutrients is an important and critical event for intestinal cells to sustain life of the whole organism. The TORC is a major protein complex involved in monitoring the nutritional status and is activated by elevated amino acid concentrations. An important feature of haematophagy is that huge amounts of blood are ingested in a single meal, which results in the release of large quantities of amino acids, together with the haemoglobin prosthetic group, haem, which decomposes hydroperoxides and propagates oxygen-derived free radicals. Our previous studies demonstrated that reactive oxygen species (ROS) levels were diminished in the mitochondria and midgut of the Dengue fever mosquito, Aedes aegypti, immediately after a blood meal. We proposed that this mechanism serves to avoid oxidative damage that would otherwise be induced by haem following a blood meal. Studies also performed in mosquitoes have shown that blood or amino acids controls protein synthesis through TORC activation. It was already proposed, in different models, a link between ROS and TOR, however, little is known about TOR signalling in insect midgut nor about the involvement of ROS in this pathway. Here, we studied the effect of a blood meal on ROS production in the midgut of Rhodnius prolixus. We observed that blood meal amino acids decreased ROS levels in the R. prolixus midgut immediately after feeding, via lowering mitochondrial superoxide production and involving the amino acid-sensing TORC pathway. PMID:26945025

Age-related changes in cyclic phosphatidic acid-induced hyaluronic acid synthesis in human fibroblasts.

PubMed

Sano, Katsura; Gotoh, Mari; Dodo, Kyoko; Tajima, Noriaki; Shimizu, Yoshibumi; Murakami-Murofushi, Kimiko

2018-01-01

Hyaluronic acid is a major component of the extracellular matrix, which is important for skin hydration. As aging brings skin dehydration, we aimed to clarify the mRNA expression of hyaluronic acid-related proteins in human skin fibroblasts from donors of various ages (range 0.7-69 years). Previously, we reported that cyclic phosphatidic acid (cPA), a unique phospholipid mediator, stimulated the expression of HAS2 and increased hyaluronic acid synthesis in human skin fibroblasts (donor age: 3 days). In this study, we measured the mRNA expression of hyaluronic acid-related proteins: hyaluronan synthase (HAS) 1-3, hyaluronidase-1, -2, and hyaluronic acid-binding protein (versican). In addition, we tested whether cPA could increase hyaluronic acid synthesis in skin fibroblasts derived from donors of various ages. The expression of HAS1, 3, hyaluronidase-1, and -2 did not change with aging. However, the mRNA expression of versican decreased with aging. Although it is thought that the amount of hyaluronic acid in the dermis decreases with aging, the mRNA expression of HAS2 was increased. But the amount of hyaluronic acid secreted by fibroblasts did not increase with aging. This suggests that the activity and/or protein expression of HAS2 decrease with aging. Furthermore, we observed that cPA caused the increase of hyaluronic acid synthesis at any age, and this effect was increased with aging. These results suggest that aging made the fibroblasts more sensitive to cPA treatment. Therefore, cPA represents a suitable candidate for the health maintenance and improvement of the skin by increasing the level of hyaluronic acid in the dermis.

Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

DOE Office of Scientific and Technical Information (OSTI.GOV)

Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.

Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

Molecular Genetic Characterization of Terreic Acid Pathway in Aspergillus terreus

DOE PAGES

Guo, Chun-Jun; Sun, Wei-wen; Bruno, Kenneth S.; ...

2014-09-29

Terreic acid is a natural product derived from 6-methylsalicylic acid (6-MSA). A compact gene cluster for its biosynthesis was characterized. Isolation of the intermediates and shunt products from the mutant strains, in combined with bioinformatic analyses, allowed us to propose a biosynthetic pathway for terreic acid. Lastly, defining the pathway and the genes involved will facilitate the engineering of this molecule with interesting antimicrobial and antitumor bioactivities.

Derivatives of diphosphonic acids: synthesis and biological activity

NASA Astrophysics Data System (ADS)

Zolotukhina, M. M.; Krutikov, V. I.; Lavrent'ev, A. N.

1993-07-01

The scientific-technical and patent literature on the synthesis of derivatives of diphosphonic acids is surveyed. Various methods of synthesis of diphosphonate, phosphonylphosphinyl, and phosphonophosphate compounds are described. The principal aspects of the use of the above compounds in medicine, biochemistry, and agriculture are examined. The bibliography includes 174 references.

Analysis of porcine adipose tissue transcriptome reveals differences in de novo fatty acid synthesis in pigs with divergent muscle fatty acid composition.

PubMed

Corominas, Jordi; Ramayo-Caldas, Yuliaxis; Puig-Oliveras, Anna; Estellé, Jordi; Castelló, Anna; Alves, Estefania; Pena, Ramona N; Ballester, Maria; Folch, Josep M

2013-12-01

In pigs, adipose tissue is one of the principal organs involved in the regulation of lipid metabolism. It is particularly involved in the overall fatty acid synthesis with consequences in other lipid-target organs such as muscles and the liver. With this in mind, we have used massive, parallel high-throughput sequencing technologies to characterize the porcine adipose tissue transcriptome architecture in six Iberian x Landrace crossbred pigs showing extreme phenotypes for intramuscular fatty acid composition (three per group). High-throughput RNA sequencing was used to generate a whole characterization of adipose tissue (backfat) transcriptome. A total of 4,130 putative unannotated protein-coding sequences were identified in the 20% of reads which mapped in intergenic regions. Furthermore, 36% of the unmapped reads were represented by interspersed repeats, SINEs being the most abundant elements. Differential expression analyses identified 396 candidate genes among divergent animals for intramuscular fatty acid composition. Sixty-two percent of these genes (247/396) presented higher expression in the group of pigs with higher content of intramuscular SFA and MUFA, while the remaining 149 showed higher expression in the group with higher content of PUFA. Pathway analysis related these genes to biological functions and canonical pathways controlling lipid and fatty acid metabolisms. In concordance with the phenotypic classification of animals, the major metabolic pathway differentially modulated between groups was de novo lipogenesis, the group with more PUFA being the one that showed lower expression of lipogenic genes. These results will help in the identification of genetic variants at loci that affect fatty acid composition traits. The implications of these results range from the improvement of porcine meat quality traits to the application of the pig as an animal model of human metabolic diseases.

Glycolysis, Glutaminolysis, and Fatty Acid Synthesis Are Required for Distinct Stages of Kaposi's Sarcoma-Associated Herpesvirus Lytic Replication.

PubMed

Sanchez, Erica L; Pulliam, Thomas H; Dimaio, Terri A; Thalhofer, Angel B; Delgado, Tracie; Lagunoff, Michael

2017-05-15

Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation. Our

Glycolysis, Glutaminolysis, and Fatty Acid Synthesis Are Required for Distinct Stages of Kaposi's Sarcoma-Associated Herpesvirus Lytic Replication

PubMed Central

Sanchez, Erica L.; Pulliam, Thomas H.; Dimaio, Terri A.; Thalhofer, Angel B.; Delgado, Tracie

2017-01-01

ABSTRACT Kaposi's sarcoma-associated herpesvirus (KSHV) is the etiologic agent of Kaposi's sarcoma (KS). KSHV infection induces and requires multiple metabolic pathways, including the glycolysis, glutaminolysis, and fatty acid synthesis (FAS) pathways, for the survival of latently infected endothelial cells. To determine the metabolic requirements for productive KSHV infection, we induced lytic replication in the presence of inhibitors of different metabolic pathways. We found that glycolysis, glutaminolysis, and FAS are all required for maximal KSHV virus production and that these pathways appear to participate in virus production at different stages of the viral life cycle. Glycolysis and glutaminolysis, but not FAS, inhibit viral genome replication and, interestingly, are required for different early steps of lytic gene expression. Glycolysis is necessary for early gene transcription, while glutaminolysis is necessary for early gene translation but not transcription. Inhibition of FAS resulted in decreased production of extracellular virions but did not reduce intracellular genome levels or block intracellular virion production. However, in the presence of FAS inhibitors, the intracellular virions are noninfectious, indicating that FAS is required for virion assembly or maturation. KS tumors support both latent and lytic KSHV replication. Previous work has shown that multiple cellular metabolic pathways are required for latency, and we now show that these metabolic pathways are required for efficient lytic replication, providing novel therapeutic avenues for KS tumors. IMPORTANCE KSHV is the etiologic agent of Kaposi's sarcoma, the most common tumor of AIDS patients. KS spindle cells, the main tumor cells, all contain KSHV, mostly in the latent state, during which there is limited viral gene expression. However, a percentage of spindle cells support lytic replication and production of virus and these cells are thought to contribute to overall tumor formation

Abiotic synthesis of fatty acids

NASA Technical Reports Server (NTRS)

Leach, W. W.; Nooner, D. W.; Oro, J.

1978-01-01

The formation of fatty acids by Fischer-Tropsch-type synthesis was investigated with ferric oxide, ammonium carbonate, potassium carbonate, powdered Pueblito de Allende carbonaceous chondrite, and filings from the Canyon Diablo meteorite used as catalysts. Products were separated and identified by gas chromatography and mass spectrometry. Iron oxide, Pueblito de Allende chondrite, and Canyon Diablo filings in an oxidized catalyst form yielded no fatty acids. Canyon Diablo filings heated overnight at 500 C while undergoing slow purging by deuterium produced fatty acids only when potassium carbonate was admixed; potassium carbonate alone also produced these compounds. The active catalytic combinations gave relatively high yields of aliphatic and aromatic hydrocarbons; substantial amounts of n-alkenes were almost invariably observed when fatty acids were produced; the latter were in the range C6 to C18, with maximum yield in C9 or 10.

Effects of exogenous fatty acids and inhibition of de novo fatty acid synthesis on disaturated phosphatidylcholine production by fetal lung cells and adult type II cells.

PubMed

Maniscalco, W M; Finkelstein, J N; Parkhurst, A B

1989-05-01

De novo fatty acid synthesis may be an important source of saturated fatty acids for fetal lung disaturated phosphatidylcholine (DSPC) production. To investigate the roles of de novo fatty acid synthesis and exogenous fatty acids, we incubated dispersed fetal lung cells and freshly isolated adult type II cells with exogenous palmitate and oleate and measured DSPC synthesis. Unlike adult type II cells, fetal lung cells did not increase DSPC synthesis when exogenous palmitate was available; adult type II cells increased DSPC synthesis by 70% in the presence of palmitate. Exogenous oleate decreased DSPC synthesis by 48% in fetal cells but not in adult type II cells. Incubation of fetal lung cells with TOFA [2-furancarboxylate, 5-(tetradecyloxy)-sodium], a metabolic inhibitor of fatty acid synthesis, decreased fatty acid synthesis by 65%. There was a simultaneous 56% inhibition of DSPC production, but no effect on protein, DNA, or glyceride-glycerol production, measured by precursor incorporation. The inhibition of DSPC synthesis associated with TOFA was partially prevented by exogenous palmitate but not oleate. Fetal cells prepared from explants that had been cultured in dexamethasone also had TOFA-associated inhibition of DSPC synthesis that was similar to non-dexamethasone-exposed cells. These studies suggest that under baseline conditions of low fatty acid availability, such as in the fetus, de novo fatty acid synthesis in fetal cells, but not in adult type II cells, provides sufficient saturated fatty acids to support maximal DSPC production. Inhibition of de novo fatty acid synthesis resulting in decreased DSPC production in fetal lung cells in conditions of low fatty acid availability suggests that fatty acid synthesis may be central to maintain DSPC synthesis in the fetus.

Upregulation of capacity for glutathione synthesis in response to amino acid deprivation: regulation of glutamate-cysteine ligase subunits

PubMed Central

Sikalidis, Angelos K.; Mazor, Kevin M.; Lee, Jeong-In; Roman, Heather B.; Hirschberger, Lawrence L.; Stipanuk, Martha H.

2014-01-01

Using HepG2/C3A cells and MEFs, we investigated whether induction of GSH synthesis in response to sulfur amino acid deficiency is mediated by the decrease in cysteine levels or whether it requires a decrease in GSH levels per se. Both the glutamate-cysteine ligase catalytic (GCLC) and modifier (GCLM) subunit mRNA levels were upregulated in response to a lack of cysteine or other essential amino acids, independent of GSH levels. This upregulation did not occur in MEFs lacking GCN2 (general control non-derepressible 2, also known as eIF2α kinase 4) or in cells expressing mutant eIF2α lacking the eIF2α kinase Ser51 phosphorylation site, indicating that expression of both GCLC and GCLM was mediated by the GCN2/ATF4 stress response pathway. Only the increase in GCLM mRNA level, however, was accompanied by a parallel increase in protein expression, suggesting that the enhanced capacity for GSH synthesis depended largely on increased association of GCLC with its regulatory subunit. Upregulation of both GCLC and GLCM mRNA levels in response to cysteine deprivation was dependent on new protein synthesis, which is consistent with expression of GCLC and GCLM being mediated by proteins whose synthesis depends on activation of the GCN2/ATF4 pathway. Our data suggest that the regulation of GCLC expression may be mediated by changes in the abundance of transcriptional regulators, whereas the regulation of GCLM expression may be mediated by changes in the abundance of mRNA stabilizing or destabilizing proteins. Upregulation of GCLM levels in response to low cysteine levels may serve to protect the cell in the face of a future stress requiring GSH as an antioxidant or conjugating/detoxifying agent. PMID:24557597

Carbon isotopic patterns of amino acids associated with various microbial metabolic pathways and physiological conditions

NASA Astrophysics Data System (ADS)

Wang, P. L.; Hsiao, K. T.; Lin, L. H.

2017-12-01

Amino acids represent one of the most important categories of biomolecule. Their abundance and isotopic patterns have been broadly used to address issues related to biochemical processes and elemental cycling in natural environments. Previous studies have shown that various carbon assimilative pathways of microorganisms (e.g. autotrophy, heterotrophy and acetotrophy) could be distinguished by carbon isotopic patterns of amino acids. However, the taxonomic and catabolic coverage are limited in previous examination. This study aims to uncover the carbon isotopic patterns of amino acids for microorganisms remaining uncharacterized but bearing biogeochemical and ecological significance in anoxic environments. To fulfill the purpose, two anaerobic strains were isolated from riverine wetland and mud volcano in Taiwan. One strain is a sulfate reducing bacterium (related to Desulfovibrio marrakechensis), which is capable of utilizing either H2 or lactate, and the other is a methanogen (related to Methanolobus profundi), which grows solely with methyl-group compounds. Carbon isotope analyses of amino acids were performed on cells grown in exponential and stationary phase. The isotopic patterns were similar for all examined cultures, showing successive 13C depletion along synthetic pathways. No significant difference was observed for the methanogen and lactate-utilizing sulfate reducer harvested in exponential and stationary phases. In contrast, the H2-utilizing sulfate reducer harvested in stationary phase depleted and enriched 13C in aspartic acid and glycine, respectively when compared with that harvested in exponential phase. Such variations might infer the change of carbon flux during synthesis of these two amino acids in the reverse TCA cycle. In addition, the discriminant function analysis for all available data from culture studies further attests the capability of using carbon isotope patterns of amino acids in identifying microbial metabolisms.

Quantitative importance of the 25-hydroxylation pathway for bile acid biosynthesis in the rat

DOE Office of Scientific and Technical Information (OSTI.GOV)

Duane, W.C.; Bjoerkhem, I.H.; Hamilton, J.N.

1988-05-01

During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. In the present study, we have quantitated the relative importance of these two pathways in vivo by measuring production of (14C) acetone from (14C)-26-cholesterol. Four days after intraperitoneal injection of 20 to 40 muCi (14C)-26-cholesterol and 1 day after beginning a constant intravenous infusion of unlabeled acetone at 25 mumolesmore » per kg per min, 6 male and 2 female Sprague-Dawley rats underwent breath collections. Expired acetone was trapped and purified as the 2,4-dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied times the acetone infusion rate to calculate production of (14C)acetone. (14C) Acetone production averaged 1.7% of total release of 14C from (14C)-26-cholesterol, estimated by 14CO2 output. The method was validated by showing that (14C) acetone production from (14C)isopropanol averaged 111% of the (14C)isopropanol infusion rate. We conclude that, in the normal rat, the 25-hydroxylation pathway accounts for less than 2% of bile acid synthesis.« less

Quantitative importance of the 25-hydroxylation pathway for bile acid biosynthesis in the rat.

PubMed

Duane, W C; Björkhem, I; Hamilton, J N; Mueller, S M

1988-01-01

During biosynthesis of bile acid, carbons 25-26-27 are removed from the cholesterol side chain. Side-chain oxidation begins either with hydroxylation at the 26-position, in which case the three-carbon fragment is released as propionic acid, or with hydroxylation at the 25-position, in which case the three-carbon fragment is released as acetone. In the present study, we have quantitated the relative importance of these two pathways in vivo by measuring production of [14C] acetone from [14C]-26-cholesterol. Four days after intraperitoneal injection of 20 to 40 muCi [14C]-26-cholesterol and 1 day after beginning a constant intravenous infusion of unlabeled acetone at 25 mumoles per kg per min, 6 male and 2 female Sprague-Dawley rats underwent breath collections. Expired acetone was trapped and purified as the 2,4-dinitrophenylhydrazine derivative. 14CO2 was trapped quantitatively using phenethylamine. Specific activity of breath acetone was multiplied times the acetone infusion rate to calculate production of [14C]acetone. [14C] Acetone production averaged 1.7% of total release of 14C from [14C]-26-cholesterol, estimated by 14CO2 output. The method was validated by showing that [14C] acetone production from [14C]isopropanol averaged 111% of the [14C]isopropanol infusion rate. We conclude that, in the normal rat, the 25-hydroxylation pathway accounts for less than 2% of bile acid synthesis.

Enzymatic routes for the synthesis of ursodeoxycholic acid.

PubMed

Eggert, Thorsten; Bakonyi, Daniel; Hummel, Werner

2014-12-10

Ursodeoxycholic acid, a secondary bile acid, is used as a drug for the treatment of various liver diseases, the optimal dose comprises the range of 8-10mg/kg/day. For industrial syntheses, the structural complexity of this bile acid requires the use of an appropriate starting material as well as the application of regio- and enantio-selective enzymes for its derivatization. Most strategies for the synthesis start from cholic acid or chenodeoxycholic acid. The latter requires the conversion of the hydroxyl group at C-7 from α- into β-position in order to obtain ursodeoxycholic acid. Cholic acid on the other hand does not only require the same epimerization reaction at C-7 but the removal of the hydroxyl group at C-12 as well. There are several bacterial regio- and enantio-selective hydroxysteroid dehydrogenases (HSDHs) to carry out the desired reactions, for example 7α-HSDHs from strains of Clostridium, Bacteroides or Xanthomonas, 7β-HSDHs from Clostridium, Collinsella, or Ruminococcus, or 12α-HSDH from Clostridium or from Eggerthella. However, all these bioconversion reactions need additional steps for the regeneration of the coenzymes. Selected multi-step reaction systems for the synthesis of ursodeoxycholic acid are presented in this review. Copyright © 2014 Elsevier B.V. All rights reserved.

Fatty Acid Synthesis in Pea Root Plastids Is Inhibited by the Action of Long-Chain Acyl- Coenzyme As on Metabolite Transporters1

PubMed Central

Fox, Simon R.; Rawsthorne, Stephen; Hills, Matthew J.

2001-01-01

The uptake in vitro of glucose (Glc)-6-phosphate (Glc-6-P) into plastids from the roots of 10- to 14-d-old pea (Pisum sativum L. cv Puget) plants was inhibited by oleoyl-coenzyme A (CoA) concentrations in the low micromolar range (1–2 μm). The IC50 (the concentration of inhibitor that reduces enzyme activity by 50%) for the inhibition of Glc-6-P uptake was approximately 750 nm; inhibition was reversed by recombinant rapeseed (Brassica napus) acyl-CoA binding protein. In the presence of ATP (3 mm) and CoASH (coenzyme A; 0.3 mm), Glc-6-P uptake was inhibited by 60%, due to long-chain acyl-CoA synthesis, presumably from endogenous sources of fatty acids present in the preparations. Addition of oleoyl-CoA (1 μm) decreased carbon flux from Glc-6-P into the synthesis of starch and through the oxidative pentose phosphate (OPP) pathway by up to 73% and 40%, respectively. The incorporation of carbon from Glc-6-P into fatty acids was not detected under any conditions. Oleoyl-CoA inhibited the incorporation of acetate into fatty acids by 67%, a decrease similar to that when ATP was excluded from incubations. The oleoyl-CoA-dependent inhibition of fatty acid synthesis was attributable to a direct inhibition of the adenine nucleotide translocator by oleoyl-CoA, which indirectly reduced fatty acid synthesis by ATP deprivation. The Glc-6-P-dependent stimulation of acetate incorporation into fatty acids was reversed by the addition of oleoyl-CoA. PMID:11457976

Arginine decarboxylase (ADC) and agmatinase (AGMAT): an alternative pathway for synthesis of polyamines in pig conceptuses and uteri

USDA-ARS?s Scientific Manuscript database

Arginine, a precursor for the synthesis of nitric oxide (NO) and polyamines, is critical for implantation and development of the conceptus. We first reported that the arginine decarboxylase (ADC)/agmatinase(AGMAT) pathway as an alternative pathway for synthesis of polyamines in the ovine conceptuses...

Farnesoid X receptor induces Takeda G-protein receptor 5 cross-talk to regulate bile acid synthesis and hepatic metabolism.

PubMed

Pathak, Preeti; Liu, Hailiang; Boehme, Shannon; Xie, Cen; Krausz, Kristopher W; Gonzalez, Frank; Chiang, John Y L

2017-06-30

The bile acid-activated receptors, nuclear farnesoid X receptor (FXR) and the membrane Takeda G-protein receptor 5 (TGR5), are known to improve glucose and insulin sensitivity in obese and diabetic mice. However, the metabolic roles of these two receptors and the underlying mechanisms are incompletely understood. Here, we studied the effects of the dual FXR and TGR5 agonist INT-767 on hepatic bile acid synthesis and intestinal secretion of glucagon-like peptide-1 (GLP-1) in wild-type, Fxr -/- , and Tgr5 -/- mice. INT-767 efficaciously stimulated intracellular Ca 2+ levels, cAMP activity, and GLP-1 secretion and improved glucose and lipid metabolism more than did the FXR-selective obeticholic acid and TGR5-selective INT-777 agonists. Interestingly, INT-767 reduced expression of the genes in the classic bile acid synthesis pathway but induced those in the alternative pathway, which is consistent with decreased taurocholic acid and increased tauromuricholic acids in bile. Furthermore, FXR activation induced expression of FXR target genes, including fibroblast growth factor 15, and unexpectedly Tgr5 and prohormone convertase 1/3 gene expression in the ileum. We identified an FXR-responsive element on the Tgr5 gene promoter. Fxr -/- and Tgr5 -/- mice exhibited reduced GLP-1 secretion, which was stimulated by INT-767 in the Tgr5 -/- mice but not in the Fxr -/- mice. Our findings uncovered a novel mechanism in which INT-767 activation of FXR induces Tgr5 gene expression and increases Ca 2+ levels and cAMP activity to stimulate GLP-1 secretion and improve hepatic glucose and lipid metabolism in high-fat diet-induced obese mice. Activation of both FXR and TGR5 may therefore represent an effective therapy for managing hepatic steatosis, obesity, and diabetes. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Compound-Specific Carbon, Nitrogen, and Hydrogen Isotopic Ratios for Amino Acids in CM and CR Chondrites and their use in Evaluating Potential Formation Pathways

NASA Technical Reports Server (NTRS)

Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

2012-01-01

Stable hydrogen, carbon, and nitrogen isotopic ratios (oD, 013C, and olSN) of organic compounds can revcal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1I2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CRZ Graves Nunataks (GRA) 95229, CRZ Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing ODC and increasing oD with increasing carbon number in the aH, (l-NH2 amino acids that correspond to predictions made for formation via Streckercyanohydrin synthesis. We also observe light ODC signatures for -alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ro-amino acids). Higher deuterium enrichments are observed in amethyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than CM chondrites, reflecting different parent-body chemistry.

Inhibition of fatty acid synthesis in isolated adipocytes by 5-(tetradecyloxy)-2-furoic acid.

PubMed

Halvorson, D L; McCune, S A

1984-11-01

The compound 5-(tetradecyloxy)-2-furoic acid (TOFA), a hypolipidemic agent, inhibits fatty acid synthesis, lactate and pyruvate accumulation and CO2 release in isolated rat adipocytes. TOFA stimulates the accumulation of citrate. ATP levels are not lowered by TOFA. In comparison with the natural fatty acid, oleate, TOFA exhibited a much greater inhibitory effect on lipogenesis. TOFyl-CoA formation within intact adipocytes was demonstrated. Although not inhibited by TOFA, acetyl-CoA carboxylase is inhibited by TOFyl-CoA. It is proposed that many of the metabolic effects of TOFA in isolated adipocytes can be explained by TOFyl-CoA inhibition of acetyl-CoA carboxylase. TOFA inhibits glycolysis as a secondary event with the primary event of inhibition of fatty acid synthesis causing an accumulation of citrate which is an inhibitor of phosphofructokinase.

Glutamic Acid as Enhancer of Protein Synthesis Kinetics in Hepatocytes from Old Rats.

PubMed

Brodsky, V Y; Malchenko, L A; Butorina, N N; Lazarev Konchenko, D S; Zvezdina, N D; Dubovaya, T K

2017-08-01

Dense cultures of hepatocytes from old rats (~2 years old, body weight 530-610 g) are different from similar cultures of hepatocytes from young rats by the low amplitude of protein synthesis rhythm. Addition of glutamic acid (0.2, 0.4, or 0.6 mg/ml) into the culture medium with hepatocytes of old rats resulted in increase in the oscillation amplitudes of the protein synthesis rhythm to the level of young rats. A similar action of glutamic acid on the protein synthesis kinetics was observed in vivo after feeding old rats with glutamic acid. Inhibition of metabotropic receptors of glutamic acid with α-methyl-4-carboxyphenylglycine (0.01 mg/ml) abolished the effect of glutamic acid. The amplitude of oscillation of the protein synthesis rhythm in a cell population characterizes synchronization of individual oscillations caused by direct cell-cell communications. Hence, glutamic acid, acting as a receptor-dependent transmitter, enhanced direct cell-cell communications of hepatocytes that were decreased with aging. As differentiated from other known membrane signaling factors (gangliosides, norepinephrine, serotonin, dopamine), glutamic acid can penetrate into the brain and thus influence the communications and protein synthesis kinetics that are disturbed with aging not only in hepatocytes, but also in neurons.

Glutamic Acid - Amino Acid, Neurotransmitter, and Drug - Is Responsible for Protein Synthesis Rhythm in Hepatocyte Populations in vitro and in vivo.

PubMed

Brodsky, V Y; Malchenko, L A; Konchenko, D S; Zvezdina, N D; Dubovaya, T K

2016-08-01

Primary cultures of rat hepatocytes were studied in serum-free media. Ultradian protein synthesis rhythm was used as a marker of cell synchronization in the population. Addition of glutamic acid (0.2 mg/ml) to the medium of nonsynchronous sparse cultures resulted in detection of a common protein synthesis rhythm, hence in synchronization of the cells. The antagonist of glutamic acid metabotropic receptors MCPG (0.01 mg/ml) added together with glutamic acid abolished the synchronization effect; in sparse cultures, no rhythm was detected. Feeding rats with glutamic acid (30 mg with food) resulted in protein synthesis rhythm in sparse cultures obtained from the rats. After feeding without glutamic acid, linear kinetics of protein synthesis was revealed. Thus, glutamic acid, a component of blood as a non-neural transmitter, can synchronize the activity of hepatocytes and can form common rhythm of protein synthesis in vitro and in vivo. This effect is realized via receptors. Mechanisms of cell-cell communication are discussed on analyzing effects of non-neural functions of neurotransmitters. Glutamic acid is used clinically in humans. Hence, a previously unknown function of this drug is revealed.

The pentose phosphate pathway and cancer

PubMed Central

Patra, Krushna C.; Hay, Nissim

2015-01-01

The pentose phosphate pathway (PPP), which branches from glycolysis at the first committed step of glucose metabolism, is required for the synthesis of ribonucleotides and is a major source of NADPH. NADPH is required for and consumed during fatty acid synthesis and the scavenging of reactive oxygen species. Therefore, the PPP plays a pivotal role in helping glycolytic cancer cells to meet their anabolic demands and combat oxidative stress. Recently, several neoplastic lesions were shown to have evolved to facilitate the flux of glucose into the pentose phosphate pathway. This review summarizes the fundamental functions of the PPP, its regulation in cancer cells, and its importance in cancer cell metabolism and survival. PMID:25037503

Effects of metabolic pathway precursors and polydimethylsiloxane (PDMS) on poly-(gamma)-glutamic acid production by Bacillus subtilis BL53.

PubMed

de Cesaro, Alessandra; da Silva, Suse Botelho; Ayub, Marco Antônio Záchia

2014-09-01

The aims of this study were to evaluate the effects of the addition of metabolic precursors and polydimethylsiloxane (PDMS) as an oxygen carrier to cultures of Bacillus subtilis BL53 during the production of γ-PGA. Kinetics analyses of cultivations of different media showed that B. subtilis BL53 is an exogenous glutamic acid-dependent strain. When the metabolic pathway precursors of γ-PGA synthesis, L-glutamine and a-ketoglutaric acid, were added to the culture medium, production of the biopolymer was increased by 20 % considering the medium without these precursors. The addition of 10 % of the oxygen carrier PDMS to cultures caused a two-fold increase in the volumetric oxygen mass transfer coefficient (kLa), improving γ-PGA production and productivity. Finally, bioreactor cultures of B. subtilis BL53 adopting the combination of optimized medium E, added of glutamine, α-ketoglutaric acid, and PDMS, showed a productivity of 1 g L(-1) h(-1) of g-PGA after only 24 h of cultivation. Results of this study suggest that the use of metabolic pathway precursors glutamine and a-ketolgutaric acid, combined with the addition of PDMS as an oxygen carrier in bioreactors, can improve γ-PGA production and productivity by Bacillus strains .

Stereoselective synthesis of conformationally constrained omega-amino acid analogues from pyroglutamic acid.

PubMed

Bentz, Emilie L; Goswami, Rajesh; Moloney, Mark G; Westaway, Susan M

2005-08-07

Bicyclic lactams derived from pyroglutamic acid provide a useful scaffold for synthesis of conformationally restricted analogues of lysine, ornithine and glutamine, as well as an Ala-Ala dipeptide analogue. Amino alcohol and carboxylic acid derivatives are accessible from a common intermediate. In this strategy, the bicyclic lactam system not only controls, but also facilitates the determination of the stereochemistry of the synthetic intermediates.

Ribonucleic Acid Synthesis and Glutamate Excretion in Escherichia coli

PubMed Central

Broda, Paul

1968-01-01

Cultures of Escherichia coli excreted glutamate into the medium when protein synthesis was blocked in RCrel strains or when it was blocked with chloramphenicol in either RCstr or RCrel strains. Both of these conditions resulted in continued ribonucleic acid (RNA) synthesis in the absence of protein synthesis. Glutamate was also excreted by both RCstr and RCrel strains when RNA synthesis was inhibited by uracil starvation or by treatment with actinomycin D. It is proposed that, in each of these cases, glutamate excretion resulted from an increase in the permeability of the cell membrane. PMID:4973126

A direct method for the synthesis of orthogonally protected furyl- and thienyl- amino acids.

PubMed

Hudson, Alex S; Caron, Laurent; Colgin, Neil; Cobb, Steven L

2015-04-01

The synthesis of unnatural amino acids plays a key part in expanding the potential application of peptide-based drugs and in the total synthesis of peptide natural products. Herein, we report a direct method for the synthesis of orthogonally protected 5-membered heteroaromatic amino acids.

Elovl5 regulates the mTORC2-Akt-FOXO1 pathway by controlling hepatic cis-vaccenic acid synthesis in diet-induced obese mice[S

PubMed Central

Tripathy, Sasmita; Jump, Donald B.

2013-01-01

Elevated hepatic expression of fatty acid elongase-5 (Elovl5) induces FoxO1 phosphorylation, lowers FoxO1 nuclear content, and suppresses expression of genes involved in gluconeogenesis (GNG). In this report, we define the molecular and metabolic basis of Elovl5 control of FoxO1 phosphorylation. Adenoviral-mediated (Ad-Elovl5) induction of hepatic Elovl5 in diet-induced obese, glucose-intolerant mice and HepG2 cells increased the phosphorylation of Akt2-S473 [mammalian target of rapamycin complex-2 (mTORC2) site], but not Akt2-T308 (PDK1 site). The Akt2 inhibitor Akti1/2 blocked Elovl5 induction of FoxO1-S256 phosphorylation in HepG2 cells. Elevated Elovl5 activity in liver and HepG2 cells induced rictor mRNA, rictor protein, and rictor-mTOR interaction, whereas rictor knockdown (siRNA) attenuated Elovl5 induction of Akt2-S473 and FoxO1-S256 phosphorylation in HepG2 cells. FA analysis revealed that the abundance of cis-vaccenic acid (18:1,n-7) was increased in livers of obese mice and HepG2 cells following Ad-Elovl5 infection. Treating HepG2 cells with Elovl5 substrates established that palmitoleic acid (16:1,n-7), but not γ-linolenic acid (18:3,n-6), induced rictor protein, Akt-S473, and FoxO1-S256 phosphorylation. Inhibition of FA elongation blocked 16:1,n-7 but not 18:1,n-7 induction of rictor protein and Akt-S473 and FoxO1-S256 phosphorylation. These results establish a novel link between Elovl5-mediated synthesis of 18:1,n-7 and GNG through the control of the mTORC2-Akt-FoxO1 pathway. PMID:23099444

Single amino acid substitution in LC-CDR1 induces Russell body phenotype that attenuates cellular protein synthesis through eIF2α phosphorylation and thereby downregulates IgG secretion despite operational secretory pathway traffic

PubMed Central

Hsu, Ann; Siegler, Karen E.

2017-01-01

ABSTRACT Amino acid sequence differences in the variable region of immunoglobulin (Ig) cause wide variations in secretion outputs. To address how a primary sequence difference comes to modulate Ig secretion, we investigated the biosynthetic process of 2 human IgG2κ monoclonal antibodies (mAbs) that differ only by one amino acid in the light chain complementarity-determining region 1 while showing ∼20-fold variance in secretion titer. Although poorly secreted, the lower-secreting mAb of the 2 was by no means defective in terms of its folding stability, antigen binding, and in vitro biologic activity. However, upon overexpression in HEK293 cells, the low-secreting mAb revealed a high propensity to aggregate into enlarged globular structures called Russell bodies (RBs) in the endoplasmic reticulum. While Golgi morphology was affected by the formation of RBs, secretory pathway membrane traffic remained operational in those cells. Importantly, cellular protein synthesis was severely suppressed in RB-positive cells through the phosphorylation of eIF2α. PERK-dependent signaling was implicated in this event, given the upregulation and nuclear accumulation of downstream effectors such as ATF4 and CHOP. These findings illustrated that the underlining process of poor Ig secretion in RB-positive cells was due to downregulation of Ig synthesis instead of a disruption or blockade of secretory pathway trafficking. Therefore, RB formation signifies an end of active Ig production at the protein translation level. Consequently, depending on how soon and how severely an antibody-expressing cell develops the RB phenotype, the productive window of Ig secretion can vary widely among the cells expressing different mAbs. PMID:28379093

Synthesis and chirality of amino acids under interstellar conditions.

PubMed

Giri, Chaitanya; Goesmann, Fred; Meinert, Cornelia; Evans, Amanda C; Meierhenrich, Uwe J

2013-01-01

Amino acids are the fundamental building blocks of proteins, the biomolecules that provide cellular structure and function in all living organisms. A majority of amino acids utilized within living systems possess pre-specified orientation geometry (chirality); however the original source for this specific orientation remains uncertain. In order to trace the chemical evolution of life, an appreciation of the synthetic and evolutional origins of the first chiral amino acids must first be gained. Given that the amino acids in our universe are likely to have been synthesized in molecular clouds in interstellar space, it is necessary to understand where and how the first synthesis might have occurred. The asymmetry of the original amino acid synthesis was probably the result of exposure to chiral photons in the form of circularly polarized light (CPL), which has been detected in interstellar molecular clouds. This chirality transfer event, from photons to amino acids, has been successfully recreated experimentally and is likely a combination of both asymmetric synthesis and enantioselective photolysis. A series of innovative studies have reported successful simulation of these environments and afforded production of chiral amino acids under realistic circumstellar and interstellar conditions: irradiation of interstellar ice analogues (CO, CO2, NH3, CH3OH, and H2O) with circularly polarized ultraviolet photons at low temperatures does result in enantiomer enriched amino acid structures (up to 1.3% ee). This topical review summarizes current knowledge and recent discoveries about the simulated interstellar environments within which amino acids were probably formed. A synopsis of the COSAC experiment onboard the ESA cometary mission ROSETTA concludes this review: the ROSETTA mission will soft-land on the nucleus of the comet 67P/Churyumov-Gerasimenko in November 2014, anticipating the first in situ detection of asymmetric organic molecules in cometary ices.

Efficient synthesis of hydroxystyrenes via biocatalytic decarboxylation/deacetylation of substituted cinnamic acids by newly isolated Pantoea agglomerans strains.

PubMed

Sharma, Upendra K; Sharma, Nandini; Salwan, Richa; Kumar, Rakesh; Kasana, Ramesh C; Sinha, Arun K

2012-02-01

Decarboxylation of substituted cinnamic acids is a predominantly followed pathway for obtaining hydroxystyrenes-one of the most extensively explored bioactive compounds in the food and flavor industry (e.g. FEMA GRAS approved 4-vinylguaiacol). For this, mild and green strategies providing good yields with high product selectivity are needed. Two newly isolated bacterial strains, i.e. Pantoea agglomerans KJLPB4 and P. agglomerans KJPB2, are reported for mild and effective decarboxylation of substituted cinnamic acids into corresponding hydroxystyrenes. Key operational parameters for the process, such as incubation temperature, incubation time, substrate concentration and effect of co-solvent, were optimized using ferulic acid as a model substrate. With strain KJLPB4, 1.51 g L⁻¹ 4-vinyl guaiacol (98% yield) was selectively obtained from 2 g L⁻¹ ferulic acid at 28 °C after 48 h incubation. However, KJPB2 provided vanillic acid in 85% yield after 72 h following the oxidative decarboxylation pathway. In addition, KJLPB4 was effectively exploited for the deacetylation of acetylated α-phenylcinnamic acids, providing corresponding compounds in 65-95% yields. Two newly isolated microbial strains are reported for the mild and selective decarboxylation of substituted cinnamic acids into hydroxystyrenes. Preparative-scale synthesis of vinyl guaiacol and utilization of renewable feedstock (ferulic acid extracted from maize bran) have been demonstrated to enhance the practical utility of the process. Copyright © 2011 Society of Chemical Industry.

Oligoglyceric acid synthesis by autocondensation of glyceroyl thioester

NASA Technical Reports Server (NTRS)

Weber, A. L.

1986-01-01

The autocondensation of the glyceroyl thioester, S-glyceroyl-ethane-thiol, yielded olioglyceric acid. The rates of autocondensation and hydrolysis of the thioester increased from pH 6.5 to pH 7.5 in 2,6-lutidine and imidazole buffers. Autocondensation and hydrolysis were much more rapid in imidazole buffers as compared to 2,6-lutidine and phosphate buffers. The efficiency of ester bond synthesis was about 20% for 40 mM S-glyceroyl-ethane-thiol in 2,6-lutidine and imidazole buffers near neutral pH. The size and yield of the olioglyceric acid products increased when the concentration of the thioester was increased. The relationship of these results to prebiotic polymer synthesis is discussed.

Influence of virgin coconut oil-enriched diet on the transcriptional regulation of fatty acid synthesis and oxidation in rats - a comparative study.

PubMed

Arunima, Sakunthala; Rajamohan, Thankappan

2014-05-28

The present study was carried out to evaluate the effects of virgin coconut oil (VCO) compared with copra oil, olive oil and sunflower-seed oil on the synthesis and oxidation of fatty acids and the molecular regulation of fatty acid metabolism in normal rats. Male Sprague-Dawley rats were fed the test oils at 8 % for 45 d along with a synthetic diet. Dietary supplementation of VCO decreased tissue lipid levels and reduced the activity of the enzymes involved in lipogenesis, namely acyl CoA carboxylase and fatty acid synthase (FAS) (P< 0·05). Moreover, VCO significantly (P< 0·05) reduced the de novo synthesis of fatty acids by down-regulating the mRNA expression of FAS and its transcription factor, sterol regulatory element-binding protein-1c, compared with the other oils. VCO significantly (P< 0·05) increased the mitochondrial and peroxisomal β-oxidation of fatty acids, which was evident from the increased activities of carnitine palmitoyl transferase I, acyl CoA oxidase and the enzymes involved in mitochondrial β-oxidation; this was accomplished by up-regulating the mRNA expression of PPARα and its target genes involved in fatty acid oxidation. In conclusion, the present results confirmed that supplementation of VCO has beneficial effects on lipid parameters by reducing lipogenesis and enhancing the rate of fatty acid catabolism; this effect was mediated at least in part via PPARα-dependent pathways. Thus, dietary VCO reduces the risk for CHD by beneficially modulating the synthesis and degradation of fatty acids.

Salicylic acid derivatives: synthesis, features and usage as therapeutic tools.

PubMed

Ekinci, Deniz; Sentürk, Murat; Küfrevioğlu, Ömer İrfan

2011-12-01

In the field of medicinal chemistry, there is a growing interest in the use of small molecules. Although acetyl salicylic acid is well known for medical applications, little is known about other salicylic acid derivatives, and there is serious lack of data and information on the effects and biological evaluation that connect them. This review covers the synthesis and drug potencies of salicylic acid derivatives. After a brief overview of the information on salicylic acid and its features, a detailed review of salicylic acids as drugs and prodrugs, usage as cyclooxygenase inhibitors, properties in plants, synthesis and recent patents, is developed. Salicylic acid research is still an important area and innovations continue to arise, which offer hope for new therapeutics in related fields. It is anticipated that this review will guide the direction of long-term drug/nutraceutical safety trials and stimulate ideas for future research.

Compound-specific carbon, nitrogen, and hydrogen isotopic ratios for amino acids in CM and CR chondrites and their use in evaluating potential formation pathways

NASA Astrophysics Data System (ADS)

Elsila, Jamie E.; Charnley, Steven B.; Burton, Aaron S.; Glavin, Daniel P.; Dworkin, Jason P.

2012-09-01

Stable hydrogen, carbon, and nitrogen isotopic ratios (δD, δ13C, and δ15N) of organic compounds can reveal information about their origin and formation pathways. Several formation mechanisms and environments have been postulated for the amino acids detected in carbonaceous chondrites. As each proposed mechanism utilizes different precursor molecules, the isotopic signatures of the resulting amino acids may indicate the most likely of these pathways. We have applied gas chromatography with mass spectrometry and combustion isotope ratio mass spectrometry to measure the compound-specific C, N, and H stable isotopic ratios of amino acids from seven CM and CR carbonaceous chondrites: CM1/2 Allan Hills (ALH) 83100, CM2 Murchison, CM2 Lewis Cliff (LEW) 90500, CM2 Lonewolf Nunataks (LON) 94101, CR2 Graves Nunataks (GRA) 95229, CR2 Elephant Moraine (EET) 92042, and CR3 Queen Alexandra Range (QUE) 99177. We compare the isotopic compositions of amino acids in these meteorites with predictions of expected isotopic enrichments from potential formation pathways. We observe trends of decreasing δ13C and increasing δD with increasing carbon number in the α-H, α-NH2 amino acids that correspond to predictions made for formation via Strecker-cyanohydrin synthesis. We also observe light δ13C signatures for β-alanine, which may indicate either formation via Michael addition or via a pathway that forms primarily small, straight-chain, amine-terminal amino acids (n-ω-amino acids). Higher deuterium enrichments are observed in α-methyl amino acids, indicating formation of these amino acids or their precursors in cold interstellar or nebular environments. Finally, individual amino acids are more enriched in deuterium in CR chondrites than in CM chondrites, reflecting different parent-body chemistry.

Whole-body DHA synthesis-secretion kinetics from plasma eicosapentaenoic acid and alpha-linolenic acid in the free-living rat.

PubMed

Metherel, Adam H; Domenichiello, Anthony F; Kitson, Alex P; Hopperton, Kathryn E; Bazinet, Richard P

2016-09-01

Whole body docosahexaenoic acid (DHA, 22:6n-3) synthesis from α-linolenic acid (ALA, 18:3n-3) is considered to be very low, however, the daily synthesis-secretion of DHA may be sufficient to supply the adult brain. The current study aims to assess whether whole body DHA synthesis-secretion kinetics are different when comparing plasma ALA versus eicosapentaenoic acid (EPA, 20:5n-3) as the precursor. Male Long Evans rats (n=6) were fed a 2% ALA in total fat diet for eight weeks, followed by surgery to implant a catheter into each of the jugular vein and carotid artery and 3h of steady-state infusion with a known amount of (2)H-ALA and (13)C-eicosapentaenoic acid (EPA, 20:5n3). Blood samples were collected at thirty-minute intervals and plasma enrichment of (2)H- and (13)C EPA, n-3 docosapentaenoic acid (DPAn-3, 22:5n-3) and DHA were determined for assessment of synthesis-secretion kinetic parameters. Results indicate a 13-fold higher synthesis-secretion coefficient for DHA from EPA as compared to ALA. However, after correcting for the 6.6 fold higher endogenous plasma ALA concentration, no significant differences in daily synthesis-secretion (nmol/day) of DHA (97.6±28.2 and 172±62), DPAn-3 (853±279 and 1139±484) or EPA (1587±592 and 1628±366) were observed from plasma unesterified ALA and EPA sources, respectively. These results suggest that typical diets which are significantly higher in ALA compared to EPA yield similar daily DHA synthesis-secretion despite a significantly higher synthesis-secretion coefficient from EPA. Copyright © 2016 The Authors. Published by Elsevier B.V. All rights reserved.

Metabolic engineering in the biotechnological production of organic acids in the tricarboxylic acid cycle of microorganisms: Advances and prospects.

PubMed

Yin, Xian; Li, Jianghua; Shin, Hyun-Dong; Du, Guocheng; Liu, Long; Chen, Jian

2015-11-01

Organic acids, which are chemically synthesized, are also natural intermediates in the metabolic pathways of microorganisms, among which the tricarboxylic acid (TCA) cycle is the most crucial route existing in almost all living organisms. Organic acids in the TCA cycle include citric acid, α-ketoglutaric acid, succinic acid, fumaric acid, l-malic acid, and oxaloacetate, which are building-block chemicals with wide applications and huge markets. In this review, we summarize the synthesis pathways of these organic acids and review recent advances in metabolic engineering strategies that enhance organic acid production. We also propose further improvements for the production of organic acids with systems and synthetic biology-guided metabolic engineering strategies. Copyright © 2015 Elsevier Inc. All rights reserved.

Fatty acid metabolism in breast cancer subtypes

PubMed Central

Monaco, Marie E.

2017-01-01

Dysregulation of fatty acid metabolism is recognized as a component of malignant transformation in many different cancers, including breast; yet the potential for targeting this pathway for prevention and/or treatment of cancer remains unrealized. Evidence indicates that proteins involved in both synthesis and oxidation of fatty acids play a pivotal role in the proliferation, migration and invasion of breast cancer cells. The following essay summarizes data implicating specific fatty acid metabolic enzymes in the genesis and progression of breast cancer, and further categorizes the relevance of specific metabolic pathways to individual intrinsic molecular subtypes of breast cancer. Based on mRNA expression data, the less aggressive luminal subtypes appear to rely on a balance between de novo fatty acid synthesis and oxidation as sources for both biomass and energy requirements, while basal-like, receptor negative subtypes overexpress genes involved in the utilization of exogenous fatty acids. With these differences in mind, treatments may need to be tailored to individual subtypes. PMID:28412757

PdhR, the pyruvate dehydrogenase repressor, does not regulate lipoic acid synthesis.

PubMed

Feng, Youjun; Cronan, John E

2014-01-01

Lipoic acid is a covalently-bound enzyme cofactor required for central metabolism all three domains of life. In the last 20 years the pathway of lipoic acid synthesis and metabolism has been established in Escherichia coli. Expression of the genes of the lipoic acid biosynthesis pathway was believed to be constitutive. However, in 2010 Kaleta and coworkers (BMC Syst. Biol. 4:116) predicted a binding site for the pyruvate dehydrogenase operon repressor, PdhR (referred to lipA site 1) upstream of lipA, the gene encoding lipoic acid synthase and concluded that PdhR regulates lipA transcription. We report in vivo and in vitro evidence that lipA is not controlled by PdhR and that the putative regulatory site deduced by the prior workers is nonfunctional and physiologically irrelevant. E. coli PdhR was purified to homogeneity and used for electrophoretic mobility shift assays. The lipA site 1 of Kaleta and coworkers failed to bind PdhR. The binding detected by these workers is due to another site (lipA site 3) located far upstream of the lipA promoter. Relative to the canonical PdhR binding site lipA site 3 is a half-palindrome and as expected had only weak PdhR binding ability. Manipulation of lipA site 3 to construct a palindrome gave significantly enhanced PdhR binding affinity. The native lipA promoter and the version carrying the artificial lipA3 palindrome were transcriptionally fused to a LacZ reporter gene to directly assay lipA expression. Deletion of pdhR gave no significant change in lipA promoter-driven β-galactosidase activity with either the native or constructed palindrome upstream sequences, indicating that PdhR plays no physiological role in regulation of lipA expression. Copyright © 2014 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

Effects of Abscisic Acid and Ethylene on the Gibberellic Acid-Induced Synthesis of α-Amylase by Isolated Wheat Aleurone Layers 1

PubMed Central

Varty, Keith; Arreguín, Barbarín L.; Gómez, Miguel T.; López, Pablo Jaime T.; Gómez, Miguel Angel L.

1983-01-01

Gibberellic acid-induced α-amylase synthesis in wheat aleurone layers (Triticum aestivum L. var Potam S-70) escaped from transcriptional control 30 h after addition of the hormone, as evidenced by the tissue's loss of susceptibility to cordycepin. Abscisic acid inhibited the accumulation of α-amylase activity when added to the tissue during this cordycepin-insensitive phase of enzyme induction. α-Amylase synthesis was not restored by the addition of cordycepin, indicating that the response to abscisic acid was not dependent upon the continuous synthesis of a short lived RNA. When ethylene was added simultaneously or some time after abscisic acid, the accumulation of α-amylase activity was sustained or quickly restored. The loss of susceptibility to cordycepin was completely prevented when aleurone layers were incubated with a combination of gibberellic and abscisic acids from the start of the induction period. This effect of abscisic acid was not reversed by ethylene. On the basis of these observations, it is suggested that abscisic acid inhibits both the transcription and translation of α-amylase mRNA, and that only the latter site of action is susceptible to reversal by ethylene. The rate of incorporation of [methyl-14C]choline into phospholipids was also inhibited by abscisic acid. Ethylene reversed this effect. The effects of abscisic acid and ethylene on phospholipid synthesis were not dependent upon the presence of gibberellic acid. No direct relationship was found between the control of α-amylase synthesis and membrane formation by abscisic acid and ethylene. PMID:16663284

Mutations in the Prokaryotic Pathway Rescue the fatty acid biosynthesis1 Mutant in the Cold.

PubMed

Gao, Jinpeng; Wallis, James G; Browse, John

2015-09-01

The Arabidopsis (Arabidopsis thaliana) fatty acid biosynthesis1 (fab1) mutant has increased levels of the saturated fatty acid 16:0 due to decreased activity of 3-ketoacyl-acyl carrier protein (ACP) synthase II. In fab1 leaves, phosphatidylglycerol, the major chloroplast phospholipid, contains up to 45% high-melting-point molecular species (molecules that contain only 16:0, 16:1-trans, and 18:0), a trait associated with chilling-sensitive plants, compared with less than 10% in wild-type Arabidopsis. Although they do not exhibit typical chilling sensitivity, when exposed to low temperatures (2°C-6°C) for long periods, fab1 plants do suffer collapse of photosynthesis, degradation of chloroplasts, and eventually death. A screen for suppressors of this low-temperature phenotype has identified 11 lines, some of which contain additional alterations in leaf-lipid composition relative to fab1. Here, we report the identification of two suppressor mutations, one in act1, which encodes the chloroplast acyl-ACP:glycerol-3-phosphate acyltransferase, and one in lpat1, which encodes the chloroplast acyl-ACP:lysophosphatidic acid acyltransferase. These enzymes catalyze the first two steps of the prokaryotic pathway for glycerolipid synthesis, so we investigated whether other mutations in this pathway would rescue the fab1 phenotype. Both the gly1 mutation, which reduces glycerol-3-phosphate supply to the prokaryotic pathway, and fad6, which is deficient in the chloroplast 16:1/18:1 fatty acyl desaturase, were discovered to be suppressors. Analyses of leaf-lipid compositions revealed that mutations at all four of the suppressor loci result in reductions in the proportion of high-melting-point molecular species of phosphatidylglycerol relative to fab1. We conclude that these reductions are likely the basis for the suppressor phenotypes. © 2015 American Society of Plant Biologists. All Rights Reserved.

Drosophila TIF-IA is required for ribosome synthesis and cell growth and is regulated by the TOR pathway.

PubMed

Grewal, Savraj S; Evans, Justin R; Edgar, Bruce A

2007-12-17

Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA(-/-) mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth-regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components.

New hydrazones of ferulic acid: synthesis, characterization and biological activity.

PubMed

Wolszleger, Maria; Stan, Cătălina Daniela; Apotrosoaei, Maria; Vasincu, Ioana; Pânzariu, Andreea; Profire, Lenuţa

2014-01-01

The ferulic acid (4-hydroxy-3-methoxy-cinnamic acid) is a phenolic compound with important antioxidant effects and which nowadays is being extensively studied for his potential indications in inflammatory and neurodegenerative diseases, hypertension, atherosclerosis, etc. The synthesis of new ferulic acid compounds with potential antioxidant activity. The synthesis of the designed compounds was performed in several steps: (i) the obtaining of ferulic acid chloride by reacting of ferulic acid with thionyl chloride; (ii) the reaction between the ferulic acid chloride and hydrazine hydrate 98% to obtain the ferulic acid hydrazide; (iii) the condensation of ferrulic acid hydrazide with various benzaldehydes (2-hydroxy/3-hydroxy/4-hydroxy/2-nitro/3-nitro/4-nitro/2-methoxi/ 4-chloro/4-fluoro/4-bromo-benzaldehyde) resulting the correspond- ing hydrazones. The structure of the synthesized compounds was confirmed by FT-IR spectroscopy and the evaluation of antioxidant potential was achieved by determining the total antioxidant capacity and reducing power. In this study new hydrazones of ferulic acid have been synthesized, physic-chemical and spectral characterized. The evaluation of antioxidant potential using in vitro methods showed the favorable influence of the structural modulation on the antioxidant effects of ferulic acid.

Cancer Cells Differentially Activate and Thrive on De Novo Lipid Synthesis Pathways in a Low-Lipid Environment

PubMed Central

Daniëls, Veerle W.; Smans, Karine; Royaux, Ines; Chypre, Melanie

2014-01-01

Increased lipogenesis is a hallmark of a wide variety of cancers and is under intense investigation as potential antineoplastic target. Although brisk lipogenesis is observed in the presence of exogenous lipids, evidence is mounting that these lipids may adversely affect the efficacy of inhibitors of lipogenic pathways. Therefore, to fully exploit the therapeutic potential of lipid synthesis inhibitors, a better understanding of the interrelationship between de novo lipid synthesis and exogenous lipids and their respective role in cancer cell proliferation and therapeutic response to lipogenesis inhibitors is of critical importance. Here, we show that the proliferation of various cancer cell lines (PC3M, HepG2, HOP62 and T24) is attenuated when cultured in lipid-reduced conditions in a cell line-dependent manner, with PC3M being the least affected. Interestingly, all cell lines - lipogenic (PC3M, HepG2, HOP62) as well as non-lipogenic (T24) - raised their lipogenic activity in these conditions, albeit to a different degree. Cells that attained the highest lipogenic activity under these conditions were best able to cope with lipid reduction in term of proliferative capacity. Supplementation of the medium with very low density lipoproteins, free fatty acids and cholesterol reversed this activation, indicating that the mere lack of lipids is sufficient to activate de novo lipogenesis in cancer cells. Consequently, cancer cells grown in lipid-reduced conditions became more dependent on de novo lipid synthesis pathways and were more sensitive to inhibitors of lipogenic pathways, like Soraphen A and Simvastatin. Collectively, these data indicate that limitation of access to exogenous lipids, as may occur in intact tumors, activates de novo lipogenesis is cancer cells, helps them to thrive under these conditions and makes them more vulnerable to lipogenesis inhibitors. These observations have important implications for the design of new antineoplastic strategies targeting

Expeditious Synthesis of Dianionic-Headed 4-Sulfoalkanoic Acid Surfactants.

PubMed

Jiang, Jianghui; Xu, Jiaxi

2017-04-16

4-Sulfoalkanoic acids are a class of important dianionic-headed surfactants. Various 4-sulfoalkanoic acids with straight C8, C10, C12, C14, C16, and C18 chains were synthesized expeditiously through the radical addition of methyl 2-((ethoxycarbonothioyl)thio)acetate to linear terminal olefins and subsequent oxidation with peroxyformic acid. This is a useful and convenient strategy for the synthesis of dianionic-headed surfactants with a carboxylic acid and sulfonic acid functionalities in the head group region.

Synthesis of monomethyl 5,5'-dehydrodiferulic acid

USDA-ARS?s Scientific Manuscript database

Synthesis of the internal reference compound, monomethyl 5,5’-dehydrodiferulic acid, is described. The synthetic scheme relies on a selective monomethylation of the known compound 5,5-dehydrodivanillin, followed by elaboration into the dehydrodiferulic framework through a dual Horner-Emmons-Wadswort...

Design of nucleic acid strands with long low-barrier folding pathways.

PubMed

Condon, Anne; Kirkpatrick, Bonnie; Maňuch, Ján

2017-01-01

A major goal of natural computing is to design biomolecules, such as nucleic acid sequences, that can be used to perform computations. We design sequences of nucleic acids that are "guaranteed" to have long folding pathways relative to their length. This particular sequences with high probability follow low-barrier folding pathways that visit a large number of distinct structures. Long folding pathways are interesting, because they demonstrate that natural computing can potentially support long and complex computations. Formally, we provide the first scalable designs of molecules whose low-barrier folding pathways, with respect to a simple, stacked pair energy model, grow superlinearly with the molecule length, but for which all significantly shorter alternative folding pathways have an energy barrier that is [Formula: see text] times that of the low-barrier pathway for any [Formula: see text] and a sufficiently long sequence.

An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid and its topoisomerase I inhibitory activity

PubMed Central

Carballeira, Néstor M.; Sanabria, David; Oyola, Delise

2006-01-01

An improved synthesis for the (Z)-14-methyl-9-pentadecenoic acid was developed based on the appropriate use of (trimethylsilyl)acetylene as the key reagent in the synthesis. The reported synthesis started with commercially available 8-bromo-1-octanol and furnished the desired acid in seven steps and in a 16% overall yield, a significant improvement over the previous reported synthesis for this fatty acid. The synthesis reported herein afforded sufficient amounts to study the acid topoisomerase I inhibitory potential and it was found that the title acid inhibits the human placenta DNA topoisomerase I enzyme at concentrations of 500 μM. PMID:17680032

Effect of the quality of dietary amino acids composition on the urea synthesis in rats.

PubMed

Tujioka, Kazuyo; Ohsumi, Miho; Hayase, Kazutoshi; Yokogoshi, Hidehiko

2011-01-01

We have shown that urinary urea excretion increased in rats given a lower quality protein. The purpose of present study was to determine whether the composition of dietary amino acids affects urea synthesis. Experiments were done on three groups of rats given diets containing a 10% gluten amino acid mix diet or 10% casein amino acid mix diet or 10% whole egg protein amino acids mix diet for 10 d. The urinary excretion of urea, the liver concentration of N-acetylglutamate, and the liver concentration of free serine, glutamic acids and alanine were greater in the group given the amino acid mix diet of lower quality. The fractional and absolute rates of protein synthesis in tissues declined with a decrease in quality of dietary amino acids. The hepatic concentration of ornithine and the activities of hepatic urea-cycle enzymes were not related to the urea excretion. These results suggest that the increased concentrations of amino acids and N-acetylglutamate seen in the liver of rats given the amino acid mix diets of lower quality are likely among the factors stimulating urea synthesis. The protein synthesis in tissues is at least partly related to hepatic concentrations of amino acids. The composition of dietary amino acids is likely to be one of the factors regulating urea synthesis when the quality of dietary protein is manipulated.

Content and synthesis of nucleic acids in the cartilage in chondromalacia patellae.

PubMed

Lund, F; Telhag, H

1978-12-01

The content and the synthesis of nucleic acids in chondromalacian, osteoarthritis and normal cartilage was compared. The chondromalacian cartilage differed from osteoarthritis in that the content of nucleic acids was less. Also, the cell density was less in chondromalacian than in normal cartilage as opposed to previous findings in osteoarthritis. The synthesis of DNA was greater in chondromalacian than in normal cartilage but less than in osteoarthritis. With regard to the RNA synthesis, however, the chondromalacian cartilage showed a higher rate than both normal and osteoarthritic cartilage.

Total amino acid stabilization during cell-free protein synthesis reactions.

PubMed

Calhoun, Kara A; Swartz, James R

2006-05-17

Limitations in amino acid supply have been recognized as a substantial problem in cell-free protein synthesis reactions. Although enzymatic inhibitors and fed-batch techniques have been beneficial, the most robust way to stabilize amino acids is to remove the responsible enzymatic activities by genetically modifying the source strain used for cell extract preparation. Previous work showed this was possible for arginine, serine, and tryptophan, but cysteine degradation remained a major limitation in obtaining high protein synthesis yields. Through radiolabel techniques, we confirmed that cysteine degradation was caused by the activity of glutamate-cysteine ligase (gene gshA) in the cell extract. Next, we created Escherichia coli strain KC6 that combines a gshA deletion with previously described deletions for arginine, serine, and tryptophan stabilization. Strain KC6 grows well, and active cell extract can be produced from it for cell-free protein synthesis reactions. The extract from strain KC6 maintains stable amino acid concentrations of all 20 amino acids in a 3-h batch reaction. Yields for three different proteins improved 75-250% relative to cell-free expression using the control extract.

Cytochrome and Alternative Pathway Respiration in Tobacco (Effects of Salicylic Acid).

PubMed

Rhoads, D. M.; McIntosh, L.

1993-11-01

In suspension cultures of NT1 tobacco (Nicotiana tabacum L. cv Bright Yellow) cells the cytochrome pathway capacity increased between d 3 and d 4 following subculturing and reached the highest level observed on d 7. The capacity decreased significantly by d 10 and was at the same level on d 14. Both alternative pathway capacity and the amount of the 35-kD alternative oxidase protein increased significantly between d 5 and d 6, reached the highest point observed on d 7, remained constant until d 10, and decreased by d 14. The highest capacities of the alternative and cytochrome pathways and the highest amount of the 35-kD protein were attained on the day that cell cultures reached a stationary phase of growth. Addition of salicylic acid to cell cultures on d 4 caused a significant increase in alternative pathway capacity and a dramatic accumulation of the 35-kD protein by 12 h. The alternative pathway capacity and the protein level reached the highest level observed by 16 h after salicylic acid addition, and the cytochrome pathway capacity was at about the same level at each time point. The accumulation of the 35-kD alternative oxidase protein was significantly decreased by addition of actinomycin D 1 h before salicylic acid and was blocked by addition of cycloheximide. These results indicate that de novo transcription and translation were necessary for salicylic acid to cause the maximum accumulation of the 35-kD protein.

Dual Functions of the Trans-2-Enoyl-CoA Reductase TER in the Sphingosine 1-Phosphate Metabolic Pathway and in Fatty Acid Elongation*

PubMed Central

Wakashima, Takeshi; Abe, Kensuke; Kihara, Akio

2014-01-01

The sphingolipid metabolite sphingosine 1-phosphate (S1P) functions as a lipid mediator and as a key intermediate of the sole sphingolipid to glycerophospholipid metabolic pathway (S1P metabolic pathway). In this pathway, S1P is converted to palmitoyl-CoA through 4 reactions, then incorporated mainly into glycerophospholipids. Although most of the genes responsible for the S1P metabolic pathway have been identified, the gene encoding the trans-2-enoyl-CoA reductase, responsible for the saturation step (conversion of trans-2-hexadecenoyl-CoA to palmitoyl-CoA) remains unidentified. In the present study, we show that TER is the missing gene in mammals using analyses involving yeast cells, deleting the TER homolog TSC13, and TER-knockdown HeLa cells. TER is known to be involved in the production of very long-chain fatty acids (VLCFAs). A significant proportion of the saturated and monounsaturated VLCFAs are used for sphingolipid synthesis. Therefore, TER is involved in both the production of VLCFAs used in the fatty acid moiety of sphingolipids as well as in the degradation of the sphingosine moiety of sphingolipids via S1P. PMID:25049234

Stereoselective synthesis of unsaturated α-amino acids.

PubMed

Fanelli, Roberto; Jeanne-Julien, Louis; René, Adeline; Martinez, Jean; Cavelier, Florine

2015-06-01

Stereoselective synthesis of unsaturated α-amino acids was performed by asymmetric alkylation. Two methods were investigated and their enantiomeric excess measured and compared. The first route consisted of an enantioselective approach induced by the Corey-Lygo catalyst under chiral phase transfer conditions while the second one involved the hydroxypinanone chiral auxiliary, both implicating Schiff bases as substrate. In all cases, the use of a prochiral Schiff base gave higher enantiomeric excess and yield in the final desired amino acid.

Ascorbate synthesis pathway, dual role of ascorbate in bone homeostasis

USDA-ARS?s Scientific Manuscript database

Using mouse gene knock-out models, we identify aldehyde reductase (EC 1.1.1.2, Akr1a4 (GR)) and aldose reductase (EC 1.1.1.21, Akr1b3 (AR)) as the enzymes responsible for conversion of D-glucuronate to L-gulonate, a key step in the ascorbate (ASC) synthesis pathway in mice. The gene knock-out (KO) m...

Creating metabolic demand as an engineering strategy in Pseudomonas putida - Rhamnolipid synthesis as an example.

PubMed

Tiso, Till; Sabelhaus, Petra; Behrens, Beate; Wittgens, Andreas; Rosenau, Frank; Hayen, Heiko; Blank, Lars Mathias

2016-12-01

Metabolic engineering of microbial cell factories for the production of heterologous secondary metabolites implicitly relies on the intensification of intracellular flux directed toward the product of choice. Apart from reactions following peripheral pathways, enzymes of the central carbon metabolism are usually targeted for the enhancement of precursor supply. In Pseudomonas putida , a Gram-negative soil bacterium, central carbon metabolism, i.e., the reactions required for the synthesis of all 12 biomass precursors, was shown to be regulated at the metabolic level and not at the transcriptional level. The bacterium's central carbon metabolism appears to be driven by demand to react rapidly to ever-changing environmental conditions. In contrast, peripheral pathways that are only required for growth under certain conditions are regulated transcriptionally. In this work, we show that this regulation regime can be exploited for metabolic engineering. We tested this driven-by-demand metabolic engineering strategy using rhamnolipid production as an example. Rhamnolipid synthesis relies on two pathways, i.e., fatty acid de novo synthesis and the rhamnose pathway, providing the required precursors hydroxyalkanoyloxy-alkanoic acid (HAA) and activated (dTDP-)rhamnose, respectively. In contrast to single-pathway molecules, rhamnolipid synthesis causes demand for two central carbon metabolism intermediates, i.e., acetyl-CoA for HAA and glucose-6-phosphate for rhamnose synthesis. Following the above-outlined strategy of driven by demand, a synthetic promoter library was developed to identify the optimal expression of the two essential genes ( rhlAB ) for rhamnolipid synthesis. The best rhamnolipid-synthesizing strain had a yield of 40% rhamnolipids on sugar [Cmol RL /Cmol Glc ], which is approximately 55% of the theoretical yield. The rate of rhamnolipid synthesis of this strain was also high. Compared to an exponentially growing wild type, the rhamnose pathway increased its

Tannic acid-mediated green synthesis of antibacterial silver nanoparticles.

PubMed

Kim, Tae Yoon; Cha, Song-Hyun; Cho, Seonho; Park, Youmie

2016-04-01

The search for novel antibacterial agents is necessary to combat microbial resistance to current antibiotics. Silver nanoparticles (AgNPs) have been reported to be effective antibacterial agents. Tannic acid is a polyphenol compound from plants with antioxidant and antibacterial activities. In this report, AgNPs were prepared from silver ions by tannic acid-mediated green synthesis (TA-AgNPs). The reaction process was facile and involved mixing both silver ions and tannic acid. The absorbance at 423 nm in the UV-Visible spectra demonstrated that tannic acid underwent a reduction reaction to produce TA-AgNPs from silver ions. The synthetic yield of TA-AgNPs was 90.5% based on inductively coupled plasma mass spectrometry analysis. High-resolution transmission electron microscopy and atomic force microscopy images indicated that spherical-shaped TA-AgNPs with a mean particle size of 27.7-46.7 nm were obtained. Powder high-resolution X-ray diffraction analysis indicated that the TA-AgNP structure was face-centered cubic with a zeta potential of -27.56 mV. The hydroxyl functional groups of tannic acid contributed to the synthesis of TA-AgNPs, which was confirmed by Fourier transform infrared spectroscopy. The in vitro antibacterial activity was measured using the minimum inhibitory concentration (MIC) method. The TA-AgNPs were more effective against Gram-negative bacteria than Gram-positive bacteria. The MIC for the TA-AgNPs in all of the tested strains was in a silver concentration range of 6.74-13.48 μg/mL. The tannic acid-mediated synthesis of AgNPs afforded biocompatible nanocomposites for antibacterial applications.

An amino acid depleted cell-free protein synthesis system for the incorporation of non-canonical amino acid analogs into proteins.

PubMed

Singh-Blom, Amrita; Hughes, Randall A; Ellington, Andrew D

2014-05-20

Residue-specific incorporation of non-canonical amino acids into proteins is usually performed in vivo using amino acid auxotrophic strains and replacing the natural amino acid with an unnatural amino acid analog. Herein, we present an efficient amino acid depleted cell-free protein synthesis system that can be used to study residue-specific replacement of a natural amino acid by an unnatural amino acid analog. This system combines a simple methodology and high protein expression titers with a high-efficiency analog substitution into a target protein. To demonstrate the productivity and efficacy of a cell-free synthesis system for residue-specific incorporation of unnatural amino acids in vitro, we use this system to show that 5-fluorotryptophan and 6-fluorotryptophan substituted streptavidin retain the ability to bind biotin despite protein-wide replacement of a natural amino acid for the amino acid analog. We envisage this amino acid depleted cell-free synthesis system being an economical and convenient format for the high-throughput screening of a myriad of amino acid analogs with a variety of protein targets for the study and functional characterization of proteins substituted with unnatural amino acids when compared to the currently employed in vivo methodologies. Copyright © 2014 Elsevier B.V. All rights reserved.

Platelet 12-lipoxygenase activation via glycoprotein VI: involvement of multiple signaling pathways in agonist control of H(P)ETE synthesis.

PubMed

Coffey, Marcus J; Jarvis, Gavin E; Gibbins, Jonathan M; Coles, Barbara; Barrett, Natasha E; Wylie, Oliver R E; O'Donnell, Valerie B

2004-06-25

Lipoxygenases (LOX) contribute to vascular disease and inflammation through generation of bioactive lipids, including 12-hydro(pero)xyeicosatetraenoic acid (12-H(P)ETE). The physiological mechanisms that acutely control LOX product generation in mammalian cells are uncharacterized. Human platelets that contain a 12-LOX isoform (p12-LOX) were used to define pathways that activate H(P)ETE synthesis in the vasculature. Collagen and collagen-related peptide (CRP) (1 to 10 microg/mL) acutely induced platelet 12-H(P)ETE synthesis. This implicated the collagen receptor glycoprotein VI (GPVI), which signals via the immunoreceptor-based activatory motif (ITAM)-containing FcRgamma chain. Conversely, thrombin only activated at high concentrations (> 0.2 U/mL), whereas U46619 and ADP alone were ineffective. Collagen or CRP-stimulated 12-H(P)ETE generation was inhibited by staurosporine, PP2, wortmannin, BAPTA/AM, EGTA, and L-655238, implicating src-tyrosine kinases, PI3-kinase, Ca2+ mobilization, and p12-LOX translocation. In contrast, protein kinase C (PKC) inhibition potentiated 12-H(P)ETE generation. Finally, activation of the immunoreceptor tyrosine-based inhibitory motif (ITIM)-containing platelet endothelial cell adhesion molecule (PECAM-1) inhibited p12-LOX product generation. This study characterizes a receptor-dependent pathway for 12-H(P)ETE synthesis via the collagen receptor GPVI, which is negatively regulated by PECAM-1 and PKC, and demonstrates a novel link between immune receptor signaling and lipid mediator generation in the vasculature.

Amino acid metabolism in dairy cows and their regulation in milk synthesis.

PubMed

Wang, Feiran; Shi, Haitao; Wang, Shuxiang; Wang, Yajing; Cao, Zhijun; Li, Shengli

2018-06-10

Reducing dietary crude protein (CP) and supplementing with certain amino acids (AAs) has been known as a potential solution to improve nitrogen (N) efficiency in dairy production. Thus understanding how AAs are utilized in various sites along the gut is critical. AA flow from the intestine to portal-drained viscera (PDV) and liver then to the mammary gland was elaborated in this article. Recoveries in individual AA in PDV and liver seem to share similar AA pattern with input: output ratio in mammary gland, which subdivides essential AA (EAA) into two groups, lysine (Lys) and branched-chain AA (BCAA) in group 1, input: output ratio > 1; methionine (Met), histidine (His), phenylalanine (Phe) etc. in group 2, input: output ratio close to 1. AAs in the mammary gland are either utilized for milk protein synthesis or retained as body tissue, or catabolized. The fractional removal of AAs and the number and activity of AA transporters together contribute to the ability of AAs going through mammary cells. Mammalian target of rapamycin (mTOR) pathway is closely related to milk protein synthesis and provides alternatives for AA regulation of milk protein synthesis, which connects AA with lactose synthesis via α-lactalbumin (gene: LALBA) and links with milk fat synthesis via sterol regulatory element-binding transcription protein 1 (SREBP1) and peroxisome proliferator-activated receptor (PPAR). Overall, AA flow across various tissues reveal AA metabolism and utilization in dairy cows on one hand. While the function of AA in the biosynthesis of milk protein, fat and lactose at both transcriptional and posttranscriptional level from another angle provides the possibility for us to regulate them for higher efficiency. Copyright© Bentham Science Publishers; For any queries, please email at epub@benthamscience.org.

Specific Inhibition of the Cyanide-insensitive Respiratory Pathway in Plant Mitochondria by Hydroxamic Acids

PubMed Central

Schonbaum, Gregory R.; Bonner, Walter D.; Storey, Bayard T.; Bahr, James T.

1971-01-01

Hydroxamic acids, R-CONHOH, are inhibitors specific to the respiratory pathway through the alternate, cyanide-insensitive terminal oxidase of plant mitochondria. The nature of the R group in these compounds affects the concentration at which the hydroxamic acids are effective, but it appears that all hydroxamic acids inhibit if high enough concentrations are used. The benzhydroxamic acids are effective at relatively low concentrations; of these, the most effective are m-chlorobenzhydroxamic acid and m-iodobenzhydroxamic acid. The concentrations required for half-maximal inhibition of the alternate oxidase pathway in mung bean (Phaseolus aureus) mitochondria are 0.03 mm for m-chlorobenzhydroxamic acid and 0.02 mm for m-iodobenzhydroxamic acid. With skunk cabbage (Symplocarpus foetidus) mitochondria, the required concentrations are 0.16 for m-chlorobenzhydroxamic acid and 0.05 for m-iodobenzhydroxamic acid. At concentrations which inhibit completely the alternate oxidase pathway, these two compounds have no discernible effect on either the respiratory pathway through cytochrome oxidase, or on the energy coupling reactions of these mitochondria. These inhibitors make it possible to isolate the two respiratory pathways and study their mode of action separately. These inhibitors also enhance an electron paramagnetic resonance signal near g = 2 in anaerobic, submitochondrial particles from skunk cabbage, which appears to be specific to the alternate oxidase and thus provides a means for its assay. PMID:5543780

Harnessing Intracellular Biochemical Pathways for In Vitro Synthesis of Designer Tellurium Nanorods.

PubMed

Xiong, Ling-Hong; Cui, Ran; Zhang, Zhi-Ling; Tu, Jia-Wei; Shi, Yun-Bo; Pang, Dai-Wen

2015-10-28

Synthesizing nanomaterials of desired properties is a big challenge, which requires extremely harsh conditions and/or use of toxic materials. More recently developed in vivo methods have brought a different set of problems such as separation and purification of nanomaterials made in vivo. Here, a novel approach that harnesses cellular pathways for in vitro synthesis of high-quality tellurium nanorods with tunable lengths and optical properties is reported. It is first demonstrated that in vivo biochemical pathways could be used to synthesize Te nanorods via the intracellular reduction of TeO3(2-) in living Staphylococcus aureus cells. The pathways to set up a quasi-biological system for Te precursor formation are then utilized, which could further synthesize Te nanorods in vitro. This allows to successfully synthesize in vitro, under routine laboratory conditions, Te nanorods with uniform and tunable lengths, ranging from about 10 to 200 nm, and controllable optical properties with high molar extinction coefficients. The approach here should open new avenues for controllable, facile, and efficient synthesis of designer nanomaterials for diverse industrial and biomedical applications. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Microwave-Assisted Rapid Enzymatic Synthesis of Nucleic Acids.

PubMed

Hari Das, Rakha; Ahirwar, Rajesh; Kumar, Saroj; Nahar, Pradip

2016-07-02

Herein we report microwave-induced enhancement of the reactions catalyzed by Escherichia coli DNA polymerase I and avian myeloblastosis virus-reverse transcriptase. The reactions induced by microwaves result in a highly selective synthesis of nucleic acids in 10-50 seconds. In contrast, same reactions failed to give desired reaction products when carried out in the same time periods, but without microwave irradiation. Each of the reactions was carried out for different duration of microwave exposure time to find the optimum reaction time. The products produced by the respective enzyme upon microwave irradiation of the reaction mixtures were identical to that produced by the conventional procedures. As the microwave-assisted reactions are rapid, microwave could be a useful alternative to the conventional and time consuming procedures of enzymatic synthesis of nucleic acids.

Glycerophosphocholine catabolism as a new route for choline formation for phosphatidylcholine synthesis by the Kennedy pathway.

PubMed

Fernández-Murray, J Pedro; McMaster, Christopher R

2005-11-18

In eukaryotes, neuropathy target esterase (Nte1p in yeast) deacylates phosphatidylcholine derived exclusively from the CDP-choline pathway to produce glycerophosphocholine (GroPCho) and release two fatty acids. The metabolic fate of GroPCho in eukaryotic cells is currently not known. Saccharomyces cerevisiae contains two open reading frames predicted to contain glycerophosphodiester phosphodiesterase domains, YPL110c and YPL206c. Pulse-chase experiments were conducted to monitor GroPCho metabolic fate under conditions known to alter CDP-choline pathway flux and consequently produce different rates of formation of GroPCho. From this analysis, it was revealed that GroPCho was metabolized to choline, with this choline serving as substrate for renewed synthesis of phosphatidylcholine. YPL110c played the major role in this metabolic pathway. To extend and confirm the metabolic studies, the ability of the ypl110cDelta and ypl206cDelta strains to utilize exogenous GroPCho or glycerophosphoinositol as the sole source of phosphate was analyzed. Consistent with our metabolic profiling, the ypl206cDelta strain grew on both substrates with a similar rate to wild type, whereas the ypl110cDelta strain grew very poorly on GroPCho and with moderately reduced growth on glycerophosphoinositol.

Drosophila TIF-IA is required for ribosome synthesis and cell growth and is regulated by the TOR pathway

PubMed Central

Grewal, Savraj S.; Evans, Justin R.; Edgar, Bruce A.

2007-01-01

Synthesis of ribosomal RNA (rRNA) is a key step in ribosome biogenesis and is essential for cell growth. Few studies, however, have investigated rRNA synthesis regulation in vivo in multicellular organisms. Here, we present a genetic analysis of transcription initiation factor IA (TIF-IA), a conserved RNA polymerase I transcription factor. Drosophila melanogaster Tif-IA −/− mutants have reduced levels of rRNA synthesis and sustain a developmental arrest caused by a block in cellular growth. We find that the target of rapamycin (TOR) pathway regulates TIF-IA recruitment to rDNA. Furthermore, we show that the TOR pathway regulates rRNA synthesis in vivo and that TIF-IA overexpression can maintain rRNA transcription when TOR activity is reduced in developing larvae. We propose that TIF-IA acts in vivo as a downstream growth–regulatory target of the TOR pathway. Overexpression of TIF-IA also elevates levels of both 5S RNA and messenger RNAs encoding ribosomal proteins. Stimulation of rRNA synthesis by TIF-IA may therefore provide a feed-forward mechanism to coregulate the levels of other ribosome components. PMID:18086911

Cytochrome and Alternative Pathway Respiration in Tobacco (Effects of Salicylic Acid).

PubMed Central

Rhoads, D. M.; McIntosh, L.

1993-01-01

In suspension cultures of NT1 tobacco (Nicotiana tabacum L. cv Bright Yellow) cells the cytochrome pathway capacity increased between d 3 and d 4 following subculturing and reached the highest level observed on d 7. The capacity decreased significantly by d 10 and was at the same level on d 14. Both alternative pathway capacity and the amount of the 35-kD alternative oxidase protein increased significantly between d 5 and d 6, reached the highest point observed on d 7, remained constant until d 10, and decreased by d 14. The highest capacities of the alternative and cytochrome pathways and the highest amount of the 35-kD protein were attained on the day that cell cultures reached a stationary phase of growth. Addition of salicylic acid to cell cultures on d 4 caused a significant increase in alternative pathway capacity and a dramatic accumulation of the 35-kD protein by 12 h. The alternative pathway capacity and the protein level reached the highest level observed by 16 h after salicylic acid addition, and the cytochrome pathway capacity was at about the same level at each time point. The accumulation of the 35-kD alternative oxidase protein was significantly decreased by addition of actinomycin D 1 h before salicylic acid and was blocked by addition of cycloheximide. These results indicate that de novo transcription and translation were necessary for salicylic acid to cause the maximum accumulation of the 35-kD protein. PMID:12231986

Ravynic acid, an antibiotic polyeneyne tetramic acid from Penicillium sp. elucidated through synthesis.

PubMed

Myrtle, J D; Beekman, A M; Barrow, R A

2016-09-21

A new antibiotic natural product, ravynic acid, has been isolated from a Penicillium sp. of fungus, collected from Ravensbourne National Park. The 3-acylpolyenyne tetramic acid structure was definitively elucidated via synthesis. Highlights of the synthetic method include the heat induced formation of the 3-acylphosphorane tetramic acid and a selective Wittig cross-coupling to efficiently prepare the natural compounds carbon skeleton. The natural compound was shown to inhibit the growth of Staphylococcus aureus down to concentrations of 2.5 µg mL(-1).

Duodenal prostaglandin synthesis and acid load in health and in duodenal ulcer disease

DOE Office of Scientific and Technical Information (OSTI.GOV)

Ahlquist, D.A.; Dozois, R.R.; Zinsmeister, A.R.

1983-09-01

We sought to test the hypothesis that duodenal ulcer disease results from an imbalance between duodenal acid load, an injurious force, and mucosal prostaglandin generation, a protective factor. Ten patients with duodenal ulcer and 8 healthy controls were studied. The duodenal acid load after an amino acid soup was quantified by a double-marker technique. Mucosal biopsy specimens were taken endoscopically from the duodenal bulb before and after the test meal. Prostaglandin synthesis activity was measured by incubating biopsy homogenates in excess (/sup 14/C)arachidonic acid. Although mean duodenal acid load was higher in duodenal ulcer, ranges overlapped. Neither the qualitative normore » quantitative profile of mucosal prostaglandin synthesis activities differed significantly between test groups. Prostaglandin synthesis activities, however, tended to increase post cibum in controls, but change little or decrease in duodenal ulcer. Only by comparing the responses with a meal of both parameters together (duodenal acid load and the change in prostaglandin synthesis activities) was there complete or nearly complete separation of duodenal ulcer from controls. Greatest discrimination was observed with prostacyclin (6-keto-PGF1 alpha). We conclude that in health, mucosal prostaglandin generation in the duodenum is induced post cibum in relation to duodenal acid load; this may be a physiologic example of adaptive cytoprotection. In duodenal ulcer there may be a defect in such a mechanism.« less

Interactions between fatty acid synthesis, oxidation, and esterification in the production of triglyceride-rich lipoproteins by the liver.

PubMed

Fukuda, N; Ontko, J A

1984-08-01

In a series of experiments with male rat livers perfused with or without 5-tetradecyloxy-2-furoic acid (TOFA) in the presence and absence of oleate, the relationships between fatty acid synthesis, oxidation, and esterification from newly synthesized and exogenous fatty acid substrates have been examined. When livers from fed rats were perfused without exogenous fatty acid substrate, 20% of the triglyceride secreted was derived from de novo fatty acid synthesis. Addition of TOFA caused immediate and nearly complete inhibition of fatty acid synthesis, measured by incorporation of 3H2O into fatty acids. Concurrently, ketone body production increased 140% and triglyceride secretion decreased 84%. These marked reciprocal alterations in fatty acid synthesis and oxidation in the liver almost completely abolished the production of very low density lipoproteins (VLDL). Cholesterol synthesis was also depressed by TOFA, suggesting that this drug also inhibited lipid synthesis at a site other than acetyl-CoA carboxylase. When livers from fed rats were supplied with a continuous infusion of [1-14C]oleate as exogenous substrate, similar proportions, about 45-47%, of both ketone bodies and triglyceride in the perfusate were derived from the infused [1-14C]oleate. The production of ketone bodies was markedly increased by TOFA; the secretion of triglyceride and cholesterol were decreased. Altered conversion of [1-14C]oleate into these products occurred in parallel. While TOFA decreased esterification of oleate into triglyceride, incorporation of [1-14C]oleate into liver phospholipid was increased, indicating that TOFA also affected glycerolipid synthesis at the stage of diglyceride processing. The decreased secretion of triglyceride and cholesterol following TOFA treatment was localized almost exclusively in VLDL. The specific activities of 3H and of 14C fatty acids in triglyceride of the perfusate were greater than those of liver triglyceride, indicating preferential secretion of

Differential regulation of protein synthesis by amino acids and insulin in peripheral and visceral tissues of neonatal pigs

PubMed Central

Suryawan, Agus; O’Connor, Pamela M. J.; Bush, Jill A.; Nguyen, Hanh V.

2009-01-01

The high efficiency of protein deposition during the neonatal period is driven by high rates of protein synthesis, which are maximally stimulated after feeding. In the current study, we examined the individual roles of amino acids and insulin in the regulation of protein synthesis in peripheral and visceral tissues of the neonate by performing pancreatic glucose–amino acid clamps in overnight-fasted 7-day-old pigs. We infused pigs (n = 8–12/group) with insulin at 0, 10, 22, and 110 ng kg−0.66 min−1 to achieve ~0, 2, 6 and 30 μU ml−1 insulin so as to simulate below fasting, fasting, intermediate, and fed insulin levels, respectively. At each insulin dose, amino acids were maintained at the fasting or fed level. In conjunction with the highest insulin dose, amino acids were also allowed to fall below the fasting level. Tissue protein synthesis was measured using a flooding dose of L-[4-3H] phenylalanine. Both insulin and amino acids increased fractional rates of protein synthesis in longissimus dorsi, gastrocnemius, masseter, and diaphragm muscles. Insulin, but not amino acids, increased protein synthesis in the skin. Amino acids, but not insulin, increased protein synthesis in the liver, pancreas, spleen, and lung and tended to increase protein synthesis in the jejunum and kidney. Neither insulin nor amino acids altered protein synthesis in the stomach. The results suggest that the stimulation of protein synthesis by feeding in most tissues of the neonate is regulated by the post-prandial rise in amino acids. However, the feeding-induced stimulation of protein synthesis in skeletal muscles is independently mediated by insulin as well as amino acids. PMID:18683020

A simple synthesis of 2-keto-3-deoxy-D-erythro-hexonic acid isopropyl ester, a key sugar for the bacterial population living under metallic stress.

PubMed

Grison, Claire M; Renard, Brice-Loïc; Grison, Claude

2014-02-01

2-Keto-3-deoxy-D-erythro-hexonic acid (KDG) is the key intermediate metabolite of the Entner Doudoroff (ED) pathway. A simple, efficient and stereoselective synthesis of KDG isopropyl ester is described in five steps from 2,3-O-isopropylidene-D-threitol with an overall yield of 47%. KDG isopropyl ester is studied as an attractive marker of a functional Entner Doudoroff pathway. KDG isopropyl ester is used to promote growth of ammonium producing bacterial strains, showing interesting features in the remediation of heavy-metal polluted soils. Copyright © 2013 Elsevier Inc. All rights reserved.

All-trans retinoic acid regulates hepatic bile acid homeostasis

PubMed Central

Yang, Fan; He, Yuqi; Liu, Hui-Xin; Tsuei, Jessica; Jiang, Xiaoyue; Yang, Li; Wang, Zheng-Tao; Wan, Yu-Jui Yvonne

2014-01-01

Retinoic acid (RA) and bile acids share common roles in regulating lipid homeostasis and insulin sensitivity. In addition, the receptor for RA (retinoid x receptor) is a permissive partner of the receptor for bile acids, farnesoid x receptor (FXR/NR1H4). Thus, RA can activate the FXR-mediated pathway as well. The current study was designed to understand the effect of all-trans RA on bile acid homeostasis. Mice were fed an all-trans RA-supplemented diet and the expression of 46 genes that participate in regulating bile acid homeostasis was studied. The data showed that all-trans RA has a profound effect in regulating genes involved in synthesis and transport of bile acids. All-trans RA treatment reduced the gene expression levels of Cyp7a1, Cyp8b1, and Akr1d1, which are involved in bile acid synthesis. All-trans RA also decreased the hepatic mRNA levels of Lrh-1 (Nr5a2) and Hnf4α (Nr2a1), which positively regulate the gene expression of Cyp7a1 and Cyp8b1. Moreover, all-trans RA induced the gene expression levels of negative regulators of bile acid synthesis including hepatic Fgfr4, Fxr, and Shp (Nr0b2) as well as ileal Fgf15. All-trans RA also decreased the expression of Abcb11 and Slc51b, which have a role in bile acid transport. Consistently, all-trans RA reduced hepatic bile acid levels and the ratio of CA/CDCA, as demonstrated by liquid chromatography-mass spectrometry. The data suggest that all-trans RA-induced SHP may contribute to the inhibition of CYP7A1 and CYP8B1, which in turn reduces bile acid synthesis and affects lipid absorption in the gastrointestinal tract. PMID:25175738

By-products of electrochemical synthesis of suberic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Shirobokova, O.I.; Adamov, A.A.; Freidlin, G.N.

By-products of the electrochemical synthesis of dimethyl suberate from glutaric anhydride were studied. This is isolated by thermal dehydration of a mixture of lower dicarboxylic acids that are wastes from the production of adipic acid. To isolate the by-products, they used the methods of vacuum rectification and preparative gas-liquid chromatography, and for their identification, PMR, IR spectroscopy, gas-liquid chromatography, and other known physicochemical methods of investigation.

Amino acids augment muscle protein synthesis in neonatal pigs during acute endotoxemia by stimulating mTOR-dependent translation initiation.

PubMed

Orellana, Renán A; Jeyapalan, Asumthia; Escobar, Jeffery; Frank, Jason W; Nguyen, Hanh V; Suryawan, Agus; Davis, Teresa A

2007-11-01

In skeletal muscle of adults, sepsis reduces protein synthesis by depressing translation initiation and induces resistance to branched-chain amino acid stimulation. Normal neonates maintain a high basal muscle protein synthesis rate that is sensitive to amino acid stimulation. In the present study, we determined the effect of amino acids on protein synthesis in skeletal muscle and other tissues in septic neonates. Overnight-fasted neonatal pigs were infused with endotoxin (LPS, 0 and 10 microg.kg(-1).h(-1)), whereas glucose and insulin were maintained at fasting levels; amino acids were clamped at fasting or fed levels. In the presence of fasting insulin and amino acids, LPS reduced protein synthesis in longissimus dorsi (LD) and gastrocnemius muscles and increased protein synthesis in the diaphragm, but had no effect in masseter and heart muscles. Increasing amino acids to fed levels accelerated muscle protein synthesis in LD, gastrocnemius, masseter, and diaphragm. LPS stimulated protein synthesis in liver, lung, spleen, pancreas, and kidney in fasted animals. Raising amino acids to fed levels increased protein synthesis in liver of controls, but not LPS-treated animals. The increase in muscle protein synthesis in response to amino acids was associated with increased mTOR, 4E-BP1, and S6K1 phosphorylation and eIF4G-eIF4E association in control and LPS-infused animals. These findings suggest that amino acids stimulate skeletal muscle protein synthesis during acute endotoxemia via mTOR-dependent ribosomal assembly despite reduced basal protein synthesis rates in neonatal pigs. However, provision of amino acids does not further enhance the LPS-induced increase in liver protein synthesis.

Fatty acid synthesis in Escherichia coli

PubMed Central

Knivett, V. A.; Cullen, Julia

1967-01-01

1. Fatty acid formation by cells of a strain of Escherichia coli has been studied in the exponential, post-exponential and stationary phases of growth. 2. During the exponential phase of growth, the metabolic quotient (mμmoles of fatty acid synthesized/mg. dry wt. of cells/hr.) for each fatty acid in the extractable lipid was constant. 3. The newly synthesized fatty acid mixtures produced during this phase contained hexadecanoic acid (41%), hexadecenoic acid (31%), octadecenoic acid (21%) and the C17-cyclopropane acid, methylenehexadecanoic acid (4%). 4. As the proportion of newly synthesized material increased, changes in the fatty acid composition of the cells during this period were towards this constant composition. 5. Abrupt changes in fatty acid synthesis occurred when exponential growth ceased. 6. In media in which glycerol, or SO42− or Mg2+, was growth-limiting there was a small accumulation of C17-cyclopropane acid in cells growing in the post-exponential phase of growth. 7. Where either NH4+ or PO43− was growth-limiting and there were adequate supplies of glycerol, Mg2+ and SO42−, there was a marked accumulation of C17-cyclopropane acid and C19-cyclopropane acid appeared. 8. Under appropriate conditions the metabolic quotient for C17-cyclopropane acid increased up to sevenfold at the end of exponential growth. Simultaneously the metabolic quotients of the other acids fell. 9. A mixture of glycerol, Mg2+ and SO42− stimulated cyclopropane acid formation in resting cells. PMID:5340364

Racemic synthesis and solid phase peptide synthesis application of the chimeric valine/leucine derivative 2-amino-3,3,4-trimethyl-pentanoic acid.

PubMed

Pelà, M; Del Zoppo, L; Allegri, L; Marzola, E; Ruzza, C; Calo, G; Perissutti, E; Frecentese, F; Salvadori, S; Guerrini, R

2014-07-01

The synthesis of non natural amino acid 2-amino-3,3,4-trimethyl-pentanoic acid (Ipv) ready for solid phase peptide synthesis has been developed. Copper (I) chloride Michael addition, followed by a Curtius rearrangement are the key steps for the lpv synthesis. The racemic valine/leucine chimeric amino acid was then successfully inserted in position 5 of neuropeptide S (NPS) and the diastereomeric mixture separated by reverse phase HPLC. The two diastereomeric NPS derivatives were tested for intracellular calcium mobilization using HEK293 cells stably expressing the mouse NPS receptor where they behaved as partial agonist and pure antagonist.

Enhancement of Schizochytrium DHA synthesis by plasma mutagenesis aided with malonic acid and zeocin screening.

PubMed

Zhao, Ben; Li, Yafei; Li, Changling; Yang, Hailin; Wang, Wu

2018-03-01

Schizochytrium sp. accumulates valuable polyunsaturated fatty acid (PUFA), such as docosahexaenoic acid (DHA). In order to increase DHA synthesis in this microorganism, physical or chemical mutagenesis aided with powerful screening methods are still preferable, as its DHA synthetic pathway has not yet been clearly defined for gene manipulation. To breed this agglomerate microorganism of thick cell wall and rather large genome for increasing lipid content and DHA percentage, a novel strategy of atmospheric and room temperature plasma (ARTP) mutagenesis coupled with stepped malonic acid (MA) and zeocin resistance screening was developed. The final resulted mutant strain mz-17 was selected with 1.8-fold increased DHA production. Accompanied with supplementation of Fe 2+ in shake flask cultivation, DHA production of 14.0 g/L on average was achieved. This work suggests that ARTP mutation combined with stepped MA and zeocin resistance screening is an efficient method of breeding Schizochytrium sp. of high DHA production, and might be applied on other microorganisms for obtaining higher desired PUFA products.

Targeting arachidonic acid pathway by natural products for cancer prevention and therapy.

PubMed

Yarla, Nagendra Sastry; Bishayee, Anupam; Sethi, Gautam; Reddanna, Pallu; Kalle, Arunasree M; Dhananjaya, Bhadrapura Lakkappa; Dowluru, Kaladhar S V G K; Chintala, Ramakrishna; Duddukuri, Govinda Rao

2016-10-01

Arachidonic acid (AA) pathway, a metabolic process, plays a key role in carcinogenesis. Hence, AA pathway metabolic enzymes phospholipase A 2 s (PLA 2 s), cyclooxygenases (COXs) and lipoxygenases (LOXs) and their metabolic products, such as prostaglandins and leukotrienes, have been considered novel preventive and therapeutic targets in cancer. Bioactive natural products are a good source for development of novel cancer preventive and therapeutic drugs, which have been widely used in clinical practice due to their safety profiles. AA pathway inhibitory natural products have been developed as chemopreventive and therapeutic agents against several cancers. Curcumin, resveratrol, apigenin, anthocyans, berberine, ellagic acid, eugenol, fisetin, ursolic acid, [6]-gingerol, guggulsteone, lycopene and genistein are well known cancer chemopreventive agents which act by targeting multiple pathways, including COX-2. Nordihydroguaiaretic acid and baicalein can be chemopreventive molecules against various cancers by inhibiting LOXs. Several PLA 2 s inhibitory natural products have been identified with chemopreventive and therapeutic potentials against various cancers. In this review, we critically discuss the possible utility of natural products as preventive and therapeutic agents against various oncologic diseases, including prostate, pancreatic, lung, skin, gastric, oral, blood, head and neck, colorectal, liver, cervical and breast cancers, by targeting AA pathway. Further, the current status of clinical studies evaluating AA pathway inhibitory natural products in cancer is reviewed. In addition, various emerging issues, including bioavailability, toxicity and explorability of combination therapy, for the development of AA pathway inhibitory natural products as chemopreventive and therapeutic agents against human malignancy are also discussed. Copyright © 2016 Elsevier Ltd. All rights reserved.

Pore-expanded SBA-15 sulfonic acid silicas for biodiesel synthesis.

PubMed

Dacquin, J P; Lee, A F; Pirez, C; Wilson, K

2012-01-07

Here we present the first application of pore-expanded SBA-15 in heterogeneous catalysis. Pore expansion over the range 6-14 nm confers a striking activity enhancement towards fatty acid methyl ester (FAME) synthesis from triglycerides (TAG), and free fatty acid (FFA), attributed to improved mass transport and acid site accessibility. This journal is © The Royal Society of Chemistry 2012

Synthesis of acid-soluble spore proteins by Bacillus subtilis.

PubMed

Leventhal, J M; Chambliss, G H

1982-12-01

The major acid-soluble spore proteins (ASSPs) of Bacillus subtilis were detected by immunoprecipitation of radioactively labeled in vitro- and in vivo-synthesized proteins. ASSP synthesis in vivo began 2 h after the initiation of sporulation (t2) and reached its maximum rate at t7. This corresponded to the time of synthesis of mRNA that stimulated the maximum rate of ASSP synthesis in vitro. Under the set of conditions used in these experiments, protease synthesis began near t0, alkaline phosphatase synthesis began at about t2, and refractile spores were first observed between t7 and t8. In vivo- and in vitro-synthesized ASSPs comigrated in sodium dodecyl sulfate-polyacrylamide gels. Their molecular weights were 4,600 (alpha and beta) and 11,000 (gamma). The average half-life of the ASSP messages was 11 min when either rifampin (10 micrograms/ml) or actinomycin D (1 microgram/ml) was used to inhibit RNA synthesis.

Prebiotic synthesis of carboxylic acids, amino acids and nucleic acid bases from formamide under photochemical conditions⋆

NASA Astrophysics Data System (ADS)

Botta, Lorenzo; Mattia Bizzarri, Bruno; Piccinino, Davide; Fornaro, Teresa; Robert Brucato, John; Saladino, Raffaele

2017-07-01

The photochemical transformation of formamide in the presence of a mixture of TiO2 and ZnO metal oxides as catalysts afforded a large panel of molecules of biological relevance, including carboxylic acids, amino acids and nucleic acid bases. The reaction was less effective when performed in the presence of only one mineral, highlighting the role of synergic effects between the photoactive catalysts. Taken together, these results suggest that the synthesis of chemical precursors for both the genetic and the metabolic apparatuses might have occurred in a simple environment, consisting of formamide, photoactive metal oxides and UV-radiation.

Bile Acid Signaling Pathways from the Enterohepatic Circulation to the Central Nervous System

PubMed Central

Mertens, Kim L.; Kalsbeek, Andries; Soeters, Maarten R.; Eggink, Hannah M.

2017-01-01

Bile acids are best known as detergents involved in the digestion of lipids. In addition, new data in the last decade have shown that bile acids also function as gut hormones capable of influencing metabolic processes via receptors such as FXR (farnesoid X receptor) and TGR5 (Takeda G protein-coupled receptor 5). These effects of bile acids are not restricted to the gastrointestinal tract, but can affect different tissues throughout the organism. It is still unclear whether these effects also involve signaling of bile acids to the central nervous system (CNS). Bile acid signaling to the CNS encompasses both direct and indirect pathways. Bile acids can act directly in the brain via central FXR and TGR5 signaling. In addition, there are two indirect pathways that involve intermediate agents released upon interaction with bile acids receptors in the gut. Activation of intestinal FXR and TGR5 receptors can result in the release of fibroblast growth factor 19 (FGF19) and glucagon-like peptide 1 (GLP-1), both capable of signaling to the CNS. We conclude that when plasma bile acids levels are high all three pathways may contribute in signal transmission to the CNS. However, under normal physiological circumstances, the indirect pathway involving GLP-1 may evoke the most substantial effect in the brain. PMID:29163019

Prebiotic selection and assembly of proteinogenic amino acids and natural nucleotides from complex mixtures

NASA Astrophysics Data System (ADS)

Islam, Saidul; Bučar, Dejan-Krešimir; Powner, Matthew W.

2017-06-01

A central problem for the prebiotic synthesis of biological amino acids and nucleotides is to avoid the concomitant synthesis of undesired or irrelevant by-products. Additionally, multistep pathways require mechanisms that enable the sequential addition of reactants and purification of intermediates that are consistent with reasonable geochemical scenarios. Here, we show that 2-aminothiazole reacts selectively with two- and three-carbon sugars (glycolaldehyde and glyceraldehyde, respectively), which results in their accumulation and purification as stable crystalline aminals. This permits ribonucleotide synthesis, even from complex sugar mixtures. Remarkably, aminal formation also overcomes the thermodynamically favoured isomerization of glyceraldehyde into dihydroxyacetone because only the aminal of glyceraldehyde separates from the equilibrating mixture. Finally, we show that aminal formation provides a novel pathway to amino acids that avoids the synthesis of the non-proteinogenic α,α-disubstituted analogues. The common physicochemical mechanism that controls the proteinogenic amino acid and ribonucleotide assembly from prebiotic mixtures suggests that these essential classes of metabolite had a unified chemical origin.

WRINKLED1 Rescues Feedback Inhibition of Fatty Acid Synthesis in Hydroxylase-Expressing Seeds1[OPEN

PubMed Central

Browse, John

2016-01-01

Previous attempts at engineering Arabidopsis (Arabidopsis thaliana) to produce seed oils containing hydroxy fatty acids (HFA) have resulted in low yields of HFA compared with the native castor (Ricinus communis) plant and caused undesirable effects, including reduced total oil content. Recent studies have led to an understanding of problems involved in the accumulation of HFA in oils of transgenic plants, which include metabolic bottlenecks and a decrease in the rate of fatty acid synthesis. Focusing on engineering the triacylglycerol assembly mechanisms led to modest increases in the HFA content of seed oil, but much room for improvement still remains. We hypothesized that engineering fatty acid synthesis in the plastids to increase flux would facilitate enhanced total incorporation of fatty acids, including HFA, into seed oil. The transcription factor WRINKLED1 (WRI1) positively regulates the expression of genes involved in fatty acid synthesis and controls seed oil levels. We overexpressed Arabidopsis WRI1 in seeds of a transgenic line expressing the castor fatty acid hydroxylase. The proportion of HFA in the oil, the total HFA per seed, and the total oil content of seeds increased to an average of 20.9%, 1.26 µg, and 32.2%, respectively, across five independent lines, compared with 17.6%, 0.83 µg, and 27.9%, respectively, for isogenic segregants. WRI1 and WRI1-regulated genes involved in fatty acid synthesis were up-regulated, providing for a corresponding increase in the rate of fatty acid synthesis. PMID:27208047

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis.

PubMed

Wilson, Fiona A; Suryawan, Agus; Orellana, Renán A; Nguyen, Hanh V; Jeyapalan, Asumthia S; Gazzaneo, Maria C; Davis, Teresa A

2008-10-01

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 microg x kg(-1) x day(-1)) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P<0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P<0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1.eIF4E complex association, and increased active eIF4E.eIF4G complex formation (P<0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex.

Leucine Affects α-Amylase Synthesis through PI3K/Akt-mTOR Signaling Pathways in Pancreatic Acinar Cells of Dairy Calves.

PubMed

Guo, Long; Liang, Ziqi; Zheng, Chen; Liu, Baolong; Yin, Qingyan; Cao, Yangchun; Yao, Junhu

2018-05-23

Dietary nutrient utilization, particularly starch, is potentially limited by digestion in dairy cow small intestine because of shortage of α-amylase. Leucine acts as an effective signal molecular in the mTOR signaling pathway, which regulates a series of biological processes, especially protein synthesis. It has been reported that leucine could affect α-amylase synthesis and secretion in ruminant pancreas, but mechanisms have not been elaborated. In this study, pancreatic acinar (PA) cells were used as a model to determine the cellular signal of leucine influence on α-amylase synthesis. PA cells were isolated from newborn Holstein dairy bull calves and cultured in Dulbecco's modifed Eagle's medium/nutrient mixture F12 liquid media containing four leucine treatments (0, 0.23, 0.45, and 0.90 mM, respectively), following α-amylase activity, zymogen granule, and signal pathway factor expression detection. Rapamycin, a specific inhibitor of mTOR, was also applied to PA cells. Results showed that leucine increased ( p < 0.05) synthesis of α-amylase as well as phosphorylation of PI3K, Akt, mTOR, and S6K1 while reduced ( p < 0.05) GCN2 expression. Inhibition of mTOR signaling downregulated the α-amylase synthesis. In addition, the extracellular leucine dosage significantly influenced intracellular metabolism of isoleucine ( p < 0.05). Overall, leucine regulates α-amylase synthesis through promoting the PI3K/Akt-mTOR pathway and reducing the GCN2 pathway in PA cells of dairy calves. These pathways form the signaling network that controls the protein synthesis and metabolism. It would be of great interest in future studies to explore the function of leucine in ruminant nutrition.

In response to 'Can sugars be produced from fatty acids? A test case for pathway analysis tools'.

PubMed

Faust, Karoline; Croes, Didier; van Helden, Jacques

2009-12-01

In their article entitled 'Can sugars be produced from fatty acids? A test case for pathway analysis tools' de Figueiredo and co-authors assess the performance of three pathway prediction tools (METATOOL, PathFinding and Pathway Hunter Tool) using the synthesis of glucose-6-phosphate (G6P) from acetyl-CoA in humans as a test case. We think that this article is biased for three reasons: (i) the metabolic networks used as input for the respective tools were of very different sizes; (ii) the 'assessment' is restricted to two study cases; (iii) developers are inherently more skilled to use their own tools than those developed by other people. We extended the analyses led by de Figueiredo and clearly show that the apparent superior performance of their tool (METATOOL) is partly due to the differences in input network sizes. We also see a conceptual problem in the comparison of tools that serve different purposes. In our opinion, metabolic path finding and elementary mode analysis are answering different biological questions, and should be considered as complementary rather than competitive approaches. Supplementary data are available at Bioinformatics online.

Anaerobic biosynthesis of unsaturated fatty acids in the cyanobacterium, Oscillatoria limnetica

NASA Technical Reports Server (NTRS)

Jahnke, L. L.; Lee, B.; Sweeney, M. J.; Klein, H. P.

1989-01-01

The mechanism for synthesis of monounsaturated fatty acids under aerobic and anaerobic conditions was studied in the facultative anaerobic cyanobacterium, Oscillatoria limnetica. The hexadecenoic acid (C16:1) of aerobically grown O. limnetica was shown to contain both the delta 7 (79%) and delta 9 (21%) isomers, while the octadecenoic (C18:1) acid was entirely the delta 9 acid. Incorporation of [2-14C] acetate into the fatty acids under aerobic conditions resulted in synthesis of the delta 7 and delta 9 C16:1 and the delta 9 C18:1. Synthesis of unsaturated fatty acids in the presence of DCMU required sulfide. Anaerobic incubations in the presence of DCMU and sulfide (less than 0.003% atmospheric oxygen) resulted in a two-fold increase in monounsaturated fatty acids of both delta 7 and delta 9 C16:1 and delta 9 and delta 11 C18:1. The synthesis of these is characteristic of a bacterial-type, anaerobic pathway.

Leucine modulates dynamic phosphorylation events in insulin signaling pathway and enhances insulin-dependent glycogen synthesis in human skeletal muscle cells

PubMed Central

2014-01-01

Background Branched-chain amino acids, especially leucine, are known to interact with insulin signaling pathway and glucose metabolism. However, the mechanism by which this is exerted, remain to be clearly defined. In order to examine the effect of leucine on muscle insulin signaling, a set of experiments was carried out to quantitate phosphorylation events along the insulin signaling pathway in human skeletal muscle cell cultures. Cells were exposed to insulin, leucine or both, and phosphorylation events of key insulin signaling molecules were tracked over time so as to monitor time-related responses that characterize the signaling events and could be missed by a single sampling strategy limited to pre/post stimulus events. Results Leucine is shown to increase the magnitude of insulin-dependent phosphorylation of protein kinase B (AKT) at Ser473 and glycogen synthase kinase (GSK3β) at Ser21-9. Glycogen synthesis follows the same pattern of GSK3β, with a significant increase at 100 μM leucine plus insulin stimulus. Moreover, data do not show any statistically significant increase of pGSK3β and glycogen synthesis at higher leucine concentrations. Leucine is also shown to increase the magnitude of insulin-mediated extracellularly regulated kinase (ERK) phosphorylation; however, differently from AKT and GSK3β, ERK shows a transient behavior, with an early peak response, followed by a return to the baseline condition. Conclusions These experiments demonstrate a complementary effect of leucine on insulin signaling in a human skeletal muscle cell culture, promoting insulin-activated GSK3β phosphorylation and glycogen synthesis. PMID:24646332

Green synthesis of gold-chitosan nanocomposites for caffeic acid sensing.

PubMed

Di Carlo, Gabriella; Curulli, Antonella; Toro, Roberta G; Bianchini, Chiara; De Caro, Tilde; Padeletti, Giuseppina; Zane, Daniela; Ingo, Gabriel M

2012-03-27

In this work, colloidal gold nanoparticles (AuNPs) stabilized into a chitosan matrix were prepared using a green route. The synthesis was carried out by reducing Au(III) to Au(0) in an aqueous solution of chitosan and different organic acids (i.e., acetic, malonic, or oxalic acid). We have demonstrated that by varying the nature of the acid it is possible to tune the reduction rate of the gold precursor (HAuCl(4)) and to modify the morphology of the resulting metal nanoparticles. The use of chitosan, a biocompatible and biodegradable polymer with a large number of amino and hydroxyl functional groups, enables the simultaneous synthesis and surface modification of AuNPs in one pot. Because of the excellent film-forming capability of this polymer, AuNPs-chitosan solutions were used to obtain hybrid nanocomposite films that combine highly conductive AuNPs with a large number of organic functional groups. Herein, Au-chitosan nanocomposites are successfully proposed as sensitive and selective electrochemical sensors for the determination of caffeic acid, an antioxidant that has recently attracted much attention because of its benefits to human health. A linear response was obtained over a wide range of concentration from 5.00 × 10(-8) M to 2.00 × 10(-3) M, and the limit of detection (LOD) was estimated to be 2.50 × 10(-8) M. Moreover, further analyses have demonstrated that a high selectivity toward caffeic acid can be achieved without interference from catechin or ascorbic acid (flavonoid and nonphenolic antioxidants, respectively). This novel synthesis approach and the high performances of Au-chitosan hybrid materials in the determination of caffeic acid open up new routes in the design of highly efficient sensors, which are of great interest for the analysis of complex matrices such as wine, soft drinks, and fruit beverages. © 2012 American Chemical Society

Synthesis of new Cα-tetrasubstituted α-amino acids

PubMed Central

Grauer, Andreas A

2009-01-01

Summary Cα-Tetrasubstituted α-amino acids are important building blocks for the synthesis of peptidemimetics with stabilized secondary structure, because of their ability to rigidify the peptide backbone. Recently our group reported a new class of cyclic Cα-tetrasubstituted tetrahydrofuran α-amino acids prepared from methionine and aromatic aldehydes. We now report the extension of this methodology to aliphatic aldehydes. Although such aldehydes are prone to give aldol products under the reaction conditions used, we were able to obtain the target cyclic amino acids in low to moderate yields and in some cases with good diastereoselectivity. PMID:19259341

A Study on Amino Acids: Synthesis of Alpha-Aminophenylacetic Acid (Phenylglycine) and Determination of its Isoelectric Point.

ERIC Educational Resources Information Center

Barrelle, M.; And Others

1983-01-01

Background information and procedures are provided for an experimental study on aminophenylacetic acid (phenylglycine). These include physical chemistry (determination of isoelectric point by pH measurement) and organic chemistry (synthesis of an amino acid in racemic form) experiments. (JN)

Bacterial fatty acid metabolism in modern antibiotic discovery.

PubMed

Yao, Jiangwei; Rock, Charles O

2017-11-01

Bacterial fatty acid synthesis is essential for many pathogens and different from the mammalian counterpart. These features make bacterial fatty acid synthesis a desirable target for antibiotic discovery. The structural divergence of the conserved enzymes and the presence of different isozymes catalyzing the same reactions in the pathway make bacterial fatty acid synthesis a narrow spectrum target rather than the traditional broad spectrum target. Furthermore, bacterial fatty acid synthesis inhibitors are single-targeting, rather than multi-targeting like traditional monotherapeutic, broad-spectrum antibiotics. The single-targeting nature of bacterial fatty acid synthesis inhibitors makes overcoming fast-developing, target-based resistance a necessary consideration for antibiotic development. Target-based resistance can be overcome through multi-targeting inhibitors, a cocktail of single-targeting inhibitors, or by making the single targeting inhibitor sufficiently high affinity through a pathogen selective approach such that target-based mutants are still susceptible to therapeutic concentrations of drug. Many of the pathogens requiring new antibiotic treatment options encode for essential bacterial fatty acid synthesis enzymes. This review will evaluate the most promising targets in bacterial fatty acid metabolism for antibiotic therapeutics development and review the potential and challenges in advancing each of these targets to the clinic and circumventing target-based resistance. This article is part of a Special Issue entitled: Bacterial Lipids edited by Russell E. Bishop. Copyright © 2016 Elsevier B.V. All rights reserved.

Synthesis of Amino Acid Precursors with Organic Solids in Planetesimals with Liquid Water

NASA Technical Reports Server (NTRS)

Kebukawa, Y; Misawa, S.; Matsukuma, J.; Chan, Q. H. S.; Kobayashi, J.; Tachibana, S.; Zolensky, M. E.

2017-01-01

Amino acids are important ingredients of life that would have been delivered to Earth by extraterrestrial sources, e.g., comets and meteorites. Amino acids are found in aqueously altered carbonaceous chondrites in good part in the form of precursors that release amino acids after acid hydrolysis. Meanwhile, most of the organic carbon (greater than 70 weight %) in carbonaceous chondrites exists in the form of solvent insoluble organic matter (IOM) with complex macromolecular structures. Complex macromolecular organic matter can be produced by either photolysis of interstellar ices or aqueous chemistry in planetesimals. We focused on the synthesis of amino acids during aqueous alteration, and demonstrated one-pot synthesis of a complex suite of amino acids simultaneously with IOM via hydrothermal experiments simulating the aqueous processing

Acid Gradient across Plasma Membrane Can Drive Phosphate Bond Synthesis in Cancer Cells: Acidic Tumor Milieu as a Potential Energy Source

PubMed Central

Dhar, Gautam; Sen, Suvajit; Chaudhuri, Gautam

2015-01-01

Aggressive cancers exhibit an efficient conversion of high amounts of glucose to lactate accompanied by acid secretion, a phenomenon popularly known as the Warburg effect. The acidic microenvironment and the alkaline cytosol create a proton-gradient (acid gradient) across the plasma membrane that represents proton-motive energy. Increasing experimental data from physiological relevant models suggest that acid gradient stimulates tumor proliferation, and can also support its energy needs. However, direct biochemical evidence linking extracellular acid gradient to generation of intracellular ATP are missing. In this work, we demonstrate that cancer cells can synthesize significant amounts of phosphate-bonds from phosphate in response to acid gradient across plasma membrane. The noted phenomenon exists in absence of glycolysis and mitochondrial ATP synthesis, and is unique to cancer. Biochemical assays using viable cancer cells, and purified plasma membrane vesicles utilizing radioactive phosphate, confirmed phosphate-bond synthesis from free phosphate (Pi), and also localization of this activity to the plasma membrane. In addition to ATP, predominant formation of pyrophosphate (PPi) from Pi was also observed when plasma membrane vesicles from cancer cells were subjected to trans-membrane acid gradient. Cancer cytosols were found capable of converting PPi to ATP, and also stimulate ATP synthesis from Pi from the vesicles. Acid gradient created through glucose metabolism by cancer cells, as observed in tumors, also proved critical for phosphate-bond synthesis. In brief, these observations reveal a role of acidic tumor milieu as a potential energy source and may offer a novel therapeutic target. PMID:25874623

Hexanoic acid is a resistance inducer that protects tomato plants against Pseudomonas syringae by priming the jasmonic acid and salicylic acid pathways.

PubMed

Scalschi, Loredana; Vicedo, Begonya; Camañes, Gemma; Fernandez-Crespo, Emma; Lapeña, Leonor; González-Bosch, Carmen; García-Agustín, Pilar

2013-05-01

Hexanoic acid-induced resistance (Hx-IR) is effective against several pathogens in tomato plants. Our study of the mechanisms implicated in Hx-IR against Pseudomonas syringae pv. tomato DC3000 suggests that hexanoic acid (Hx) treatment counteracts the negative effect of coronatine (COR) and jasmonyl-isoleucine (JA-Ile) on the salicylic acid (SA) pathway. In Hx-treated plants, an increase in the expression of jasmonic acid carboxyl methyltransferase (JMT) and the SA marker genes PR1 and PR5 indicates a boost in this signalling pathway at the expense of a decrease in JA-Ile. Moreover, Hx treatment potentiates 12-oxo-phytodienoic acid accumulation, which suggests that this molecule might play a role per se in Hx-IR. These results support a positive relationship between the SA and JA pathways in Hx-primed plants. Furthermore, one of the mechanisms of virulence mediated by COR is stomatal re-opening on infection with P. syringae. In this work, we observed that Hx seems to inhibit stomatal opening in planta in the presence of COR, which suggests that, on infection in tomato, this treatment suppresses effector action to prevent bacterial entry into the mesophyll. © 2012 BSPP AND BLACKWELL PUBLISHING LTD.

Synthesis of novel acid electrolytes for phosphoric acid fuel cells

NASA Astrophysics Data System (ADS)

Adcock, James L.

1988-11-01

A 40 millimole per hour scale aerosol direct fluorination reactor was constructed. F-Methyl F-4-methoxybutanoate and F-4-methoxybutanoyl fluoride were synthesized by aerosol direct fluorination of methyl 4-methoxybutanoate. Basic hydrolysis of the perfluorinated derivatives produce sodium F-4 methoxybutanoate which was pyrolyzed to F-3-methoxy-1-propene. Purification and shipment of 33 grams of F-3-methoxy-1-propene followed. Syntheses by analogous methods allowed production and shipment of 5 grams of F-3-ethoxy 1-propene, 18 grams of F-3-(2-methoxy.ethoxy) 1-propene, and 37 grams of F-3,3-dimethyl 1-butene. Eighteen grams of F-2,2-dimethyl 1-chloropropane was produced directly and shipped. As suggested by other contractors, 5 grams of F-3-methoxy 1-iodopropane, and 5 grams of F-3-(2-methoxy.ethoxy) 1-iodopropane were produced by converting the respective precursor acid sodium salts produced for olefin synthesis to the silver salts and pyrolyzing them with iodine. Each of these compounds was prepared for the first time by the aerosol fluorination process during the course of the contract. These samples were provided to other Gas Research Institute (GRI) contractors for synthesis of perfluorinated sulfur (VI) and phosphorous (V) acids.

l-Tartaric acid synthesis from vitamin C in higher plants

PubMed Central

DeBolt, Seth; Cook, Douglas R.; Ford, Christopher M.

2006-01-01

The biosynthetic pathway of l-tartaric acid, the form most commonly encountered in nature, and its catabolic ties to vitamin C, remain a challenge to plant scientists. Vitamin C and l-tartaric acid are plant-derived metabolites with intrinsic human value. In contrast to most fruits during development, grapes accumulate l-tartaric acid, which remains within the berry throughout ripening. Berry taste and the organoleptic properties and aging potential of wines are intimately linked to levels of l-tartaric acid present in the fruit, and those added during vinification. Elucidation of the reactions relating l-tartaric acid to vitamin C catabolism in the Vitaceae showed that they proceed via the oxidation of l-idonic acid, the proposed rate-limiting step in the pathway. Here we report the use of transcript and metabolite profiling to identify candidate cDNAs from genes expressed at developmental times and in tissues appropriate for l-tartaric acid biosynthesis in grape berries. Enzymological analyses of one candidate confirmed its activity in the proposed rate-limiting step of the direct pathway from vitamin C to tartaric acid in higher plants. Surveying organic acid content in Vitis and related genera, we have identified a non-tartrate-forming species in which this gene is deleted. This species accumulates in excess of three times the levels of vitamin C than comparably ripe berries of tartrate-accumulating species, suggesting that modulation of tartaric acid biosynthesis may provide a rational basis for the production of grapes rich in vitamin C. PMID:16567629

Serine hydroxymethyltransferase anchors de novo thymidylate synthesis pathway to nuclear lamina for DNA synthesis.

PubMed

Anderson, Donald D; Woeller, Collynn F; Chiang, En-Pei; Shane, Barry; Stover, Patrick J

2012-03-02

The de novo thymidylate biosynthetic pathway in mammalian cells translocates to the nucleus for DNA replication and repair and consists of the enzymes serine hydroxymethyltransferase 1 and 2α (SHMT1 and SHMT2α), thymidylate synthase, and dihydrofolate reductase. In this study, we demonstrate that this pathway forms a multienzyme complex that is associated with the nuclear lamina. SHMT1 or SHMT2α is required for co-localization of dihydrofolate reductase, SHMT, and thymidylate synthase to the nuclear lamina, indicating that SHMT serves as scaffold protein that is essential for complex formation. The metabolic complex is enriched at sites of DNA replication initiation and associated with proliferating cell nuclear antigen and other components of the DNA replication machinery. These data provide a mechanism for previous studies demonstrating that SHMT expression is rate-limiting for de novo thymidylate synthesis and indicate that de novo thymidylate biosynthesis occurs at replication forks.

Differential effects of long-term leucine infusion on tissue protein synthesis in neonatal pigs

USDA-ARS?s Scientific Manuscript database

Leucine is unique among the amino acids in its ability to promote protein synthesis by activating translation initiation via the mammalian target of rapamycin (mTOR) pathway. Previously, we showed that leucine infusion acutely stimulates protein synthesis in fast-twitch glycolytic muscle of neonatal...

Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis

PubMed Central

Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L. Ashley; Lopes-Virella, Maria F.

2018-01-01

It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages. PMID:29474492

Docosahexaenoic acid antagonizes the boosting effect of palmitic acid on LPS inflammatory signaling by inhibiting gene transcription and ceramide synthesis.

PubMed

Jin, Junfei; Lu, Zhongyang; Li, Yanchun; Cowart, L Ashley; Lopes-Virella, Maria F; Huang, Yan

2018-01-01

It is well known that saturated fatty acids (SFAs) and unsaturated fatty acid, in particular omega-3 polyunsaturated fatty acids (n-3 PUFAs), have different effects on inflammatory signaling: SFAs are pro-inflammatory but n-3 PUFAs have strong anti-inflammatory properties. We have reported that palmitic acid (PA), a saturated fatty acid, robustly amplifies lipopolysaccharide (LPS) signaling to upregulate proinflammatory gene expression in macrophages. We also reported that the increased production of ceramide (CER) via sphingomyelin (SM) hydrolysis and CER de novo synthesis plays a key role in the synergistic effect of LPS and PA on proinflammatory gene expression. However, it remains unclear if n-3 PUFAs are capable of antagonizing the synergistic effect of LPS and PA on gene expression and CER production. In this study, we employed the above macrophage culture system and lipidomical analysis to assess the effect of n-3 PUFAs on proinflammatory gene expression and CER production stimulated by LPS and PA. Results showed that DHA strongly inhibited the synergistic effect of LPS and PA on proinflammatory gene expression by targeting nuclear factor kappa B (NFκB)-dependent gene transcription. Results also showed that DHA inhibited the cooperative effect of LPS and PA on CER production by targeting CER de novo synthesis, but not SM hydrolysis. Furthermore, results showed that myriocin, a specific inhibitor of serine palmitoyltransferase, strongly inhibited both LPS-PA-stimulated CER synthesis and proinflammatory gene expression, indicating that CER synthesis is associated with proinflammatory gene expression and that inhibition of CER synthesis contributes to DHA-inhibited proinflammatory gene expression. Taken together, this study demonstrates that DHA antagonizes the boosting effect of PA on LPS signaling on proinflammatory gene expression by targeting both NFκB-dependent transcription and CER de novo synthesis in macrophages.

Aldehyde dehydrogenase 1a1 mediates a GABA synthesis pathway in midbrain dopaminergic neurons.

PubMed

Kim, Jae-Ick; Ganesan, Subhashree; Luo, Sarah X; Wu, Yu-Wei; Park, Esther; Huang, Eric J; Chen, Lu; Ding, Jun B

2015-10-02

Midbrain dopamine neurons are an essential component of the basal ganglia circuitry, playing key roles in the control of fine movement and reward. Recently, it has been demonstrated that γ-aminobutyric acid (GABA), the chief inhibitory neurotransmitter, is co-released by dopamine neurons. Here, we show that GABA co-release in dopamine neurons does not use the conventional GABA-synthesizing enzymes, glutamate decarboxylases GAD65 and GAD67. Our experiments reveal an evolutionarily conserved GABA synthesis pathway mediated by aldehyde dehydrogenase 1a1 (ALDH1a1). Moreover, GABA co-release is modulated by ethanol (EtOH) at concentrations seen in blood alcohol after binge drinking, and diminished ALDH1a1 leads to enhanced alcohol consumption and preference. These findings provide insights into the functional role of GABA co-release in midbrain dopamine neurons, which may be essential for reward-based behavior and addiction. Copyright © 2015, American Association for the Advancement of Science.

Transfer of the cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis

PubMed Central

Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik

2016-01-01

Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1–0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. PMID:26969746

Synthesis and antituberculosis activity of new fatty acid amides.

PubMed

D'Oca, Caroline Da Ros Montes; Coelho, Tatiane; Marinho, Tamara Germani; Hack, Carolina Rosa Lopes; Duarte, Rodrigo da Costa; da Silva, Pedro Almeida; D'Oca, Marcelo Gonçalves Montes

2010-09-01

This work reports the synthesis of new fatty acid amides from C16:0, 18:0, 18:1, 18:1 (OH), and 18:2 fatty acids families with cyclic and acyclic amines and demonstrate for the first time the activity of these compounds as antituberculosis agents against Mycobacterium tuberculosis H(37)Rv, M. tuberculosis rifampicin resistance (ATCC 35338), and M. tuberculosis isoniazid resistance (ATCC 35822). The fatty acid amides derivate from ricinoleic acid were the most potent one among a series of tested compounds, with a MIC 6.25 microg/mL for resistance strains. Copyright 2010 Elsevier Ltd. All rights reserved.

Pulmonary fatty acid synthesis. I. Mitochondrial acetyl transfer by rat lung in vitro.

PubMed

Evans, R M; Scholz, R W

1977-04-01

Incorporation of tritiated water into fatty acids by rat adipose tissue and lung tissue slices incubated with 5 mM glucose indicated a level of fatty acid synthesis in rat lung approximately 15% that observed in adipose tissue in vitro. (-)-Hydroxycitrate, and inhibitor of ATP citrate lyase, markedly reduced tritiated water incorporation into fatty acids by lung tissue slices. The effects of (-)-hydroxycitrate and n-butymalonate on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate suggested that citrate is a major acetyl carrier for de novo fatty acid synthesis in lung tissue. Alternative mechanisms to citrate as an acetyl carrier were also considered. Lung mitochondrial preparations formed significant levels of acetylcarnitine in the presence of pyruvate and carnitine. However, the effect of carnitine on the incorporation of 14C-labeled glucose, pyruvate, acetate, and citrate into fatty acids by lung tissue slices indicated that acetylcarnitine may not be a significant acetyl carrier for fatty acid synthesis but may serve as an acetyl "buffer" in the control of mitochondrial acetyl-CoA levels. Additionally, it appears unlikely that either acetylaspartate or acetoacetate are of major importance in acetyl transfer in lung tissue.

Synthesis of the sulfur amino acids: cysteine and methionine.

PubMed

Wirtz, Markus; Droux, Michel

2005-12-01

This review will assess new features reported for the molecular and biochemical aspects of cysteine and methionine biosynthesis in Arabidopsis thaliana with regards to early published data from other taxa including crop plants and bacteria (Escherichia coli as a model). By contrast to bacteria and fungi, plant cells present a complex organization, in which the sulfur network takes place in multiple sites. Particularly, the impact of sulfur amino-acid biosynthesis compartmentalization will be addressed in respect to localization of sulfur reduction. To this end, the review will focus on regulation of sulfate reduction by synthesis of cysteine through the cysteine synthase complex and the synthesis of methionine and its derivatives. Finally, regulatory aspects of sulfur amino-acid biosynthesis will be explored with regards to interlacing processes such as photosynthesis, carbon and nitrogen assimilation.

Chlamydia trachomatis Scavenges Host Fatty Acids for Phospholipid Synthesis via an Acyl-Acyl Carrier Protein Synthetase*

PubMed Central

Yao, Jiangwei; Dodson, V. Joshua; Frank, Matthew W.; Rock, Charles O.

2015-01-01

The obligate intracellular parasite Chlamydia trachomatis has a reduced genome but relies on de novo fatty acid and phospholipid biosynthesis to produce its membrane phospholipids. Lipidomic analyses showed that 8% of the phospholipid molecular species synthesized by C. trachomatis contained oleic acid, an abundant host fatty acid that cannot be made by the bacterium. Mass tracing experiments showed that isotopically labeled palmitic, myristic, and lauric acids added to the medium were incorporated into C. trachomatis-derived phospholipid molecular species. HeLa cells did not elongate lauric acid, but infected HeLa cell cultures elongated laurate to myristate and palmitate. The elongated fatty acids were incorporated exclusively into C. trachomatis-produced phospholipid molecular species. C. trachomatis has adjacent genes encoding the separate domains of the bifunctional acyl-acyl carrier protein (ACP) synthetase/2-acylglycerolphosphoethanolamine acyltransferase gene (aas) of Escherichia coli. The CT775 gene encodes an acyltransferase (LpaT) that selectively transfers fatty acids from acyl-ACP to the 1-position of 2-acyl-glycerophospholipids. The CT776 gene encodes an acyl-ACP synthetase (AasC) with a substrate preference for palmitic compared with oleic acid in vitro. Exogenous fatty acids were elongated and incorporated into phospholipids by Escherichia coli-expressing AasC, illustrating its function as an acyl-ACP synthetase in vivo. These data point to an AasC-dependent pathway in C. trachomatis that selectively scavenges host saturated fatty acids to be used for the de novo synthesis of its membrane constituents. PMID:26195634

Metabolism of organic acids, nitrogen and amino acids in chlorotic leaves of 'Honeycrisp' apple (Malus domestica Borkh) with excessive accumulation of carbohydrates.

PubMed

Wang, Huicong; Ma, Fangfang; Cheng, Lailiang

2010-07-01

Metabolite profiles and activities of key enzymes in the metabolism of organic acids, nitrogen and amino acids were compared between chlorotic leaves and normal leaves of 'Honeycrisp' apple to understand how accumulation of non-structural carbohydrates affects the metabolism of organic acids, nitrogen and amino acids. Excessive accumulation of non-structural carbohydrates and much lower CO(2) assimilation were found in chlorotic leaves than in normal leaves, confirming feedback inhibition of photosynthesis in chlorotic leaves. Dark respiration and activities of several key enzymes in glycolysis and tricarboxylic acid (TCA) cycle, ATP-phosphofructokinase, pyruvate kinase, citrate synthase, aconitase and isocitrate dehydrogenase were significantly higher in chlorotic leaves than in normal leaves. However, concentrations of most organic acids including phosphoenolpyruvate (PEP), pyruvate, oxaloacetate, 2-oxoglutarate, malate and fumarate, and activities of key enzymes involved in the anapleurotic pathway including PEP carboxylase, NAD-malate dehydrogenase and NAD-malic enzyme were significantly lower in chlorotic leaves than in normal leaves. Concentrations of soluble proteins and most free amino acids were significantly lower in chlorotic leaves than in normal leaves. Activities of key enzymes in nitrogen assimilation and amino acid synthesis, including nitrate reductase, glutamine synthetase, ferredoxin and NADH-dependent glutamate synthase, and glutamate pyruvate transaminase were significantly lower in chlorotic leaves than in normal leaves. It was concluded that, in response to excessive accumulation of non-structural carbohydrates, glycolysis and TCA cycle were up-regulated to "consume" the excess carbon available, whereas the anapleurotic pathway, nitrogen assimilation and amino acid synthesis were down-regulated to reduce the overall rate of amino acid and protein synthesis.

Synthesis of 6-phosphofructose aspartic acid and some related Amadori compounds.

PubMed

Hansen, Alexandar L; Behrman, Edward J

2016-08-05

We describe the synthesis and characterization of 6-phosphofructose-aspartic acid, an intermediate in the metabolism of fructose-asparagine by Salmonella. We also report improved syntheses of fructose-asparagine itself and of fructose-aspartic acid. Copyright © 2016 Elsevier Ltd. All rights reserved.

Stereoselective Synthesis of α-Amino-C-phosphinic Acids and Derivatives.

PubMed

Viveros-Ceballos, José Luis; Ordóñez, Mario; Sayago, Francisco J; Cativiela, Carlos

2016-08-29

α-Amino-C-phosphinic acids and derivatives are an important group of compounds of synthetic and medicinal interest and particular attention has been dedicated to their stereoselective synthesis in recent years. Among these, phosphinic pseudopeptides have acquired pharmacological importance in influencing physiologic and pathologic processes, primarily acting as inhibitors for proteolytic enzymes where molecular stereochemistry has proven to be critical. This review summarizes the latest developments in the asymmetric synthesis of acyclic and phosphacyclic α-amino-C-phosphinic acids and derivatives, following in the first case an order according to the strategy used, whereas for cyclic compounds the nitrogen embedding in the heterocyclic core is considered. In addition selected examples of pharmacological implications of title compounds are also disclosed.

Evolution of Abscisic Acid Synthesis and Signaling Mechanisms

PubMed Central

Hauser, Felix; Waadt, Rainer; Schroeder, Julian I.

2011-01-01

The plant hormone abscisic acid (ABA) mediates seed dormancy, controls seedling development and triggers tolerance to abiotic stresses, including drought. Core ABA signaling components consist of a recently identified group of ABA receptor proteins of the PYRABACTIN RESISTANCE (PYR)/REGULATORY COMPONENT OF ABA RECEPTOR (RCAR) family that act as negative regulators of members of the PROTEIN PHOSPHATASE 2C (PP2C) family. Inhibition of PP2C activity enables activation of SNF1-RELATED KINASE 2 (SnRK2) protein kinases, which target downstream components, including transcription factors, ion channels and NADPH oxidases. These and other components form a complex ABA signaling network. Here, an in depth analysis of the evolution of components in this ABA signaling network shows that (i) PYR/RCAR ABA receptor and ABF-type transcription factor families arose during land colonization of plants and are not found in algae and other species, (ii) ABA biosynthesis enzymes have evolved to plant- and fungal-specific forms, leading to different ABA synthesis pathways, (iii) existing stress signaling components, including PP2C phosphatases and SnRK kinases, were adapted for novel roles in this plant-specific network to respond to water limitation. In addition, evolutionarily conserved secondary structures in the PYR/RCAR ABA receptor family are visualized. PMID:21549957

Synthesis and characterization of 3-ketohexadecanoic acid-1-14-C, DL-3-hydroxyhexadecanoic acid-1-14-C, and trans-2-hexadecenoic acid-1-14-C.

PubMed

Jones, J A; Blecher, M

1966-05-01

The chemical synthesis and characterization of three intermediates in the Beta oxidation of palmitic acid-1-(14)C by rat liver mitochondria, namely, 3-ketohexadecanoic acid-1-(14)C, DL-3-hydroxyhexadecanoic acid-1-(14)C, and trans-2-hexadecenoic acid-1-(14)C, are described.

The kynurenine pathway in schizophrenia and bipolar disorder.

PubMed

Erhardt, Sophie; Schwieler, Lilly; Imbeault, Sophie; Engberg, Göran

2017-01-01

The kynurenine pathway of tryptophan degradation generates several neuroactive compounds. Of those, kynurenic acid is an N-methyl-d-aspartate (NMDA) and alpha7 nicotinic receptor antagonist. The kynurenic acid hypothesis of schizophrenia is built upon the fact that kynurenic acid blocks glutamate receptors and is elevated in schizophrenia. Kynurenic acid tightly controls glutamatergic and dopaminergic neurotransmission and elevated brain levels appear related to psychotic symptoms and cognitive impairments. Contributing to enhanced production of kynurenic acid, the expression and enzyme activity of kynurenine 3-monooxygenase (KMO) are reduced in schizophrenia and in bipolar patients with a history of psychosis. The kynurenine pathway is also critically regulated by cytokines, and, indeed, the pro-inflammatory cytokines interleukin (IL)-1β and IL-6 are elevated in schizophrenia and bipolar disorder and stimulate the production of kynurenic acid. One physiological mechanism controlling the activity of the kynurenine pathway originates from the protein sorting nexin 7 (SNX7). This glial signaling pathway initiates a caspase-8-driven activation of IL-1β that induces tryptophan-2,3-dioxygenase 2 (TDO2), an enzyme in the kynurenine pathway. A recent study shows that a genetic variation resulting in decreased expression of SNX7 is linked to increased central levels of kynurenic acid and ultimately to psychosis and cognitive dysfunction in bipolar disorder. Experimental studies highlight the detrimental effects of increased synthesis of kynurenic acid during sensitive periods of early brain development. Furthermore, experimental studies strongly support inhibition of kynurenine aminotransferase (KAT) II as a novel target and a valuable pharmacological strategy in the treatment of psychosis and for improving cognitive performance relevant for schizophrenia. This article is part of the Special Issue entitled 'The Kynurenine Pathway in Health and Disease'. Copyright �

Ixodes scapularis Tick Cells Control Anaplasma phagocytophilum Infection by Increasing the Synthesis of Phosphoenolpyruvate from Tyrosine.

PubMed

Cabezas-Cruz, Alejandro; Espinosa, Pedro J; Obregón, Dasiel A; Alberdi, Pilar; de la Fuente, José

2017-01-01

The obligate intracellular pathogen, Anaplasma phagocytophilum , is the causative agent of life-threatening diseases in humans and animals. A. phagocytophilum is an emerging tick-borne pathogen in the United States, Europe, Africa and Asia, with increasing numbers of infected people and animals every year. It is increasingly recognized that intracellular pathogens modify host cell metabolic pathways to increase infection and transmission in both vertebrate and invertebrate hosts. Recent reports have shown that amino acids are central to the host-pathogen metabolic interaction. In this study, a genome-wide search for components of amino acid metabolic pathways was performed in Ixodes scapularis , the main tick vector of A. phagocytophilum in the United States, for which the genome was recently published. The enzymes involved in the synthesis and degradation pathways of the twenty amino acids were identified. Then, the available transcriptomics and proteomics data was used to characterize the mRNA and protein levels of I. scapularis amino acid metabolic pathway components in response to A. phagocytophilum infection of tick tissues and ISE6 tick cells. Our analysis was focused on the interplay between carbohydrate and amino acid metabolism during A. phagocytophilum infection in ISE6 cells. The results showed that tick cells increase the synthesis of phosphoenolpyruvate (PEP) from tyrosine to control A. phagocytophilum infection. Metabolic pathway analysis suggested that this is achieved by (i) increasing the transcript and protein levels of mitochondrial phosphoenolpyruvate carboxykinase (PEPCK-M), (ii) shunting tyrosine into the tricarboxylic acid (TCA) cycle to increase fumarate and oxaloacetate which will be converted into PEP by PEPCK-M, and (iii) blocking all the pathways that use PEP downstream gluconeogenesis (i.e., de novo serine synthesis pathway (SSP), glyceroneogenesis and gluconeogenesis). While sequestering host PEP may be critical for this bacterium

Inhibition of Fatty Acid Synthesis Induces Apoptosis of Human Pancreatic Cancer Cells.

PubMed

Nishi, Koji; Suzuki, Kenta; Sawamoto, Junpei; Tokizawa, Yuma; Iwase, Yumiko; Yumita, Nagahiko; Ikeda, Toshihiko

2016-09-01

Cancer cells tend to have a high requirement for lipids, including fatty acids, cholesterol and triglyceride, because of their rapid proliferative rate compared to normal cells. In this study, we investigated the effects of inhibition of lipid synthesis on the proliferation and viability of human pancreatic cancer cells. Of the inhibitors of lipid synthesis that were tested, 5-(tetradecyloxy)-2-furoic acid (TOFA), which is an inhibitor of acetyl-CoA carboxylase, and the fatty acid synthase (FAS) inhibitors cerulenin and irgasan, significantly suppressed the proliferation of MiaPaCa-2 and AsPC-1 cells. Treatment of MiaPaCa-2 cells with these inhibitors significantly increased the number of apoptotic cells. In addition, TOFA increased caspase-3 activity and induced cleavage of poly (ADP-ribose) polymerase in MiaPaCa-2 cells. Moreover, addition of palmitate to MiaPaCa-2 cells treated with TOFA rescued cells from apoptotic cell death. These results suggest that TOFA induces apoptosis via depletion of fatty acids and that, among the various aspects of lipid metabolism, inhibition of fatty acid synthesis may be a notable target for the treatment of human pancreatic cancer cells. Copyright© 2016 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Microbial chemical factories: recent advances in pathway engineering for synthesis of value added chemicals.

PubMed

Dhamankar, Himanshu; Prather, Kristala L J

2011-08-01

The dwindling nature of petroleum and other fossil reserves has provided impetus towards microbial synthesis of fuels and value added chemicals from biomass-derived sugars as a renewable resource. Microbes have naturally evolved enzymes and pathways that can convert biomass into hundreds of unique chemical structures, a property that can be effectively exploited for their engineering into Microbial Chemical Factories (MCFs). De novo pathway engineering facilitates expansion of the repertoire of microbially synthesized compounds beyond natural products. In this review, we visit some recent successes in such novel pathway engineering and optimization, with particular emphasis on the selection and engineering of pathway enzymes and balancing of their accessory cofactors. Copyright © 2011 Elsevier Ltd. All rights reserved.

α-Ketophosphonic Acid Esters — Synthesis, Structure, and Reactions

NASA Astrophysics Data System (ADS)

Zhdanov, Yu A.; Uzlova, L. A.; Glebova, Z. I.

1980-09-01

Studies on the synthesis and properties of α-ketophosphonic acid esters (KPE) — a class of highly reactive organophosphorus compounds — are surveyed. Data are presented concerning instances of the anomalous course of the process in the synthesis of KPE by the Arbuzov reaction. The reactions of KPE with nucleophiles, including those which lead to the rupture of the phosphorus-carbon bond, are examined in detail. The problems of the stereochemistry of KPE are dealt with briefly. The bibliography includes 162 references.

Fed levels of amino acids are required for the somatotropin-induced increase in muscle protein synthesis

PubMed Central

Wilson, Fiona A.; Suryawan, Agus; Orellana, Renán A.; Nguyen, Hanh V.; Jeyapalan, Asumthia S.; Gazzaneo, Maria C.; Davis, Teresa A.

2008-01-01

Chronic somatotropin (pST) treatment in pigs increases muscle protein synthesis and circulating insulin, a known promoter of protein synthesis. Previously, we showed that the pST-mediated rise in insulin could not account for the pST-induced increase in muscle protein synthesis when amino acids were maintained at fasting levels. This study aimed to determine whether the pST-induced increase in insulin promotes skeletal muscle protein synthesis when amino acids are provided at fed levels and whether the response is associated with enhanced translation initiation factor activation. Growing pigs were treated with pST (0 or 180 μg·kg−1·day−1) for 7 days, and then pancreatic-glucose-amino acid clamps were performed. Amino acids were raised to fed levels in the presence of either fasted or fed insulin concentrations; glucose was maintained at fasting throughout. Muscle protein synthesis was increased by pST treatment and by amino acids (with or without insulin) (P < 0.001). In pST-treated pigs, fed, but not fasting, amino acid concentrations further increased muscle protein synthesis rates irrespective of insulin level (P < 0.02). Fed amino acids, with or without raised insulin concentrations, increased the phosphorylation of S6 kinase (S6K1) and eukaryotic initiation factor (eIF) 4E-binding protein 1 (4EBP1), decreased inactive 4EBP1·eIF4E complex association, and increased active eIF4E·eIF4G complex formation (P < 0.02). pST treatment did not alter translation initiation factor activation. We conclude that the pST-induced stimulation of muscle protein synthesis requires fed amino acid levels, but not fed insulin levels. However, under the current conditions, the response to amino acids is not mediated by the activation of translation initiation factors that regulate mRNA binding to the ribosomal complex. PMID:18682537

Conditional knock-out of lipoic acid protein ligase 1 reveals redundancy pathway for lipoic acid metabolism in Plasmodium berghei malaria parasite.

PubMed

Wang, Min; Wang, Qiong; Gao, Xiang; Su, Zhong

2017-06-27

Lipoic acid is a cofactor for α-keto acid dehydrogenase system that is involved in the central energy metabolism. In the apicomplexan parasite, Plasmodium, lipoic acid protein ligase 1 (LplA1) and LplA2 catalyse the ligation of acquired lipoic acid to the dehydrogenase complexes in the mitochondrion. The enzymes LipB and LipA mediate lipoic acid synthesis and ligation to the enzymes in the apicoplast. These enzymes in the lipoic acid metabolism machinery have been shown to play important roles in the biology of Plasmodium parasites, but the relationship between the enzymes is not fully elucidated. We used an anhydrotetracycline (ATc)-inducible transcription system to generate transgenic P. berghei parasites in which the lplA1 gene was conditionally knocked out (LplA1-cKO). Phenotypic changes and the lplA1 and lplA2 gene expression profiles of cloned LplA1-cKO parasites were analysed. LplA1-cKO parasites showed severely impaired growth in vivo in the first 8 days of infection, and retarded blood-stage development in vitro, in the absence of ATc. However, these parasites resumed viability in the late stage of infection and mounted high levels of parasitemia leading to the death of the hosts. Although lplA1 mRNA expression was regulated tightly by ATc during the whole course of infection, lplA2 mRNA expression was significantly increased in the late stage of infection only in the LplA1-cKO parasites that were not exposed to ATc. The lplA2 gene can be activated as an alternative pathway to compensate for the loss of LplA1 activity and to maintain lipoic acid metabolism.

Synthesis, characterization and reactivity of 3-mercaptopyruvic acid.

PubMed

Galardon, Erwan; Lec, Jean-Chrstophe

2018-05-20

A synthesis of the sulfur metabolic compound 3-mercaptopyruvic acid (3-MPH) is reported and allowed its isolation and characterization for the first time. Detailed kinetic, thermodynamic and spectroscopic studies of its complex behaviour in solution are discussed. © 2018 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Glass-ionomer cement formulations. II. The synthesis of novel polycarobxylic acids.

PubMed

Crisp, S; Kent, B E; Lewis, B G; Ferner, A J; Wilson, A D

1980-06-01

The synthesis of many polycarboxylic acids is reported. An account is given of their stability in aqueous solution and the properties of cements formed by their reaction with ion-leachable glasses. A copolymer of acrylic and itaconic acids was found to combine several favorable characteristics.

Increased synthesis of a new oleanane-type saponin in hairy roots of marigold (Calendula officinalis) after treatment with jasmonic acid.

PubMed

Markowski, Michał; Długosz, Marek; Szakiel, Anna; Durli, Mathieu; Poinsignon, Sophie; Bouguet-Bonnet, Sabine; Vernex-Loset, Lionel; Krier, Gabriel; Henry, Max

2018-04-18

Native plant of marigold (Calendula officinalis L.) synthesizes oleanolic acid saponins classified as glucosides or glucuronides according to the first residue in sugar chain bound to C-3 hydroxyl group. Hairy root culture, obtained by transformation with Agrobacterium rhizogenes strain 15834, exhibit a potent ability of synthesis of oleanolic acid glycosides. The HPLC profile of saponin fraction obtained from C. officinalis hairy roots treated with plant stress hormone, jasmonic acid, showed the 10-times increase of the content of one particular compound, determined by NMR and MALDI TOF as a new bisdesmoside saponin, 3-O-β-d-glucuronopyranosyl-28-O-β-d-galactopyranosyl-oleanolic acid. Such a diglycoside does not occur in native C. officinalis plant. It is a glucuronide, whereas in the native plant glucuronides are mainly accumulated in flowers, while glucosides are the most abundant saponins in roots. Thus, our results revealed that the pathways of saponin biosynthesis, particularly reactions of glycosylation, are altered in C. officinalis hairy root culture.

The aromatic amino acids biosynthetic pathway: A core platform for products

DOE Office of Scientific and Technical Information (OSTI.GOV)

Lievense, J.C.; Frost, J.W.

The aromatic amino acids biosynthetic pathway is viewed conventionally and primarily as the source of the amino acids L-tyrosine, L-phenylalanine. The authors have recognized the expanded role of the pathway as the major source of aromatic raw materials on earth. With the development of metabolic engineering approaches, it is now possible to biosynthesize a wide variety of aromatic compounds from inexpensive, clean, abundant, renewable sugars using fermentation methods. Examples of already and soon-to-be commercialized biosynthesis of such compounds are described. The long-term prospects are also assessed.

Synthesis of medium-chain fatty acids and their incorporation into triacylglycerols by cell-free fractions from Cuphea embryos.

PubMed

Deerberg, S; von Twickel, J; Förster, H H; Cole, T; Fuhrmann, J; Heise, K P

1990-02-01

During their rapid maturation period, seeds of Cuphea wrightii A. Gray mainly accumulate medium-chain fatty acids (C8 to C14) in their storage lipids. The rate of lipid deposition (40-50 mg·d(-1)·(g fresh weight)(-1)) is fourfold higher than in seeds of Cuphea racemosa (L. f.) Spreng, which accumulate long-chain fatty acids (C16 to C18). Measurements of the key enzymes of fatty-acid synthesis in cell-free extracts of seeds of different maturities from Cuphea wrightii show that malonyl-CoA synthesis may be a triggering factor for the observed high capacity for fatty-acid synthesis. Experiments on the incorporation of [1-(14)C]acetate into fatty acids by purified plastid preparations from embryos of Cuphea wrightii have demonstrated that the biosynthesis of medium-chain fatty acids (C8 to C14) is localized in the plastid. Thus, in the presence of cofactors for lipid synthesis (ATP, NADPH, NADH, acyl carrier protein, and sn-glycerol-3-phosphate), purified plastid fractions predominantly synthesized free fatty acids, 30% of which were of medium chain length. Transesterification of the freshly synthesized fatty acids to coenzyme A and recombination with the microsomal fraction of the embryo homogenate induced triacylglycerol synthesis. It also stimulated fatty-acid synthesis by a factor 2-3 and increased the relative amount of medium-chain fatty acids bound to triacylglycerols, which corresponded to about 60-80% in this lipid fraction.

Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways.

PubMed

Mur, Luis A J; Prats, Elena; Pierre, Sandra; Hall, Michael A; Hebelstrup, Kim H

2013-01-01

Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used.

Integrating nitric oxide into salicylic acid and jasmonic acid/ ethylene plant defense pathways

PubMed Central

Mur, Luis A. J.; Prats, Elena; Pierre, Sandra; Hall, Michael A.; Hebelstrup, Kim H.

2013-01-01

Plant defense against pests and pathogens is known to be conferred by either salicylic acid (SA) or jasmonic acid (JA)/ethylene (ET) pathways, depending on infection or herbivore-grazing strategy. It is well attested that SA and JA/ET pathways are mutually antagonistic allowing defense responses to be tailored to particular biotic stresses. Nitric oxide (NO) has emerged as a major signal influencing resistance mediated by both signaling pathways but no attempt has been made to integrate NO into established SA/JA/ET interactions. NO has been shown to act as an inducer or suppressor of signaling along each pathway. NO will initiate SA biosynthesis and nitrosylate key cysteines on TGA-class transcription factors to aid in the initiation of SA-dependent gene expression. Against this, S-nitrosylation of NONEXPRESSOR OF PATHOGENESIS-RELATED PROTEINS1 (NPR1) will promote the NPR1 oligomerization within the cytoplasm to reduce TGA activation. In JA biosynthesis, NO will initiate the expression of JA biosynthetic enzymes, presumably to over-come any antagonistic effects of SA on JA-mediated transcription. NO will also initiate the expression of ET biosynthetic genes but a suppressive role is also observed in the S-nitrosylation and inhibition of S-adenosylmethionine transferases which provides methyl groups for ET production. Based on these data a model for NO action is proposed but we have also highlighted the need to understand when and how inductive and suppressive steps are used. PMID:23818890

Kynurenine Pathway Metabolism is Involved in the Maintenance of the Intracellular NAD+ Concentration in Human Primary Astrocytes

PubMed Central

Grant, Ross; Nguyen, Susan; Guillemin, Gilles

2010-01-01

Efficient synthesis of NAD+ is critical to maintaining cell viability in all organs of the body. However, little is known of the pathway(s) by which cells of the central nervous system produce NAD+. The aim of this study was to investigate the relationship, between tryptophan degradation via the kynurenine pathway (KP) and de novo NAD+ synthesis in human astrocytes, a major cell type within the brain. In this study we observed that inhibition of single enzymes of the KP resulted in significant decreases in NAD+ levels in astroglial cells after a 24 hr period. We also observed that astrocytes cultured in media deficient in tryptophan, nicotinic acid and nicotinamide resulted in a 50% decrease in NAD+ levels after 24 hrs. This decrease in NAD+ was partially restored by supplementation of the culture media with either tryptophan or kynurenine, or nicotinic acid or with supply of the salvage pathway precursor nicotinamide. PMID:22084595

An integrative model links multiple inputs and signaling pathways to the onset of DNA synthesis in hepatocytes

PubMed Central

Huard, Jérémy; Mueller, Stephanie; Gilles, Ernst D; Klingmüller, Ursula; Klamt, Steffen

2012-01-01

During liver regeneration, quiescent hepatocytes re-enter the cell cycle to proliferate and compensate for lost tissue. Multiple signals including hepatocyte growth factor, epidermal growth factor, tumor necrosis factor α, interleukin-6, insulin and transforming growth factor β orchestrate these responses and are integrated during the G1 phase of the cell cycle. To investigate how these inputs influence DNA synthesis as a measure for proliferation, we established a large-scale integrated logical model connecting multiple signaling pathways and the cell cycle. We constructed our model based upon established literature knowledge, and successively improved and validated its structure using hepatocyte-specific literature as well as experimental DNA synthesis data. Model analyses showed that activation of the mitogen-activated protein kinase and phosphatidylinositol 3-kinase pathways was sufficient and necessary for triggering DNA synthesis. In addition, we identified key species in these pathways that mediate DNA replication. Our model predicted oncogenic mutations that were compared with the COSMIC database, and proposed intervention targets to block hepatocyte growth factor-induced DNA synthesis, which we validated experimentally. Our integrative approach demonstrates that, despite the complexity and size of the underlying interlaced network, logical modeling enables an integrative understanding of signaling-controlled proliferation at the cellular level, and thus can provide intervention strategies for distinct perturbation scenarios at various regulatory levels. PMID:22443451

Polyploid genome of Camelina sativa revealed by isolation of fatty acid synthesis genes

PubMed Central

2010-01-01

Background Camelina sativa, an oilseed crop in the Brassicaceae family, has inspired renewed interest due to its potential for biofuels applications. Little is understood of the nature of the C. sativa genome, however. A study was undertaken to characterize two genes in the fatty acid biosynthesis pathway, fatty acid desaturase (FAD) 2 and fatty acid elongase (FAE) 1, which revealed unexpected complexity in the C. sativa genome. Results In C. sativa, Southern analysis indicates the presence of three copies of both FAD2 and FAE1 as well as LFY, a known single copy gene in other species. All three copies of both CsFAD2 and CsFAE1 are expressed in developing seeds, and sequence alignments show that previously described conserved sites are present, suggesting that all three copies of both genes could be functional. The regions downstream of CsFAD2 and upstream of CsFAE1 demonstrate co-linearity with the Arabidopsis genome. In addition, three expressed haplotypes were observed for six predicted single-copy genes in 454 sequencing analysis and results from flow cytometry indicate that the DNA content of C. sativa is approximately three-fold that of diploid Camelina relatives. Phylogenetic analyses further support a history of duplication and indicate that C. sativa and C. microcarpa might share a parental genome. Conclusions There is compelling evidence for triplication of the C. sativa genome, including a larger chromosome number and three-fold larger measured genome size than other Camelina relatives, three isolated copies of FAD2, FAE1, and the KCS17-FAE1 intergenic region, and three expressed haplotypes observed for six predicted single-copy genes. Based on these results, we propose that C. sativa be considered an allohexaploid. The characterization of fatty acid synthesis pathway genes will allow for the future manipulation of oil composition of this emerging biofuel crop; however, targeted manipulations of oil composition and general development of C. sativa should

Roles of Fe-S proteins: from cofactor synthesis to iron homeostasis to protein synthesis.

PubMed

Pain, Debkumar; Dancis, Andrew

2016-06-01

Fe-S cluster assembly is an essential process for all cells. Impairment of Fe-S cluster assembly creates diseases in diverse and surprising ways. In one scenario, the loss of function of lipoic acid synthase, an enzyme with Fe-S cluster cofactor in mitochondria, impairs activity of various lipoamide-dependent enzymes with drastic consequences for metabolism. In a second scenario, the heme biosynthetic pathway in red cell precursors is specifically targeted, and iron homeostasis is perturbed, but lipoic acid synthesis is unaffected. In a third scenario, tRNA modifications arising from action of the cysteine desulfurase and/or Fe-S cluster proteins are lost, which may lead to impaired protein synthesis. These defects can then result in cancer, neurologic dysfunction or type 2 diabetes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Fine-Tuning of the Fatty Acid Pathway by Synthetic Antisense RNA for Enhanced (2S)-Naringenin Production from l-Tyrosine in Escherichia coli

PubMed Central

Wu, Junjun; Yu, Oliver; Du, Guocheng

2014-01-01

Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5′-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. PMID:25239896

Fine-Tuning of the Fatty Acid Pathway by Synthetic Antisense RNA for Enhanced (2S)-Naringenin Production from l-Tyrosine in Escherichia coli.

PubMed

Wu, Junjun; Yu, Oliver; Du, Guocheng; Zhou, Jingwen; Chen, Jian

2014-12-01

Malonyl coenzyme A (malonyl-CoA) is an important precursor for the synthesis of natural products, such as polyketides and flavonoids. The majority of this cofactor often is consumed for producing fatty acids and phospholipids, leaving only a small amount of cellular malonyl-CoA available for producing the target compound. The tuning of malonyl-CoA into heterologous pathways yields significant phenotypic effects, such as growth retardation and even cell death. In this study, fine-tuning of the fatty acid pathway in Escherichia coli with antisense RNA (asRNA) to balance the demands on malonyl-CoA for target-product synthesis and cell health was proposed. To establish an efficient asRNA system, the relationship between sequence and function for asRNA was explored. It was demonstrated that the gene-silencing effect of asRNA could be tuned by directing asRNA to different positions in the 5'-UTR (untranslated region) of the target gene. Based on this principle, the activity of asRNA was quantitatively tailored to balance the need for malonyl-CoA in cell growth and the production of the main flavonoid precursor, (2S)-naringenin. Appropriate inhibitory efficiency of the anti-fabB/fabF asRNA improved the production titer by 431% (391 mg/liter). Therefore, the strategy presented in this study provided a useful tool for the fine-tuning of endogenous gene expression in bacteria. Copyright © 2014, American Society for Microbiology. All Rights Reserved.

Nucleic acid sensing and innate immunity: signaling pathways controlling viral pathogenesis and autoimmunity.

PubMed

Ahlers, Laura R H; Goodman, Alan G

2016-09-01

Innate immunity refers to the body's initial response to curb infection upon exposure to invading organisms. While the detection of pathogen-associated molecules is an ancient form of host defense, if dysfunctional, autoimmune disease may result. The innate immune response during pathogenic infection is initiated through the activation of receptors recognizing conserved molecular patterns, such as nucleic acids from a virus' genome or replicative cycle. Additionally, the host's own nucleic acids are capable of activating an immune response. Therefore, it follows that the nucleic acid-sensing pathways must be tightly controlled to avoid an autoimmune response from recognition of self, yet still be unimpeded to respond to viral infections. In this review, we will describe the nucleic acid sensing pathways and how they respond to virus infection. Moreover, we will discuss autoimmune diseases that develop when these pathways fail to signal properly and identify knowledge gaps that are prime for interrogation.

[Study on Precursors for Synthesis of Anthraquinone Metabolites from Rheum tanguticum].

PubMed

Hasi, Qi-mei-ge; Lj, Hai-ling; Cheng, Yan; Menggen, Qi-qi-ge; Zhang, Yang

2015-01-01

To explore the potential precursors of the anthraquinone metabolites from Rheum tanguticum and preliminanly identify the synthesis pathway thereof. Sterile seedlings sprouted from the seeds of Rheum tanguticum were chosen as materials for inducing callus. The effects of different precursors and feeding duration on the callus of Rheum tanguticum and the anthraquinone yield in adult rheum were studied. The greatest improvement of anthraquinone yield was achieved by acetic acid, increasing 43. 9% for the callus and 45. 8% in the adult rheum; the second greatest improvement was achieved by malonic acid, increasing 15. 8% for the callus and only 3. 6% in the adult rheum. The yield of anthraquinone was not influenced significantly by benzoic acid and p-benzoquinone, and in contrast, was inhibited in some degree by shikimic acid and α-ketoglutaric acid. A suitable feeding duration was 36 h, which worked well for the effects of precursors. The precursor for synthesis of anthraquinone metabolites from Rheum tan- guticum is acetic acid, which improves the yields of callus and anthraquinone in adult rheum, concluding that the anthraquinone metabolites are synthesized via polyketone pathway.

The effects of reduced dietary protein level on amino acid transporters and mTOR signaling pathway in pigs.

PubMed

Wang, Dan; Wan, Xuebin; Peng, Jian; Xiong, Qi; Niu, Hongdan; Li, Huanan; Chai, Jin; Jiang, Siwen

2017-04-01

Amino acid transporter plays an important role in regulating mTOR signaling pathway. This study investigated the effects of reduced dietary protein levels on amino acid transporters and mTOR signaling pathway. A total of 54 weaning pigs were randomly allocated into a 3 × 3 factorial design, followed by slaughtering the pigs separately after 10-, 25- and 45-day feeding, with 18 pigs from each feeding period divided into three subgroups for treatment with three different protein-level diets: 20% crude protein (CP) diet (normal recommended, high protein, HP), 17% CP diet (medium protein, MP) and 14% CP diet (low protein, LP). The results indicated that reduced dietary protein level decreased the weight of longissimus dorsi. Additionally, quantitative PCR chip analysis showed that mRNA expression of amino acid transporters SLC38A2, SLC1A7, SLC7A1, SLC7A5, SLC16A10 and SLC3A2 in the LP group were significantly (P < 0.05) higher than those in the MP or HP group, and the phosphorylation of mTOR and S6K1 decreased in the LP group after 25-day feeding. Furthermore, the vitro experimental results further confirmed that the mRNA levels for SLC7A1, SLC7A5, SLC3A2, SLC38A2 and SLC36A1 were increased and the phosphorylation of mTOR and S6K1 was decreased when the concentration of amino acids in C2C12 myoblasts was reduced. All these results indicated that the LP diet induced a high expression of amino acid transporters and the inhibition of the mTOR activity, which resulting in restriction on protein synthesis and longissimus dorsi growth. Copyright © 2017 Elsevier Inc. All rights reserved.

Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid

PubMed Central

Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A.; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A.

2017-01-01

mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein–12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. PMID:28223357

Lipid sensing by mTOR complexes via de novo synthesis of phosphatidic acid.

PubMed

Menon, Deepak; Salloum, Darin; Bernfeld, Elyssa; Gorodetsky, Elizabeth; Akselrod, Alla; Frias, Maria A; Sudderth, Jessica; Chen, Pei-Hsuan; DeBerardinis, Ralph; Foster, David A

2017-04-14

mTOR, the mammalian target of rapamycin, integrates growth factor and nutrient signals to promote a transformation from catabolic to anabolic metabolism, cell growth, and cell cycle progression. Phosphatidic acid (PA) interacts with the FK506-binding protein-12-rapamycin-binding (FRB) domain of mTOR, which stabilizes both mTOR complexes: mTORC1 and mTORC2. We report here that mTORC1 and mTORC2 are activated in response to exogenously supplied fatty acids via the de novo synthesis of PA, a central metabolite for membrane phospholipid biosynthesis. We examined the impact of exogenously supplied fatty acids on mTOR in KRas-driven cancer cells, which are programmed to utilize exogenous lipids. The induction of mTOR by oleic acid was dependent upon the enzymes responsible for de novo synthesis of PA. Suppression of the de novo synthesis of PA resulted in G 1 cell cycle arrest. Although it has long been appreciated that mTOR is a sensor of amino acids and glucose, this study reveals that mTOR also senses the presence of lipids via production of PA. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

Synthesis and characterization of bis-thiourea having amino acid derivatives

NASA Astrophysics Data System (ADS)

Fakhar, Imran; Yamin, Bohari M.; Hasbullah, Siti Aishah

2016-11-01

In this article four new symmetric bis-thiourea derivatives having amino acid linkers were reported with good yield. Isophthaloyl dichloride was used as spacer and L-alanine, L-aspartic acid, L-phenylalanine and L-glutamic acid were used as linkers. Bis-thiourea derivatives were prepared from relatively stable isophthaloyl isothiocyanate intermediate. Newly synthesized bis-thiourea derivatives were characterized by FTIR, H-NMR, 13C-NMR and CHNS-O elemental analysis techniques. Characterization data was in good agreement with the expected derivatives, hence confirmed the synthesis of four new derivatives of bis-thiourea having amino acids.

From N-triisopropylsilylpyrrole to an optically active C-4 substituted pyroglutamic acid: total synthesis of penmacric acid.

PubMed

Berini, Christophe; Pelloux-Léon, Nadia; Minassian, Frédéric; Denis, Jean-Noël

2009-11-07

The stereoselective synthesis of penmacric acid, an optically active C-4 substituted pyroglutamic acid, has been efficiently achieved through an unusual 11-step sequence starting from simple N-triisopropylsilylpyrrole. The key-steps are the initial addition of the pyrrole nucleus onto a chiral nitrone and the obtention of the pyroglutamic acid moiety by reductive hydrogenation of the pyrrole followed by oxidation of the corresponding pyrrolidine into pyrrolidinone.

Metabolism of exogenous fatty acids, fatty acid-mediated cholesterol efflux, PKA and PKC pathways in boar sperm acrosome reaction.

PubMed

Hossain, Md Sharoare; Afrose, Sadia; Sawada, Tomio; Hamano, Koh-Ichi; Tsujii, Hirotada

2010-03-01

For understanding the roles of fatty acids on the induction of acrosome reaction which occurs under association of cholesterol efflux and PKA or PKC pathways in boar spermatozoa, metabolic fate of alone and combined radiolabeled 14 C-oleic acid and 3 H-linoleic acid incorporated in the sperm was compared, and behavior of cholesterol and effects of PKA and PKC inhibitors upon fatty acid-induced acrosome reaction were examined. Semen was collected from a Duroc boar, and the metabolic activities of fatty acids in the spermatozoa were measured using radioactive compounds and thin layer chromatography. Cholesterol efflux was measured with a cholesterol determination assay kit. Participation of fatty acids on the AR through PKA and PKC pathways was evaluated using a specific inhibitor of these enzymes. Incorporation rate of 14 C-oleic acid into the sperm lipids was significantly higher than that of 3 H-linoleic acid ( P < 0.05). The oxidation of 14 C-oleic acid was higher in combined radiolabeling rather than in one. The highest amounts of 3 H-linoleic acid and 14 C-oleic acid were recovered mainly in the triglycerides and phospholipids fraction, and 14 C-oleic acid distribution was higher than the 3 H-linoleic acid in both labeled ( P < 0.05) sperm lipids. In the 3 H-linoleic and 14 C-oleic acid combined radiolabeling, the incorporation rate of the radioactive fatty acids in all the lipid fractions increased 15 times more than the alone radiolabeling. Boar sperm utilize oleic acid to generate energy for hyperactivation ( P < 0.05). Supplementation of arachidonic acid significantly increased ( P < 0.05) cholesterol efflux in sperm. When spermatozoa were incubated with PKA or PKC inhibitors, there was a significant reduction of arachidonic acid-induced acrosome reaction (AR) ( P < 0.05), and inhibition by PKA inhibitor is stronger than that by PKC inhibitor. Incorporation of unsaturated fatty acids, especially oleic acid, into triglycerides and phospholipids provides

Synthesis of 1-O-methylchlorogenic acid: reassignment of structure for MCGA3 isolated from bamboo (Phyllostachys edulis) leaves

USDA-ARS?s Scientific Manuscript database

The first synthesis of 1-O-methylchlorogenic acid is described. The short and efficient synthesis of this compound provides laboratory-scale quantities of the material to investigate its biological properties. The synthesis involved C-1 alkylation of the known (-)-4,5-cyclohexylidenequinic acid lact...

Revealing the Bacterial Butyrate Synthesis Pathways by Analyzing (Meta)genomic Data

PubMed Central

Vital, Marius; Howe, Adina Chuang

2014-01-01

ABSTRACT Butyrate-producing bacteria have recently gained attention, since they are important for a healthy colon and when altered contribute to emerging diseases, such as ulcerative colitis and type II diabetes. This guild is polyphyletic and cannot be accurately detected by 16S rRNA gene sequencing. Consequently, approaches targeting the terminal genes of the main butyrate-producing pathway have been developed. However, since additional pathways exist and alternative, newly recognized enzymes catalyzing the terminal reaction have been described, previous investigations are often incomplete. We undertook a broad analysis of butyrate-producing pathways and individual genes by screening 3,184 sequenced bacterial genomes from the Integrated Microbial Genome database. Genomes of 225 bacteria with a potential to produce butyrate were identified, including many previously unknown candidates. The majority of candidates belong to distinct families within the Firmicutes, but members of nine other phyla, especially from Actinobacteria, Bacteroidetes, Fusobacteria, Proteobacteria, Spirochaetes, and Thermotogae, were also identified as potential butyrate producers. The established gene catalogue (3,055 entries) was used to screen for butyrate synthesis pathways in 15 metagenomes derived from stool samples of healthy individuals provided by the HMP (Human Microbiome Project) consortium. A high percentage of total genomes exhibited a butyrate-producing pathway (mean, 19.1%; range, 3.2% to 39.4%), where the acetyl-coenzyme A (CoA) pathway was the most prevalent (mean, 79.7% of all pathways), followed by the lysine pathway (mean, 11.2%). Diversity analysis for the acetyl-CoA pathway showed that the same few firmicute groups associated with several Lachnospiraceae and Ruminococcaceae were dominating in most individuals, whereas the other pathways were associated primarily with Bacteroidetes. PMID:24757212

Chemoselective synthesis of sialic acid 1,7-lactones.

PubMed

Allevi, Pietro; Rota, Paola; Scaringi, Raffaella; Colombo, Raffaele; Anastasia, Mario

2010-08-20

The chemoselective synthesis of the 1,7-lactones of N-acetylneuraminic acid, N-glycolylneuraminic acid, and 3-deoxy-d-glycero-d-galacto-nononic acid is accomplished in two steps: a simple treatment of the corresponding free sialic acid with benzyloxycarbonyl chloride and a successive hydrogenolysis of the formed 2-benzyloxycarbonyl 1,7-lactone. The instability of the 1,7-lactones to protic solvents has been also evidenced together with the rationalization of the mechanism of their formation under acylation conditions. The results permit to dispose of authentic 1,7-sialolactones to be used as reference standards and of a procedure useful for the preparation of their isotopologues to be used as inner standards in improved analytical procedures for the gas liquid chromatography-mass spectrometry (GLC-MS) analysis of 1,7-sialolactones in biological media.

Automated synthesis of N-(2-[18 F]Fluoropropionyl)-l-glutamic acid as an amino acid tracer for tumor imaging on a modified [18 F]FDG synthesis module.

PubMed

Liu, Shaoyu; Sun, Aixia; Zhang, Zhanwen; Tang, Xiaolan; Nie, Dahong; Ma, Hui; Jiang, Shende; Tang, Ganghua

2017-06-15

N-(2-[ 18 F]Fluoropropionyl)-l-glutamic acid ([ 18 F]FPGLU) is a potential amino acid tracer for tumor imaging with positron emission tomography. However, due to the complicated multistep synthesis, the routine production of [ 18 F]FPGLU presents many challenging laboratory requirements. To simplify the synthesis process of this interesting radiopharmaceutical, an efficient automated synthesis of [ 18 F]FPGLU was performed on a modified commercial fluorodeoxyglucose synthesizer via a 2-step on-column hydrolysis procedure, including 18 F-fluorination and on-column hydrolysis reaction. [ 18 F]FPGLU was synthesized in 12 ± 2% (n = 10, uncorrected) radiochemical yield based on [ 18 F]fluoride using the tosylated precursor 2. The radiochemical purity was ≥98%, and the overall synthesis time was 35 minutes. To further optimize the radiosynthesis conditions of [ 18 F]FPGLU, a brominated precursor 3 was also used for the preparation of [ 18 F]FPGLU, and the improved radiochemical yield was up to 20 ± 3% (n = 10, uncorrected) in 35 minutes. Moreover, all these results were achieved using the similar on-column hydrolysis procedure on the modified fluorodeoxyglucose synthesis module. Copyright © 2017 John Wiley & Sons, Ltd.

Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis.

PubMed

Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki; Dever, Thomas E

2017-08-21

Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. Published by Oxford University Press on behalf of Nucleic Acids Research 2017.

Restoration of enterohepatic bile acid pathways in pregnant mice following short term activation of Fxr by GW4064

DOE Office of Scientific and Technical Information (OSTI.GOV)

Moscovitz, Jamie E.; Kong, Bo; Buckley, Kyle

The farnesoid X receptor (Fxr) controls bile acid homeostasis by coordinately regulating the expression of synthesizing enzymes (Cyp7a1, Cyp8b1), conjugating enzymes (Bal, Baat) and transporters in the ileum (Asbt, Ostα/β) and liver (Ntcp, Bsep, Ostβ). Transcriptional regulation by Fxr can be direct, or through the ileal Fgf15/FGF19 and hepatic Shp pathways. Circulating bile acids are increased during pregnancy due to hormone-mediated disruption of Fxr signaling. While this adaptation enhances lipid absorption, elevated bile acids may predispose women to develop maternal cholestasis. The objective of this study was to determine whether short-term treatment of pregnant mice with GW4064 (a potent FXRmore » agonist) restores Fxr signaling to the level observed in virgin mice. Plasma, liver and ilea were collected from virgin and pregnant mice administered vehicle or GW4064 by oral gavage. Treatment of pregnant mice with GW4064 induced ileal Fgf15, Shp and Ostα/β mRNAs, and restored hepatic Shp, Bal, Ntcp, and Bsep back to vehicle-treated virgin levels. Pregnant mice exhibited 2.5-fold increase in Cyp7a1 mRNA compared to virgin controls, which was reduced by GW4064. Similarly treatment of mouse primary hepatocytes with plasma isolated from pregnant mice induced Cyp7a1 mRNA by nearly 3-fold as compared to virgin plasma, which could be attenuated by co-treatment with either GW4064 or recombinant FGF19 protein. Collectively, these data reveal that repressed activity of intestinal and hepatic Fxr in pregnancy, as previously demonstrated, may be restored by pharmacological activation. This study provides the basis for a novel approach to restore bile acid homeostasis in patients with maternal cholestasis. - Highlights: • Ileal bile acid pathways are altered in pregnancy in an Fxr-dependent manner. • Ileal Fxr/Fgf contributes to changes in hepatic bile acid synthesis and transport. • Treatment of pregnant mice with an Fxr agonist restores bile acid homeostasis.« less

Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia.

PubMed

Brose, Stephen A; Golovko, Svetlana A; Golovko, Mikhail Y

2016-01-01

Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA) biosynthesis followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FA synthesis maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FA synthesis inhibition on [Formula: see text]/NAD + and [Formula: see text]/NADP + ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FA synthesis inhibitors, TOFA (inhibits Acetyl-CoA carboxylase) and cerulenin (inhibits FA synthase), increased [Formula: see text]/NAD + and [Formula: see text]/NADP + ratios under hypoxia. Further, FA synthesis inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke.

Fatty Acid Biosynthesis Inhibition Increases Reduction Potential in Neuronal Cells under Hypoxia

PubMed Central

Brose, Stephen A.; Golovko, Svetlana A.; Golovko, Mikhail Y.

2016-01-01

Recently, we have reported a novel neuronal specific pathway for adaptation to hypoxia through increased fatty acid (FA) biosynthesis followed by esterification into lipids. However, the biological role of this pathway under hypoxia remains to be elucidated. In the presented study, we have tested our hypothesis that activation of FA synthesis maintains reduction potential and reduces lactoacidosis in neuronal cells under hypoxia. To address this hypothesis, we measured the effect of FA synthesis inhibition on NADH2+/NAD+ and NADPH2+/NADP+ ratios, and lactic acid levels in neuronal SH-SY5Y cells exposed to normoxic and hypoxic conditions. FA synthesis inhibitors, TOFA (inhibits Acetyl-CoA carboxylase) and cerulenin (inhibits FA synthase), increased NADH2+/NAD+ and NADPH2+/NADP+ ratios under hypoxia. Further, FA synthesis inhibition increased lactic acid under both normoxic and hypoxic conditions, and caused cytotoxicity under hypoxia but not normoxia. These results indicate that FA may serve as hydrogen acceptors under hypoxia, thus supporting oxidation reactions including anaerobic glycolysis. These findings may help to identify a radically different approach to attenuate hypoxia related pathophysiology in the nervous system including stroke. PMID:27965531

Synthesis of Triamino Acid Building Blocks with Different Lipophilicities

PubMed Central

Maity, Jyotirmoy; Honcharenko, Dmytro; Strömberg, Roger

2015-01-01

To obtain different amino acids with varying lipophilicity and that can carry up to three positive charges we have developed a number of new triamino acid building blocks. One set of building blocks was achieved by aminoethyl extension, via reductive amination, of the side chain of ortnithine, diaminopropanoic and diaminobutanoic acid. A second set of triamino acids with the aminoethyl extension having hydrocarbon side chains was synthesized from diaminobutanoic acid. The aldehydes needed for the extension by reductive amination were synthesized from the corresponding Fmoc-L-2-amino fatty acids in two steps. Reductive amination of these compounds with Boc-L-Dab-OH gave the C4-C8 alkyl-branched triamino acids. All triamino acids were subsequently Boc-protected at the formed secondary amine to make the monomers appropriate for the N-terminus position when performing Fmoc-based solid-phase peptide synthesis. PMID:25876040

Enhanced Synthesis of Alkyl Amino Acids in Miller's 1958 H2S Experiment

NASA Technical Reports Server (NTRS)

Parker, Eric T.; Cleaves, H. James; Callahan, Michael P.; Dworkin, James P.; Glavin, Daniel P.; Lazcano, Antonio; Bada, Jeffrey L.

2011-01-01

Stanley Miller's 1958 H2S-containing experiment, which included a simulated prebiotic atmosphere of methane (CH4), ammonia (NH3), carbon dioxide (CO2), and hydrogen sulfide (H2S) produced several alkyl amino acids, including the alpha-, beta-, and gamma-isomers of aminobutyric acid (ABA) in greater relative yields than had previously been reported from his spark discharge experiments. In the presence of H2S, aspariic and glutamic acids could yield alkyl amino acids via the formation of thioimide intermediates. Radical chemistry initiated by passing H2S through a spark discharge could have also enhanced alkyl amino acid synthesis by generating alkyl radicals that can help form the aldehyde and ketone precursors to these amino acids. We propose mechanisms that may have influenced the synthesis of certain amino acids in localized environments rich in H2S and lightning discharges, similar to conditions near volcanic systems on the early Earth, thus contributing to the prebiotic chemical inventory of the primordial Earth.

Co-opting the Fanconi Anemia Genomic Stability Pathway Enables Herpesvirus DNA Synthesis and Productive Growth

PubMed Central

Karttunen, Heidi; Savas, Jeffrey N.; McKinney, Caleb; Chen, Yu-Hung; Yates, John R.; Hukkanen, Veijo; Huang, Tony T.; Mohr, Ian

2015-01-01

SUMMARY DNA damage associated with viral DNA synthesis can result in double strand breaks that threaten genome integrity and must be repaired. Here, we establish that the cellular Fanconi Anemia (FA) genomic stability pathway is exploited by HSV1 to promote viral DNA synthesis and enable its productive growth. Potent FA pathway activation in HSV1-infected cells resulted in monoubiquitination of FA effector proteins, FANCI and FANCD2 (FANCI-D2) and required the viral DNA polymerase. FANCD2 relocalized to viral replication compartments and FANCI-D2 interacted with a multi-subunit complex containing the virus-encoded single-stranded DNA-binding protein ICP8. Significantly, while HSV1 productive growth was impaired in monoubiquitination-defective FA patient cells, this restriction was partially surmounted by antagonizing the DNA-dependent protein kinase (DNA-PK), a critical enzyme required for non-homologous end-joining (NHEJ). This identifies the FA-pathway as a new cellular factor required for herpesvirus productive growth and suggests that FA-mediated suppression of NHEJ is a fundamental step in the viral lifecycle. PMID:24954902

Transfer of the cytochrome P450-dependent dhurrin pathway from Sorghum bicolor into Nicotiana tabacum chloroplasts for light-driven synthesis.

PubMed

Gnanasekaran, Thiyagarajan; Karcher, Daniel; Nielsen, Agnieszka Zygadlo; Martens, Helle Juel; Ruf, Stephanie; Kroop, Xenia; Olsen, Carl Erik; Motawie, Mohammed Saddik; Pribil, Mathias; Møller, Birger Lindberg; Bock, Ralph; Jensen, Poul Erik

2016-04-01

Plant chloroplasts are light-driven cell factories that have great potential to act as a chassis for metabolic engineering applications. Using plant chloroplasts, we demonstrate how photosynthetic reducing power can drive a metabolic pathway to synthesise a bio-active natural product. For this purpose, we stably engineered the dhurrin pathway from Sorghum bicolor into the chloroplasts of Nicotiana tabacum (tobacco). Dhurrin is a cyanogenic glucoside and its synthesis from the amino acid tyrosine is catalysed by two membrane-bound cytochrome P450 enzymes (CYP79A1 and CYP71E1) and a soluble glucosyltransferase (UGT85B1), and is dependent on electron transfer from a P450 oxidoreductase. The entire pathway was introduced into the chloroplast by integrating CYP79A1, CYP71E1, and UGT85B1 into a neutral site of the N. tabacum chloroplast genome. The two P450s and the UGT85B1 were functional when expressed in the chloroplasts and converted endogenous tyrosine into dhurrin using electrons derived directly from the photosynthetic electron transport chain, without the need for the presence of an NADPH-dependent P450 oxidoreductase. The dhurrin produced in the engineered plants amounted to 0.1-0.2% of leaf dry weight compared to 6% in sorghum. The results obtained pave the way for plant P450s involved in the synthesis of economically important compounds to be engineered into the thylakoid membrane of chloroplasts, and demonstrate that their full catalytic cycle can be driven directly by photosynthesis-derived electrons. © The Author 2016. Published by Oxford University Press on behalf of the Society for Experimental Biology.

Overlapping the Tryptophan Catabolite (TRYCAT) and Melatoninergic Pathways in Alzheimer's Disease.

PubMed

Maes, Michael; Anderson, George

2016-01-01

Activation of the trptophan catabolite (TRYCAT) pathways by oxidative and nitrosative stress and proinflammatory cytokine-driven indoleamine 2,3-dioxygenase (IDO) and tryptophan 2,3-dioxygenase (TDO) leads to the synthesis of a number of neuroregulatory TRYCATs, such as kynurenic acid and quinolinic acid. Such TRYCATs have significant impacts on neuronal functioning and survival contributing to the changes seen in Alzheimer's disease (AD), including in its association with depression as well as alterations in the reactivity of immune and glia cells. By decreasing the availability of tryptophan for serotonin synthesis, such IDO and TDO-driven TRYCATs, also decrease the availability of serotonin for N-acetylserotonin (NAS) and melatonin synthesis. The loss of NAS and melatonin has significant consequences for the etiology, course and treatment of AD, including via interactions with altered TRYCATs, but also by changing the levels of trophic support and modulating the patterning of immune activity. In this review, we look at how such interactions of the TRYCAT and melatoninergic pathways link a plethora of previously diffuse data in AD as well as the treatment implications and future research directions that such data would suggest.

Omega-6 and omega-3 fatty acids metabolism pathways in the body of pigs fed diets with different sources of fatty acids.

PubMed

Skiba, Grzegorz; Poławska, Ewa; Sobol, Monika; Raj, Stanisława; Weremko, Dagmara

2015-01-01

This study was carried out on 24 gilts (♀ Polish Large White × ♂ Danish Landrace) grown with body weight (BW) of 60 to 105 kg. The pigs were fed diets designed on the basis of a standard diet (appropriate for age and BW of pigs) where a part of the energy content was replaced by different fat supplements: linseed oil in Diet L, rapeseed oil in Diet R and fish oil in Diet F (6 gilts per dietary treatment). The fat supplements were sources of specific fatty acids (FA): in Diet L α-linolenic acid (C18:3 n-3, ALA); in Diet R linoleic acid (C18:2 n-6, LA) and in Diet F eicosapentaenoic acid (C20:5 n-3, EPA), docosapentaenoic acid (C22:5 n-3, DPA) and docosahexaenoic acid (C22:6 n-3, DHA). The protein, fat and total FA contents in the body did not differ among groups of pigs. The enhanced total intake of LA and ALA by pigs caused an increased deposition of these FA in the body (p < 0.01) and an increased potential body pool of these acids for further metabolism/conversions. The conversion efficiency of LA and ALA from the feed to the pig's body differed among groups (p < 0.01) and ranged from 64.4% to 67.2% and from 69.4% to 81.7%, respectively. In Groups L and R, the level of de novo synthesis of long-chain polyunsaturated FA was higher than in Group F. From the results, it can be concluded that the efficiency of deposition is greater for omega-3 FA than for omega-6 FA and depends on their dietary amount. The level of LA and ALA intake influences not only their deposition in the body but also the end products of the omega-3 and omega-6 pathways.

Preparation, characterization and catalytic properties of MCM-48 supported tungstophosphoric acid mesoporous materials for green synthesis of benzoic acid

NASA Astrophysics Data System (ADS)

Wu, Hai-Yan; Zhang, Xiao-Li; Chen, Xi; Chen, Ya; Zheng, Xiu-Cheng

2014-03-01

MCM-48 and tungstophosphoric acid (HPW) were prepared and applied for the synthesis of HPW/MCM-48 mesoporous materials. The characterization results showed that HPW/MCM-48 obtained retained the typical mesopore structure of MCM-48, and the textural parameters decreased with the increase loading of HPW. The catalytic oxidation results of benzyl alcohol and benzaldehyde with 30% H2O2 indicated that HPW/MCM-48 was an efficient catalyst for the green synthesis of benzoic acid. Furthermore, 35 wt% HPW/MCM-48 sample showed the highest activity under the reaction conditions.

Prospective association of fatty acids in the de novo lipogenesis pathway with risk of type 2 diabetes: the Cardiovascular Health Study.

PubMed

Ma, Wenjie; Wu, Jason H Y; Wang, Qianyi; Lemaitre, Rozenn N; Mukamal, Kenneth J; Djoussé, Luc; King, Irena B; Song, Xiaoling; Biggs, Mary L; Delaney, Joseph A; Kizer, Jorge R; Siscovick, David S; Mozaffarian, Dariush

2015-01-01

Experimental evidence suggests that hepatic de novo lipogenesis (DNL) affects insulin homeostasis via synthesis of saturated fatty acids (SFAs) and monounsaturated fatty acids (MUFAs). Few prospective studies have used fatty acid biomarkers to assess associations with type 2 diabetes. We investigated associations of major circulating SFAs [palmitic acid (16:0) and stearic acid (18:0)] and MUFA [oleic acid (18:1n-9)] in the DNL pathway with metabolic risk factors and incident diabetes in community-based older U.S. adults in the Cardiovascular Health Study. We secondarily assessed other DNL fatty acid biomarkers [myristic acid (14:0), palmitoleic acid (16:1n-7), 7-hexadecenoic acid (16:1n-9), and vaccenic acid (18:1n-7)] and estimated dietary SFAs and MUFAs. In 3004 participants free of diabetes, plasma phospholipid fatty acids were measured in 1992, and incident diabetes was identified by medication use and blood glucose. Usual diets were assessed by using repeated food-frequency questionnaires. Multivariable linear and Cox regression were used to assess associations with metabolic risk factors and incident diabetes, respectively. At baseline, circulating palmitic acid and stearic acid were positively associated with adiposity, triglycerides, inflammation biomarkers, and insulin resistance (P-trend < 0.01 each), whereas oleic acid showed generally beneficial associations (P-trend < 0.001 each). During 30,763 person-years, 297 incident diabetes cases occurred. With adjustment for demographics and lifestyle, palmitic acid (extreme-quintile HR: 1.89; 95% CI: 1.27, 2.83; P-trend = 0.001) and stearic acid (HR: 1.62; 95% CI: 1.09, 2.41; P-trend = 0.006) were associated with higher diabetes risk, whereas oleic acid was not significantly associated. In secondary analyses, vaccenic acid was inversely associated with diabetes (HR: 0.56; 95% CI: 0.38, 0.83; P-trend = 0.005). Other fatty acid biomarkers and estimated dietary SFAs or MUFAs were not significantly associated with

Deciphering the roles of Arabidopsis LPCAT and PAH in phosphatidylcholine homeostasis and pathway coordination for chloroplast lipid synthesis.

PubMed

Wang, Liping; Kazachkov, Michael; Shen, Wenyun; Bai, Mei; Wu, Hong; Zou, Jitao

2014-12-01

Phosphatidylcholine (PC) is a key intermediate in the metabolic network of glycerolipid biosynthesis. Lysophosphatidylcholine acyltransferase (LPCAT) and phosphatidic acid phosphatase (PAH) are two key enzymes of PC homeostasis. We report that LPCAT activity is markedly induced in the Arabidopsis pah mutant. The quadruple pah lpcat mutant, with dual defects in PAH and LPCAT, had a level of lysophosphatidylcholine (LPC) that was much higher than that in the lpcat mutants and a PC content that was higher than that in the pah mutant. Comparative molecular profile analysis of monogalactosyldiacylglycerol and digalactosyldiacylglycerol revealed that both the pah and pah lpcat mutants had increased proportions of 34:6 from the prokaryotic pathway despite differing levels of LPCAT activity. We show that a decreased representation of the C16:0 C18:2 diacylglycerol moiety in PC was a shared feature of pah and pah lpcat, and that this change in PC metabolic profile correlated with the increased prokaryotic contribution to chloroplast lipid synthesis. We detected increased PC deacylation in the pah lpcat mutant that was attributable at least in part to the induced phospholipases. Increased LPC generation was also evident in the pah mutant, but the phospholipases were not induced, raising the possibility that PC deacylation is mediated by the reverse reaction of LPCAT. We discuss possible roles of LPCAT and PAH in PC turnover that impacts lipid pathway coordination for chloroplast lipid synthesis. © 2014 National Research Council Canada. The Plant Journal © 2014 Society For Experimental Biology and John Wiley & Sons.

Thyroid hormone reduces PCSK9 and stimulates bile acid synthesis in humans[S

PubMed Central

Bonde, Ylva; Breuer, Olof; Lütjohann, Dieter; Sjöberg, Stefan; Angelin, Bo; Rudling, Mats

2014-01-01

Reduced plasma LDL-cholesterol is a hallmark of hyperthyroidism and is caused by transcriptional stimulation of LDL receptors in the liver. Here, we investigated whether thyroid hormone (TH) actions involve other mechanisms that may also account for the reduction in LDL-cholesterol, including effects on proprotein convertase subtilisin/kexin type 9 (PCSK9) and bile acid synthesis. Twenty hyperthyroid patients were studied before and after clinical normalization, and the responses to hyperthyroidism were compared with those in 14 healthy individuals after 14 days of treatment with the liver-selective TH analog eprotirome. Both hyperthyroidism and eprotirome treatment reduced circulating PCSK9, lipoprotein cholesterol, apoB and AI, and lipoprotein(a), while cholesterol synthesis was stable. Hyperthyroidism, but not eprotirome treatment, markedly increased bile acid synthesis and reduced fibroblast growth factor (FGF) 19 and dietary cholesterol absorption. Eprotirome treatment, but not hyperthyroidism, reduced plasma triglycerides. Neither hyperthyroidism nor eprotirome treatment altered insulin, glucose, or FGF21 levels. TH reduces circulating PSCK9, thereby likely contributing to lower plasma LDL-cholesterol in hyperthyroidism. TH also stimulates bile acid synthesis, although this response is not critical for its LDL-lowering effect. PMID:25172631

Purification, characterization, and bioinformatics studies of phosphatidic acid phosphohydrolase from Lagenaria siceraria

USDA-ARS?s Scientific Manuscript database

Phosphatidic acid phosphohydrolase (PAP), EC 3.1.3.4, is the penultimate step in the Kennedy pathway of triacyl glycerol (TAG) synthesis leading to the formation of diacyl glycerol (DAG), which is a key intermediate in TAG synthesis. We partially purified a soluble PAP from mid maturing seeds of bot...

Probabilistic pathway construction.

PubMed

Yousofshahi, Mona; Lee, Kyongbum; Hassoun, Soha

2011-07-01

Expression of novel synthesis pathways in host organisms amenable to genetic manipulations has emerged as an attractive metabolic engineering strategy to overproduce natural products, biofuels, biopolymers and other commercially useful metabolites. We present a pathway construction algorithm for identifying viable synthesis pathways compatible with balanced cell growth. Rather than exhaustive exploration, we investigate probabilistic selection of reactions to construct the pathways. Three different selection schemes are investigated for the selection of reactions: high metabolite connectivity, low connectivity and uniformly random. For all case studies, which involved a diverse set of target metabolites, the uniformly random selection scheme resulted in the highest average maximum yield. When compared to an exhaustive search enumerating all possible reaction routes, our probabilistic algorithm returned nearly identical distributions of yields, while requiring far less computing time (minutes vs. years). The pathways identified by our algorithm have previously been confirmed in the literature as viable, high-yield synthesis routes. Prospectively, our algorithm could facilitate the design of novel, non-native synthesis routes by efficiently exploring the diversity of biochemical transformations in nature. Copyright © 2011 Elsevier Inc. All rights reserved.

Suppression of glycosaminoglycan synthesis by articular cartilage, but not of hyaluronic acid synthesis by synovium, after exposure to radiation

DOE Office of Scientific and Technical Information (OSTI.GOV)

Hugenberg, S.T.; Myers, S.L.; Brandt, K.D.

1989-04-01

We recently found that injection of 2 mCi of yttrium 90 (90Y; approximately 23,000 rads) into normal canine knees stimulated glycosaminoglycan (GAG) synthesis by femoral condylar cartilage. The present investigation was conducted to determine whether radiation affects cartilage metabolism directly. Rates of GAG synthesis and degradation in normal canine articular cartilage were studied following irradiation. Cultured synovium from the same knees was treated similarly, to determine the effects of irradiation on hyaluronic acid synthesis. Twenty-four hours after exposure to 1,000 rads, 10,000 rads, or 50,000 rads, 35S-GAG synthesis by the cartilage was 93%, 69%, and 37%, respectively, of that inmore » control, nonirradiated cartilage. The effect was not rapidly reversible: 120 hours after exposure to 50,000 rads, GAG synthesis remained at only 28% of the control level. Autoradiography showed marked suppression of 35S uptake by chondrocytes after irradiation. Cartilage GAG degradation was also increased following irradiation: 4 hours and 8 hours after exposure to 50,000 rads, the cartilage GAG concentration was only 66% and 54%, respectively, of that at time 0, while corresponding values for control, nonirradiated cartilage were 90% and 87%. In contrast to its effects on cartilage GAG metabolism, radiation at these levels had no effect on synovial hyaluronic acid synthesis.« less

Synthesis of Rosin Acid Starch Catalyzed by Lipase

PubMed Central

Lin, Rihui; Li, He; Long, Han; Su, Jiating; Huang, Wenqin

2014-01-01

Rosin, an abundant raw material from pine trees, was used as a starting material directly for the synthesis of rosin acid starch. The esterification reaction was catalyzed by lipase (Novozym 435) under mild conditions. Based on single factor experimentation, the optimal esterification conditions were obtained as follows: rosin acid/anhydrous glucose unit in the molar ratio 2 : 1, reaction time 4 h at 45°C, and 15% of lipase dosage. The degree of substitution (DS) reaches 0.098. Product from esterification of cassava starch with rosin acid was confirmed by FTIR spectroscopy and iodine coloration analysis. Scanning electron microscopy and X-ray diffraction analysis showed that the morphology and crystallinity of the cassava starch were largely destroyed. Thermogravimetric analysis indicated that thermal stability of rosin acid starch decreased compared with native starch. PMID:24977156

Amino acid substrates impose polyamine, eIF5A, or hypusine requirement for peptide synthesis

PubMed Central

Shin, Byung-Sik; Katoh, Takayuki; Gutierrez, Erik; Kim, Joo-Ran; Suga, Hiroaki

2017-01-01

Abstract Whereas ribosomes efficiently catalyze peptide bond synthesis by most amino acids, the imino acid proline is a poor substrate for protein synthesis. Previous studies have shown that the translation factor eIF5A and its bacterial ortholog EF-P bind in the E site of the ribosome where they contact the peptidyl-tRNA in the P site and play a critical role in promoting the synthesis of polyproline peptides. Using misacylated Pro-tRNAPhe and Phe-tRNAPro, we show that the imino acid proline and not tRNAPro imposes the primary eIF5A requirement for polyproline synthesis. Though most proline analogs require eIF5A for efficient peptide synthesis, azetidine-2-caboxylic acid, a more flexible four-membered ring derivative of proline, shows relaxed eIF5A dependency, indicating that the structural rigidity of proline might contribute to the requirement for eIF5A. Finally, we examine the interplay between eIF5A and polyamines in promoting translation elongation. We show that eIF5A can obviate the polyamine requirement for general translation elongation, and that this activity is independent of the conserved hypusine modification on eIF5A. Thus, we propose that the body of eIF5A functionally substitutes for polyamines to promote general protein synthesis and that the hypusine modification on eIF5A is critically important for poor substrates like proline. PMID:28637321

Synthesis and properties of fatty acid starch esters.

PubMed

Winkler, Henning; Vorwerg, Waltraud; Wetzel, Hendrik

2013-10-15

Being completely bio-based, fatty acid starch esters (FASEs) are attractive materials that represent an alternative to crude oil-based plastics. In this study, two synthesis methods were compared in terms of their efficiency, toxicity and, especially, product solubility with starch laurate (C12) as model compound. Laurates (DS>2) were obtained through transesterification of fatty acid vinylesters in DMSO or reaction with fatty acid chlorides in pyridine. The latter lead to higher DS-values in a shorter reaction time. But due to the much better solubility of the products compared to lauroyl chloride esterified ones, vinylester-transesterification was preferred to optimize reaction parameters, where reaction time could be shortened to 2h. FASEs C6-C18 were also successfully prepared via transesterification. To determine the DS of the resulting starch laurates, the efficient ATR-IR method was compared with common methods (elementary analysis, (1)H NMR). Molar masses (Mw) of the highly soluble starch laurates were analyzed using SEC-MALLS (THF). High recovery rates (>80%) attest to the outstanding solubility of products obtained through transesterification, caused by a slight disintegration during synthesis. Particle size distributions (DLS) demonstrated stable dissolutions in CHCl3 of vinyl laurate esterified - contrary to lauroyl chloride esterified starch. For all highly soluble FASEs (C6-C18), formation of concentrated solutions (10 wt%) is feasible. Copyright © 2013 Elsevier Ltd. All rights reserved.

Apicoplast and Endoplasmic Reticulum Cooperate in Fatty Acid Biosynthesis in Apicomplexan Parasite Toxoplasma gondii*

PubMed Central

Ramakrishnan, Srinivasan; Docampo, Melissa D.; MacRae, James I.; Pujol, François M.; Brooks, Carrie F.; van Dooren, Giel G.; Hiltunen, J. Kalervo; Kastaniotis, Alexander J.; McConville, Malcolm J.; Striepen, Boris

2012-01-01

Apicomplexan parasites are responsible for high impact human diseases such as malaria, toxoplasmosis, and cryptosporidiosis. These obligate intracellular pathogens are dependent on both de novo lipid biosynthesis as well as the uptake of host lipids for biogenesis of parasite membranes. Genome annotations and biochemical studies indicate that apicomplexan parasites can synthesize fatty acids via a number of different biosynthetic pathways that are differentially compartmentalized. However, the relative contribution of each of these biosynthetic pathways to total fatty acid composition of intracellular parasite stages remains poorly defined. Here, we use a combination of genetic, biochemical, and metabolomic approaches to delineate the contribution of fatty acid biosynthetic pathways in Toxoplasma gondii. Metabolic labeling studies with [13C]glucose showed that intracellular tachyzoites synthesized a range of long and very long chain fatty acids (C14:0–26:1). Genetic disruption of the apicoplast-localized type II fatty-acid synthase resulted in greatly reduced synthesis of saturated fatty acids up to 18 carbons long. Ablation of type II fatty-acid synthase activity resulted in reduced intracellular growth that was partially restored by addition of long chain fatty acids. In contrast, synthesis of very long chain fatty acids was primarily dependent on a fatty acid elongation system comprising three elongases, two reductases, and a dehydratase that were localized to the endoplasmic reticulum. The function of these enzymes was confirmed by heterologous expression in yeast. This elongase pathway appears to have a unique role in generating very long unsaturated fatty acids (C26:1) that cannot be salvaged from the host. PMID:22179608

An Ancient Pathway Combining Carbon Dioxide Fixation with the Generation and Utilization of a Sodium Ion Gradient for ATP Synthesis

PubMed Central

Poehlein, Anja; Schmidt, Silke; Kaster, Anne-Kristin; Goenrich, Meike; Vollmers, John; Thürmer, Andrea; Bertsch, Johannes; Schuchmann, Kai; Voigt, Birgit; Hecker, Michael; Daniel, Rolf; Thauer, Rudolf K.; Gottschalk, Gerhard; Müller, Volker

2012-01-01

Synthesis of acetate from carbon dioxide and molecular hydrogen is considered to be the first carbon assimilation pathway on earth. It combines carbon dioxide fixation into acetyl-CoA with the production of ATP via an energized cell membrane. How the pathway is coupled with the net synthesis of ATP has been an enigma. The anaerobic, acetogenic bacterium Acetobacterium woodii uses an ancient version of this pathway without cytochromes and quinones. It generates a sodium ion potential across the cell membrane by the sodium-motive ferredoxin:NAD oxidoreductase (Rnf). The genome sequence of A. woodii solves the enigma: it uncovers Rnf as the only ion-motive enzyme coupled to the pathway and unravels a metabolism designed to produce reduced ferredoxin and overcome energetic barriers by virtue of electron-bifurcating, soluble enzymes. PMID:22479398

Valproate induced hepatic steatosis by enhanced fatty acid uptake and triglyceride synthesis.

PubMed

Bai, Xupeng; Hong, Weipeng; Cai, Peiheng; Chen, Yibei; Xu, Chuncao; Cao, Di; Yu, Weibang; Zhao, Zhongxiang; Huang, Min; Jin, Jing

2017-06-01

Steatosis is the characteristic type of VPA-induced hepatotoxicity and may result in life-threatening hepatic lesion. Approximately 61% of patients treated with VPA have been diagnosed with hepatic steatosis through ultrasound examination. However, the mechanisms underlying VPA-induced intracellular fat accumulation are not yet fully understood. Here we demonstrated the involvement of fatty acid uptake and lipogenesis in VPA-induced hepatic steatosis in vitro and in vivo by using quantitative real-time PCR (qRT-PCR) analysis, western blotting analysis, fatty acid uptake assays, Nile Red staining assays, and Oil Red O staining assays. Specifically, we found that the expression of cluster of differentiation 36 (CD36), an important fatty acid transport, and diacylglycerol acyltransferase 2 (DGAT2) were significantly up-regulated in HepG2 cells and livers of C57B/6J mice after treatment with VPA. Furthermore, VPA treatment remarkably enhanced the efficiency of fatty acid uptake mediated by CD36, while this effect was abolished by the interference with CD36-specific siRNA. Also, VPA treatment significantly increased DGAT2 expression as a result of the inhibition of mitogen-activated protein kinase kinase (MEK) - extracellular regulated kinase (ERK) pathway; however, DGAT2 knockdown significantly alleviated VPA-induced intracellular lipid accumulation. Additionally, we also found that sterol regulatory element binding protein-1c (SREBP-1c)-mediated fatty acid synthesis may be not involved in VPA-induced hepatic steatosis. Overall, VPA-triggered over-regulation of CD36 and DGAT2 could be helpful for a better understanding of the mechanisms underlying VPA-induced hepatic steatosis and may offer novel therapeutic strategies to combat VPA-induced hepatotoxicity. Copyright © 2017 Elsevier Inc. All rights reserved.

Guanine- Formation During the Thermal Polymerization of Amino Acids

NASA Technical Reports Server (NTRS)

Mc Caw, B. K.; Munoz, E. F.; Ponnamperuma, C.; Young, R. S.

1964-01-01

The action of heat on a mixture of amino acids was studied as a possible abiological pathway for the synthesis of purines and pyrimidines. Guanine was detected. This result is significant in the context of chemical evolution.

High hydrostatic pressure increases amino acid requirements in the piezo-hyperthermophilic archaeon Thermococcus barophilus.

PubMed

Cario, Anaïs; Lormières, Florence; Xiang, Xiao; Oger, Philippe

2015-11-01

We have established a defined growth medium for the piezophilic hyperthermophilic archaeon Thermococcus barophilus, which allows growth yields of ca. 10(8) cells/ml under both atmospheric and high hydrostatic pressure. Our results demonstrate a major impact of hydrostatic pressure on amino acid metabolism, with increases from 3 amino acids required at atmospheric pressure to 17 at 40 MPa. We observe in T. barophilus and other Thermococcales a similar discrepancy between the presence/absence of amino acid synthesis pathways and amino acid requirements, which supports the existence of alternate, but yet unknown, amino acid synthesis pathways, and may explain the low number of essential amino acids observed in T. barophilus and other Thermococcales. T. barophilus displays a strong metabolic preference for organic polymers such as polypeptides and chitin, which may constitute a more readily available resource of carbon and energy in situ in deep-sea hydrothermal vents. We hypothesize that the low energy yields of fermentation of organic polymers, together with energetic constraints imposed by high hydrostatic pressure, may render de novo synthesis of amino acids ecologically unfavorable. Induction of this metabolic switch to amino acid recycling can explain the requirement for non-essential amino acids by Thermococcales for efficient growth in defined medium. Copyright © 2015 Institut Pasteur. Published by Elsevier Masson SAS. All rights reserved.

The metabolic burden of creatine synthesis.

PubMed

Brosnan, John T; da Silva, Robin P; Brosnan, Margaret E

2011-05-01

Creatine synthesis is required in adult animals to replace creatine that is spontaneously converted to creatinine and excreted in the urine. Additionally, in growing animals it is necessary to provide creatine to the expanding tissue mass. Creatine synthesis requires three amino acids: glycine, methionine and arginine, and three enzymes: L-arginine:glycine amidinotransferase (AGAT), methionine adenosyltransferase (MAT) and guanidinoacetate methyltransferase (GAMT). The entire glycine molecule is consumed in creatine synthesis but only the methyl and amidino groups, respectively, from methionine and arginine. Creatinine loss averages approximately 2 g (14.6 mmol) for 70 kg males in the 20- to 39-year age group. Creatinine loss is lower in females and in older age groups because of lower muscle mass. Approximately half of this creatine lost to creatinine can be replaced, in omnivorous individuals, by dietary creatine. However, since dietary creatine is only provided in animal products, principally in meat and fish, virtually all of the creatine loss in vegetarians must be replaced via endogenous synthesis. Creatine synthesis does not appear to place a major burden on glycine metabolism in adults since this amino acid is readily synthesized. However, creatine synthesis does account for approximately 40% of all of the labile methyl groups provided by S-adenosylmethionine (SAM) and, as such, places an appreciable burden on the provision of such methyl groups, either from the diet or via de novo methylneogenesis. Creatine synthesis consumes some 20-30% of arginine's amidino groups, whether provided in the diet or synthesized within the body. Creatine synthesis is, therefore, a quantitatively major pathway in amino acid metabolism and imposes an appreciable burden on the metabolism of methionine and of arginine.

Oleic acid-enhanced transdermal delivery pathways of fluorescent nanoparticles

NASA Astrophysics Data System (ADS)

Lo, Wen; Ghazaryan, Ara; Tso, Chien-Hsin; Hu, Po-Sheng; Chen, Wei-Liang; Kuo, Tsung-Rong; Lin, Sung-Jan; Chen, Shean-Jen; Chen, Chia-Chun; Dong, Chen-Yuan

2012-05-01

Transdermal delivery of nanocarriers provides an alternative pathway to transport therapeutic agents, alleviating pain, improving compliance of patients, and increasing overall effectiveness of delivery. In this work, enhancement of transdermal delivery of fluorescent nanoparticles and sulforhodamine B with assistance of oleic acid was visualized utilizing multiphoton microscopy (MPM) and analyzed quantitatively using multi-photon excitation-induced fluorescent signals. Results of MPM imaging and MPM intensity-based spatial depth-dependent analysis showed that oleic acid is effective in facilitating transdermal delivery of nanoparticles.

Combining chemoinformatics with bioinformatics: in silico prediction of bacterial flavor-forming pathways by a chemical systems biology approach "reverse pathway engineering".

PubMed

Liu, Mengjin; Bienfait, Bruno; Sacher, Oliver; Gasteiger, Johann; Siezen, Roland J; Nauta, Arjen; Geurts, Jan M W

2014-01-01

The incompleteness of genome-scale metabolic models is a major bottleneck for systems biology approaches, which are based on large numbers of metabolites as identified and quantified by metabolomics. Many of the revealed secondary metabolites and/or their derivatives, such as flavor compounds, are non-essential in metabolism, and many of their synthesis pathways are unknown. In this study, we describe a novel approach, Reverse Pathway Engineering (RPE), which combines chemoinformatics and bioinformatics analyses, to predict the "missing links" between compounds of interest and their possible metabolic precursors by providing plausible chemical and/or enzymatic reactions. We demonstrate the added-value of the approach by using flavor-forming pathways in lactic acid bacteria (LAB) as an example. Established metabolic routes leading to the formation of flavor compounds from leucine were successfully replicated. Novel reactions involved in flavor formation, i.e. the conversion of alpha-hydroxy-isocaproate to 3-methylbutanoic acid and the synthesis of dimethyl sulfide, as well as the involved enzymes were successfully predicted. These new insights into the flavor-formation mechanisms in LAB can have a significant impact on improving the control of aroma formation in fermented food products. Since the input reaction databases and compounds are highly flexible, the RPE approach can be easily extended to a broad spectrum of applications, amongst others health/disease biomarker discovery as well as synthetic biology.

The effects of centrally injected arachidonic acid on respiratory system: Involvement of cyclooxygenase to thromboxane signaling pathway.

PubMed

Erkan, Leman Gizem; Guvenc, Gokcen; Altinbas, Burcin; Niaz, Nasir; Yalcin, Murat

2016-05-01

Arachidonic acid (AA) is a polyunsaturated fatty acid that is present in the phospholipids of the cell membranes of the body and is abundant in the brain. Exogenously administered AA has been shown to affect brain metabolism and to exhibit cardiovascular and neuroendocrine actions. However, little is known regarding its respiratory actions and/or central mechanism of its respiratory effects. Therefore, the present study was designed to investigate the possible effects of centrally injected AA on respiratory system and the mediation of the central cyclooxygenase (COX) to thromboxane A2 (TXA2) signaling pathway on AA-induced respiratory effects in anaesthetized rats. Intracerebroventricular (i.c.v.) administration of AA induced dose- and time-dependent increase in tidal volume, respiratory rates and respiratory minute ventilation and also caused an increase in partial oxygen pressure (pO2) and decrease in partial carbon dioxide pressure (pCO2) in male anaesthetized Spraque Dawley rats. I.c.v. pretreatment with ibuprofen, a non-selective COX inhibitor, completely blocked the hyperventilation and blood gases changes induced by AA. In addition, central pretreatment with different doses of furegrelate, a TXA2 synthesis inhibitor, also partially prevented AA-evoked hyperventilation and blood gases effects. These data explicitly show that centrally administered AA induces hyperventilation with increasing pO2 and decreasing pCO2 levels which are mediated by the activation of central COX to TXA2 signaling pathway. Copyright © 2016 Elsevier B.V. All rights reserved.

Continuous multistep synthesis of perillic acid from limonene by catalytic biofilms under segmented flow.

PubMed

Willrodt, Christian; Halan, Babu; Karthaus, Lisa; Rehdorf, Jessica; Julsing, Mattijs K; Buehler, Katja; Schmid, Andreas

2017-02-01

The efficiency of biocatalytic reactions involving industrially interesting reactants is often constrained by toxification of the applied biocatalyst. Here, we evaluated the combination of biologically and technologically inspired strategies to overcome toxicity-related issues during the multistep oxyfunctionalization of (R)-(+)-limonene to (R)-(+)-perillic acid. Pseudomonas putida GS1 catalyzing selective limonene oxidation via the p-cymene degradation pathway and recombinant Pseudomonas taiwanensis VLB120 were evaluated for continuous perillic acid production. A tubular segmented-flow biofilm reactor was used in order to relieve oxygen limitations and to enable membrane mediated substrate supply as well as efficient in situ product removal. Both P. putida GS1 and P. taiwanensis VLB120 developed a catalytic biofilm in this system. The productivity of wild-type P. putida GS1 encoding the enzymes for limonene bioconversion was highly dependent on the carbon source and reached 34 g L tube -1  day -1 when glycerol was supplied. More than 10-fold lower productivities were reached irrespective of the applied carbon source when the recombinant P. taiwanensis VLB120 harboring p-cymene monooxygenase and p-cumic alcohol dehydrogenase was used as biocatalyst. The technical applicability for preparative perillic acid synthesis in the applied system was verified by purification of perillic acid from the outlet stream using an anion exchanger resin. This concept enabled the multistep production of perillic acid and which might be transferred to other reactions involving volatile reactants and toxic end-products. Biotechnol. Bioeng. 2017;114: 281-290. © 2016 Wiley Periodicals, Inc. © 2016 Wiley Periodicals, Inc.

Prebiotic synthesis of phosphoenol pyruvate by α-phosphorylation-controlled triose glycolysis

NASA Astrophysics Data System (ADS)

Coggins, Adam J.; Powner, Matthew W.

2017-04-01

Phosphoenol pyruvate is the highest-energy phosphate found in living organisms and is one of the most versatile molecules in metabolism. Consequently, it is an essential intermediate in a wide variety of biochemical pathways, including carbon fixation, the shikimate pathway, substrate-level phosphorylation, gluconeogenesis and glycolysis. Triose glycolysis (generation of ATP from glyceraldehyde 3-phosphate via phosphoenol pyruvate) is among the most central and highly conserved pathways in metabolism. Here, we demonstrate the efficient and robust synthesis of phosphoenol pyruvate from prebiotic nucleotide precursors, glycolaldehyde and glyceraldehyde. Furthermore, phosphoenol pyruvate is derived within an α-phosphorylation controlled reaction network that gives access to glyceric acid 2-phosphate, glyceric acid 3-phosphate, phosphoserine and pyruvate. Our results demonstrate that the key components of a core metabolic pathway central to energy transduction and amino acid, sugar, nucleotide and lipid biosyntheses can be reconstituted in high yield under mild, prebiotically plausible conditions.

Enhancing poly-γ-glutamic acid production in Bacillus amyloliquefaciens by introducing the glutamate synthesis features from Corynebacterium glutamicum.

PubMed

Feng, Jun; Quan, Yufen; Gu, Yanyan; Liu, Fenghong; Huang, Xiaozhong; Shen, Haosheng; Dang, Yulei; Cao, Mingfeng; Gao, Weixia; Lu, Xiaoyun; Wang, Yi; Song, Cunjiang; Wang, Shufang

2017-05-22

Poly-γ-glutamic acid (γ-PGA) is a valuable polymer with glutamate as its sole precursor. Enhancement of the intracellular glutamate synthesis is a very important strategy for the improvement of γ-PGA production, especially for those glutamate-independent γ-PGA producing strains. Corynebacterium glutamicum has long been used for industrial glutamate production and it exhibits some unique features for glutamate synthesis; therefore introduction of these metabolic characters into the γ-PGA producing strain might lead to increased intracellular glutamate availability, and thus ultimate γ-PGA production. In this study, the unique glutamate synthesis features from C. glutamicum was introduced into the glutamate-independent γ-PGA producing Bacillus amyloliquefaciens NK-1 strain. After introducing the energy-saving NADPH-dependent glutamate dehydrogenase (NADPH-GDH) pathway, the NK-1 (pHT315-gdh) strain showed slightly increase (by 9.1%) in γ-PGA production. Moreover, an optimized metabolic toggle switch for controlling the expression of ɑ-oxoglutarate dehydrogenase complex (ODHC) was introduced into the NK-1 strain, because it was previously shown that the ODHC in C. glutamicum was completely inhibited when glutamate was actively produced. The obtained NK-PO1 (pHT01-xylR) strain showed 66.2% higher γ-PGA production than the NK-1 strain. However, the further combination of these two strategies (introducing both NADPH-GDH pathway and the metabolic toggle switch) did not lead to further increase of γ-PGA production but rather the resultant γ-PGA production was even lower than that in the NK-1 strain. We proposed new metabolic engineering strategies to improve the γ-PGA production in B. amyloliquefaciens. The NK-1 (pHT315-gdh) strain with the introduction of NADPH-GDH pathway showed 9.1% improvement in γ-PGA production. The NK-PO1 (pHT01-xylR) strain with the introduction of a metabolic toggle switch for controlling the expression of ODHC showed 66.2% higher �

Metabolic engineering of Saccharomyces cerevisiae for production of fatty acid-derived hydrocarbons.

PubMed

Zhang, Yiming; Nielsen, Jens; Liu, Zihe

2018-06-05

Fatty acid-derived hydrocarbons attract increasing attention as biofuels due to their immiscibility with water, high-energy content, low freezing point, and high compatibility with existing refineries and end-user infrastructures. Yeast Saccharomyces cerevisiae has advantages for production of fatty acid-derived hydrocarbons as its native routes toward fatty acid synthesis involve only a few reactions that allow more efficient conversion of carbon substrates. Here we describe major biosynthetic pathways of fatty acid-derived hydrocarbons in yeast, and summarize key metabolic engineering strategies, including enhancing precursor supply, eliminating competing pathways, and expressing heterologous pathways. With recent advances in yeast production of fatty acid-derived hydrocarbons, our review identifies key research challenges and opportunities for future optimization, and concludes with perspectives and outlooks for further research directions. © 2018 Wiley Periodicals, Inc.

Accumulation of Polyhydroxyalkanoic Acid Containing Large Amounts of Unsaturated Monomers in Pseudomonas fluorescens BM07 Utilizing Saccharides and Its Inhibition by 2-Bromooctanoic Acid

PubMed Central

Lee, Ho-Joo; Choi, Mun Hwan; Kim, Tae-Un; Yoon, Sung Chul

2001-01-01

-bromooctanoic acid was determined to be 60 μM, assuming a single-site binding of the inhibitor at a specific inhibition site. Thus, it seems likely that a coenzyme A thioester derivative of 2-bromooctanoic acid specifically inhibits an enzyme linking the two pathways, fatty acid de novo synthesis and PHA synthesis. We suggest that 2-bromooctanoic acid can substitute for the far more expensive (2,000 times) and cell-growth-inhibiting PHA synthesis inhibitor, cerulenin. PMID:11679314

Effect of Thymine Starvation on Messenger Ribonucleic Acid Synthesis in Escherichia coli

PubMed Central

Luzzati, Denise

1966-01-01

Luzzati, Denise (Institut de Biologie Physico-Chimique, Paris, France). Effect of thymine starvation on messenger ribonucleic acid synthesis in Escherichia coli. J. Bacteriol. 92:1435–1446. 1966.—During the course of thymine starvation, the rate of synthesis of messenger ribonucleic acid (mRNA, the rapidly labeled fraction of the RNA which decays in the presence of dinitrophenol or which hybridizes with deoxyribonucleic acid) decreases exponentially, in parallel with the viability of the thymine-starved bacteria. The ability of cell-free extracts of starved bacteria to incorporate ribonucleoside triphosphates into RNA was determined; it was found to be inferior to that of extracts from control cells. The analysis of the properties of cell-free extracts of starved cells shows that their decreased RNA polymerase activity is the consequence of a modification of their deoxyribonucleic acid, the ability of which to serve as a template for RNA polymerase decreases during starvation. PMID:5332402

Perilipin 1 Mediates Lipid Metabolism Homeostasis and Inhibits Inflammatory Cytokine Synthesis in Bovine Adipocytes

PubMed Central

Zhang, Shiqi; Liu, Guowen; Xu, Chuang; Liu, Lei; Zhang, Qiang; Xu, Qiushi; Jia, Hongdou; Li, Xiaobing; Li, Xinwei

2018-01-01

Dairy cows with ketosis displayed lipid metabolic disorder and high inflammatory levels. Adipose tissue is an active lipid metabolism and endocrine tissue and is closely related to lipid metabolism homeostasis and inflammation. Perilipin 1 (PLIN1), an adipocyte-specific lipid-coated protein, may be involved in the above physiological function. The aim of this study is to investigate the role of PLIN1 in lipid metabolism regulation and inflammatory factor synthesis in cow adipocytes. The results showed that PLIN1 overexpression upregulated the expression of fatty acid and triglyceride (TAG) synthesis molecule sterol regulator element-binding protein-1c (SREBP-1c) and its target genes, diacylglycerol acyltransferase (DGAT) 1, and DGAT2, but inhibited the expression of lipolysis enzymes hormone-sensitive lipase (HSL) and CGI-58 for adipose triglyceride lipase (ATGL), thus augmenting the fatty acids and TAG synthesis and inhibiting lipolysis. Importantly, PLIN1 overexpression inhibited the activation of the NF-κB inflammatory pathway and decreased the expression and content of tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), and interleukin 6 (IL-6) induced by lipopolysaccharide. Conversely, PLIN1 silencing inhibited TAG synthesis, promoted lipolysis, and overinduced the activation of the NF-κB inflammatory pathway in cow adipocytes. In ketotic cows, the expression of PLIN1 was markedly decreased, whereas lipid mobilization, NF-κB pathway, and downstream inflammatory cytokines were overinduced in adipose tissue. Taken together, these results indicate that PLIN1 can maintain lipid metabolism homeostasis and inhibit the NF-κB inflammatory pathway in adipocytes. However, low levels of PLIN1 reduced the inhibitory effect on fat mobilization, NF-κB pathway, and inflammatory cytokine synthesis in ketotic cows. PMID:29593725

Perilipin 1 Mediates Lipid Metabolism Homeostasis and Inhibits Inflammatory Cytokine Synthesis in Bovine Adipocytes.

PubMed

Zhang, Shiqi; Liu, Guowen; Xu, Chuang; Liu, Lei; Zhang, Qiang; Xu, Qiushi; Jia, Hongdou; Li, Xiaobing; Li, Xinwei

2018-01-01

Dairy cows with ketosis displayed lipid metabolic disorder and high inflammatory levels. Adipose tissue is an active lipid metabolism and endocrine tissue and is closely related to lipid metabolism homeostasis and inflammation. Perilipin 1 (PLIN1), an adipocyte-specific lipid-coated protein, may be involved in the above physiological function. The aim of this study is to investigate the role of PLIN1 in lipid metabolism regulation and inflammatory factor synthesis in cow adipocytes. The results showed that PLIN1 overexpression upregulated the expression of fatty acid and triglyceride (TAG) synthesis molecule sterol regulator element-binding protein-1c (SREBP-1c) and its target genes, diacylglycerol acyltransferase (DGAT) 1, and DGAT2, but inhibited the expression of lipolysis enzymes hormone-sensitive lipase (HSL) and CGI-58 for adipose triglyceride lipase (ATGL), thus augmenting the fatty acids and TAG synthesis and inhibiting lipolysis. Importantly, PLIN1 overexpression inhibited the activation of the NF-κB inflammatory pathway and decreased the expression and content of tumor necrosis factor alpha (TNF-α), interleukin 1 beta (IL-1β), and interleukin 6 (IL-6) induced by lipopolysaccharide. Conversely, PLIN1 silencing inhibited TAG synthesis, promoted lipolysis, and overinduced the activation of the NF-κB inflammatory pathway in cow adipocytes. In ketotic cows, the expression of PLIN1 was markedly decreased, whereas lipid mobilization, NF-κB pathway, and downstream inflammatory cytokines were overinduced in adipose tissue. Taken together, these results indicate that PLIN1 can maintain lipid metabolism homeostasis and inhibit the NF-κB inflammatory pathway in adipocytes. However, low levels of PLIN1 reduced the inhibitory effect on fat mobilization, NF-κB pathway, and inflammatory cytokine synthesis in ketotic cows.

A novel role of cytosolic protein synthesis inhibition in aminoglycoside ototoxicity

PubMed Central

Francis, Shimon P.; Katz, Joshua; Fanning, Kathryn D.; Harris, Kimberly A.; Nicholas, Brian D.; Lacy, Michael; Pagana, James; Agris, Paul F.; Shin, Jung-Bum

2013-01-01

Ototoxicity is a main dose-limiting factor in the clinical application of aminoglycoside antibiotics. Despite longstanding research efforts, our understanding of the mechanisms underlying aminoglycoside ototoxicity remains limited. Here we report the discovery of a novel stress pathway that contributes to aminoglycoside-induced hair cell degeneration. Modifying the recently developed bioorthogonal noncanonical amino acid tagging (BONCAT) method, we used click-chemistry to study the role of protein synthesis activity in aminoglycoside-induced hair cell stress. We demonstrate that aminoglycosides inhibit protein synthesis in hair cells and activate a signaling pathway similar to ribotoxic stress response, contributing to hair cell degeneration. The ability of a particular aminoglycoside to inhibit protein synthesis and to activate the c-Jun N-terminal kinase (JNK) pathway correlated well with its ototoxic potential. Finally, we report that a FDA-approved drug known to inhibit ribotoxic stress response also prevents JNK activation and improves hair cell survival, opening up novel strategies to prevent and treat aminoglycoside ototoxicity. PMID:23407963

One-pot synthesis of bioactive cyclopentenones from α-linolenic acid and docosahexaenoic acid.

PubMed

Maynard, Daniel; Müller, Sara Mareike; Hahmeier, Monika; Löwe, Jana; Feussner, Ivo; Gröger, Harald; Viehhauser, Andrea; Dietz, Karl-Josef

2018-04-01

Oxidation products of the poly-unsaturated fatty acids (PUFAs) arachidonic acid, α-linolenic acid and docosahexaenoic acid are bioactive in plants and animals as shown for the cyclopentenones prostaglandin 15d-PGJ 2 and PGA 2 , cis-(+)-12-oxophytodienoic acid (12-OPDA), and 14-A-4 neuroprostane. In this study an inexpensive and simple enzymatic multi-step one-pot synthesis is presented for 12-OPDA, which is derived from α-linolenic acid, and the analogous docosahexaenoic acid (DHA)-derived cyclopentenone [(4Z,7Z,10Z)-12-[[-(1S,5S)-4-oxo-5-(2Z)-pent-2-en-1yl]-cyclopent-2-en-1yl] dodeca-4,7,10-trienoic acid, OCPD]. The three enzymes utilized in this multi-step cascade were crude soybean lipoxygenase or a recombinant lipoxygenase, allene oxide synthase and allene oxide cyclase from Arabidopsis thaliana. The DHA-derived 12-OPDA analog OCPD is predicted to have medicinal potential and signaling properties in planta. With OCPD in hand, it is shown that this compound interacts with chloroplast cyclophilin 20-3 and can be metabolized by 12-oxophytodienoic acid reductase (OPR3) which is an enzyme relevant for substrate bioactivity modulation in planta. Copyright © 2017 Elsevier Ltd. All rights reserved.

Assembly of Lipoic Acid on Its Cognate Enzymes: an Extraordinary and Essential Biosynthetic Pathway

PubMed Central

2016-01-01

SUMMARY Although the structure of lipoic acid and its role in bacterial metabolism were clear over 50 years ago, it is only in the past decade that the pathways of biosynthesis of this universally conserved cofactor have become understood. Unlike most cofactors, lipoic acid must be covalently bound to its cognate enzyme proteins (the 2-oxoacid dehydrogenases and the glycine cleavage system) in order to function in central metabolism. Indeed, the cofactor is assembled on its cognate proteins rather than being assembled and subsequently attached as in the typical pathway, like that of biotin attachment. The first lipoate biosynthetic pathway determined was that of Escherichia coli, which utilizes two enzymes to form the active lipoylated protein from a fatty acid biosynthetic intermediate. Recently, a more complex pathway requiring four proteins was discovered in Bacillus subtilis, which is probably an evolutionary relic. This pathway requires the H protein of the glycine cleavage system of single-carbon metabolism to form active (lipoyl) 2-oxoacid dehydrogenases. The bacterial pathways inform the lipoate pathways of eukaryotic organisms. Plants use the E. coli pathway, whereas mammals and fungi probably use the B. subtilis pathway. The lipoate metabolism enzymes (except those of sulfur insertion) are members of PFAM family PF03099 (the cofactor transferase family). Although these enzymes share some sequence similarity, they catalyze three markedly distinct enzyme reactions, making the usual assignment of function based on alignments prone to frequent mistaken annotations. This state of affairs has possibly clouded the interpretation of one of the disorders of human lipoate metabolism. PMID:27074917

Long-term leucine induced stimulation of muscle protein synthesis is amino acid dependent

USDA-ARS?s Scientific Manuscript database

Infusing leucine for 1 h increases skeletal muscle protein synthesis in the neonate, but this is not sustained for 2 h unless the corresponding fall in amino acids is prevented. This study aimed to determine whether a continuous leucine infusion can stimulate protein synthesis for a prolonged period...

SYNTHESIS OF MIXED FULL AND SEMIESTERS OF PHOSPHOROUS ACID AS ORGANIC MOTOR OIL ADDITIVES,

DTIC Science & Technology

The synthesis of mixed full and semiesters of phosphonic acid was effected using alkylphenols produced by the chemical industry. By condensation of...industrial alkylphenol or the condensation of acid chloride of di-(alkylphenyl)-phosphorous acid with diethylamine, the corresponding mixed full and semiesters

Synthesis of fatty acids from [1-14C]acetylcoenzyme A in subcellular particles of rat epididymal adipose tissue

PubMed Central

Kanoh, H.; Lindsay, D. B.

1972-01-01

1. Mitochondrial and microsomal fractions of rat epididymal adipose tissue incorporated [1-14C]acetyl-CoA equally well into various fatty acids by a chain-elongation mechanism. C18 and C20 fatty acids were the two major products, and comprised about 80% of the total fatty acids synthesized in both particles. 2. When incubated in air, mitochondria synthesized stearic acid, octadecenoic acid and eicosamonoenoic acid in almost equal amounts (about 20% each), whereas in microsomal fractions, the synthesis of octadecenoic acid was more than fivefold the stearic acid formation. In both fractions, major components of synthesized monoenoic fatty acids were the Δ11:12 isomers. Hexadecenoic acid and octadecenoic acid from whole adipose tissue contained approx. 11 and 14% of the Δ11:12 isomer respectively. 3. When mitochondria or microsomal fractions were incubated in nitrogen, there was increased synthesis of stearic acid and palmitic acid and less of C16 and C18 monoenoic acids; synthesis of C20 acids remained predominantly of the monoenoic acids. Determination of the position of the double bond in the monoenoic acids supported the view that the synthesis of hexadecenoic acid and octadecenoic acid involves a desaturase activity, whereas eicosamonoenoic acid and eicosadienoic acid are formed only by elongation of endogenous fatty acids. 4. Most of the radioactivity was found in free fatty acids (63%) and the phospholipid (26%) fraction. In phospholipids, phosphatidylcholine and phosphatidylethanolamine were the two major components. 5. Most of the fatty acids synthesized, including those not normally found in particle lipids (arachidic acid, eicosamonoenoic acid and eicosadienoic acid) were distributed fairly evenly in the phospholipid and free fatty acid fractions. However, stearic acid was found predominantly in the phospholipid fraction. PMID:4638795

Advances in the synthesis of α-quaternary α-ethynyl α-amino acids.

PubMed

Boibessot, Thibaut; Bénimélis, David; Meffre, Patrick; Benfodda, Zohra

2016-09-01

α-Quaternary α-ethynyl α-amino acids are an important class of non-proteinogenic amino acids that play an important role in the development of peptides and peptidomimetics as therapeutic agents and in the inhibition of enzyme activities. This review provides an overview of the literature concerning synthesis and applications of α-quaternary α-ethynyl α-amino acids covering the period from 1977 to 2015.

The role of uric acid in the pathogenesis of diabetic retinopathy based on notch pathway.

PubMed

Zhu, Dan-Dan; Wang, Yun-Zhi; Zou, Chen; She, Xin-Ping; Zheng, Zhi

2018-06-19

Uric acid has been proposed as an independent risk factor of diabetic retinopathy. Although Notch signaling was reported to be affected in the presence of high concentrations of uric acid or glucose, the underlying mechanisms of hyperuricemia through the Notch signaling pathway to promote the development of diabetic retinopathy remain unknown. We incubated human retinal endothelial cells (HRECs) with high glucose, high uric acid and high glucose plus high glucose respectively and evaluated the apoptosis rate in different treated cells by Tunel staining. We induced diabetic model by intraperitoneally streptozotocin. Then healthy rats and diabetic rats were given with adenine and oteracil potassium by gavage. Using automatic biochemical analyzer to detect blood glucose, uric acid, urea nitrogen, creatinine levels, to verify the success of modeling. The expression and mRNA levels of ICAM-1, IL-6, MCP-1, TNF-a, receptors Notch 1, ligands Dll 1, Dll 4, Jagged 1, Jagged 2 were detected by RT-PCR and Western-Blot. Notch1 siRNA was used to interfere Notch signaling pathway, the expression and mRNA levels of ICAM-1, IL-6, MCP-1 and TNF-α was detected by RT-PCR and Western blot respectively. In vitro models, the apoptosis of HRECs cells in high uric acid plus high glucose group was the most significant. In vitro and vivo models, detection of inflammatory cytokines revealed that the expression of inflammatory cytokines increased most significantly in high uric acid plus high glucose group. Notch signaling pathway activity was also increased most significantly in high uric acid plus high glucose group. After Notch 1 siRNA transfection in high glucose and high glucose plus uric acid group, the activity of Notch signaling pathway was successfully down-regulated. We found that the apoptosis of HRECs was significantly decreased in cells transfected with Notch 1 siRNA compared to the blank vector group, and the expression of inflammatory cytokines in cells was also significantly

Morphokinetic Reaction of Cells of Streptococcus faecalis (ATCC 9790) to Specific Inhibition of Macromolecular Synthesis: Dependence of Mesosome Growth on Deoxyribonucleic Acid Synthesis

PubMed Central

Higgins, Michael L.; Daneo-Moore, Lolita

1972-01-01

The application of quantitative electron microscopy to thin sections of cells of Streptococcus faecalis specifically inhibited for deoxyribonucleic acid (DNA), ribonucleic acid, and protein synthesis shows that septal mesosomes (i) increase in size when protein synthesis is inhibited by at least 80% while DNA synthesis proceeds at no less than 50% of the control rate and (ii) decrease in size when DNA synthesis is inhibited 50% or more during the initial 10 min of treatment. This indicates that fluctuations in mesosome size are dependent on the extent of DNA synthesis. The fluctuations in mesosome areas observed on treatment do not correlate with the kinetics of glycerol incorporation per milliliter of a culture. However, when glycerol incorporation is placed on a per cell basis, a strong correlation is observed between increases in (i) the thickness of the electron-transparent layer of the cytoplasmic membrane and (ii) the amount of glycerol incorporated per cell. It seems that the electron-transparent membrane layer may thicken to accommodate changes in lipid content when protein and lipid synthesis are uncoupled. Images PMID:4110926

Global changes in the proteome of Cupriavidus necator H16 during poly-(3-hydroxybutyrate) synthesis from various biodiesel by-product substrates.

PubMed

Sharma, Parveen K; Fu, Jilagamazhi; Spicer, Victor; Krokhin, Oleg V; Cicek, Nazim; Sparling, Richard; Levin, David B

2016-12-01

Synthesis of poly-[3-hydroxybutyrate] (PHB) by Cupriavidus necator H16 in batch cultures was evaluated using three biodiesel-derived by-products as the sole carbon sources: waste glycerol (REG-80, refined to 80 % purity with negligible free fatty acids); glycerol bottom (REG-GB, with up to 65 % glycerol and 35 % free fatty acids), and free fatty acids (REG-FFA, with up to 75 % FFA and no glycerol). All the three substrates supported growth and PHB production by C. necator, with polymer accumulation ranging from 9 to 84 % cell dry weight (cdw), depending on the carbon source. To help understand these differences, proteomic analysis indicated that although C. necator H16 was able to accumulate PHB during growth on all three biodiesel by-products, no changes in the levels of PHB synthesis enzymes were observed. However, significant changes in the levels of expression were observed for two Phasin proteins involved with PHB accumulation, and for a number of gene products in the fatty acid β-oxidation pathway, the Glyoxylate Shunt, and the hydrogen (H2) synthesis pathways in C. necator cells cultured with different substrates. The glycerol transport protein (GlpF) was induced in REG-GB and REG-80 glycerol cultures only. Cupriavidus necator cells cultured with REG-GB and REG-FFA showed up-regulation of β-oxidation and Glyoxylate Shunt pathways proteins at 24 h pi, but H2 synthesis pathways enzymes were significantly down-regulated, compared with cells cultured with waste glycerol. Our data confirmed earlier observations of constitutive expression of PHB synthesis proteins, but further suggested that C. necator H16 cells growing on biodiesel-derived glycerol were under oxidative stress.

De-novo NAD+ synthesis regulates SIRT1-FOXO1 apoptotic pathway in response to NQO1 substrates in lung cancer cells

PubMed Central

Cheng, Xuefang; Li, Qingran; Liu, Fang; Ye, Hui; Zhao, Min; Wang, Hong; Wang, Guangji; Hao, Haiping

2016-01-01

Tryptophan metabolism is essential in diverse kinds of tumors via regulating tumor immunology. However, the direct role of tryptophan metabolism and its signaling pathway in cancer cells remain largely elusive. Here, we establish a mechanistic link from L-type amino acid transporter 1 (LAT1) mediated transport of tryptophan and the subsequent de-novo NAD+ synthesis to SIRT1-FOXO1 regulated apoptotic signaling in A549 cells in response to NQO1 activation. In response to NQO1 activation, SIRT1 is repressed leading to the increased cellular accumulation of acetylated FOXO1 that transcriptionally activates apoptotic signaling. Decreased uptake of tryptophan due to the downregulation of LAT1 coordinates with PARP-1 hyperactivation to induce rapid depletion of NAD+ pool. Particularly, the LAT1-NAD+-SIRT1 signaling is activated in tumor tissues of patients with non-small cell lung cancer. Because NQO1 activation is characterized with oxidative challenge induced DNA damage, these results suggest that LAT1 and de-novo NAD+ synthesis in NSCLC cells may play essential roles in sensing excessive oxidative stress. PMID:27566573

De-novo NAD+ synthesis regulates SIRT1-FOXO1 apoptotic pathway in response to NQO1 substrates in lung cancer cells.

PubMed

Liu, Huiying; Xing, Rong; Cheng, Xuefang; Li, Qingran; Liu, Fang; Ye, Hui; Zhao, Min; Wang, Hong; Wang, Guangji; Hao, Haiping

2016-09-20

Tryptophan metabolism is essential in diverse kinds of tumors via regulating tumor immunology. However, the direct role of tryptophan metabolism and its signaling pathway in cancer cells remain largely elusive. Here, we establish a mechanistic link from L-type amino acid transporter 1 (LAT1) mediated transport of tryptophan and the subsequent de-novo NAD+ synthesis to SIRT1-FOXO1 regulated apoptotic signaling in A549 cells in response to NQO1 activation. In response to NQO1 activation, SIRT1 is repressed leading to the increased cellular accumulation of acetylated FOXO1 that transcriptionally activates apoptotic signaling. Decreased uptake of tryptophan due to the downregulation of LAT1 coordinates with PARP-1 hyperactivation to induce rapid depletion of NAD+ pool. Particularly, the LAT1-NAD+-SIRT1 signaling is activated in tumor tissues of patients with non-small cell lung cancer. Because NQO1 activation is characterized with oxidative challenge induced DNA damage, these results suggest that LAT1 and de-novo NAD+ synthesis in NSCLC cells may play essential roles in sensing excessive oxidative stress.

In vitro synthesis of 9,10-dihydroxyhexadecanoic acid using recombinant Escherichia coli.

PubMed

Kaprakkaden, Anees; Srivastava, Preeti; Bisaria, Virendra Swarup

2017-05-18

Hydroxy fatty acids are widely used in food, chemical and cosmetic industries. A variety of dihydroxy fatty acids have been synthesized so far; however, no studies have been done on the synthesis of 9,10-dihydroxyhexadecanoic acid. In the present study recombinant E. coli has been used for the heterologous expression of fatty acid hydroxylating enzymes and the whole cell lysate of the induced culture was used for in vitro production of 9,10-dihydroxyhexadecanoic acid. A first of its kind proof of principle has been successfully demonstrated for the production of 9,10-dihydroxyhexadecanoic acid using three different enzymes viz. fatty acid desaturase (FAD) from Saccharomyces cerevisiae, epoxide hydrolase (EH) from Caenorhabditis elegance and epoxygenase (EPOX) from Stokasia laevis. The genes for these proteins were codon-optimised, synthesised and cloned in pET 28a (+) vector. The culture conditions for induction of these three proteins in E. coli were optimised in shake flask. The induced cell lysates were used both singly and in combination along with the trans-supply of hexadecanoic acid and 9-hexadecenoic acid, followed by product profiling by GC-MS. Formation of 9,10-dihydroxyhexadecanoic acid was successfully achieved when combination of induced cell lysates of recombinant E. coli containing FAD, EH, and EPOX were incubated with 9-hexadecenoic acid. The in vitro production of 9,10-dihydroxyhexadecanoic acid synthesis using three fatty acid modification genes from different sources has been successfully demonstrated. The strategy adopted can be used for the production of similar compounds.

Activation of Exogenous Fatty Acids to Acyl-Acyl Carrier Protein Cannot Bypass FabI Inhibition in Neisseria*

PubMed Central

Yao, Jiangwei; Bruhn, David F.; Frank, Matthew W.; Lee, Richard E.; Rock, Charles O.

2016-01-01

Neisseria is a Gram-negative pathogen with phospholipids composed of straight chain saturated and monounsaturated fatty acids, the ability to incorporate exogenous fatty acids, and lipopolysaccharides that are not essential. The FabI inhibitor, AFN-1252, was deployed as a chemical biology tool to determine whether Neisseria can bypass the inhibition of fatty acid synthesis by incorporating exogenous fatty acids. Neisseria encodes a functional FabI that was potently inhibited by AFN-1252. AFN-1252 caused a dose-dependent inhibition of fatty acid synthesis in growing Neisseria, a delayed inhibition of growth phenotype, and minimal inhibition of DNA, RNA, and protein synthesis, showing that its mode of action is through inhibiting fatty acid synthesis. Isotopic fatty acid labeling experiments showed that Neisseria encodes the ability to incorporate exogenous fatty acids into its phospholipids by an acyl-acyl carrier protein-dependent pathway. However, AFN-1252 remained an effective antibacterial when Neisseria were supplemented with exogenous fatty acids. These results demonstrate that extracellular fatty acids are activated by an acyl-acyl carrier protein synthetase (AasN) and validate type II fatty acid synthesis (FabI) as a therapeutic target against Neisseria. PMID:26567338

The return of metabolism: biochemistry and physiology of the pentose phosphate pathway

PubMed Central

Stincone, Anna; Prigione, Alessandro; Cramer, Thorsten; Wamelink, Mirjam M. C.; Campbell, Kate; Cheung, Eric; Olin-Sandoval, Viridiana; Grüning, Nana-Maria; Krüger, Antje; Alam, Mohammad Tauqeer; Keller, Markus A.; Breitenbach, Michael; Brindle, Kevin M.; Rabinowitz, Joshua D.; Ralser, Markus

2015-01-01

The pentose phosphate pathway (PPP) is a fundamental component of cellular metabolism. The PPP is important to maintain carbon homoeostasis, to provide precursors for nucleotide and amino acid biosynthesis, to provide reducing molecules for anabolism, and to defeat oxidative stress. The PPP shares reactions with the Entner–Doudoroff pathway and Calvin cycle and divides into an oxidative and non-oxidative branch. The oxidative branch is highly active in most eukaryotes and converts glucose 6-phosphate into carbon dioxide, ribulose 5-phosphate and NADPH. The latter function is critical to maintain redox balance under stress situations, when cells proliferate rapidly, in ageing, and for the ‘Warburg effect’ of cancer cells. The non-oxidative branch instead is virtually ubiquitous, and metabolizes the glycolytic intermediates fructose 6-phosphate and glyceraldehyde 3-phosphate as well as sedoheptulose sugars, yielding ribose 5-phosphate for the synthesis of nucleic acids and sugar phosphate precursors for the synthesis of amino acids. Whereas the oxidative PPP is considered unidirectional, the non-oxidative branch can supply glycolysis with intermediates derived from ribose 5-phosphate and vice versa, depending on the biochemical demand. These functions require dynamic regulation of the PPP pathway that is achieved through hierarchical interactions between transcriptome, proteome and metabolome. Consequently, the biochemistry and regulation of this pathway, while still unresolved in many cases, are archetypal for the dynamics of the metabolic network of the cell. In this comprehensive article we review seminal work that led to the discovery and description of the pathway that date back now for 80 years, and address recent results about genetic and metabolic mechanisms that regulate its activity. These biochemical principles are discussed in the context of PPP deficiencies causing metabolic disease and the role of this pathway in biotechnology, bacterial and

Oxygen and the evolution of metabolic pathways

NASA Technical Reports Server (NTRS)

Jahnke, L. L.

1986-01-01

While a considerable amount of evidence has been accumulated about the history of oxygen on this planet, little is known about the relative amounts to which primitive cells might have been exposed. One clue may be found in the metabolic pathways of extant microorganisms. While eucaryotes are principally aerobic organisms, a number are capable of anaerobic growth by fermentation. One such eucaryotic microorganism, Saccharomyces cerevisiae, will grow in the complete absence of oxygen when supplemented with unsaturated fatty acid and sterol. Oxygen-requiring enzymes are involved in the synthesis of both of these compounds. Studies have demonstrated that the oxidative desaturation of palmitic acid and the conversion of squalene to sterols occur in the range of 10-(3) to 10(-2) PAL. Thus, if the oxygen requirements of these enzymatic processes are an indication, eucaryotes might be more primitive than anticipated from the microfossil record. Results of studies on the oxygen requirements for sterol and unsaturated fatty acid synthesis in a more primitive procaryotic system are also discussed.

Comparative proteomic analysis of engineered Saccharomyces cerevisiae with enhanced free fatty acid accumulation.

PubMed

Chen, Liwei; Lee, Jaslyn Jie Lin; Zhang, Jianhua; Chen, Wei Ning

2016-02-01

The engineered Saccharomyces cerevisiae strain △faa1△faa4 [Acot5s] was demonstrated to accumulate more free fatty acids (FFA) previously. Here, comparative proteomic analysis was performed to get a global overview of metabolic regulation in the strain. Over 500 proteins were identified, and 82 of those proteins were found to change significantly in the engineered strains. Proteins involved in glycolysis, acetate metabolism, fatty acid synthesis, TCA cycle, glyoxylate cycle, the pentose phosphate pathway, respiration, transportation, and stress response were found to be upregulated in △faa1△faa4 [Acot5s] as compared to the wild type. On the other hand, proteins involved in glycerol, ethanol, ergosterol, and cell wall synthesis were downregulated. Taken together with our metabolite analysis, our results showed that the disruption of Faa1 and Faa4 and expression of Acot5s in the engineered strain △faa1△faa4 [Acot5s] not only relieved the feedback inhibition of fatty acyl-CoAs on fatty acid synthesis, but also caused a major metabolic rearrangement. The rearrangement redirected carbon flux toward the pathways which generate the essential substrates and cofactors for fatty acid synthesis, such as acetyl-CoA, ATP, and NADPH. Therefore, our results help shed light on the mechanism for the increased production of fatty acids in the engineered strains, which is useful in providing information for future studies in biofuel production.

Aldo-keto reductase family 1 B10 affects fatty acid synthesis by regulating the stability of acetyl-CoA carboxylase-alpha in breast cancer cells.

PubMed

Ma, Jun; Yan, Ruilan; Zu, Xuyu; Cheng, Ji-Ming; Rao, Krishna; Liao, Duan-Fang; Cao, Deliang

2008-02-08

Recent studies have demonstrated that aldo-keto reductase family 1 B10 (AKR1B10), a novel protein overexpressed in human hepatocellular carcinoma and non-small cell lung carcinoma, may facilitate cancer cell growth by detoxifying intracellular reactive carbonyls. This study presents a novel function of AKR1B10 in tumorigenic mammary epithelial cells (RAO-3), regulating fatty acid synthesis. In RAO-3 cells, Sephacryl-S 300 gel filtration and DEAE-Sepharose ion exchange chromatography demonstrated that AKR1B10 exists in two distinct forms, monomers (approximately 40 kDa) bound to DEAE-Sepharose column and protein complexes (approximately 300 kDa) remaining in flow-through. Co-immunoprecipitation with AKR1B10 antibody and protein mass spectrometry analysis identified that AKR1B10 associates with acetyl-CoA carboxylase-alpha (ACCA), a rate-limiting enzyme of de novo fatty acid synthesis. This association between AKR1B10 and ACCA proteins was further confirmed by co-immunoprecipitation with ACCA antibody and pulldown assays with recombinant AKR1B10 protein. Intracellular fluorescent studies showed that AKR1B10 and ACCA proteins co-localize in the cytoplasm of RAO-3 cells. More interestingly, small interfering RNA-mediated AKR1B10 knock down increased ACCA degradation through ubiquitination-proteasome pathway and resulted in >50% decrease of fatty acid synthesis in RAO-3 cells. These data suggest that AKR1B10 is a novel regulator of the biosynthesis of fatty acid, an essential component of the cell membrane, in breast cancer cells.

Synthesis of 14C-labeled perfluorooctanoic and perfluorodecanoic acids; Purification of perfluorodecanoic acid

DOE Office of Scientific and Technical Information (OSTI.GOV)

Reich, I.L.; Reich, H.J.; Menahan, L.A.

1987-01-01

Perfluorooctanoic and -decanoic acids are representative of a series of perfluorinated acids that have been used for a variety of industrial purposes primarily due to their surfactant properties. The toxicity of these compounds is being investigated in a number of laboratories. 14C-labeled materials would be useful in these studies but are not commercially available. Johncock prepared unlabeled PFOA in low yield by carbonation of the unstable perfluoroheptyllithium at -90 degrees Centigrade. We anticipated several problems in applying this procedure to the synthesis of the 14C-labeled material. Johncock's procedure was run on a fairly large scale (10 mmol) with excess CO2.

"Prokaryotic Pathway" Is Not Prokaryotic: Noncyanobacterial Origin of the Chloroplast Lipid Biosynthetic Pathway Revealed by Comprehensive Phylogenomic Analysis.

PubMed

Sato, Naoki; Awai, Koichiro

2017-11-01

Lipid biosynthesis within the chloroplast, or more generally plastids, was conventionally called "prokaryotic pathway," which produces glycerolipids bearing C18 acids at the sn-1 position and C16 acids at the sn-2 position, as in cyanobacteria such as Anabaena and Synechocystis. This positional specificity is determined during the synthesis of phosphatidate, which is a precursor to diacylglycerol, the acceptor of galactose for the synthesis of galactolipids. The first acylation at sn-1 is catalyzed by glycerol-3-phosphate acyltransferase (GPAT or GPT), whereas the second acylation at sn-2 is performed by lysophosphatidate acyltransferase (LPAAT, AGPAT, or PlsC). Here we present comprehensive phylogenomic analysis of the origins of various acyltransferases involved in the synthesis of phosphatidate, as well as phosphatidate phosphatases in the chloroplasts. The results showed that the enzymes involved in the two steps of acylation in cyanobacteria and chloroplasts are entirely phylogenetically unrelated despite a previous report stating that the chloroplast LPAAT (ATS2) and cyanobacterial PlsC were sister groups. Phosphatidate phosphatases were separated into eukaryotic and prokaryotic clades, and the chloroplast enzymes were not of cyanobacterial origin, in contrast with another previous report. These results indicate that the lipid biosynthetic pathway in the chloroplasts or plastids did not originate from the cyanobacterial endosymbiont and is not "prokaryotic" in the context of endosymbiotic theory of plastid origin. This is another line of evidence for the discontinuity of plastids and cyanobacteria, which has been suggested in the glycolipid biosynthesis. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

Adverse Outcome Pathway (AOP) Network Development for ...

EPA Pesticide Factsheets

Adverse outcome pathways (AOPs) are descriptive biological sequences that start from a molecular initiating event (MIE) and end with an adverse health outcome. AOPs provide biological context for high throughput chemical testing and further prioritize environmental health risk research. According to the Organization for Economic Co-operation and Development guidelines, AOPs are pathways with one MIE anchored to an adverse outcome (AO) by key events (KEs) and key event relationships (KERs). However, this approach does not always capture the cumulative impacts of multiple MIEs on the AO. For example, hepatic lipid flux due to chemical-induced toxicity initiates from multiple ligand-activated receptors and signaling pathways that cascade across biology to converge upon a common fatty liver (FL, also known as steatosis) outcome. To capture this complexity, a top-down strategy was used to develop a FL AOP network (AOPnet). Literature was queried based on the terms steatosis, fatty liver, cirrhosis, and hepatocellular carcinoma. Search results were analyzed for physiological and pathophysiological organ level, cellular and molecular processes, as well as pathway intermediates, to identify potential KEs and MIEs that are key for hepatic lipid metabolism, maintenance, and dysregulation. The analysis identified four apical KE nodes (hepatic fatty acid uptake, de novo fatty acid and lipid synthesis, fatty acid oxidation, and lipid efflux) juxtaposed to the FL AO. The apic

Synthesis oftrans-3-hexadecenoic acid and oftrans-3-hexadecenoic-1-C(14) acid.

PubMed

Knipprath, W G; Stein, R A

1966-01-01

Thetrans-3-hexadecenoic acid has been synthesized. Physical properties and chemical degradation prove its identity with the acid earlier isolated from several plant lipids. In the sequence of the synthesis, the introduction of a terminal triple bond into commercially available 1-tetradecene was performed by bromination and debromination with KOH and NaNH(2). Chain elongation by a Grignard reaction with CO(2) gave a carboxylic acid with a triple bond in the 2-position. Reduction with LiAlH(4) yielded the corresponding alcohol, and reduction of the triple to thetrans double bond was accomplished with Na in ethanol. Bromination of the alcohol with PBr(3) and conversion of the bromide to the nitrile with KCN or KC(14)N elongated the carbon chain to the desired length. Methanolysis with HCl in methanol and saponification with KOH formed the acid with acceptable yields, and in the case of the C(14)-labeled carboxyl, group, with high specific activity.

Sensitivity of whole body protein synthesis to amino acid administration during short-term bed rest.

PubMed

Biolo, Gianni; Ciocchi, Beniamino; Lebenstedt, Marion; Heer, Martina; Guarnieri, Gianfranco

2002-07-01

We tested the hypothesis that a reduced stimulation of whole-body protein synthesis by amino acid administration represents a major mechanism for the bed rest-induced loss of lean body mass. Healthy young subjects and matched controls were studied on the last day of a 14-day bed rest or ambulatory period, as part of the overall protocol "Short-term Bed Rest - Integrated Physiology" set up by the German Aerospace Centre (DLR) in co-operation with the European Space Agency. A balanced mixture of essential and non-essential amino acids was intravenously infused in the postabsorptive state for 3 hours at the rate of 0.1 g/kg/hour. The oxidative and non-oxidative (i.e., to protein synthesis) disposal of the infused leucine was determined by stable isotope and mass spectrometry techniques. The clearance of total infused amino acids tended to be greater (P=0.07) in the ambulatory group than in the bed rest group. When leucine clearance was partitioned between its oxidative and non-oxidative (i.e., to protein synthesis) components, the results indicated that the oxidative disposal was not statistically different in the bed rest and in the ambulatory groups. In contrast, the non-oxidative leucine disposal (i.e., to protein synthesis) was about 20% greater (P<0.01) in the ambulatory group than in the bed rest group. In conclusion, these preliminary data suggest that 14-day bed rest impairs the ability to utilise exogenous amino acids for protein synthesis.

Kinetic resolution and stereoselective synthesis of 3-substituted aspartic acids by using engineered methylaspartate ammonia lyases.

PubMed

Raj, Hans; Szymanski, Wiktor; de Villiers, Jandré; Puthan Veetil, Vinod; Quax, Wim J; Shimamoto, Keiko; Janssen, Dick B; Feringa, Ben L; Poelarends, Gerrit J

2013-08-19

Enzymatic amino acid synthesis: Kinetic resolution and asymmetric synthesis of various valuable 3-substituted aspartic acids, which were obtained in fair to good yields with diastereomeric ratio values of up to >98:2 and enantiomeric excess values of up to >99 %, by using engineered methylaspartate ammonia lyases are described. These biocatalytic methodologies for the selective preparation of aspartic acid derivatives appear to be attractive alternatives for existing chemical methods. Copyright © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

Silencing of the pentose phosphate pathway genes influences DNA replication in human fibroblasts.

PubMed

Fornalewicz, Karolina; Wieczorek, Aneta; Węgrzyn, Grzegorz; Łyżeń, Robert

2017-11-30

Previous reports and our recently published data indicated that some enzymes of glycolysis and the tricarboxylic acid cycle can affect the genome replication process by changing either the efficiency or timing of DNA synthesis in human normal cells. Both these pathways are connected with the pentose phosphate pathway (PPP pathway). The PPP pathway supports cell growth by generating energy and precursors for nucleotides and amino acids. Therefore, we asked if silencing of genes coding for enzymes involved in the pentose phosphate pathway may also affect the control of DNA replication in human fibroblasts. Particular genes coding for PPP pathway enzymes were partially silenced with specific siRNAs. Such cells remained viable. We found that silencing of the H6PD, PRPS1, RPE genes caused less efficient enterance to the S phase and decrease in efficiency of DNA synthesis. On the other hand, in cells treated with siRNA against G6PD, RBKS and TALDO genes, the fraction of cells entering the S phase was increased. However, only in the case of G6PD and TALDO, the ratio of BrdU incorporation to DNA was significantly changed. The presented results together with our previously published studies illustrate the complexity of the influence of genes coding for central carbon metabolism on the control of DNA replication in human fibroblasts, and indicate which of them are especially important in this process. Copyright © 2017 Elsevier B.V. All rights reserved.

A new family of extraterrestrial amino acids in the Murchison meteorite.

PubMed

Koga, Toshiki; Naraoka, Hiroshi

2017-04-04

The occurrence of extraterrestrial organic compounds is a key for understanding prebiotic organic synthesis in the universe. In particular, amino acids have been studied in carbonaceous meteorites for almost 50 years. Here we report ten new amino acids identified in the Murchison meteorite, including a new family of nine hydroxy amino acids. The discovery of mostly C 3 and C 4 structural isomers of hydroxy amino acids provides insight into the mechanisms of extraterrestrial synthesis of organic compounds. A complementary experiment suggests that these compounds could be produced from aldehydes and ammonia on the meteorite parent body. This study indicates that the meteoritic amino acids could be synthesized by mechanisms in addition to the Strecker reaction, which has been proposed to be the main synthetic pathway to produce amino acids.

Synthesis and preliminary biological evaluations of (+)-isocampholenic acid-derived amides.

PubMed

Grošelj, Uroš; Golobič, Amalija; Knez, Damijan; Hrast, Martina; Gobec, Stanislav; Ričko, Sebastijan; Svete, Jurij

2016-08-01

The synthesis of two novel (+)-isocampholenic acid-derived amines has been realized starting from commercially available (1S)-(+)-10-camphorsulfonic acid. The novel amines as well as (+)-isocampholenic acid have been used as building blocks in the construction of a library of amides using various aliphatic, aromatic, and amino acid-derived coupling partners using BPC and CDI as activating agents. Amide derivatives have been assayed against several enzymes that hold potential for the development of new drugs to battle bacterial infections and Alzheimer's disease. Compounds 20c and 20e showed promising selective sub-micromolar inhibition of human butyrylcholinesterase [Formula: see text] ([Formula: see text] values [Formula: see text] and [Formula: see text], respectively).

Spin labeled amino acid nitrosourea derivatives--synthesis and antitumour activity.

PubMed

Zheleva, A; Raikov, Z; Ilarionova, M; Todorov, D

1995-01-01

The synthesis of three spin labeled derivatives of N-[N'-(chloroethyl)-N'-nitrosocarbamoyl] amino acids is reported. The new nitrosoureas are obtained by condensation of the corresponding N-[N'-(2-chloroethyl)-N'-nitrosocarbamoyl] amino acid with 2,2,6,6-tetramethyl-1-oxyl-4-aminopiperidine using dicyclohexylcarbodiimide. Their chemical structures are confirmed by elemental analysis, IR, MS, and EPR spectroscopy. All newly synthesized compounds showed high antitumour activity against the lymphoid leukemia L1210 in BDF1 mice.

Abscisic-acid-induced cellular apoptosis and differentiation in glioma via the retinoid acid signaling pathway.

PubMed

Zhou, Nan; Yao, Yu; Ye, Hongxing; Zhu, Wei; Chen, Liang; Mao, Ying

2016-04-15

Retinoid acid (RA) plays critical roles in regulating differentiation and apoptosis in a variety of cancer cells. Abscisic acid (ABA) and RA are direct derivatives of carotenoids and share structural similarities. Here we proposed that ABA may also play a role in cellular differentiation and apoptosis by sharing a similar signaling pathway with RA that may be involved in glioma pathogenesis. We reported for the first time that the ABA levels were twofold higher in low-grade gliomas compared with high-grade gliomas. In glioma tissues, there was a positive correlation between the ABA levels and the transcription of cellular retinoic acid-binding protein 2 (CRABP2) and a negative correlation between the ABA levels and transcription of fatty acid-binding protein 5 (FABP5). ABA treatment induced a significant increase in the expression of CRABP2 and a decrease in the expression of peroxisome proliferator-activated receptor (PPAR) in glioblastoma cells. Remarkably, both cellular apoptosis and differentiation were increased in the glioblastoma cells after ABA treatment. ABA-induced cellular apoptosis and differentiation were significantly reduced by selectively silencing RAR-α, while RAR-α overexpression exaggerated the ABA-induced effects. These results suggest that ABA may play a role in the pathogenesis of glioma by promoting cellular apoptosis and differentiation through the RA signaling pathway. © 2015 UICC.

Lactic acid as an invaluable green solvent for ultrasound-assisted scalable synthesis of pyrrole derivatives.

PubMed

Wang, Shi-Fan; Guo, Chao-Lun; Cui, Ke-Ke; Zhu, Yan-Ting; Ding, Jun-Xiong; Zou, Xin-Yue; Li, Yi-Hang

2015-09-01

Lactic acid has been used as a bio-based green solvent to study the ultrasound-assisted scale-up synthesis. We report here, for the first time, on the novel and scalable process for synthesis of pyrrole derivatives in lactic acid solvent under ultrasonic radiation. Eighteen pyrrole derivatives have been synthesized in lactic acid solvent under ultrasonic radiation and characterized by (1)H NMR, IR, ESI MS. The results show, under ultrasonic radiation, lactic acid solvent can overcome the scale-up challenges and exhibited many advantages, such as bio-based origin, shorter reaction time, lower volatility, higher yields, and ease of isolating the products. Copyright © 2015 Elsevier B.V. All rights reserved.

Synthesis of peptides from amino acids and ATP with lysine-rich proteinoid

NASA Technical Reports Server (NTRS)

Nakashima, T.; Fox, S. W.

1980-01-01

The paper examines the synthesis of peptides from aminoacids and ATP with a lysine-rich protenoid. The latter in aqueous solution catalyzes the formation of peptides from free amino acids and ATP; this catalytic activity is not found in acidic protenoids, even though the latter contain a basic aminoacid. The pH optimum for the synthesis is about 11, but it is appreciable below 8 and above 13. Temperature data indicate an optimum at 20 C or above, with little increase in rate up to 60 C. Pyrophosphate can be used instead of ATP, but the yields are lower. The ATP-aided syntheses of peptides in aqueous solution occur with several types of proteinous aminoacids.

Phospholipase D Signaling Pathways and Phosphatidic Acid as Therapeutic Targets in Cancer

PubMed Central

Bruntz, Ronald C.; Lindsley, Craig W.

2014-01-01

Phospholipase D is a ubiquitous class of enzymes that generates phosphatidic acid as an intracellular signaling species. The phospholipase D superfamily plays a central role in a variety of functions in prokaryotes, viruses, yeast, fungi, plants, and eukaryotic species. In mammalian cells, the pathways modulating catalytic activity involve a variety of cellular signaling components, including G protein–coupled receptors, receptor tyrosine kinases, polyphosphatidylinositol lipids, Ras/Rho/ADP-ribosylation factor GTPases, and conventional isoforms of protein kinase C, among others. Recent findings have shown that phosphatidic acid generated by phospholipase D plays roles in numerous essential cellular functions, such as vesicular trafficking, exocytosis, autophagy, regulation of cellular metabolism, and tumorigenesis. Many of these cellular events are modulated by the actions of phosphatidic acid, and identification of two targets (mammalian target of rapamycin and Akt kinase) has especially highlighted a role for phospholipase D in the regulation of cellular metabolism. Phospholipase D is a regulator of intercellular signaling and metabolic pathways, particularly in cells that are under stress conditions. This review provides a comprehensive overview of the regulation of phospholipase D activity and its modulation of cellular signaling pathways and functions. PMID:25244928

Chitosan oligosaccharide induces resistance to Tobacco mosaic virus in Arabidopsis via the salicylic acid-mediated signalling pathway

PubMed Central

Jia, Xiaochen; Meng, Qingshan; Zeng, Haihong; Wang, Wenxia; Yin, Heng

2016-01-01

Chitosan is one of the most abundant carbohydrate biopolymers in the world, and chitosan oligosaccharide (COS), which is prepared from chitosan, is a plant immunity regulator. The present study aimed to validate the effect of COS on inducing resistance to tobacco mosaic virus (TMV) in Arabidopsis and to investigate the potential defence-related signalling pathways involved. Optimal conditions for the induction of TMV resistance in Arabidopsis were COS pretreatment at 50 mg/L for 1 day prior to inoculation with TMV. Multilevel indices, including phenotype data, and TMV coat protein expression, revealed that COS induced TMV resistance in wild-type and jasmonic acid pathway- deficient (jar1) Arabidopsis plants, but not in salicylic acid pathway deficient (NahG) Arabidopsis plants. Quantitative-PCR and analysis of phytohormone levels confirmed that COS pretreatment enhanced the expression of the defence-related gene PR1, which is a marker of salicylic acid signalling pathway, and increased the amount of salicylic acid in WT and jar1, but not in NahG plants. Taken together, these results confirm that COS induces TMV resistance in Arabidopsis via activation of the salicylic acid signalling pathway. PMID:27189192

Chitosan oligosaccharide induces resistance to Tobacco mosaic virus in Arabidopsis via the salicylic acid-mediated signalling pathway.

PubMed

Jia, Xiaochen; Meng, Qingshan; Zeng, Haihong; Wang, Wenxia; Yin, Heng

2016-05-18

Chitosan is one of the most abundant carbohydrate biopolymers in the world, and chitosan oligosaccharide (COS), which is prepared from chitosan, is a plant immunity regulator. The present study aimed to validate the effect of COS on inducing resistance to tobacco mosaic virus (TMV) in Arabidopsis and to investigate the potential defence-related signalling pathways involved. Optimal conditions for the induction of TMV resistance in Arabidopsis were COS pretreatment at 50 mg/L for 1 day prior to inoculation with TMV. Multilevel indices, including phenotype data, and TMV coat protein expression, revealed that COS induced TMV resistance in wild-type and jasmonic acid pathway- deficient (jar1) Arabidopsis plants, but not in salicylic acid pathway deficient (NahG) Arabidopsis plants. Quantitative-PCR and analysis of phytohormone levels confirmed that COS pretreatment enhanced the expression of the defence-related gene PR1, which is a marker of salicylic acid signalling pathway, and increased the amount of salicylic acid in WT and jar1, but not in NahG plants. Taken together, these results confirm that COS induces TMV resistance in Arabidopsis via activation of the salicylic acid signalling pathway.

Inhibitors targeting on cell wall biosynthesis pathway of MRSA.

PubMed

Hao, Haihong; Cheng, Guyue; Dai, Menghong; Wu, Qinghua; Yuan, Zonghui

2012-11-01

Methicillin resistant Staphylococcus aureus (MRSA), widely known as a type of new superbug, has aroused world-wide concern. Cell wall biosynthesis pathway is an old but good target for the development of antibacterial agents. Peptidoglycan and wall teichoic acids (WTAs) biosynthesis are two main processes of the cell wall biosynthesis pathway (CWBP). Other than penicillin-binding proteins (PBPs), some key factors (Mur enzymes, lipid I or II precursor, etc.) in CWBP are becoming attractive molecule targets for the discovery of anti-MRSA compounds. A number of new compounds, with higher affinity for PBPs or with inhibitory activity on such molecule targets in CWBP of MRSA, have been in the pipeline recently. This review concludes recent research achievements and provides a complete picture of CWBP of MRSA, including the peptidoglycan and wall teichoic acids synthesis pathway. The potential inhibitors targeting on CWBP are subsequently presented to improve development of novel therapeutic strategies for MRSA.